TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548ar-3p
miRNA Sequence: UAAAACUGCAGUUAUUUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr862400 990 508 389 381 375 ------
NM_000112chr5104743 4482 4464 4203 1826 1267 834 539 501 209 11128 14415 --
NM_000248chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_000259chr15136247 5663 4989 4978 4631 4375 2183 2143 1687 1594 1007 615 464 --45994 2276 2254 1438 1731
NM_000267chr1793058 2903 2885 2576 1337 810 755 382 130 12877 12892 --
NM_000332chr687072 6367 6176 4689 2466 1998 1952 1793 25748 2034 36405 5987 1574 --
NM_000368chr974594 3313 3033 1811 579 447 421 34551 2970 1895 1162 --
NM_000489chrX42877 1171 1124 99 43460 1234 487 135 12238 --
NM_000555chrX97246 5864 5553 5537 2038 1387 1090 752 105 16158 11174 --
NM_000633chr1874918 4894 4820 4083 3657 1674 1504 11511 --14311
NM_000719chr1286512 1806 1797 1672 1593 883 764 746 25450 956 1758 --
NM_000788chr461213 934 534 383 171 103 1506 ----
NM_000813chr595573 5325 5201 5113 4877 4121 928 920 200 14955 24498 3632 --
NM_000814chr1583080 1431 757 533 495 434 312 70 13477 14116 --
NM_000875chr15147021 6755 6531 6490 6182 5895 5702 5284 4595 2599 2480 2447 2367 400 26398 75 ----
NM_000901chr452488 2206 2022 333 118 41588 1575 1553 316 11603 --
NM_000945chr252023 1972 1937 1577 1397 11417 --1469
NM_001001323chr1272291 1285 1078 1049 672 592 270 --22987 2447 --
NM_001001396chr194311 3287 3272 3247 2857 2844 1520 996 281 14414 11168 --
NM_001001419chr574240 3994 1949 1009 578 427 383 45162 3961 2087 516 21785 870 11090
NM_001001420chr574240 3994 1949 1009 578 427 383 45162 3961 2087 516 21785 870 11090
NM_001001928chr2276293 6005 5829 2584 1927 1577 1488 18350 28335 3172 11405
NM_001002257chr273605 3527 3450 3362 760 715 684 33499 1385 1105 ----
NM_001002926chr782846 2344 2045 704 510 459 261 100 --125 --
NM_001003652chr18198459 8169 7563 7429 6545 6305 6247 6149 5970 2838 2703 1657 1488 1378 1326 1244 1102 657 366 16073 28690 6633 --
NM_001003674chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_001003675chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_001003712chr1243505 1287 1213 628 1434 13845 13092
NM_001004065chr994009 3891 3465 3047 3008 2606 1523 756 435 13938 11533 --
NM_001004317chr663581 2864 1629 1019 551 434 24447 413 --13535
NM_001005375chrY61596 418 301 150 129 109 1232 ----
NM_001005404chr1774529 4348 3652 3629 1714 888 237 --23776 3300 11087
NM_001005473chr594632 4189 4048 4041 2419 1663 1182 561 471 24446 2317 --24306 4058
NM_001006600chr542387 2137 2014 225 11790 1762 1960
NM_001007278chr1385054 4749 4331 4291 4055 2016 2002 945 11993 22076 24 13336
NM_001008239chr1853666 3153 2982 2675 1326 33191 2692 1098 21449 345 --
NM_001008408chr7116436 5847 5116 4946 4522 4231 2424 1845 644 376 248 14882 ----
NM_001008495chr8102264 2177 1999 1867 1778 1759 1535 460 346 120 --11727 1394
NM_001008726chr1421126 39 21580 33 1355 11349
NM_001008925chr473372 3183 3112 2972 741 729 94 --33222 901 427 --
NM_001009554chr464152 4037 3119 1467 427 418 11571 --22875 440
NM_001009554chr464152 4037 3119 1467 427 418 11571 --22875 440
NM_001010000chr1843246 2176 719 497 11328 13263 13338
NM_001010888chrX104582 4411 4339 4110 3885 3780 3367 821 719 377 11128 14500 --
NM_001010891chr576668 6184 5959 1198 916 705 388 46498 4474 2104 1445 15924 1729
NM_001011537chr341555 724 630 138 --12185 1710
NM_001011666chr755860 5413 2518 2126 2043 21892 1022 34304 605 240 12051
NM_001012968chrX72492 2444 1887 1750 878 430 152 ----11720
NM_001014380chr13145465 4961 4783 4259 4028 3983 1958 1875 1732 1486 1410 1319 1112 106 25170 1796 1341 --
NM_001014797chr10107393 7386 7270 6828 6032 5196 2917 2477 1156 767 25407 1109 ----
NM_001015877chrX43073 3060 219 212 12339 12933 12728
NM_001018067chr154531 3847 1346 860 341 53246 846 541 432 410 35290 5252 201 11474
NM_001018068chr154531 3847 1346 860 341 53246 846 541 432 410 35290 5252 201 11474
NM_001018069chr154531 3847 1346 860 341 53246 846 541 432 410 35290 5252 201 11474
NM_001025076chr10125576 4681 3817 2026 1885 1559 1424 966 548 520 472 188 --25461 3910 11722
NM_001025077chr10156934 6039 5175 4633 2917 2782 2324 1906 1878 1830 1546 1320 1103 666 174 --26819 5268 --
NM_001025079chr363839 2816 2637 1641 340 164 24186 4173 23435 238 13306
NM_001025108chr2103692 3167 3016 2731 2694 2601 1306 1265 834 239 --34124 3935 1330 --
NM_001025580chrX104279 4144 3901 3538 3090 2995 1708 459 250 112 11227 1428 --
NM_001029863chr663203 2527 2360 817 385 57 --1141 --
NM_001029884chr672698 2605 2526 1821 1804 540 265 22394 363 ----
NM_001030055chr1474720 4432 4046 3689 3663 2988 1775 24576 1821 14376 --
NM_001031732chr483636 3439 2941 2863 2375 1276 1229 1055 ----11381
NM_001034841chr16105154 4981 4397 4016 3515 3411 1960 1462 1050 417 --35335 3779 360 --
NM_001034850chr561650 1614 1420 1140 1104 365 --1345 --
NM_001037165chr7118918 8330 7646 7524 6666 6620 5994 2742 1816 1159 574 --27308 1401 --
NM_001037172chr341227 1163 968 69 1884 --1996
