TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548ao-3p
miRNA Sequence: AAAGACCGUGACUACUUUUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX25092 4318 14681 ----
NM_000089chr71825 ------
NM_000108chr731659 492 418 1560 ----
NM_000109chrX52117 1951 1879 832 119 1263 ----
NM_000110chr1--1798 ----
NM_000125chr623536 3005 --14171 --
NM_000161chr1411449 --169 --
NM_000163chr522106 1720 ------
NM_000165chr631296 1068 432 ------
NM_000176chr523436 86 23318 522 ----
NM_000210chr222298 2014 ------
NM_000214chr203710 291 252 1394 ----
NM_000242chr10--22631 2122 ----
NM_000245chr731471 691 48 ------
NM_000248chr363081 2232 1898 1081 1034 80 12466 ----
NM_000252chrX31305 1236 216 ------
NM_000259chr1586247 5478 4978 4375 2481 1751 1380 1007 --12276 --
NM_000267chr1762903 2885 2576 810 382 130 12877 ----
NM_000271chr182531 50 1666 ----
NM_000304chr171178 ------
NM_000310chr111232 ------
NM_000314chr1042487 2304 470 169 ------
NM_000321chr1331611 1437 1130 ------
NM_000332chr687072 6367 4689 4609 2466 1998 1707 1161 11741 ----
NM_000337chr565883 5826 4824 4153 2124 627 36453 6270 1700 ----
NM_000361chr2041655 1566 445 382 ------
NM_000362chr2222347 206 13653 12375 --
NM_000368chr931347 579 447 11895 1162 --
NM_000390chrX31121 906 49 1318 --12299
NM_000399chr102355 315 ------
NM_000408chr223237 767 ------
NM_000430chr1743349 3123 1507 1190 1704 ----
NM_000448chr1162864 2758 2312 377 368 28 ------
NM_000451chrX41852 1672 740 401 ------
NM_000461chr331671 1665 521 1227 ----
NM_000462chr1521714 301 ------
NM_000465chr2143 ------
NM_000484chr214751 678 240 215 ------
NM_000493chr61236 ------
NM_000495chrX1419 ------
NM_000523chr24428 356 235 217 ------
NM_000527chr1922454 810 ------
NM_000546chr174980 233 79 72 ------
NM_000555chrX45892 5135 4785 2038 ------
NM_000598chr71153 ------
NM_000599chr263934 3186 3064 2795 724 234 ------
NM_000600chr71394 ------
NM_000610chr1142952 2449 2096 920 ------
NM_000615chr1162816 2410 2289 1921 1143 964 --12848 --
NM_000618chr1235672 5507 4859 25486 1625 ----
NM_000618chr1235672 5507 4859 25486 1625 ----
NM_000633chr1824894 1075 11511 ----
NM_000701chr11228 ------
NM_000719chr1254976 1672 1075 883 764 --1758 --
NM_000721chr122621 630 ------
NM_000767chr192968 434 ------
NM_000813chr544877 920 831 200 13405 ----
NM_000814chr1511431 13477 ----
NM_000826chr422322 206 ------
NM_000827chr532581 1751 143 ------
NM_000829chr113929 228 87 ------
NM_000831chr156070 5758 5619 1561 1153 16292 ----
NM_000833chr16--11110 ----
NM_000840chr71518 ------
NM_000844chr33905 727 367 ------
NM_000855chr111227 ------
NM_000859chr52528 137 ------
NM_000860chr421468 1339 ------
NM_000868chrX21624 870 22607 81 ----
NM_000875chr1596531 6490 6182 6116 5953 5284 2599 2194 806 26398 1157 ----
NM_000891chr172239 44 12612 ----
NM_000899chr1223556 418 12781 ----
NM_000901chr412259 21575 1553 1562 --
NM_000934chr171690 ------
NM_000945chr211937 11417 ----
NM_000950chrX53618 3268 2537 1206 231 13050 ----
NM_000956chr141310 ------
NM_000958chr511205 11299 ----
NM_000964chr171511 ------
NM_000983chr111571 ------
NM_001001132chr211405 ------
NM_001001323chr1232291 1078 347 22603 2145 ----
NM_001001330chr10--21248 462 ----
NM_001001331chr352475 498 465 388 367 --1249 --
NM_001001389chr1142952 2449 2096 920 ------
NM_001001390chr1142952 2449 2096 920 ------
NM_001001391chr1142952 2449 2096 920 ------
NM_001001392chr1152998 2495 2142 1877 966 ------
NM_001001395chr1232290 2182 2071 ------
NM_001001396chr144311 4166 3247 3205 ------
NM_001001419chr511009 35162 3961 2087 ----
NM_001001420chr511009 35162 3961 2087 ----
NM_001001433chr2032020 425 187 ------
NM_001001481chr811248 --1337 --
NM_001001520chr192185 127 ------
NM_001001556chr15--21237 200 ----
NM_001001557chr81493 ------
NM_001001740chr11116 ------
NM_001001740chr11116 ------
NM_001001852chr221177 1739 ----
NM_001001890chr2133296 3264 542 ------
NM_001001928chr22108204 6509 6005 5931 5829 3236 2825 2584 1927 259 18350 13172 --
NM_001002026chr312346 2290 152 1542 --
NM_001002257chr243450 3362 3244 760 ------
NM_001002838chrX21544 33 11493 ----
NM_001002843chr1531031 872 273 ------
NM_001002860chr1464629 3055 1832 1484 173 106 ------
NM_001002901chr12113 45 ------
NM_001003652chr1878459 6247 3430 2838 1657 1378 657 ------
NM_001003681chr2211427 1102 ----
NM_001003688chr431189 487 450 11112 ----
NM_001003792chr33472 196 185 ------
NM_001003793chr33472 196 185 ------
NM_001003810chr41332 ------
NM_001004065chr923891 2734 13938 11533 --
NM_001004127chr131687 ------
NM_001004317chr621019 551 14447 ----
NM_001004342chr196019 4263 4123 3812 1894 1863 1725 1372 959 ------
NM_001004360chr211767 21966 1509 ----
NM_001004419chr1254168 3792 2803 843 358 11637 ----
NM_001005266chr151196 1608 ----
NM_001005267chr151196 1608 ----
NM_001005268chr151196 1608 ----
NM_001005269chr151196 1608 ----
NM_001005366chr123274 201 21 ------
NM_001005386chr262377 2303 682 626 602 570 ------
NM_001005404chr1714348 ----11087
NM_001005463chr1021934 1026 ------
NM_001005473chr535041 4189 2419 ------
NM_001005743chr1421094 1084 21152 899 ----
NM_001005744chr1421094 1084 21152 899 ----
NM_001005745chr1421094 1084 21152 899 ----
NM_001005753chr222314 141 ------
NM_001005781chr21381 ------
NM_001005782chr21830 1716 ----
NM_001005845chr821428 30 ------
NM_001006600chr51225 ------
NM_001006610chr1631007 918 374 ------
NM_001006612chrX--1116 ----
NM_001006613chrX--1116 ----
NM_001006614chrX--1116 ----
NM_001006618chr9166 ------
NM_001006636chr2--1641 ----
NM_001006946chr221222 275 11489 ----
NM_001007024chr1763398 3277 473 456 237 50 1337 11384 --
NM_001007025chr1763398 3277 473 456 237 50 1337 11384 --
NM_001007156chr15--11488 ----
NM_001007246chr21--21668 251 ----
NM_001007277chr112755 359 ------
NM_001007466chr61146 34961 3257 278 14246 --
NM_001007546chr221449 1237 ------
NM_001007553chr121133 824 ----11107
NM_001007559chr1851925 1832 1595 1429 535 ------
NM_001008239chr1853733 3153 2675 1326 927 ------
NM_001008272chr32122 52 ------
NM_001008273chr32122 52 ------
NM_001008388chr41373 159 ----
NM_001008408chr785804 5777 5116 4857 4522 4231 1500 307 14882 ----
NM_001008495chr842264 2177 1759 460 --11727 --
NM_001008540chr21436 ------
NM_001008564chr1311687 ------
NM_001008726chr14--21580 33 1156 --
NM_001008777chr17--1240 ----
NM_001008801chr1952002 1675 464 278 109 ------
NM_001008895chr1331342 970 303 ------
NM_001009554chr444037 3119 1467 418 11571 ----
NM_001009554chr444037 3119 1467 418 11571 ----
NM_001009566chr131409 1179 25 ------
NM_001009899chr395254 4076 2519 2189 1636 1543 1321 892 685 ------
NM_001009909chr1132594 1184 253 --11490 --
NM_001009955chr11375 ------
NM_001009955chr11375 ------
NM_001010852chr6150 ------
NM_001010853chr642308 2149 1234 722 ------
NM_001010854chr14--1505 ----
NM_001010867chr185738 5467 5364 2194 1477 729 499 72 12173 11242 --
NM_001010888chrX64582 4411 3691 3367 821 626 ------
NM_001010895chr92320 103 ------
NM_001010924chr1021025 797 ------
NM_001010971chr11212 1744 ----
NM_001010989chr161558 ------
NM_001010990chr161558 ------
NM_001011513chr423179 187 ------
NM_001011537chr331754 379 138 --12185 --
NM_001011551chrX2347 173 ------
NM_001011657chrX31153 949 131 ------
NM_001011666chr732518 2126 1554 21892 1022 ----
NM_001011713chr1421221 1065 1451 ----
NM_001012755chrX21437 1396 14903 ----
NM_001012756chr1942894 2676 2549 1133 ------
NM_001012761chr522510 23 ------
NM_001013031chr1023450 137 ------
NM_001013398chr71153 ------
NM_001013399chr62802 415 ------
NM_001013620chr1256076 5965 3039 2102 393 ------
NM_001013693chr122383 1008 ------
NM_001013693chr122383 1008 ------
NM_001013843chr151884 125 ----
NM_001014380chr1384961 4783 3983 3728 1958 1875 1486 106 ------
NM_001014431chr142666 80 1207 ----
NM_001014432chr142666 80 1207 ----
NM_001014445chr1731034 689 164 ------
NM_001014809chr42688 650 1270 ----
NM_001015508chr81215 ------
NM_001015881chrX11173 ------
NM_001017371chr221223 199 11001 ----
NM_001017395chr383199 3182 3073 2428 2406 886 862 724 ------
NM_001017405chr41958 ------
NM_001017415chr12126 115 ------
NM_001017416chr12126 115 ------
NM_001017440chr786822 6248 5881 2940 2290 1450 964 225 --1580 --
NM_001017977chr11104 ------
NM_001018037chr921088 1075 --1227 --
NM_001018065chr955757 4765 4655 1161 305 14789 ----
NM_001018066chr955757 4765 4655 1161 305 14789 ----
NM_001018067chr144531 4275 3847 860 2432 410 15290 --
NM_001018068chr144531 4275 3847 860 2432 410 15290 --
NM_001018069chr144531 4275 3847 860 2432 410 15290 --
NM_001018074chr523436 86 23318 522 ----
NM_001018075chr523436 86 23318 522 ----
NM_001018076chr523436 86 23318 522 ----
NM_001018077chr523436 86 23318 522 ----
NM_001018090chr1572694 2521 750 684 659 633 245 ------
NM_001018091chr1572804 2631 860 794 769 743 355 ------
NM_001018102chr1572694 2521 750 684 659 633 245 ------
NM_001018108chr1552050 1986 1418 900 719 11998 ----
NM_001018111chr733843 3585 1614 ------
NM_001018676chr81418 --1475 --
NM_001018677chr81418 --1475 --
NM_001020658chr11397 11212 ----
NM_001020658chr11397 11212 ----
NM_001024024chr143186 175 163 ------
NM_001024070chr143182 171 159 ------
NM_001024094chr523436 86 23318 522 ----
NM_001024226chr121061 387 ------
NM_001024227chr121061 387 ------
NM_001024228chr121061 387 ------
NM_001024401chr1612860 ------
NM_001024809chr171511 ------
NM_001024948chr143174 1246 1128 619 22401 1235 ----
NM_001025076chr1042026 1885 1559 1253 --14242 --
NM_001025077chr1022917 2611 --15600 --
NM_001025108chr242938 2731 1518 35 ------
NM_001025201chr21651 ------
NM_001025266chr344039 3928 3493 1795 ------
NM_001025366chr611293 --11381 --
NM_001025366chr611293 --11381 --
NM_001025367chr611293 --11381 --
NM_001025367chr611293 --11381 --
NM_001025368chr611293 --11381 --
NM_001025368chr611293 --11381 --
NM_001025369chr611309 --11397 --
NM_001025369chr611309 --11397 --
NM_001025370chr611293 --11381 --
NM_001025370chr611293 --11381 --
NM_001025580chrX43090 589 250 73 ------
NM_001025595chr431250 1105 322 1179 ----
NM_001025780chr941127 1105 82 29 1155 ----
NM_001029858chr6--12203 ----
NM_001029859chr112224 59 ------
NM_001029875chr531892 314 93 12962 ----
NM_001029882chr12592 35 ------
NM_001029882chr12592 35 ------
NM_001030007chr1643610 2928 1303 323 23315 1253 ----
NM_001030055chr1423933 789 ------
NM_001030059chr10178 ------
NM_001031680chr131877 838 114 ------
NM_001031684chr251323 1027 932 204 189 ------
NM_001031685chr12930 781 ------
NM_001031695chr2244554 1614 1419 501 --11598 --
NM_001031700chr432105 184 52 12379 ----
NM_001031702chr3184 ------
NM_001031712chr61386 ----1100
NM_001031732chr443227 2941 2811 1055 ------
NM_001031803chr17--1269 ----
NM_001031812chr521988 369 ------
NM_001032279chr112370 320 ------
NM_001032288chr2021409 1215 ------
NM_001032289chrX--186 ----
NM_001032293chr171245 ------
NM_001032296chr1332447 891 24 1618 ----
NM_001032999chr2065235 5180 1668 1373 1349 1055 11214 ----
NM_001033044chr141806 1392 700 510 ------
NM_001033047chr442628 2346 2047 145 ------
NM_001033056chr141806 1392 700 510 ------
NM_001033087chr2032979 968 750 ------
NM_001033117chr334672 3829 3384 ------
NM_001033506chr112387 107 ------
NM_001033507chr121566 1280 ------
NM_001033576chr1742637 2501 2004 1940 ------
NM_001033659chr1721219 373 ------
NM_001033723chr842768 2682 2176 1785 11115 ----
NM_001033756chr611227 --11315 --
NM_001033756chr611227 --11315 --
