TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548ar-5p
miRNA Sequence: AAAAGUAAUUGCAGUUUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr14590 558 225 148 1526 2625 262 --
NM_000024chr54452 195 188 176 1471 1145 --
NM_000038chr561628 1517 628 516 294 161 21487 686 21717 181 1522
NM_000051chr1143505 3238 647 197 33477 82 51 42956 2295 1050 62 33540 1138 923
NM_000052chrX153479 3257 2617 2184 2164 1367 1314 1178 690 586 531 390 314 214 191 43272 3108 2878 2485 23034 621 43434 3350 3299 2193
NM_000055chr33337 321 32 1157 ----
NM_000059chr132780 186 2803 549 2886 833 --
NM_000074chrX1943 --1948 --
NM_000081chr151757 1721 1295 1144 717 51408 1163 547 404 192 31544 616 499 --
NM_000084chrX116522 6004 5659 5277 4951 4278 2443 2090 671 620 496 1943 55919 2332 1957 449 272 26952 1953
NM_000088chr1751328 1005 989 291 139 --11366 --
NM_000089chr75766 647 611 581 121 ------
NM_000090chr24861 698 199 107 --1211 --
NM_000091chr292662 2456 2274 1856 1038 980 81 72 30 32844 2810 1889 12488 12886
NM_000092chr2114154 3129 1824 1775 1734 1560 1336 878 736 495 262 33378 1761 508 33823 3715 1379 21724 232
NM_000093chr932229 943 380 --12268 --
NM_000094chr31128 ------
NM_000097chr31348 1396 2469 400 11067
NM_000108chr761678 1567 508 266 190 22 1173 1406 --
NM_000109chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_000110chr141111 1004 988 965 ------
NM_000111chr72249 102 ------
NM_000112chr5105476 5392 5345 4828 4271 4212 4198 4080 2072 1336 21396 814 74990 4699 3554 2077 1776 1472 1087 --
NM_000125chr694044 3374 3360 2708 2646 2611 1594 1570 148 1645 34187 3247 810 --
NM_000138chr15112258 2224 2198 1881 1842 1017 612 373 350 327 63 --12485 --
NM_000142chr421467 1169 11078 11142 --
NM_000151chr1751897 1766 1547 1372 501 21929 1878 ----
NM_000152chr17----1525 --
NM_000163chr542282 2092 2059 440 31682 578 220 22394 522 --
NM_000165chr641452 1396 564 367 --11090 --
NM_000167chrX81841 1682 1124 706 674 588 573 109 --41472 1427 713 444 --
NM_000168chr772384 2346 2217 1316 1165 860 715 1100 53303 2784 2369 2318 1105 22878 495
NM_000176chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_000179chr2----183 --
NM_000189chr261587 1537 808 779 347 105 --22243 1903 --
NM_000192chr1241354 1210 477 438 11194 11359 --
NM_000194chrX2509 180 1144 --1479
NM_000196chr161541 ------
NM_000210chr272062 1867 1809 1749 1722 821 228 --32232 839 439 --
NM_000214chr2051414 681 497 477 353 --21137 482 --
NM_000217chr12145370 5318 5172 4522 4094 3898 3313 3302 1649 579 522 341 249 213 35149 1020 104 22069 1758 23329 891
NM_000222chr442015 1875 1740 1345 --21934 68 --
NM_000230chr741071 953 492 177 --11895 1790
NM_000233chr26884 701 655 582 296 104 --1109 --
NM_000237chr841709 1210 698 445 1369 --1156
NM_000240chrX52235 1584 664 657 202 ------
NM_000242chr1082664 2548 2316 2235 2152 467 288 216 22624 2144 32731 2499 335 12332
NM_000245chr731502 673 130 --11521 --
NM_000248chr372835 2469 2135 1992 1111 1014 888 4750 187 146 123 71216 894 840 834 818 754 150 1830
NM_000251chr2----1176 --
NM_000252chrX31044 576 311 --31388 1066 401 21285 340
NM_000255chr62139 107 --1323 2126 42
NM_000259chr15186037 6004 5814 5637 5466 5458 5449 4395 4337 4277 4157 4002 2197 2107 990 866 154 61 25922 1514 35738 5213 955 22175 321
NM_000264chr993357 3279 3005 2687 2623 2435 2385 404 379 1449 52640 2417 2238 422 156 --
NM_000267chr1752132 1102 1032 877 212 1613 43133 3128 1038 760 --
NM_000268chr2233735 2942 1451 --12363 --
NM_000276chrX2217 181 ------
NM_000278chr1012025 ------
NM_000280chr111259 ------
NM_000289chr122344 301 ------
NM_000291chrX3991 627 263 1603 2831 645 --
NM_000297chr442057 1911 1835 589 11482 31626 654 382 1149
NM_000314chr1072712 2623 2577 2511 2342 1265 1078 --12270 22432 994
NM_000317chr112338 276 ------
NM_000318chr882726 2488 2131 2084 1065 842 755 613 --1360 --
NM_000321chr1371766 1492 1331 1160 406 343 193 21792 282 71718 1504 1461 1419 1112 720 618 21711 570
NM_000325chr41674 --1643 --
NM_000328chrX3320 174 161 1432 ----
NM_000329chr13587 348 175 2798 321 ----
NM_000332chr6187089 6984 5763 5663 5225 4840 4758 4472 2786 2598 2420 2391 2378 2132 2067 737 694 176 22021 621 65752 5382 4347 2766 1870 1236 25742 1845
NM_000337chr5146506 6497 5320 5162 4473 4212 4136 2329 1847 1835 1765 1447 1102 75 --31704 1471 1056 34529 4524 1715
NM_000338chr153816 782 363 169 2936 807 --
NM_000340chr36961 545 515 262 182 160 --41490 532 229 111 11412
NM_000345chr441018 900 311 293 --1983 1892
NM_000346chr1771862 1713 1286 697 591 500 446 1438 61681 759 607 526 386 114 --
NM_000353chr162896 141 --21237 1148 --
NM_000362chr2293656 3555 3238 2789 2407 1122 1109 365 302 --23379 2493 --
NM_000368chr994844 4644 4425 3124 1903 747 732 526 373 13825 1281 --
NM_000388chr31505 11253 ----
NM_000389chr62179 101 ----1238
NM_000390chrX103318 3061 3014 2927 2077 982 627 399 387 332 23406 1074 2518 411 --
NM_000391chr1121653 484 11342 11346 1444
NM_000393chr2102132 1952 1641 1407 1348 815 667 337 315 214 11441 1416 1176
NM_000397chrX42414 915 469 215 ------
NM_000399chr1041202 1013 1003 794 1293 1338 --
NM_000408chr2123397 3317 3262 3110 2575 2460 2142 1274 1116 339 218 168 1179 53118 2814 2717 2632 1356 22149 814
NM_000411chr2163125 3110 2427 2369 2027 330 --33075 1264 644 --
NM_000415chr122880 815 1229 1949 --
NM_000426chr61210 172 ----
NM_000430chr1783460 3170 2643 1489 1395 755 711 691 11248 13250 --
NM_000435chr194922 911 860 186 --3406 342 336 --
NM_000437chr142025 1427 543 155 --12096 --
NM_000441chr782215 2135 1591 923 635 532 494 147 --1756 --
NM_000446chr731090 1048 44 ------
NM_000447chr13398 129 87 ----1422
NM_000448chr11113235 3167 2848 2491 2179 2136 1162 1093 777 408 181 13245 63067 3035 2373 1052 816 810 12982
NM_000452chr1362026 1611 1543 1391 567 67 22098 2064 --22103 496
NM_000458chr17------1935
NM_000459chr93654 336 259 1751 ----
NM_000461chr374481 4335 3824 3041 1570 686 105 --11771 23848 3683
NM_000462chr1551684 1361 504 465 339 --31223 521 250 21571 318
NM_000474chr73673 640 583 ------
NM_000478chr1----1299 --
NM_000480chr1141405 536 464 353 ------
NM_000489chrX123409 3034 2755 2659 2425 2302 2277 2225 1321 1014 443 315 23265 528 53350 1260 720 139 54 --
NM_000492chr7--11173 --11136
NM_000493chr641020 947 924 750 --1110 --
NM_000495chrX31089 1060 289 --5450 445 383 236 203 --
NM_000503chr861893 1725 1500 1316 636 480 11163 1436 --
NM_000508chr41117 --2869 621 --
NM_000509chr4166 --127 --
NM_000510chr1121202 1090 21296 1060 11214 --
NM_000521chr51102 ------
NM_000522chr741226 1128 1046 1022 --158 --
NM_000523chr22301 201 --21102 1064 1373
NM_000527chr1922342 1547 --22240 872 --
NM_000533chrX41325 653 206 115 11981 11377 --
NM_000536chr11294 51 1205 1417 --
NM_000538chr1351709 1288 1179 520 61 --21846 297 --
NM_000550chr97984 953 910 884 316 145 80 11055 ----
NM_000553chr82594 88 2602 61 1622 2427 248
NM_000555chrX167358 6319 6303 6149 5921 5732 5651 5644 5078 2936 2751 2353 1555 1532 1423 97 21269 1245 77811 5095 2415 1506 161 128 111 12211
NM_000560chr1--1696 ----
NM_000565chr152304 1803 1542 1503 528 ------
NM_000572chr12807 166 --1235 --
NM_000574chr171251 1089 1044 857 387 349 116 41278 1027 934 521 11239 --
NM_000575chr23412 201 182 ------
NM_000586chr42190 47 ------
NM_000588chr51254 ----1289
NM_000589chr5135 ------
NM_000590chr51111 --1136 --
NM_000594chr63789 514 486 ------
NM_000595chr61388 ------
NM_000596chr72157 116 --1177 --
NM_000598chr721437 1073 --21409 45 31576 1557 1552
NM_000600chr71349 1128 1136 --
NM_000601chr71333 ----1384
NM_000602chr711400 21524 1472 ----
NM_000609chr1043094 2969 2126 143 23047 1946 32898 2254 183 --
NM_000610chr1112173 --82920 2482 2158 2146 1848 632 441 195 --
NM_000611chr11107077 6931 6689 6128 5470 4851 2746 1438 1282 87 11158 45067 4955 1918 325 1803
NM_000615chr1142779 2499 473 420 --4987 969 792 465 2846 601
NM_000618chr12146552 6416 6356 6288 6274 5092 4913 4710 4606 2640 2479 2257 912 420 44933 4925 2458 2277 35902 815 650 45192 4752 4426 632
NM_000618chr12146552 6416 6356 6288 6274 5092 4913 4710 4606 2640 2479 2257 912 420 44933 4925 2458 2277 35902 815 650 45192 4752 4426 632
NM_000619chr123165 84 66 1400 ----
NM_000625chr173365 159 126 ----1474
NM_000627chr22607 318 2601 357 --1271
NM_000633chr1885068 5034 3699 1514 959 811 717 259 25128 1806 34960 4935 230 --
NM_000641chr1971612 1577 1195 323 170 160 47 11549 1340 --
NM_000665chr7163 ------
NM_000681chr1051312 1189 492 284 270 ------
NM_000683chr41508 ------
NM_000684chr1031005 981 66 --21178 506 --
NM_000685chr34600 330 310 97 --1324 1866
NM_000685chr34600 330 310 97 --1324 1866
NM_000686chrX11268 21176 613 41501 622 64 43 --
NM_000693chr1551615 1270 1248 343 333 11514 ----
NM_000717chr171114 ------
NM_000719chr12116691 2578 1899 1763 1695 1613 1602 1513 1014 895 33 21980 1466 2787 782 16246
NM_000721chr142285 1899 521 296 --32304 2229 1868 1184
NM_000724chr10101841 1720 1354 792 577 529 450 176 139 121 1644 --1677
NM_000726chr241332 1058 509 208 ------
NM_000756chr82484 157 --1104 --
NM_000758chr52236 222 ------
NM_000773chr101117 --1152 --
NM_000780chr861216 1125 1050 1041 834 140 21139 514 2315 288 21222 311
NM_000783chr101196 2481 208 ----
NM_000788chr471518 1360 1054 923 569 551 224 11012 11406 1511
NM_000792chr1--1958 ----
NM_000793chr1495055 4515 4056 3218 2055 1543 1323 1002 318 55135 4709 3447 1852 1519 21861 974 11857
NM_000801chr201167 21116 403 1257 1408
NM_000806chr541617 706 391 50 41289 694 615 83 3596 503 122 --
NM_000807chr41685 ----1719
NM_000808chrX2822 179 1291 ----
NM_000809chr4399283 9057 8790 8371 8100 8003 7942 7825 7799 7755 7075 6921 6844 6826 6533 6495 6399 6047 5965 5953 5773 5741 5658 3531 3463 3135 2927 2577 2438 2210 2062 1967 1457 1178 903 874 793 698 297 59213 8974 7819 2944 1320 129076 9036 8934 8915 8452 7472 6870 6455 6018 2832 2566 2523 33519 3148 203
NM_000810chr15--1380 ----
NM_000811chr51298 ------
NM_000812chr42162 33 --1335 --
NM_000813chr5245449 4958 4943 4749 4618 4139 3987 3711 3544 3515 2016 1977 1751 1656 1542 1531 1379 1287 1255 1184 1101 597 447 162 14008 45544 5234 4144 1661 --
NM_000814chr1584152 4120 2839 1502 1199 1115 1092 513 11643 12691 33633 2712 2666
NM_000816chr51186 --1639 --
NM_000817chr251029 965 813 774 143 ------
NM_000818chr10--1512 ----
NM_000820chr13----1249 --
NM_000824chr42756 222 1960 --1939
NM_000826chr4132552 2414 2106 1703 1687 1675 1640 883 813 685 602 569 559 --32564 2441 1617 --
NM_000827chr562545 2525 2471 2339 2274 434 --11977 1339
NM_000829chr1132095 1921 896 --2588 556 --
NM_000838chr662793 2122 1934 1816 1088 720 11996 12381 12201
NM_000839chr3----3495 464 377 --
NM_000840chr7----1134 --
NM_000844chr331113 991 837 2760 163 2814 49 1181
NM_000845chr72491 331 ------
NM_000859chr531718 1143 533 1208 21560 1379 --
NM_000861chr392181 1975 1810 1761 1722 1026 834 778 642 --11945 --
NM_000866chr32521 232 1141 1411 11225
NM_000868chrX72543 1754 1047 944 924 838 508 2639 145 32510 247 218 --
NM_000872chr1081591 1526 1385 1264 1155 569 375 260 --11296 --
NM_000875chr15187036 6991 6618 6284 6252 5883 5051 4540 2380 2250 2115 1829 1767 1738 1371 1279 781 763 26312 6023 22636 2462 --
NM_000876chr611377 2361 327 1956 --
NM_000877chr2102901 2879 2241 2168 1983 1899 1190 979 788 425 --13085 22420 840
NM_000882chr35423 398 375 327 142 ----1315
NM_000885chr252137 1909 1596 655 521 --21902 670 --
NM_000891chr17163694 3667 3304 3263 3104 3071 3036 2980 2945 2665 2490 2376 1056 902 735 418 23366 1458 23597 3224 33688 939 33
NM_000899chr12124318 3918 3824 3770 3375 3115 2821 1745 1271 1077 1044 61 44394 3576 2919 248 33679 1376 28 --
NM_000901chr482321 2233 2175 1771 840 823 606 296 --22399 1847 22576 994
NM_000902chr341103 713 635 265 --33252 3145 448 22170 579
NM_000908chr53794 768 743 1731 --1720
NM_000909chr44808 239 147 67 11234 21335 137 1422
NM_000910chr491764 1427 1395 1278 1250 1244 593 265 210 --21501 275 --
NM_000919chr53605 469 132 --1575 --
NM_000921chr122530 152 ------
NM_000922chr1151096 821 294 278 250 --2393 317 --
NM_000925chr32126 35 ------
NM_000926chr11289325 9015 8970 8875 8794 8596 8578 8157 6839 6104 5852 3289 3191 3122 2918 2851 2718 2261 2030 1996 1603 1568 1446 1438 513 384 282 214 78735 6750 5990 3680 1522 1499 1392 99260 8759 7010 6171 3699 3548 2243 1418 163 26192 1212
NM_000933chr20----21550 80 1671
NM_000935chr391005 949 507 481 373 346 339 251 242 --41010 887 810 34 --
NM_000937chr17--1311 1399 1395
NM_000944chr42191 116 --12312 12177
NM_000945chr291914 1867 1852 786 626 582 537 521 106 11841 3452 279 36 --
NM_000949chr54958 951 919 906 1877 1211 --
NM_000950chrX143661 3594 3442 3120 3111 3017 2756 2588 2473 2341 1189 1176 986 609 23533 2521 33180 1212 138 22719 97
NM_000956chr142767 347 2951 355 ----
NM_000957chr13508 194 54 ------
NM_000958chr541258 871 842 476 --31329 1066 996 --
NM_000959chr1173009 2967 2791 2687 2622 2567 2500 1559 1459 1446 1424 1193 902 451 315 279 272 21279 886 93986 3081 2979 2471 1429 1319 703 434 370 --
NM_000962chr972950 2897 2858 2824 2674 2369 2340 --22043 364 --
NM_000963chr1132157 1774 1752 1640 1515 831 684 516 422 261 91 58 23 1698 22505 432 --
NM_000964chr17------1523
NM_000965chr351246 1200 872 381 252 --21313 480 --
NM_000983chr131615 1293 151 --2467 338 --
NM_000990chr1183864 3757 3667 2710 2682 1486 603 39 13925 13943 --
NM_001001132chr2161396 986 490 399 319 214 1355 2967 340 --
NM_001001323chr12133178 3157 2911 2854 2514 2082 1205 1197 961 836 756 709 476 13135 22459 430 --
NM_001001330chr1071299 1237 496 484 167 152 100 --21136 128 1811
NM_001001389chr1112173 --82920 2482 2158 2146 1848 632 441 195 --
NM_001001390chr1112173 --82920 2482 2158 2146 1848 632 441 195 --
NM_001001391chr1112173 --82920 2482 2158 2146 1848 632 441 195 --
NM_001001392chr1112219 --82966 2528 2204 2192 1894 678 487 241 --
NM_001001394chr21532 ------
NM_001001395chr12112773 2339 2329 2299 2109 1844 787 635 422 364 238 1443 52187 1804 1095 810 279 21960 881
NM_001001396chr184290 4126 3305 3252 2925 2710 1344 1076 1315 ----
NM_001001419chr5215176 5064 4916 4613 4399 3801 3738 3688 3677 3661 3517 2051 1156 998 823 796 519 418 314 276 147 24841 3345 85134 4471 2059 1891 1844 1020 847 112 45236 4933 746 283
NM_001001420chr5215176 5064 4916 4613 4399 3801 3738 3688 3677 3661 3517 2051 1156 998 823 796 519 418 314 276 147 24841 3345 85134 4471 2059 1891 1844 1020 847 112 45236 4933 746 283
NM_001001433chr2083001 2978 2969 2470 889 494 355 277 --11991 --
NM_001001436chr164856 702 609 578 1598 2869 570 --
NM_001001481chr8123337 2964 2787 2779 2709 1277 1207 1070 1025 944 848 199 22219 1395 53362 2726 785 269 263 21172 487
NM_001001483chr112367 300 --1427 --
NM_001001484chr105986 850 637 551 354 12025 --1212
NM_001001522chr111387 ------
NM_001001549chr772817 2757 2452 2147 2074 1149 669 --22304 376 --
NM_001001550chr772817 2757 2452 2147 2074 1149 669 --22304 376 --
NM_001001555chr772817 2757 2452 2147 2074 1149 669 --22304 376 --
NM_001001556chr1551554 1377 1273 1199 133 --11575 --
NM_001001567chr21----1179 --
NM_001001568chr21----1179 --
NM_001001571chr21----1179 --
NM_001001572chr21----1179 --
NM_001001573chr21----1179 --
NM_001001574chr21----1179 --
NM_001001575chr21----1179 --
NM_001001576chr21----1179 --
NM_001001577chr21----1179 --
NM_001001579chr21----1179 --
NM_001001580chr21----1179 --
NM_001001581chr21----1179 --
NM_001001582chr21----1179 --
NM_001001584chr21----1179 --
NM_001001585chr21----1179 --
NM_001001664chr284100 3961 2980 1606 1309 1056 885 137 43675 3638 3085 250 73258 3089 2588 893 553 369 102 --
NM_001001668chr19124006 3864 3427 3353 2716 1677 1267 977 757 622 126 38 23907 1390 33519 1154 199 12813
NM_001001669chr532497 2426 492 --1851 --
NM_001001787chr1----2362 182 1164
NM_001001852chr221907 ------
NM_001001890chr2173795 3652 1713 1615 816 644 588 13343 63270 3254 1475 600 548 487 13662
NM_001001928chr22178366 7973 7952 6532 6277 6106 6039 5849 3011 2910 2432 2136 1408 1191 785 550 498 17194 67418 6635 6322 5145 1441 1248 46631 6626 1775 300
NM_001001933chr13434 410 96 --1473 --
NM_001001936chr1031135 861 60 ----1298
NM_001001938chr9114056 3609 3132 3070 2895 2832 2754 1338 1314 1209 857 --54127 3368 3333 3116 487 13088
NM_001001971chr1071216 1125 992 880 464 338 270 21256 290 21055 55 11032
NM_001001974chr1092181 1786 1567 1559 865 780 720 512 285 1703 22247 560 22191 1524
NM_001001995chrX51783 1717 1258 599 254 --11655 11873
NM_001002006chr25889 626 573 311 114 --1877 --
NM_001002026chr352481 2412 1891 873 202 --4851 730 427 90 --
NM_001002233chr862193 2171 1722 1673 1474 459 32108 326 248 21659 1572 12113
NM_001002243chr23742 706 166 --131 --
NM_001002255chr6----1348 --
NM_001002257chr293336 3136 2680 2310 1388 825 133 119 40 11426 12219 --
NM_001002258chr23805 659 111 12007 ----
NM_001002269chr91420 ------
NM_001002295chr104818 792 768 728 11169 ----
NM_001002759chr101422 ----1530
NM_001002838chrX81879 1854 1668 1638 1224 426 132 98 1280 147 1119
NM_001002843chr1561206 1191 1171 822 486 428 --11148 --
NM_001002860chr14184644 4534 4474 4097 4055 3690 3597 3362 3223 2874 1616 1596 1369 1288 445 383 375 268 --63835 3814 3662 1609 472 313 --
NM_001002906chrY2457 423 ------
NM_001002909chr1762184 1523 889 835 745 327 --22022 168 --
NM_001003652chr18268623 8560 7739 7662 7640 7255 7144 6983 6601 6106 5996 5820 3006 2976 2907 2889 2748 2707 2462 2330 1870 1640 1568 1316 999 512 78514 6441 6160 3254 2776 2100 1062 68420 6638 6001 2181 977 463 26465 3142
NM_001003665chr13164 142 128 --1147 --
NM_001003674chr18146979 6641 6555 6156 5320 5126 4980 4946 4346 2706 2511 1269 279 222 16702 46865 5190 883 470 35446 5369 1053
NM_001003675chr18146979 6641 6555 6156 5320 5126 4980 4946 4346 2706 2511 1269 279 222 16702 46865 5190 883 470 35446 5369 1053
NM_001003678chr11----194 --
NM_001003679chr151982 1875 1845 814 474 21894 1811 22132 1443 --
NM_001003681chr2251895 1606 1481 1363 175 --32050 364 180 --
NM_001003688chr421228 1167 1462 21233 1116 --
NM_001003694chr31616 ------
NM_001003696chr211129 ------
NM_001003697chr211129 ------
NM_001003698chr621917 268 --21455 351 --
NM_001003699chr621917 268 --21455 351 --
NM_001003701chr211129 ------
NM_001003703chr211129 ------
NM_001003712chr1273364 2804 2782 2664 1525 1221 407 22641 969 53496 3468 2890 798 606 1907
NM_001003760chr6123581 3542 3511 3341 2798 1371 1329 1201 1008 455 241 40 13071 83638 3144 2882 2857 2635 2608 699 402 --
NM_001003792chr351261 995 943 436 349 21173 295 2484 209 1480
NM_001003793chr351261 995 943 436 349 21173 295 2484 209 1480
NM_001003800chr983494 3468 3391 3141 2966 2912 1171 1050 ----13537
NM_001003810chr45655 638 616 209 48 --1196 --
NM_001003937chr231488 1455 1329 --31538 498 93 --
NM_001004023chr1140 ------
NM_001004051chrX3226 100 61 ------
NM_001004065chr983931 3469 3446 3012 2771 1149 989 824 21578 619 33979 3809 573 --
NM_001004127chr13167 130 --1105
NM_001004303chr12765 283 --1718 2676 527
NM_001004303chr12765 283 --1718 2676 527
NM_001004317chr674516 3824 3514 3386 1006 961 938 21247 838 34164 3539 1436 --
NM_001004329chr1221516 498 1132 21456 1062 --
NM_001004342chr175989 4501 3982 2047 1636 1516 1500 --1790 --
NM_001004346chr471101 938 842 455 299 93 48 2421 75 3240 179 111 --
NM_001004360chr221686 772 31903 1838 509 11263 --
NM_001004419chr1284515 4409 4325 3295 2817 1630 1473 155 24113 1740 24613 3301 --
NM_001004431chr171237 ------
NM_001004441chr561602 1550 1458 1410 1279 1078 21154 348 --11480
NM_001005242chr1231504 408 56 11192 21304 529 11088
NM_001005266chr15124 ------
NM_001005267chr15124 ------
NM_001005268chr15124 ------
NM_001005269chr15124 ------
NM_001005335chr19178 ------
NM_001005353chr131278 1035 329 --11211 --
NM_001005353chr131278 1035 329 --11211 --
NM_001005367chr191371 1347 ----
NM_001005375chrY21608 270 1696 ----
NM_001005377chr191276 ----1282
NM_001005386chr26771 667 657 291 243 37 --1617 --
NM_001005404chr1754385 3425 3140 3126 1747 24055 3263 44120 3762 3216 191 --
NM_001005463chr1072105 1992 1646 462 284 235 154 11732 22366 1044 --
NM_001005473chr5166625 6404 6107 5839 5559 5380 5322 5182 4430 4412 2613 2597 2579 2232 1471 304 16524 55870 4904 4733 2267 1631 24207 1627
NM_001005474chr3----31335 1308 532 --
NM_001005505chr341858 1810 1723 1382 11554 ----
NM_001005527chr361254 975 829 336 187 59 11237 --1535
NM_001005609chrX83731 3225 2936 1459 746 663 500 132 ------
NM_001005739chr25859 816 778 734 351 1335 ----
NM_001005743chr141525 11337 21267 238 1932
NM_001005744chr141525 11337 21267 238 1932
NM_001005745chr141525 11337 21267 238 1932
NM_001005746chr241332 1058 509 208 ------
NM_001005747chr241332 1058 509 208 ------
NM_001005751chr102533 144 ------
NM_001005781chr22245 238 ------
NM_001005782chr23694 687 360 --146 2792 787
NM_001005861chr36777 658 373 359 183 73 1139 4782 633 366 264 --
NM_001005914chr31166 ------
NM_001006600chr572097 1913 1588 1546 442 82 73 12148 41656 566 402 292 1928
NM_001006605chr151174 1042 889 468 248 --1960 11165
NM_001006605chr151174 1042 889 468 248 --1960 11165
NM_001006610chr161675 2891 661 ----
NM_001006618chr92276 209 1246 ----
NM_001006623chr272497 2243 945 697 538 151 137 --2247 159 --
NM_001006641chr951590 1469 1443 1113 1087 ------
NM_001006642chr951590 1469 1443 1113 1087 ------
NM_001006643chr951590 1469 1443 1113 1087 ------
NM_001006657chr263212 897 755 510 118 83 1586 12655 22346 961
NM_001006658chr14704 563 528 33 --1475 --
NM_001006684chrX4435 424 397 178 --186 --
NM_001006944chr111153 ------
NM_001006945chr14670 638 529 243 1607 --1255
NM_001007023chr1495055 4515 4056 3218 2055 1543 1323 1002 318 55135 4709 3447 1852 1519 21861 974 11857
NM_001007024chr1784214 3796 3579 3402 3243 2954 1617 385 --44306 3434 2976 247 --
NM_001007025chr1784214 3796 3579 3402 3243 2954 1617 385 --44306 3434 2976 247 --
NM_001007026chr121334 ------
NM_001007088chrX2476 78 ------
NM_001007097chr9104121 4017 3844 1941 1707 907 884 610 375 340 31666 1152 476 45036 3922 3630 1485 --
NM_001007098chr12818 378 1153 --1808
NM_001007099chr16864 826 606 328 194 21 --2690 589 --
NM_001007100chr16864 826 606 328 194 21 --2690 589 --
NM_001007102chr681563 1330 1193 613 498 388 298 129 21369 38 31440 1309 653 --
NM_001007156chr1521745 1491 --31972 624 618 1333
NM_001007189chr51113 --1158 150
NM_001007214chr14743 342 309 162 ------
NM_001007237chr162389 2107 1860 983 839 646 22365 2151 22376 530 --
NM_001007245chr75430 237 127 39 25 --1645 --
NM_001007257chr121252 1133 ----11246
NM_001007277chr112801 373 ------
NM_001007464chr6----1103 --
NM_001007466chr6125204 5041 5020 4685 4556 4543 3273 1946 1735 1696 1222 266 13321 75160 5122 4965 4731 4497 3261 1070 --
NM_001007468chr22------1247
NM_001007538chr1361891 1714 1648 1633 591 346 11907 31480 1432 1179 --
NM_001007559chr1882091 2044 1792 1371 1326 433 416 355 --1773 --
NM_001007565chr31325 170 ----
NM_001007794chr11757 --2733 651 --
NM_001008226chr1541715 1357 1147 112 31729 249 181 21204 620 21755 1673
NM_001008239chr18123775 3701 3632 3455 3384 3368 3356 3177 3132 2972 1002 539 33840 3336 317 33082 3018 364 2550 263
NM_001008388chr43811 300 87 --2353 102 --
NM_001008392chr383497 3228 3150 2816 2749 2454 2352 760 22401 175 1231 32383 749 419
NM_001008393chr4172922 2779 2645 2542 2168 2103 2077 1018 993 804 788 774 736 699 322 175 61 22590 213 52381 2230 1042 945 898 --
NM_001008401chr1941501 1436 1419 1280 --11509 --
NM_001008405chr761863 1312 702 389 345 64 ----1496
NM_001008407chr711820 --11405 --
NM_001008408chr7116040 5948 5766 5081 4871 4713 4415 1849 1197 1066 212 24791 4373 55514 5276 4817 4442 1454 34955 4887 1966
NM_001008491chr262008 1949 1751 1647 501 185 --1510 12024
NM_001008492chr262008 1949 1751 1647 501 185 --1510 12024
NM_001008495chr892032 1945 1930 1601 690 556 326 307 267 --31813 654 426 --
NM_001008528chr1731631 1253 456 --1167 11229
NM_001008539chr8165396 5379 5308 5140 4389 4248 3885 3873 3863 3489 2038 1615 1600 1452 1301 1034 35360 1787 1565 21569 1350 --
NM_001008541chr1052134 2019 1962 1505 895 11479 1545 11589
NM_001008541chr1052134 2019 1962 1505 895 11479 1545 11589
NM_001008564chr1351927 1850 1715 117 60 11408 22280 1951 --
NM_001008660chr1151293 1170 550 316 63 ------
NM_001008708chr2299 63 --177 1113
NM_001008723chr101336 1384 ----
NM_001008727chr19------9267 262 257 252 247 242 237 232 227
NM_001008738chr5112849 2836 2185 2106 1127 1070 681 646 582 479 439 32462 774 497 21974 935 --
NM_001008777chr172515 63 ------
NM_001008779chr21312 1242 --1277
NM_001008783chr63898 602 175 --2649 275 3688 663 43
NM_001008860chr152769 757 2306 240 2310 149 --