NM_001039538chr283357 2711 2348 2300 1282 1174 734 475 12258 23211 1453 --
NM_001039547chr356595 6381 5998 5942 1113 37776 5019 2806 --17039
NM_001039590chrX53733 3578 3181 1498 470 --43718 3631 3566 3421 --
NM_001039591chrX53733 3578 3181 1498 470 --43718 3631 3566 3421 --
NM_001039618chr11135256 5209 4659 4544 4302 4076 3962 3883 1801 800 616 360 212 --24917 2358 --
NM_001039693chr283683 2773 1598 1516 1020 1013 941 696 --11621 --
NM_001039840chrX74290 2305 2087 1599 1232 1080 493 23774 438 15337 --
NM_001040284chr16115927 5842 5462 5149 4361 4354 2309 2284 2127 1947 614 --14309 --
NM_001040665chr764092 3562 3196 1863 695 147 ----11127
NM_001042355chr1664667 3642 978 742 622 222 65034 4535 3453 1461 1344 442 1546 --
NM_001042412chr1664667 3642 978 742 622 222 65034 4535 3453 1461 1344 442 1546 --
NM_001042453chrX61757 1540 1261 1255 1217 217 --11342 --
NM_001042492chr1793058 2903 2885 2576 1337 810 755 382 130 12877 12892 --
NM_001042555chr1274340 1926 989 965 930 775 41 23169 1643 1851 --
NM_001042599chr296954 6394 4821 2371 1081 646 547 531 102 --14984 --
NM_001042601chr383226 2989 2939 2892 2798 882 244 101 2852 804 ----
NM_001042603chr1275120 4938 4522 3752 2137 1862 1780 --11733 --
NM_001042604chr364459 3118 3074 1194 987 204 23964 3198 33739 3485 598 --
NM_001099678chr3126180 6096 5758 5494 5424 4673 2243 1565 1272 1165 258 219 16158 1246 12392
NM_001100108chr1117319 5381 5223 2997 2849 2746 2489 2388 1977 1666 155 --12908 17923
NM_001106chr3139702 9650 9156 9051 8637 8161 6731 6319 3639 2710 2673 2092 850 49773 8294 6990 2655 38807 2265 197 18865
NM_001167chrX116658 6048 4994 4820 4628 2323 2262 1388 1213 1085 975 36512 2179 813 16489 --
NM_001173chr1474720 4432 4046 3689 3663 2988 1775 24576 1821 14376 --
NM_001186chr21103192 2782 2555 2436 2374 2177 2019 423 116 47 ------
NM_001201chr493839 3630 3567 3365 3352 2594 824 634 44 22454 623 13820 --
NM_001204chr2177635 7039 6794 6216 6160 5468 5460 5193 5134 2399 1651 833 519 441 350 340 205 36245 5685 2648 37183 2450 1361 16224
NM_001206chr962919 2911 2258 521 285 277 32764 2041 1115 --13032
NM_001304chr1773760 3073 2476 1378 902 490 439 12972 33600 2628 161 --
NM_001402chr661931 1723 1379 784 209 174 1357 --1197
NM_001419chr1964766 4717 4619 3361 1489 137 34674 1065 386 34391 2987 1532 --
NM_001682chr1262005 999 792 763 386 306 --22701 2161 --
NM_001684chr184028 3004 2989 2964 2574 2561 1237 713 14131 1885 --
NM_001695chr883801 3578 1628 1501 1307 1066 259 191 --21704 795 --
NM_001759chr12135294 5270 5141 4957 4644 3354 2070 1939 1931 1878 1679 1673 937 ------
NM_001777chr363839 2816 2637 1641 340 164 24186 4173 23435 238 13306
NM_001806chr1982914 2674 2495 925 873 802 567 208 31096 371 193 ----
NM_001858chr634152 3470 585 35078 3136 250 21600 749 --
NM_001938chr121203 719 21465 664 --11505
NM_002006chr475822 5518 4882 4543 1308 955 101 34348 3643 456 33711 3617 1262 --
NM_002025chrX139192 9047 7792 7745 7674 5749 2989 2690 2549 2312 2259 1111 809 23144 709 26433 1045 --
NM_002092chr4155066 4700 4518 4459 4243 3812 3783 3438 3172 3090 1819 479 361 193 88 21712 518 --1613
NM_002126chr1764086 3567 3556 3161 1607 43 --41078 977 563 437 --
NM_002158chr273744 3648 3265 2749 2650 140 133 2766 81 11259 --
NM_002210chr253042 2931 953 460 247 11347 13364 12350
NM_002270chr5105574 4137 2108 1923 1087 993 981 861 489 475 35201 4583 3778 24928 4910 25538 5274
NM_002285chr2103692 3167 3016 2731 2694 2601 1306 1265 834 239 --34124 3935 1330 --
NM_002336chr1244076 1905 1449 1245 21711 253 23350 1276 --
NM_002374chr283357 2711 2348 2300 1282 1174 734 475 12258 23211 1453 --
NM_002481chr177900 7873 7556 6816 6743 2852 1500 42541 1833 616 207 --1218
NM_002577chr353929 3460 1338 532 375 --13553 1660
NM_002581chr974289 4237 4039 3867 3475 2059 1423 14369 23991 3467 15506
NM_002655chr844907 2029 1650 501 23861 1307 34157 3442 3267 --
NM_002736chr752086 1971 804 484 108 1635 --1554
NM_002737chr17126669 6610 6491 6301 5672 5477 4268 1623 1506 1110 615 229 11402 ----
NM_002886chr3155062 4952 4787 4700 4511 4466 4156 3618 2076 2006 1923 1857 1753 1136 394 23331 473 ----
NM_002892chr1431416 690 30 --31384 1341 1187 --
NM_002959chr174232 4045 3296 1484 1429 1394 1249 33545 1785 1347 21718 1509 --
NM_003108chr2117281 6670 5817 5569 5304 5225 5174 5049 1407 1270 237 25762 807 26752 5563 --
NM_003161chr1732553 2358 93 ----21168 1110
NM_003262chr384400 1966 1531 1159 1151 449 413 188 35009 4231 314 1898 --
NM_003337chr581748 1072 684 613 501 374 267 132 193 ----
NM_003392chr374192 3530 1578 1503 1210 79 72 23586 3521 23309 2990 --
NM_003409chr1821349 295 --11289 21228 424
NM_003478chr1193272 3173 3034 2548 2325 2062 760 688 637 22998 2192 12153 --
NM_003566chr1273249 2855 2732 2645 862 615 575 ----11223
NM_003574chr18115802 5359 4985 4767 4434 4387 4176 2180 2078 813 542 34809 968 293 ----
NM_003590chr222900 683 23616 1056 --43895 3674 2887 2795
NM_003597chr2102208 1621 1492 835 467 375 221 207 197 136 --12170 11932
NM_003615chr393683 3644 3181 2579 1280 852 731 580 116 --13603 --
