TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548at-5p
miRNA Sequence: AAAAGUUAUUGCGGUUUUGGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531291 1199 1185 11146 --11249
NM_000024chr52348 63 ------
NM_000027chr43938 810 792 ----1731
NM_000033chrX1640 ------
NM_000038chr582028 1929 1867 1624 739 723 618 97 31514 1444 80 ----
NM_000046chr563096 2832 2529 625 273 140 23176 3117 12397 1971
NM_000051chr1173387 3078 2535 2268 2240 1142 738 --13225 12723
NM_000052chrX83246 2554 2545 2432 1353 921 707 31 23187 2664 33113 1170 455 33096 2636 188
NM_000053chr1331915 1472 100 ----11970
NM_000067chr82655 547 1491 2556 276 --
NM_000081chr171744 1312 1303 1245 643 280 59 21599 714 21577 479 --
NM_000084chrX116422 5948 5895 5482 4790 4777 2554 781 718 667 292 14997 55113 4270 745 659 173 26532 592
NM_000088chr1741346 1049 127 44 --1262 --
NM_000091chr2122757 2737 2706 2658 2585 2515 2499 2371 1880 1160 744 115 12453 --1810
NM_000092chr2114604 4498 3950 3942 3570 3448 2986 2873 1610 1468 1212 34400 1268 1220 14512 --
NM_000093chr932157 855 124 --1890 22264 940
NM_000104chr292826 2719 2708 2643 2143 1890 1098 560 477 41242 824 710 26 --12034
NM_000108chr751819 1222 412 118 46 1341 1312 11300
NM_000109chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_000110chr12133 31 --1292 1456
NM_000111chr72338 125 154 ----
NM_000112chr5165199 4654 4627 4510 4100 3947 3822 1942 1837 1624 1433 1192 957 791 671 85 54977 4758 3618 1280 102 65319 4713 3549 3502 1933 819 11440
NM_000115chr13112372 2155 2035 1970 1926 1814 909 868 817 463 408 52234 2123 1940 1875 443 21885 237 22431 1002
NM_000125chr6114269 4182 3834 3767 3617 3242 3032 2592 649 540 449 ------
NM_000126chr155318 247 213 115 30 1259 ----
NM_000129chr621476 92 21434 576 1505 21387 241
NM_000138chr1562244 2104 545 517 432 369 --11896 --
NM_000139chr1182809 2686 2491 2207 2143 2089 486 339 1633 ----
NM_000141chr1021105 543 --31447 552 317 --
NM_000161chr1421649 327 1111 42000 1809 1491 1362 21939 1381
NM_000163chr572126 1910 1452 816 795 555 433 1827 31671 407 280 21991 1923
NM_000165chr661719 1603 1448 1372 1271 517 11185 183 --
NM_000167chrX41583 1404 99 37 --21774 644 21758 1552
NM_000176chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_000189chr252186 1803 887 790 751 32397 2056 805 --12044
NM_000192chr1241379 1278 452 171 1186 1199 11286
NM_000194chrX3428 234 103 1128 ----
NM_000196chr161536 ------
NM_000202chrX123836 3202 3120 3026 2989 1570 990 742 710 641 451 229 11375 43423 1249 1239 1191 --
NM_000208chr1984608 4227 4143 3893 3342 3082 1862 1476 --23326 1023 --
NM_000210chr242114 1580 454 415 --1421 --
NM_000214chr2071508 1484 643 583 521 114 95 ----1471
NM_000216chrX73590 3499 3421 3361 1178 464 258 12568 53460 3074 2958 2558 818 1126
NM_000217chr1275097 4839 4198 3637 1980 1262 185 45315 4365 4106 1178 21079 356 --
NM_000222chr431773 588 223 11417 11884 12035
NM_000227chr183386 361 267 --1131 --
NM_000232chr493181 2964 2662 2286 966 424 344 189 40 33092 642 505 62977 2453 2272 924 647 46 --
NM_000233chr26866 662 624 325 245 233 --1259 174
NM_000237chr841919 1669 1614 554 1413 171 --
NM_000240chrX101931 1792 1773 1628 1513 746 734 724 653 176 --1370 --
NM_000245chr751542 1421 1396 806 275 --1665 --
NM_000248chr392983 2307 1100 1068 973 352 159 110 65 1261 42697 515 266 92 11989
