TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548as-3p
miRNA Sequence: UAAAACCCACAAUUAUGUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000719chr1284655 4568 1672 1132 883 877 764 758 ------
NM_000875chr1556182 5284 5112 4874 1007 16398 36531 6490 2599 --
NM_001011666chr736113 4187 2126 11022 12518 11892
NM_001039547chr315942 15019 --27776 2806
NM_001042355chr1664667 4316 1533 742 622 222 45034 1461 1344 442 --14535
NM_001042412chr1664667 4316 1533 742 622 222 45034 1461 1344 442 --14535
NM_001042601chr352939 882 817 244 116 1804 --1852
NM_004904chr736113 4187 2126 11022 12518 11892
NM_005156chr965055 4138 2003 1413 1272 1200 25086 4698 1986 14034
NM_005231chr112266 79 1251 186 11321
NM_014774chr173213 2970 2507 2501 798 620 501 12514 ----
NM_014864chr174378 4153 3364 3322 3149 1374 1367 ------
NM_014873chr111392 --54620 4325 4298 3440 1649 --
NM_015247chr1664667 4316 1533 742 622 222 45034 1461 1344 442 --14535
NM_015458chr843502 860 762 754 ----13258
NM_016090chr11--1167 --2218 199
NM_017637chr939383 8367 486 28330 3557 --29242 1535
NM_017658chr1434387 3367 3328 23573 579 --14542
NM_020122chr275560 1950 1267 1182 1170 380 75 12062 11069 --
NM_020727chr2153447 3162 2910 326 319 23847 3471 11277 --
NM_020772chr1747840 2593 2375 267 35511 2223 510 21610 1204 --
NM_020774chr1864897 3815 2246 1853 1610 850 36265 3791 380 12147 15952
NM_021148chr74814 808 793 749 21675 1006 1821 --
NM_022491chr1253352 3248 2984 2912 257 --22621 1169 147
NM_024524chr332879 879 325 1619 --22035 648
NM_032228chr1122962 673 --22616 2352 1477
NM_052879chr1222898 182 33828 3334 278 12995 11492
NM_080836chr2064379 3984 656 495 387 167 14525 14099 13749
NM_138565chr112266 79 1251 186 11321
NM_152624chr525181 2489 27474 877 --21306 273
NM_175624chr1264753 2632 1442 1232 832 569 ----12738
NM_175625chr1264753 2632 1442 1232 832 569 ----12738
NM_182898chr736113 4187 2126 11022 12518 11892
NM_182899chr736113 4187 2126 11022 12518 11892
NM_199188chr1222898 182 33828 3334 278 12995 11492
NM_199190chr1222898 182 33828 3334 278 12995 11492