NM_003620chr173801 114 24 --1874 1139
NM_003672chr151916 718 601 533 477 21988 467 --21670 240
NM_003759chr483689 3377 3281 3014 2784 2638 1478 936 --21396 239 14219
NM_003774chr1263210 2437 2209 1183 410 233 1546 --12894
NM_003913chr683466 3026 2687 1442 1389 1315 856 64 --23722 3355 --
NM_003966chr5147813 7606 6721 6405 6039 3109 3015 2883 2063 1992 1327 1144 639 234 12790 ----
NM_004081chrY61596 418 301 150 129 109 1232 ----
NM_004124chr1462499 2338 1024 823 380 104 --22220 711 --
NM_004136chr1582966 2727 2563 2504 2343 724 523 348 ----13190
NM_004171chr1187735 6188 6078 5826 3472 3425 2600 836 11335 25997 3432 1594
NM_004232chr18113712 3508 2998 2593 2364 1264 1145 680 496 136 61 21009 214 13379 23236 114
NM_004261chr13937 282 78 1678 --1303
NM_004338chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_004362chr43673 505 280 1635 --1262
NM_004437chr1111301 1228 1191 1026 924 917 903 589 268 260 139 --12586 --
NM_004571chr2122942 2784 11055 --22927 62
NM_004586chrX135435 5338 5149 5084 4975 4943 4874 4853 4771 4380 3695 1328 381 --11265 --
NM_004612chr974457 4210 1558 1464 1306 785 476 23183 55 11601 13949
NM_004660chrY52090 2006 575 528 218 12294 1850 12188
NM_004736chr192035 1910 1852 1836 772 618 433 415 34 --1388 --
NM_004745chr857040 6795 1405 1086 1061 36896 6361 1748 24862 4361 --
NM_004760chr752503 2267 1996 1709 1638 22351 1880 11735 12282
NM_004775chr1842253 2139 2039 562 11769 32241 1946 397 --
NM_004817chr93657 565 540 ----1795
NM_004859chr1752682 1185 970 219 68 2981 935 21937 860 --
NM_004866chr554832 4675 1743 1532 178 44700 4035 3765 1507 24013 3539 --
NM_004904chr755860 5413 2518 2126 2043 21892 1022 34304 605 240 12051
NM_004949chr1852176 1779 1347 1322 311 41755 853 781 774 11856 --
NM_004956chr784551 4314 4298 4214 2886 1493 503 300 ------
NM_004985chr12124010 4002 3642 3398 1618 1119 544 500 425 207 201 167 33004 1313 922 12960 --
NM_004992chrX127944 7428 7039 7015 5759 5423 5411 3146 3056 3014 2752 1952 --38279 3271 1967 --
NM_004992chrX127944 7428 7039 7015 5759 5423 5411 3146 3056 3014 2752 1952 --38279 3271 1967 --
NM_004993chr1471501 1335 1229 581 355 230 118 ----1977
NM_004999chr6103743 3385 3169 2875 1744 1187 965 763 751 552 23212 792 24146 1251 --
NM_005016chr125304 233 118 103 68 195 ----
NM_005036chr2276293 6005 5829 2584 1927 1577 1488 18350 28335 3172 11405
NM_005056chr1275364 5182 4766 3996 2106 2024 262 --11977 --
NM_005121chr1763516 3273 3150 2530 665 457 23501 967 --11046
NM_005156chr9175310 5055 4645 4325 4316 4138 4023 3639 2150 2003 1413 1368 1272 1216 1200 986 322 45086 4698 4164 4034 24968 3318 --
NM_005171chr1251259 1191 1101 1071 889 167 ----
NM_005235chr296954 6394 4821 2371 1081 646 547 531 102 --14984 --
NM_005339chr473787 3779 3438 2993 1735 1238 879 --1962 --
NM_005359chr18106296 5182 4531 4268 4255 2407 2271 1502 1022 849 32255 2009 1922 25335 1109 21934 617
NM_005461chr2021816 769 11946 --21771 591
NM_005497chr17146006 5435 4708 4536 4219 4157 3969 2246 2112 1341 1105 804 470 36 --36170 559 292 --
NM_005504chr12146617 6446 6112 5896 5815 5801 5768 5176 5106 4242 1228 910 320 115 35015 4086 734 ----
NM_005578chr385107 3790 2021 1668 1656 1551 1126 358 14473 21879 1070 --
NM_005596chr9135456 5200 4725 4378 3994 2329 2236 1859 1240 759 695 138 66 36309 6233 455 11003 --
NM_005665chr194946 4754 3394 3101 1842 1778 1440 951 821 34679 4634 945 21713 1484 --
NM_005711chr551089 1002 848 433 94 ----1778
NM_005725chr151915 1819 1748 531 386 ----1575
NM_005748chr1263178 3073 1061 623 455 284 52894 1186 875 605 121 ----
NM_005798chr1385054 4749 4331 4291 4055 2016 2002 945 11993 22076 24 13336
NM_005843chr261680 1446 1259 243 189 162 11728 11232 --
NM_005898chr1172678 2277 2189 2135 2097 1094 783 ----12636
NM_005901chr18198459 8169 7563 7429 6545 6305 6247 6149 5970 2838 2703 1657 1488 1378 1326 1244 1102 657 366 16073 28690 6633 --
NM_005903chr574240 3994 1949 1009 578 427 383 45162 3961 2087 516 21785 870 11090
NM_005935chr4115151 4918 4067 3637 1895 1762 1673 946 481 453 354 11949 13495 --
NM_006007chr9114132 3982 3811 3293 2980 2838 1670 1517 1320 1181 790 24429 109 11349 --
NM_006095chr444354 1424 909 337 23319 3234 24238 1374 --
NM_006106chr11101385 1366 1352 1119 1079 1061 879 778 722 393 12141 186 --
NM_006203chr545607 4056 1267 695 24933 1540 21483 172 21864 1597
NM_006252chr1186773 6589 6539 6066 5712 5656 5199 4737 4668 2995 2282 2222 1859 1736 1302 1255 530 378 15525 37379 6463 1223 --
NM_006282chr2054619 4496 1690 1398 448 2296 247 --1440
NM_006352chr162038 1935 1815 1799 550 350 11449 --1396
NM_006371chr365283 4545 4375 1790 1028 402 35138 4750 4412 --11277
NM_006393chr1074385 4183 3199 3107 3006 2783 944 --14465 --
NM_006420chr2083412 3066 3044 2543 2161 655 518 446 ------
NM_006451chr54799 417 209 37 ----126
NM_006544chr1485502 5212 4573 4124 3706 3689 1596 486 34226 1708 168 25909 439 --
NM_006547chr752048 1503 1350 758 107 11708 --1476
NM_006561chr10125576 4681 3817 2026 1885 1559 1424 966 548 520 472 188 --25461 3910 11722