NM_000251chr2--1248 ----
NM_000252chrX61492 1350 1039 538 515 274 21369 1105 2613 53 --
NM_000259chr15206190 6067 6056 5942 5792 5760 5499 5473 5284 5259 4920 4840 4415 4121 4095 1850 1388 1022 950 363 35696 4206 1553 35842 2153 903 11489
NM_000264chr9103258 3209 2974 2729 2619 2562 2430 2292 2140 375 --42310 2274 524 499 --
NM_000266chrX4981 715 698 396 --1629 1855
NM_000267chr17113308 3279 3207 3025 2596 1349 1295 1050 553 500 279 --62390 2372 964 795 788 198 --
NM_000268chr2233760 1080 125 1640 23450 2935 --
NM_000274chr102577 113 2424 67 ----
NM_000276chrX32256 2244 2016 1815 ----
NM_000282chr131175 ------
NM_000288chr61339 ------
NM_000291chrX3670 296 215 --2639 332 --
NM_000297chr471871 1486 773 665 506 491 143 1160 2643 456 --
NM_000314chr1072858 2587 1215 1099 811 383 339 32811 2508 1262 --22194 537
NM_000317chr111374 --2333 299 --
NM_000321chr1361373 1347 1327 613 414 393 21651 1457 21384 75 1551
NM_000328chrX2391 66 1317 --1333
NM_000329chr12127 109 182 ----
NM_000330chrX31824 351 246 11940 51895 1666 278 159 137 --
NM_000332chr6126879 6859 6004 5099 5052 2528 2052 1769 1553 1513 906 637 27039 6832 66941 6100 5947 2687 2302 2104 1108
NM_000337chr565097 4399 2520 1494 668 530 16165 36619 6419 1084 2888 513
NM_000340chr351522 1058 598 488 394 31296 1279 528 11081 --
NM_000343chr223368 174 101 ------
NM_000345chr4--1700 11000 --
NM_000346chr1761881 1834 1702 1221 375 292 --2693 571 --
NM_000351chrX94247 4170 2935 2789 1542 1515 1314 1036 839 23737 783 11662 1496
NM_000362chr2242432 2382 880 719 13565 33071 2399 1044 --
NM_000368chr984690 3966 1773 1116 1096 515 77 27 ----1277
NM_000369chr1461929 1881 1716 1212 397 262 ----1564
NM_000390chrX163437 3342 3160 3095 2807 2776 2763 2631 1039 944 933 803 758 328 196 31 42582 2573 1374 407 13300 --
NM_000393chr272016 1504 683 618 509 376 65 1857 11446 --
NM_000405chr521785 487 --1501 --
NM_000408chr283434 3407 2881 2740 2369 2162 991 962 31047 165 139 23278 206 33377 2660 1057
NM_000414chr51254 ------
NM_000416chr66424 402 190 124 62 24 1540 --1394
NM_000426chr6--1163 ----
NM_000430chr1783093 3010 2611 1429 1352 817 552 375 13658 11442 --
NM_000439chr571751 1638 865 629 445 410 357 32343 2283 2135 ----
NM_000452chr1382003 1974 1955 1948 1828 1304 558 504 --2529 376 11651
NM_000461chr384303 4289 3952 3142 1336 1180 537 478 23767 3751 34579 3670 1293 11798
NM_000462chr1541655 1526 1323 91 2673 67 11580 --
NM_000478chr12745 689 ------
NM_000480chr1141264 1099 205 88 21167 122 2256 29 21435 1412
NM_000484chr213953 880 782 --1924 --
NM_000489chrX73293 2668 2369 1313 790 303 72 23116 2105 12711 1991
NM_000492chr721113 370 --31233 1212 1098 --
NM_000493chr661067 968 878 774 721 701 --2456 104 --
NM_000495chrX11112 31052 725 89 1255 --
NM_000503chr891854 1747 1596 1291 729 679 548 493 415 2644 520 11868 --
NM_000510chr1151458 1279 1198 948 479 --11388 --
NM_000531chrX1367 ------
NM_000533chrX41952 328 297 253 21930 1654 11517 --
NM_000536chr112229 39 ----1551
NM_000551chr381945 1697 1668 777 408 201 154 39 --21449 670 21662 337
NM_000554chr1932026 428 404 11112 3917 605 410 --
NM_000555chrX116872 6659 6627 6436 6269 6102 3082 2846 2641 2546 1213 57408 7179 2954 2615 2600 86888 6514 6061 5519 5231 4904 1185 324 --
NM_000575chr221011 979 1246 ----