NM_001034850chr521614 1104 ------
NM_001034852chr1442039 1739 1442 284 ------
NM_001035chr111028 ------
NM_001035260chr1011285 ------
NM_001037132chr7--12128 ----
NM_001037133chr7--12128 ----
NM_001037164chr761434 601 289 194 46 37 ------
NM_001037174chr2--11726 ----
NM_001037281chr161116 ------
NM_001037954chr1111182 ------
NM_001038628chr341857 1607 382 226 ------
NM_001039348chr22952 229 ------
NM_001039349chr22952 229 ------
NM_001039350chr7--1620 ----
NM_001039457chr1150 ------
NM_001039547chr345942 5870 2827 1805 47776 5019 2806 600 ----
NM_001039570chr2234608 4359 3956 ------
NM_001039571chr2234608 4359 3956 ------
NM_001039577chr124199 3250 21041 987 ----
NM_001039590chrX53733 3571 3181 2810 1498 ------
NM_001039591chrX53733 3571 3181 2810 1498 ------
NM_001039618chr1133883 1801 1647 12157 ----
NM_001039709chr2065235 5180 1668 1373 1349 1055 11214 ----
NM_001039840chrX44801 2087 493 79 23774 438 ----
NM_001040057chr711062 ------
NM_001040159chr411296 1406 ----
NM_001040202chr431975 1026 812 12345 ----
NM_001040284chr1665927 4361 4354 2284 1240 1008 ------
NM_001040402chr442872 2541 887 397 13187 ----
NM_001040429chr1323131 2316 13017 ----
NM_001040633chr711033 1757 ----
NM_001040665chr723196 1061 ----11127
NM_001040709chr131768 839 113 1267 ----
NM_001040712chr923247 646 --13195 --
NM_001042355chr1654667 4256 742 622 222 55034 4535 1461 1344 442 ----
NM_001042388chr18--1361 ----
NM_001042404chr111375 21644 248 ----
NM_001042412chr1654667 4256 742 622 222 55034 4535 1461 1344 442 ----
NM_001042413chr953838 3043 2697 493 207 1589 ----
NM_001042414chr13--188 ----
NM_001042453chrX31757 1261 347 ------
NM_001042492chr1762903 2885 2576 810 382 130 12877 ----
NM_001042498chrX1119 1223 ----
NM_001042506chrX21123 56 ------
NM_001042550chr93666 612 252 ------
NM_001042555chr121989 13169 ----
NM_001042599chr256394 2371 2257 646 76 ------
NM_001042601chr342939 882 834 244 2852 804 ----
NM_001042603chr1245145 4144 4020 1473 ------
NM_001042681chr122382 2097 ------
NM_001042682chr122382 2097 ------
NM_001042682chr122382 2097 ------
NM_001043351chr122324 1609 11942 ----
NM_001044722chr521988 369 ------
NM_001044723chr521988 369 ------
NM_001046chr522165 1967 ----1182
NM_001068chr3----1117 --
NM_001071775chr13--11442 ----
NM_001076chr4--171 ----
NM_001076chr4--171 ----
NM_001077628chr12634 204 1455 ----
NM_001078chr12727 487 1506 ----
NM_001079874chr1--1635 ----
NM_001080418chr11156 ------
NM_001083620chr412320 ------
NM_001094chr172870 808 ------
NM_001106chr399650 8161 7637 6783 6163 3639 2673 2106 2092 12655 ----
NM_001109977chr41774 146 ----
NM_001121chr10--1142 ----
NM_001128chr1643610 2928 1303 323 23315 1253 ----
NM_001148chr421690 1370 ------
NM_001149chr1011296 ------
NM_001173chr1423933 789 ------
NM_001187chr212444 47 ------
NM_001189chr41330 ------
NM_001197chr22--1151 ----
NM_001198chr612036 12294 ----
NM_001204chr246794 6216 833 285 16245 ----
NM_001206chr931185 285 277 11115 ----
NM_001256chr1722377 2204 ------
NM_001257chr16186 11341 1130 --
NM_001271chr1533091 716 57 1816 22988 2731 --
NM_001277chr111890 ------
NM_001280chr191224 ------
NM_001289chrX31521 182 70 ------
NM_001290chr41785 ----1292
NM_001293chr111559 ------
NM_001299chr191420 ------
NM_001304chr1763251 3073 1378 1139 902 439 --11079 --
NM_001313chr42688 650 1270 ----
NM_001332chr511109 ------
NM_001338chr212806 73 1496 ----
NM_001351chr32356 41 ------
NM_001356chrX32081 969 851 ------
NM_001364chr11--14763 ----
NM_001365chr173588 513 57 ------
NM_001383chr172266 60 ------
NM_001386chr832254 1828 1821 ------
NM_001389chr212537 474 ------
NM_001391chr1821114 423 --134 --
NM_001396chr2162019 816 742 484 322 278 ----12615
NM_001400chr111253 ------
NM_001406chr1721415 382 ------
NM_001407chr331426 1298 537 ------
NM_001408chr111538 ------
NM_001412chrX42768 1127 1014 146 1617 ----
NM_001417chr1221950 1658 ------
NM_001418chr112621 155 ------
NM_001418chr112621 155 ------
NM_001419chr1934766 3361 137 ------
NM_001420chr1932197 1224 284 12502 ----
NM_001427chr731723 433 242 ------
NM_001429chr22--1329 ----
NM_001431chr63282 276 180 ------
NM_001432chr422997 570 --13688 --
NM_001440chr842521 2183 1003 312 12773 ----
NM_001448chrX1329 1442 ----
NM_001452chr61547 ------
NM_001483chr7--2758 102 ----
NM_001543chr564578 4463 4054 4031 3574 3494 ------
NM_001546chr6--1949 ----
NM_001608chr2----1245 --
NM_001609chr1043656 1161 480 162 2814 459 ----
NM_001614chr173643 591 544 ------
NM_001614chr173643 591 544 ------
NM_001619chr11--184 ----
NM_001635chr7141 ------
NM_001655chr1121943 770 ------
NM_001658chr121061 387 ------
NM_001659chr1242260 1004 688 254 ------
NM_001660chr32622 46 1188 ----
NM_001663chr1421688 160 ------
NM_001664chr31667 ------
NM_001682chr1232005 792 61 22317 1859 ----
NM_001683chr352475 498 465 388 367 --1249 --
NM_001684chr144028 3883 2964 2922 ------
NM_001695chr853858 3578 3088 2895 143 ------
NM_001718chr621327 203 ------
NM_001723chr61227 ------
NM_001730chr131500 11256 ----
NM_001730chr131500 11256 ----
NM_001754chr2133296 3264 542 ------
NM_001755chr1661888 1768 740 415 206 158 11606 ----
NM_001759chr1295294 5141 4644 3837 3464 1939 1931 1679 47 15216 ----
NM_001789chr321440 409 1539 ----
NM_001792chr182794 22 ------
NM_001795chr1631466 1416 356 ------
NM_001798chr1211022 ------
NM_001799chr51185 ------
NM_001801chr5--126 ----
NM_001806chr1922495 208 31096 371 193 ----
NM_001822chr21651 ------
NM_001829chr41137 2903 841 ----
NM_001830chrX33968 3143 2452 23219 989 11265 --
NM_001842chr9177 ------
NM_001845chr132474 443 1941 ----
NM_001858chr6----11600 --
NM_001873chr42647 62 1552 ----
NM_001895chr201773 11259 ----
NM_001896chr16--1457 ----
NM_001935chr2--1227 ----
NM_001936chr7--1620 ----
NM_001949chr612052 --1890 --
NM_001955chr631024 703 215 ------
NM_001962chr54598 423 102 44 ------
NM_001969chr1433246 3204 146 ------
NM_001970chr172392 139 ------
NM_001982chr121225 ------
NM_001992chr511408 12090 ----
NM_001993chr121042 165 ------
NM_001995chr421425 934 1306 ----
NM_001999chr531480 1473 548 11392 ----
NM_002006chr435518 2070 1308 13643 ----
NM_002015chr1332437 668 378 22979 2088 ----
NM_002017chr1111034 ------
NM_002024chrX--11616 ----
NM_002025chrX79192 9047 7885 7674 7515 2989 1111 1373 ----
NM_002027chr81418 --1475 --
NM_002035chr1832570 2462 429 ------
NM_002039chr42905 313 ------
NM_002040chr2112115 13116 ----
NM_002044chr15--21237 200 ----
NM_002056chr21804 ------
NM_002065chr141806 1392 700 510 ------
NM_002069chr7--1327 ----
NM_002074chr12690 589 ------
NM_002077chr9183 ------
NM_002104chr5--1182 ----
NM_002106chr42319 241 ------
NM_002126chr1733556 2574 1607 --1977 --
NM_002128chr1311686 ------
NM_002129chr41321 ------
NM_002130chr541618 427 295 207 ------
NM_002133chr222569 515 ------
NM_002136chr12--1250 ----
NM_002137chr732167 1476 292 ------
NM_002138chr41332 ------
NM_002146chr17----1572 --
NM_002151chr191280 ------
NM_002167chr13409 349 341 ------
NM_002182chr31105 22696 2487 ----
NM_002193chr211708 ------
NM_002198chr51189 ------
NM_002203chr51502 ------
NM_002211chr101110 194 ----
NM_002214chr734666 4540 1354 ------
NM_002222chr311371 11059 ----
NM_002232chr13537 418 58 ------
NM_002247chr1022325 404 ------
NM_002264chr384973 4623 3761 3494 3419 3400 771 561 ------
NM_002265chr172773 749 ------
NM_002267chr1312442 11763 ----
NM_002268chr311499 ------
NM_002270chr534387 4137 2108 ----15538
NM_002285chr242938 2731 1518 35 ------
NM_002293chr11940 21818 197 ----
NM_002310chr565813 5390 4591 2612 705 356 ------
NM_002334chr1111331 12011 ----
NM_002355chr1221084 926 ------
NM_002356chr642355 2166 1056 78 ------
NM_002358chr42237 48 ------
NM_002359chr1744297 2945 1181 27 ------
NM_002376chr141481 ------
NM_002382chr1431142 506 466 --1894 --
NM_002383chr161789 1164 ----
NM_002397chr511406 ------
NM_002401chr1731635 1558 132 21987 1962 ----
NM_002408chr141657 1206 ----
NM_002442chr1221515 1464 11757 ----
NM_002449chr51252 ------
NM_002455chr1129 ------
NM_002481chr167873 7556 6743 5575 2998 1601 ------
NM_002482chr13561 192 127 1173 ----
NM_002486chr93787 429 29 12262 ----
NM_002499chr1522168 1580 1976 ----
NM_002501chr1954006 3916 2626 1446 1311 ------
NM_002505chr611336 ------
NM_002520chr5--1208 ----
NM_002522chr171145 ------
NM_002524chr12821 297 ------
NM_002542chr3--1204 ----
NM_002556chr111534 21742 746 ----
NM_002569chr1511444 11547 ----
NM_002577chr343460 2701 242 99 ------
NM_002581chr943867 3475 1423 127 14369 ----
NM_002583chr122449 251 1173 ----
NM_002585chr11249 ------
NM_002590chr132528 67 ------
NM_002594chr2042269 1778 1708 391 ------
NM_002595chr1221854 213 21699 1545 --1206
NM_002601chr22371 37 ------
NM_002605chr1521196 254 ------
NM_002613chr1654980 4179 3503 3281 751 23958 3904 11278 --
NM_002648chr61531 11248 ----
NM_002651chr12742 227 ------
NM_002655chr821650 799 13861 13442 --
NM_002657chr2033907 3805 1141 ------
NM_002687chr141819 1948 ----
NM_002699chr131238 1225 549 --1559 --
NM_002701chr6181 ------
NM_002706chr2141 ------
NM_002707chr21274 ------
NM_002709chr22905 840 1354 ----
NM_002710chr121759 ------
NM_002714chr651097 1047 1035 714 155 ------
NM_002715chr511010 ------
NM_002719chr1412004 ------
NM_002729chr101281 1348 ----
NM_002731chr142206 481 297 128 ------
NM_002736chr722086 108 1635 ----
NM_002738chr161801 1766 ----
NM_002740chr342420 965 855 230 12400 ----
NM_002745chr2253290 3130 3023 887 141 ------
NM_002764chrX1352 1835 ----
NM_002814chrX1632 ------
NM_002819chr1911013 --11246 --
NM_002839chr923247 646 --13195 --
NM_002843chr1143218 2500 990 504 ------
NM_002851chr71774 1621 ----
NM_002855chr1143503 2967 2448 1406 1640 ----
NM_002858chr111234 ------
NM_002869chr1132200 2144 804 1867 1593 --
NM_002880chr32804 603 1823 ----
NM_002886chr374952 4511 3703 3309 2006 1923 394 13331 ----
NM_002892chr1411416 ------
NM_002902chr151147 1537 ----
NM_002906chr111188 ------
NM_002941chr31166 ------
NM_002942chr32571 355 ------
NM_002994chr421861 1299 ------
NM_002997chr221222 275 11489 ----
NM_003029chr11563 ------
NM_003030chr331721 694 254 ------
NM_003031chr1631007 918 374 ------
NM_003034chr1237576 449 49 15804 ----
NM_003036chr121025 493 ------
NM_003048chr222388 667 1886 ----
NM_003069chrX1261 ------
NM_003070chr91312 1329 ----
NM_003074chr332181 1982 755 22127 1861 ----
NM_003076chr1241148 332 246 84 ------
NM_003077chr171549 ------
NM_003079chr171729 162 ----
NM_003100chr5--1124 ----
NM_003106chr32935 710 ------
NM_003107chr622440 472 ------
NM_003108chr246670 5569 5049 2450 1807 1465 --
NM_003111chr221223 199 11001 ----
NM_003115chr1--1114 ----
NM_003118chr531975 482 401 ------
NM_003136chr141306 ------
NM_003142chr2--140 ----
NM_003144chr631618 810 198 1257 128 --
NM_003145chr11467 ------
NM_003150chr1722338 1823 12096 ----
NM_003155chr822611 528 ------
NM_003189chr143253 2767 2541 976 --1246 --
NM_003199chr1833752 3678 1828 1793 ----
NM_003211chr121188 ------
NM_003214chr6--11281 ----
NM_003216chr2232943 2712 1309 13084 ----
NM_003223chr162759 672 ------
NM_003236chr222924 1292 1634 ----
NM_003246chr1521894 1395 ------
NM_003253chr2121617 573 1586 1117 --
NM_003257chr151895 ------
NM_003269chr6--1471 ----
NM_003274chr2142737 2220 972 927 ----1388
NM_003275chr9--1137 ----
NM_003286chr201388 ------
NM_003291chr131299 ------
NM_003298chr345947 4565 3921 754 1294 ----
NM_003304chr331301 1110 258 11272 ----
NM_003305chr4--1149 ----