NM_006599chr16128145 6571 6395 5621 5422 5095 2657 1917 1653 1204 784 307 --36792 1901 1357 1517
NM_006609chr252662 2183 474 415 219 --21841 889 --
NM_006620chr664287 3031 1531 722 640 411 34116 3440 1327 23099 353 --
NM_006628chr1553935 866 734 174 164 33161 1668 294 22841 1107 14333
NM_006654chr1274340 1926 989 965 930 775 41 23169 1643 1851 --
NM_006722chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_006731chr9115821 5756 5722 5044 4578 4560 4475 4199 3774 1267 329 15736 23799 1187 --
NM_006750chr16117813 7166 6487 6076 5322 5316 2438 2138 944 756 740 26551 5506 13229 --
NM_006777chrX72186 2004 1076 269 221 172 26 21099 457 12267 --
NM_006803chr861671 1579 1545 1436 1327 712 11556 --11846
NM_006815chr1291306 1257 1203 949 943 468 325 279 76 11173 11063 --
NM_006885chr1673846 3437 2886 1646 1493 1486 1467 23617 807 1566 1425
NM_006938chr183219 190 134 4949 817 213 127 175 --
NM_007006chr16113482 3429 3423 3107 1415 1305 1168 944 794 673 89 2863 99 ----
NM_007007chr12114762 4478 4363 3992 3822 3418 3198 3048 1147 339 75 1810 --11622
NM_007011chr15136593 6036 5877 5171 4728 2628 1965 1224 1061 552 300 262 203 ------
NM_007137chrX85460 5167 1909 1474 1169 1158 1038 252 31922 1143 622 13763 --
NM_007203chr994009 3891 3465 3047 3008 2606 1523 756 435 13938 11533 --
NM_007212chr151684 1535 442 312 132 --11416 12157
NM_007249chr13159477 8979 8951 8908 8690 7961 7219 5930 3030 2805 2467 2177 2156 1637 1350 13189 ----
NM_007350chr1284233 3916 667 598 327 166 126 31 24377 3764 14104 --
NM_012081chr573495 3408 3152 3076 2806 2739 1016 23230 3043 1281 --
NM_012164chr997091 7006 2508 1728 1048 969 657 505 52 22636 303 47245 6477 2939 2687 --
NM_012193chr1165455 4919 4244 1855 498 97 2492 79 --11213
NM_012218chr1941936 311 256 248 162 --1412
NM_012234chr363753 3559 3032 2449 2354 324 11002 33259 2457 463 --
NM_012262chr165256 5014 4825 3457 1434 1021 2721 566 14119 --
NM_012294chr753813 3520 3021 661 389 32656 406 103 23485 293 --
NM_012297chr452557 2021 1916 1605 566 12335 --11968
NM_012301chr7101938 1823 1797 1734 1609 1582 803 779 754 296 1729 ----
NM_012309chr1184190 3262 1979 1710 1591 1532 239 207 11540 ----
NM_012345chr1351788 1714 1671 1285 1190 ----11438
NM_012382chr594529 4126 3869 3114 1661 1503 1374 249 55 1694 ----
NM_012464chr452758 2512 2268 1129 309 ----11793
NM_013255chr7147395 6512 6401 6297 6134 5988 3430 3181 2773 1897 1739 1718 311 142 26322 1501 12572 --
NM_014011chr262427 1705 549 396 253 247 12305 ----
NM_014043chr361484 1456 1414 1229 297 198 ----11090
NM_014048chr1675022 4877 4855 3951 1762 596 197 --21968 67 --
NM_014055chr124452 210 162 130 127 --1443
NM_014141chr795109 1685 1621 1279 1005 921 705 343 206 35370 5095 1883 1555 --
NM_014155chr1197499 7030 6059 5323 5254 5128 2564 1649 275 12830 31070 295 68 --
NM_014253chrX102411 2376 1990 1757 1716 1651 887 845 354 75 12475 1260 --
NM_014331chr4107853 6693 6116 4863 2116 1030 985 789 746 368 46783 5135 713 383 ----
NM_014423chr555096 3560 1647 343 110 24987 1474 24613 2015 --
NM_014615chr16113514 3071 2625 2522 1084 931 913 816 732 409 253 --1234 --
NM_014682chr842252 2073 1738 334 1453 1741 11797
NM_014702chr683348 2404 1186 1106 933 904 432 212 ------
NM_014721chr6107260 7160 6822 6337 5332 2898 2790 2738 1881 1279 15906 --17146
NM_014735chrX31300 810 168 --42088 1445 860 145 --
NM_014755chr274083 4000 3350 3040 2842 575 138 24278 366 11679 --
NM_014765chr122329 461 12122 22070 328 12671
NM_014803chr1052887 2801 2682 583 198 32631 2391 1171 12747 --
NM_014829chr562113 2077 1796 1513 509 67 21532 908 1566 12202
NM_014830chr12123915 3817 3590 3379 3289 2820 2685 2398 1462 1271 395 261 2338 320 ----
NM_014873chr194620 4353 4325 4298 3440 1698 1649 1018 998 ------
NM_014877chr17187673 7632 7590 7220 6871 6758 6632 6626 6210 5901 5409 4768 2973 1947 1624 1583 1465 949 45650 4866 571 512 12237 --
NM_014903chr1262308 2208 2191 2069 849 196 31747 720 656 11905 --
NM_014904chr1082959 2491 1542 1535 1132 743 446 387 1137 ----
NM_014947chr13661 337 275 --43002 2753 437 395 --
NM_014953chr1344223 3736 1124 92 14132 13641 14214
NM_014962chr2081980 1912 1002 853 784 677 455 233 --1301 --
NM_015026chr1274282 3991 3564 2966 1037 761 303 --23684 1545 --
NM_015076chr674240 3966 3905 3492 3299 926 564 21139 411 ----
NM_015097chr32579 440 1762 11657 21691 117
NM_015144chr1673932 3862 3094 1213 742 690 682 1645 12791 --
NM_015199chr363021 1032 583 573 459 260 3560 170 157 ----
NM_015208chr18113758 3715 3542 3372 3259 2912 2479 1359 453 412 194 2493 360 1477 --
NM_015247chr1664667 3642 978 742 622 222 65034 4535 3453 1461 1344 442 1546 --
NM_015278chr653411 2415 912 793 786 22346 904 --12727
NM_015310chr888336 7786 5870 2387 1546 284 149 49 1403 17914 --
NM_015314chr752303 2065 1012 753 448 42366 2191 2098 698 12168 --
NM_015328chr772840 2814 1253 1111 1041 799 374 1772 22635 680 --
NM_015349chr672976 2314 1077 920 494 470 462 12590 ----
NM_015365chrX104279 4144 3901 3538 3090 2995 1708 459 250 112 11227 1428 --
NM_015436chr473191 3002 2931 2791 1353 560 548 --33041 720 246 --