NM_000584chr451239 1177 1050 852 410 2915 335 2879 247 11149
NM_000585chr43556 466 232 ------
NM_000597chr21278 ------
NM_000599chr244577 1675 1190 406 24335 1810 21625 1049 11792
NM_000600chr72338 142 ------
NM_000610chr1132762 506 127 12154 32926 2515 619 --
NM_000611chr11156950 6837 5260 5153 4791 2817 1907 1651 1614 1391 1089 280 233 163 124 1627 47033 6461 2308 1194 --
NM_000615chr1172993 2917 2760 1898 977 711 519 1862 42999 2589 2576 749 --
NM_000617chr1272272 1887 761 582 502 444 136 1901 1810 --
NM_000618chr12116494 6343 5697 4991 4631 4564 4464 4163 2227 697 77 55212 5027 1919 1164 646 25458 801 --
NM_000618chr12116494 6343 5697 4991 4631 4564 4464 4163 2227 697 77 55212 5027 1919 1164 646 25458 801 --
NM_000619chr121124 131 ----
NM_000627chr21749 --1366 --
NM_000633chr1895224 5011 4880 4603 4037 3725 2008 1659 902 14399 33578 1750 1398 --
NM_000663chr1622484 320 12268 22857 930 --
NM_000685chr32166 142 1278 131 1882
NM_000685chr32166 142 1278 131 1882
NM_000686chrX41588 1482 996 617 11310 31560 1089 156 11294
NM_000688chr3--198 ----
NM_000693chr1551504 1469 1210 1181 1128 ------
NM_000706chr121825 1783 139 2616 287
NM_000719chr1276274 4763 4613 4573 2160 1916 983 11743 15294 14931
NM_000724chr1061837 1818 1558 1380 1372 797 11265 ----
NM_000726chr251158 498 312 280 76 --1585 --
NM_000767chr1911095 --21196 386 1534
NM_000780chr841067 988 784 228 --21259 934 --
NM_000783chr102454 85 --1460 175
NM_000788chr471308 1238 1155 1104 160 66 49 21003 401 11473 --
NM_000793chr1475144 3828 3779 3246 1958 1640 655 --13256 34251 3891 3731
NM_000801chr205764 754 427 163 96 1816 2780 413 --
NM_000806chr531218 724 631 1447 11450 2754 524
NM_000807chr44673 274 128 88 ------
NM_000809chr4248493 8242 7664 7550 7518 7462 7249 7123 7029 6994 6902 6440 6139 3392 3286 3065 2901 2386 1466 1425 1222 625 617 466 18854 58405 7419 7056 2719 112 28574 2776
NM_000810chr154569 214 168 112 ------
NM_000813chr5195229 5206 5144 4598 4446 4436 4186 4000 3993 3550 1946 1719 1692 1336 1174 1109 1082 691 299 14935 44134 3943 1737 896 11098
NM_000814chr1583800 3586 3362 2718 2637 1451 1394 146 --24140 3007 --
NM_000816chr51557 1139 ----
NM_000817chr2----11070 --
NM_000824chr4290 82 --2930 151 --
NM_000826chr472524 2495 2042 748 475 401 259 1769 1879 11848
NM_000827chr562444 2325 2138 1707 927 375 11781 11653 --
NM_000828chrX52114 1985 1604 754 724 --1767 --
NM_000838chr672513 2245 1781 1724 942 824 660 --31810 1765 289 --
NM_000840chr72396 167 ------
NM_000844chr31375 1946 11123 1849
NM_000845chr73487 472 377 ------
NM_000866chr34370 209 133 87 21913 1382 11881 --
NM_000868chrX62626 2377 1034 980 213 55 --3708 129 68 --
NM_000875chr15116774 6543 6362 5722 4611 2457 1433 1115 605 496 202 --46831 1391 1222 587 35816 5685 5466
NM_000876chr641023 1007 888 111 11420 31254 395 93 --
NM_000877chr2103106 3098 3020 2733 2701 2163 2118 1942 771 79 1835 53001 2407 2318 2182 914 --
NM_000879chr53275 248 106 --195 --
NM_000880chr81752 136 1842 --
NM_000882chr35365 336 309 59 43 ------
NM_000891chr1763007 2745 2570 2556 2438 912 32733 692 471 43528 930 808 379 1452
NM_000899chr12114149 3109 2966 2952 2832 1720 1591 1443 1431 1318 460 64416 2812 1172 1070 566 80 34047 2682 1541 2378 147
NM_000901chr492467 2270 2229 2189 2056 2035 982 970 24 --32317 886 684 --