NM_001008892chr152769 757 2306 240 2310 149 --
NM_001008894chr152769 757 2306 240 2310 149 --
NM_001008895chr1331369 1165 1055 21087 1080 21434 932 --
NM_001008925chr4113246 3227 2976 2727 2590 2437 2332 1267 1228 924 481 1633 33281 2986 2313 23333 498
NM_001009185chr51156 1181 2581 185 --
NM_001009554chr4114741 4259 4249 4099 4089 3970 3620 3138 1574 1448 926 14754 64449 4157 1408 644 450 364 13575
NM_001009554chr4114741 4259 4249 4099 4089 3970 3620 3138 1574 1448 926 14754 64449 4157 1408 644 450 364 13575
NM_001009555chr441413 1095 654 83 --11461 1369
NM_001009567chr106692 496 484 469 177 152 1225 ----
NM_001009571chr731594 1125 547 --21184 56 --
NM_001009814chr131165 --192 --
NM_001009881chr12212 177 1630 ----
NM_001009882chr12212 177 1630 ----
NM_001009894chr1241593 1375 622 588 ------
NM_001009899chr3196498 6190 6124 6063 5692 5508 4251 4081 2501 2476 2462 2149 1503 1022 968 887 701 671 215 46523 4237 1218 1048 66381 4133 3996 1760 1119 223 1981
NM_001009909chr11123955 3830 3192 3143 2903 2887 2554 1530 1422 893 662 217 12992 43701 1552 534 514 23632 3262
NM_001009958chr71532 ----1247
NM_001009959chr272354 1841 1003 977 758 664 85 12027 1443 --
NM_001009960chr782827 2426 2379 1025 775 671 505 285 32577 2238 964 3860 812 806 1997
NM_001009993chr244335 3946 3672 1121 54469 3821 3444 945 391 21779 880 11825
NM_001009994chr62122 90 ------
NM_001010000chr1863397 2947 2883 741 670 480 1924 1989 --
NM_001010844chr63196 53 45 ------
NM_001010853chr6153199 3176 2749 2523 2298 2159 1997 1042 922 914 893 872 842 682 370 --33115 2600 1091 --
NM_001010854chr143661 625 256 1583 ----
NM_001010861chr192791 2661 2502 2155 1789 697 637 493 377 2992 969 51077 973 531 471 391 21026 527
NM_001010862chrX72990 2855 2409 2400 2238 257 113 12249 43299 2108 586 69 --
NM_001010867chr144883 2451 2154 465 36744 2465 1551 15323 16006
NM_001010876chr6--155 159 --
NM_001010888chrX114650 4302 4114 4011 3820 3415 3399 3385 2904 1658 586 2945 868 34531 1175 417 14345
NM_001010891chr5256931 6501 6134 5916 5603 5255 4840 4325 4277 4193 2391 2284 2262 1528 1430 1397 1147 1130 1077 709 545 495 443 356 141 56825 5796 5041 2457 470 34627 4315 1007 25066 1153
NM_001010895chr931759 1593 579 3512 447 32 1135 --
NM_001010908chr101309 ------
NM_001010922chr173731 3309 3177 3140 659 363 245 32978 2706 864 63609 3573 3476 3103 1271 140 1796
NM_001010923chr671565 1530 1362 1288 380 286 257 --31617 1502 1367 21230 1104
NM_001010927chr62549 214 --2564 43 3416 391 160
NM_001010932chr71333 ----1384
NM_001010934chr73950 265 129 --11131 --
NM_001010942chr1271279 1163 1052 903 853 339 202 2386 323 11071 --
NM_001010971chr161017 994 872 821 747 674 ------
NM_001010984chr1102585 2405 2317 2294 2251 2073 2064 2014 782 197 22304 1893 2995 203 --
NM_001010986chrX51647 930 894 598 349 11997 22449 627 1873
NM_001010989chr161130 2509 421 1491 1514
NM_001010990chr161130 2509 421 1491 1514
NM_001011513chr493586 3116 3047 3003 2764 2735 2605 820 517 1218 54052 3026 2956 832 205 --
NM_001011515chr44946 725 386 123 1852 4785 419 303 51 --
NM_001011516chr44946 725 386 123 1852 4785 419 303 51 --
NM_001011537chr382305 2118 1692 1603 1514 925 88 52 12294 3308 128 122 11803
NM_001011551chrX2431 57 ------
NM_001011553chr72966 684 --1137 1880
NM_001011663chr1010953 927 855 804 752 709 686 408 286 123 21104 970 1844 --
NM_001011666chr7135488 5465 5445 4652 4502 4320 4227 4172 2112 1988 766 256 229 65754 5394 4818 2283 2255 1908 104280 4084 2551 2067 1652 1505 1499 1139 811 674 11512
NM_001011705chr135297 277 246 232 101 --2256 240 --
NM_001011708chr222072 854 22903 2052 3946 211 130 22932 2856
NM_001011713chr1441486 1464 1339 287 21622 1111 71547 1302 1157 1120 1029 455 78 11116
NM_001011720chr851010 564 488 35 25 21062 148 41019 380 152 91 --
NM_001011724chr13------1204
NM_001011725chr13------1204
NM_001012267chr921492 81 ------
NM_001012279chr62131 34 --149 1212
NM_001012393chr1165040 4678 4351 4197 788 143 24960 738 45028 4080 458 156 13377
NM_001012398chr163849 265 186 1781 ----
NM_001012418chr694287 4202 4068 3940 3685 3387 3179 2585 1641 14184 54226 3658 3255 3205 285 --
NM_001012420chr1572807 2382 824 503 211 119 87 1904 12039 --
NM_001012423chr1582807 2382 824 503 211 149 119 87 1904 12039 --
NM_001012425chr1----1135 --
NM_001012478chr191406 1643 1647 --
NM_001012614chr42721 297 --1494 1768
NM_001012751chr1071795 1582 1463 1323 774 235 104 ----1727
NM_001012754chr1351639 1318 268 182 154 1204 31951 1854 91 21947 1850
NM_001012755chrX145088 4972 4772 4728 4443 4070 4002 3607 3564 1356 826 522 332 69 13583 54907 4651 4184 1876 1794 --
NM_001012756chr19113262 3030 2643 2509 2291 2260 1294 763 597 536 406 ----13008
NM_001012761chr532258 2037 550 12697 62356 2313 2194 603 276 30 --
NM_001012968chrX222775 2742 2542 2414 2359 1932 1905 1880 1838 1813 1778 1731 1723 1710 1098 870 712 659 457 394 185 177 12786 32094 673 52 --
NM_001012969chr153310 118 105 ------
NM_001012984chr161144 ------
NM_001012985chr1--1197 ----
NM_001012989chrX5681 491 256 129 64 ------
NM_001013031chr1053336 3230 1175 534 322 32657 360 212 63545 3280 3144 3031 3026 2988 --
NM_001013398chr721437 1073 --21409 45 31576 1557 1552
NM_001013399chr6----1134 --
NM_001013406chr741737 1724 1512 1140 --51412 1182 590 385 83 --
NM_001013415chr441455 1080 620 297 11162 41583 1439 1028 306 --
NM_001013438chr33955 768 327 ------
NM_001013439chr33801 614 173 --1270 --
NM_001013615chr151143 1108 930 911 386 --21013 395 --
NM_001013620chr12288425 8414 8379 8333 7757 7221 7193 6707 5791 5703 5655 5597 5432 5340 5317 5194 5139 3330 3287 2999 2579 2357 2224 2189 1757 1674 1391 1187 58513 8258 7140 7052 145 118479 8300 7186 6533 5487 5311 2334 2178 2155 2145 429 13305
NM_001013659chr19155235 4958 3299 2014 1840 1816 1610 1392 1379 1261 944 937 793 580 216 --25408 423 22060 407
NM_001013690chr122589 148 22515 769 31923 782 418 --
NM_001013699chr12149 1527 ----
NM_001013838chr16------133
NM_001014286chr132300 72 1100 ----
NM_001014431chr143930 215 85 --1987 --
NM_001014432chr143930 215 85 --1987 --
NM_001014434chr16764 685 677 311 205 78 --1818 172
NM_001014443chr1183 ------
NM_001014449chr161195 ------
NM_001014451chr161195 ------
NM_001014797chr10168231 7412 7029 5265 3183 1575 1223 827 802 753 727 685 411 308 297 154 35009 3067 616 77374 7308 5605 5600 3044 732 385 26768 1114
NM_001014812chr153411 382 349 ------
NM_001014839chr121033 718 --1723 --
NM_001014841chr121033 718 --1723 --
NM_001014972chr2161 ------
NM_001015048chr1453063 2618 1989 1274 146 --53202 3019 2876 2769 723 12745
NM_001015049chr1453063 2618 1989 1274 146 --53202 3019 2876 2769 723 12745
NM_001015877chrX83021 2710 2613 2357 1134 1019 955 627 32423 964 943 63046 2892 2666 984 927 921 --
NM_001015880chr1091685 1617 1278 348 327 260 85 71 55 1505 --21716 1303
NM_001015882chr941097 1006 408 391 --148 166
NM_001015887chr381758 1694 1506 1426 744 608 198 145 --51725 1699 1324 1253 726 21685 385
NM_001017368chr1752771 2735 2180 1833 1121 22824 460 12805 --
NM_001017369chr43998 967 70 2943 168 1424 --
NM_001017371chr271399 1183 1152 1081 1010 489 210 1553 31163 151 35 1526
NM_001017395chr363172 2842 2260 1068 663 171 12220 32657 1308 893 --
NM_001017405chr42685 244 --1896 --
NM_001017420chr871429 1421 1374 1362 1259 972 952 21389 1125 --11460
NM_001017424chr131781 1225 752 --31722 1610 1509 --
NM_001017425chr131781 1225 752 --31722 1610 1509 --
NM_001017434chr17620 533 516 277 231 220 125 --2775 585 1753
NM_001017440chr7158247 7824 7555 7269 7055 6615 6270 5308 5076 2780 2144 1434 1275 1154 269 1217 47068 5180 1456 1081 --
NM_001017922chr14620 565 403 324 --11719 --
NM_001017923chr1481704 1574 1402 1108 323 270 264 126 2386 227 3610 210 68 11370
NM_001017926chr841795 1332 683 512 --31355 1236 708 --
NM_001017928chr3--1210 ----
NM_001017963chr143687 199 61 1124 2223 83 --
NM_001017969chr91552 1592 1414 --
NM_001017977chr12258 62 --1371 --
NM_001017992chr591549 1422 1293 1284 1249 1242 1071 456 65 31145 1042 622 11530 11517
NM_001017999chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_001017999chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_001018000chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_001018000chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_001018001chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_001018004chr15185 --190 --
NM_001018006chr15185 --190 --
NM_001018007chr15185 --190 --
NM_001018009chr351026 981 863 480 346 11112 11187 --
NM_001018020chr15185 --190 --
NM_001018037chr941459 977 523 412 1203 2534 268 --
NM_001018038chr93575 242 88 1437 ----
NM_001018053chr151852 1597 1431 1215 696 --41998 1968 1246 384 --
NM_001018054chr151447 1295 1225 498 428 1512 1563 --
NM_001018064chr931937 1891 542 --11968 --
NM_001018065chr9105850 4976 4792 4057 3896 1579 1456 1419 1384 1140 34696 1774 1032 65585 4638 4569 4214 1184 415 21560 1365
NM_001018066chr9105850 4976 4792 4057 3896 1579 1456 1419 1384 1140 34696 1774 1032 65585 4638 4569 4214 1184 415 21560 1365
NM_001018067chr194690 4421 3469 3323 3313 1202 548 443 274 34323 1084 530 85392 5167 4780 4387 2146 1571 1119 735 15056
NM_001018068chr194690 4421 3469 3323 3313 1202 548 443 274 34323 1084 530 85392 5167 4780 4387 2146 1571 1119 735 15056
NM_001018069chr194690 4421 3469 3323 3313 1202 548 443 274 34323 1084 530 85392 5167 4780 4387 2146 1571 1119 735 15056
NM_001018074chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_001018075chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_001018076chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_001018077chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_001018080chr1121202 1090 21296 1060 11214 --
NM_001018090chr15112456 2389 2243 2236 2190 2105 2017 2006 1930 772 275 2941 254 32223 945 315 12805
NM_001018091chr15122566 2499 2353 2346 2300 2215 2127 2116 2040 1828 882 385 21051 364 32333 1055 425 12915
NM_001018100chr153856 809 637 1304 ----
NM_001018102chr15112456 2389 2243 2236 2190 2105 2017 2006 1930 772 275 2941 254 32223 945 315 12805
NM_001018111chr764000 3113 3024 2960 2872 721 13010 ----
NM_001018837chr11167 ------
NM_001020658chr151631 1439 1215 295 207 --11680 --
NM_001020658chr151631 1439 1215 295 207 --11680 --
NM_001020825chr571426 1044 1006 928 872 343 243 --31304 1123 961 --
NM_001023567chr1561534 827 355 149 119 87 --22379 506 --
NM_001023587chr351150 1142 953 334 119 ------
NM_001024094chr5123951 3569 3531 3453 3397 2868 2768 1523 1467 951 780 353 --43829 3648 3486 99 11343
NM_001024218chr142861 618 --1245 --
NM_001024226chr141091 1003 988 168 142 ----
NM_001024227chr141091 1003 988 168 142 ----
NM_001024228chr141091 1003 988 168 142 ----
NM_001024380chr821615 546 11549 1105 --
NM_001024381chr821615 546 11549 1105 --
NM_001024401chr1612874 ------
NM_001024647chr12197717 7408 6610 4832 4794 2921 2282 2149 1824 1259 1055 998 977 945 491 174 81 70 59 36733 911 536 76812 6170 5635 1148 1029 576 451 --
NM_001024649chr5102916 2784 2687 2632 2287 2130 1988 1801 1099 525 12677 12044 12658
NM_001024660chr351519 1259 1242 1034 581 --11362 --
NM_001024807chr191246 --1234 --
NM_001024808chr1252808 2011 1098 859 306 ------
NM_001024809chr17------1523
NM_001024847chr321563 685 11609 42434 1856 999 578 --
NM_001024916chr9176 1108 --185
NM_001024947chr52926 721 ------
NM_001024948chr1133273 3092 3026 2864 2724 2558 2500 1347 962 782 728 668 340 32841 2821 2260 12442 23099 231
NM_001024956chr11155849 5300 4985 4501 4403 4315 3847 3677 2281 1618 1524 1451 1402 752 739 14941 13549 14783
NM_001025068chr361633 1261 1132 439 370 265 11805 51691 652 631 476 382 2667 546
NM_001025069chr361633 1261 1132 439 370 265 11805 51691 652 631 476 382 2667 546
NM_001025072chr382845 2385 1088 1070 883 635 579 565 1111 22192 2060 --
NM_001025073chr382845 2385 1088 1070 883 635 579 565 1111 22192 2060 --
NM_001025076chr10216201 6166 5904 5206 5065 4929 4525 4477 3916 2470 2463 1831 1790 1666 1657 1648 1568 1385 1284 913 866 21163 735 66138 5470 5373 3879 3794 339 --
NM_001025077chr10237559 7524 7262 6564 6423 6287 5883 5835 5274 4999 3024 3015 3006 2926 2743 2642 2271 2224 905 863 842 645 200 32521 2093 1045 107496 6828 6731 5237 5152 4950 1697 1078 306 129 2662 589
NM_001025079chr3134077 4067 3993 3920 3913 3627 3309 3057 1563 1362 1226 745 677 33322 3273 2610 33260 2916 251 --
NM_001025108chr273912 3864 3233 2689 2656 1494 580 --32895 526 495 --
NM_001025201chr23671 541 86 --1738 1584
NM_001025233chr1242753 2384 1985 700 --31902 772 407 --
NM_001025252chr8113200 2927 2566 1260 1108 666 546 510 467 217 102 1312 23008 732 --
NM_001025253chr8113200 2927 2566 1260 1108 666 546 510 467 217 102 1312 23008 732 --
NM_001025266chr3154794 4062 4017 3888 3666 3434 3290 3252 3192 1755 1316 908 832 545 91 24808 4368 43705 3653 1953 221 --
NM_001025356chr1242887 1115 734 523 --3373 333 138 12676
NM_001025366chr641739 1370 1236 318 1406 21845 272 --
NM_001025366chr641739 1370 1236 318 1406 21845 272 --
NM_001025367chr641739 1370 1236 318 1406 21845 272 --
NM_001025367chr641739 1370 1236 318 1406 21845 272 --
NM_001025368chr641739 1370 1236 318 1406 21845 272 --
NM_001025368chr641739 1370 1236 318 1406 21845 272 --
NM_001025369chr641755 1386 1252 334 1422 21861 288 --
NM_001025369chr641755 1386 1252 334 1422 21861 288 --
NM_001025370chr641739 1370 1236 318 1406 21845 272 --
NM_001025370chr641739 1370 1236 318 1406 21845 272 --
NM_001025389chr1141405 536 464 353 ------
NM_001025390chr1141405 536 464 353 ------
NM_001025579chr1731082 363 285 ------
NM_001025580chrX114136 3857 3583 3254 3047 3022 2839 1273 1004 442 342 11064 83943 3880 3783 3638 3528 3052 1028 284 23914 207
NM_001025595chr441355 663 593 466 31546 399 152 --11590
NM_001025596chr112328 184 ------
NM_001025616chr491669 1657 1526 1493 1181 609 505 415 372 --51555 1549 1498 645 336 2401 279
NM_001025780chr971588 1218 1087 393 341 310 218 11488 --1527
NM_001029839chr361022 613 515 497 487 361 2381 113 1585 --
NM_001029840chr361022 613 515 497 487 361 2381 113 1585 --
NM_001029858chr632242 2163 574 33411 2472 442 42207 2055 875 446 22460 2271
NM_001029860chr82119 66 1261 ----
NM_001029863chr643114 2777 786 483 2970 191 12783 22765 2366
NM_001029875chr521082 305 11059 2524 125 --
NM_001029882chr11239 --1575 --
NM_001029882chr11239 --1575 --
NM_001029884chr672743 2486 2283 1742 256 212 129 12580 32646 2511 39 --
NM_001030002chr17----1380 --
NM_001030006chr174908 416 320 250 --1586 --
NM_001030007chr1693879 3216 3132 2846 2711 1380 1069 662 222 23236 1198 12678 13556
NM_001030055chr14204658 4551 4505 4473 3909 3501 3213 3067 2873 1733 1588 1344 1320 1218 1057 997 576 403 384 372 54692 4445 823 814 479 24487 1855 24751 4746
NM_001030272chr111483 ------
NM_001030273chr111483 ------
NM_001031623chr641739 1347 352 162 11180 2381 127 1587
NM_001031679chr1253368 169 139 125 85 --43448 3053 2943 653 33390 649 644
NM_001031684chr261487 1446 1372 1073 963 209 --21172 36 --
NM_001031689chr9126 ------
NM_001031695chr2244630 3873 185 150 34577 3336 2110 55333 3793 2187 2181 1047 13947
NM_001031700chr4112408 2135 1895 1648 1002 717 625 576 555 369 222 1874 52486 2256 2207 840 650 12193
NM_001031709chr10182 --270 44 --
NM_001031710chr741112 1034 352 56 1183 1975 --
NM_001031712chr62380 146 1110 ----
NM_001031715chr151202 ----1180
NM_001031716chr23882 286 70 --2718 222 1797
NM_001031722chr6135 --1170 --
NM_001031723chr42377 370 1193 142 --
NM_001031725chr12106 24 ------
NM_001031732chr4113412 3162 2887 2541 2320 1104 1048 945 852 365 51 32355 1158 1112 5885 539 370 312 87 --
NM_001031738chr22500 66 1493 ----
NM_001031804chr16134373 3715 3567 3472 3197 3084 2913 2755 1423 1180 1082 906 432 --83402 2853 1410 1394 1366 1015 527 498 11417
NM_001031812chr5112141 2096 1818 1564 1530 1467 490 231 128 91 33 22075 811 62260 2128 1828 1576 1472 729 11701
NM_001032221chr941664 1333 359 312 11696 ----
NM_001032279chr112397 326 ------
NM_001032280chr631437 1419 1249 --11545 21730 1096
NM_001032282chr821148 251 21315 947 1324 1320
NM_001032283chr124769 763 279 40 1685 1258 --
NM_001032284chr124769 763 279 40 1685 1258 --
NM_001032293chr171167 ----1150
NM_001032296chr13--1375 42294 1018 622 245 2238 233
NM_001032363chr141855 1683 896 175 2845 119 --11987
NM_001032363chr141855 1683 896 175 2845 119 --11987
NM_001032380chr1052010 1304 369 349 243 --41704 1474 1468 282 2404 399
NM_001032393chrX--1660 --1257
NM_001032394chr682827 2717 2704 2604 2193 935 563 255 1796 42152 1972 1066 596 1703
NM_001032395chr682694 2584 2571 2471 2060 802 430 122 1663 42019 1839 933 463 1570
NM_001032730chr13272 176 134 ----1689
NM_001032999chr2065299 5245 4005 3793 1536 725 24207 688 14211 --
NM_001033002chr17184 --196 --
NM_001033044chr151570 1184 1176 659 517 --21293 147 --
NM_001033045chr284231 3667 2977 2940 1534 1386 1087 382 43871 3403 2952 1781 1966 24402 2920
NM_001033047chr442656 2594 2318 158 12012 22517 571 --
NM_001033049chr2132166 786 276 --22142 352 1451
NM_001033056chr151570 1184 1176 659 517 --21293 147 --
NM_001033057chr392106 1968 1851 1334 489 238 224 210 72 11688 ----
NM_001033059chr651738 1647 1511 89 60 1608 ----
NM_001033081chr131748 1541 1196 --21839 50 --
NM_001033082chr131748 1541 1196 --21839 50 --
NM_001033087chr20123106 3079 2961 2438 2319 2306 2117 1002 735 547 352 341 12341 22921 2296 --
NM_001033117chr364677 4657 3770 3239 1560 556 ------
NM_001033506chr11170 --1335 --
NM_001033507chr111252 1429 41286 571 556 491 --
NM_001033518chr722524 1012 --1552 --
NM_001033519chr722524 1012 --1552 --
NM_001033520chr722524 1012 --1552 --
NM_001033557chr241290 336 217 28 21235 51 21255 314 11091
NM_001033566chr174941 662 242 40 2143 62 --1109
NM_001033568chr174941 662 242 40 2143 62 --1109
NM_001033578chr862351 2215 911 463 264 142 --2948 222 11871
NM_001033602chr131993 1432 1829 11882
NM_001033723chr842803 2567 2536 352 11122 42793 1801 1731 454 21824 1020
NM_001033756chr651673 1304 1170 732 252 1340 21779 206 --
NM_001033756chr651673 1304 1170 732 252 1340 21779 206 --
NM_001033910chr162153 861 738 554 227 220 21717 379 ----
NM_001033925chr1071897 1459 858 762 651 615 536 31952 694 347 31743 1448 143 1103
NM_001034841chr1695532 4560 4193 3568 1947 1390 569 485 431 45257 3883 2015 511 25200 5021 15538
NM_001034850chr551482 1378 1051 632 606 --41470 1383 200 129 1114
NM_001034954chr1043258 2836 2533 232 --33189 2989 28 --
NM_001034955chr1043258 2836 2533 232 --33189 2989 28 --
NM_001034956chr1043258 2836 2533 232 --33189 2989 28 --
NM_001034957chr1043258 2836 2533 232 --33189 2989 28 --
NM_001035chr11370 --2525 182 --
NM_001035260chr1071559 1299 1264 587 510 344 289 --1424 21341 240
NM_001035267chr121242 ------
NM_001037132chr792003 1879 1530 805 680 371 277 199 104 ----11987
NM_001037133chr792003 1879 1530 805 680 371 277 199 104 ----11987
NM_001037164chr731907 1317 507 11334 21351 691 --
NM_001037165chr7138852 8763 8742 8476 8443 6816 6531 5848 3332 3217 2281 974 648 28505 8094 36821 6671 240 18871
NM_001037174chr261801 1776 599 444 430 144 1414 32266 351 181 --
NM_001037277chr141689 1492 1472 318 ----139
NM_001037278chr141689 1492 1472 318 ----139
NM_001037317chr192791 2661 2502 2155 1789 697 637 493 377 2992 969 51077 973 531 471 391 21026 527
NM_001037332chr592525 2513 2430 1902 941 896 730 331 247 --12285 --
NM_001037333chr592525 2513 2430 1902 941 896 730 331 247 --12285 --
NM_001037334chr1892095 1778 1771 1725 1536 713 378 246 46 22186 916 21656 718 1260
NM_001037339chr141687 702 625 125 --21304 582 --
NM_001037340chr141687 702 625 125 --21304 582 --
NM_001037341chr141687 702 625 125 --21304 582 --
NM_001037341chr141687 702 625 125 --21304 582 --
NM_001037494chr12----1209 --
NM_001037495chr12----1209 --
NM_001037535chrX51458 1108 996 551 534 31561 1388 455 61226 1181 1025 974 517 249 --
NM_001037536chrX51458 1108 996 551 534 31561 1388 455 61226 1181 1025 974 517 249 --
NM_001037540chrX51458 1108 996 551 534 31561 1388 455 61226 1181 1025 974 517 249 --
NM_001037553chr2174514 4211 4133 3287 1385 306 99 --24937 991 --
NM_001037631chr251154 1122 854 460 119 ----123
NM_001037637chr54316 278 122 71 156 1271 --
NM_001037872chr24715 643 554 297 ----1194
NM_001037954chr1193336 3306 3196 3080 2863 2133 1228 1167 571 13034 33369 3228 996 1383
NM_001038603chr52293 262 --243 25 239 34
NM_001038640chr154894 650 225 195 --1293 --
NM_001038702chr592665 2646 2405 1799 587 463 403 362 333 2449 263 2860 709 2983 600
NM_001039029chr1212024 ------
NM_001039091chrX3928 300 205 1948 1467 --
NM_001039199chr2094882 4590 4548 3957 3074 2009 1230 842 270 --34968 3319 280 1175
NM_001039348chr221074 420 31055 1023 70 11059 --
NM_001039349chr221074 420 31055 1023 70 11059 --
NM_001039350chr72608 154 ----11802
NM_001039372chr73579 500 478 --3679 634 628 --
NM_001039395chr952400 2236 1681 919 477 --52460 2405 2332 2326 2287 --
NM_001039457chr1138 ------
NM_001039479chr1472434 2236 2186 2127 805 594 269 --12219 --
NM_001039538chr273706 3221 2426 2278 1402 579 412 13157 83428 2467 1229 1068 1058 979 491 241 1278
NM_001039547chr3248032 7161 7119 6978 6849 6812 6782 6558 6426 6023 5675 5178 3024 2787 2515 2433 2357 2248 2051 1294 1235 844 585 230 77915 3221 2465 1592 1351 959 497 83200 3100 2998 2555 2469 738 174 139 --
NM_001039570chr2274641 4615 4599 4493 3548 407 398 14550 24672 4666 --
NM_001039571chr2274641 4615 4599 4493 3548 407 398 14550 24672 4666 --
NM_001039573chr171417 ------
NM_001039577chr1103673 3476 1590 1180 1162 1144 789 450 438 185 11050 14498 --
NM_001039580chr4224647 4638 4620 4445 4197 4082 4065 3532 3360 3328 3201 3143 2024 1976 925 694 564 313 143 78 31 23 53301 1768 639 602 100 54410 3923 2043 2033 795 34798 4129 3930
NM_001039585chr1153266 3224 3048 2944 2879 2824 2757 1703 1681 1450 1159 708 572 536 529 21536 1143 94243 3338 3236 2728 1686 1576 960 691 627 --
NM_001039590chrX113913 3808 3514 3435 3280 2870 1406 1136 810 754 541 33466 3027 2915 63470 2722 2703 2591 1513 1433 11420
NM_001039591chrX113913 3808 3514 3435 3280 2870 1406 1136 810 754 541 33466 3027 2915 63470 2722 2703 2591 1513 1433 11420
NM_001039618chr11305836 5714 5447 5374 5260 5000 4907 4877 4792 4712 4683 4456 4435 4243 4191 4121 4068 3933 3673 2369 2308 2253 2240 2220 1877 1676 1564 1508 1195 331 45782 1413 1136 341 55671 1557 1480 997 752 11418
NM_001039661chr1141127 1007 990 847 --21108 1072 --
NM_001039693chr283739 3275 2783 2674 1609 1201 1127 1092 14116 13726 --
NM_001039709chr2065299 5245 4005 3793 1536 725 24207 688 14211 --
NM_001039711chr141101 972 451 201 --1836 --
NM_001039712chr141101 972 451 201 --1836 --
NM_001039715chr1--1958 ----
NM_001039716chr1--11022 ----
NM_001039762chr1041806 1554 1520 64 11710 1367 --
NM_001039802chr131362 1144 237 --11267 --
NM_001039840chrX195549 5373 5247 5226 4680 4662 3717 3696 2406 2358 1786 1472 1450 1401 1282 1262 999 462 447 43686 1919 1631 1228 55577 2430 2011 1982 845 34453 2272 511
NM_001039885chr1961479 1417 1037 974 533 498 --11203 --
NM_001039916chr12----11004 --
NM_001039917chr12----11004 --
NM_001039918chr12----11004 --
NM_001039919chr12----11004 --
NM_001039920chr12----11004 --
NM_001039937chr13123106 2784 1598 1583 1553 1333 1043 845 470 301 259 27 33905 795 525 73774 3559 2886 610 436 371 183 13555
NM_001040001chr651952 1872 1599 1525 1498 --21714 728 3409 180 175
NM_001040020chr741480 1431 1290 146 3383 267 85 21605 387 21532 475
NM_001040033chr1--1696 ----
NM_001040057chr73461 284 196 31481 1267 439 1934 --
NM_001040092chr82355 47 1105 ----
NM_001040100chr34909 796 275 47 1201 21051 488 --
NM_001040110chr711579 --21704 1689 --
NM_001040142chr292065 1873 1797 1727 673 618 464 389 218 22403 550 31802 1577 754 11573
NM_001040143chr292065 1873 1797 1727 673 618 464 389 218 22403 550 31802 1577 754 11573
NM_001040152chr744822 4743 4683 3385 --54998 4581 3817 3352 1436 --
NM_001040153chr133928 306 274 2808 386 ----
NM_001040157chr462880 2692 2054 858 500 170 42923 2008 193 58 11114 12479
NM_001040159chr431417 128 116 1434 2935 184 11210
NM_001040167chr73855 792 348 ----1888
NM_001040181chr371067 999 935 819 765 93 61 1128 139 1190
NM_001040182chr371067 999 935 819 765 93 61 1128 139 1190
NM_001040183chr371067 999 935 819 765 93 61 1128 139 1190
NM_001040199chr371067 999 935 819 765 93 61 1128 139 1190
NM_001040200chr371067 999 935 819 765 93 61 1128 139 1190
NM_001040202chr441722 1575 767 300 42227 579 175 124 22277 375 11794
NM_001040214chr642344 2244 956 937 32047 1579 753 ----
NM_001040272chr962395 2371 2088 1918 1909 90 ------