NM_015458chr8135179 4815 3683 3502 1901 1717 1600 1299 1280 860 762 754 532 13258 14279 --
NM_015554chr1592949 2807 2387 1007 829 773 586 272 104 32834 2301 1979 ----
NM_015569chr184484 3956 1501 1269 1230 717 577 312 13189 --2889 124
NM_015640chr154531 3847 1346 860 341 53246 846 541 432 410 35290 5252 201 11474
NM_015878chr872076 1498 680 655 617 482 224 11705 1340 --
NM_015879chr1838511 2203 328 35981 2102 160 --15649
NM_015886chr895366 5341 4947 3968 3943 3490 2055 1716 1494 15606 ----
NM_015906chr184863 4702 4651 3935 3606 3106 831 568 34798 3473 602 1896 --
NM_016132chr1573144 3065 1320 676 302 215 186 2450 433 1312 1800
NM_016142chr1131135 516 76 1923 --2497 329
NM_016206chr3158680 7358 7205 5866 5642 5440 2088 1581 1560 1184 735 706 283 141 73 ------
NM_016248chr13133896 3553 3101 2710 2653 2617 2441 1176 993 749 621 505 281 ----13660
NM_016260chr2137171 6971 5800 5453 5167 4957 2879 2804 1061 874 783 707 383 47298 6640 4991 2781 17607 --
NM_016271chr1882368 1992 1781 1759 1456 941 862 124 --11540 12308
NM_016272chr2262767 2728 2666 2558 379 279 1241 11076 --
NM_016275chr372602 2352 2277 2214 518 509 422 12422 11091 --
NM_016485chr63873 702 104 --1177 188
NM_016507chr17113178 3017 2816 2807 2781 2650 2457 1237 449 388 342 ------
NM_016530chr1563918 3225 3047 2522 1099 1009 21110 866 11212 --
NM_016542chrX61757 1540 1261 1255 1217 217 --11342 --
NM_016544chr263905 3738 3466 2947 2479 80 --13238 23595 3022
NM_016626chr1851571 1136 563 243 198 11749 21304 446 --
NM_017447chr21133848 3815 3589 3568 3157 3150 3101 3022 2988 2835 1684 1482 1188 ------
NM_017563chr395265 4868 4476 2170 2156 2037 2023 1285 990 14137 ----
NM_017628chr4105240 5065 4429 3635 1626 1620 1157 1079 1040 347 15031 1114 --
NM_017629chr111289 41902 559 550 540 ----
NM_017637chr967555 3467 3450 641 486 220 59242 8330 3557 2735 1535 1346 --
NM_017644chr375147 4074 1888 1518 1040 756 519 152 11379 1462
NM_017658chr1474482 4152 3536 3328 882 164 135 44542 3573 579 286 44387 3757 773 71 --
NM_017709chr153909 3595 3397 3161 3137 --13151 --
NM_017736chr1673105 2742 2153 1080 452 355 335 12286 2162 92 --
NM_017753chr92869 803 --1754 1325
NM_017769chr1472967 2826 2635 2503 2494 2165 174 --13108 --
NM_017813chr8105716 5325 5148 5055 4561 4405 1655 1381 834 807 24412 4190 15436 14175
NM_017824chr1072456 1930 1010 828 818 781 262 11864 22208 1777 --
NM_017944chr1163119 2451 1183 1063 976 35 142 --11029
NM_018015chrX21066 423 --11151 1133
NM_018017chr1052814 2340 2039 672 603 42757 2686 809 484 --1525
NM_018084chr253053 892 769 610 57 1242 --11153
NM_018126chr431295 1283 181 41563 1361 1024 499 1252 11260
NM_018155chr3112548 2425 2339 1124 1073 971 909 660 288 131 99 22865 2624 13251 --
NM_018279chr1272836 2806 2559 1008 553 447 316 --12427 12316
NM_018313chr382092 468 433 365 358 343 324 247 32263 592 281 ----
NM_018351chr1274676 4466 4061 3946 3342 1775 1020 ----13029
NM_018362chr1152640 655 589 353 50 13799 33924 1482 447 --
NM_018364chr164095 3967 3931 3448 2721 526 42948 2693 85 62 --1980
NM_018374chr773770 3517 1596 1589 1556 1170 678 34828 3971 1186 13426 --
NM_018403chr393858 3251 3096 2703 1646 1506 1495 487 446 24142 935 13514 --
NM_018429chr542653 2368 2269 1810 12415 12012 11069
NM_018437chr93503 376 52 ----1460
NM_018440chr8148600 8431 8217 8124 6881 6763 6543 5547 2870 2757 2463 1258 390 159 15420 --28728 728
NM_018566chr1144801 4763 3952 3347 3285 3135 1933 1927 1796 1478 1383 1219 1040 60 11183 24640 925 --
NM_018638chr12135090 4886 4342 4230 3841 2264 2099 1325 1027 1014 987 379 250 35409 5014 389 14196 1784
NM_018695chr542387 2137 2014 225 11790 1762 1960
NM_018947chr774945 1946 1767 1137 1068 1019 485 23700 323 23815 182 13724
NM_018970chr72706 684 --22414 1958 21208 110
NM_018999chr1094859 4612 4436 4157 2992 1557 871 389 229 11286 13378 --
NM_019000chr561650 1614 1420 1140 1104 365 --1345 --
NM_019001chr364459 3118 3074 1194 987 204 23964 3198 33739 3485 598 --
NM_019050chr461832 1823 1804 1755 1573 690 12122 11974 --
NM_019087chr551507 1155 675 457 54 ----11209
NM_020122chr2115783 5560 4410 4278 2319 2094 1950 1069 956 780 380 22062 401 31766 1288 1221 --
NM_020193chr1151191 1130 1045 496 414 --21285 293 11202
NM_020337chr462759 2652 982 640 618 594 12955 12047 --
NM_020342chr242167 1896 958 672 22050 1711 --11989
NM_020420chrY61596 418 301 150 129 109 1232 ----
NM_020466chr684278 3919 3742 3227 3060 3047 1900 1262 --13275 --
NM_020475chr862337 927 445 326 318 312 ------
NM_020476chr862337 927 445 326 318 312 ------
NM_020477chr862337 927 445 326 318 312 ------
NM_020478chr862400 990 508 389 381 375 ------
NM_020480chr862337 927 445 326 318 312 ------
NM_020651chr271695 1491 1387 363 356 222 58 11428 185 --
NM_020673chr2087649 7062 7056 2747 1894 1392 456 299 13028 37364 1010 84 35769 5419 5374
NM_020718chr1695624 2378 2263 2214 2197 1665 1320 1222 339 35801 4113 1902 16229 --
NM_020727chr21134005 3802 3769 3447 3310 2910 1455 1277 1065 726 444 326 319 43847 3471 3434 1251 ----
NM_020734chr1273151 2891 1198 717 507 500 354 ------