NM_003317chr142322 203 ------
NM_003337chr5--193 ----
NM_003338chr1031872 235 50 ------
NM_003339chr511630 ------
NM_003342chr1733085 2409 389 13316 ----
NM_003344chr731088 234 110 ------
NM_003345chr162563 156 --1205 --
NM_003349chr2021409 1215 ------
NM_003352chr21830 1716 ----
NM_003359chr42934 315 1990 ----
NM_003368chr12126 115 ------
NM_003370chr191663 ------
NM_003371chr982136 2119 1957 1896 1839 1634 1626 1613 ------
NM_003376chr611293 --11381 --
NM_003376chr611293 --11381 --
NM_003390chr1121075 776 --1883 --
NM_003392chr33479 79 72 ------
NM_003394chr123636 505 197 ------
NM_003403chr141559 ------
NM_003404chr201292 ------
NM_003405chr221540 ------
NM_003406chr831707 1397 149 ------
NM_003411chrY11628 1420 ----
NM_003412chr32900 456 ------
NM_003432chr5142 ------
NM_003442chr111670 ------
NM_003452chr92896 879 ------
NM_003453chr132502 483 2518 187 ----
NM_003457chr171245 ------
NM_003467chr21436 ------
NM_003468chr233012 382 170 --1630 --
NM_003470chr1641585 1577 1435 661 ------
NM_003474chr1011477 ------
NM_003478chr1133202 3034 637 ------
NM_003482chr1212358 ------
NM_003489chr2122294 574 13134 12754 --
NM_003507chr251858 798 618 564 198 ------
NM_003557chr121214 484 21637 1532 ----
NM_003566chr123862 615 72 11069 ----
NM_003574chr1865380 4950 4767 4434 4361 2027 35111 968 293 ----
NM_003576chr1332447 891 24 1618 ----
NM_003580chr82545 434 1131 ----
NM_003583chr1253653 3479 3050 2595 1492 13493 ----
NM_003589chr1331342 970 303 ------
NM_003592chr72469 145 ------
NM_003597chr261852 1621 1492 375 221 136 --1103 11932
NM_003603chr421588 101 ------
NM_003615chr323683 116 ------
NM_003617chr134021 3525 359 ------
NM_003618chr2--21288 1165 ----
NM_003629chr163452 3033 2515 1124 464 263 ------
NM_003644chr1744571 4442 1555 1292 22295 572 ----
NM_003654chr111560 --145 --
NM_003662chrX2139 23 ------
NM_003663chr331054 1010 268 ------
NM_003671chr942465 847 375 296 13577 ----
NM_003672chr11477 ------
NM_003679chr132477 2322 818 1992 ----
NM_003693chr173718 652 572 ------
NM_003701chr131212 ------
NM_003728chr41457 ------
NM_003743chr2--12053 ----
NM_003744chr1421094 1084 21152 899 ----
NM_003759chr423014 2784 ------
NM_003762chr1--11440 ----
NM_003763chr2032020 425 187 ------
NM_003772chr111827 ------
NM_003774chr1233210 2437 246 1546 ----
NM_003781chr341857 1607 382 226 ------
NM_003796chr192634 471 ------
NM_003800chr62722 554 ------
NM_003819chr11239 1266 ----
NM_003822chr142943 2413 2018 1981 ------
NM_003829chr94891 770 488 102 1841 ----
NM_003861chr1432728 2216 449 11922 ----
NM_003872chr232557 859 351 ------
NM_003884chr331780 1233 648 11569 ----
NM_003885chr1732484 2303 136 ------
NM_003887chr21187 ------
NM_003913chr643466 3026 490 349 ------
NM_003916chrX--1387 ----
NM_003930chr722391 1792 ------
NM_003934chr951239 1160 325 309 71 1499 ----
NM_003957chr1131012 821 772 ------
NM_003966chr586405 6112 3109 2883 2174 1820 1344 1327 ------
NM_003971chr17--1594 ----
NM_003980chr631367 1322 935 1344 ----
NM_003994chr1223556 418 12781 ----
NM_004006chrX52117 1951 1879 832 119 1263 ----
NM_004007chrX52117 1951 1879 832 119 1263 ----
NM_004009chrX52117 1951 1879 832 119 1263 ----
NM_004010chrX52117 1951 1879 832 119 1263 ----
NM_004011chrX52117 1951 1879 832 119 1263 ----
NM_004012chrX52117 1951 1879 832 119 1263 ----
NM_004013chrX52117 1951 1879 832 119 1263 ----
NM_004014chrX52117 1951 1879 832 119 1263 ----
NM_004015chrX52117 1951 1879 832 119 1263 ----
NM_004016chrX52031 1865 1793 746 33 1177 ----
NM_004017chrX52117 1951 1879 832 119 1263 ----
NM_004018chrX52031 1865 1793 746 33 1177 ----
NM_004020chrX52117 1951 1879 832 119 1263 ----
NM_004021chrX52031 1865 1793 746 33 1177 ----
NM_004022chrX52031 1865 1793 746 33 1177 ----
NM_004023chrX52031 1865 1793 746 33 1177 ----
NM_004047chr1150 ------
NM_004050chr1422192 1756 ------
NM_004067chr721048 218 11507 ----
NM_004087chr331269 1249 125 1374 ----
NM_004089chrX11173 ------
NM_004093chr1332895 1097 837 13172 ----
NM_004100chr622706 226 1201 ----
NM_004105chr22952 229 ------
NM_004112chr171463 11455 ----
NM_004113chr31440 ------
NM_004114chrX1983 ------
NM_004130chr31106 ------
NM_004145chr191353 ------
NM_004157chr31792 ------
NM_004161chr231496 1290 1280 ------
NM_004170chr92353 172 1239 ----
NM_004171chr1199509 9355 6078 5826 3472 2609 2155 1852 836 ------
NM_004180chr22404 51 ------
NM_004200chr1152582 2468 2093 1157 626 ------
NM_004205chr112539 533 ------
NM_004229chrX21853 355 ------
NM_004232chr1833508 2598 1264 1214 ----
NM_004242chr6--1360 ----
NM_004274chr1423074 2041 ----12296
NM_004281chr10193 ------
NM_004311chr102435 137 ------
NM_004316chr1221060 885 ------
NM_004319chr13638 553 68 12860 ----
NM_004329chr1031346 256 231 ------
NM_004337chr82669 61 ------
NM_004343chr191138 ------
NM_004346chr42522 23 ------
NM_004350chr131877 838 114 ------
NM_004364chr1931133 1056 1039 ------
NM_004378chr151216 ------
NM_004380chr1662480 1870 958 275 206 192 21949 663 ----
NM_004384chr521988 369 ------
NM_004386chr1962227 2118 2099 2017 549 288 ------
NM_004392chr1341815 1641 686 552 1935 ----
NM_004396chr171189 ------
NM_004397chr1144303 2724 247 86 --12633 --
NM_004414chr2111471 11360 ----
NM_004423chr322643 2016 ------
NM_004428chr11166 ------
NM_004429chrX11356 ------
NM_004430chr821719 693 12406 ----
NM_004432chr921554 225 ------
NM_004437chr173184 1191 1026 917 903 589 268 ------
NM_004438chr213250 11219 --11137
NM_004440chr611499 11807 ----
NM_004451chr11--1735 ----
NM_004454chr332128 1924 72 ------
NM_004458chrX2162 49 ------
NM_004459chr17--1228 ----
NM_004491chr1974266 4183 3682 2997 1286 1252 436 ------
NM_004497chr191587 ------
NM_004501chr123456 556 11190 ----
NM_004502chr171204 ------
NM_004504chr212480 1478 ----
NM_004506chr62687 680 ------
NM_004516chr1921007 401 ------
NM_004524chr17--1241 ----
NM_004535chr2021470 1444 ------
NM_004543chr22106 62 1157 ----
NM_004559chr12267 34 1394 ----
NM_004560chr92904 417 2848 655 ----
NM_004561chr111138 1681 ----
NM_004569chr143720 206 69 ------
NM_004578chr12838 254 ------
NM_004586chrX35435 4874 4051 ------
NM_004596chr191216 ------
NM_004598chr523083 1299 ------
NM_004612chr964574 1558 1518 1464 1306 785 33183 292 55 ----
NM_004622chr232478 1918 1822 12165 ----
NM_004630chr1131207 736 47 ------
NM_004642chr121219 ------
NM_004660chrY12006 ----12188
NM_004663chr1521452 332 ------
NM_004664chr121264 ------
NM_004701chr151158 ------
NM_004703chr1732036 1885 39 ------
NM_004709chrX--11644 ----
NM_004717chr741190 1183 1170 367 ------
NM_004725chr1021135 144 ------
NM_004726chrX65422 4967 4294 1397 675 650 14122 ----
NM_004730chr551813 1505 1423 793 536 11367 ----
NM_004731chr12--2617 90 1299 --
NM_004734chr131261 ------
NM_004736chr142183 1910 415 34 --1388 --
NM_004737chr221105 ------
NM_004742chr321807 1411 --11621 --
NM_004748chr1523870 1057 ------
NM_004755chr143387 311 98 ------
NM_004762chr1731944 1454 24 ------
NM_004774chr1743084 3046 3016 2028 ------
NM_004788chr1132415 2357 1061 ------
NM_004796chr1442182 1896 611 244 ------
NM_004805chr22953 299 1492 ----
NM_004808chr1042883 2489 2295 2273 ------
NM_004822chr1753210 3103 2937 2694 2563 --11345 --
NM_004834chr233214 3146 2707 22418 390 ----
NM_004845chrX53609 3177 1294 1099 145 ------
NM_004849chr621622 255 21254 171 ----
NM_004850chr21510 ------
NM_004856chr151404 1422 ----
NM_004860chr171461 ------
NM_004863chr1425267 4011 1615 ----
NM_004869chr1841594 1243 1144 315 1143 ----
NM_004871chr1763398 3277 473 456 237 50 1337 11384 --
NM_004879chr112633 237 ------
NM_004884chr1511732 ------
NM_004902chr201699 ------
NM_004904chr732518 2126 1554 21892 1022 ----
NM_004924chr192986 230 ------
NM_004926chr141641 ------
NM_004947chr321687 243 ------
NM_004949chr1821347 311 1781 ----
NM_004956chr744551 4438 3651 157 ------
NM_004960chr161100 ------
NM_004973chr631575 1254 301 1127 ----
NM_004985chr1242748 544 425 207 ------
NM_004992chrX117944 7428 7039 7015 5759 5692 3146 3056 2752 1952 1483 ------
NM_004992chrX117944 7428 7039 7015 5759 5692 3146 3056 2752 1952 1483 ------
NM_004999chr643169 2875 965 454 1792 ----
NM_005010chr7--12128 ----
NM_005016chr121233 195 ----
NM_005022chr171216 ------
NM_005023chr521089 145 ------
NM_005027chr1931195 1140 1073 ------
NM_005028chr1011899 ------
NM_005036chr22108204 6509 6005 5931 5829 3236 2825 2584 1927 259 18350 13172 --
NM_005053chr191568 ------
NM_005056chr1245389 4388 4264 1717 ------
NM_005063chr103811 793 361 152 ----
NM_005065chr1421791 1399 ------
NM_005067chr32965 62 ------
NM_005077chr91413 ------
NM_005078chr1521458 1428 ------
NM_005088chrX2721 616 ------
NM_005093chr2065235 5180 1668 1373 1349 1055 11214 ----
NM_005095chr122209 524 ------
NM_005116chr2044362 3272 1287 1275 1899 14009 --
NM_005119chr12977 831 11244 ----
NM_005120chrX1170 ------
NM_005121chr1733367 3248 550 1795 ----
NM_005131chr18179 ------
NM_005133chr112370 320 ------
NM_005134chr18--1361 ----
NM_005137chr2232492 2393 27 ------
NM_005156chr995055 4940 4138 2003 1413 1272 1200 986 955 35086 4698 4034 ----
NM_005157chr911932 ------
NM_005163chr142666 80 1207 ----
NM_005168chr221237 335 ------
NM_005190chr62802 415 ------
NM_005197chr1431553 1452 122 ------
NM_005207chr2293276 2883 2754 1410 912 786 549 514 288 12508 13564 --
NM_005224chr194714 608 588 252 ------
NM_005229chrX1265 ------
NM_005231chr113266 86 79 21321 251 ----
NM_005235chr256394 2371 2257 646 76 ------
NM_005238chr1142833 2781 963 635 12990 ----
NM_005245chr43741 729 188 ------
NM_005259chr2145 11126 ----
NM_005268chr11220 ------
NM_005273chr7--1311 ----
NM_005281chr11709 ------
NM_005312chr951802 1708 270 257 230 ------
NM_005313chr151209 ------
NM_005316chr113743 403 25 ------
NM_005318chr221812 ------
NM_005329chr1642237 2175 2127 1744 ------
NM_005333chrX11271 ------
NM_005349chr42587 574 ------
NM_005354chr191490 --1653 --
NM_005359chr1884299 4255 4238 2292 2271 1732 1502 849 ------
NM_005375chr641020 860 344 28 ------
NM_005381chr25396 299 172 121 54 ------
NM_005392chr911903 ------
NM_005397chr733843 3585 1614 ------
NM_005398chr102910 24 1470 ----
NM_005400chr231063 680 83 1602 ----
NM_005406chr181168 ------
NM_005407chr1411475 ------
NM_005414chr3143 ------
NM_005426chr12930 781 ------
NM_005433chr1822164 552 12354 ----
NM_005436chr1033737 3464 3421 ------
NM_005443chr42492 146 1193 ----
NM_005445chr10------1325
NM_005450chr171101 ------
NM_005477chr1552210 2068 810 730 645 ------
NM_005477chr1552210 2068 810 730 645 ------
NM_005487chr2211427 1102 ----
NM_005493chr62606 114 ------
NM_005506chr432732 2192 353 ------
NM_005512chr112215 105 ------
NM_005539chr1031415 534 225 ------
NM_005565chr5--1126 ----
NM_005576chr152295 226 ------
NM_005585chr151388 ------
NM_005596chr955456 4746 3944 2236 66 16233 ----
NM_005599chr121455 993 1311 ----
NM_005602chr31957 ------
NM_005604chr631738 875 844 11850 ----
NM_005610chr12656 75 ------
NM_005611chr1611027 ------
NM_005627chr63695 622 197 122 ----
NM_005631chr711086 ------
NM_005634chrX3685 462 160 ------
NM_005637chr1851925 1832 1595 1429 535 ------
NM_005644chr12340 299 ------
NM_005647chrX1563 ------
NM_005656chr21156 ------
NM_005657chr15--264 24 ----
NM_005662chr82391 364 ------
NM_005667chr21324 ------
NM_005688chr32513 445 ------
NM_005708chr131328 ------
NM_005715chr622679 209 22636 164 1154 --
NM_005721chr2184 2246 93 ----
NM_005722chr262377 2303 682 626 602 570 ------
NM_005736chr101498 ------