NM_001040284chr16165863 5132 4773 4758 4255 4084 2037 1506 1259 1207 1185 929 820 561 472 235 44544 4413 3744 1777 31982 1862 790 24338 786
NM_001040402chr4122824 2672 2497 2399 2061 1220 1155 858 831 586 316 193 21235 389 43008 2794 1182 653 12095
NM_001040409chr23911 817 79 1758 1878 --
NM_001040424chr2152245 1963 1821 1029 745 --12128 11813
NM_001040429chr1373584 3212 2797 2526 2390 2274 2219 42191 1092 1022 114 12441 12609
NM_001040432chr31142 ------
NM_001040440chr54530 508 448 231 ----1556
NM_001040441chr1135204 4292 4201 3634 3346 1579 1558 1489 1158 1134 814 683 140 35429 2118 347 34326 3529 255 24844 276
NM_001040446chr562683 2297 2133 500 343 229 12221 32690 2506 159 --
NM_001040450chr1572681 2292 2221 1883 1786 561 142 --22556 2519 --
NM_001040453chr1572681 2292 2221 1883 1786 561 142 --22556 2519 --
NM_001040633chr72833 704 --2680 278 --
NM_001040653chr3102596 2353 2332 2025 1778 876 841 312 228 198 22082 528 11984 1697
NM_001040665chr7124828 4593 4208 3657 3585 3437 3409 3367 3201 1807 1325 1310 43619 3481 1510 951 53755 3268 3147 1050 53 1267
NM_001040697chr111200 --1104 1616
NM_001040708chr841041 937 461 362 --2301 157 --
NM_001040709chr152307 1965 894 270 258 1800 ----
NM_001040712chr9103525 3511 3168 3064 2824 2708 630 414 324 248 1913 63518 3215 3188 2793 2345 835 23201 2921
NM_001040876chr471688 1596 1524 1437 603 573 258 ----1417
NM_001041chr33415 399 356 --1134 --
NM_001042355chr16104963 4852 4162 4078 4063 4050 1940 1448 1417 291 24181 769 45230 4881 1315 158 1912
NM_001042357chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042358chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042360chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042361chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042363chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042364chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042365chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042387chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042389chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042390chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042392chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042393chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042395chr1061131 951 481 337 190 110 --41489 1292 961 131 --
NM_001042396chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042397chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_001042403chr126852 385 344 246 181 46 ------
NM_001042404chr171962 1940 1762 1675 1547 440 135 --51972 1945 1914 1908 144 --
NM_001042406chr62948 918 11099 1936 1963
NM_001042412chr16104963 4852 4162 4078 4063 4050 1940 1448 1417 291 24181 769 45230 4881 1315 158 1912
NM_001042413chr9104112 3243 2949 2597 1439 682 638 553 282 46 23252 650 63990 3711 3420 3340 2642 2602 --
NM_001042422chr17------168
NM_001042423chr17------168
NM_001042424chr443260 864 812 300 --22850 2180 --
NM_001042425chr631437 1419 1249 --11545 21730 1096
NM_001042440chr541714 1653 1450 384 12059 21544 506 --
NM_001042441chr541714 1653 1450 384 12059 21544 506 --
NM_001042442chr541714 1653 1450 384 12059 21544 506 --
NM_001042443chr541714 1653 1450 384 12059 21544 506 --
NM_001042444chr541714 1653 1450 384 12059 21544 506 --
NM_001042445chr541714 1653 1450 384 12059 21544 506 --
NM_001042446chr541714 1653 1450 384 12059 21544 506 --
NM_001042453chrX71689 1643 1604 1481 690 174 147 --31465 257 188 --
NM_001042459chr32103 36 1312 1344 --
NM_001042472chr201607 ------
NM_001042473chr1092149 2106 1787 1708 1388 845 821 343 157 --61860 1763 1682 1658 392 108 12028
NM_001042481chr1482640 2440 2313 1967 489 380 316 80 32165 1868 820 42686 2630 2175 1854 --
NM_001042486chr2021192 1037 ------
NM_001042492chr1752132 1102 1032 877 212 1613 43133 3128 1038 760 --
NM_001042493chr671911 1598 1288 572 432 373 215 31370 735 333 11353 1592
NM_001042494chr1583133 2903 2679 2456 2427 2402 2338 738 11120 13883 --
NM_001042495chr1583133 2903 2679 2456 2427 2402 2338 738 11120 13883 --
NM_001042496chr1583133 2903 2679 2456 2427 2402 2338 738 11120 13883 --
NM_001042497chr1583133 2903 2679 2456 2427 2402 2338 738 11120 13883 --
NM_001042506chrX61387 1335 1292 578 468 172 ------
NM_001042510chr862067 1651 1390 366 305 79 11515 21505 1368 11487
NM_001042511chr862067 1651 1390 366 305 79 11515 21505 1368 11487
NM_001042517chr135746 677 371 255 158 --180 3819 364 282
NM_001042537chrX22316 404 21973 910 32470 2232 234 12436
NM_001042543chr491522 1387 1366 1350 1338 1223 431 340 149 11399 ----
NM_001042548chr21190 2775 700 ----
NM_001042552chr141018 545 375 204 ------
NM_001042555chr12104543 4389 3148 1563 1300 1157 1106 1051 600 466 44730 3466 1809 1556 44365 3736 1067 880 --
NM_001042573chr17--12014 12050 --
NM_001042599chr2227854 7768 7639 7570 7559 7391 7298 7215 7129 6621 6302 6141 5952 5930 5912 5137 4887 3053 1104 991 835 697 57665 2888 1570 794 769 67485 7271 7029 6577 5891 2973 25918 1539
NM_001042601chr3112880 2853 1172 1039 868 602 546 535 468 126 61 21285 304 --11259
NM_001042603chr12175369 5189 4820 4766 4206 4006 3936 3615 3515 3457 3399 3341 1970 880 524 409 96 13627 63872 1691 1404 1301 1196 1149 11316
NM_001042604chr3174747 4449 4413 3998 3549 3472 3347 3153 1343 1240 1214 1033 1003 860 533 510 463 44623 4576 1727 96 53404 3040 1523 1513 844 21129 604
NM_001042618chr14--183 ----
NM_001042646chr351760 1615 1440 1348 1341 21772 1365 1757 --
NM_001042669chr491669 1657 1526 1493 1181 609 505 415 372 --51555 1549 1498 645 336 2401 279
NM_001042681chr122631 594 --12244 1473
NM_001042682chr122631 594 --12244 1473
NM_001042682chr122631 594 --12244 1473
NM_001042683chr661837 1353 1143 715 573 299 21871 457 21426 237 --
NM_001042749chrX82031 777 718 633 606 358 281 273 2597 236 --21546 1394
NM_001042750chrX82031 777 718 633 606 358 281 273 2597 236 --21546 1394
NM_001042751chrX82031 777 718 633 606 358 281 273 2597 236 --21546 1394
NM_001042762chr73429 419 87 --2176 50 --
NM_001043318chr14114120 4050 3739 3690 3162 2781 1620 1566 801 701 618 23857 3032 34125 4039 3890 --
NM_001043351chr162067 2026 906 635 628 116 11570 31406 774 642 --
NM_001044305chr651511 1365 484 248 90 --11516 --
NM_001044385chr263817 2513 606 262 254 66 23161 1511 --23690 2999
NM_001044387chr1943714 3410 2797 2543 --11446 --
NM_001044388chr1943714 3410 2797 2543 --11446 --
NM_001044722chr5112141 2096 1818 1564 1530 1467 490 231 128 91 33 22075 811 62260 2128 1828 1576 1472 729 11701
NM_001044723chr5112141 2096 1818 1564 1530 1467 490 231 128 91 33 22075 811 62260 2128 1828 1576 1472 729 11701
NM_001046chr5133002 2964 2928 2848 2775 2591 2539 2028 1842 1178 817 709 418 22800 1142 22487 2004 --
NM_001048183chr163408 1365 1104 1031 209 37 13798 23544 2597 1652
NM_001049chr1482293 2270 2224 2207 2011 410 306 210 ----12031
NM_001068chr31287 ----192
NM_001071775chr1391853 1758 1734 1655 1343 719 504 271 235 --1119 --
NM_001076chr4154 1166 1143 --
NM_001076chr4154 1166 1143 --
NM_001078chr12512 297 --1705 --
NM_001079874chr172066 1987 1598 642 502 400 313 11653 22133 759 21850 372
NM_001083620chr4132550 2412 2104 1702 1686 1674 1639 882 812 684 601 568 558 --32562 2439 1616 --
NM_001094chr173831 768 755 --1802 1777
NM_001099678chr3146231 6117 5772 5536 5482 5384 5159 5055 2289 1985 1851 1626 1580 1070 21321 1179 26251 887 21588 196
NM_001100108chr1248317 8212 7190 7180 6771 6242 5988 5792 5076 3353 3106 3067 2991 2423 2325 1851 1600 1283 1252 1200 983 724 601 503 38380 3054 1308 25746 1288 11607
NM_001101662chr1--141 ----
NM_001105518chr13902 801 287 --2879 855 --
NM_001106chr3188894 8837 8654 7855 7033 6828 6739 6106 3377 3146 2459 2390 2270 2245 1972 1746 1498 1005 58145 7837 7346 1532 120 66804 6004 2546 2443 528 179 15910
NM_001109977chr43662 542 263 198 2843 768 1679
NM_001113490chrX143270 3246 3127 2965 2849 2438 2232 1023 1003 907 872 630 179 42 13683 23423 725 --
NM_001116chr1672596 1958 1892 879 399 325 75 --32577 437 372 --
NM_001117chr1892320 2241 2160 1740 639 424 394 197 141 --22408 1749 --
NM_001121chr1081818 1767 1710 1620 698 413 349 286 21941 454 21823 659 --
NM_001122631chr11----1478 --
NM_001123chr105729 339 271 201 52 --1287 --
NM_001124chr111508 1570 ----
NM_001126chr13930 753 407 11014 2962 311 11048
NM_001128chr1693879 3216 3132 2846 2711 1380 1069 662 222 23236 1198 12678 13556
NM_001135chr151821 --1345 --
NM_001140chr172526 23 1660 1534 --
NM_001144chr1621321 178 11242 11127 --
NM_001146chr852339 2154 1988 1802 924 11520 1305 11560
NM_001148chr441991 1392 446 396 ----1312
NM_001149chr1021410 1289 --1420 11010
NM_001151chr4------1193
NM_001152chrX2208 202 ------
NM_001153chr24838 324 282 99 1183 1275 --
NM_001156chr101591 1427 1181 --
NM_001160chr1252679 2252 1758 745 403 22037 342 1605 1484
NM_001167chrX126356 6207 5778 2618 1883 1758 1747 1573 1054 911 838 216 46561 6436 1811 1264 66746 6703 5191 2028 883 550 22592 1847
NM_001172chr141152 ------
NM_001173chr14204658 4551 4505 4473 3909 3501 3213 3067 2873 1733 1588 1344 1320 1218 1057 997 576 403 384 372 54692 4445 823 814 479 24487 1855 24751 4746
NM_001177chr1252423 2347 900 468 323 32279 1550 588 1227 --
NM_001178chr111483 ------
NM_001186chr2153306 2952 2466 947 500 63161 2970 2594 2413 2095 419 32672 2074 952 22250 2054
NM_001198chr6112398 2222 2187 2143 1814 1653 1595 727 457 275 240 22446 1938 42347 2298 344 23 --
NM_001200chr204939 314 157 124 2206 46 21078 304 --
NM_001201chr4173989 3788 3732 3722 3379 3278 3068 2978 1497 1304 1286 1257 951 876 670 611 120 33558 3058 2520 41195 653 308 49 --
NM_001202chr142229 184 ----1288
NM_001204chr2277662 7344 7288 7123 7092 7054 6976 6447 6320 6257 5714 5419 5358 2712 2021 1829 1744 1478 1466 1399 1336 940 821 615 423 296 183 46766 5384 2362 87 117491 7486 5829 4798 2080 1610 1569 1450 906 678 33 32567 902 135
NM_001205chr51433 ------
NM_001206chr9103126 2364 2345 1161 1118 1049 838 776 668 269 --73065 3036 2652 2583 802 760 315 22004 891
NM_001207chr54316 278 122 71 156 1271 --
NM_001211chr156337 289 277 257 144 126 ------
NM_001219chr72857 269 11532 32227 261 41 --
NM_001233chr7122355 2286 2226 1601 1470 931 915 661 625 414 381 170 --12247 1267
NM_001235chr111663 ------
NM_001241chr282441 1963 1789 1717 1627 451 442 417 1233 32180 1776 132 1670
NM_001241chr282441 1963 1789 1717 1627 451 442 417 1233 32180 1776 132 1670
NM_001253chr6------1127
NM_001254chr1751052 769 341 185 113 174 1909 --
NM_001256chr1782911 2550 2274 2152 2121 987 676 392 32101 639 312 42413 2105 1822 371 22899 2296
NM_001257chr1631398 1328 285 11316 1137 --
NM_001259chr7216356 5904 5781 5472 4588 4509 4299 4180 4046 2461 2082 1735 1529 1430 1208 1178 1079 897 834 751 394 45201 793 768 703 85347 5117 4724 1401 1328 1213 962 480 --
NM_001270chr53220 173 125 1826 ----
NM_001271chr1533249 819 51 23052 2406 ----
NM_001273chr121593 --1366 --
NM_001280chr191602 --1251 --
NM_001282chr174908 416 320 250 --1586 --
NM_001284chr51410 2581 525 ----
NM_001286chr172836 2812 2067 1825 1758 514 360 ------
NM_001289chrX5431 272 190 139 48 1174 1620 --
NM_001290chr45882 761 433 426 68 21062 1051 ----
NM_001298chr221083 373 11275 1307 --
NM_001304chr17103696 3557 3323 3122 2799 1342 462 349 314 95 --12714 23862 2780
NM_001310chr1272994 2976 2207 2181 1908 595 302 12657 72955 2484 2449 1948 1914 771 488 42551 1939 327 175
NM_001315chr682303 2044 1586 1579 911 554 470 368 12221 --21572 1397
NM_001316chr204442 433 394 380 ----1143
NM_001326chr112427 393 ----1323
NM_001328chr42721 297 --1494 1768
NM_001330chr162960 310 --1135 --
NM_001331chr11102827 2626 2208 2193 2181 2092 521 259 250 39 12684 42765 2268 469 45 12435
NM_001332chr541334 986 643 594 2274 157 11055 --
NM_001338chr2161067 866 473 418 330 141 1970 1395 --
NM_001343chr551205 1057 483 166 135 11578 11684 --
NM_001349chr2--1126 2413 185 --
NM_001356chrX42409 2318 1771 1708 --42521 1824 1641 339 --
NM_001357chr13270 226 86 ------
NM_001358chr41106 ------
NM_001363chrX3780 690 135 --1639 --
NM_001364chr1194193 4063 3808 3095 2921 1676 996 775 661 24799 3435 31583 1471 1085 1353
NM_001365chr172772 115 --1777 --
NM_001378chr21346 ------
NM_001380chr1021005 126 ----11084
NM_001385chr82300 282 1265 1392 --
NM_001386chr842340 1847 1729 808 --22133 1909 11856
NM_001387chr532760 511 376 12344 31960 726 181 --
NM_001390chr1863623 3586 3165 3111 1385 798 --43331 3171 2691 2638 --
NM_001391chr1841188 961 943 105 --21181 45 11206
NM_001396chr2132665 1108 901 12451 42143 1127 1115 1072 --
NM_001399chrX83731 3225 2936 1459 746 663 500 132 ------
NM_001400chr151008 989 943 236 39 1507 --21138 500
NM_001401chr951366 1171 1016 581 473 --1396 --
NM_001407chr311074 --41150 1065 490 259 --
NM_001412chrX123540 3158 2900 2861 2517 1194 1157 793 552 510 284 139 63627 3552 2694 2455 1111 876 32946 1092 835 11323
NM_001415chrX31563 1419 1244 1792 51821 1816 1546 305 75 1802
NM_001417chr1231386 757 528 --1153 --
NM_001418chr111570 1200 ----
NM_001418chr111570 1200 ----
NM_001419chr19144882 4743 4565 3870 3743 3507 3496 3365 2954 1642 1620 1021 466 218 3961 888 308 74417 4357 4207 4093 1170 1143 989 11232
NM_001420chr1983168 3161 2955 2271 2187 2087 703 600 ------
NM_001422chr1111360 1473 1263 --
NM_001423chr1242030 2005 1548 208 11445 21915 1425 --
NM_001427chr721773 196 --11494 --
NM_001429chr2251036 894 412 378 203 --4899 795 336 39 --
NM_001430chr232003 767 189 11738 1445 --
NM_001431chr641211 890 850 317 --3916 298 212 --
NM_001432chr4153876 3746 3623 3259 3175 2663 2569 2502 1316 1136 1000 861 848 723 220 23545 117 63881 3634 2756 1248 154 143 1944
NM_001438chr1123496 3293 3246 3196 3115 3094 3026 2644 2357 282 274 191 23286 2367 42674 797 315 243 13558
NM_001440chr83437 382 342 ------
NM_001448chrX61797 1676 1655 700 445 292 11552 184 1513
NM_001451chr1671378 1286 1183 969 959 426 74 --3466 459 432 --
NM_001452chr66702 681 640 612 513 159 2648 602 ----
NM_001453chr661724 1201 1191 604 349 191 11356 41384 1300 516 334 1413
NM_001460chr1102602 2434 2388 1157 1135 1104 1085 913 792 207 23567 2344 42940 2234 2221 1215 --
NM_001463chr23810 140 50 --2594 332 --
NM_001482chr154953 857 213 144 2102 76 1154 1707
NM_001483chr73892 719 709 1808 1762 --
NM_001490chr953471 2523 1492 1390 374 13441 2828 607 23005 2534
NM_001491chr652494 1672 986 845 635 22621 610 11733 --
NM_001495chr8127 --21118 797 --
NM_001497chr952761 2676 1859 866 167 1728 21923 826 12143
NM_001498chr621328 200 21275 219 1980 --
NM_001511chr42492 153 1193 ----
NM_001514chr13378 369 137 ----1402
NM_001518chr741096 833 147 127 11104 1326 --
NM_001530chr144865 435 276 71 --2320 285 11031
NM_001533chr19178 ------
NM_001535chr211607 ------
NM_001542chr162389 2107 1860 983 839 646 22365 2151 22376 530 --
NM_001543chr564015 3714 1624 1053 946 869 1939 ----
NM_001546chr651240 1164 1102 425 360 1580 11380 --
NM_001550chr75430 237 127 39 25 --1645 --
NM_001554chr13626 532 214 ------
NM_001557chr221358 1307 21259 1218 ----
NM_001558chr1151563 1542 586 321 21 --11551 --
NM_001560chrX72064 1809 1704 1630 1044 877 361 12138 1327 --
NM_001570chr311124 11436 ----
NM_001584chr1131017 765 81 31137 414 322 11146 4312 166 161 156
NM_001587chrX2217 181 ------
NM_001604chr111259 ------
NM_001609chr10124397 4030 3527 3194 3001 2937 2880 1068 788 646 281 233 44362 1092 737 118 13624 24190 883
NM_001616chr293414 3200 3148 3127 2706 2573 894 688 378 32743 2656 1271 43343 3164 1384 82 1570
NM_001619chr11156 --288 38 --
NM_001621chr7183012 2954 2779 2650 2480 2350 2276 1922 1028 847 756 714 648 521 495 460 371 345 2693 591 22286 157 --
NM_001621chr7183012 2954 2779 2650 2480 2350 2276 1922 1028 847 756 714 648 521 495 460 371 345 2693 591 22286 157 --
NM_001624chr641872 592 329 49 1468 1681 --
NM_001634chr651738 1647 1511 89 60 1608 ----
NM_001642chr1141189 1137 888 435 11350 11195 11155
NM_001650chr18133991 3900 2974 2958 2912 1333 1302 1282 976 891 550 384 215 1249 1896 12797
NM_001655chr1121857 829 1528 32094 364 329 2661 336
NM_001656chr5112032 1825 1788 1650 1586 1532 1355 790 474 263 154 22010 591 11462 2521 160
NM_001658chr141091 1003 988 168 142 ----
NM_001659chr1252536 2150 2032 2026 1831 --12056 --
NM_001661chr171556 --1286 --
NM_001663chr1462357 1867 990 501 392 359 1956 42347 2028 1047 442 --
NM_001668chr141913 856 692 654 --31804 1785 1579 --
NM_001675chr22----172 --
NM_001677chr1--3403 327 123 31000 931 820 1802
NM_001679chr31765 --1529 1644
NM_001681chr121584 --1536 --
NM_001682chr12132892 2871 2625 2568 2228 1796 919 911 675 550 470 423 190 12849 22173 144 --
NM_001684chr174007 3843 3022 2969 2642 1061 793 132 ----
NM_001685chr211129 ------
NM_001689chr23805 659 111 12007 ----
NM_001690chr3102487 2457 2031 1801 1691 793 413 134 91 61 --5625 613 606 600 481 11780
NM_001693chr841119 954 372 308 21232 905 1456 --
NM_001694chr161294 ------
NM_001695chr8134249 3989 3518 3508 2855 2776 1362 1240 1144 263 243 100 79 1856 43922 3865 1355 1312 --
NM_001701chr941566 436 230 223 ------
NM_001702chr81547 ------
NM_001703chr1151 ------
NM_001704chr6------2459 394
NM_001707chr71918 1899 1840 --
NM_001709chr1142914 818 550 458 32761 932 309 42651 2534 2295 1054 1515
NM_001714chr12--1430 2493 422 --
NM_001718chr621196 999 11136 ----
NM_001722chr8----1243 --
NM_001726chr11111 ------
NM_001730chr1341505 1306 405 130 --21523 1311 --
NM_001730chr1341505 1306 405 130 --21523 1311 --
NM_001731chr124899 821 794 237 --2715 56 --
NM_001742chr7101837 1599 1564 1382 1313 1212 731 604 408 374 11675 2380 173 --
NM_001743chr23501 453 48 --1506 1186
NM_001746chr5102916 2784 2687 2632 2287 2130 1988 1801 1099 525 12677 12044 12658
NM_001750chr541714 1653 1450 384 12059 21544 506 --
NM_001753chr771661 1642 1551 1302 615 240 186 11825 11599 --
NM_001754chr2173795 3652 1713 1615 816 644 588 13343 63270 3254 1475 600 548 487 13662
NM_001755chr1672162 1894 1609 1398 578 437 95 11456 42300 2255 1588 499 31868 1477 309
NM_001759chr1254807 4716 4600 4505 3501 11776 34813 3775 649 35008 1803 1580
NM_001762chr75784 751 696 287 173 ----1242
NM_001777chr3134077 4067 3993 3920 3913 3627 3309 3057 1563 1362 1226 745 677 33322 3273 2610 33260 2916 251 --
NM_001788chr72966 684 --1137 1880
NM_001791chr131362 1144 237 --11267 --
NM_001792chr182774 335 --3917 910 401 --
NM_001795chr1631577 1502 1440 ------
NM_001797chr163570 563 78 1746 --2768 681
NM_001798chr1231114 434 345 ------
NM_001801chr51427 --1478 131
NM_001806chr1952952 2932 2785 1111 126 --1964 --
NM_001812chr4189 --1230 --
NM_001822chr23671 541 86 --1738 1584
NM_001830chrX84035 3871 3844 2752 915 825 816 428 13734 73471 2777 974 833 767 491 21 13619
NM_001839chr13772 755 116 ------
NM_001842chr9184 ------
NM_001844chr122394 57 ------
NM_001845chr1341070 931 897 254 ------
NM_001851chr62708 634 1613 --1714
NM_001854chr131340 987 606 11302 31474 1100 386 21242 1078
NM_001858chr6105107 4706 4165 3905 3755 3630 3186 1982 1715 497 44949 4849 3716 2009 74963 4096 3975 2030 1720 1462 93 21734 220
NM_001859chr934004 1529 1052 11324 21563 1079 12606
NM_001870chr3----1253 --
NM_001875chr241065 372 337 239 2725 358 31055 285 120 --
NM_001881chr101469 ------
NM_001882chr52483 174 --1439 --
NM_001884chr51114 1543 ----
NM_001891chr4----2315 34 --
NM_001894chr2251200 1080 902 49 30 --21141 1041 21037 1032
NM_001896chr16------1427
NM_001901chr651079 1015 986 697 97 --1682 --
NM_001902chr1----1307 --
NM_001903chr54869 800 213 180 --1614 --
NM_001904chr33973 145 51 ------
NM_001914chr181376 1345 1349 --
NM_001918chr1199240 9222 9197 9190 8837 8382 7075 6529 6139 5866 5728 2269 1818 972 964 833 714 679 643 66753 3555 2342 2263 1273 1026 48194 6439 3468 1607 17215
NM_001924chr13501 430 355 1421 --1483
NM_001931chr1141203 1193 1048 136 11177 1106 2466 94
NM_001935chr22879 737 1915 ----
NM_001936chr72608 154 ----11802
NM_001938chr151792 1746 1599 1496 1307 21840 1754 1627 --
NM_001940chr121334 ------
NM_001942chr1831822 1450 760 11854 1330 --
NM_001946chr1251184 982 826 769 78 ------
NM_001949chr682757 2746 2693 2657 2374 908 225 39 --22781 879 12454
NM_001951chr82146 138 ----1189
NM_001955chr651114 1072 1033 731 210 --2944 888 --
NM_001957chr4112177 2097 1944 609 546 536 505 479 419 303 134 21910 746 2750 628 --
NM_001963chr45787 714 261 193 155 --2610 579 --
NM_001964chr531120 977 481 11100 21104 1086 --
NM_001966chr331377 1099 290 11265 ----
NM_001968chr41859 2843 359 2874 869 --
NM_001969chr14123407 2833 2794 1493 1191 1185 1163 1118 1018 936 828 210 12785 42448 1036 799 779 1358
NM_001973chr13417 333 285 ------
NM_001977chr451541 1354 1267 539 112 1503 --31533 446 273
NM_001980chr1221966 1627 22264 346 11392 --
NM_001981chr152180 1720 913 543 457 32061 955 282 11730 --
NM_001987chr1273404 3113 1441 944 755 571 427 --21328 1070 --
NM_001992chr592263 1679 1507 1369 679 519 322 159 132 ------
NM_001999chr571383 998 507 492 394 356 220 --21540 399 11188
NM_002006chr4185746 5599 5392 5278 5031 4812 4675 4576 4329 4033 3981 3633 2270 1579 1395 1383 1004 610 35694 4788 52 15790 24623 269
NM_002009chr15112563 2502 2300 2284 1011 967 952 887 744 497 344 22277 920 193 --
NM_002011chr5----1439 --
NM_002014chr12----2271 110 --
NM_002015chr1372731 2716 1086 832 698 677 322 22648 1121 32590 2541 691 --
NM_002017chr1151284 1177 1124 168 47 --2962 854 --
NM_002024chrX72096 2062 1751 1542 1389 690 681 2663 477 51829 1429 260 218 147 --
NM_002025chrX189297 9146 8168 7814 7501 7047 6936 3635 3190 3111 2961 1518 1330 1125 983 748 658 199 49071 8079 6614 264 77905 7461 6970 6145 3028 1287 698 28371 5727
NM_002031chr61154 --1252 --
NM_002039chr43788 625 167 1371 ----
NM_002040chr21113158 2805 2329 2214 2168 1968 1043 977 552 374 96 42133 951 409 184 73151 2701 2417 2295 2061 707 170 1421
NM_002041chr15----190 --
NM_002044chr1551554 1377 1273 1199 133 --11575 --
NM_002045chr31309 ------
NM_002051chr104818 792 768 728 11169 ----
NM_002056chr24809 777 710 119 1862 2834 258 --
NM_002061chr1101871 1536 635 573 451 381 357 351 316 261 --2272 201 --
NM_002063chrX21194 842 --1848 21270 811
NM_002065chr151570 1184 1176 659 517 --21293 147 --
NM_002069chr741241 1203 539 436 2682 565 21168 318 --
NM_002072chr92799 167 1267 ----
NM_002073chr2231178 1083 1073 11577 ----
NM_002074chr121746 1243 ------
NM_002076chr1253284 3022 2187 1986 720 21083 358 11214 --
NM_002077chr93744 631 107 ------
NM_002086chr171553 --12123 --
NM_002089chr43497 465 153 1202 --1268
NM_002090chr47549 476 445 436 261 214 163 2201 193 1176 --
NM_002092chr4144324 3920 3913 3210 1979 1715 1273 1146 1052 1023 941 541 334 139 44032 3701 1031 918 33705 3446 889 23843 448
NM_002094chr162352 111 --2321 80 --
NM_002099chr442028 1537 752 531 --21661 237 --
NM_002106chr41334 ------
NM_002107chr12426 94 ------
NM_002126chr17103190 2982 1490 1462 1120 1105 1065 787 622 353 21664 1626 31259 556 545 --
NM_002128chr1332343 872 195 22392 2239 21744 526 --
NM_002129chr42382 158 --157 --
NM_002130chr541547 1434 1297 393 ------
NM_002135chr121484 ------
NM_002136chr12------1204
NM_002137chr752224 1883 1571 952 197 22355 2196 1957 1543
NM_002138chr45655 638 616 209 48 --1196 --
NM_002140chr91780 --3944 349 289 --
NM_002141chr74551 541 484 42 ------
NM_002145chr172325 292 --1379 --
NM_002146chr1731161 1107 1091 11222 21400 170 --
NM_002148chr21135 1449 1263 --
NM_002158chr2123574 3545 3301 3249 2964 2947 2740 1210 749 695 420 107 23357 3016 73789 3550 3434 2789 2349 1492 479 12785
NM_002163chr1611143 --41258 480 245 117 --
NM_002166chr23679 213 192 1659 187 --
NM_002180chr111842 ------
NM_002182chr382774 2744 2722 2703 2675 2577 2027 2005 --42799 2680 1019 423 11942
NM_002189chr105715 706 666 659 281 154 ----
NM_002190chr64410 386 264 231 1331 2335 243 --
NM_002193chr241808 1427 1400 152 1219 21515 1451 --
NM_002194chr21127 ------
NM_002196chr2041139 820 786 775 --21058 1025 --
NM_002196chr2041139 820 786 775 --21058 1025 --
NM_002199chr4--4808 653 92 66 2788 70 --
NM_002201chr151109 ------
NM_002202chr53901 718 21 ------
NM_002203chr563874 3102 1516 1165 564 91 43852 457 225 128 23788 1530 13109
NM_002207chr32681 311 ------
NM_002210chr2133300 3006 2457 2442 2185 1441 1234 1135 992 909 812 593 349 2658 292 53265 1300 974 570 465 --
NM_002211chr1051148 1041 909 838 467 1761 41005 819 813 154 1806
NM_002214chr7105531 5463 5390 4833 4740 3888 1911 1336 607 258 35249 5161 4356 65640 5334 4638 4446 612 565 --
NM_002222chr331340 1062 311 --1912 --
NM_002226chr142729 223 --2141 99 --
NM_002229chr19------1423
NM_002232chr12531 440 ------
NM_002234chr123624 536 197 --1763 --
NM_002239chr2298 25 ------
NM_002240chr211100 --2550 89 --
NM_002241chr162617 2082 2066 1938 1159 462 ----12216
NM_002245chr11621 --1473 --