NM_020772chr17137865 7840 7054 6147 5952 5542 2593 2208 1870 1610 1204 284 267 45511 5303 2223 510 11584 17425
NM_020774chr18105388 5064 4921 2147 2061 1853 1610 1440 669 108 56265 5958 5952 3791 380 21484 850 --
NM_020782chr1274867 4296 3965 1524 1500 406 42 --24459 3922 --
NM_020810chr1443653 3085 2910 88 23517 2933 1754 1571
NM_020841chr1243505 1287 1213 628 1434 13845 13092
NM_020871chrX112447 2163 2104 920 763 742 469 436 301 98 32 ------
NM_020918chr1053657 3409 2360 1327 645 13232 1907 1480
NM_020921chr1483356 3349 845 458 314 308 299 137 --1288 --
NM_020948chr183627 3477 3253 1004 830 484 381 101 22377 1433 13558 --
NM_021148chr782375 821 814 808 793 749 691 96 21675 1006 12020 --
NM_021163chr783556 2738 2358 1123 760 713 683 451 1238 1587 --
NM_021190chr171352 1318 1250 868 537 429 248 --11012 11091
NM_021252chr1061967 1915 1281 735 188 95 21458 654 1203 --
NM_021255chr14103856 3628 3417 3359 1466 1054 941 534 300 288 --13844 11619
NM_021647chr464152 4037 3119 1467 427 418 11571 --22875 440
NM_021813chr6165788 5644 5632 5023 4864 4184 2338 2228 1911 1576 1563 1271 869 790 727 591 2695 410 15441 --
NM_021911chr595573 5325 5201 5113 4877 4121 928 920 200 14955 24498 3632 --
NM_021912chr1583080 1431 757 533 495 434 312 70 13477 14116 --
NM_021961chr1186562 6221 6143 4905 4620 2453 1659 1276 --26811 2862 11085
NM_021964chr3125604 4388 4209 4120 2216 2184 1915 1880 1863 794 734 375 1803 46563 2516 2379 1461 15975
NM_022048chr15126152 6131 4963 4808 4609 4603 4577 2438 1062 759 354 342 1825 --15791
NM_022459chr13115759 5145 4928 4696 4246 4240 4033 1270 782 592 552 22223 632 36030 5689 1505 14612
NM_022473chr1573851 3420 3376 3363 502 357 320 33944 3653 196 11038 1453
NM_022474chr1451927 1882 1788 892 171 12512 31875 929 634 --
NM_022893chr222505 915 21008 715 12751 1518
NM_022898chr1494560 4225 3941 3928 3468 1293 821 602 242 --33063 1571 567 --
NM_023000chr1431416 690 30 --31384 1341 1187 --
NM_023001chr1431416 690 30 --31384 1341 1187 --
NM_023016chr252801 2769 2550 2389 789 --1361 1637
NM_023929chr891966 1768 1762 1726 1036 996 845 433 417 22615 2279 ----
NM_024422chr1841968 1571 683 103 41547 645 573 566 21648 752 --
NM_024524chr392879 2737 2486 931 879 351 338 325 100 42626 2035 648 619 12689 --
NM_024624chr261548 1443 644 387 324 244 1228 1597 --
NM_024665chr3154467 3811 3710 3293 2859 1211 994 986 825 752 528 460 414 259 182 23565 1833 34500 3934 324 --
NM_024721chr872570 2511 1742 973 798 662 385 12424 11821 1606
NM_024744chr272482 2074 2032 1023 1011 295 110 ------
NM_024824chr1451672 1660 532 44 35 2185 126 1593 --
NM_024920chr441421 1245 643 417 ----1294
NM_024947chr3119156 8031 3826 3818 2528 2427 2029 1213 1016 582 406 26415 2745 48216 5925 683 639 29209 35
NM_024949chr4104881 4757 4409 3700 1963 1858 1460 1219 366 94 --14359 --
NM_024989chr2137651 6657 6389 6326 6247 6191 5194 3023 799 516 421 180 144 21611 1327 27348 2843 11432
NM_025054chr863970 3045 2859 2853 1574 1058 23931 3342 13275 --
NM_025073chr154648 4586 3498 1130 963 24684 4295 21022 809 --
NM_025146chr392561 2507 2411 1924 1856 1714 606 439 252 22466 153 12645 --
NM_030625chr1032361 967 283 32056 228 220 ----
NM_030627chr5104088 3895 3787 3718 3595 3003 2629 1304 632 341 1231 1433 --
NM_030647chr7145834 5789 5691 5585 5404 5034 4930 3994 2130 1779 1297 983 450 93 25727 2364 24420 1406 --
NM_030648chr4125477 4960 4514 3967 1864 1462 1323 1267 1173 517 356 331 --14619 --
NM_030650chr283981 3728 2601 1509 1364 1055 851 697 11038 11440 --
NM_030660chr1471501 1335 1229 581 355 230 118 ----1977
NM_030751chr1031892 1433 1268 21603 1356 21640 243 11703
NM_030751chr1031892 1433 1268 21603 1356 21640 243 11703
NM_030816chr173405 2740 2677 2653 1341 232 176 ----1953
NM_031431chr1331338 1167 594 --11514 11770
NM_031438chr531738 495 122 ----21678 266
NM_031845chr283357 2711 2348 2300 1282 1174 734 475 12258 23211 1453 --
NM_031847chr283357 2711 2348 2300 1282 1174 734 475 12258 23211 1453 --
NM_031942chr251007 977 877 275 203 ----1302
NM_031989chr125304 233 118 103 68 195 ----
NM_032116chr13145465 4961 4783 4259 4028 3983 1958 1875 1732 1486 1410 1319 1112 106 25170 1796 1341 --
NM_032288chr341555 724 630 138 --12185 1710
NM_032321chr241240 993 648 42 23222 3021 1870 1802
NM_032373chr1085124 4817 4609 4211 3863 3662 1458 478 12167 44878 1326 1219 372 15450
NM_032457chr443669 1500 1447 1090 12997 --13889
NM_032458chrX43403 3390 549 542 12669 13263 13058
NM_032505chr322663 936 31053 626 103 21858 639 11776
NM_032859chr1353625 3137 2836 240 153 33497 1161 1079 12696 11129
NM_032864chr161569 622 558 345 160 106 --31387 502 192 --
NM_032932chr1786471 4653 4174 1583 1335 1243 887 854 ----1731
NM_032973chrY63632 3455 1357 781 493 406 --1500 --
NM_033020chr184863 4702 4651 3935 3606 3106 831 568 34798 3473 602 1896 --
NM_033224chr7116986 5994 5910 4979 2873 1834 1623 1469 1164 772 662 38052 4874 2238 --25575 812
NM_033285chr873999 3665 3378 3082 2955 1463 568 33908 1792 120 34472 4345 3885 --