NM_005738chr761434 601 289 194 46 37 ------
NM_005739chr1512055 ------
NM_005740chr224916 824 107 86 1858 --1894
NM_005748chr1243064 623 455 204 22894 605 ----
NM_005759chr244422 3756 1560 44 11742 ----
NM_005762chr191128 ------
NM_005766chr1331381 1156 1078 ------
NM_005779chr542706 1252 410 182 ------
NM_005780chr13--1368 ----
NM_005786chr181125 ------
NM_005795chr211896 12753 ----
NM_005801chr172745 738 ------
NM_005813chr23757 542 248 12102 ----
NM_005822chr641718 1711 1469 438 ------
NM_005832chr31216 ------
NM_005840chrX36573 1431 409 ------
NM_005841chr41387 ------
NM_005859chr511484 ------
NM_005869chr51126 ------
NM_005875chr3157 ------
NM_005880chr1631245 557 116 ------
NM_005882chr41958 ------
NM_005895chr1273753 3506 3195 3072 1295 1081 762 23552 1046 12639 --
NM_005900chr431189 487 450 11112 ----
NM_005901chr1878459 6247 3430 2838 1657 1378 657 ------
NM_005903chr511009 35162 3961 2087 ----
NM_005904chr182214 135 ------
NM_005907chr611280 ------
NM_005911chr2--1955 ----
NM_005923chr61516 ------
NM_005924chr7----1327 --
NM_005933chr1122504 501 ------
NM_005935chr474067 3637 1895 1739 987 453 285 ------
NM_005938chrX1218 ------
NM_005941chr823652 1127 --21060 415 --
NM_005943chr611135 ------
NM_005955chr175236 3969 3487 2138 2056 878 374 ------
NM_005986chr1342385 2256 629 582 1221 ----
NM_005994chr172891 277 ------
NM_005996chr1241523 1306 1032 300 ------
NM_005999chr111486 11518 ----
NM_006007chr983982 3861 3811 3690 1517 1181 790 653 14429 ----
NM_006009chr122187 73 ------
NM_006011chr1534010 1258 107 ------
NM_006015chr111094 1821 ----
NM_006016chr622113 1707 ------
NM_006035chr1411226 ------
NM_006037chr294767 4755 4155 3446 1834 1797 1692 957 715 ------
NM_006047chr2053514 2293 995 627 304 ------
NM_006048chr121017 849 1238 ----
NM_006079chr61261 1157 ----
NM_006092chr72691 28 ------
NM_006094chr821735 840 ------
NM_006106chr1152666 879 778 722 452 ------
NM_006113chr1--1635 ----
NM_006135chr1----1123 --
NM_006141chr1652446 2219 1093 1075 980 1940 ----
NM_006148chr1752855 2462 2439 879 218 ------
NM_006158chr821499 721 ------
NM_006160chr1711126 ------
NM_006191chr124967 759 711 185 ------
NM_006196chr2--186 ----
NM_006202chr191135 ------
NM_006203chr545470 3449 1334 1267 11540 --11597
NM_006224chr1742071 1886 1647 537 ------
NM_006228chr81355 ------
NM_006235chr1121528 1324 ------
NM_006241chr342406 2003 1837 685 12067 ----
NM_006251chr532765 708 556 ------
NM_006252chr154737 2995 2688 2282 1255 ------
NM_006256chr11893 12368 ----
NM_006265chr811476 ------
NM_006275chr201343 ------
NM_006313chr1211599 ------
NM_006315chr432935 1678 331 ------
NM_006328chr112229 109 ------
NM_006329chr142592 510 ------
NM_006352chr12550 75 11449 ----
NM_006364chr141807 ------
NM_006366chr611237 ------
NM_006371chr375283 3612 1790 844 833 424 402 24750 4412 ----
NM_006372chr61471 ------
NM_006379chr71568 12110 ----
NM_006380chr1722734 1242 23706 3370 ----
NM_006386chr2232330 1851 1592 1606 ----
NM_006407chr321432 1381 ------
NM_006420chr201446 ------
NM_006457chr423179 187 ------
NM_006460chr1721800 638 ------
NM_006469chr121284 392 ------
NM_006482chr1253653 3479 3050 2595 1492 13493 ----
NM_006496chr11368 11357 ----
NM_006534chr203790 760 574 ------
NM_006538chr253469 896 332 260 75 ------
NM_006539chr161533 ------
NM_006544chr1455502 2204 2131 1596 486 24226 168 12440 --
NM_006547chr721463 758 ------
NM_006561chr1042026 1885 1559 1253 --14242 --
NM_006575chr142996 417 ------
NM_006593chr21237 ------
NM_006599chr1625621 1653 15290 ----
NM_006614chr343048 1176 1086 357 13119 ----
NM_006620chr654287 3031 1531 722 411 ------
NM_006624chr1021930 452 1281 156 --
NM_006628chr1524393 3648 ----14333
NM_006633chr51762 ------
NM_006646chr1353091 684 438 151 56 1484 ----
NM_006654chr121989 13169 ----
NM_006662chr161338 ------
NM_006667chrX2999 910 11205 ----
NM_006706chr5164 ------
NM_006708chr631080 1006 181 ------
NM_006717chr953199 2709 2162 2120 138 12780 ----
NM_006722chr363081 2232 1898 1081 1034 80 12466 ----
NM_006731chr944199 1686 1034 329 15736 ----
NM_006734chr611243 ------
NM_006735chr7158 ------
NM_006761chr172143 113 ------
NM_006766chr852063 1731 988 199 193 ------
NM_006775chr612372 12989 ----
NM_006777chrX32260 1076 689 ------
NM_006790chr5--1104 ----
NM_006791chr151538 ------
NM_006805chr51660 ------
NM_006811chr201938 1890 ----
NM_006814chr2021008 397 ------
NM_006815chr1251203 966 949 943 468 --11063 --
NM_006819chr111286 ------
NM_006827chr1443229 2698 1196 219 13114 ----
NM_006851chr1222770 378 11913 ----
NM_006852chr1742580 831 774 703 ------
NM_006854chr721638 606 ------
NM_006874chr421137 1098 ------
NM_006884chr331721 694 254 ------
NM_006885chr1663437 2886 2755 1493 1486 275 ------
NM_006887chr21193 ------
NM_006892chr2011179 ------
NM_006892chr2011179 ------
NM_006908chr721041 187 ------
NM_006920chr211799 ------
NM_006922chr212036 ------
NM_006924chr1723595 1391 ------
NM_006930chr511332 ------
NM_006963chr1011226 11165 ----
NM_006981chr922030 264 ------
NM_007005chr91530 ------
NM_007006chr1643429 1168 944 794 2863 99 ----
NM_007007chr1233822 3198 3048 1810 ----
NM_007011chr1566593 6036 2291 1831 836 203 ------
NM_007031chr21123 ------
NM_007036chr51911 ------
NM_007038chr2135865 4666 4568 14526 ----
NM_007039chr1432182 255 246 1848 ----
NM_007046chr21377 ------
NM_007054chr553551 2947 2859 2409 1514 13489 ----
NM_007067chr1731492 1290 1166 ------
NM_007078chr1042183 2009 784 144 ------
NM_007084chr131106 11448 1388 --
NM_007106chr1322125 239 ------
NM_007118chr53825 691 616 1834 ----
NM_007129chr13--21009 388 ----
NM_007136chr321082 30 ------
NM_007146chr1712483 ------
NM_007158chr121133 824 ----11107
NM_007159chr311199 ------
NM_007173chr1131786 438 35 ------
NM_007175chr842749 1273 1192 589 32328 980 190 ----
NM_007185chr111021 1903 ----
NM_007203chr923891 2734 13938 11533 --
NM_007207chr1172 ------
NM_007212chr121684 1535 ------
NM_007218chr82185 132 ------
NM_007235chr12188 1493 ----
NM_007246chr42910 863 ------
NM_007249chr1398908 5930 3209 2738 2467 2156 1637 732 159 13189 ----
NM_007250chrX1156 1576 ----
NM_007260chr11748 ------
NM_007285chr161146 ------
NM_007313chr911932 ------
NM_007345chr1822302 2185 1305 ----
NM_007350chr1244233 3916 3817 31 14377 ----
NM_012090chr1--11108 ----
NM_012095chr1033347 1248 339 ------
NM_012097chr2--11726 ----
NM_012098chr921525 550 ------
NM_012102chr122382 2097 ------
NM_012120chr6--11056 ----
NM_012164chr947006 2420 1405 52 1303 ----
NM_012177chr61125 159 ----
NM_012197chr931329 1274 589 11613 ----
NM_012199chr144421 4044 1760 589 ------
NM_012200chr11183 ------
NM_012207chr102928 45 ------
NM_012215chr1041840 1805 1538 68 11773 ----
NM_012223chr2159 21285 333 ----
NM_012224chr43778 389 294 ------
NM_012234chr333559 2449 324 13588 ----
NM_012247chr103420 126 27 ------
NM_012249chr222972 1374 ------
NM_012250chr1121052 402 ------
NM_012259chr611178 1565 ----
NM_012262chr125256 1021 1566 ----
NM_012266chr941075 1067 849 132 ------
NM_012281chr7--1863 ----
NM_012286chrX1526 --1592 --
NM_012300chr5131 ------
NM_012301chr721823 803 1729 ----
NM_012302chr121247 837 ------
NM_012308chr1152330 2296 2181 2175 1841 ------
NM_012309chr1141748 1591 1532 168 11540 ----
NM_012316chr155417 1673 1206 237 209 1629 ----
NM_012317chrX--1669 ----
NM_012325chr2031630 1614 573 1534 ----
NM_012330chr10--2651 570 ----
NM_012333chr121698 38 1185 ----
NM_012347chr642991 2414 1128 802 ------
NM_012382chr543869 3502 1374 229 1694 ----
NM_012399chr2221716 753 ------
NM_012406chr1241254 976 254 79 ------
NM_012419chr62161 136 1404 ----
NM_012420chr10----1180 --
NM_012426chr161343 ------
NM_012446chr51514 ------
NM_012471chrX21706 346 ------
NM_012479chr752345 2138 716 701 303 ------
NM_013236chr221401 ------
NM_013259chr32122 52 ------
NM_013261chr4--13708 ----
NM_013262chr621161 1080 ------
NM_013264chr112157 61 ------
NM_013269chr1244095 3719 770 285 11564 ----
NM_013272chr151275 ------
NM_013281chr20138 21399 1079 ----
NM_013309chr1532175 1732 619 ------
NM_013322chr711413 1303 ----
NM_013334chr3----134 --
NM_013346chrX153 ------
NM_013354chr81534 159 ----
NM_013371chr12329 51 ------
NM_013372chr1542653 2523 1209 313 ------
NM_013400chr7--11091 ----
NM_013436chr2--150 ----
NM_013437chr811207 ------
NM_013446chr741058 956 535 28 ------
NM_013448chr141244 ------
NM_013952chr212362 ------
NM_013953chr212362 ------
NM_013992chr212362 ------
NM_013995chrX22474 181 ------
NM_014005chr522075 938 ------
NM_014011chr222119 253 --12601 --
NM_014089chr1311687 ------
NM_014096chr112557 38 1646 ----
NM_014106chr1542035 783 575 29 --1867 --
NM_014112chr874735 4387 4007 2091 2065 723 39 --13899 --
NM_014117chr1622350 898 12104 ----
NM_014155chr11107030 6647 6059 5128 2564 2442 1807 1464 1028 324 --168 --
NM_014222chr9168 ------
NM_014225chr192356 111 ------
NM_014238chr1731473 1409 323 ------
NM_014240chr333475 2623 342 ------
NM_014250chr2211427 1102 ----
NM_014253chrX41990 1757 887 75 12475 ----
NM_014263chr10--133 ----
NM_014271chrX2329 135 ------
NM_014279chr91726 --1243 --
NM_014283chr11450 ------
NM_014294chr81127 ------
NM_014296chr31215 ------
NM_014309chr2244544 1604 1409 491 --11588 --
NM_014315chr14--1116 ----
NM_014323chr221170 1694 ----
NM_014325chr1231804 913 485 ------
NM_014331chr477150 6693 6603 5673 2386 2116 368 26783 383 ----
NM_014333chr1112149 ------
NM_014335chr1521238 332 21363 950 ----
NM_014361chr111186 ------
NM_014372chr141433 1296 538 49 1432 ----
NM_014374chr7--11091 ----
NM_014405chr1722345 440 ------
NM_014423chr525096 1508 24987 4293 ----
NM_014445chr321524 409 ------
NM_014447chr431249 1104 322 1179 ----
NM_014452chr6154 ------
NM_014456chr1011306 1538 ----
NM_014458chr11223 1208 ----
NM_014494chr1612230 ------
NM_014502chr112395 137 ------
NM_014503chr121311 1400 ----
NM_014504chr71296 ----11829
NM_014515chr12--1109 ----
NM_014517chr32760 334 11810 ----
NM_014521chr21358 ------
NM_014552chr221429 60 ------
NM_014554chr122877 761 ------
NM_014573chr1741807 1798 396 374 ------
NM_014574chr1421411 989 ------
NM_014603chr1721400 1042 ------
NM_014614chr211136 ------
NM_014615chr164931 913 732 253 ------
NM_014634chr2252707 2347 1322 1004 734 ------
NM_014636chr924001 3541 ------
NM_014640chr21290 ------
NM_014660chr711149 ------
NM_014663chr12964 447 ------
NM_014666chr51985 ------
NM_014667chr31678 ----11558
NM_014670chr241315 631 623 329 ------
NM_014671chr721535 1406 ------
NM_014676chr11397 11212 ----
NM_014682chr812200 1453 1741 --
NM_014683chr1732036 1460 1355 ------
NM_014685chr161558 ------
NM_014686chr1942334 964 487 337 ------
NM_014689chr2----1390 --
NM_014705chr711426 ------
NM_014707chr721432 130 1582 ----
NM_014715chr112935 864 ------
NM_014718chr121835 ------
NM_014729chr842179 1573 338 255 ------
NM_014730chr1264927 3370 1754 1068 421 63 ------
NM_014730chr1264927 3370 1754 1068 421 63 ------
NM_014733chr51914 1468 ----
NM_014735chrX1810 ------
NM_014743chr432976 1076 508 ------
NM_014749chr14191 143 ----
NM_014751chr811781 ------
NM_014764chr122390 301 ------
NM_014767chr1022814 2384 1334 ----
NM_014774chr142970 2507 2501 501 12514 ----
NM_014786chr1131186 1180 345 ----11216
NM_014787chr142534 2214 2091 70 ------
NM_014791chr91229 ------
NM_014812chr111375 21644 248 ----
NM_014824chr1151776 1652 1597 1545 282 ------
NM_014829chr5135 --1566 --
NM_014832chr1331795 1780 201 ------
NM_014839chr13641 289 258 11899 ----