NM_002247chr10112236 1773 1619 1500 942 826 475 397 347 222 164 11521 11952 --
NM_002252chr2----1167 --
NM_002253chr431416 1155 1047 11040 1524 11123
NM_002254chr252142 1609 660 190 176 ------
NM_002264chr3124168 3756 3331 1968 1726 1229 1048 1015 760 643 471 129 24876 3268 44521 4296 3579 1953 --
NM_002266chr17148 ------
NM_002267chr1362077 1753 1708 691 463 250 1798 22354 955 --
NM_002268chr361796 1705 1466 1435 1224 270 --11762 --
NM_002270chr5145594 5204 5095 4661 4288 4143 3741 3664 3438 2245 2183 1679 1484 1226 33705 3490 1919 64301 3812 1661 1605 1052 847 12229
NM_002271chr1352331 1576 791 739 241 ------
NM_002285chr273912 3864 3233 2689 2656 1494 580 --32895 526 495 --
NM_002290chr641277 1053 230 157 1516 1422 11499
NM_002293chr152614 2432 2401 631 576 22768 2545 32451 2406 1731 12517
NM_002296chr161744 1313 1083 667 177 110 --31560 1555 335 --
NM_002298chr1321503 229 --21037 269 --
NM_002310chr5196621 6547 5689 5440 5235 5119 4495 4329 4229 4187 4009 2264 1357 1224 753 744 589 436 157 36010 1968 1386 75881 5637 4673 4650 4404 829 725 14176
NM_002312chr134995 870 718 301 1705 2839 89 --
NM_002314chr72918 262 --2988 941 --
NM_002332chr121177 ------
NM_002334chr1112051 12073 21360 1291 --
NM_002335chr11--177 ----
NM_002336chr12144896 4793 4767 3940 3590 3576 3456 1725 1668 1408 1138 1055 929 184 14985 24814 257 --
NM_002345chr125654 567 480 245 88 3219 72 26 2531 135 --
NM_002349chr231030 374 111 21415 307 51419 1308 1161 525 511 11445
NM_002350chr861238 1010 925 788 458 449 ----11251
NM_002351chrX31763 1541 389 2271 26 2223 30 1361
NM_002354chr23372 350 258 ------
NM_002355chr1251356 565 508 495 405 --4424 181 130 118 --
NM_002356chr672864 2274 2034 1139 999 538 317 --42549 285 278 136 1132
NM_002358chr42531 86 --1159 --
NM_002359chr1753505 3281 1283 1008 722 --24306 3420 --
NM_002360chr762633 2508 2491 2308 2251 2161 --12496 --
NM_002361chr191265 ------
NM_002372chr52664 656 ----184
NM_002373chr151393 ------
NM_002374chr273706 3221 2426 2278 1402 579 412 13157 83428 2467 1229 1068 1058 979 491 241 1278
NM_002381chr221014 859 --1708 --
NM_002382chr143836 449 201 --2141 106 11344
NM_002384chr181696 1973 1983 --
NM_002387chr5165132 5097 5088 4852 4822 4740 4354 3713 3420 2075 1838 1630 1446 1207 603 277 25157 3152 14827 13333
NM_002389chr171838 1822 1627 699 580 440 310 41708 1546 532 391 129 --
NM_002395chr681385 1206 1194 488 454 384 205 184 11236 2982 357 21120 115
NM_002396chr183686 130 24 1220 1563 --
NM_002397chr592158 2074 1733 1516 880 757 696 328 145 1804 21604 701 11627
NM_002398chr231345 1176 1145 --21546 1126 --
NM_002399chr15--1371 3956 444 437 --
NM_002401chr1742506 2448 2131 805 --2401 383 --
NM_002402chr721140 1083 --21208 209 11011
NM_002408chr142272 35 2338 98 ----
NM_002416chr452084 1524 791 658 638 148 ----
NM_002427chr1161264 912 876 829 821 24 1861 ----
NM_002428chr1631414 175 133 ------
NM_002430chr2262256 2068 1673 669 394 280 --52520 2037 473 462 417 --
NM_002438chr106692 496 484 469 177 152 1225 ----
NM_002439chr53910 326 318 ------
NM_002440chr1--1101 154 --
NM_002442chr1221788 254 --41761 1650 1521 264 --
NM_002444chrX51953 1637 808 517 286 ----11498
NM_002449chr561070 1014 801 435 411 356 11239 --1326
NM_002451chr963780 2885 1306 458 372 323 11177 31267 1244 842 31294 1221 749
NM_002460chr683527 3211 1517 1362 1310 1253 853 378 22313 1533 13092 --
NM_002469chr121391 1442 ----
NM_002473chr2231096 964 363 ------
NM_002480chr1251366 1344 1033 494 369 --11039 11096
NM_002481chr1127829 6596 6553 6544 6428 2960 1815 1669 1311 1220 708 320 16730 67811 6704 6515 1619 1253 579 --
NM_002482chr1154 --1667 --
NM_002486chr952537 2186 1595 775 531 --72306 1614 643 262 155 84 61 --
NM_002487chr153762 229 133 2643 594 ----
NM_002492chr32324 72 ------
NM_002499chr1542470 2135 866 386 --41809 766 659 561 2404 399
NM_002500chr22815 391 1496 3913 439 201 --
NM_002507chr17----11740 --
NM_002515chr1481859 1826 1726 1473 474 437 218 72 --11700 --
NM_002518chr2----41142 996 469 459 --
NM_002519chr1161538 1492 1283 1229 192 182 1965 1198 --
NM_002520chr52201 44 1311 ----
NM_002523chr7--11106 11110 11053
NM_002524chr111078 --1245 --
NM_002525chr1--141 ----
NM_002526chr631482 649 289 1632 21620 401 --
NM_002527chr122257 106 ----136
NM_002538chr52572 390 2533 214 --1131
NM_002541chr72986 59 --1991 --
NM_002544chr17--1311 ----
NM_002545chr1165040 4678 4351 4197 788 143 24960 738 45028 4080 458 156 13377
NM_002546chr86754 670 617 600 554 234 --1814 --
NM_002556chr1162108 1761 1646 1633 645 94 11975 1818 --
NM_002577chr374028 3994 2973 2918 2661 2651 1475 1580 63970 2495 2489 1560 456 297 32929 2924 1334
NM_002578chrX1174 ------
NM_002581chr9165639 5541 5524 5433 5354 3905 3816 3616 2258 2190 2015 1655 1559 1470 844 764 25663 4552 55491 4859 4556 4154 3726 --
NM_002583chr123633 511 121 134 ----
NM_002585chr11328 ------
NM_002589chr4----1135 --
NM_002590chr132512 401 ------
NM_002592chr202315 219 ------
NM_002594chr2052364 2141 1694 962 246 31654 630 349 21584 152 12380
NM_002595chr12121834 1614 1523 1396 1351 1213 701 492 344 301 141 76 1781 1706 11434
NM_002600chr141687 702 625 125 --21304 582 --
NM_002603chr81132 ------
NM_002605chr15--1966 ----
NM_002606chr21----1179 --
NM_002608chr2231607 1567 36 --11588 --
NM_002610chr273134 2270 770 399 331 223 201 2189 91 23074 2375 12774
NM_002612chr772128 1777 1665 1390 1371 1356 690 1357 3837 832 220 --
NM_002613chr16105155 5132 5093 5072 4363 3554 3379 1302 224 140 35350 5240 1962 24404 3347 --
NM_002618chr23347 58 46 137 ----
NM_002623chr208776 703 283 200 169 157 120 25 ----2696 163
NM_002628chr351069 881 487 368 105 11048 ----
NM_002631chr12148 90 ------
NM_002633chr11543 ------
NM_002636chr62482 470 --1448 --
NM_002641chrX71699 1650 758 657 293 201 140 --31768 1344 73 --
NM_002645chr1193079 2726 2626 2374 1080 771 553 322 110 23041 2563 32685 1958 1120 --
NM_002647chr183273 222 128 ------
NM_002648chr61909 --11292 1842
NM_002649chr771298 1286 1243 1219 358 298 207 ----11209
NM_002655chr8195090 4962 4849 4561 4509 3954 3753 3574 3525 3372 3356 3325 2006 1824 1540 1245 727 206 105 43781 3380 1989 81 43875 3384 885 311 43689 3489 1608 69
NM_002656chr63777 192 21 ------
NM_002657chr2063781 3710 3318 1514 511 239 --43323 3128 250 244 --
NM_002658chr102885 873 ------
NM_002667chr651285 1223 1060 1005 424 --2360 206 --
NM_002670chr3101526 1472 1239 1177 1150 1091 606 428 263 95 1637 1255 --
NM_002677chr872916 2829 2547 2496 979 166 58 --22999 102 11020
NM_002687chr144506 383 188 163 21122 305 2392 358 --
NM_002699chr11564 21535 1304 51434 1425 1343 1231 89 11421
NM_002703chr451948 1935 1771 1695 575 21847 300 21659 1601 --
NM_002706chr23573 89 22 1518 1538 --
NM_002707chr21293 ------
NM_002709chr232304 682 363 13268 33626 504 380 32920 2598 688
NM_002714chr641106 1084 188 138 ------
NM_002715chr521067 858 --3476 275 269 --
NM_002716chr11123286 3078 2598 2520 2333 2241 1476 1379 1279 996 590 210 1262 33341 1444 988 1450
NM_002718chr351721 1683 1038 945 84 138 11885 --
NM_002719chr1482420 2102 2094 1813 1782 787 565 411 --1511 1698
NM_002721chr9181 1514 ----
NM_002727chr101647 5618 466 192 174 49 ----
NM_002731chr1113077 3065 2759 2667 2327 2133 1243 1159 986 456 234 42715 1941 1223 864 32684 389 323 12049
NM_002734chr1792253 2210 1919 1845 1730 1638 672 629 284 167 31421 141 71 --
NM_002736chr772148 1955 1948 1768 732 570 343 --31863 1381 742 11671
NM_002737chr17146286 5435 5389 4981 4673 4354 2043 1971 1599 1427 1418 964 694 321 --66598 6382 4690 2184 1467 815 --
NM_002738chr163923 788 304 1879 3793 431 253 --
NM_002740chr352731 1919 941 627 571 12470 42820 2748 2643 2034 --
NM_002742chr142731 180 --192 --
NM_002745chr22174500 4452 4310 3842 3824 3732 3635 3582 3571 3315 3272 3219 3199 3108 1520 474 166 23342 1232 21689 292 1277
NM_002748chr155890 840 398 365 86 11188 1978 21193 939
NM_002749chr171231 ------
NM_002750chr101197 --1222 --
NM_002755chr151356 --2728 654 --
NM_002756chr172909 389 --1877 1673
NM_002758chr171535 --1496 1388
NM_002760chrY105908 5428 5377 4771 4429 4324 1355 984 491 368 --75459 5100 4780 4291 1730 612 606 --
NM_002765chrX3928 300 205 1948 1467 --
NM_002788chr14--128 ----
NM_002792chr201121 ------
NM_002806chr14----1315 --
NM_002814chrX3726 662 157 1517 2488 24 --
NM_002819chr1911271 --1109 --
NM_002822chr127616 454 408 374 335 182 110 1524 11496 --
NM_002823chr22272 230 1249 2671 608 --
NM_002825chr71215 --1623 --
NM_002827chr202617 403 --31801 712 191 --
NM_002828chr18----1865 --
NM_002833chr15----11513 --
NM_002835chr71126 --2578 190 --
NM_002836chr20146 ------
NM_002837chr1294005 2907 1614 1475 1219 253 214 187 66 --44574 4300 4295 1224 --
NM_002838chr15918 768 760 55 48 1137 31088 1013 343 1202
NM_002839chr9103525 3511 3168 3064 2824 2708 630 414 324 248 1913 63518 3215 3188 2793 2345 835 23201 2921
NM_002841chr3--1477 2136 104 1442
NM_002843chr1163336 1377 945 638 571 406 32357 387 338 33397 1339 1302 --
NM_002844chr631110 348 142 --1510 --
NM_002845chr183669 650 157 1437 2107 102 --
NM_002847chr751501 1432 258 244 157 11469 ----
NM_002848chr1241016 1007 106 51 --21222 331 --
NM_002851chr72254 191 1552 ----
NM_002852chr33570 230 138 1601 ----
NM_002858chr131121 850 474 --11356 --
NM_002865chr8----1241 --
NM_002869chr1192152 2128 2101 2026 1913 1657 1396 196 43 3757 374 204 21964 388 --
NM_002874chr942526 1765 758 256 2619 342 2809 695 11991
NM_002886chr3115222 5017 4660 3864 3339 1727 1265 822 773 414 74 23956 3602 65198 5190 3354 1313 1206 82 --
NM_002890chr57981 962 846 835 820 693 321 --2651 631 --
NM_002892chr1431268 1176 121 1650 2470 242 --
NM_002894chr18154 --1151 1212
NM_002897chr23675 156 130 186 --1230
NM_002902chr152563 182 189 161 --
NM_002906chr1162116 1816 1741 1629 1560 662 --1905 11461
NM_002907chr122312 124 2380 104 160 --
NM_002912chr68819 786 764 738 387 302 73 34 1710 1608 1634
NM_002922chr12648 459 ----2479 474
NM_002923chr11648 --1663 --
NM_002924chr11197 --2528 128 --
NM_002940chr471688 1596 1524 1437 603 573 258 ----1417
NM_002941chr351652 1264 278 266 247 21138 621 41591 1269 1170 625 --
NM_002942chr351196 1092 449 163 95 ------
NM_002946chr1--131 2451 168 --
NM_002948chr33912 113 73 --1378 1209
NM_002955chr621917 268 --21455 351 --
NM_002956chr1251268 891 538 321 136 21424 477 2349 103 --
NM_002957chr963497 3343 3250 1467 1275 170 23412 3334 23211 2537 --
NM_002958chr36777 658 373 359 183 73 1139 4782 633 366 264 --
NM_002959chr183291 1765 1533 1207 816 789 715 245 --21489 1232 --
NM_002968chr162246 183 --3962 349 205 --
NM_002971chr341118 783 422 379 1838 ----
NM_002973chr121461 --2535 94 --
NM_002977chr283299 1300 929 850 537 396 385 48 --21201 175 --
NM_002979chr16864 826 606 328 194 21 --2690 589 --
NM_002982chr173367 338 139 --142 177
NM_002993chr42711 132 --11048 1227
NM_002994chr441921 1630 551 116 3790 750 485 41958 1636 1465 712 1252
NM_002995chr12176 123 1744 2553 129 --
NM_002996chr161303 11986 ----
NM_002998chr832159 1699 1400 31729 1626 766 31814 597 376 21916 593
NM_003010chr1732293 1533 720 32351 958 901 22225 498 1544
NM_003013chr42708 263 1682 --1791
NM_003014chr741382 1278 1039 954 11057 --11135
NM_003016chr1751971 1588 1465 797 606 ------
NM_003017chr641253 903 888 40 --2373 256 31006 574 223
NM_003022chrX31309 953 78 11291 21222 51 11178
NM_003024chr211369 ------
NM_003027chr152356 29 2407 144 ----
NM_003029chr131200 1039 1025 2999 466 11017 --
NM_003030chr361854 1838 1403 782 646 445 1520 11505 11878
NM_003031chr161675 2891 661 ----
NM_003034chr12258115 7977 7921 7800 6873 6842 6721 6690 6529 6077 5039 3209 2914 2104 1948 1789 1629 1487 1051 830 691 627 603 467 38 87142 5915 5721 5433 5345 5121 2215 205 57689 5627 2651 472 152 21682 797
NM_003035chr13996 958 310 1613 1734 --
NM_003043chr364210 4052 1173 361 313 210 34264 4064 282 24280 4236 --
NM_003046chr8165396 5379 5308 5140 4389 4248 3885 3873 3863 3489 2038 1615 1600 1452 1301 1034 35360 1787 1565 21569 1350 --
NM_003048chr292786 2763 2535 2253 2190 2016 361 341 234 11727 --12455
NM_003051chr151754 1561 1376 531 427 --21683 801 --
NM_003054chr101261 ----1224
NM_003060chr541178 885 852 505 ------
NM_003068chr821073 1059 1709 2895 380 --
NM_003069chrX3662 297 186 3504 288 279 1576 --
NM_003071chr371753 811 637 385 344 282 170 31869 761 117 3546 362 244 --
NM_003072chr19--1369 ----
NM_003073chr22------1247
NM_003074chr352028 1543 1497 534 527 --22215 356 --
NM_003082chr146553 446 395 353 124 62 1340 2489 428 1485
NM_003088chr72761 322 --11091 --
NM_003099chr15176600 6548 6391 5072 4793 2516 2497 2253 2020 1575 1563 914 843 421 296 185 162 36336 380 214 11528 24754 2002
NM_003100chr52381 320 1105 ----
NM_003105chr11--142 1105 --
NM_003106chr33988 885 266 2965 928 1949 --
NM_003107chr621741 350 --21728 482 --
NM_003108chr2217132 7113 6783 6661 6566 5862 5721 5653 5506 5458 5423 5141 5107 4852 4603 4553 4504 1467 974 962 541 14916 96807 6347 5443 5001 4779 4739 2136 782 331 --
NM_003110chr1741062 946 709 289 --2992 954 --
NM_003111chr271399 1183 1152 1081 1010 489 210 1553 31163 151 35 1526
NM_003112chr7103021 2866 2673 2632 2596 1994 1075 958 913 368 22282 2141 42475 1205 646 353 --
NM_003114chr86780 642 278 193 173 133 1734 2554 138 1271
NM_003115chr11310 --2118 47 1408
NM_003128chr262795 1738 1098 871 836 412 12467 ----
NM_003131chr642080 756 716 49 1688 ----
NM_003133chr15753 673 400 248 195 185 1200 1151
NM_003135chr52281 248 ------
NM_003137chr632261 1557 154 11940 2795 772 --
NM_003144chr662092 1922 553 526 51 33 ------
NM_003149chr321428 1394 --11314 --
NM_003155chr852662 2415 577 400 113 --22757 850 12745
NM_003156chr1141363 1260 1213 175 --21047 365 --
NM_003157chr3141 1867 2681 298 --
NM_003161chr17143581 3551 3345 3101 2936 2694 2643 2532 2392 1190 1151 1113 532 315 --22665 723 12703
NM_003162chr261119 1089 937 887 753 257 1840 2909 798 --
NM_003171chr10----155 --
NM_003174chr103166 102 74 --1352 --
NM_003176chr13342 69 59 --1226 --
NM_003176chr13342 69 59 --1226 --
NM_003178chr361904 1869 1836 1469 829 487 1726 --21825 750
NM_003182chr72358 90 --1138 --
NM_003182chr72358 90 --1138 --
NM_003184chr871108 1023 981 950 833 785 160 11002 1696 --
NM_003185chr2071263 1170 1079 1040 1004 864 330 11283 41287 1206 929 412 1408
NM_003186chr111387 ------
NM_003188chr6----1154 --
NM_003189chr183003 1041 1022 808 670 642 304 225 --22802 2491 --
NM_003193chr11140 ------
NM_003194chr63543 462 182 ------
NM_003199chr1895294 5269 5094 3831 1950 1719 890 796 25 --65029 4019 3672 3667 1922 1324 34157 4135 4130
NM_003201chr101942 1688 4759 744 202 165 --
NM_003202chr521899 1842 11748 ----
NM_003204chr1721719 1359 --31750 1732 1559 --
NM_003206chr62424 401 ------
NM_003211chr1261548 1425 1375 1307 1132 710 1100 31507 1467 1336 1538
NM_003213chr121191 ------
NM_003217chr1271854 1764 1758 590 540 139 122 ------
NM_003220chr631437 1419 1249 --11545 21730 1096
NM_003221chr684046 3990 3635 3553 3509 2725 444 394 11465 22892 1449 --
NM_003222chr201878 1845 ----
NM_003223chr163861 787 678 --1694 --
NM_003234chr352343 1767 888 672 254 --2724 376 --
NM_003242chr321563 685 11609 42434 1856 999 578 --
NM_003244chr182462 85 --1301 177
NM_003246chr1531988 1853 272 --41937 1757 1744 241 11740
NM_003247chr651931 1855 1842 425 335 1789 21677 285 11418
NM_003253chr2141884 1509 698 247 41432 1392 708 500 ----
NM_003255chr1742632 2442 2375 862 --22429 2079 1914
NM_003257chr1521286 242 --1247 1412
NM_003262chr3154582 4332 4213 4120 3675 1715 1675 1576 1444 1213 920 778 771 522 272 34159 1995 1974 53280 1300 1141 581 456 31338 998 761
NM_003269chr621176 350 ----1452
NM_003270chrX5991 843 789 405 77 --1361 --
NM_003272chr13261 245 113 ----1177
NM_003274chr2142660 1008 500 200 --52750 2701 1055 1013 850 --
NM_003275chr931216 387 228 --21242 1229 --
NM_003286chr2031162 1125 193 1408 2968 255 --
NM_003288chr20----1581 --
NM_003290chr1931241 288 143 --1230 --
NM_003295chr131138 ------
NM_003298chr355697 5452 4790 2417 77 --32029 1578 1566 15633
NM_003300chr141498 ------
NM_003304chr381580 1456 1069 1024 641 511 497 265 1274 31380 1366 614 1476
NM_003309chr671691 1459 1344 1308 1301 1214 98 --11804 --
NM_003319chr2------1255
NM_003320chr1164454 4383 3670 3438 3112 2840 11102 24406 4066 21741 1163
NM_003330chr1231797 1578 1173 --11587 1679
NM_003336chrX3989 884 216 2918 296 2362 281 2830 90
NM_003337chr571740 1633 699 445 304 235 172 41725 1449 1217 536 2593 329 --
NM_003338chr1041856 1601 724 424 --31938 478 307 --
NM_003339chr521623 86 --21337 383 11152
NM_003340chr441011 962 912 200 2555 479 21158 122 --
NM_003341chr33532 133 29 ----1516
NM_003342chr17123309 3155 3011 2475 2355 2226 1324 1051 681 638 338 33 12700 1567 --
NM_003344chr741594 420 351 37 11158 21758 1743 --
NM_003348chr1251722 686 671 489 256 11615 31456 1310 367 4363 358 353 348
NM_003350chr84952 854 844 375 1363 ----
NM_003352chr23694 687 360 --146 2792 787
NM_003358chr9----1133 --
NM_003359chr461165 1133 925 511 431 275 11076 11178 --
NM_003360chr42250 62 1193 ----
NM_003369chr1162708 2661 2433 859 298 292 --32823 206 193 --
NM_003372chrX2165 132 1217 2320 228 --
NM_003373chr1051939 1804 1718 1633 694 --21602 1435 --
NM_003374chr5137 ------
NM_003375chr10--1137 1412 --
NM_003376chr641739 1370 1236 318 1406 21845 272 --
NM_003376chr641739 1370 1236 318 1406 21845 272 --
NM_003384chr14----181 --
NM_003385chr23687 142 117 ----1812
NM_003387chr272673 2579 2562 2016 974 328 209 52709 2496 694 649 577 22623 658 22736 2515
NM_003390chr111155 1991 187 --
NM_003392chr3124350 4326 3921 3892 3382 3085 2898 2859 1518 185 91 46 24233 4101 84331 3907 3146 1195 864 539 225 98 14106
NM_003400chr22248 202 1844 1602 --
NM_003403chr142528 89 ------
NM_003406chr8111865 1819 1600 1521 1233 737 723 655 603 273 116 1417 1636 --
NM_003407chr194669 571 512 497 ------
NM_003409chr1831015 147 86 --11387 1270
NM_003410chrX153073 3022 2537 2113 1100 1081 900 712 641 515 507 498 310 293 129 12198 32429 605 233 1906
NM_003411chrY91363 1330 1236 686 652 471 283 221 124 31751 1540 1244 21634 657 --
NM_003412chr343023 2787 2346 648 32993 2208 694 3827 591 204 12933
NM_003413chrX82021 1751 1565 1374 1316 517 482 240 1729 11648 --
NM_003418chr32222 119 --3737 624 51 --
NM_003432chr5232 21 ------
NM_003436chr19----1713 --
NM_003439chr763461 2801 2202 434 414 51 --22593 1362 --
NM_003442chr115862 845 826 686 641 --1831 --
NM_003443chr1127 --196 --
NM_003452chr92920 862 ------
NM_003453chr131231 ------
NM_003454chr1631412 1206 316 --31450 1431 536 11212
NM_003457chr171167 ----1150
NM_003463chr6123129 3058 3029 2957 2442 2302 1299 873 852 545 486 380 22996 1049 52816 2287 1315 953 785 22244 594
NM_003468chr2104318 4292 4209 3680 3404 3036 1055 481 258 204 24008 3307 31565 1115 307 11468
NM_003469chr23481 431 26 --1360 --
NM_003471chr3102176 1904 1820 911 674 577 566 533 344 203 1905 12333 21550 647
NM_003472chr681389 1103 960 586 419 341 329 249 --2578 235 --
NM_003473chr1021009 826 21060 428 --1433
NM_003474chr1042205 1571 818 291 1301 1354 --
NM_003477chr111117 ------
NM_003478chr11113298 2922 2913 2789 2200 2113 987 751 616 149 89 31159 996 662 53350 3329 2865 2809 332 13169
NM_003482chr1232753 2431 1819 --12564 --
NM_003483chr12112860 2847 2491 1976 1906 1818 1177 1134 591 569 536 11987 12627 12031
NM_003489chr2193441 3191 3118 2954 2801 2272 1333 1169 170 52674 2534 729 720 356 3554 365 360 --
NM_003498chr1652786 2436 965 897 264 --32500 1950 867 --
NM_003503chr13839 817 56 --11175 1111
NM_003505chr731856 1298 354 11949 21306 1209 --
NM_003506chr851165 887 880 455 226 41093 478 326 306 21194 330 --
NM_003507chr281932 1770 1556 793 746 737 610 441 --11987 11737
NM_003508chr71274 ------
NM_003557chr141663 1588 1433 1069 ------
NM_003566chr1293264 2822 1385 979 688 353 300 171 134 22638 1116 83454 3308 2688 2345 1120 950 914 205 12724
NM_003569chr66581 569 482 287 173 119 --1127 186
NM_003573chr191265 ------
NM_003574chr18205738 5580 5130 5082 4802 4577 4550 4325 3977 3635 3612 2248 1741 1575 1479 1211 1010 794 728 391 31668 1647 1425 54731 4514 4043 2290 977 24424 337
NM_003576chr13--1375 42294 1018 622 245 2238 233
NM_003579chr1------1142
NM_003582chr1140 ------
NM_003583chr1261334 831 789 294 204 91 42470 1381 1244 190 31357 1253 734 23396 1249
NM_003587chr6----180 --
NM_003589chr1331369 1165 1055 21087 1080 21434 932 --
NM_003590chr2163976 3499 3080 2860 2507 1548 1496 1249 1232 1187 973 928 798 697 487 385 33217 3059 718 23400 2489 --
NM_003597chr282269 2174 1972 1870 1792 1590 1452 886 ------
NM_003603chr422095 848 42153 1839 795 527 ----
NM_003607chr164037 3497 3299 3205 3148 1077 54342 4177 2954 958 516 44201 1571 348 255 14197
NM_003613chr154498 473 138 114 --1143 --
NM_003615chr3153992 3898 3847 3366 3291 3098 2998 2648 2583 1339 767 394 342 289 278 42917 1216 848 413 41287 1268 1140 1056 43669 3372 1043 955
NM_003617chr1174784 4516 4494 4130 3829 3376 3055 1632 1548 1540 1165 806 535 458 162 139 39 54943 4893 3291 750 519 44422 3434 3199 2005 23867 3337
NM_003618chr23465 302 241 21214 378 31133 978 111 21273 994
NM_003620chr172784 159 ----31048 959 860
NM_003622chr1272547 2418 1852 1720 1669 813 497 22614 280 3546 487 53 22155 2139
NM_003626chr1171362 1346 1335 1250 1240 549 247 2189 134 41370 1129 1001 252 --
NM_003629chr173224 2911 2895 2398 2270 988 579 13153 1422 --
NM_003630chr64602 499 172 154 2776 300 2728 41 --
NM_003631chr105783 658 354 259 223 1975 ----
NM_003632chr172874 815 ----1604
NM_003633chr541866 1638 1012 783 21772 1668 22559 2309 --
NM_003645chr15----2250 189 --
NM_003655chr172627 522 1310 ----
NM_003663chr3122343 1221 988 944 818 615 535 518 359 351 308 86 12443 33367 904 430 33185 2884 980
NM_003668chr121267 ------
NM_003670chr381417 1381 1287 1275 1209 422 251 25 --31185 1069 30 --
NM_003671chr943479 3427 2497 457 23069 571 33465 390 107 --
NM_003672chr1101935 1902 1596 1287 665 407 359 283 259 226 41946 1544 1266 451 1272 11797
NM_003675chr102419 361 --1204 --
NM_003676chr11631 ----1651
NM_003681chr2156227 4292 607 168 107 --1529 --
NM_003682chr112832 277 ------
NM_003688chrX2300 278 ------
NM_003692chr93997 266 79 1693 3379 204 94 --
NM_003709chr23405 328 308 ------
NM_003713chr141763 1661 1520 1461 ------
NM_003714chr542448 2433 2321 731 2879 694 23089 2728 --
NM_003716chr3----4980 861 738 733 --
NM_003718chr75513 487 431 423 172 --1114 --
NM_003722chr392672 2657 2541 1859 1780 1773 1754 622 452 22601 677 42554 2132 1955 1789 --
NM_003725chr123419 393 295 1338 ----
NM_003743chr262124 1950 828 793 555 68 --3866 284 162 --
NM_003744chr141525 11337 21267 238 1932
NM_003745chr162379 61 1373 2349 51 --
NM_003746chr12----1209 --
NM_003749chr1342457 2177 1799 735 11766 21837 1687 --
NM_003758chr1541204 1157 1132 129 11566 21150 451 --
NM_003758chr1541204 1157 1132 129 11566 21150 451 --
NM_003759chr484290 3655 1482 958 810 639 227 108 74277 4211 3438 3293 2735 691 625 54040 4004 2656 862 214 14097
NM_003760chr14561 248 234 47 ------
NM_003762chr151443 926 576 283 231 1326 --11429
NM_003763chr2083001 2978 2969 2470 889 494 355 277 --11991 --
NM_003764chr66753 739 720 637 592 543 --1648 --
NM_003766chr172594 169 ----1146
NM_003769chr122224 51 1335 130 --
NM_003772chr1131228 350 180 1419 --11122
NM_003774chr12143215 3074 2483 2425 2400 2386 2373 2222 2171 1302 1047 661 426 208 22649 85 83395 3149 2506 2430 2405 2394 2058 485 22513 90
NM_003778chr32317 137 ------
NM_003779chr11483 ------
NM_003783chr12999 129 1471 ----
NM_003787chr1851656 1603 1480 1325 1213 41239 1139 473 204 2537 225 11157
NM_003794chr331004 879 391 1173 ----
NM_003796chr192590 419 1182 2424 114 --
NM_003798chr91132 ------
NM_003799chr1883932 3904 3543 1558 1503 958 532 226 --21123 750 1998
NM_003800chr692233 1998 1842 1543 731 657 648 386 219 1821 32362 2309 2277 --
NM_003809chr17----1486 --
NM_003816chr831002 466 52 --1589 11520
NM_003818chr2041081 981 141 135 ------
NM_003819chr11269 ------
NM_003821chr82490 152 --160 --
NM_003822chr173079 3011 2882 2066 1937 825 26 --12462 62627 2470 2458 2453 2092 128
NM_003825chr1531343 1030 203 --41282 374 368 293 11488
NM_003829chr92254 159 11193 1941 --
NM_003831chr1821828 122 1429 11568 21529 386
NM_003838chr191464 1405 1394 1247 454 390 222 203 60 11100 1514 11353
NM_003850chr134635 549 525 240 ------
NM_003858chr141643 --1522 1279
NM_003861chr1432716 2585 407 --21950 1852 42422 2087 2082 2063
NM_003862chr52106 75 ------
NM_003864chr4--1185 ----
NM_003870chr1562044 1957 1593 1491 1343 246 11435 ----
NM_003873chr1042333 2266 1031 944 11560 22391 870 --
NM_003877chr125971 913 647 187 105 ------