NM_033360chr12134131 4123 3763 3519 2848 1739 1240 665 621 546 328 322 288 33125 1434 1043 13081 --
NM_033430chr4124120 3909 3822 3667 3598 3579 2919 1582 838 345 312 63 1969 --11627
NM_033437chr4124120 3909 3822 3667 3598 3579 2919 1582 838 345 312 63 1969 --11627
NM_033505chr276149 5936 5922 4833 4360 1996 909 16704 --12129
NM_033656chr21165946 5636 5561 5283 4726 4410 4339 3846 3676 2330 2198 2066 1058 982 611 375 34991 4051 1953 15971 14399
NM_052811chr1385054 4749 4331 4291 4055 2016 2002 945 11993 22076 24 13336
NM_052879chr1293280 2995 2898 2635 1514 1260 720 627 182 43828 3334 1492 278 13839 --
NM_052885chr1283677 1864 1553 1405 1279 784 740 109 34424 4416 3529 2873 452 14638
NM_052900chr83650 552 232 1191 --11587
NM_053016chr997497 7457 7421 7063 5491 5165 2140 1925 1542 22259 1454 21747 1327 --
NM_053042chr4103145 3123 2737 2228 1200 1108 928 579 540 39 12142 ----
NM_053043chr7116436 5847 5116 4946 4522 4231 2424 1845 644 376 248 14882 ----
NM_054016chr161852 1813 1238 185 115 53 ----21599 1337
NM_054016chr161852 1813 1238 185 115 53 ----21599 1337
NM_054016chr161852 1813 1238 185 115 53 ----21599 1337
NM_057175chr462609 1771 1655 980 642 199 --1664 --
NM_080666chr1421126 39 21580 33 1355 11349
NM_080867chr1494693 4546 4171 3294 1973 1438 1007 873 220 --14939 14130
NM_080927chr3102693 2607 2492 2312 2297 2263 2201 2087 2079 2060 21324 1025 11110 --
NM_130809chr572982 2655 2287 2083 1187 1028 106 --13122 --
NM_133334chr465365 5098 4237 1837 516 350 --14696 1546
NM_133370chr483636 3439 2941 2863 2375 1276 1229 1055 ----11381
NM_138270chrX42877 1171 1124 99 43460 1234 487 135 12238 --
NM_138288chr1452225 1886 830 764 439 --1212 1550
NM_138444chr1363922 3509 1461 1190 616 320 21275 539 24352 4170 11947
NM_138459chr643334 3247 1421 1399 22459 895 12706 --
NM_138554chr91383 --1645 12214
NM_138576chr1494560 4225 3941 3928 3468 1293 821 602 242 --33063 1571 567 --
NM_138713chr16128145 6571 6395 5621 5422 5095 2657 1917 1653 1204 784 307 --36792 1901 1357 1517
NM_138714chr16128145 6571 6395 5621 5422 5095 2657 1917 1653 1204 784 307 --36792 1901 1357 1517
NM_144567chr152459 2084 1717 504 450 32662 2621 245 --11064
NM_144571chr4136470 6352 5463 5389 5245 5019 4928 2636 2162 1406 1371 677 655 34442 2537 1585 ----
NM_144578chr1494736 4471 3941 3778 2019 1554 1377 1149 234 34752 4305 614 11602 --
NM_144599chr1575491 5348 4834 4107 2118 1940 450 24865 4025 24585 1475 --
NM_144949chr262427 1705 549 396 253 247 12305 ----
NM_145055chr1853666 3153 2982 2675 1326 33191 2692 1098 21449 345 --
NM_145117chr1143227 1028 1001 810 --22292 1022 13005
NM_145259chr266339 5336 4873 4862 1251 314 16665 26033 2180 15565
NM_145307chr10114588 4144 3987 3683 3248 2956 1553 1173 685 525 226 1420 --11139
NM_145808chr773125 2525 2472 2414 2265 2113 700 1680 ----
NM_145810chr251007 977 877 275 203 ----1302
NM_147150chr994009 3891 3465 3047 3008 2606 1523 756 435 13938 11533 --
NM_148174chr872076 1498 680 655 617 482 224 11705 1340 --
NM_152261chr1282320 2299 1949 692 438 423 287 207 1537 ----
NM_152282chr341227 1163 968 69 1884 --1996
NM_152332chr1442652 2093 1806 842 --21033 948 --
NM_152384chr272050 2017 1974 543 126 85 46 --21931 168 --
NM_152409chr593303 2812 2418 2308 1373 1260 458 349 127 2873 68 ----
NM_152424chrX63891 3079 1173 1075 149 137 --21447 237 13561
NM_152519chr241847 1504 624 483 21389 850 --1889
NM_152594chr1541950 1822 1558 892 ----21883 486
NM_152622chr583328 2879 2513 2497 2199 877 818 612 33264 1141 505 1784 11182
NM_152624chr586462 5181 2489 2313 2052 1793 1016 386 56604 1306 877 539 273 --17474
NM_152737chr671833 1730 1589 820 813 573 148 --1591 --
NM_152756chr594301 4244 3989 3317 3046 1169 861 705 292 --11404 1235
NM_152787chrX83782 3078 2850 2721 2534 1436 797 376 12995 --12448
NM_152924chr15136593 6036 5877 5171 4728 2628 1965 1224 1061 552 300 262 203 ------
NM_152999chr764092 3562 3196 1863 695 147 ----11127
NM_153184chr361860 1219 561 382 338 309 21706 26 ----
NM_153188chr5105574 4137 2108 1923 1087 993 981 861 489 475 35201 4583 3778 24928 4910 25538 5274
NM_153207chr1294080 3847 3769 3247 3224 3043 1496 858 362 --21531 767 --
NM_153256chr1061864 1818 1517 1218 610 555 --1565 --
NM_153634chr1241565 1121 106 97 1441 21154 1136 --
NM_153686chr462472 1986 1909 1849 1774 802 2301 281 22361 679 --
NM_153687chr1221454 628 11433 11363 11351
NM_170710chr42771 528 11181 1607 12948
NM_172071chr186732 2573 1334 1192 1115 1059 373 43 24639 669 26319 1918 12959
NM_173214chr16128145 6571 6395 5621 5422 5095 2657 1917 1653 1204 784 307 --36792 1901 1357 1517
NM_173468chr4165790 5446 5329 5124 4909 4614 4186 3922 2124 1401 1257 1234 969 514 262 244 24323 3974 --21471 1436
NM_173536chr4114973 4967 4629 3911 3670 3485 1597 1522 1179 1077 496 45045 3399 1454 1269 34655 1963 1093 11037
NM_173582chr1186184 5767 5656 3951 1132 573 546 304 16293 35694 5485 5010 12448
NM_173642chr1116302 3520 2674 1913 1610 1218 948 866 777 172 54 ------
NM_173797chr53405 295 51 --11226 11171
NM_173808chr194233 3871 3700 3497 2981 2793 1519 335 73 14392 ----