NM_014841chr62996 911 ------
NM_014847chr11468 ------
NM_014850chr334672 3829 3384 ------
NM_014853chr1711452 ------
NM_014868chr123608 242 36 ------
NM_014873chr164620 4325 4298 3440 3236 1649 11228 ----
NM_014877chr17107590 6871 6626 6546 6118 5307 5257 1465 1291 949 15650 ----
NM_014893chrY32210 1591 1480 ------
NM_014897chr1743120 2676 2166 836 ------
NM_014899chr512633 1170 ----
NM_014903chr122682 126 21747 656 ----
NM_014904chr1021542 1094 ------
NM_014906chr1732751 599 388 1775 ----
NM_014918chr1541102 1059 565 113 ------
NM_014932chr321913 144 ------
NM_014939chr18--157 ----
NM_014944chr131409 1179 25 ------
NM_014946chr243106 3048 2535 273 --12992 --
NM_014962chr2032663 1980 233 ------
NM_014964chr1732398 1986 1801 21948 791 ----
NM_014969chr12327 303 ------
NM_014978chr1021827 295 11781 ----
NM_014989chr61458 21790 1619 ----
NM_014991chr432580 594 32 ------
NM_014996chr3129 ------
NM_014997chr752341 2212 1189 1005 153 1841 ----
NM_015000chr1232542 2257 977 1539 ----
NM_015001chr11628 ------
NM_015008chr383199 3182 3073 2428 2406 886 862 724 ------
NM_015009chr31731 1620 1106 --
NM_015024chr8--11319 ----
NM_015025chr21641 ------
NM_015026chr1274282 2966 1895 1606 1450 1420 1037 ------
NM_015027chr1621715 1345 11601 1437 --
NM_015035chr20116496 6167 6142 6129 5761 5634 4516 2262 1886 1723 1091 --1960 --
NM_015039chr154164 4043 1663 1360 1174 --1853 --
NM_015040chr22770 185 ------
NM_015042chr153902 589 354 14024 ----
NM_015044chr1622648 2019 1345 ----
NM_015045chr1012244 ------
NM_015049chr242680 2435 1115 72 ------
NM_015051chr932856 2124 129 ------
NM_015053chr13487 474 333 12336 ----
NM_015069chr162600 581 ------
NM_015071chr545269 1182 862 821 12403 ----
NM_015073chr1941992 1898 718 208 ------
NM_015075chrX11685 ------
NM_015076chr633966 3492 2950 11139 ----
NM_015093chr611817 ------
NM_015097chr311727 1762 11711 --
NM_015100chr142030 1960 396 250 1553 ----
NM_015101chr162367 2259 2096 417 224 48 ------
NM_015107chrX1519 --1709 --
NM_015110chr922114 725 ------
NM_015115chr442872 2541 887 397 13187 ----
NM_015125chr191445 ------
NM_015138chr151385 22154 1883 ----
NM_015144chr1663932 3314 2578 1213 690 352 1645 ----
NM_015155chr1052308 1247 971 397 134 ------
NM_015156chr1443005 2836 1239 1198 ------
NM_015170chr832010 1914 1659 ------
NM_015172chr141544 1497 1398 1269 11614 1415 --
NM_015180chr14--1798 ----
NM_015186chr91362 1312 ----
NM_015192chr2032662 2606 2523 1585 ----
NM_015197chr1422908 913 22225 529 12536 --
NM_015199chr352584 2169 583 459 260 1560 ----
NM_015200chr421021 790 1858 ----
NM_015213chr111652 ------
NM_015215chr121258 631 ------
NM_015236chr421448 471 --11190 --
NM_015239chr9153 ------
NM_015245chr622730 974 ------
NM_015247chr1654667 4256 742 622 222 55034 4535 1461 1344 442 ----
NM_015250chr951831 677 416 401 165 1834 ----
NM_015263chr151354 ------
NM_015265chr222378 106 ------
NM_015271chr453991 3746 1634 1553 33 13558 ----
NM_015272chr1611904 ------
NM_015278chr653411 2625 2594 793 786 1904 ----
NM_015282chr252903 2886 1867 972 439 ------
NM_015296chr1311177 ------
NM_015305chr14--11932 ----
NM_015310chr868336 8022 3275 981 284 49 15866 ----
NM_015313chr1154517 4241 3491 3208 1466 14372 ----
NM_015314chr72753 123 12366 ----
NM_015317chr212856 21970 639 ----
NM_015326chr122675 265 ------
NM_015328chr752840 2814 2520 1962 969 ------
NM_015335chr122809 631 ------
NM_015336chr1232056 668 272 1662 ----
NM_015344chr821490 746 21685 609 ----
NM_015347chr1252817 2528 2297 2186 187 ------
NM_015349chr632314 470 100 ------
NM_015355chr1721374 426 ------
NM_015358chr2111269 ------
NM_015361chr21226 ------
NM_015365chrX43090 589 250 73 ------
NM_015375chr164683 3364 3273 3110 1794 1574 14980 ----
NM_015387chr22203 116 1395 ----
NM_015396chr31219 ------
NM_015455chr543708 3220 1507 633 ------
NM_015458chr865179 4322 3502 860 762 754 13258 ----
NM_015465chr51201 1583 ----
NM_015472chr31159 ------
NM_015472chr31159 ------
NM_015477chr151229 ------
NM_015508chr3161 11533 ----
NM_015514chr142531 443 ------
NM_015532chr1572694 2521 750 684 659 633 245 ------
NM_015554chr1531833 586 104 22301 1979 ----
NM_015564chr5--12861 ----
NM_015565chr21--11603 ----
NM_015567chr13--11031 ----
NM_015569chr1--13189 ----
NM_015571chr622424 2226 12479 ----
NM_015578chr193765 318 124 ------
NM_015602chr111384 ------
NM_015607chr11211 ------
NM_015609chr122265 1082 1541 ----
NM_015640chr144531 4275 3847 860 2432 410 15290 --
NM_015641chr751097 846 823 170 47 ------
NM_015652chr10--1232 ----
NM_015670chr171116 ------
NM_015691chrX82713 2542 2254 2198 2032 2000 465 189 12697 ----
NM_015695chr621556 595 ------
NM_015726chr121777 439 ------
NM_015850chr831859 1628 360 ------
NM_015872chr121266 398 ------
NM_015874chr42587 574 ------
NM_015878chr821498 655 11705 ----
NM_015885chr111837 ------
NM_015898chr1922242 296 11623 ----
NM_015906chr144503 3306 3258 670 2602 564 ----
NM_015907chr4162 ------
NM_015932chr134559 548 305 148 ------
NM_015976chr1--1246 ----
NM_015986chr1721116 26 ------
NM_016009chr12590 525 ----1428
NM_016021chr642743 2246 807 760 12952 ----
NM_016022chr131026 134 112 1847 ----
NM_016026chr14183 ------
NM_016037chr16999 429 406 245 99 92 ------
NM_016038chr7175 1182 ----
NM_016059chr61338 ------
NM_016061chr21370 ------
NM_016073chr1511014 1963 ----
NM_016075chr1311140 22739 1006 ----
NM_016079chr222314 141 ------
NM_016081chr4--11605 ----
NM_016090chr11--2218 199 --1167
NM_016107chr51394 ------
NM_016121chr12896 431 ------
NM_016124chr1----11311 --
NM_016125chr17--1115 ----
NM_016131chr222349 540 ------
NM_016144chr52682 612 ------
NM_016203chr711033 1757 ----
NM_016205chr42518 223 11247 ----
NM_016206chr388680 7600 7358 6427 5866 1581 141 73 ------
NM_016217chr633069 1425 189 23641 2372 ----
NM_016224chr621485 182 ------
NM_016227chr11450 ------
NM_016230chr6163 ------
NM_016231chr1721314 438 1309 ----
NM_016248chr1343553 2710 2441 281 ----13660
NM_016252chr2--1819 ----
NM_016255chr621153 707 11264 ----
NM_016260chr245453 4957 874 802 11133 ----
NM_016264chr19--135 ----
NM_016269chr41254 ------
NM_016270chr191466 ------
NM_016271chr1822368 1456 ------
NM_016277chr631429 278 85 ------
NM_016287chr121599 1336 ------
NM_016289chr222177 2068 11626 1121 --
NM_016303chrX--1116 ----
NM_016304chr151746 ------
NM_016306chr3166 ------
NM_016315chr211889 ------
NM_016322chr922142 353 11991 ----
NM_016333chr161486 ------
NM_016337chr144488 320 311 183 ------
NM_016396chr1521156 954 ------
NM_016410chr91463 ------
NM_016433chr123332 324 186 ------
NM_016436chr2012536 ------
NM_016441chr211468 ------
NM_016483chr31317 ------
NM_016505chr11740 ------
NM_016507chr1743017 2781 2650 449 ------
NM_016521chrX180 ------
NM_016530chr151449 32547 1110 866 ----
NM_016531chr443968 3544 614 116 13147 ----
NM_016542chrX31757 1261 347 ------
NM_016545chr12864 806 ------
NM_016569chr1241523 1306 1032 300 ------
NM_016603chr521961 1378 ------
NM_016614chr62629 23 ------
NM_016618chr21394 160 ----
NM_016620chr1----1574 --
NM_016621chr1164554 3468 3436 1707 1637 1290 ------
NM_016625chr3157 ------
NM_016626chr1821136 183 --11304 --
NM_016628chr10126 ------
NM_016631chr212880 707 ------
NM_016653chr2166 ------
NM_016819chr3--1511 ----
NM_016820chr3--126 ----
NM_016823chr172947 368 ------
NM_016824chr10--1142 ----
NM_016948chr161116 ------
NM_016950chr411296 1406 ----
NM_016952chr1161355 1305 935 642 412 395 13446 ----
NM_017413chrX32339 556 65 ------
NM_017420chr1422366 1318 13600 ----
NM_017424chr2281954 1849 1554 697 639 523 316 204 ------
NM_017447chr2143157 3022 2988 42 ------
NM_017456chr1731944 1454 24 ------
NM_017489chr811190 ------
NM_017526chr11103 ------
NM_017544chrX1764 ------
NM_017575chr1721616 1286 ------
NM_017580chr1062108 1944 895 768 654 648 ------
NM_017582chr131701 624 466 ------
NM_017611chr112557 38 1646 ----
NM_017612chr12182 ------
NM_017626chr1031683 1556 721 11327 ----
NM_017629chr131888 1289 104 ------
NM_017632chr4--1435 ----
NM_017633chr6--1137 ----
NM_017634chr8--1276 ----
NM_017635chr1111095 ------
NM_017637chr951360 937 709 486 366 49242 8330 3557 1535 ----
NM_017638chr1172 ------
NM_017640chr61228 1742 ----
NM_017643chr1722862 2599 ------
NM_017650chr775977 5944 5401 3822 1338 1117 954 ------
NM_017658chr1413328 34542 3573 579 14387 --
NM_017661chr1531031 872 273 ------
NM_017666chrX11523 11656 ----
NM_017670chr11168 ------
NM_017672chr15127 ------
NM_017681chrX2848 82 1732 ----
NM_017714chr20162 ------
NM_017719chr331938 942 160 181 ----
NM_017737chr111883 ------
NM_017742chr1831449 375 189 ------
NM_017748chr172210 26 ------
NM_017758chr1741197 146 96 73 ------
NM_017769chr1422494 174 ------
NM_017778chr82294 200 ------
NM_017779chr12927 565 ------
NM_017784chr321079 76 ------
NM_017787chr1032132 1165 974 11933 ----
NM_017799chr1411503 ------
NM_017801chr362581 1847 1004 947 511 504 11624 ----
NM_017811chr91327 12108 11072 --
NM_017822chr121773 --1681 --
NM_017824chr1021930 262 11864 ----
NM_017848chrX54627 3219 449 361 185 ------
NM_017849chr242686 2491 1279 196 2748 558 ----
NM_017893chr1011297 ------
NM_017907chr112482 468 ------
NM_017913chr91170 --1108 --
NM_017915chr122907 110 1825 ----
NM_017922chr142435 249 ------
NM_017944chr1122451 2000 142 ----
NM_017964chr22667 262 ------
NM_017983chr17149 ------
NM_017988chr122669 228 ------
NM_018011chr132260 73 ------
NM_018026chr1121433 257 ------
NM_018027chr1012775 12599 ----
NM_018043chr1121388 109 ------
NM_018049chr192103 96 ------
NM_018061chr121176 624 ------
NM_018070chr11375 ------
NM_018078chr4126 1308 ----
NM_018084chr223053 769 1242 ----
NM_018086chr211808 ------
NM_018096chr1731034 689 164 ------
NM_018105chr82275 186 ------
NM_018110chr1631312 1091 1072 ------
NM_018126chr411283 31563 1024 499 ----
NM_018131chr102877 352 ------
NM_018133chr322016 1564 ------
NM_018151chr23761 229 26 ------
NM_018155chr31288 22865 2624 ----
NM_018179chr122551 50 ------
NM_018182chr1722253 1407 1196 ----
NM_018184chr33571 356 328 ------
NM_018195chr1141983 680 514 64 21699 1400 ----
NM_018206chr16--2666 52 ----
NM_018211chr131817 1678 718 ------
NM_018221chr2--1446 ----
NM_018247chr622956 1089 12590 ----
NM_018254chr122420 836 ------
NM_018265chr121994 1847 ------
NM_018279chr1222836 2806 ----12316
NM_018283chr1311009 11315 ----
NM_018287chr1021272 1253 ------
NM_018293chr332181 1102 112 ------
NM_018299chr811248 --1337 --
NM_018312chr1111776 --1407 --
NM_018313chr34365 358 343 324 1592 ----
NM_018327chr2021356 654 ------
NM_018330chr103443 418 412 ------
NM_018360chrX175 ------
NM_018362chr1112640 23799 1244 13924 --
NM_018364chr143967 3871 3448 2721 ------
NM_018368chr6--124 ----
NM_018374chr733826 1596 1589 24828 1186 ----
NM_018388chrX1497 ------
NM_018416chr1232597 2336 564 4849 794 533 369 ----
NM_018423chr12176 1268 ----
NM_018426chr62584 561 ------
NM_018440chr878124 6763 2023 1258 970 390 288 ------
NM_018442chr11104 ------
NM_018444chr831945 672 494 ------
NM_018451chr133834 793 254 ------
NM_018452chr6_random31446 713 533 ------
NM_018469chr1721374 1181 ------
NM_018482chr831975 327 165 --12128 --
NM_018489chr122128 327 ------
NM_018557chr21381 21184 150 ----
NM_018566chr184146 3704 1933 1927 1491 1040 845 60 ------
NM_018638chr1243841 2264 2099 1325 ------
NM_018640chr1232290 2182 2071 ------
NM_018649chr102508 57 ------
NM_018650chr131870 382 86 ------
NM_018695chr51225 ------
NM_018697chr712384 ------