NM_003884chr371735 1580 1133 749 590 548 519 31867 1793 700 31637 711 409 2416 200
NM_003885chr1712115 --42671 2661 2172 1923 --
NM_003887chr272343 2161 1935 1835 1658 1437 547 31708 1683 770 22246 2199 2392 257
NM_003888chr1581724 1710 1537 1383 1261 314 106 54 ------
NM_003895chr2152105 1701 1637 810 520 2536 263 2744 34 1444
NM_003899chr132882 555 --22609 1778 --
NM_003909chr882993 2895 2749 1230 965 683 488 83 22179 701 2295 160 32147 830 706
NM_003913chr6104275 3229 3175 1690 1567 1468 1109 1094 1075 1013 43763 3752 3273 972 33261 777 657 1577
NM_003916chrX31508 1139 1061 1240 21488 569 --
NM_003922chr15172 --2397 175 --
NM_003927chr183948 409 159 2972 418 1199 --
NM_003929chr11550 --1347 --
NM_003930chr7132500 2492 2416 2405 2106 1870 901 718 534 258 231 114 45 32477 2238 296 32220 539 391 1133
NM_003932chr2291874 1865 1722 1537 766 738 504 294 120 1481 11359 11425
NM_003934chr991266 1091 1059 926 915 874 467 340 212 --31173 898 204 --
NM_003936chr211010 ------
NM_003939chr1044049 3712 3201 3071 13792 43097 2693 1514 377 --
NM_003941chr77361 348 321 253 114 55 29 12215 4921 700 455 132 11837
NM_003942chr111153 ------
NM_003948chr462346 2122 1966 1644 1632 446 1331 1653 1539
NM_003951chrX3283 159 76 ------
NM_003953chr172866 2763 2197 1966 764 499 262 12879 12846 1626
NM_003956chr103460 371 85 1508 1484 1111
NM_003957chr111745 ------
NM_003958chr683356 3097 2679 2612 1209 831 405 273 33830 1399 779 2892 843 --
NM_003961chr16--1209 ----
NM_003966chr5137785 7336 5232 5185 5038 4907 2854 2752 2355 1214 1156 861 255 25983 2405 56527 2089 2040 1797 1029 46146 5222 5175 295
NM_003968chr35673 578 565 248 45 ------
NM_003971chr172245 73 --155 1516
NM_003972chr101265 1347 ----
NM_003977chr111103 ------
NM_003980chr621300 269 1225 --11132
NM_003983chr1684383 4316 4288 3835 3451 3169 500 287 1386 13285 1872
NM_003987chr1012025 ------
NM_003988chr1012102 ------
NM_003989chr1011961 ------
NM_003990chr1011961 ------
NM_003994chr12124318 3918 3824 3770 3375 3115 2821 1745 1271 1077 1044 61 44394 3576 2919 248 33679 1376 28 --
NM_003995chr92246 213 ------
NM_003998chr44665 577 493 255 1631 2677 476 1673
NM_004006chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004007chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004009chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004010chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004011chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004012chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004013chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004014chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004015chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004016chrX52429 2316 1648 713 97 22571 332 22486 1931 12121
NM_004017chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004018chrX52429 2316 1648 713 97 22571 332 22486 1931 12121
NM_004019chrX1115 ------
NM_004020chrX52515 2402 1734 799 183 22657 418 22572 2017 12207
NM_004021chrX52429 2316 1648 713 97 22571 332 22486 1931 12121
NM_004022chrX52429 2316 1648 713 97 22571 332 22486 1931 12121
NM_004023chrX52429 2316 1648 713 97 22571 332 22486 1931 12121
NM_004028chr18133991 3900 2974 2958 2912 1333 1302 1282 976 891 550 384 215 1249 1896 12797
NM_004034chr101591 1427 1181 --
NM_004035chr1774917 4479 3683 3309 2027 1687 382 --54967 4299 3382 3372 327 14273
NM_004036chr22621 578 1699 148 --
NM_004037chr11893 ------
NM_004040chr241120 1062 537 258 --31268 1019 515 --
NM_004047chr1138 ------
NM_004050chr1432682 1919 308 12592 22726 2596 --
NM_004052chr103752 110 41 2792 323 1601 --
NM_004056chr82874 284 1853 1776 2923 820
NM_004060chr521242 472 ------
NM_004064chr1241114 905 862 234 --3954 526 355 --
NM_004067chr761530 1176 1023 628 591 428 11324 31511 1295 457 1435
NM_004071chr2----175 --
NM_004073chr13255 237 220 ------
NM_004080chr741317 1230 1111 239 --11025 --
NM_004081chrY21608 270 1696 ----
NM_004087chr341967 1739 1493 180 ------
NM_004093chr1373280 3130 3071 2692 2011 1102 27 13183 22426 2074 13152
NM_004094chr1472917 2596 2486 1011 812 115 109 22965 2788 21058 841 1496
NM_004096chr1052070 1389 729 707 545 11935 11366 --
NM_004097chr2----1318 --
NM_004098chr1021285 1212 ------
NM_004099chr941921 828 366 229 --1792 11716
NM_004100chr631644 963 823 ------
NM_004105chr221074 420 31055 1023 70 11059 --
NM_004109chr1171848 1762 1623 250 57 43 23 32276 485 122 1180 12374
NM_004113chr341401 751 444 187 1458 1615 1352
NM_004114chrX2276 183 ------
NM_004124chr14113333 2956 2900 2745 2416 871 737 384 228 97 73 23294 945 53541 3301 3144 3041 1395 1776
NM_004128chr132198 114 --1445 --
NM_004133chr872488 2430 2029 928 612 235 135 --52601 2518 1919 1831 664 2544 334
NM_004136chr1573161 2871 2722 2662 2555 2515 829 1270 33285 2835 785 --
NM_004152chr192282 263 ------
NM_004161chr231079 1042 301 11063 41636 1511 1218 258 --
NM_004162chr341186 998 955 425 --21146 932 31178 867 142
NM_004163chr182431 405 1135 148 --
NM_004170chr921501 324 11151 2690 135 --
NM_004171chr11278510 7976 7857 7830 7617 7264 7094 7081 6915 6779 6675 6510 6138 6018 3437 3227 2801 2786 2116 1858 1473 956 939 874 825 233 116 46060 3298 741 199 58148 7390 1835 913 891 --
NM_004172chr542036 1723 1367 1310 --22023 1426 --
NM_004177chr1151815 1534 706 406 364 ----11839
NM_004180chr22564 438 --1160 --
NM_004202chrY170 --149 158
NM_004207chr17------168
NM_004209chr1611141 ------
NM_004215chr81596 185 1469 --
NM_004225chr871504 1380 1208 1087 978 950 139 --1461 1576
NM_004227chr762884 2846 2579 2291 595 579 1867 --11108
NM_004228chr192168 25 ------
NM_004229chrX61835 1775 1541 1368 691 310 1434 11980 --
NM_004232chr18103484 3219 2818 2674 2462 2455 1420 1060 607 524 23273 690 33319 1368 181 1511
NM_004235chr95845 793 625 553 51 1893 158 --
NM_004240chr19182 ------
NM_004241chr106713 609 557 132 46 22 --2734 289 --
NM_004242chr65433 345 161 76 63 ------
NM_004244chr123533 381 372 --1426 1433
NM_004253chr97955 862 826 753 371 332 26 --2735 324 --
NM_004261chr151027 973 245 108 83 1907 1927 --
NM_004264chr1251023 849 335 153 136 11256 21121 485 --
NM_004268chr115971 375 286 177 136 11178 1936 --
NM_004272chr552036 1750 481 394 378 21741 1295 1675 12016
NM_004273chr1095056 5008 4576 4278 3961 3618 1337 1296 784 1392 23517 1380 --
NM_004274chr1472203 2127 1256 1108 904 783 583 ----12509
NM_004277chr651536 1379 643 575 83 --1146 11155
NM_004279chr7102379 2299 1996 1935 1628 853 732 260 208 116 --1354 --
NM_004280chr62157 104 ------
NM_004282chr61561 2183 62 1520 --
NM_004285chr176081 5985 5306 4675 3942 1553 39 35356 4859 2131 16440 --
NM_004287chr1742403 2148 1946 670 ----12595
NM_004290chr531259 874 142 --21020 295 --
NM_004291chr52293 43 --1106 --
NM_004293chr9163007 2814 2548 2478 2372 1347 1339 1325 1248 1092 816 772 662 617 420 364 2852 783 23507 1536 1246
NM_004296chr1441557 1420 795 553 --13982 --
NM_004301chr34347 314 265 246 --1251 --
NM_004302chr1232278 2263 1140 ------
NM_004311chr1082972 2813 2511 2233 1971 401 220 72 --32983 2931 2767 --
NM_004319chr152484 2069 2028 1056 86 --33016 260 248 22406 657
NM_004323chr962609 2537 2525 1962 1712 292 11055 --11857
NM_004326chr14289 267 129 63 --3401 233 219 1496
NM_004329chr103993 986 342 31465 1046 1010 --2487 220
NM_004330chr155998 947 381 360 90 1235 ----
NM_004331chr852156 1805 886 824 67 32624 575 153 3895 880 793 --
NM_004337chr872228 1573 1420 683 618 479 298 --3894 623 276 --
NM_004338chr18146979 6641 6555 6156 5320 5126 4980 4946 4346 2706 2511 1269 279 222 16702 46865 5190 883 470 35446 5369 1053
NM_004342chr752219 1979 1942 1616 737 1835 42317 1932 552 118 --
NM_004354chr43862 256 155 2815 214 2297 233 2705 694
NM_004360chr1651948 1728 1541 1268 201 ------
NM_004364chr1931033 932 359 --11144 1938
NM_004365chr5156 ----1340
NM_004370chr662172 2127 1820 1585 867 531 12136 31739 760 576 1251
NM_004379chr261707 672 577 286 245 155 11274 21171 84 --
NM_004381chr61138 --1291 --
NM_004383chr15----1405 --
NM_004384chr5112141 2096 1818 1564 1530 1467 490 231 128 91 33 22075 811 62260 2128 1828 1576 1472 729 11701
NM_004392chr1372594 2461 2340 1752 1036 779 581 22111 1744 11771 --
NM_004393chr352333 2020 1608 637 616 --41599 558 216 210 --
NM_004396chr17178 ------
NM_004397chr11113697 3547 3384 3238 2887 2850 2829 1348 1159 1052 443 23965 1731 44044 1328 576 100 13535
NM_004404chr262008 1949 1751 1647 501 185 --1510 12024
NM_004405chr251081 1027 1017 828 55 --1924 --
NM_004407chr42860 118 --1873 --
NM_004411chr75703 523 274 172 114 1715 ----
NM_004412chr10164754 4731 4710 4682 4376 4238 2252 2022 1286 1110 679 466 435 386 359 227 45496 1647 212 185 35335 4496 1828 22230 109
NM_004415chr61753 1644 1620 --
NM_004417chr52568 106 ------
NM_004420chr1132282 194 131 ------
NM_004423chr352692 2670 2465 1677 499 12606 182 --
NM_004426chr12--1209 2682 213 --
NM_004430chr8102515 2499 2436 2180 2097 2085 2042 1752 1099 133 ----12774
NM_004431chr14842 590 583 96 --1810 --
NM_004432chr9112414 2304 1919 1808 1710 831 730 716 663 496 477 --31910 1898 522 --
NM_004433chr131708 1697 520 ----11322
NM_004437chr163481 3189 962 690 649 321 --12980 12640
NM_004438chr2123243 3196 3173 2948 2939 2465 2243 1140 382 236 144 84 --33003 2720 709 12774
NM_004440chr6111994 1828 1772 1701 1660 1590 1380 1293 1276 692 382 21837 1669 11846 --
NM_004441chr3------21264 1132
NM_004442chr121062 250 1606 ----
NM_004447chr1261005 781 443 225 157 54 21049 905 2967 173 2272 235
NM_004451chr11--1696 1618 --
NM_004454chr372236 2168 1937 1896 1606 1596 734 11871 12311 1700
NM_004457chr271628 1247 1227 1060 412 396 115 --21391 621 1217
NM_004458chrX52570 2433 722 683 215 22523 2202 --32257 1064 168
NM_004459chr1731744 1323 396 160 31796 1783 453 --
NM_004463chrX1641 1519 ----
NM_004464chr4153565 3241 3218 3163 2939 2871 2807 2749 1528 600 458 398 379 307 275 --43228 1556 466 359 42770 1622 476 244
NM_004481chr132659 2595 933 --1938 --
NM_004482chr22772 132 --1931 --
NM_004484chrX188 --178 --
NM_004487chr33924 423 193 --21270 1110 --
NM_004491chr1974144 4084 3957 3912 3442 3356 3001 14096 13895 --
NM_004496chr1451284 1149 403 350 123 --21160 862 21217 176
NM_004498chr151124 ------
NM_004499chr54424 378 122 40 1465 ----
NM_004500chr1471901 1561 773 716 496 364 37 22039 703 3694 595 234 --
NM_004501chr154143 3817 1417 1146 678 23120 2873 21642 314 11374
NM_004503chr12----1851 --
NM_004504chr233088 1163 293 32873 2785 965 12792 --
NM_004505chr1731698 1249 170 --31317 562 526 1107
NM_004506chr6179 --2140 95 160
NM_004514chr1753091 2638 2116 819 424 ------
NM_004516chr1931176 869 251 --31271 785 320 1340
NM_004520chr5----2274 249 1714
NM_004521chr102351 342 --1368 --
NM_004523chr1041268 1194 567 171 --128 --
NM_004525chr261468 979 173 156 108 53 21549 91 11490 11432
NM_004529chr921391 1232 --21366 161 --
NM_004535chr2071543 1396 1359 1352 1184 1171 1108 --21341 244 --
NM_004537chr1251258 454 119 104 94 --21238 1217 --
NM_004540chr211936 --1867 --
NM_004561chr112731 684 --1695 11837
NM_004563chr14--1161 ----
NM_004566chr1072552 2359 2299 2177 2036 1754 694 --32336 2325 1783 --
NM_004569chr144670 625 568 505 1216 ----
NM_004571chr2152750 1165 608 572 65 12120 11302 --
NM_004575chr451626 1532 552 492 410 --21558 1214 --
NM_004578chr12869 236 --1366 --
NM_004580chr1551607 1426 1315 1146 108 --11566 --
NM_004582chr1199 1170 ----
NM_004583chr171732 ------
NM_004586chrX145410 5315 5113 4036 3990 3956 3945 2142 2103 1200 842 822 497 149 35302 4222 3711 35034 4462 322 23701 1113
NM_004593chr35900 235 189 137 60 --1886 --
NM_004595chrX2463 165 --1131 --
NM_004598chr563240 2834 2498 2442 2364 480 --43348 2557 1168 225 --
NM_004599chr221709 --1676 --
NM_004600chr171564 1503 1155 980 965 618 346 1601 2955 280 11197
NM_004602chr202557 65 --41435 1174 934 597 --
NM_004607chr5--1196 165 1189
NM_004612chr9134769 4040 3952 3475 2967 1934 1730 1563 1423 955 739 573 109 24363 995 43723 3346 1112 248 13853
NM_004615chrX5881 796 742 720 628 ----1777
NM_004619chr162153 861 738 554 227 220 21717 379 ----
NM_004620chr113625 254 203 ------
NM_004622chr272466 1981 909 703 475 370 293 --42183 914 612 115 2490 469
NM_004627chr211569 1685 ----
NM_004631chr151447 1295 1225 498 428 1512 1563 --
NM_004634chr31616 ------
NM_004636chr31166 ------
NM_004643chr144748 528 184 116 --1804 --
NM_004650chrX41901 1703 1579 148 --21245 128 11921
NM_004651chrX2335 252 ------
NM_004654chrY81299 1182 1090 1037 991 558 376 141 --21394 334 --
NM_004655chr1751407 1352 1065 855 526 21245 422 ----
NM_004660chrY82279 2161 1866 1703 1584 1516 709 337 1245 11754 --
NM_004663chr1531525 1355 102 11533 21241 259 11477
NM_004666chr64317 186 121 27 11059 11394 --
NM_004670chr1091685 1617 1278 348 327 260 85 71 55 1505 --21716 1303
NM_004677chrY2457 423 ------
NM_004681chrY2308 149 1200 1127 --
NM_004685chr13113017 2804 2480 2250 2231 1922 946 862 756 431 391 --62760 2685 2090 1964 1103 846 --
NM_004686chr871298 1249 645 582 532 403 273 1116 1609 --
NM_004687chr1731543 1469 591 --21480 718 11761
NM_004689chr14----2351 342 --
NM_004690chr63729 664 283 1128 1132 --
NM_004696chr14848 805 721 302 --2835 792 --
NM_004698chr1----1212 --
NM_004703chr1782339 1826 952 945 519 291 132 73 1468 1553 1394
NM_004709chrX31343 1141 488 31707 1208 25 144 --
NM_004711chr2223416 579 ------
NM_004717chr731299 982 259 11376 11380 21367 306
NM_004718chr23516 218 88 --1688 --
NM_004719chr12112892 2677 2541 2286 2124 2084 1933 1790 1757 1137 515 12420 1119 12443
NM_004721chr3--1245 1283 --
NM_004723chr12729 261 ------
NM_004725chr1061497 1366 1265 1200 1104 1007 --1495 11089
NM_004726chrX135454 3733 3724 2003 1781 1656 1490 817 767 564 407 396 324 55559 5428 4372 4311 3765 55236 4812 4792 4394 3614 21002 990
NM_004730chr531690 1438 693 2356 305 41943 1738 416 270 --
NM_004733chr34610 250 207 173 1593 2544 464 198
NM_004734chr1373059 2989 2895 2703 2302 2154 1054 --42801 2690 2685 1149 --
NM_004736chr162110 2028 629 538 226 208 22156 844 21965 565 21471 801
NM_004738chr203720 627 464 --22554 2210 --
NM_004741chr101614 1310 2234 52 --
NM_004742chr381821 1580 1540 1152 385 372 132 88 --1355 --
NM_004744chr483761 3534 3087 1519 1155 931 674 507 31529 732 579 31331 701 398 22811 859
NM_004745chr8196596 6165 5732 5677 5602 5334 5261 4710 2732 2297 1099 991 857 824 818 798 351 344 198 36969 6480 1829 36832 2391 1752 26862 6655
NM_004747chr1031347 479 358 21224 221 21596 484 --
NM_004748chr15144212 4190 3875 3328 3086 2896 1650 1587 1418 1397 1303 760 410 234 43924 1126 987 76 52940 2717 1668 1637 297 12825
NM_004755chr144878 822 484 76 41118 1053 849 786 2835 364 --
NM_004756chr1921516 382 11360 ----
NM_004759chr11687 --11609 --
NM_004760chr762303 2049 1629 533 424 56 1545 2881 221 --
NM_004762chr173771 450 147 --11871 --
NM_004764chr124537 223 137 67 1198 3668 246 72 1170
NM_004768chr12967 153 --1842 --
NM_004772chr531090 619 565 31580 1571 455 1613 1130
NM_004774chr1773158 3076 2260 804 589 333 252 22592 600 --2811 578
NM_004775chr18101909 1898 1749 1608 927 892 685 447 335 313 12133 62329 2304 2284 2230 2176 1773 --
NM_004776chr2033290 3161 706 12271 22463 1119 125
NM_004779chr541116 910 901 844 --1526 1169
NM_004781chr12676 487 --31202 448 337 --
NM_004781chr12676 487 --31202 448 337 --
NM_004787chr4----1122 --
NM_004788chr1172704 2681 2374 907 867 390 314 ----12482
NM_004789chr92338 291 173 1440 --
NM_004791chr131690 --133 --
NM_004795chr1321506 336 21640 632 --31861 1645 1494
NM_004796chr1472379 2354 2202 1665 776 377 41 21640 1589 1621 --
NM_004798chr2083605 3453 3105 3005 2907 2571 565 285 ------
NM_004801chr231380 1199 72 --4977 971 631 77 --
NM_004804chr232803 2438 535 22396 381 1158 --
NM_004808chr1083391 2840 2070 1268 1187 659 632 287 ------
NM_004815chr1124876 3817 3207 1707 1661 1274 1032 991 501 398 261 226 23941 802 74070 4055 3973 1117 530 368 44 21612 757
NM_004817chr92613 261 ------
NM_004820chr8199 ------
NM_004824chr631358 1072 919 1965 11250 1225
NM_004830chr63838 340 189 --2736 132 --
NM_004831chr191951 ----1708
NM_004834chr243207 2580 1175 1150 12715 22863 952 13185
NM_004835chr34600 330 310 97 --1324 1866
NM_004835chr34600 330 310 97 --1324 1866
NM_004836chr24880 610 336 124 --1852 --
NM_004837chr141689 1492 1472 318 ----139
NM_004841chr15936 875 712 306 188 ------
NM_004842chr691753 1723 1445 1418 616 550 515 352 133 21227 374 21484 1310 11106
NM_004844chr351026 981 863 480 346 11112 11187 --
NM_004845chrX73672 3506 3386 1195 796 694 314 --33713 2823 801 23738 590
NM_004849chr651604 1335 654 191 70 --1175 --
NM_004850chr22560 102 11222 21291 531 --
NM_004857chr14184043 3769 3748 3709 3422 3279 3263 3105 1887 1839 1827 1787 1654 1470 1196 830 472 280 34219 3461 1805 34583 3919 424 --
NM_004859chr1792907 2181 2056 1952 1911 693 173 111 32 11164 1203 --
NM_004860chr17----1556 --
NM_004865chr61347 --1318 --
NM_004866chr5164853 4773 4733 3972 3862 3802 3743 3698 3341 1949 1682 1608 572 269 242 73 43827 3238 1795 1782 84721 4704 4503 3663 3173 3133 1432 468 1167
NM_004869chr1871376 558 380 337 167 154 54 31411 1369 1312 11702 1374
NM_004871chr1784214 3796 3579 3402 3243 2954 1617 385 --44306 3434 2976 247 --
NM_004873chr1453063 2618 1989 1274 146 --53202 3019 2876 2769 723 12745
NM_004874chr82498 427 1167 ----
NM_004879chr113679 390 251 ------
NM_004884chr1531725 1340 1217 ------
NM_004891chr22222 205 ------
NM_004896chr1071474 1214 1179 502 425 259 204 --1339 21256 155
NM_004897chr106788 743 646 605 593 103 ------
NM_004898chr4102735 2672 2545 2341 1988 1962 958 759 412 251 1924 32027 888 508 1929
NM_004902chr204767 757 287 72 ------
NM_004904chr7135488 5465 5445 4652 4502 4320 4227 4172 2112 1988 766 256 229 65754 5394 4818 2283 2255 1908 104280 4084 2551 2067 1652 1505 1499 1139 811 674 11512
NM_004905chr13894 649 326 --1908 --
NM_004912chr741737 1724 1512 1140 --51412 1182 590 385 83 --
NM_004922chr10----11019 --
NM_004924chr1921090 258 ----1779
NM_004926chr1461800 1443 1202 1165 1133 281 ----31449 1393 1388
NM_004927chr1131428 441 142 ------
NM_004929chr84987 468 443 81 --21366 264 1400
NM_004932chr541748 1499 1410 471 1391 31672 1312 197 --
NM_004946chr51122 1424 --1403
NM_004947chr332357 2231 273 12496 1217 --
NM_004949chr18102079 1725 1699 1642 862 831 465 417 407 324 21464 1402 42090 2084 1793 1452 31581 684 586
NM_004953chr3----1310 --
NM_004956chr7124237 4022 3966 3737 3459 1359 1230 909 775 272 180 84 1101 74470 3668 3438 1511 582 266 105 2588 364
NM_004958chr11110 151 ----
NM_004960chr16----166 --
NM_004964chr12539 73 ------
NM_004965chr214646 166 79 66 --1204 --
NM_004966chr103332 203 26 1693 1984 --
NM_004969chr101193 1220 1442 --
NM_004972chr911073 1731 ----
NM_004976chr1165098 3815 2021 1600 1583 603 ----15167
NM_004985chr12104492 4320 4275 4191 2867 1673 1451 951 598 289 34267 2811 1405 31225 1185 297 21457 148
NM_004992chrX127495 7457 7044 6999 6371 5571 5521 5440 5372 2950 977 117 --78347 6201 5417 5404 2737 1850 943 18302
NM_004992chrX127495 7457 7044 6999 6371 5571 5521 5440 5372 2950 977 117 --78347 6201 5417 5404 2737 1850 943 18302
NM_004993chr142457 34 --2986 590 1982
NM_004996chr16--11781 11659 --
NM_004999chr6104467 4396 2804 1630 1411 1380 1238 526 350 101 21198 472 2654 193 --
NM_005006chr27989 792 746 711 672 355 78 ------
NM_005010chr792003 1879 1530 805 680 371 277 199 104 ----11987
NM_005011chr711579 --21704 1689 --
NM_005013chr11--198 ----
NM_005021chr64317 283 178 102 ------
NM_005022chr17----182 --
NM_005023chr521199 1037 11367 1508 1434
NM_005026chr141755 1748 1643 144 ------
NM_005028chr1082115 2079 2058 2019 1693 1643 1508 822 --12085 --
NM_005032chrX6925 854 790 756 354 301 --21004 396 --
NM_005036chr22178366 7973 7952 6532 6277 6106 6039 5849 3011 2910 2432 2136 1408 1191 785 550 498 17194 67418 6635 6322 5145 1441 1248 46631 6626 1775 300
NM_005037chr3--1133 1171 --
NM_005045chr72673 185 1681 ----
NM_005053chr19192 ------
NM_005054chr241788 1677 1158 462 1182 11700 21762 1530
NM_005056chr12195613 5433 5064 5010 4450 4250 4180 3859 3759 3701 3643 3585 3461 2214 1124 768 653 340 28 13871 64116 1935 1648 1545 1440 1393 11560
NM_005057chr121791 1775 11243 --1766
NM_005063chr1063789 3555 3500 3125 1102 195 --12906 --
NM_005065chr14185216 5038 4347 3905 3468 3454 2052 1927 1831 1659 1510 1492 1444 1130 893 774 686 333 --35027 935 164 31756 931 577
NM_005066chr13721 576 205 --1214 --
NM_005069chr2141705 1117 673 556 11228 31599 1102 545 11246
NM_005076chr134187 3069 2615 32820 160 125 12724 --
NM_005077chr92442 136 ------
NM_005078chr1511871 --11575 --
NM_005079chr8113200 2927 2566 1260 1108 666 546 510 467 217 102 1312 23008 732 --
NM_005086chr1251403 1193 178 136 128 21337 661 1492 11704
NM_005087chr33801 614 173 --1270 --
NM_005093chr2065299 5245 4005 3793 1536 725 24207 688 14211 --
NM_005095chr12391 298 --42088 882 268 23 --
NM_005097chr102303 292 ------
NM_005099chr161220 1091 946 512 329 308 --1533 --
NM_005102chr21190 2775 700 ----
NM_005105chr132043 1978 439 --22079 175 --
NM_005109chr352387 2108 1864 228 59 12550 1832 --
NM_005113chr141395 --1435 1105
NM_005114chr42167 100 --1489 --
NM_005116chr2084575 4312 3521 2830 2799 1115 308 193 44564 4506 3497 3476 34384 4378 3120 13278
NM_005120chrX1181 ------
NM_005121chr17133796 3422 3243 3117 2667 2457 2328 1406 1352 903 445 172 122 12563 73687 3316 2322 1150 1092 612 598 1537
NM_005123chr122261 73 1326 ----
NM_005124chr64929 688 71 51 1232 --1648
NM_005125chr11----1155 --
NM_005126chr342194 2107 678 516 1859 21688 1659 --
NM_005133chr112397 326 ------
NM_005135chr1583133 2903 2679 2456 2427 2402 2338 738 11120 13883 --
NM_005146chr11----163 --
NM_005151chr1892095 1778 1771 1725 1536 713 378 246 46 22186 916 21656 718 1260
NM_005156chr9165332 5242 5115 4517 3740 3664 3271 1620 1564 1507 1407 1037 852 792 403 369 1134 54777 4463 3474 1441 943 33470 3465 3460
NM_005157chr921965 1211 21777 1558 11562 --
NM_005159chr1552226 2145 2042 1766 342 11966 2874 238 3550 473 152
NM_005160chr22216233 5881 5852 5664 5648 5632 5586 5472 5338 4974 4939 4809 2208 2109 1632 1585 1480 1425 1362 1061 502 15562 56771 5379 2585 1495 1441 --
NM_005163chr143930 215 85 --1987 --
NM_005164chr1292604 2563 2203 1700 1025 975 966 662 590 42460 2444 2170 895 22337 980 --
NM_005166chr191246 --1234 --
NM_005171chr1241035 984 101 22 1816 1855 11085
NM_005178chr191420 ------
NM_005180chr1071600 1547 1540 1498 1381 1269 417 11058 71606 1520 1489 1342 1335 1190 111 21149 628
NM_005181chr84686 574 302 154 --2715 173 --
NM_005187chr161444 ------
NM_005188chr11208340 8260 7984 7852 6082 5999 5809 5597 5443 5357 3210 3201 3038 2829 2775 2585 1704 1208 589 311 18071 38216 5943 2853 1196
NM_005190chr6----1134 --
NM_005194chr203534 229 178 1155 ----
NM_005197chr14116062 5918 5544 5374 5314 4665 4655 4470 1833 1072 302 --51542 1481 1375 198 147 15047
NM_005203chr101139 1399 155 --
NM_005204chr103991 946 364 ------
NM_005207chr2273662 3551 3379 2529 1166 746 28 11151 53712 3687 3254 1118 417 --
NM_005214chr251117 1085 817 423 82 ------
NM_005215chr181629 ------
NM_005221chr71328 ----1266
NM_005227chr11506 ------
NM_005229chrX51299 1227 837 408 269 --2960 278 --
NM_005230chr121425 --2545 498 --
NM_005231chr113974 175 163 --1148 11293
NM_005233chr3102619 2593 2407 2180 2016 1949 807 425 393 205 --42111 643 219 168 22497 2209
NM_005235chr2227854 7768 7639 7570 7559 7391 7298 7215 7129 6621 6302 6141 5952 5930 5912 5137 4887 3053 1104 991 835 697 57665 2888 1570 794 769 67485 7271 7029 6577 5891 2973 25918 1539
NM_005238chr11143373 3320 3303 3289 3231 2957 2734 2401 949 870 670 599 409 91 13558 32803 1179 98 23485 577
NM_005239chr2162055 723 672 587 347 216 --11388 --
NM_005241chr341409 1325 1312 193 21113 857 21233 430 --
NM_005242chr521106 78 21282 353 --11470
NM_005243chr221135 1128 144 --
NM_005249chr143669 256 84 --1704 --
NM_005252chr143761 682 651 --2693 492 1689
NM_005254chr1551351 1343 1212 1081 975 1964 31238 1013 31 31257 1234 171
NM_005256chr117838 828 782 736 658 611 242 1359 1159 --
NM_005257chr1821323 63 11258 1125 1935
NM_005259chr251492 1425 1178 1015 1000 1331 21384 1005 21391 1287
NM_005261chr86856 749 671 656 275 191 --2902 718 --
NM_005264chr102885 376 1241 ----
NM_005271chr1061205 1090 798 774 351 239 1465 1360 --
NM_005273chr71332 ----1316
NM_005277chr4101953 1835 1822 1800 1598 1573 1296 635 389 353 ------
NM_005281chr1----2716 622 --
NM_005284chr62454 431 --1361 --
NM_005295chr72268 223 196 ----
NM_005296chrX4852 778 729 442 --1418 1414
NM_005302chr73163 73 31 ----1360
NM_005308chr101414 ------
NM_005310chr17----1380 --
NM_005311chr772817 2757 2452 2147 2074 1149 669 --22304 376 --