NM_173829chr585950 5516 5461 2443 2227 1770 1739 1031 55685 3913 2030 985 625 21814 498 --
NM_175624chr12117651 5725 5551 4753 2725 2632 1785 1442 1238 1232 1010 12738 ----
NM_175625chr12117651 5725 5551 4753 2725 2632 1785 1442 1238 1232 1010 12738 ----
NM_175876chr142642 1998 971 93 31083 757 745 --1290
NM_178151chrX97246 5864 5553 5537 2038 1387 1090 752 105 16158 11174 --
NM_178152chrX97246 5864 5553 5537 2038 1387 1090 752 105 16158 11174 --
NM_178153chrX97246 5864 5553 5537 2038 1387 1090 752 105 16158 11174 --
NM_178815chr1082635 2327 2197 1921 1869 1750 1740 860 12528 ----
NM_181265chr42771 528 11181 1607 12948
NM_181358chr184166 4030 3427 2859 2747 1577 1225 148 24198 899 22780 575 --
NM_181443chr2081980 1912 1002 853 784 677 455 233 --1301 --
NM_181481chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_181482chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_181483chr1896690 6151 5923 5251 5185 2776 1979 916 88 11572 35861 4835 2451 --
NM_181504chr513557 13460 32843 1021 883 1846
NM_181521chr16196983 6915 6185 5976 5967 5581 4702 2700 2646 2613 2577 2555 2278 2019 1282 1272 1217 712 57 12759 27162 4668 --
NM_181523chr513557 13460 32843 1021 883 1846
NM_181524chr513557 13460 32843 1021 883 1846
NM_181705chr595738 5596 4917 4506 3570 1011 653 530 352 25785 3611 23795 587 --
NM_181836chr562624 2530 2194 1669 1019 641 ----1468
NM_182485chr463691 3611 3393 3379 2603 364 43206 1130 944 719 ----
NM_182503chr6105451 5050 4632 4500 3866 1625 1495 1328 777 372 44897 4879 1389 254 ----
NM_182551chr273605 3527 3450 3362 760 715 684 33499 1385 1105 ----
NM_182646chr463691 3611 3393 3379 2603 364 43206 1130 944 719 ----
NM_182789chr54799 417 209 37 ----126
NM_182898chr755860 5413 2518 2126 2043 21892 1022 34304 605 240 12051
NM_182899chr755860 5413 2518 2126 2043 21892 1022 34304 605 240 12051
NM_182964chr1143227 1028 1001 810 --22292 1022 13005
NM_183323chr54799 417 209 37 ----126
NM_194071chr795418 5252 5126 4391 3980 1501 1333 1292 810 15010 --14704
NM_194247chr2113915 3754 3719 3669 1490 1101 877 750 555 445 207 44190 3870 2907 1415 21720 406 --
NM_194314chr184843 4658 4320 3799 1400 665 124 103 45526 3576 1519 766 11413 11392
NM_194434chr18115802 5359 4985 4767 4434 4387 4176 2180 2078 813 542 34809 968 293 ----
NM_197978chr93503 376 52 ----1460
NM_198123chr83650 552 232 1191 --11587
NM_198124chr83650 552 232 1191 --11587
NM_198128chr1882368 1992 1781 1759 1456 941 862 124 --11540 12308
NM_198158chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_198159chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_198177chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_198178chr373081 2232 2208 1898 1034 1005 80 12466 2735 708 11981
NM_198181chr1582586 2509 2313 636 208 178 150 120 --12824 --
NM_198268chr184166 4030 3427 2859 2747 1577 1225 148 24198 899 22780 575 --
NM_198269chr184166 4030 3427 2859 2747 1577 1225 148 24198 899 22780 575 --
NM_198270chrX93436 3028 2421 2313 1325 1150 1057 236 187 32637 2300 1337 ----
NM_198465chrX72879 2762 2513 2307 679 635 280 42741 2492 1924 149 1605 192
NM_198468chr694481 3938 3823 3514 1787 1210 1081 1003 875 24574 1688 ----
NM_198581chr297330 6938 5657 2267 2232 2143 1876 355 84 17316 ----
NM_198793chr363835 2812 2633 1637 336 160 24182 4169 23431 234 13302
NM_199072chr773078 3006 2632 2390 2025 2002 373 1206 ----
NM_199188chr1293280 2995 2898 2635 1514 1260 720 627 182 43828 3334 1492 278 13839 --
NM_199190chr1293280 2995 2898 2635 1514 1260 720 627 182 43828 3334 1492 278 13839 --
NM_199421chr1494693 4546 4171 3294 1973 1438 1007 873 220 --14939 14130
NM_201629chr93657 565 540 ----1795
NM_203341chr131010 355 151 1751 --1376
NM_203342chr1111301 1228 1191 1026 924 917 903 589 268 260 139 --12586 --
NM_203343chr1111301 1228 1191 1026 924 917 903 589 268 260 139 --12586 --
NM_203504chr452557 2021 1916 1605 566 12335 --11968
NM_203505chr452557 2021 1916 1605 566 12335 --11968
NM_205768chr162038 1935 1815 1799 550 350 11449 --1396
NM_206853chr674082 3691 3028 1278 1005 987 832 13851 1933 13089
NM_206854chr695343 4952 4289 3538 3427 2093 761 516 187 35112 3487 3449 --14350
NM_206855chr6126308 5917 5254 4503 4392 3945 3917 1726 1481 1152 530 198 56077 4452 4414 865 273 --25315 61
NM_206866chr21103192 2782 2555 2436 2374 2177 2019 423 116 47 ------
NM_206909chr888336 7786 5870 2387 1546 284 149 49 1403 17914 --
NM_207299chr92869 803 --1754 1325
NM_207303chr1063423 3295 2589 1305 1292 122 44024 3413 2677 173 2383 211 --
NM_207352chr471866 1850 1712 677 505 172 165 11115 ----
NM_207361chr1375780 5246 5165 4393 3922 487 436 36142 4089 2195 11742 --
NM_207396chr131423 1318 86 --11333 11810
NM_207406chr476419 5921 4666 1465 1407 1355 750 15842 1727 --
NM_207660chr1451672 1660 532 44 35 2185 126 1593 --
NM_207661chr1451672 1660 532 44 35 2185 126 1593 --
NM_207662chr1451672 1660 532 44 35 2185 126 1593 --
NM_213589chr284518 4056 3706 2127 2050 1899 1366 1229 23448 2135 12182 12044
NM_213590chr1385054 4749 4331 4291 4055 2016 2002 945 11993 22076 24 13336