NM_018700chr511227 ------
NM_018708chr19--11572 ----
NM_018710chr81194 ------
NM_018711chr1281451 1441 1185 1027 521 487 133 26 ------
NM_018712chr1111097 ------
NM_018715chr122158 290 ------
NM_018890chr721041 187 ------
NM_018898chr51167 ------
NM_018899chr51167 ------
NM_018900chr51167 ------
NM_018901chr51167 ------
NM_018902chr51167 ------
NM_018903chr51167 ------
NM_018904chr51167 ------
NM_018905chr51167 ------
NM_018906chr51167 ------
NM_018907chr51167 ------
NM_018908chr51167 ------
NM_018909chr51167 ------
NM_018910chr51167 ------
NM_018911chr51167 ------
NM_018951chr7----124 --
NM_018959chr191168 ------
NM_018977chrX2984 873 ------
NM_018992chr1611550 ------
NM_018994chr1--1447 ----
NM_019000chr521614 1104 ------
NM_019004chr732082 1630 743 ------
NM_019006chr152136 60 ------
NM_019027chr42882 287 1990 ----
NM_019042chr72899 313 ------
NM_019091chr221159 1085 ------
NM_019094chr1263799 3707 3685 2824 1448 119 ------
NM_019106chr2232838 2112 507 ------
NM_019114chr922041 438 ------
NM_019555chr3176 11530 ----
NM_019557chr12352 284 ------
NM_019558chr22260 135 ------
NM_019590chr101178 ------
NM_019613chr1741184 1124 930 120 --11176 --
NM_019845chr24801 723 549 150 ------
NM_019896chr21298 ------
NM_019903chr10--1142 ----
NM_020066chr12835 787 ------
NM_020122chr255560 1950 1779 1069 380 12062 ----
NM_020177chr532408 1222 270 ------
NM_020189chr8--131 ----
NM_020193chr1131326 1068 256 ----11202
NM_020194chr22617 473 ------
NM_020198chr1721320 1185 2276 161 ----
NM_020205chr153495 2976 2774 2554 2306 ------
NM_020210chr151951 ------
NM_020226chr41294 ------
NM_020228chr1121681 276 --1200 --
NM_020231chr32520 124 ------
NM_020245chr6152 34867 3163 184 14152 --
NM_020307chr3138 ------
NM_020336chr2043307 3249 1120 500 ------
NM_020337chr422652 982 ------
NM_020338chr1033238 1479 601 ------
NM_020342chr231896 817 184 ------
NM_020348chr1052584 2118 2102 1086 245 1822 ----
NM_020378chr191578 ------
NM_020381chr61348 21852 1768 ----
NM_020382chr1221216 524 1309 ----
NM_020403chr1321699 1413 ------
NM_020416chr472488 2479 1639 1081 656 612 321 12172 1329 --
NM_020438chr931300 383 327 ------
NM_020443chr146137 982 832 277 16352 ----
NM_020452chr121565 504 ------
NM_020456chr1321844 1611 ------
NM_020457chr161694 ------
NM_020463chr21295 135 ----
NM_020466chr644253 3060 3047 1900 13990 ----
NM_020474chr1821935 1865 11890 ----
NM_020528chr211114 ------
NM_020640chr331442 921 319 ------
NM_020644chr112352 67 1741 ----
NM_020647chr811908 ------
NM_020651chr231491 1181 58 ------
NM_020653chr17------129
NM_020673chr20107062 7056 6180 5250 2892 2747 2173 1450 1392 1237 ------
NM_020689chr2011504 ------
NM_020693chr111403 ------
NM_020698chr1243093 3005 1999 614 ------
NM_020699chr125284 2006 ------
NM_020715chr141531 21855 645 ----
NM_020718chr1652378 2214 1410 1222 339 35335 4113 1902 ----
NM_020727chr2153447 2910 1277 326 319 33847 3471 2491 ----
NM_020738chr221405 200 ------
NM_020739chr1523870 1057 ------
NM_020748chr1711394 ------
NM_020752chr1022024 826 ------
NM_020768chr52431 336 ------
NM_020770chr11827 11307 ----
NM_020772chr1768416 7840 2593 1610 1204 267 35511 2223 510 ----
NM_020773chr411833 12694 ----
NM_020774chr1854813 2147 1966 1853 1610 46265 5952 3791 380 1850 --
NM_020783chr1822062 33 ------
NM_020795chr1731801 1705 334 ------
NM_020796chr552739 2130 2008 1104 909 ------
NM_020800chr311292 11481 ----
NM_020801chr5--12099 ----
NM_020805chr18--1240 ----
NM_020808chr1172 ------
NM_020809chr1132251 1964 670 1254 ----
NM_020810chr14188 13517 ----
NM_020818chr141363 ------
NM_020831chr221234 ------
NM_020858chr1522394 365 ------
NM_020860chr41920 ------
NM_020861chr611112 1259 ----
NM_020868chr211767 21966 1509 ----
NM_020870chr452112 2101 715 556 187 11678 ----
NM_020873chr31218 ------
NM_020904chr192151 44 ------
NM_020918chr1011214 13232 ----
NM_020922chrX21544 33 11493 ----
NM_020935chr274455 4251 3565 3075 3026 1519 189 --14602 --
NM_020948chr133477 3253 830 ------
NM_020951chr1921539 22 ------
NM_020956chr1924532 4138 ------
NM_020967chr2011239 ------
NM_020975chr1031648 637 282 1164 ----
NM_020977chr421690 1370 ------
NM_020981chr21105 ------
NM_020987chr1011296 ------
NM_020988chr1621251 1108 ----1192
NM_021005chr1521062 819 ------
NM_021012chr171374 ------
NM_021032chr31440 ------
NM_021033chr1373313 3237 3053 1380 1292 1195 773 ------
NM_021038chr3--23246 3086 ----
NM_021069chr421588 101 ------
NM_021072chr542521 2247 2197 1688 ------
NM_021097chr22433 297 ------
NM_021103chr21186 ------
NM_021116chr768240 7082 6766 1905 697 672 ------
NM_021136chr141230 ------
NM_021137chr1722083 443 22255 2002 ----
NM_021140chrX173 ------
NM_021148chr75821 814 808 793 749 21675 1006 ----
NM_021155chr1932140 1150 784 --12208 --
NM_021159chr411261 ------
NM_021174chr81739 --1588 --
NM_021177chr64287 128 119 96 ------
NM_021189chr11171 --1160 --
NM_021215chr2032236 1677 272 ------
NM_021220chr20163 ------
NM_021222chr131304 386 177 ------
NM_021252chr1052010 1967 1915 1667 735 11458 ----
NM_021255chr1463417 1466 941 831 534 288 ------
NM_021620chr62756 296 ------
NM_021637chrX--11255 ----
NM_021643chr211734 ------
NM_021644chr102928 45 ------
NM_021647chr444037 3119 1467 418 11571 ----
NM_021705chr611336 ------
NM_021784chr20----1665 --
NM_021785chrX--157 ----
NM_021809chr2041594 889 131 81 ------
NM_021813chr6105644 5632 5373 5023 2338 2228 1911 1576 790 727 1695 --1128
NM_021814chr611492 ------
NM_021908chr73902 355 297 ------
NM_021911chr544877 920 831 200 13405 ----
NM_021912chr1511431 13477 ----
NM_021914chr1431894 84 78 ------
NM_021945chr61532 ------
NM_021960chr132496 2330 968 ------
NM_021961chr1126864 2906 --16811 --
NM_021964chr355604 5358 4120 2184 794 ------
NM_021971chr3----134 --
NM_021973chr41130 ------
NM_021988chr2021409 1215 ------
NM_022037chr2--1990 ----
NM_022041chr1611802 22714 131 ----
NM_022048chr1544603 4577 1835 354 1825 ----
NM_022049chr11601 ------
NM_022051chr11246 ------
NM_022093chr14921 826 185 81 ------
NM_022114chr124290 214 1487 ----
NM_022118chr131609 1538 ----
NM_022123chr141460 ------
NM_022130chr52273 73 ------
NM_022137chr1442039 1739 1442 284 ------
NM_022160chr91135 2164 121 ----
NM_022166chr1635676 1736 1145 24892 3866 ----
NM_022169chr112594 231 ------
NM_022170chr71164 ------
NM_022173chr2--1990 ----
NM_022351chr822805 607 ------
NM_022368chrX126 1446 ----
NM_022442chr2021409 1215 ------
NM_022457chr11116 ------
NM_022459chr1354246 4240 4033 782 592 1632 22481 1505 --
NM_022461chr32171 114 1337 ----
NM_022462chr1953543 1097 815 469 197 12677 ----
NM_022473chr1513992 33944 3653 196 ----
NM_022491chr1263352 3248 3173 2621 1299 1169 147 ----
NM_022552chr23507 336 319 ------
NM_022574chr741517 349 335 195 --12029 --
NM_022575chr20--1138 ----
NM_022658chr122432 343 1160 11053 --
NM_022716chr11576 22657 2518 ----
NM_022731chr12238 93 ------
NM_022735chr141399 1309 752 117 11829 ----
NM_022737chr1921094 1007 ------
NM_022753chr122624 749 12198 ----
NM_022756chr141521 1311 487 358 1192 ----
NM_022758chr623221 251 ------
NM_022776chr311340 11048 ----
NM_022780chr23707 258 207 ------
NM_022781chr942712 812 601 266 ------
NM_022822chr111896 ------
NM_022824chr511459 2755 89 ----
NM_022826chr22828 243 11192 ----
NM_022832chr441893 369 328 124 1181 ----
NM_022841chr15--1218 ----
NM_022843chr1321098 145 ------
NM_022845chr1661842 1722 694 369 160 112 11560 ----
NM_022893chr233094 2505 2223 1715 ----
NM_022894chr21142 1270 ----
NM_022898chr1494560 4293 4225 4016 3684 1293 821 602 242 ------
NM_022912chr232376 1178 694 ------
NM_022977chrX2162 49 ------
NM_023000chr1411416 ------
NM_023001chr1411416 ------
NM_023009chr11491 1720 ----
NM_023034chr82225 170 ------
NM_023039chr51108 1120 ----
NM_023105chr831859 1628 360 ------
NM_023106chr831859 1628 360 ------
NM_023110chr831859 1628 360 ------
NM_023111chr831859 1628 360 ------
NM_023927chr521371 981 ------
NM_023929chr842723 1768 1036 845 12279 ----
NM_024055chr51643 ------
NM_024065chr2193 ------
NM_024077chr91590 ------
NM_024092chr1121000 326 11223 ----
NM_024094chr81639 ------
NM_024102chr111034 2892 338 ----
NM_024293chr22549 330 1200 ----
NM_024294chr623221 251 ------
NM_024408chr142715 817 572 480 ------
NM_024415chr5130 ------
NM_024429chr711033 1757 ----
NM_024430chr1821513 267 11492 ----
NM_024501chr22738 524 ------
NM_024503chr11276 ------
NM_024519chr161270 ------
NM_024524chr342879 879 551 325 32035 648 619 ----
NM_024539chrX1408 ------
NM_024545chr24780 626 74 68 ------
NM_024546chr1341169 287 275 29 ------
NM_024556chr111400 ------
NM_024586chr11231 1552 ----
NM_024590chr41536 --11323 --
NM_024617chr92904 306 ------
NM_024635chr9--2249 217 ----
NM_024638chr342350 2069 1694 729 ------
NM_024639chr61218 ------
NM_024653chr721357 1224 ------
NM_024659chr2--1641 ----
NM_024665chr354467 3811 3293 994 752 11833 ----
NM_024674chr122298 734 11001 ----
NM_024700chr121161 34 1290 ----
NM_024713chr1541435 1296 1133 32 ------
NM_024721chr822570 978 12424 ----
NM_024744chr212482 ------
NM_024755chr151884 125 ----
NM_024757chr911021 ------
NM_024761chr954490 3662 683 421 347 ------
NM_024789chr10172 ------
NM_024811chr112617 280 ------
NM_024814chr71126 1145 ----
NM_024824chr14--1185 ----
NM_024835chr17--1340 ----
NM_024896chr942220 1989 769 676 ------
NM_024917chrX4837 760 370 153 1847 ----
NM_024941chr521324 993 ------
NM_024945chr92791 407 11044 ----
NM_024947chr358701 6399 3826 2427 78 16415 ----
NM_024953chr1242334 1952 868 408 ------
NM_024963chr745335 4523 1689 26 15719 ----
NM_024989chr257449 2710 2648 2391 180 11611 ----
NM_025054chr833045 2991 2859 ------
NM_025134chr161651 12403 ----
NM_025146chr341924 1714 629 439 12466 ----
NM_025154chr721206 349 ------
NM_025160chr122960 988 13543 ----
NM_025164chr1141395 637 275 177 1834 ----
NM_025187chr1631003 900 85 ------
NM_025235chr1032069 1922 481 11798 ----
NM_025248chr1752005 1097 955 777 183 ------
NM_025263chr641816 1159 597 380 ------
NM_030594chr1521266 192 ------
NM_030621chr142478 312 ------
NM_030627chr543595 632 420 341 ------
NM_030629chr1611707 11637 ----
NM_030647chr735834 2130 450 15727 ----
NM_030648chr475344 4960 4514 1467 517 356 331 ------
NM_030650chr211055 22642 1038 ----
NM_030661chr731414 1391 149 --11277 --
NM_030670chr1221737 497 ------
NM_030671chr1221737 497 ------
NM_030674chr1255805 5079 1565 795 306 ------
NM_030756chr10286 39 ------
NM_030758chr2231279 1255 84 ------
NM_030761chr11121 ------
NM_030775chr121932 ------
NM_030806chr157737 7703 3051 1891 926 22454 316 ----
NM_030809chr123944 635 120 11699 ----
NM_030816chr133405 2653 902 ------
NM_030881chr2232330 1851 1592 1606 ----
NM_030915chr261963 1897 928 587 350 153 --1744 --
NM_030920chr1--21986 131 ----
NM_030925chr1311974 ------
NM_030939chr651054 893 797 357 338 1830 ----
NM_030949chr61195 1187 ----
NM_030963chr62610 602 ------
NM_030964chr553610 2980 2384 1324 902 187 ----
NM_030981chr1121245 1017 ------
NM_031157chr12--1250 ----
NM_031229chr201529 ------
NM_031243chr732167 1476 292 ------
NM_031244chr631132 817 193 ------
NM_031268chr1654980 4179 3503 3281 751 23958 3904 11278 --
NM_031283chr22857 739 ------
NM_031296chr442197 997 452 190 12220 ----
NM_031369chr41332 ------
NM_031370chr41332 ------
NM_031407chrX129 ------
NM_031411chr51167 ------
NM_031417chr1922780 1014 --21035 844 --
NM_031438chr531738 495 122 ------
NM_031445chr252902 2553 2366 1193 977 ------