NM_005313chr152270 223 11081 1334 --
NM_005316chr1141075 839 350 329 1293 1910 --
NM_005318chr2241238 898 229 45 --11170 --
NM_005324chr1741620 755 236 49 1528 11584 --
NM_005327chr41229 ------
NM_005328chr84782 731 489 206 3765 561 304 2565 146 --
NM_005329chr1682362 2313 1988 1905 1715 1553 1444 643 2860 569 22303 2140 --
NM_005333chrX51062 494 353 62 35 21243 430 1337 --
NM_005334chrX11761 ------
NM_005339chr4214056 4008 3981 3919 3863 3740 3732 3323 3008 2850 2803 1739 1692 1441 1022 903 809 711 444 353 320 2282 213 32855 1426 66 1996
NM_005342chrX3645 335 71 --22638 792 --
NM_005347chr93391 344 154 11413 --1397
NM_005348chr143687 199 61 1124 2223 83 --
NM_005358chr13111585 1461 1314 1180 579 555 492 379 284 188 176 1345 41685 1505 629 97 --
NM_005359chr18236480 6422 6004 5383 5099 5090 5075 4855 4648 4631 4611 4121 4073 4010 2081 1862 1768 1269 1031 951 856 741 558 35423 2396 101 31631 621 421 11525
NM_005370chr191219 --2879 339 1161
NM_005375chr63416 327 105 1303 --11188
NM_005376chr11905 --11121 1347
NM_005378chr21639 1598 196 1683
NM_005384chr9----1237 --
NM_005385chr352661 748 604 192 30 22223 685 12537 1292
NM_005387chr114637 562 519 433 1465 ----
NM_005388chr991694 1672 1623 1598 1167 1129 430 377 230 --164 --
NM_005389chr62814 568 1290 1167 1274
NM_005391chrX2253 136 ------
NM_005392chr921815 1174 --21761 1207 11397
NM_005393chrX1248 --1301 --
NM_005397chr764000 3113 3024 2960 2872 721 13010 ----
NM_005398chr1061408 1270 1139 495 248 231 --1450 --
NM_005399chr194292 4257 4215 3996 3793 3710 1699 945 146 22814 1732 33778 3273 98 1195
NM_005400chr263014 2255 1105 711 595 411 12952 31976 1020 1000 12835
NM_005401chr11247 --1183 1165
NM_005402chr741831 1694 1413 210 1534 11733 2163 93
NM_005406chr1831632 996 259 2617 501 21292 146 --
NM_005407chr1411272 ------
NM_005410chr52684 186 1511 --1269
NM_005412chr122569 86 ------
NM_005415chr25667 272 154 138 111 ------
NM_005430chr121971 ------
NM_005433chr18112777 2615 2490 2447 2189 1980 1951 897 525 351 293 ------
NM_005436chr10134079 3332 3182 2805 1240 1119 1003 810 535 370 303 219 102 21325 915 23135 581 --
NM_005439chr12----1520 --
NM_005445chr10--1236 --1278
NM_005455chr1131668 1494 1483 1154 1142 738 612 375 340 326 257 181 159 136 2673 231 11417
NM_005458chr931937 210 195 --11942 --
NM_005461chr2071993 1871 1654 1483 1235 683 388 --11585 --
NM_005465chr1--11784 ----
NM_005466chr141103 186 1123 --
NM_005475chr1253024 2948 2027 664 629 ------
NM_005479chr1031509 404 265 ----21547 410
NM_005484chr14--183 ----
NM_005487chr2251895 1606 1481 1363 175 --32050 364 180 --
NM_005493chr63857 719 132 --1190 --
NM_005497chr17136097 5058 4868 3916 1524 1486 1410 1123 979 740 378 317 27 14044 61964 1954 1312 1082 676 437 --
NM_005499chr191596 ------
NM_005502chr9143111 2832 2724 2557 2299 2240 2154 1289 1147 1050 1038 1018 970 633 12270 11153 --
NM_005503chr151238 ------
NM_005504chr12146580 6551 6074 5340 5046 4896 4003 2661 2174 2147 2021 1655 1541 759 11701 24748 863 15565
NM_005506chr482923 2835 2422 2297 2152 1964 926 690 11884 ----
NM_005509chr581626 1466 1332 1166 728 628 294 101 21884 1811 11694 1122
NM_005513chr351460 1386 518 424 239 21306 230 11359 --
NM_005517chr131392 901 61 --21444 101 --
NM_005519chr104515 447 157 138 ------
NM_005520chr52486 281 --1492 --
NM_005521chr101262 ----1274
NM_005522chr751236 922 876 523 254 --11348 --
NM_005524chr32342 147 --1118 --
NM_005526chr81278 ------
NM_005530chr1551444 1242 934 212 94 --1383 --
NM_005536chr821288 982 1220 2963 34 21366 142
NM_005537chr132986 99 ----2366 343
NM_005539chr1041104 1001 984 556 ----11191
NM_005540chr141610 1365 1054 242 21594 22 3279 269 262 --
NM_005542chr741570 1272 1249 745 --21946 1448 --
NM_005544chr22783 418 ----1164
NM_005561chr131206 --2828 822 --
NM_005563chr14799 686 634 231 1100 2669 78 --
NM_005566chr11--1110 1448 --
NM_005568chr17155 ------
NM_005574chr111588 1698 ----
NM_005575chr53262 197 152 1837 1556 1772
NM_005576chr151241 --1232 --
NM_005578chr3124983 4830 4706 4556 4531 4455 3716 3396 1472 1319 709 392 34042 3557 1491 84818 4772 4363 4177 3895 3430 1862 1084 21760 494
NM_005581chr191322 ------
NM_005584chr134824 685 642 582 --1787 --
NM_005585chr151287 --1318 --
NM_005587chr154899 873 387 26 1814 --1977
NM_005593chr124552 498 215 191 ------
NM_005595chr12939 859 1158 1945 --
NM_005596chr9166271 6168 5998 5441 4922 4774 4191 1987 1939 1879 1760 1751 1619 1330 1122 845 36082 4266 409 24279 991 --
NM_005600chr11234 ------
NM_005602chr34924 888 377 301 ------
NM_005603chr1842004 1968 1335 46 11392 ----
NM_005604chr692476 2365 2324 2290 1948 1002 572 446 120 22556 1864 2630 108 21772 636
NM_005605chr8159 ------
NM_005607chr82732 710 1839 11036 --
NM_005610chr11615 --3939 810 281 --
NM_005611chr1641326 1072 979 429 ------
NM_005613chr132073 1494 494 194 11507 12025
NM_005618chr65642 593 549 474 445 --1424 --
NM_005626chr11441 ------
NM_005627chr63878 778 682 ------
NM_005632chr161980 11026 ----
NM_005637chr1882091 2044 1792 1371 1326 433 416 355 --1773 --
NM_005638chrX71746 1651 1445 1250 547 474 244 ------
NM_005639chr1241703 1258 301 256 1380 ----
NM_005647chrX73485 3125 1022 1001 878 696 532 22156 924 13139 --
NM_005650chr2221327 358 --11098 --
NM_005655chr821148 251 21315 947 1324 1320
NM_005657chr151120 ------
NM_005665chr1154917 4611 4526 4422 4313 3731 1857 1607 1508 1273 1201 1121 834 670 32 33374 381 149 23144 840 --
NM_005667chr21152 ----1436
NM_005668chr5113903 3689 3609 1768 1756 1570 1537 1242 832 640 189 64204 4188 3955 3236 1424 1265 83245 2916 2822 1269 1209 1004 976 623 --
NM_005669chr542138 1472 233 153 2604 322 21617 158 187
NM_005688chr32935 168 --11353 1361
NM_005690chr12175 ------
NM_005707chr151137 --31335 1294 1195 --
NM_005711chr52948 822 --2782 245 3958 932 199
NM_005715chr682731 2604 2475 2402 2324 2077 1751 167 21865 1018 22674 2423 --
NM_005717chr131267 846 482 --31059 345 123 --
NM_005721chr26994 961 855 398 389 270 1143 ----
NM_005722chr26771 667 657 291 243 37 --1617 --
NM_005725chr142390 1733 764 639 32445 1690 240 1805 21721 798
NM_005730chr12123632 3613 3535 3430 3227 3025 2956 2450 2306 1297 1235 967 11324 11147 --
NM_005734chr111266 --195 --
NM_005737chr262956 2050 1791 1133 763 723 12424 22337 2260 --
NM_005738chr731907 1317 507 11334 21351 691 --
NM_005739chr1551491 886 471 359 138 1111 21734 393 --
NM_005746chr752644 2473 999 368 100 1888 1915 1345
NM_005748chr12143378 2911 2732 2202 1269 1252 1137 1042 752 703 634 613 384 272 1832 52898 2647 2397 2218 639 12393
NM_005749chr172680 566 1197 1548 1179
NM_005751chr73472 433 74 ------
NM_005752chr1631120 1048 90 --2876 794 1800
NM_005754chr551218 1174 1037 436 273 1222 3388 278 131 11094
NM_005756chrX31483 1286 439 --1462 --
NM_005759chr284605 4528 3993 3268 1861 1782 968 515 13439 54462 4301 3550 1787 990 --
NM_005765chrX3821 731 668 296 77 1133 --
NM_005776chr144724 710 668 160 1695 1136 2619 117
NM_005779chr583616 3206 2544 1263 818 721 528 380 --22549 2501 --
NM_005780chr134997 959 724 681 ------
NM_005786chr185986 798 507 287 139 --2216 181 --
NM_005788chr111719 ------
NM_005789chr1732120 1925 1650 --11320 --
NM_005795chr282852 2705 2585 2537 2354 2238 2227 1841 32554 1201 1098 32896 2734 886 42270 1179 950 945
NM_005801chr171796 ------
NM_005802chr96779 642 324 295 240 166 2737 124 2784 753 1660
NM_005806chr2131299 1087 949 --31264 1097 889 1826
NM_005808chr383497 3228 3150 2816 2749 2454 2352 760 22401 175 1231 32383 749 419
NM_005813chr262571 2473 2400 923 255 52 --11995 22545 1050
NM_005819chr133002 2736 1262 11164 32462 2205 594 --
NM_005822chr691686 1604 929 881 856 505 236 206 48 12294 1497 --
NM_005828chr1765073 5057 4845 4828 4235 1933 14561 44544 3763 1802 112 11728
NM_005832chr37549 503 492 417 375 250 229 11084 21170 1048 --
NM_005839chr12789 33 1231 1385 --
NM_005840chrX97689 7515 6245 5789 3013 2545 2179 1884 554 55686 2928 2825 2370 1035 76894 5230 3005 2312 2169 1399 560 37064 4727 1198
NM_005841chr431000 954 412 1966 --11067
NM_005842chr133627 494 142 --1584 2665 644
NM_005843chr241838 1768 498 233 --31931 1814 254 21966 439
NM_005853chr16----2573 63 --
NM_005857chr181389 1352 1040 1019 510 288 262 40 --51357 1172 1080 986 434 --
NM_005859chr551559 1508 999 512 339 1491 ----
NM_005862chr341015 897 375 39 --2675 387 --
NM_005868chr7122341 2035 1905 1683 1629 991 922 652 480 300 209 134 11893 1599 31566 835 140
NM_005870chr13--1952 2904 30 --
NM_005871chr1061060 783 351 317 82 64 --1439 --
NM_005872chr12559 198 ------
NM_005875chr31107 ------
NM_005876chr21717 ------
NM_005880chr1651586 1413 1286 1270 1142 21532 331 11053 --
NM_005882chr42685 244 --1896 --
NM_005885chr521596 1155 --2577 320 11585
NM_005895chr12124181 4017 4007 3243 3033 2568 2528 1563 722 471 265 58 --43268 3176 1050 428 1988
NM_005896chr21753 --1224 1220
NM_005898chr11102917 2639 2535 2413 2316 625 414 313 262 191 22458 284 --12265
NM_005899chr1771420 1347 474 327 308 155 85 21205 253 2578 90 --
NM_005900chr421228 1167 1462 21233 1116 --
NM_005901chr18268623 8560 7739 7662 7640 7255 7144 6983 6601 6106 5996 5820 3006 2976 2907 2889 2748 2707 2462 2330 1870 1640 1568 1316 999 512 78514 6441 6160 3254 2776 2100 1062 68420 6638 6001 2181 977 463 26465 3142
NM_005902chr1573734 3313 3162 1617 1395 1224 1007 21584 1485 23258 3192 --
NM_005903chr5215176 5064 4916 4613 4399 3801 3738 3688 3677 3661 3517 2051 1156 998 823 796 519 418 314 276 147 24841 3345 85134 4471 2059 1891 1844 1020 847 112 45236 4933 746 283
NM_005904chr1861321 1286 1200 1133 69 55 11260 188 11378
NM_005906chr671544 1459 1319 1306 542 529 476 21335 154 ----
NM_005907chr661659 1318 1078 666 634 524 1377 11559 11597
NM_005909chr554227 3281 3068 1658 670 --33581 2634 986 12640
NM_005920chr163789 3394 3331 2393 1381 177 ------
NM_005922chr6------1505
NM_005923chr62553 521 ------
NM_005924chr711135 --41091 429 276 218 1923
NM_005925chr182146 109 ------
NM_005927chr561157 1126 1097 837 811 186 --11117 --
NM_005930chr144739 178 133 70 1611 1699 1191
NM_005933chr1152530 2476 1869 991 755 --11078 11074
NM_005935chr4154801 4761 4235 3995 3821 3814 3695 3288 2079 2059 1618 1080 937 302 39 35047 3571 1098 54808 4511 4011 3717 1426 --
NM_005937chr1764125 3335 1613 1579 1176 910 --13666 --
NM_005941chr8114184 3498 3299 2848 2784 2683 1640 1284 1217 776 564 22605 1253 1349 43615 3135 974 454
NM_005955chr1135559 5434 5405 5271 4860 3653 2016 1125 932 900 455 265 135 15471 33670 3437 1876 13597
NM_005957chr164592 4577 3979 3543 823 598 14586 ----
NM_005962chr1052134 2019 1962 1505 895 11479 1545 11589
NM_005962chr1052134 2019 1962 1505 895 11479 1545 11589
NM_005964chr1721532 245 ------
NM_005966chr282401 2251 2183 1888 1575 773 410 295 21603 934 12129 1387
NM_005967chr121714 --2727 719 1745
NM_005968chr19149 ------
NM_005977chr134778 138 127 72 --1255 --
NM_005986chr1372555 2007 1949 1755 829 638 388 --32053 990 669 --
NM_005989chr751603 1576 1508 1472 1047 21390 1073 ----
NM_005994chr17193 ------
NM_005999chr151435 1096 1081 1033 67 1310 31522 1231 319 --
NM_006002chr13286 37 ------
NM_006007chr953821 3562 3430 3280 388 44398 4169 1027 143 31675 1354 1327 33069 1567 41
NM_006010chr3----182 --
NM_006011chr1584197 4147 3273 3252 3245 3238 3221 846 --11196 --
NM_006015chr1177 --11082 1292
NM_006016chr651620 1514 1438 811 262 21490 797 22061 1413 22202 234
NM_006022chr132927 673 ------
NM_006024chr76588 347 297 249 138 98 1216 1633 --
NM_006029chr142530 47 1788 ----
NM_006030chr341858 1810 1723 1382 11554 ----
NM_006033chr1862274 2242 1880 1702 591 405 11972 21840 1755 --
NM_006036chr2122565 2546 2463 2454 2390 1983 1953 1946 355 165 145 56 --32013 554 539 11776
NM_006037chr2134920 4473 4304 3884 3643 3399 1947 1767 1662 1428 1183 1110 1078 --54229 1714 1702 1443 483 1897
NM_006038chr202757 193 11475 1770 --
NM_006041chr17--185 199 --
NM_006042chr175465 413 375 108 46 ------
NM_006047chr2093043 2719 2653 2367 2218 2211 1093 576 526 --53361 2583 2571 2154 432 --
NM_006054chr112426 65 --11309 --
NM_006060chr783529 3460 3419 3384 3189 3060 1726 945 --2194 176 13391
NM_006067chr1641018 801 332 62 11070 1905 --
NM_006070chr31325 170 ----
NM_006079chr61794 1843 1691 --
NM_006080chr782910 2669 2637 2109 1946 959 770 449 2881 635 32035 1898 788 --
NM_006089chrX41804 1182 584 497 31907 1734 116 41599 1266 1260 571 21546 1256
NM_006090chr11757 --2733 651 --
NM_006094chr8112439 2407 2315 1692 1657 1541 1477 692 641 358 262 --1740 --
NM_006095chr4154539 4424 4262 4085 4006 3774 3564 3465 1594 1400 1386 1326 1102 747 599 34151 3074 1769 44011 3666 3286 1292 13874
NM_006100chr3----145 --
NM_006106chr1162579 1001 895 550 234 145 1133 63421 3359 2829 2770 1240 541 1602
NM_006108chr1142226 1485 726 63 1665 41999 1747 1700 737 --
NM_006113chr172066 1987 1598 642 502 400 313 11653 22133 759 21850 372
NM_006118chr11167 ------
NM_006135chr151404 1380 982 506 95 --1377 --
NM_006136chr741039 918 871 553 2909 305 1168 21226 1221
NM_006139chr272727 2521 2294 1164 1143 810 734 --1685 --
NM_006141chr1632365 2286 2066 1860 72761 2488 2211 1955 864 829 609 --
NM_006143chr12----1113 --
NM_006153chr33491 251 136 ------
NM_006154chr1572767 2338 2039 2009 1895 1004 628 2798 469 32308 522 164 --
NM_006155chr262008 1949 1751 1647 501 185 --1510 12024
NM_006157chr112384 331 --2389 343 --
NM_006158chr891788 1777 1515 614 560 457 439 195 22 --11421 --
NM_006159chr124589 536 528 421 ------
NM_006162chr1841784 1315 469 409 ------
NM_006166chr1251892 1881 1735 1608 226 --3525 343 322 11978
NM_006178chr1721348 1296 --11407 --
NM_006180chr931937 1891 542 --11968 --
NM_006183chr12--1538 1392 --
NM_006186chr211156 --21113 973 --
NM_006194chr1421295 885 ------
NM_006195chr91316 2286 262 11444 --
NM_006196chr21249 ------
NM_006197chr862253 2226 2027 1920 424 114 11974 11762 --
NM_006198chr211243 ------
NM_006202chr1911477 --1244 --
NM_006203chr5135589 5475 4849 4781 4438 4423 3738 3487 979 882 747 365 351 34279 1285 826 84973 4901 4352 4298 887 669 596 283 44294 4289 4284 4117
NM_006204chr10------1230
NM_006206chr482719 2593 2485 2478 2266 2013 1156 171 12787 12255 --
NM_006209chr82355 47 1105 ----
NM_006212chr1145062 4990 4888 4760 4706 4495 4100 3445 3398 1583 598 482 473 424 14789 44667 3874 1107 838 --
NM_006216chr23673 93 40 --1485 --
NM_006224chr1742488 921 424 320 --12418 --
NM_006226chr231378 1246 130 --21265 1259 --
NM_006237chr1362156 1811 1621 1429 834 733 22011 502 ----
NM_006238chr632011 398 367 ------
NM_006241chr341968 814 543 65 3462 303 205 52226 1613 945 343 250 --
NM_006242chr2062152 2080 1563 868 754 382 22141 632 --11858
NM_006243chr161087 947 872 378 358 48 ------
NM_006244chr111497 ------
NM_006246chr1421266 325 11341 1982 --
NM_006251chr5123312 3217 2976 2728 2703 2416 2288 2235 2102 1087 668 257 1274 52949 2734 2462 2197 1014 --
NM_006252chr1187569 7395 7343 6361 6225 5287 3019 2260 2134 1972 1800 1410 1316 1205 479 382 173 116 26472 6436 107150 6015 4619 2904 1387 1244 912 818 351 71 24674 432
NM_006254chr31420 ------
NM_006255chr141986 ------
NM_006256chr192728 2592 2478 2169 1900 1012 721 291 272 32415 2229 2125 --32755 1790 572
NM_006258chr1021309 555 --1286 11531
NM_006264chr43501 203 173 1186 --1368
NM_006267chr261905 1797 1612 1581 1469 1218 ------
NM_006275chr2082505 2447 2388 748 735 707 363 355 22513 1755 41791 1742 635 368 --
NM_006278chr111578 ------
NM_006279chr1----1368 --
NM_006281chr84777 420 406 77 --1425 --
NM_006281chr84777 420 406 77 --1425 --
NM_006282chr2064578 4290 3612 3209 2910 1672 11893 32881 1602 962 --
NM_006283chr894962 3789 3276 1986 1209 818 621 456 428 34319 3870 977 33938 3654 319 --
NM_006285chr91245 ------
NM_006287chr2142664 2602 2275 1899 1883 993 913 803 767 250 226 182 89 73 2898 42 42526 2478 231 161 --
NM_006290chr661986 1845 1814 1798 1519 744 1701 11380 --
NM_006291chr1432017 1518 1324 --12002 --
NM_006298chr652725 2370 991 609 273 1928 --13381
NM_006299chr62236 225 --1241 --
NM_006300chr1942311 1682 1619 383 1195 1617 11741
NM_006305chr151200 ------
NM_006306chrX105920 5847 4036 3982 2276 1984 1768 1700 1668 702 15936 23987 1413 --
NM_006307chrX2323 98 1120 ----
NM_006313chr1261711 1591 1460 1218 1210 590 11580 21333 357 11540
NM_006315chr474266 3919 3852 3184 2809 1372 805 --42874 2754 793 322 --
NM_006317chr52618 238 ------
NM_006320chr44955 727 282 169 --1753 1438
NM_006321chr352154 859 499 429 231 ----1895
NM_006323chr43744 604 225 ------
NM_006330chr871589 1560 1241 1131 627 450 425 --51159 1110 1046 613 594 11106
NM_006333chr23499 249 147 2544 466 ----
NM_006334chr9----1110 --
NM_006335chr13827 688 192 ------
NM_006343chr21178 ------
NM_006345chr44899 512 313 262 21199 138 --1951
NM_006346chr131117 3482 199 182 1186 --
NM_006348chr71140 2163 97 1802 --
NM_006352chr171783 1622 822 624 504 460 283 --32003 1919 1576 --
NM_006353chr631411 1255 59 ----1534
NM_006359chrX22316 404 21973 910 32470 2232 234 12436
NM_006363chr204574 557 232 148 --183 --
NM_006364chr1481312 1041 999 968 874 446 430 107 21266 864 41255 894 512 202 --
NM_006371chr395324 5001 4511 4235 3818 3517 1561 746 384 --43522 1710 751 687 --
NM_006372chr62516 440 1122 1186 --
NM_006375chrX71929 1758 1383 1346 746 326 74 --1613 --
NM_006378chr951416 1047 1038 381 150 --31408 494 478 --
NM_006379chr761971 1894 1443 758 352 241 185 22006 743 22115 764
NM_006380chr17134316 4078 4023 3990 3020 1655 1420 1344 1275 901 795 750 133 34087 3737 1612 23308 2995 23381 778
NM_006386chr2282294 1972 1963 1760 1671 609 513 323 1450 1961 --
NM_006390chr1231485 92 45 1190 21680 1296 --
NM_006391chr111230 --1239 --
NM_006393chr10124400 4034 3830 3560 3173 3019 1734 1706 901 604 290 75 44582 4235 3618 3540 42870 1257 1251 429 199
NM_006401chr92473 402 --3427 407 339 --
NM_006403chr681830 1547 1435 1403 1362 476 259 88 2121 101 ----
NM_006411chr61853 ------
NM_006413chr104465 302 241 138 1220 1973 --
NM_006415chr941208 1194 1172 494 41241 985 815 304 21292 174 --
NM_006420chr2093459 2816 2655 2567 2548 2487 2442 2126 958 32505 2170 591 23278 914 --
NM_006421chr821259 378 ------
NM_006424chr421671 319 ------
NM_006425chr561443 649 432 254 238 201 11603 21135 263 11521
NM_006427chr141128 ------
NM_006430chr23409 219 92 ------
NM_006431chr122248 161 ------
NM_006434chr1043258 2836 2533 232 --33189 2989 28 --
NM_006449chr282092 1941 810 719 649 444 402 134 11726 1630 --
NM_006451chr54948 891 848 321 2810 708 1735 --
NM_006457chr493586 3116 3047 3003 2764 2735 2605 820 517 1218 54052 3026 2956 832 205 --
NM_006459chr1031747 1498 549 ----12031
NM_006460chr1731593 1466 169 1435 31825 622 209 --
NM_006463chr23596 574 177 ------
NM_006464chr2154610 4564 4534 4232 3459 3205 2914 1755 1520 1392 641 573 487 267 215 11448 34575 3608 508 1699
NM_006465chr152774 374 --12300 --
NM_006466chr206767 682 371 151 143 45 ------
NM_006467chr592314 2302 2230 1872 1609 1535 938 329 26 2768 72 32292 2128 449 22053 761
NM_006469chr181438 1403 1118 468 445 209 169 157 1562 1232 1228
NM_006471chr181258 ------
NM_006475chr133631 578 149 --1519 --
NM_006476chr11141 ------
NM_006482chr1261334 831 789 294 204 91 42470 1381 1244 190 31357 1253 734 23396 1249
NM_006489chr1481859 1826 1726 1473 474 437 218 72 --11700 --
NM_006495chr171176 ------
NM_006496chr151419 554 413 405 147 11270 11946 --
NM_006497chr171232 ------
NM_006502chr6137 170 ----
NM_006504chr1092819 2730 2628 1921 168 115 70 47 23 1609 22941 1157 --
NM_006506chr3----142 --
NM_006516chr111275 --21183 261 --
NM_006520chrX21438 299 1116 1554 11078
NM_006526chr20102148 2139 2078 2009 1668 1560 870 281 263 71 11356 11930 12100
NM_006527chr41186 --3758 147 136 --
NM_006529chr4101513 1378 1357 1341 1329 1214 667 422 331 140 11390 ----
NM_006532chr1982005 1910 1871 1765 1364 642 378 68 ------
NM_006534chr20123409 3324 3087 2711 2680 2476 2198 1245 1230 882 724 545 22765 135 12089 --
NM_006536chr12899 632 --2985 376 --
NM_006538chr2114133 4087 3892 3500 2883 2672 1633 1157 793 717 43 --42873 569 480 238 --
NM_006544chr14276049 5702 4761 4691 4444 4409 4255 3997 3985 3942 3830 3722 3711 2090 2033 1922 1875 1678 1621 1358 1344 702 667 537 349 199 171 55650 4432 4074 2051 630 85734 4913 1896 1884 1832 1029 757 204 65763 4936 3934 973 814 480
NM_006546chr1776346 5683 5620 5117 2386 1190 901 56469 2211 1795 1743 917 46544 1799 1668 534 --
NM_006547chr741592 715 360 56 31979 630 176 21983 480 --
NM_006548chr321544 1145 1475 11392 --
NM_006555chr72370 230 11940 1126 --
NM_006557chr951656 1564 434 299 40 ------
NM_006558chr83500 198 139 ----1357
NM_006559chr13906 359 249 1190 --181
NM_006560chr112328 184 ------
NM_006561chr10216201 6166 5904 5206 5065 4929 4525 4477 3916 2470 2463 1831 1790 1666 1657 1648 1568 1385 1284 913 866 21163 735 66138 5470 5373 3879 3794 339 --
NM_006565chr1621190 453 --31117 434 428 11201
NM_006566chr184982 973 867 465 --41042 995 496 123 --
NM_006570chr9--1350 162 --
NM_006571chr8----1115 --
NM_006572chr17153424 3336 3251 3218 3202 2794 2259 2242 1081 1050 1026 546 465 307 140 32349 1182 539 32937 2166 571 --
NM_006575chr1461353 1283 475 310 215 153 2939 134 11271 197
NM_006577chr291314 1238 1225 1199 984 907 820 363 40 31090 1040 1028 21131 452 --
NM_006578chr1551307 1270 342 228 69 ----11376
NM_006587chr431430 1261 197 11094 31042 460 173 11683
NM_006595chr1162048 1414 1331 263 253 206 --31947 1857 626 --
NM_006599chr16188222 8139 8015 8005 7921 7619 7606 7533 7011 6113 5996 5727 3071 2557 2455 1993 1967 1581 86774 6522 6020 5006 2531 2400 1198 205 106942 6905 5118 2762 1537 867 649 386 370 276 47633 6653 891 79
NM_006601chr122955 772 1120 ----
NM_006602chr204702 646 573 340 --1854 1563
NM_006603chrX82031 777 718 633 606 358 281 273 2597 236 --21546 1394
NM_006606chr20102794 2775 2709 2702 2325 2124 1973 1264 213 22 12152 --22109 2104
NM_006609chr262699 2382 2029 2007 903 611 52564 1898 1886 1875 880 11985 32591 1903 748
NM_006614chr3153649 3286 3216 2943 2735 2722 2235 1162 837 648 522 450 412 202 157 33228 3149 2356 31344 1102 946 11267
NM_006618chr141447 1377 546 205 1632 11386 --
NM_006620chr6104353 4055 3901 3008 1330 1232 970 886 605 506 --44083 2983 832 253 11274
NM_006621chr161694 1659 759 685 172 57 --176 --
NM_006622chr51504 ------
NM_006624chr1061750 1527 1307 597 561 92 --11821 1219
NM_006625chr131141 483 87 1773 31064 463 430 --
NM_006625chr131141 483 87 1773 31064 463 430 --
NM_006625chr131141 483 87 1773 31064 463 430 --
NM_006626chr9132651 2395 2386 2133 2096 2052 1952 1059 810 671 601 512 113 1800 32142 999 804 --
NM_006628chr15214034 3974 3785 3761 3608 3115 3074 3033 1803 1671 1629 1167 1093 990 553 358 323 75 69 60 42 --24590 4430 33434 3429 1534
NM_006633chr53808 699 66 1566 ----
NM_006636chr23911 817 79 1758 1878 --
NM_006640chr17----11617 184
NM_006644chr13291 43 --1488 --
NM_006646chr1383095 2547 2318 1962 661 529 260 125 --32307 2209 1979 --
NM_006648chr91167 ------
NM_006653chr61366 --3434 379 101 --
NM_006654chr12104543 4389 3148 1563 1300 1157 1106 1051 600 466 44730 3466 1809 1556 44365 3736 1067 880 --
NM_006667chrX51181 1124 769 35 27 ----1779
NM_006675chr1232419 1146 1072 ----2521 516
NM_006682chr782514 2242 2211 1147 721 299 290 88 11013 52712 2230 1935 1928 767 --
NM_006691chr112975 787 --11026 --
NM_006693chr71175 ------
NM_006698chr2061440 1212 1041 906 441 179 ------
NM_006699chr172737 2442 2092 1666 958 441 233 --42501 2419 1026 871 --
NM_006704chr132425 304 1131 3412 322 142 --
NM_006710chr251096 1016 957 777 76 --11101 --
NM_006713chr53737 564 136 --2782 201 --
NM_006717chr992897 2757 2409 2099 1015 889 715 589 50 1549 22726 75 13276
NM_006718chr63777 192 21 ------
NM_006721chr105729 339 271 201 52 --1287 --
NM_006722chr372835 2469 2135 1992 1111 1014 888 4750 187 146 123 71216 894 840 834 818 754 150 1830
NM_006724chr6------1505
NM_006726chr48978 957 426 252 228 155 141 115 ------
NM_006727chr53523 196 124 --1535 --
NM_006729chrX165652 5488 5270 2118 2093 1830 1609 1184 917 901 856 790 739 726 597 555 2778 765 23926 2039 35437 4277 1308
NM_006731chr9155489 4803 4505 4375 3753 2141 1919 1880 1457 1395 893 732 626 607 456 45688 2275 1263 1234 15791 1837
NM_006732chr1922071 1420 --11907 --
NM_006734chr65488 425 324 220 130 1305 3537 493 257 --
NM_006735chr72341 72 --3306 92 85 --
NM_006738chr1564411 4059 3410 1612 1567 371 14592 31444 1291 1285 --
NM_006745chr43998 967 70 2943 168 1424 --
NM_006746chrX51458 1108 996 551 534 31561 1388 455 61226 1181 1025 974 517 249 --
NM_006750chr16197777 7735 6646 6314 6252 5769 5562 5096 4921 2883 2722 2121 1513 1262 845 744 726 459 272 16632 1770 38124 5146 801
