TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548at-3p
miRNA Sequence: CAAAACCGCAGUAACUUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr697072 6367 4881 4689 2659 2466 1998 1315 863 ------
NM_000875chr1587061 6531 6490 6181 5632 5352 5284 2599 16398 ----
NM_000926chr1179392 9126 8627 8607 6914 690 681 18294 ----
NM_001001928chr2266005 5829 2731 2583 1926 1453 18350 13172 --
NM_001003652chr1888458 6246 5776 2837 1656 1377 1112 656 ------
NM_001009554chr464036 3779 3118 1466 500 418 11571 ----
NM_001009554chr464036 3779 3118 1466 500 418 11571 ----
NM_001010888chrX84582 4411 4314 3366 1799 995 821 603 ------
NM_001011666chr764946 2518 2340 2125 889 295 21892 1022 ----
NM_001014380chr1384961 4783 3983 1958 1874 1486 1430 105 ------
NM_001018067chr144531 3846 860 661 2432 410 15290 --
NM_001018068chr144531 3846 860 661 2432 410 15290 --
NM_001018069chr144531 3846 860 661 2432 410 15290 --
NM_001025076chr1072025 1885 1559 862 811 708 445 ------
NM_001039547chr357219 6616 5941 3155 38 37776 5019 2806 ----
NM_001099678chr346096 5493 1565 238 ----12392
NM_001106chr3109650 8161 6455 3639 3237 2672 2369 2092 1728 620 12655 ----
NM_001609chr1064342 3656 1161 1015 950 161 2814 459 ----
NM_001759chr1285293 5141 4823 4644 1938 1930 1678 1009 ------
NM_002025chrX99252 9191 9060 9046 7674 6877 2988 2101 1111 ------
NM_002270chr544746 4136 2108 1564 ----15538
NM_003597chr251621 1492 374 220 135 ----11932
NM_004904chr764946 2518 2340 2125 889 295 21892 1022 ----
NM_005036chr2266005 5829 2731 2583 1926 1453 18350 13172 --
NM_005156chr9105055 4137 3992 2003 1412 1271 1199 986 919 213 35086 4698 4034 ----
NM_005901chr1888458 6246 5776 2837 1656 1377 1112 656 ------
NM_006047chr2083514 2293 995 773 626 411 303 122 ------
NM_006203chr534491 1448 1267 11540 --11597
NM_006252chr177309 5696 4736 2994 2281 1255 332 ------
NM_006561chr1072025 1885 1559 862 811 708 445 ------
NM_006599chr1677973 7596 5620 3016 2900 1926 1652 ------
NM_012262chr175255 5032 4622 3684 2095 1756 1020 1566 ----
NM_014155chr1167029 6058 5343 5128 2637 2563 --168 --
NM_014253chrX51990 1757 886 74 61 12475 ----
NM_015458chr8105193 5179 3502 3419 3285 911 860 762 753 388 13258 ----
NM_015640chr144531 3846 860 661 2432 410 15290 --
NM_016206chr388679 7358 5866 2418 1581 424 140 73 ------
NM_016248chr1343552 2710 2440 281 ----13660
NM_017813chr885424 5054 4405 4238 3855 1381 1269 807 14412 ----
NM_018313chr352570 365 357 343 324 1592 ----
NM_018440chr898124 7799 7003 6762 2832 1617 1363 1257 390 ------
NM_020718chr1675853 5602 4091 2377 2214 1222 339 24113 1902 ----
NM_020727chr2173447 2917 2909 1277 325 319 229 23847 3471 ----
NM_020772chr1797840 7616 7567 7473 3274 2593 1610 1204 267 35511 2223 510 ----
NM_020774chr1845984 2147 1853 1609 46265 5952 3791 380 1850 --
NM_021647chr464036 3779 3118 1466 500 418 11571 ----
NM_021813chr695643 5631 5023 2337 2228 1911 1576 790 721 1695 ----
NM_021964chr385604 4326 4119 2184 1837 1439 1080 794 ------
NM_022459chr1374508 4239 4180 4033 970 782 592 1632 11505 --
NM_022473chr1564302 3832 3751 878 863 389 33944 3653 196 ----
NM_032116chr1384961 4783 3983 1958 1874 1486 1430 105 ------
NM_033224chr776985 6387 2873 2484 1834 1469 661 14874 ----
NM_033285chr883998 3529 3148 2955 1463 567 36 26 11792 ----
NM_080927chr373359 3195 2312 2296 2262 2087 2060 11025 ----
NM_138713chr1677973 7596 5620 3016 2900 1926 1652 ------
NM_138714chr1677973 7596 5620 3016 2900 1926 1652 ------
NM_144571chr484928 2636 2162 1186 1025 676 647 349 12537 ----
NM_152624chr555180 2759 2712 2488 2390 31306 877 273 --17474
NM_152641chr1272481 2316 1101 1074 991 545 438 ------
NM_152744chr763461 3265 2333 1222 1176 172 ----12670
NM_152838chr2083514 2293 995 773 626 411 303 122 ------
NM_153188chr544746 4136 2108 1564 ----15538
NM_172071chr121192 373 24639 669 --12959
NM_173214chr1677973 7596 5620 3016 2900 1926 1652 ------
NM_175624chr1276470 6260 4752 2632 1785 1441 1231 12738 ----
NM_175625chr1276470 6260 4752 2632 1785 1441 1231 12738 ----
NM_175861chr1286019 5435 5120 4960 4628 4249 3729 268 11287 ----
NM_182898chr764946 2518 2340 2125 889 295 21892 1022 ----
NM_182899chr764946 2518 2340 2125 889 295 21892 1022 ----