NM_031453chr1042503 2356 2238 335 ------
NM_031459chr121681 502 ------
NM_031461chr811760 1209 ----
NM_031468chr786822 6248 5881 2940 2290 1450 964 225 --1580 --
NM_031476chr1632265 922 51 1520 ----
NM_031492chr111459 ------
NM_031844chr123456 556 11190 ----
NM_031849chr51167 ------
NM_031857chr51167 ------
NM_031860chr51167 ------
NM_031914chr142735 157 ------
NM_031922chr62468 45 ------
NM_031989chr121233 195 ----
NM_031990chr1911013 --11246 --
NM_031991chr1911013 --11246 --
NM_031992chr71164 ------
NM_032047chr32839 819 11716 ----
NM_032050chr221170 1694 ----
NM_032052chr221555 11079 ----
NM_032102chr1111235 1538 ----
NM_032109chr51275 --11445 --
NM_032116chr1384961 4783 3983 3728 1958 1875 1486 106 ------
NM_032121chrX42267 855 665 524 ------
NM_032124chr1821204 383 ------
NM_032131chr61487 1123 ----
NM_032138chr133530 421 249 ------
NM_032144chr231169 1156 656 1719 ----
NM_032145chr61407 ------
NM_032153chr322105 546 12242 ----
NM_032186chr1----1574 --
NM_032189chr1334748 1968 563 ------
NM_032192chr172669 143 ------
NM_032199chr1033374 1194 680 11420 11280 --
NM_032217chr4--1298 ----
NM_032221chr2052057 1836 1742 1266 626 1355 ----
NM_032228chr1132962 2616 2352 1477 ----
NM_032233chr142860 140 ------
NM_032236chr111082 --1758 --
NM_032268chr1653242 2103 554 528 465 ------
NM_032271chr1621436 79 ------
NM_032281chr1932197 1224 284 12502 ----
NM_032288chr331754 379 138 --12185 --
NM_032291chr1--1217 ----
NM_032293chr9--1247 ----
NM_032352chr1411124 1282 ----
NM_032368chr1167 ------
NM_032373chr1044191 3863 3662 478 ------
NM_032408chr72843 81 ------
NM_032436chr1321034 170 ------
NM_032440chr1022074 770 ------
NM_032441chrX31153 949 131 ------
NM_032445chr1511918 ------
NM_032446chr543681 2540 1082 713 13514 ----
NM_032468chr81374 ------
NM_032491chr1211103 ------
NM_032552chr9----1238 --
NM_032557chr42740 310 ------
NM_032558chr911461 21269 1079 ----
NM_032560chr142287 91 ------
NM_032562chr10126 ------
NM_032581chr751446 365 340 184 79 ------
NM_032590chr123446 373 193 ------
NM_032595chr1721237 1012 --11545 --
NM_032626chr16--1250 ----
NM_032631chr192185 127 ------
NM_032632chr142629 116 1666 ----
NM_032642chr121932 ------
NM_032646chr1721355 43 11195 ----
NM_032682chr333391 1231 836 ------
NM_032711chr1744297 2945 1181 27 ------
NM_032737chr1962458 1844 1785 1750 563 395 --12636 --
NM_032765chr5--1301 ----
NM_032826chr744847 4048 1889 330 15314 ----
NM_032833chr131925 1811 927 12378 ----
NM_032839chr31123 ------
NM_032857chr152155 44 ------
NM_032873chr1121657 1347 12767 ----
NM_032875chr171338 ------
NM_032880chr11128 --153 --
NM_032892chr151285 ------
NM_032905chr101163 ------
NM_032927chr42640 21 ------
NM_032932chr1756156 5395 4185 4174 1614 11317 11670 --
NM_032949chr132528 67 ------
NM_032978chr1821114 423 --134 --
NM_032979chr1821114 423 --134 --
NM_032981chr1821114 423 --134 --
NM_032983chr762715 2457 2386 2220 901 345 ------
NM_032991chr42522 23 ------
NM_033012chr131212 ------
NM_033020chr144503 3306 3258 670 2602 564 ----
NM_033027chr32985 134 --1325 --
NM_033030chr241318 1096 589 228 ------
NM_033044chr1--11108 ----
NM_033067chr1--2647 571 ----
NM_033081chr2021458 1298 1383 ----
NM_033088chr12683 266 ------
NM_033089chr2021000 541 ------
NM_033131chr111378 21757 518 ----
NM_033161chr921679 730 ------
NM_033167chr341857 1607 382 226 ------
NM_033168chr341857 1607 382 226 ------
NM_033169chr341857 1607 382 226 ------
NM_033211chr51518 ------
NM_033222chr93437 377 50 11298 ----
NM_033224chr7117923 6986 6808 3077 2873 2625 2560 1834 1469 662 492 14874 ----
NM_033260chr62645 552 ------
NM_033274chr511041 --11427 --
NM_033285chr854289 3999 2955 1463 568 11792 ----
NM_033300chr11390 11210 ----
NM_033305chr921088 1075 --1227 --
NM_033309chr16152 ------
NM_033316chr34609 529 68 28 ------
NM_033331chr942465 847 375 296 13577 ----
NM_033360chr1242869 665 546 328 ------
NM_033380chrX1419 ------
NM_033381chrX1419 ------
NM_033389chr1744740 1825 692 560 1924 ----
NM_033402chr81171 1565 ----
NM_033425chr1111182 ------
NM_033430chr454120 3667 1320 345 312 ------
NM_033437chr454120 3667 1320 345 312 ------
NM_033480chr642991 2414 1128 802 ------
NM_033481chr642991 2414 1128 802 ------
NM_033505chr255961 4833 4552 4529 2390 16704 ----
NM_033512chr832915 2900 562 ------
NM_033642chrX1983 ------
NM_033644chr5131 ------
NM_033645chr5131 ------
NM_044472chr12478 283 ------
NM_052818chr1321857 188 ------
NM_052827chr1211022 ------
NM_052869chr1721355 43 11195 ----
NM_052879chr1232995 2898 182 43828 3334 1492 278 ----
NM_052885chr1244265 1864 1405 784 13529 ----
NM_052886chr811720 12110 ----
NM_052896chr112428 ------
NM_052898chr81164 21882 1347 1267 --
NM_052905chr221879 1366 ------
NM_052918chr1023649 336 ------
NM_052927chr5--21944 860 ----
NM_052932chr1132157 547 181 1227 ----
NM_052954chr2111912 1539 ----
NM_052965chr13919 506 133 ------
NM_053002chr31961 ------
NM_053043chr785804 5777 5116 4857 4522 4231 1500 307 14882 ----
NM_053056chr1121990 917 1487 ----
NM_054016chr1------11599
NM_054016chr1------11599
NM_054016chr1------11599
NM_058170chr1--11427 ----
NM_058246chr711232 ------
NM_080413chr20--1138 ----
NM_080414chr20--1138 ----
NM_080552chr201230 --1565 --
NM_080607chr20------11091
NM_080617chr202959 849 ------
NM_080626chr121347 ------
NM_080647chr221453 ------
NM_080666chr14--21580 33 1156 --
NM_080676chr2032979 968 750 ------
NM_080682chr12727 487 1506 ----
NM_080759chr1341815 1641 686 552 1935 ----
NM_080760chr1341815 1641 686 552 1935 ----
NM_080764chr2252971 2270 1047 512 198 ------
NM_080872chr81359 13524 ----
NM_080927chr362312 2297 2263 2087 2060 644 11025 ----
NM_100264chr10126 ------
NM_100486chr10126 ------
NM_130391chr923247 646 --13195 --
NM_130392chr923247 646 --13195 --
NM_130393chr923247 646 --13195 --
NM_130436chr2162019 816 742 484 322 278 ----12615
NM_130438chr2152596 1319 1061 899 855 ----13192
NM_130459chr9--21635 523 ----
NM_130797chr7--1620 ----
NM_130808chr3--1394 ----
NM_130838chr1521714 301 ------
NM_130839chr1521714 301 ------
NM_133264chr1753123 3041 2924 1464 1180 ------
NM_133369chr5--1971 ----
NM_133370chr443227 2941 2811 1055 ------
NM_133433chr51713 1828 ----
NM_133443chr1611940 ------
NM_133445chr973770 3137 1427 1132 394 320 116 ------
NM_133496chr184108 3211 3115 2884 889 593 257 210 ------
NM_133510chr141317 ------
NM_133631chr31166 ------
NM_133638chr51502 ------
NM_133642chr221105 ------
NM_134269chr221323 ------
NM_134270chr221152 ------
NM_134447chr192634 471 ------
NM_138316chr1031062 208 170 ------
NM_138357chr1021679 714 ------
NM_138395chr21328 1414 ----
NM_138415chr2221805 1699 ------
NM_138423chr1532252 1545 648 ------
NM_138459chr611461 12459 ----
NM_138555chr151404 1422 ----
NM_138565chr113266 86 79 21321 251 ----
NM_138576chr1494560 4293 4225 4016 3684 1293 821 602 242 ------
NM_138621chr253469 896 332 260 75 ------
NM_138638chr1431894 84 78 ------
NM_138689chr111178 ------
NM_138713chr1625621 1653 15290 ----
NM_138714chr1625621 1653 15290 ----
NM_138730chr6--1385 ----
NM_138774chr193332 299 125 ----1595
NM_138927chr211325 1164 ----
NM_138970chr1442182 1896 611 244 ------
NM_139015chr1221742 1368 --1654 --
NM_139035chrX1261 ------
NM_139045chr91312 1329 ----
NM_139071chr1241148 332 246 84 ------
NM_139135chr111094 1821 ----
NM_139167chr82535 72 ------
NM_139168chr51265 11274 ----
NM_139211chr4182 ------
NM_139212chr4182 ------
NM_139242chr1551490 1401 1211 958 300 ------
NM_139276chr1722338 1823 12096 ----
NM_139312chr10--133 ----
NM_139316chr7141 ------
NM_139321chr202410 166 ------
NM_139323chr201292 ------
NM_144571chr444928 2636 2162 677 12537 ----
NM_144578chr141234 24752 614 ----
NM_144599chr1522118 127 24865 4025 ----
NM_144633chr32353 231 ------
NM_144636chr33561 152 144 ------
NM_144664chr1142468 919 449 347 11955 ----
NM_144667chr123952 865 195 ------
NM_144724chr52742 350 ------
NM_144728chr1172 ------
NM_144729chr1172 ------
NM_144778chr1312571 ------
NM_144949chr222119 253 --12601 --
NM_144979chr41674 1106 ----
NM_145010chr1031945 1557 624 11494 ----
NM_145055chr1853733 3153 2675 1326 927 ------
NM_145112chr1431142 506 466 --1894 --
NM_145113chr1421414 1071 --11166 --
NM_145117chr1133227 1028 810 ------
NM_145119chrX2445 26 ------
NM_145176chr632596 393 114 11140 ----
NM_145185chr19--11728 ----
NM_145203chr131242 ------
NM_145206chr1022968 1082 ----1814
NM_145251chr14--1197 ----
NM_145259chr236339 5813 570 16665 ----
NM_145296chr192742 327 1753 ----
NM_145307chr1033683 3390 1416 1420 ----
NM_145313chr1021493 438 ------
NM_145341chr1011306 1538 ----
NM_145350chr1741464 1398 1318 24 ------
NM_145351chr1752604 2538 2458 559 374 ------
NM_145648chr12124 ------
NM_145686chr233214 3146 2707 22418 390 ----
NM_145687chr233214 3146 2707 22418 390 ----
NM_145690chr831707 1397 149 ------
NM_145716chr11375 ------
NM_145753chr311162 1173 ----
NM_145800chrX1693 ------
NM_145913chr12175 1748 ----
NM_147128chr721382 27 ------
NM_147150chr923891 2734 13938 11533 --
NM_147156chr102547 327 ------
NM_147164chr9177 ------
NM_147223chr2--12236 ----
NM_147233chr2--12053 ----
NM_148174chr821498 655 11705 ----
NM_148904chr11231 1552 ----
NM_148905chr11231 1552 ----
NM_148906chr11231 1552 ----
NM_148907chr11231 1552 ----
NM_148908chr11231 1552 ----
NM_148909chr11231 1552 ----
NM_148921chr1732398 1986 1801 21948 791 ----
NM_148977chr1031062 208 170 ------
NM_148978chr1031062 208 170 ------
NM_152238chr1--1246 ----
NM_152259chr152924 135 ------
NM_152261chr121207 1537 ----
NM_152263chr124412 2349 15982 1702 --
NM_152267chr22--12422 ----
NM_152275chr22787 229 ------
NM_152277chr521956 534 ------
NM_152288chr163934 769 225 1997 ----
NM_152298chr13561 192 127 1173 ----
NM_152305chr331480 520 124 12144 ----
NM_152335chr151240 ------
NM_152383chr2297 85 ------
NM_152384chr232050 593 543 ------
NM_152387chr21239 ------
NM_152406chr5--21225 276 ----
NM_152407chr5102879 2390 2311 2304 2297 2290 1316 327 300 172 ------
NM_152409chr51127 168 ----
NM_152414chr811573 --1192 --
NM_152423chrX1630 ------
NM_152424chrX31815 1075 149 --11013 --
NM_152437chr1211824 ------
NM_152441chr121179 ------
NM_152470chr1833793 1334 1143 1808 ----
NM_152556chr71998 12481 ----
NM_152594chr1511558 ------
NM_152608chr12694 201 1810 ----
NM_152622chr522497 818 1505 ----
NM_152624chr555181 4925 4814 2530 2489 45565 1306 877 273 --17474
NM_152629chr953838 3043 2697 493 207 1589 ----
NM_152636chr1123055 2745 ------
NM_152641chr1252481 2317 1101 992 546 ------
NM_152665chr13916 460 223 ------
NM_152671chr21113 ------
NM_152692chrX2347 173 ------
NM_152699chr353111 2896 2874 2311 463 1706 ----
NM_152707chr102349 21 ------
NM_152715chr11170 ------
NM_152722chr112223 36 1312 ----
NM_152737chr631833 820 148 ------
NM_152744chr753266 3192 2333 1176 172 ----12670
NM_152753chr6--1777 11329 --
NM_152756chr554244 3317 1169 705 292 ------
NM_152758chr842244 1990 1962 153 ------
NM_152772chr121383 ------
NM_152787chrX33098 797 174 ------
NM_152789chr711062 ------
NM_152829chr751097 846 823 170 47 ------
NM_152835chr122705 509 ------
NM_152838chr2053514 2293 995 627 304 ------
NM_152857chr6--1717 ----
NM_152858chr6--1717 ----
NM_152896chr91646 1745 ----
NM_152903chr1342823 2407 2177 448 ------
NM_152924chr1566593 6036 2291 1831 836 203 ------
NM_152999chr723196 1061 ----11127
NM_153013chr521870 951 12090 ----
NM_153028chr162428 265 ------
NM_153184chr31309 11706 ----