NM_006751chr22157 142 2946 53 11075 --
NM_006754chr771225 1125 932 425 368 136 76 --21216 887 --
NM_006756chr851437 1405 1281 1007 223 11199 21107 574 --
NM_006763chr13763 588 88 --4749 645 523 119 22143 1770
NM_006764chr32473 49 --1102 --
NM_006766chr862670 2529 2238 1929 1654 967 12385 32502 302 143 2355 139
NM_006769chr12726 716 ------
NM_006772chr6----11631 --
NM_006775chr6132785 2666 2553 2205 2171 2108 1045 999 975 932 798 681 90 12914 21164 1120 23063 726
NM_006777chrX102896 2740 2241 2222 2108 1930 1050 1020 975 948 12615 ----
NM_006785chr185834 466 338 272 168 ----11477
NM_006788chr1851381 1332 855 455 242 1282 22123 330 12133
NM_006793chr103593 84 61 1755 1708 2599 517
NM_006800chrX3596 575 509 1458 3638 541 214 --
NM_006805chr541219 1146 267 254 21757 1377 2507 398 --
NM_006806chr211353 1375 1126 1332
NM_006813chr63333 246 162 2736 156 ----
NM_006814chr2032631 2191 509 --22115 790 --
NM_006815chr1251121 1114 536 528 288 2877 361 31015 881 91 1555
NM_006818chr12977 152 1814 ----
NM_006819chr111296 ------
NM_006822chr173747 586 545 ----1275
NM_006823chr83971 542 484 1897 ----
NM_006826chr231082 896 838 11058 ----
NM_006827chr1483195 3107 3077 2971 2658 1320 1277 1111 12956 ----
NM_006832chr1411102 1321 --11080
NM_006838chr1261818 1265 341 332 302 115 --2387 34 11926
NM_006842chr11------1111
NM_006851chr1252955 2793 1989 522 197 21010 91 42704 923 837 344 12119
NM_006852chr1752741 897 884 720 118 12136 42572 607 132 124 12804
NM_006854chr762058 1623 1413 1309 1254 755 --22020 448 1333
NM_006857chr24780 242 134 66 ------
NM_006861chr1222108 100 ----1829
NM_006868chr1853218 2286 2049 1050 495 --23180 503 1854
NM_006873chr2163264 3163 3091 2926 2695 2455 1364 1278 970 858 843 813 538 528 241 170 21011 682 22627 177 2961 914
NM_006874chr411060 21151 481 ----
NM_006884chr361854 1838 1403 782 646 445 1520 11505 11878
NM_006885chr1683746 3496 3109 2790 2622 1607 1447 1320 21541 657 43862 3393 1314 1239 22582 1177
NM_006887chr21679 --1218 --
NM_006888chr1463500 3103 2891 1065 910 59 12650 --13087
NM_006892chr2021287 1213 ------
NM_006892chr2021287 1213 ------
NM_006895chr262129 1459 460 383 63 37 --1738 --
NM_006901chr151480 1510 1429 --
NM_006908chr731099 1065 963 11166 1270 11078
NM_006910chr161138 ------
NM_006914chr92515 187 1333 41543 1365 345 132 --
NM_006915chrX102505 2468 2058 1884 662 548 492 392 368 157 --31721 967 124 3977 398 302
NM_006918chr11155849 5300 4985 4501 4403 4315 3847 3677 2281 1618 1524 1451 1402 752 739 14941 13549 14783
NM_006920chr2101719 1689 1637 1606 1541 1262 724 676 450 63 --52084 1774 1525 1454 1312 11450
NM_006922chr292557 2401 2368 1593 763 572 432 360 336 1609 31743 855 682 2929 819
NM_006924chr1774357 4235 3574 3009 1628 973 396 34060 3792 187 84240 3855 3811 2824 687 631 626 346 --
NM_006930chr522008 1530 31738 316 80 41876 1572 1271 453 --
NM_006931chr1231639 473 190 12012 21525 595 21325 479
NM_006938chr18143 11096 3919 904 877 1702
NM_006939chr1471161 1133 1039 957 446 323 92 2840 85 ----
NM_006940chr1251772 1442 1382 1312 549 1578 2766 667 1108
NM_006941chr2221096 1041 ------
NM_006948chr2192249 2141 1918 1601 1534 898 396 275 24 12098 22317 823 21670 633
NM_006952chr31183 --1276 --
NM_006959chr192451 372 --2355 343 --
NM_006962chrX2476 78 ------
NM_006963chr1041275 919 437 281 2896 93 ----
NM_006965chr184969 455 336 264 --1904 --
NM_006980chr72823 225 --1130 --
NM_006981chr942251 1942 915 594 --52879 2504 2497 1961 374 1527
NM_006982chr12153 --121 --
NM_006988chr2131189 809 267 11101 11176 1435
NM_006996chr171861 1297 1166 645 476 204 192 31913 1249 560 21895 1563 1596
NM_006999chr552051 536 523 517 341 --1689 --
NM_007005chr911324 21302 1215 31199 1053 293 --
NM_007006chr16123493 3270 3077 3051 2225 1218 1062 892 701 452 224 201 --63112 2822 2622 2306 385 206 23546 263
NM_007007chr12143349 3082 1817 1636 1199 1043 974 945 686 459 210 197 180 79 14270 64720 4201 4193 3439 1736 186 34163 1751 1627
NM_007008chr2--1288 2292 132 --
NM_007011chr15116631 5937 5825 5577 5338 4279 1904 1554 1167 944 183 11542 66820 4439 1994 1325 337 279 --
NM_007013chr82813 791 1174 1740 1360
NM_007015chr135297 277 246 232 101 --2256 240 --
NM_007017chr53865 846 710 --1654 1615
NM_007018chr93396 384 354 --2372 136 --
NM_007023chr25984 939 839 776 180 --1978 1990
NM_007026chr172524 485 --1605 1142
NM_007033chr1--1626 2644 590 --
NM_007034chr16809 644 318 248 235 27 4999 872 661 208 11003 --
NM_007036chr53869 789 35 1742 ----
NM_007038chr21186091 6039 6015 5563 5441 4963 4949 4849 4388 2315 1770 1277 1046 905 893 734 711 583 24050 535 95723 4673 4207 2114 2108 2052 1853 1786 1667 21418 1107
NM_007039chr1452094 2025 739 289 79 1309 4898 766 589 517 21867 397
NM_007040chr192771 446 --2981 223 --
NM_007045chr62431 137 --1532 --
NM_007050chr20128029 7972 7411 7252 6575 5611 4932 2875 2573 1611 1215 306 22497 1661 43133 1007 880 700 11547
NM_007052chrX2160 60 --1590 --
NM_007054chr593901 3221 2814 1560 1142 943 834 801 146 23913 981 43734 1102 999 967 23725 869
NM_007064chr351519 1259 1242 1034 581 --11362 --
NM_007073chr6114261 4190 4033 3121 2972 2745 1600 964 874 742 251 43738 3044 2854 97 43235 2564 922 327 14176
NM_007074chr16----1106 --
NM_007078chr1033057 3019 445 --31906 1068 322 --
NM_007080chr43278 69 42 1351 1319 --
NM_007084chr1321354 1127 --31253 975 288 --
NM_007106chr13122419 2137 2035 1995 1961 1903 1719 1074 596 208 198 76 12672 32648 2022 383 --
NM_007107chr321881 330 12283 11557 --
NM_007114chr3113240 3030 2836 2569 2453 1171 1157 894 879 744 626 23286 2627 41008 225 198 175 31085 803 275
NM_007115chr23442 332 91 --199 --
NM_007118chr52837 587 1242 ----
NM_007124chr6112007 1550 1340 1289 792 747 676 658 482 440 180 11643 --31780 1495 798
NM_007125chrY132 51170 1130 901 463 328 21280 984 --
NM_007126chr91464 ----1456
NM_007129chr133999 763 725 ------
NM_007145chr1931246 1236 512 11425 11227 --
NM_007146chr1732384 863 238 --22895 2768 1888
NM_007147chr1931171 397 333 2434 167 1892 1172
NM_007150chrX62136 2122 1718 487 196 130 --1528 --
NM_007157chrX62933 2580 2531 1168 437 227 --82489 2438 2252 886 717 520 258 37 --
NM_007159chr371678 1234 701 498 473 308 218 31429 1415 334 11448 1142
NM_007166chr1151293 1170 550 316 63 ------
NM_007173chr1171631 809 689 644 533 326 232 12161 --21802 50
NM_007174chr1262123 2028 1818 1740 1510 626 1367 22159 1545 --
NM_007175chr8103561 3522 3358 3310 3214 2545 691 552 362 193 --148 22589 540
NM_007187chr135871 795 275 146 28 --3966 354 165 --
NM_007190chr105989 914 876 350 25 ------
NM_007192chr1431136 324 79 ----1916
NM_007195chr18143193 3069 2868 2792 2782 2774 2767 2567 2484 2411 2322 1339 1136 270 33664 3363 2430 93535 3382 3095 3080 2880 2874 2800 232 47 --
NM_007197chr1241000 661 380 53 11018 ----
NM_007198chr831556 1522 167 --31658 1456 1432 --
NM_007200chr1564411 4059 3410 1612 1567 371 14592 31444 1291 1285 --
NM_007203chr983931 3469 3446 3012 2771 1149 989 824 21578 619 33979 3809 573 --
NM_007207chr13911 900 791 --2968 146 --
NM_007212chr171942 1794 862 773 537 203 161 --178 --
NM_007214chr621181 227 --21006 519 11310
NM_007217chr31155 ------
NM_007220chrX164875 4325 3956 3841 3834 3376 1852 1681 1593 1538 1402 1216 789 719 687 25 23386 592 53223 3214 3204 1584 30 2597 37
NM_007222chr841795 1332 683 512 --31355 1236 708 --
NM_007224chr121649 ------
NM_007231chrX72045 1792 540 380 341 266 66 --1310 12411
NM_007236chr1572116 963 889 776 589 482 426 12347 12137 --
NM_007242chr161195 ------
NM_007245chr162805 127 --2914 796 --
NM_007246chr43813 767 377 --4775 322 276 165 --
NM_007249chr13108942 8009 7939 7618 7418 6730 5692 3156 1613 1224 27859 1758 19272 18763
NM_007270chr731474 567 464 11452 --11457
NM_007271chr661557 1444 670 594 228 56 --11344 --
NM_007276chr71215 --1182 21094 1020
NM_007279chr191406 1643 1647 --
NM_007282chr32655 25 --1103 --
NM_007285chr162406 125 --1187 --
NM_007287chr341103 713 635 265 --33252 3145 448 22170 579
NM_007288chr341103 713 635 265 --33252 3145 448 22170 579
NM_007289chr341103 713 635 265 --33252 3145 448 22170 579
NM_007292chr1774917 4479 3683 3309 2027 1687 382 --54967 4299 3382 3372 327 14273
NM_007294chr1731199 397 298 1125 11131 --
NM_007295chr1731199 397 298 1125 11131 --
NM_007296chr1731199 397 298 1125 11131 --
NM_007297chr1731199 397 298 1125 11131 --
NM_007298chr1731199 397 298 1125 11131 --
NM_007299chr1731199 397 298 1125 11131 --
NM_007300chr1731199 397 298 1125 11131 --
NM_007302chr1731199 397 298 1125 11131 --
NM_007303chr1731199 397 298 1125 11131 --
NM_007304chr1731199 397 298 1125 11131 --
NM_007305chr1731199 397 298 1125 11131 --
NM_007308chr41293 1580 1584 --
NM_007313chr921965 1211 21777 1558 11562 --
NM_007327chr91242 ------
NM_007331chr462288 1946 803 522 427 182 12013 12530 --
NM_007345chr18142354 2323 2205 2152 2131 2121 2029 1885 1759 1627 1602 1586 1569 917 22242 1801 22035 1890 11778
NM_007347chr1593149 3020 2402 2069 1119 586 487 471 60 52992 2963 2159 1082 799 63173 2967 2533 2193 697 298 33169 2908 665
NM_007351chr441040 268 162 66 1151 1467 --
NM_007358chr1112042 1988 1858 1810 1700 1624 1456 1436 1258 754 423 --31946 1324 1303 22001 1482
NM_007361chr143462 248 190 ------
NM_007372chr172741 331 ------
NM_007373chr1091590 1460 1345 1336 678 611 377 322 252 --21203 447 --
NM_007374chr141415 ------
NM_007375chr172160 1837 1798 883 710 628 142 1302 11827 12697
NM_009585chr34600 330 310 97 --1324 1866
NM_009585chr34600 330 310 97 --1324 1866
NM_012063chr12175 ------
NM_012064chr1231097 1050 1008 --1112 --
NM_012073chr551584 1363 1001 195 80 1348 1555 --
NM_012074chr1431026 438 78 --2272 122 --
NM_012081chr5113605 3557 3415 3392 3302 2978 1079 914 428 406 44 12998 2153 134 --
NM_012082chr82664 247 1724 1241 1207
NM_012084chrX2226 218 1454 ----
NM_012089chr181150 1105 1052 1034 428 245 119 103 31566 1300 266 21525 230 1376
NM_012090chr141197 1180 841 161 1336 2977 136 --
NM_012093chr131237 884 141 ------
NM_012095chr1093403 3193 2350 1304 824 789 782 614 139 22863 755 21341 206 --
NM_012096chr3123543 3447 3409 3092 2837 2365 2283 998 844 583 378 115 33272 1372 477 33672 3499 3314 --
NM_012097chr261801 1776 599 444 430 144 1414 32266 351 181 --
NM_012099chr1931260 861 185 --2398 314 1992
NM_012102chr122631 594 --12244 1473
NM_012104chr1143404 3337 3124 1250 22521 1312 --1481
NM_012104chr1143404 3337 3124 1250 22521 1312 --1481
NM_012108chr4146 --166 --
NM_012115chr62385 200 --3583 390 228 --
NM_012118chr4139 ------
NM_012120chr6172990 2715 2040 1998 1175 1116 1104 1025 885 698 580 514 424 251 204 170 75 32692 778 690 62937 2745 2362 2131 520 317 1898
NM_012124chr112607 33 ----1919
NM_012129chr7112538 2240 2097 1946 1690 1530 1001 426 364 252 201 3701 587 446 1533 12432
NM_012137chr1152726 2548 2538 2485 2424 2311 2294 2146 2025 1170 888 452 315 298 147 --42793 2343 481 370 --
NM_012141chr13123106 2784 1598 1583 1553 1333 1043 845 470 301 259 27 33905 795 525 73774 3559 2886 610 436 371 183 13555
NM_012153chr1142276 2051 184 90 1718 1177 12197
NM_012155chr19144 ------
NM_012158chr1361853 1786 1445 1181 91 61 11173 31749 1506 1208 --
NM_012161chr44925 791 470 191 1266 2930 415 21080 767
NM_012164chr9157444 7429 7205 7104 7026 6223 6107 6064 5668 5141 2877 2380 2144 1446 898 27000 2904 45392 5197 2514 2209 27360 2199
NM_012176chr51252 ------
NM_012177chr65567 539 517 504 172 1233 ----
NM_012180chr42463 33 1156 1601 1636
NM_012186chr11482 --1732 --
NM_012188chr5----11088 --
NM_012193chr11115340 4983 4258 4099 3562 3511 1676 1660 761 617 22 1924 11149 14351
NM_012197chr921641 1462 --1651 11618
NM_012199chr174548 4036 3680 2982 1614 915 666 2528 403 54338 3901 3278 1261 1119 --
NM_012204chr94858 827 444 277 --2404 282 --
NM_012207chr1071092 992 818 236 189 177 129 2297 84 ----
NM_012214chr2186293 6209 5974 5849 5825 5381 4745 1835 1236 1080 680 650 555 509 480 349 254 77 56260 5750 5720 4830 4482 86298 5341 5074 5044 2547 1967 1871 534 34765 747 367
NM_012215chr1051331 1319 601 541 312 11207 21846 1765 --
NM_012218chr1932843 2339 356 2398 390 --1432
NM_012219chr323080 778 ----2463 448
NM_012223chr271243 1225 1138 972 227 68 21 21024 870 ----
NM_012224chr431152 192 94 2236 184 2848 842 11202
NM_012233chr22937 443 1951 31190 1080 942 1925
NM_012234chr3103436 3333 3195 3129 2339 1031 717 512 380 266 23716 2654 --12516
NM_012238chr1061742 1504 1198 421 170 75 21576 1279 41604 1306 621 503 11362
NM_012242chr102817 282 --1256 --
NM_012244chr1421714 107 --21699 1675 --
NM_012247chr104963 873 703 308 --1943 --
NM_012249chr283186 2875 2867 2465 1257 1157 609 560 33371 2710 219 43068 2594 2488 422 13086
NM_012250chr1151176 1044 932 906 866 --1879 --
NM_012252chr7135362 5248 5056 4856 4556 4118 3884 3786 3608 3445 2150 1867 726 25313 4622 55282 3895 1079 95 85 13891
NM_012257chr761090 1064 952 916 797 748 --2224 167 1335
NM_012259chr621356 925 --21405 1135 --
NM_012262chr1125278 4681 4512 4283 4204 3428 3407 2057 897 880 786 459 34654 975 912 64940 4687 3757 3337 3178 200 14217
NM_012266chr911124 11163 1431 --
NM_012281chr772386 2316 2129 2085 1759 917 798 ------
NM_012287chr3114290 4266 4119 3798 3725 3607 3352 1823 1408 1044 817 74369 3193 3182 3049 1481 614 83 54400 4137 3071 1230 1029 34223 3543 675
NM_012288chr695760 5604 5301 5149 4737 3822 361 353 341 13680 65645 4782 4678 4327 1959 889 --
NM_012290chr251347 664 392 302 39 1676 ----
NM_012294chr774073 4050 3904 3611 3489 1529 1262 --3708 395 74 --
NM_012297chr482396 2096 2044 1974 1893 1789 863 162 --22415 2013 --
NM_012300chr522527 573 --42222 1780 949 369 --
NM_012301chr722142 1744 --21882 82 11977
NM_012302chr141173 846 823 216 1251 --11125
NM_012307chr183878 853 756 --4899 835 736 695 --
NM_012309chr11134455 4312 4224 4075 3666 3313 3094 1907 1871 1549 704 690 399 33997 3105 1727 13305 --
NM_012311chr104620 580 492 236 --1215 --
NM_012316chr1125575 5469 4291 3483 1944 1913 1604 1165 939 891 556 257 11128 55445 5439 4267 346 340 --
NM_012322chr72316 126 --2295 283 --
NM_012323chr2231583 1540 1051 11146 ----
NM_012325chr2021126 611 21641 1419 11270 --
NM_012327chr1841302 1261 1110 482 21617 1316 11127 --
NM_012328chr761439 929 908 247 196 83 --11160 --
NM_012329chr1731709 434 35 21595 281 61599 1420 1240 1192 1186 389 --
NM_012330chr1051497 1352 586 429 131 --1228 11515
NM_012334chr573440 3280 3156 2987 1650 998 788 43581 3250 1155 697 43561 3387 1451 1251 1731
NM_012338chr781261 1217 1209 1200 1169 1098 768 363 1142 ----
NM_012341chr103479 200 46 1438 2389 130 1403
NM_012342chr104527 360 193 160 --1198 --
NM_012343chr52704 226 1252 ----
NM_012345chr1351885 1692 1365 1292 505 31849 1629 444 31853 1553 1442 1260
NM_012347chr692941 2886 2234 2037 1169 503 429 270 215 --21201 207 1164
NM_012382chr5144378 4365 4267 4259 3306 3231 1239 885 878 830 471 435 177 22 14104 41540 1188 918 698 43762 1695 1536 845
NM_012388chr1593164 2890 2700 2503 2368 2218 1177 248 212 12309 63016 2608 2040 2035 428 233 22575 364
NM_012398chr191258 ------
NM_012399chr2261955 1298 788 708 634 354 1773 21292 493 --
NM_012405chr183804 2820 2615 2533 886 580 541 481 --43597 3147 3015 2649 --
NM_012414chr11254 --2837 711 164
NM_012417chr173489 90 34 ------
NM_012420chr1051876 1847 1577 795 285 21722 150 11606 178
NM_012424chr15776 689 619 562 87 ------
NM_012425chr1092772 2740 2696 1996 1842 1777 841 494 308 --3553 401 113 22643 407
NM_012428chr155882 862 319 210 136 --2679 238 --
NM_012430chr32535 108 --2749 527 --
NM_012431chr7133001 2287 1420 1392 1257 1242 1084 761 616 441 278 213 91 23190 936 2303 261 3623 485 299
NM_012432chr11340 ------
NM_012434chr661513 1468 1446 1175 328 39 21578 216 11622 --
NM_012443chr103866 130 102 1151 ----
NM_012446chr53556 450 132 1473 1486 --
NM_012448chr1772422 2384 2347 1585 966 521 495 22532 2399 21650 308 --
NM_012454chr62549 214 --2564 43 3416 391 160
NM_012463chr12101823 1279 1145 1136 669 494 399 348 332 167 31506 1232 1174 31529 1288 261 --
NM_012464chr472858 2012 962 571 514 409 58 12933 42901 2773 2559 1932 --
NM_012465chr1093364 2851 2794 2531 2264 772 371 206 106 33008 2859 2539 23371 3315 --
NM_012471chrX41822 1628 192 126 --51896 724 300 295 181 --
NM_012475chr1183 ------
NM_012479chr792676 2621 2594 2458 2049 2015 900 643 410 --32645 2153 54 --
NM_012482chr11613 --2143 53 --
NM_012484chr52517 29 184 1169 --
NM_012486chr13398 129 87 ----1422
NM_013227chr151821 --1345 --
NM_013229chr1252679 2252 1758 745 403 22037 342 1605 1484
NM_013230chrY81721 1411 1391 1339 1170 1150 1144 511 ----11696
NM_013231chr14124263 3608 3207 2834 2746 1594 1452 1419 1163 1011 928 861 --2910 224 24418 3657
NM_013233chr251328 1131 1034 413 353 2429 203 1550 --
NM_013243chr1541043 1001 502 228 1248 1268 --
NM_013246chr112904 887 ------
NM_013249chr114363 340 203 146 ------
NM_013254chr12------2502 497
NM_013255chr7318867 8780 7956 7834 7100 6929 6791 6518 6455 6255 6146 6004 5648 5546 5496 3367 2130 2014 1980 1902 1722 1630 1532 1504 1125 937 500 392 332 257 228 48583 7181 2482 713 117037 6891 6326 2742 2672 2052 1969 1509 1031 986 976 1268
NM_013257chr862351 2215 911 463 264 142 --2948 222 11871
NM_013261chr472826 2733 2435 2415 1444 1350 1104 43582 3190 2565 107 43033 3027 2671 264 11111
NM_013262chr631348 1264 1094 --31399 925 411 --
NM_013269chr1284442 4336 4252 3222 2744 1557 1400 82 24040 1667 24540 3228 --
NM_013281chr2041517 1220 259 237 1230 31446 1108 294 --
NM_013282chr1921307 1091 11172 31211 156 150 --
NM_013283chr54812 644 608 340 196 --1867
NM_013286chr3113803 3634 3400 3118 3025 2762 2493 2437 1210 822 260 --33796 268 111 153
NM_013293chr73637 257 123 --1278 --
NM_013309chr157714 675 649 547 444 350 32 22274 587 ----
NM_013314chr104259 244 87 31 --1265 --
NM_013320chr12140 ------
NM_013322chr771443 1166 1059 658 510 472 155 1534 21653 1193 21475 172
NM_013341chr222072 854 22903 2052 3946 211 130 22932 2856
NM_013352chr66807 746 690 291 267 130 1620 1909 --
NM_013354chr871444 1423 1009 973 528 355 280 11156 31128 314 22 --
NM_013357chr81734 --1766 --
NM_013367chr4----1112 --
NM_013372chr1582760 2744 2501 2477 1200 941 232 80 22445 250 23014 2945 --
NM_013374chr393087 3005 2984 2955 2925 2659 474 427 303 32277 1038 656 --1700
NM_013381chr12112440 2371 2292 2108 2052 1798 572 389 254 172 166 22150 1769 21498 146 11618
NM_013382chr1451917 1675 906 409 399 --11794 --
NM_013386chr1131794 1570 1516 1509 1498 1468 1351 1199 697 629 590 400 341 1229 31371 727 520 11161
NM_013390chr971806 1111 588 564 270 151 53 --1299 --
NM_013396chr2151172 611 425 259 78 21574 1142 2292 287 1113
NM_013410chr131278 1035 329 --11211 --
NM_013411chr152272 1967 640 323 277 --1832 --
NM_013423chrX41124 846 505 292 21158 1090 ----
NM_013427chrX41124 846 505 292 21158 1090 ----
NM_013436chr25602 309 301 243 131 174 ----
NM_013437chr871432 1298 1211 1186 1032 935 387 21084 188 21013 58 1368
NM_013438chr961542 1529 471 400 300 173 21698 73 2305 37 --
NM_013441chr11430 ------
NM_013444chrX51135 971 434 261 193 --41085 198 91 39 --
NM_013448chr142539 294 ------
NM_013449chr1282541 2528 2371 2103 1985 1835 375 280 11915 22253 1853 --
NM_013450chr251189 1029 931 434 375 --51241 796 402 390 23 1497
NM_013943chr1123323 3253 3198 3140 2964 2896 2723 2525 2125 1322 440 95 12348 42475 2236 618 599 2834 187
NM_013956chr8------143
NM_013957chr8------143
NM_013960chr8------3765 760 719
NM_013964chr8------143
NM_013979chr51433 ------
NM_013986chr221135 1128 144 --
NM_013989chr1495055 4515 4056 3218 2055 1543 1323 1002 318 55135 4709 3447 1852 1519 21861 974 11857
NM_013995chrX112615 2530 2429 2388 2340 1925 1883 818 788 580 492 42349 911 775 257 2918 211 --
NM_013996chr72358 90 --1138 --
NM_013996chr72358 90 --1138 --
NM_013997chr72358 90 --1138 --
NM_013997chr72358 90 --1138 --
NM_013998chr72358 90 --1138 --
NM_013998chr72358 90 --1138 --
NM_014000chr1051939 1804 1718 1633 694 --21602 1435 --
NM_014003chr161404 ------
NM_014005chr582415 2035 1179 1034 597 209 98 74 41195 1080 1056 235 --1376
NM_014011chr232324 980 150 22060 697 1383 --
NM_014016chr361684 1610 1525 1297 433 356 31179 674 332 21356 375 --
NM_014021chr1143507 3253 3029 2960 2950 2897 2620 2592 2529 2374 2341 913 378 198 11372 1759 --
NM_014023chr1052661 2624 629 183 116 --32879 2856 190 --
NM_014026chr11--196 ----
NM_014028chr6173083 3033 2906 2706 2687 2475 2433 2424 2060 1187 1125 1061 857 772 671 627 193 42651 799 649 226 31236 732 660 43197 704 280 275
NM_014031chr54359 303 234 31 ------
NM_014033chr1262282 2240 2107 1978 610 306 12312 1943 1911
NM_014034chr641174 949 386 179 1358 21549 253 1211
NM_014038chr71309 ------
NM_014039chr1191361 1310 1295 1036 1024 924 472 316 219 --1397 11094
NM_014043chr371586 1128 642 412 286 90 22 --21632 471 --
NM_014044chr21201 ------
NM_014048chr16135204 4890 4687 4137 3389 1943 1930 1629 1573 1537 1515 1311 856 1625 24932 601 14635
NM_014055chr123490 446 30 --1457 --
NM_014057chr941567 1492 1309 1230 2522 129 41574 1503 1459 645 1641
NM_014059chr133360 290 252 ------
NM_014079chr331035 890 76 --21066 844 --
NM_014089chr1351927 1850 1715 117 60 11408 22280 1951 --
NM_014106chr15122621 2431 2187 2099 2015 1103 1029 1015 743 254 121 62 32995 2212 1880 52755 2216 885 566 45 31958 1184 431
NM_014109chr831019 776 394 --2879 274 --
NM_014112chr874963 4444 1834 1784 1440 1002 676 13784 105395 4324 2041 1949 1912 1549 1486 1379 1007 845 15391
NM_014117chr1662657 1772 762 391 351 335 12421 32260 2198 2179 --
NM_014141chr7135021 4774 3488 2144 2104 1993 1414 1305 1237 546 439 379 245 11121 65099 4933 4391 3311 984 294 22025 990
NM_014153chr163613 586 524 ------
NM_014154chr371444 1293 1135 1058 1040 295 167 11341 ----
NM_014155chr11197155 7046 6964 6018 5895 5802 5742 5177 5047 4986 4757 4733 2060 1849 1776 999 799 714 459 87576 7112 6692 6561 6258 5636 2993 1154 77273 4694 2360 1609 1424 439 413 16318
NM_014160chr361414 1152 1124 1066 379 217 ----31372 1326 297
NM_014171chr24547 541 307 269 --3652 196 42 --
NM_014181chr2132862 2841 2621 2585 2420 1891 1840 1044 938 872 777 738 533 32609 673 403 1820 --
NM_014184chr13142 131 107 ------
NM_014191chr12----1348 --
NM_014212chr12----371 64 58 254 49
NM_014217chr131781 1225 752 --31722 1610 1509 --
NM_014220chr33527 198 118 ------
NM_014223chr12490 184 --1694 --
NM_014225chr191324 --1402 1389
NM_014232chr171156 ------
NM_014232chr171156 ------
NM_014240chr393436 1347 1111 903 738 589 567 201 190 --14082 --
NM_014243chr451965 1847 1411 1374 1334 --1161 1510
NM_014246chr2252236 1882 1874 1761 471 ------
NM_014249chr151389 --1524 --
NM_014250chr2251895 1606 1481 1363 175 --32050 364 180 --
NM_014253chrX52460 2341 2237 911 560 42304 2249 2201 156 11703 --
NM_014258chr203626 480 218 126 1695 --
NM_014263chr1071211 1006 549 413 212 126 70 --11365 11444
NM_014264chr4----2567 459 --
NM_014267chr111332 2893 314 2921 139 --
NM_014268chr1821392 433 --41380 1310 1304 1238 --
NM_014271chrX2805 302 ----1336
NM_014278chr4--1343 1389 --
NM_014284chr121033 718 --1723 --
NM_014289chrX----148 --
NM_014294chr831051 387 45 4986 539 245 190 31485 260 249 1544
NM_014296chr341614 1216 1117 528 11534 11271 --
NM_014300chr151310 ------
NM_014305chr132561 530 --2696 675 --
NM_014309chr2244620 3863 175 140 34567 3326 2100 65323 3783 2183 2177 2171 1037 13937
NM_014313chr121472 100 11510 1481 11629
NM_014315chr141149 ------
NM_014319chr12111953 1778 1505 1259 763 470 293 195 99 83 33 11650 --21847 1210
NM_014320chr62233 128 ------
NM_014321chr165800 755 749 727 228 ----1656
NM_014322chr151178 1112 995 309 292 1203 1890 1978
NM_014325chr1262260 2084 792 462 454 285 --32142 553 391 --
NM_014331chr4267773 7669 7359 6921 6302 6285 5969 5881 5816 5572 5381 4935 4920 3039 2913 2817 2751 2710 2584 2403 2223 1802 1540 1004 499 63 57822 7807 7296 540 139 76311 5154 5139 4890 2594 2408 124 36769 6291 480
NM_014332chrX1337 ------
NM_014333chr1182469 1978 1857 1825 1018 490 354 232 --52657 2519 1874 475 465 11890
NM_014335chr1571115 1099 1069 1020 571 481 443 --1280 --
NM_014344chr11----1782 1823
NM_014345chr661067 996 764 337 326 244 --41050 782 704 270 --
NM_014350chr561001 404 368 165 148 38 --41131 1032 1025 378 --
NM_014352chr1121406 1232 2957 286 ----
NM_014363chr1361280 1253 1227 800 360 194 11140 21184 468 11055
NM_014368chr942133 2118 2015 389 --21371 460 --
NM_014372chr161806 1726 1619 1578 596 198 1166 41820 1345 787 349 11470
NM_014376chr592525 2513 2430 1902 941 896 730 331 247 --12285 --
NM_014382chr341126 345 257 22 --41766 1705 669 355 2676 665
NM_014388chr1186091 5881 5858 4180 3827 2089 1866 1658 1591 1473 1377 1191 1153 1085 623 391 276 81 1878 54096 3833 1401 1239 783 --
NM_014393chr882274 2106 1638 1569 1473 943 921 122 1548 22181 180 12247
NM_014395chr461912 1663 1385 1319 613 475 --31986 705 572 --
NM_014397chr941473 1432 1082 49 ------
NM_014399chr71138 ------
NM_014411chr711948 --1152 11589
NM_014415chr31434 3587 577 519 21101 227 31396 551 350
NM_014421chr4102028 2001 1987 1955 1670 1580 1550 807 673 362 11415 ----
NM_014423chr5195597 5500 5443 5317 5285 5062 5046 3841 3616 2055 1819 1635 1082 684 418 358 305 210 201 23588 1389 41595 1393 989 862 1311
NM_014432chr62543 126 31135 620 598 2348 320 --
NM_014445chr352134 1954 1910 1541 788 2804 611 11663 --
NM_014447chr441354 663 593 466 31545 399 152 --11589
NM_014448chr11518 ------
NM_014452chr64481 351 320 294 ----21014 921
NM_014454chr661077 1024 940 793 232 142 --31049 306 237 --
NM_014455chr1--1378 ----
NM_014456chr1051627 582 462 438 376 ------
NM_014458chr141392 1216 382 103 --2304 200 --
NM_014462chr82307 131 --1122 --
NM_014487chr42700 677 ------
NM_014489chr112863 704 ------
NM_014496chrX2212 99 ----1295
NM_014497chr2161 ------
NM_014500chrX1264 ------
NM_014503chr122469 406 ------
NM_014504chr751801 554 190 95 27 12097 21500 766 --
NM_014506chr911179 --11069 11185
NM_014515chr1231025 767 250 ------
NM_014516chr191235 ------
NM_014517chr351715 1556 1531 1201 725 --31932 1790 1638 --
NM_014520chr172399 56 ------
NM_014521chr251821 1736 1467 1450 630 21831 1578 ----
NM_014522chrX1671 --2521 21 --
NM_014547chr152827 195 2667 173 ----
NM_014547chr152827 195 2667 173 ----
NM_014548chr1531044 194 158 --1300 --
NM_014552chr241473 1184 960 321 11533 11506 11159
NM_014554chr1261544 1459 1443 599 253 186 --11701 --
NM_014570chr223997 843 112 --2856 257 1253
NM_014572chr13101767 1723 1532 1497 1380 1305 1196 562 236 121 21681 356 41447 511 340 273 --
NM_014574chr1461348 1190 1035 973 191 35 31580 1081 547 21272 497 1503
NM_014575chr32174 149 1447 141 1163
NM_014577chr223717 337 140 1855 2865 859 1593
NM_014584chr1441567 1102 659 559 3597 519 211 1117 11187
NM_014585chr251277 1201 1114 970 938 11061 4944 429 410 58 --
NM_014586chr2134473 3085 1525 14190 24339 1752 13296
NM_014587chr1651586 1375 1366 1357 1346 --2623 599 --
NM_014606chr441345 1079 1011 89 11232 41522 1416 627 577 1993
NM_014607chr281969 1690 1643 1357 336 275 202 93 187 22145 543 11363
NM_014608chr153180 116 82 --1155 --
NM_014613chr572702 690 592 580 526 431 133 23057 2243 1365 12177
NM_014614chr221345 334 --21100 395 --
NM_014615chr1673580 3089 2530 509 465 277 76 153 63422 2830 2543 964 524 414 1835
NM_014616chr383214 3195 3188 2278 743 589 441 357 32597 839 312 32160 1114 867 --
NM_014620chr123735 292 70 --1297 --
NM_014629chr841364 850 473 459 1905 --11371
NM_014630chr1593979 3619 3557 3118 2624 1325 397 220 211 13142 33604 3130 2674 --
NM_014633chr112578 432 --1438 --
NM_014635chr231121 452 426 1146 11678 21740 1502
NM_014636chr974329 4300 4266 1725 1588 832 323 24347 592 24372 1297 --
NM_014637chr831429 1408 372 11055 21043 172 --
NM_014647chr1692221 2079 2007 661 599 536 414 350 219 1262 ----
NM_014653chr1242120 1987 1557 1403 ------
NM_014660chr76773 720 374 257 207 167 --2845 272 --
NM_014663chr11389 --11096 --
NM_014666chr541303 1214 493 355 --2950 872 1868
NM_014667chr371847 1747 380 369 248 169 122 1804 1914 --
NM_014669chr161125 ------
NM_014670chr231594 540 266 --11600 21188 137
NM_014671chr761560 1527 1479 1261 563 183 41469 1201 553 244 1199 11417
NM_014673chr8169 ------
NM_014674chr3103863 3753 3698 3299 2585 2434 1224 837 736 424 33884 2810 396 53758 3711 2573 1312 400 --
NM_014675chr11453 ------
NM_014676chr151631 1439 1215 295 207 --11680 --
NM_014677chr841199 950 890 331 ------
NM_014679chr1151208 464 388 294 69 --2536 531 --
NM_014682chr892119 2110 2058 1783 759 371 314 246 221 21982 1961 41539 397 226 138 --
NM_014683chr1761990 1807 1452 1434 1394 781 32186 1791 670 11365 11796
NM_014685chr161130 2509 421 1491 1514
NM_014686chr1911993 2528 462 ----
NM_014689chr23543 113 88 1596 1628 --
NM_014699chr162366 352 --1338 --
NM_014701chr15163224 3133 3102 2676 2428 2177 1265 1197 977 762 729 722 357 293 140 126 12840 1228 23375 3055
NM_014702chr693353 2880 2774 2315 2148 1175 738 459 423 32444 2347 943 42977 1041 986 834 23432 2597
NM_014705chr771976 1599 1450 749 696 619 131 11564 21769 579 21846 426
NM_014707chr762019 1983 1939 1851 1762 277 2856 614 3662 656 305 --
NM_014711chr16122097 2077 2021 2013 2004 1988 1436 1372 802 782 155 53 11724 62083 2069 2032 2026 305 33 1245
NM_014713chr22365 348 --1130 --
NM_014718chr121682 ------
NM_014720chr1061596 1284 731 548 503 315 11740 11400 --
NM_014721chr6227367 7316 7310 7242 7024 6974 6725 6661 6326 6181 6009 5909 4799 2498 2305 1969 1953 1662 1439 1343 728 467 42519 1891 1631 1193 21833 1049 52432 1984 1976 1504 604
NM_014723chr2032009 1023 93 ------
NM_014727chr191265 ------
NM_014729chr832078 583 542 22037 810 51855 724 703 181 64 --
NM_014730chr1274612 4306 3937 3511 1020 620 77 14628 15286 11667
NM_014730chr1274612 4306 3937 3511 1020 620 77 14628 15286 11667
NM_014733chr581898 1808 771 685 505 386 280 201 --1792 --
NM_014735chrX62138 1941 1693 1624 614 267 --21503 1496 --
NM_014738chr171684 ------
NM_014739chr684174 3906 2878 2568 1657 941 280 95 42642 2583 1266 1018 33231 2791 643 1428
NM_014741chr1142185 2116 1379 509 1825 1805 --
NM_014743chr463201 2420 2099 562 289 149 --23024 835 1155
NM_014746chr2124392 3802 3536 3413 3286 1572 1565 1458 1321 1301 870 496 24328 4093 21545 1492 --
NM_014749chr143887 611 549 1126 ----
NM_014751chr812169 32059 1835 1512 --1455
NM_014752chr1151687 1663 1575 1427 460 2784 304 31673 557 241 1232
NM_014753chr101299 --2270 242 --
NM_014755chr2103340 3060 2651 1261 690 630 556 409 352 90 21703 822 54268 2767 1449 1077 145 23093 550
NM_014757chr582393 2171 2024 1980 615 428 78 45 --42360 2178 2102 1522 --
NM_014764chr1221293 424 172 1308 21132 1127
NM_014765chr132680 1988 190 42010 623 161 44 2169 137 22523 1043
NM_014766chr722988 29 13551 43187 2652 2605 2495 --
NM_014772chr1833598 2497 2329 --43125 2730 725 707 13113
NM_014774chr1123165 3146 2998 2557 2394 2370 2258 2077 2044 184 115 70 --1159 --
NM_014779chr39990 887 821 790 756 460 441 430 100 ------
NM_014781chr821225 1108 --1144 --
NM_014782chrX3333 270 82 ------
NM_014783chr1591550 1542 1526 1161 1116 595 408 181 168 21641 1285 ----
NM_014786chr111431 ------
NM_014787chr162273 2175 1991 1881 1754 481 12647 22798 2332 --
NM_014790chr51144 1118 ----
NM_014793chr152612 579 ------
NM_014795chr271254 1010 977 879 479 400 30 21064 275 21182 870 11178
NM_014797chr663190 3039 2462 2046 721 424 22148 629 1432 --
NM_014802chr1231134 1124 808 --21151 56 --
NM_014803chr1062820 1797 995 972 954 458 --32673 2546 510 --
NM_014806chr91467 ------
NM_014810chr142742 1283 913 513 13674 2607 212 11013
NM_014811chr93227 205 154 ------
NM_014812chr171962 1940 1762 1675 1547 440 135 --51972 1945 1914 1908 144 --
NM_014819chr5102346 2262 2207 2113 1919 1529 873 861 835 440 12217 22244 1926 --
NM_014820chr381856 1517 1430 1396 1373 1273 784 127 1383 ----
NM_014824chr1151976 1828 1798 1380 807 11819 --11854
NM_014826chr164037 3497 3299 3205 3148 1077 54342 4177 2954 958 516 44201 1571 348 255 14197
NM_014827chr131657 1524 1201 --11588 1184
NM_014828chr1482542 2205 1685 1544 698 546 460 200 --1207 --
NM_014830chr1263920 3826 3306 2689 1502 1265 --32752 1507 1088 --
NM_014832chr1381983 1741 1422 1404 844 615 442 256 ----21814 672
NM_014835chr2042189 1841 623 554 --1586 12174
NM_014836chr1052010 1304 369 349 243 --41704 1474 1468 282 2404 399
NM_014838chr2252890 2333 2141 1760 997 1393 1612 22403 409
NM_014839chr182495 2296 863 759 725 699 667 572 42336 931 550 310 2868 753 1830
NM_014840chr1293377 3202 3183 3152 3140 2746 1254 1189 1061 23274 2651 13429 1235
NM_014841chr641226 1215 281 227 --1555 1900
NM_014847chr11202 ------
NM_014848chr1581829 949 776 719 647 584 499 469 12626 32654 2012 1014 --
NM_014850chr364677 4657 3770 3239 1560 556 ------
NM_014858chr13767 275 149 --21038 999 11034
NM_014860chr2101748 1040 812 720 703 682 603 571 556 334 11980 2633 169 --
NM_014864chr144229 3645 1350 145 13104 23874 3542 --
NM_014872chr92627 530 2757 486 22002 537 --
NM_014873chr1114877 4648 4567 4538 4340 3859 3152 1798 1375 837 662 34179 204 153 84554 4423 3832 3348 3299 1508 1196 920 34606 4510 69
NM_014876chr2232249 743 246 --22195 294 --
NM_014877chr17197653 7329 6875 6822 6679 6077 5463 5082 4800 3060 2719 2456 2379 2247 1967 1348 1030 982 647 47763 4972 2592 830 167596 7355 6887 6503 6390 6229 5665 4976 4830 2530 1326 1234 701 451 181 134 16310
NM_014887chr133773 761 714 2310 186 ----
NM_014888chr741480 1431 1290 146 3383 267 85 21605 387 21532 475
NM_014890chr32103 36 1312 1344 --
NM_014892chr61656 1434 1212 --
NM_014893chrY71958 1669 1552 1469 715 674 370 1244 ----
NM_014897chr1773097 2636 2441 2367 2194 2026 232 --53001 2765 1174 841 320 31170 575 558
NM_014898chr1951971 1747 933 127 94 12357 --12302
NM_014899chr572681 2663 2314 1254 1190 1042 555 43109 3041 2066 1996 --23046 270
NM_014902chr2021192 1037 ------
NM_014903chr1282485 2423 2374 2241 1634 769 200 65 --32464 1817 35 --
NM_014904chr1073883 2542 2531 1623 1567 1554 837 32625 1221 454 93298 3020 2928 2755 2616 2610 2496 1346 1265 22773 1560
NM_014905chr262041 2025 1942 1531 641 289 199 ----
NM_014906chr17153753 3725 2955 2664 1563 1237 1222 1190 1013 993 913 742 721 692 339 24070 833 11646 --
NM_014910chr192806 199 ------
NM_014912chr10153324 3250 3234 3226 3215 3117 2683 2601 2322 2229 2167 1157 873 568 154 --93392 3373 3317 3167 3035 2804 2308 607 401 11192
NM_014913chr1851509 570 543 177 132 --1341 --
NM_014916chr72745 637 ------
NM_014917chr1----2825 717 1974
NM_014918chr1551583 1570 1252 1217 1160 1102 147 --
NM_014920chr693675 3220 2695 2390 1131 544 440 357 49 12343 73756 3427 3174 1421 1414 632 241 33368 3170 216
NM_014923chr13122233 1906 1677 1495 1486 739 729 668 652 491 312 60 --272 40 --
NM_014924chr1452830 2672 2564 806 716 22037 566 12687 --
NM_014926chr32385 28 --2372 270 --
NM_014932chr372000 1461 605 409 226 200 25 ------
NM_014936chr6122901 2792 2778 2559 2436 2396 2367 2218 752 467 313 94 31947 1849 584 41111 917 894 138 11762
NM_014937chr1041292 985 237 36 2483 71 11267 --
NM_014942chr6122438 2380 2100 2046 2032 1635 934 878 708 624 564 212 --42390 1936 1014 699 --
NM_014946chr283058 2942 2633 2430 946 769 424 36 --62387 954 835 629 563 486 22462 1094
NM_014947chr1133054 3025 2863 2437 2285 2230 759 698 532 472 458 323 169 11088 31219 914 126 --
NM_014949chr13983 362 176 1370 ----
NM_014950chr1431731 1103 701 31691 1364 551 31681 1124 1108 --
NM_014951chr1062536 2436 2318 1975 1849 1814 --42481 2364 2308 2106 --
NM_014952chr1531944 1868 1840 11933 ----
NM_014953chr13103784 3309 2727 951 921 718 594 341 333 201 23924 529 22643 100 --
NM_014961chr43872 585 253 11744 --11557
NM_014962chr2092852 2791 2538 1886 941 905 535 354 272 11067 22427 390 22419 2271
NM_014964chr1772427 2056 920 782 695 676 611 1468 21615 472 --
NM_014969chr151190 1050 976 926 177 11065 21017 446 11042
NM_014977chr14----2524 518 --
NM_014978chr1041853 1663 1272 563 --31491 1464 45 --
NM_014982chr14165044 4587 4511 4504 4486 3329 2097 1955 1166 1155 1002 750 636 609 350 210 1308 74389 4006 3516 1780 1254 1131 1124 13879
NM_014988chr452182 2009 1904 1871 579 ------
NM_014989chr6142033 2002 1837 1827 1729 1547 1484 759 689 501 438 392 153 39 --22084 1673 --
NM_014990chr1471136 1029 842 521 396 354 288 ------
NM_014991chr4113039 2994 2941 2917 2717 2536 2499 2234 1233 1184 346 11219 42833 2827 2789 1024 --
NM_014994chr1532303 2287 175 ------
NM_014996chr34866 743 687 104 1941 1961 1422
NM_014997chr752705 2550 199 116 58 11140 12317 12738
NM_014999chr1251425 1100 655 573 408 31563 1071 123 --21199 92
NM_015000chr12102899 2871 2862 2735 2500 2199 1018 910 896 61 22929 204 72943 2652 2163 2083 1072 971 211 1830
NM_015002chr1232086 1803 814 1719 31424 820 580 --
NM_015005chr14----21293 317 11737
NM_015008chr363172 2842 2260 1068 663 171 12220 32657 1308 893 --
NM_015009chr32311 247 1164 2862 770 --
NM_015012chr11179 --1364 --
NM_015013chr11300 ------
NM_015017chr131159 126 91 1397 31034 253 101 197
NM_015018chr6146 ------
NM_015020chr1663834 3825 3502 3219 2997 2766 22778 2592 32457 906 277 --
NM_015024chr821242 580 --11323 --
NM_015025chr262242 2009 1003 361 91 30 2551 338 22571 555 21064 154
NM_015026chr12234699 4538 4290 4249 4132 4020 3523 3284 3253 1703 1658 1626 1620 1572 1336 1311 1305 1268 1143 625 613 543 330 43931 3222 1652 932 23073 1750 43879 3507 1433 694
NM_015027chr1641825 1736 1376 687 --11605 --
NM_015032chr1322123 2030 42436 1071 745 170 32754 1785 137 1663
NM_015035chr2096666 5779 5211 2287 1850 1801 1352 1227 746 21277 712 45958 1930 1728 627 --
NM_015037chr101238 ------
NM_015039chr184315 1696 1623 1557 1490 585 491 468 --23420 496 14249
NM_015040chr293363 3328 2616 2344 781 745 693 453 82 23344 2746 22672 2599 --
NM_015042chr15114339 4329 3604 3193 3051 1459 1315 1277 1237 1204 498 ------
NM_015044chr1662882 2834 2819 2552 1004 820 --22117 49 --
NM_015045chr1082280 2145 2125 1623 1440 871 654 617 11674 4661 484 478 267 32152 1679 304
NM_015046chr972593 2412 2039 2012 1029 486 167 --22210 1821 11811
NM_015051chr9102347 2194 2154 567 533 509 396 361 95 75 --63052 2495 2489 1318 1203 101 --
NM_015052chr741071 1035 503 347 --1121 --
NM_015054chr123506 430 411 --194 --
NM_015055chr1192933 2793 2610 2536 2389 1893 1120 481 419 --12669 --
NM_015056chr2152375 2293 1846 1829 33 --12164 --
NM_015057chr132462 447 --1192 --
NM_015059chr1583993 2983 2729 1571 1453 1123 1058 624 --33984 3032 652 --
NM_015068chr743674 3595 3535 1264 --43850 3433 2669 288 --
NM_015070chr1391573 1490 1353 646 512 486 227 120 92 --1158 11187
NM_015071chr596408 6045 5455 5379 4335 2283 2157 1570 1267 15513 21664 436 --
NM_015072chr143631 391 96 --1429 --
NM_015074chr1114321 3647 3454 3413 3024 1907 1502 937 694 442 348 --34818 1868 1553 --
NM_015075chrX22028 2012 ------
NM_015076chr6104455 4434 4197 3886 3724 3475 2910 1112 1054 906 31371 651 538 --14523
NM_015080chr11----2302 280 --
NM_015087chr13112667 2635 2433 2238 2146 1029 573 368 320 251 98 --22378 226 1771
NM_015091chr145865 676 540 255 122 ----1706
NM_015092chr16144632 4412 4045 4011 3576 3539 3009 1217 1177 951 844 725 612 486 33699 3512 1306 74425 3631 3205 3136 3057 3027 1310 --
NM_015093chr641861 1771 1364 380 21197 661 31703 1351 689 --
NM_015094chr2233390 1787 859 11824 1662 14690
NM_015097chr392288 2188 1629 812 672 433 421 285 146 11957 2778 397 11696
NM_015100chr151581 775 332 297 108 ------
NM_015107chrX82429 2294 2231 2034 1684 1514 734 120 --21689 1554 --
NM_015110chr992535 2513 2414 2074 1734 1624 643 323 120 1798 62384 1544 834 766 369 106 1777
NM_015115chr4122824 2672 2497 2399 2061 1220 1155 858 831 586 316 193 21235 389 43008 2794 1182 653 12095
NM_015116chr1311725 11075 21639 1379 11250
NM_015120chr21280 2116 40 169 --
NM_015122chr19----1230 --
NM_015129chrX51581 1540 716 535 212 161 31705 1587 246 --
NM_015130chr441235 1138 507 237 --11167 11272
NM_015132chr741903 1481 1312 220 1683 ----
NM_015137chr8112322 2261 1837 1722 1692 907 785 766 729 184 76 31757 626 492 1217 1926
NM_015141chr362366 2211 2164 2015 502 281 2735 340 11803 12070
NM_015143chr451336 580 324 273 263 --21328 284 11302
NM_015144chr1663950 3847 3760 3037 2925 1135 22956 116 32803 2770 120 33277 1429 951
NM_015149chr132130 2074 1528 --1505 --
NM_015153chr63750 713 222 1702 1606 1544
NM_015155chr1062739 1298 1266 1229 370 296 --11124 1210
NM_015156chr14133972 3701 3307 3218 2815 2745 2608 2465 1475 924 907 716 398 23856 1502 ----
NM_015158chr93844 607 24 --1792 --
NM_015161chr1641541 1531 1507 1404 --21437 272 1355
NM_015163chr1461692 1662 1538 1427 736 322 --21667 284 11680
NM_015169chr8----1374 --
NM_015170chr872308 2238 1993 1813 1596 840 123 --42021 1868 1643 1606 --
NM_015172chr11535 21143 1117 1512 --
NM_015176chr161432 1216 1110 581 496 402 11360 21306 198 --
NM_015180chr144785 614 603 224 --1790 1564
NM_015185chrX32840 2369 477 --4706 526 353 324 --
NM_015186chr93466 333 158 ----2317 22
NM_015191chr1172404 2391 912 506 413 164 56 11063 22654 88 --
NM_015192chr2093009 2926 2903 2764 2416 1999 1912 544 405 --42774 929 896 508 --
NM_015196chr41100 ------
NM_015199chr362873 2671 1950 833 656 49 --22532 978 12795
NM_015200chr44701 558 285 151 --21008 636 31663 1045 366
NM_015202chr1611700 ------
NM_015203chr1181 ------
NM_015206chr1553620 2915 1422 1209 501 13157 22926 812 --
NM_015208chr18113498 3044 2682 2672 2628 2610 1514 1248 1094 881 214 42981 2826 1344 998 23408 170 23228 524
NM_015209chr172213 2102 2050 1767 1706 865 804 11625 1297 12347
NM_015213chr114720 686 533 171 1161 2245 184 --
NM_015215chr152123 1123 840 727 461 23171 1085 43049 819 563 40 22503 2310
NM_015216chr531533 1085 588 --2549 355 --
NM_015225chr982640 2273 2095 1199 289 195 187 29 42431 875 631 169 22615 925 1605
NM_015226chr1653388 2419 636 599 447 --2714 478 --
NM_015230chr471669 1617 1464 1171 652 386 256 --41872 1355 193 32 --
NM_015233chr131993 1432 1829 11882
NM_015236chr421355 363 1590 21302 943 --
NM_015238chr53472 273 68 ------
NM_015239chr9158 --1189 --
NM_015245chr672555 2535 2119 1988 1926 1912 530 --12738 --
NM_015247chr16104963 4852 4162 4078 4063 4050 1940 1448 1417 291 24181 769 45230 4881 1315 158 1912
NM_015250chr981796 1770 1693 1443 1268 532 374 358 ----11839
NM_015252chr25928 878 750 602 46 2133 122 1333 --
NM_015254chr852750 2069 1976 750 122 11039 1761 --
NM_015256chr51156 1181 2581 185 --
NM_015262chr102533 144 ------
NM_015263chr1551187 940 893 749 73 --1971 --
NM_015265chr262287 1970 1712 1025 604 52 11652 42314 1762 622 120 --
NM_015267chr1221800 1792 1340 ----
NM_015269chr12212 177 1630 ----
NM_015270chr1251765 1455 428 416 225 ------
NM_015271chr4144224 3874 3664 3583 3417 3341 3276 3168 3050 2641 1716 1380 1080 131 14234 24004 520 33881 3576 3102
NM_015272chr164493 389 175 160 --2687 339 --
NM_015275chr1261499 792 742 683 361 180 31326 667 144 31967 1773 637 11698
NM_015277chr1841500 1271 588 402 2538 297 2505 367 --
NM_015278chr643321 1138 896 591 22571 1221 73248 3109 3044 747 571 248 242 12550
NM_015282chr252958 2702 580 423 131 --1398 --
NM_015285chr1851732 1579 698 641 301 12236 --11846
NM_015286chr1531839 551 393 11722 42093 596 212 115 173
NM_015288chr563636 2898 2877 1527 1384 367 --43593 3568 2370 132 12938
NM_015291chr1103418 3382 3110 3062 2209 2202 1161 1042 564 65 13545 42607 1316 1141 226 23510 2541
NM_015294chr171105 21059 763 21127 787 --
NM_015296chr1351188 1127 309 264 182 11104 1157 --
NM_015305chr1441943 1660 1285 341 --31898 1642 346 --
NM_015310chr8178294 8080 6986 6497 6120 5791 5443 3139 2635 1798 1708 1694 1682 1550 1254 647 140 47367 7231 5147 2177 48116 6188 1780 187 38112 5435 3048
NM_015313chr11164679 4511 4455 4406 4308 3975 3752 3008 1811 1711 1678 1502 1490 555 387 346 24558 2919 64493 3698 3653 3619 3057 852 --
NM_015314chr752267 1966 1950 493 216 32037 972 405 --21818 566
NM_015315chr553459 3388 904 693 544 13429 1732 1728
NM_015316chr1431187 1104 200 ------
NM_015317chr2112526 2038 1816 1799 1792 1111 839 830 621 538 301 22237 517 52068 1000 886 881 451 12064
NM_015319chr121458 ------
NM_015321chr1964891 1819 1797 1025 1001 564 13322 13326 --
NM_015323chr621747 1336 31162 1126 396 41079 568 489 259 --
NM_015326chr122922 2162 1464 --11144
NM_015328chr792454 2162 1015 925 775 667 539 401 137 ------
NM_015330chr2211990 --11995 --
NM_015331chr12604 580 ------
NM_015335chr1262650 2030 1699 966 603 541 --42264 2254 1841 645 32250 2177 609
NM_015336chr12142564 2556 2492 2470 2442 2398 2198 2113 1979 1942 1713 851 379 288 11791 32587 2299 1795 12550
NM_015339chr202180 147 --11006 1275
NM_015342chr53143 126 118 ------
NM_015344chr8112103 2013 1932 1613 1554 1501 751 672 414 238 156 1117 --1647
NM_015345chr612243 --22413 2255 --
NM_015347chr1272973 2781 2694 2272 1012 690 182 1701 22538 2499 22997 404
NM_015349chr682860 2815 2006 1924 702 670 426 293 12755 42981 2907 2404 487 --
NM_015352chr2073824 3799 3786 3335 1431 493 229 12740 13255 --
NM_015354chr9----1162 --
NM_015355chr17101990 1863 1788 1685 1296 1248 771 356 304 254 1224 --11656
NM_015358chr2151251 1222 1036 368 271 1957 21091 1061 --
NM_015359chr862944 2871 2836 2638 1929 523 12782 11915 11983
NM_015361chr21741 1815 1273 --
NM_015365chrX114136 3857 3583 3254 3047 3022 2839 1273 1004 442 342 11064 83943 3880 3783 3638 3528 3052 1028 284 23914 207
NM_015367chr2231628 1027 455 21587 437 11554 --
NM_015375chr154312 3919 3797 3092 36 --34119 3994 3899 --
NM_015378chr132522 2023 288 ----1196
NM_015379chr72212 76 --1218 --
NM_015381chr2232008 1720 461 --2451 445 --
NM_015382chr144739 714 577 555 --1702 1227
NM_015385chr1043258 2836 2533 232 --33189 2989 28 --
NM_015387chr261845 1786 1777 1345 813 154 1745 21994 680 --
NM_015393chr473510 3085 3013 2694 2647 374 43 1996 32624 1520 347 21158 966
NM_015394chr123503 169 98 11627 141 1706
NM_015396chr321230 476 --1428 1530
NM_015397chr951421 520 338 269 230 --1184 --
NM_015409chr1242694 2149 2016 345 --22622 2251 11928
NM_015412chr382845 2385 1088 1070 883 635 579 565 1111 22192 2060 --
NM_015423chr112530 92 ----11634
NM_015429chr371113 979 728 350 315 281 84 1259 1368 --
NM_015431chr153470 2753 2727 1011 549 --31291 621 514 --
NM_015432chr161643 --1522 --
NM_015435chr81269 1394 21108 1098 21387 211
NM_015436chr4123065 3046 2795 2546 2409 2256 2151 1309 1086 1047 743 300 1452 33100 2805 2132 23152 317
NM_015443chr1761445 1389 1376 1365 145 137 ------
NM_015446chr161569 1507 1400 1168 1123 474 41642 1143 420 190 21336 1181 --
NM_015455chr5204142 3729 3032 2843 2836 2694 2633 2554 2522 1574 1442 1342 1056 1012 845 655 350 282 130 94 54130 3777 3372 395 194 ----
NM_015457chr112918 345 --11096 --
NM_015458chr874971 4683 4305 3869 1780 1475 609 11381 64288 3225 1616 1605 1025 246 1670
NM_015460chr32429 288 12018 31946 1449 301 --
NM_015463chr23265 224 49 --1139 --
NM_015464chr78920 895 754 675 659 118 111 60 3821 311 45 ----
NM_015469chr96680 653 575 564 154 93 --1190 1308
NM_015474chr203251 212 110 198 ----
NM_015475chr251078 437 316 192 78 --1759 1853
NM_015483chr721134 40 --1123 1367
NM_015484chr12786 239 2683 277 5957 925 815 797 264 1857
NM_015488chr2--11661 ----
NM_015496chr83269 227 118 ------
NM_015497chr152411 219 ------
NM_015508chr3111522 1381 1045 1032 989 521 470 399 199 147 26 --21593 1386 --
NM_015509chr1271527 1277 1228 1221 1147 354 179 --11352 --
NM_015514chr142600 485 --3558 146 139 --
NM_015520chr382804 2666 2549 2032 936 922 908 770 12386 11924 --
NM_015532chr15112456 2389 2243 2236 2190 2105 2017 2006 1930 772 275 2941 254 32223 945 315 12805
NM_015535chr2114211 4137 3829 3595 2591 1277 1123 560 204 188 166 12719 1909 1468
NM_015541chr331359 1282 962 1264 21342 319 --
NM_015542chr1021119 856 --31041 929 924 --
NM_015548chr65814 729 672 130 44 --1871 1152
NM_015550chr7163594 3484 3295 3280 3257 3053 2931 2922 2906 2875 1248 1146 1001 587 532 147 11028 33532 3229 1092 23469 3454
NM_015553chr6104461 4328 4192 4033 3950 2037 1594 1119 1113 1020 45061 4901 1972 33 55184 3863 3781 3772 968 --
NM_015554chr15112876 2665 2376 2356 2322 1817 1794 1158 852 838 388 2931 805 32686 935 866 12398
NM_015555chr641739 1347 352 162 11180 2381 127 1587
NM_015559chr183932 729 684 ------
NM_015560chr392867 2624 2583 1089 1081 1043 918 309 211 32718 1955 904 42820 2630 1959 1134 1722
NM_015564chr5123577 3493 2903 2768 2636 2543 2339 1047 876 314 241 149 2176 46 ----
NM_015565chr2192263 2250 2143 2104 778 674 659 446 167 1436 52035 1584 183 133 103 1494
NM_015567chr1321055 375 1972 ----
NM_015569chr1124703 4589 4576 4170 3852 3562 3325 1924 789 640 500 259 13160 64627 4595 3628 902 843 301 --
NM_015570chr761318 737 693 532 409 229 11557 1460 --
NM_015571chr6122482 2395 2278 1701 941 888 866 721 472 408 249 29 12679 41948 965 917 215 --
NM_015575chr283532 3484 2368 1471 1260 950 815 375 13635 33277 1480 348 --
NM_015576chr362972 2954 1885 1189 374 350 12488 22604 2464 --
NM_015577chr511794 --21533 1284 --
NM_015578chr1961571 1349 1336 847 501 299 --21456 176 12034
NM_015601chr102326 109 1826 2963 392 1977
NM_015602chr1--11799 11821 11657
NM_015605chr1061162 982 512 368 221 141 --41520 1323 992 162 --
NM_015608chr103663 642 72 ----1140
NM_015609chr162327 2291 995 837 486 119 12983 ----
NM_015610chr722524 1012 --1552 --
NM_015622chr7--1247 ----
NM_015626chr1771223 1149 1030 833 323 163 107 --1289 11056
NM_015630chr261140 252 224 215 197 156 2844 802 1354 -