NM_153188chr534387 4137 2108 ----15538
NM_153207chr1253769 3247 3224 944 858 --1767 --
NM_153215chr31876 ------
NM_153235chr622222 197 ------
NM_153267chr92371 220 ------
NM_153321chr171178 ------
NM_153322chr171178 ------
NM_153341chr11127 ------
NM_153347chr111633 11011 ----
NM_153354chr5--1361 ----
NM_153365chr412365 22317 2145 ----
NM_153367chr1072945 2918 2907 1445 1248 735 435 ----13338
NM_153450chr112785 62 ------
NM_153607chr543073 2474 2428 384 ------
NM_153616chr1522394 365 ------
NM_153617chr1522394 365 ------
NM_153618chr1522394 365 ------
NM_153619chr1523632 175 12237 ----
NM_153631chr731414 1391 149 --11277 --
NM_153632chr731414 1391 149 --11277 --
NM_153649chr122324 1609 11942 ----
NM_153675chr20----1665 --
NM_153686chr421909 1810 --12361 --
NM_153715chr7----124 --
NM_153757chr441200 265 95 52 ------
NM_153758chr12329 51 ------
NM_153759chr23507 336 319 ------
NM_153816chr61397 ------
NM_170606chr741845 1764 1368 329 ------
NM_170665chr1243689 3568 1815 373 ------
NM_170706chr154164 4043 1663 1360 1174 --1853 --
NM_170707chr12891 125 1176 ----
NM_170708chr12891 125 1176 ----
NM_170711chr191344 ------
NM_170739chr111222 ------
NM_170750chrX1778 ------
NM_171998chrX1968 12291 ----
NM_172070chr22861 517 ------
NM_172071chr147459 6398 1192 373 35700 4639 669 --12959
NM_172103chr622706 226 1201 ----
NM_172105chr622706 226 1201 ----
NM_172127chr421416 456 ------
NM_172128chr421372 412 ------
NM_172164chr13561 192 127 1173 ----
NM_173065chr153125 2655 2338 1260 1220 ----11287
NM_173075chr42724 238 ------
NM_173083chr11381 11095 ----
NM_173156chr142179 2158 2131 1738 ------
NM_173167chr1742637 2501 2004 1940 ------
NM_173198chr922030 264 ------
NM_173200chr922030 264 ------
NM_173214chr1625621 1653 15290 ----
NM_173359chr3143 ----156
NM_173454chr1521196 254 ------
NM_173468chr455074 3681 1257 667 244 13974 ----
NM_173470chrX52337 2133 982 418 304 --11992 --
NM_173471chr311065 ------
NM_173475chr161309 ------
NM_173491chr5125 11212 ----
NM_173495chrX21743 479 32253 495 36 ----
NM_173517chr7167 ------
NM_173552chr32451 411 ------
NM_173582chr112573 188 16293 ----
NM_173602chr1273283 2942 2881 1481 1342 1328 719 ------
NM_173609chr151196 1608 ----
NM_173642chr179130 6302 3378 3217 948 866 172 ------
NM_173644chr2021915 56 1345 ----
NM_173647chr22448 354 ------
NM_173694chrX----1955 --
NM_173803chr1621264 379 ------
NM_173808chr123497 313 14392 ----
NM_173822chr231848 865 166 11510 ----
NM_173825chr332726 744 332 --1430 --
NM_173830chr6--168 ----
NM_173848chr81199 ------
NM_173851chr813915 11495 ----
NM_173872chr42373 69 2835 773 ----
NM_174890chr101571 --1784 --
NM_174907chr3--149 ----
NM_174934chr1122445 657 ------
NM_174936chr111209 ------
NM_174978chr143323 208 170 ------
NM_175566chr111186 ------
NM_175607chr311276 11195 ----
NM_175610chr151895 ------
NM_175612chr311276 11195 ----
NM_175624chr1266745 4753 2632 1785 1442 1232 12738 ----
NM_175625chr1266745 4753 2632 1785 1442 1232 12738 ----
NM_175629chr23507 336 319 ------
NM_175768chr6131 ------
NM_175847chr1911013 --11246 --
NM_175848chr2011179 ------
NM_175848chr2011179 ------
NM_175849chr2011179 ------
NM_175849chr2011179 ------
NM_175850chr2011179 ------
NM_175850chr2011179 ------
NM_175854chr1332354 1013 869 ------
NM_175866chr111412 1214 ----
NM_175873chr53949 423 300 ------
NM_175907chr1842532 2123 725 258 21886 403 ----
NM_176792chr1011345 ------
NM_176814chr711083 11276 ----
NM_177398chr121566 1280 ------
NM_177399chr121566 1280 ------
NM_177438chr142478 312 ------
NM_177559chr201773 11259 ----
NM_177560chr201773 11259 ----
NM_177925chr1232605 1924 876 ------
NM_177966chr321306 540 11836 ----
NM_177969chr2141 ------
NM_177974chr1532252 1545 648 ------
NM_177983chr21274 ------
NM_177985chr2--11726 ----
NM_178011chr1032558 1034 657 ------
NM_178135chr441111 878 870 261 ------
NM_178151chrX45892 5135 4785 2038 ------
NM_178152chrX45892 5135 4785 2038 ------
NM_178153chrX45892 5135 4785 2038 ------
NM_178313chr2150 ------
NM_178426chr122284 1874 11900 ----
NM_178496chr321468 1402 ------
NM_178565chr8132 ------
NM_178578chr2021008 397 ------
NM_178585chr432580 594 32 ------
NM_178586chr1412004 ------
NM_178812chr8--11470 ----
NM_180989chr131633 1613 ----
NM_181351chr1162816 2410 2289 1921 1143 964 --12848 --
NM_181358chr11148 24198 899 ----
NM_181361chr31216 ------
NM_181443chr2032663 1980 233 ------
NM_181504chr524026 3287 13460 ----
NM_181505chr172669 143 ------
NM_181523chr524026 3287 13460 ----
NM_181524chr524026 3287 13460 ----
NM_181552chr71953 ------
NM_181575chr21141 ------
NM_181659chr203790 760 574 ------
NM_181659chr203790 760 574 ------
NM_181670chr121234 ----11475
NM_181672chrX1271 2541 456 ----
NM_181673chrX1271 2541 456 ----
NM_181705chr545775 5738 4506 1011 ------
NM_181706chr1142035 968 837 371 ------
NM_181711chr121685 ------
NM_181782chr621718 472 1674 ----
NM_181807chr112352 273 ------
NM_181836chr522624 1669 ------
NM_181838chr511630 ------
NM_181876chr472488 2479 1639 1081 656 612 321 12172 1329 --
NM_182485chr432603 1411 364 23206 1130 ----
NM_182493chr1654985 3644 1918 1896 676 24472 4049 ----
NM_182501chr232993 2492 121 2439 302 ----
NM_182503chr665477 5451 5339 5050 3866 1328 25082 254 ----
NM_182543chr10155 ------
NM_182551chr243450 3362 3244 760 ------
NM_182557chr1122173 1688 ------
NM_182641chr17--1228 ----
NM_182643chr821735 840 ------
NM_182646chr432603 1411 364 23206 1130 ----
NM_182648chr141244 ------
NM_182663chr111518 22264 352 ----
NM_182664chr111648 22394 482 ----
NM_182665chr111518 22264 352 ----
NM_182685chr11166 ------
NM_182691chr721452 331 ------
NM_182692chr721452 331 ------
NM_182697chr731088 234 110 ------
NM_182765chr1021846 1634 1639 ----
NM_182830chr142484 368 ------
NM_182898chr732518 2126 1554 21892 1022 ----
NM_182899chr732518 2126 1554 21892 1022 ----
NM_182907chr612036 12294 ----
NM_182910chr14--1798 ----
NM_182913chr14--1798 ----
NM_182914chr14--1798 ----
NM_182920chr311228 --11092 --
NM_182947chr122340 296 ------
NM_182948chr142206 481 297 128 ------
NM_182964chr1133227 1028 810 ------
NM_182972chr162295 1937 1849 967 662 651 ------
NM_182983chr191280 ------
NM_183004chr1433246 3204 146 ------
NM_183227chr631429 278 85 ------
NM_183377chr172870 808 ------
NM_184234chr201699 ------
NM_194071chr725252 1501 15010 ----
NM_194247chr253428 1701 877 750 271 24190 3870 ----
NM_194250chr21328 ------
NM_194259chr162563 156 --1205 --
NM_194260chr162563 156 --1205 --
NM_194261chr162563 156 --1205 --
NM_194282chr422393 1157 12994 ----
NM_194286chr1266194 6156 4406 2170 834 288 ------
NM_194291chr832586 976 645 1554 ----
NM_194314chr134843 4658 665 13576 ----
NM_194317chr212767 ------
NM_194328chr942712 812 601 266 ------
NM_194329chr942712 812 601 266 ------
NM_194330chr942712 812 601 266 ------
NM_194332chr942712 812 601 266 ------
NM_194434chr1865380 4950 4767 4434 4361 2027 35111 968 293 ----
NM_194449chr18--186 ----
NM_194463chrX1408 ------
NM_197968chr132502 483 2518 187 ----
NM_197970chr241318 1096 589 228 ------
NM_197977chr92896 879 ------
NM_198057chrX11173 ------
NM_198074chr11216 ------
NM_198128chr1822368 1456 ------
NM_198158chr363081 2232 1898 1081 1034 80 12466 ----
NM_198159chr363081 2232 1898 1081 1034 80 12466 ----
NM_198177chr363081 2232 1898 1081 1034 80 12466 ----
NM_198178chr363081 2232 1898 1081 1034 80 12466 ----
NM_198181chr1532313 636 275 --12824 --
NM_198182chr221429 60 ------
NM_198243chr152154 134 1217 ----
NM_198268chr11148 24198 899 ----
NM_198269chr11148 24198 899 ----
NM_198270chrX23028 2421 11337 ----
NM_198279chrX11210 ------
NM_198390chr1611707 11637 ----
NM_198391chr20138 21399 1079 ----
NM_198503chr1--1316 ----
NM_198504chr31879 ------
NM_198513chr821780 336 ------
NM_198567chr51538 ------
NM_198578chr1211506 ------
NM_198679chr951802 1708 270 257 230 ------
NM_198794chr142996 417 ------
NM_198829chr721041 187 ------
NM_198859chr334887 3638 3204 ------
NM_198883chr1129 ------
NM_198889chr4--1298 ----
NM_198896chr1132200 2144 804 1867 1593 --
NM_198925chr151951 ------
NM_199000chr712168 ------
NM_199040chr1263799 3707 3685 2824 1448 119 ------
NM_199054chr193171 157 59 ------
NM_199132chr1952002 1675 464 278 109 ------
NM_199144chr2021409 1215 ------
NM_199168chr102973 264 ------
NM_199185chr5--1208 ----
NM_199188chr1232995 2898 182 43828 3334 1492 278 ----
NM_199190chr1232995 2898 182 43828 3334 1492 278 ----
NM_199203chr2021409 1215 ------
NM_199205chr81739 --1588 --
NM_199262chr1722209 837 ------
NM_199320chr422338 1166 12629 ----
NM_199320chr422338 1166 12629 ----
NM_199324chr443313 3253 2824 1099 ------
NM_199327chr41387 ------
NM_199329chr112557 38 1646 ----
NM_199342chr12241 227 ------
NM_199423chr1611017 11103 ----
NM_199436chr243106 3048 2535 273 --12992 --
NM_199437chr1121681 276 --1200 --
NM_199438chr1121681 276 --1200 --
NM_199439chr1121681 276 --1200 --
NM_199454chr124290 214 1487 ----
NM_199461chr1042570 1209 576 134 ------
NM_199462chr164683 3364 3273 3110 1794 1574 14980 ----
NM_199482chr22203 116 1395 ----
NM_201266chr232557 859 351 ------
NM_201269chr1----1574 --
NM_201279chr232557 859 351 ------
NM_201413chr214751 678 240 215 ------
NM_201414chr214751 678 240 215 ------
NM_201432chr1744571 4442 1555 1292 22295 572 ----
NM_201433chr1744571 4442 1555 1292 22295 572 ----
NM_201567chr321440 409 1539 ----
NM_201568chr142179 2158 2131 1738 ------
NM_201569chr142179 2158 2131 1738 ------
NM_201995chr114778 307 256 212 --1137 --
NM_201998chr113843 321 277 --1202 --
NM_201999chr421137 1098 ------
NM_203283chr42587 574 ------
NM_203284chr42587 574 ------
NM_203301chr1411255 11479 ----
NM_203304chr191607 ------
NM_203307chr1941379 1153 354 102 ------
NM_203327chr2044362 3272 1287 1275 1899 14009 --
NM_203342chr173184 1191 1026 917 903 589 268 ------
NM_203343chr173184 1191 1026 917 903 589 268 ------
NM_203351chr1731635 1558 132 21987 1962 ----
NM_203390chr81161 ------
NM_203394chr121244 ------
NM_203417chr2111471 11360 ----
NM_203418chr2111471 11360 ----
NM_203459chr132544 2394 1042 ------
NM_203463chr244394 3737 892 619 --13578 --
NM_203487chr1321699 1413 ------
NM_205768chr12550 75 11449 ----
NM_205842chr2--150 ----
NM_205860chr142943 2413 2018 1981 ------
NM_206839chr151538 ------
NM_206852chr141230 ------
NM_206853chr632901 1005 987 1366 ----
NM_206854chr624162 187 23487 1627 --11280
NM_206855chr635127 3917 1152 24452 865 --12245
NM_206857chr141230 ------
NM_206876chr22905 840 1354 ----
NM_206907chr532765 708 556 ------
NM_206909chr868336 8022 3275 981 284 49 15866 ----
NM_207012chr1033347 1248 339 ------
NM_207123chr42905 313 ------
NM_207171chr142030 1960 396 250 1553 ----
NM_207292chr3--23246 3086 ----
NM_207293chr3--23246 3086 ----
NM_207294chr3--23246 3086 ----
NM_207295chr3--23246 3086 ----
NM_207296chr3--23246 3086 ----
NM_207297chr3--23271 3111 ----
NM_207304chr1312458 ------
NM_207317chr51348 ------
NM_207371chr101165 ------
NM_207372chr1052283 2012 1766 687 174 22356 699 ----
NM_207406chr474666 2300 2117 1501 1407 1355 978 ------
NM_207412chr841365 993 268 132 ------
NM_207418chr1_random2996 746 1913 ----
NM_207577chr1142874 2747 954 565 ------
NM_207645chr1111023 ------
NM_207660chr14--1185 ----
NM_207661chr14--1185 ----
NM_207662chr14--1185 ----
NM_212460chr761434 601 289 194 46 37 ------
NM_212469chr111890 ------
NM_212554chr10181 1274 ----
NM_213594chr1211103 ------
NM_213606chr10--1514 ----
NM_213662chr1722432 1917 12190 ----