NM_000902chr363192 2164 995 672 240 106 32986 2419 929 33078 2261 748 11164
NM_000908chr52547 124 ----1109
NM_000910chr42742 735 21643 1497 1355 11480
NM_000912chr863429 3092 1393 1367 651 117 --22192 1282 13280
NM_000917chr103753 301 278 1263 174 --
NM_000919chr53624 541 431 ------
NM_000922chr1121044 386 1740 ----
NM_000926chr11209489 8183 7939 7931 7554 7036 3360 2970 2876 2521 2327 2320 2299 1675 1660 1426 1149 1052 451 33 38112 5930 2463 68464 8325 6901 5995 490 312 53226 2313 1921 1887 1369
NM_000933chr2051803 1624 541 478 145 --1468 11088
NM_000935chr351115 1064 1031 899 148 1917 --11273
NM_000938chr41159 ------
NM_000941chr7------1334
NM_000944chr441836 396 387 112 1262 1623 --
NM_000945chr261810 1653 1620 674 381 274 --31699 1367 352 21631 623
NM_000949chr54929 811 757 585 ------
NM_000950chrX113460 2529 1374 963 929 790 605 495 343 91 55 12714 22846 1032 13502
NM_000958chr54892 849 437 321 21062 946 ----
NM_000959chr1133693 3650 3597 3261 3166 3018 2709 1328 1183 1163 718 689 253 13866 1745 23041 3002
NM_000962chr993134 3032 2959 2771 2670 2434 2074 871 36 22292 136 22297 385 12933
NM_000963chr1112465 2214 2097 1936 1757 976 963 543 504 157 50 32286 672 413 --11528
NM_000964chr171557 --1528 --
NM_000965chr351163 811 329 192 173 1202 ----
NM_000998chr2152 ------
NM_001001132chr2131043 387 110 --31000 360 295 --
NM_001001323chr1272669 2535 1106 885 700 677 455 2588 56 32968 2821 1097 --
NM_001001330chr1061295 1194 1072 896 827 479 --2971 912 11145
NM_001001389chr1132762 506 127 12154 32926 2515 619 --
NM_001001390chr1132762 506 127 12154 32926 2515 619 --
NM_001001391chr1132762 506 127 12154 32926 2515 619 --
NM_001001392chr1132808 552 173 12200 32972 2561 665 --
NM_001001395chr1252757 2633 2592 2555 863 21763 658 1459 2990 737
NM_001001396chr1144447 4427 4238 4079 2975 2784 2769 1553 1312 1188 763 476 364 288 --11534 --
NM_001001419chr5155202 4640 4394 4116 4042 3794 3758 1867 1774 906 685 638 350 299 61 11887 23213 1960 23821 51
NM_001001420chr5155202 4640 4394 4116 4042 3794 3758 1867 1774 906 685 638 350 299 61 11887 23213 1960 23821 51
NM_001001433chr2083174 3075 2443 2267 2118 710 553 406 --53233 3132 1265 564 394 --
NM_001001436chr161698 ------
NM_001001481chr8183464 3414 3214 3043 2978 2904 2670 2446 2300 1295 1273 1062 1037 892 835 706 324 279 23164 80 ----
NM_001001483chr112447 165 --1354 --
NM_001001484chr1082099 2048 1904 1512 492 484 460 216 --22480 1951 22299 566
NM_001001520chr191144 ------
NM_001001557chr861953 1803 1583 1517 630 179 12060 ----
NM_001001567chr21--1175 ----
NM_001001568chr21--1175 ----
NM_001001571chr21--1175 ----
NM_001001572chr21--1175 ----
NM_001001573chr21--1175 ----
NM_001001574chr21--1175 ----
NM_001001575chr21--1175 ----
NM_001001576chr21--1175 ----
NM_001001577chr21--1175 ----
NM_001001579chr21--1175 ----
NM_001001580chr21--1175 ----
NM_001001581chr21--1175 ----
NM_001001582chr21--1175 ----
NM_001001584chr21--1175 ----
NM_001001585chr21--1175 ----
NM_001001660chr123246 187 73 1176 ----
NM_001001664chr2134026 3917 3885 3839 3490 3325 1598 1460 947 740 548 228 157 53807 3706 1343 391 178 63125 934 859 730 255 37 22788 1349
NM_001001665chr242182 1132 448 259 13168 33124 3001 946 11189
NM_001001668chr1964266 3724 3655 1306 555 189 13900 ----
NM_001001702chr511823 --31762 1642 1199 --
NM_001001787chr11158 1370 ----
NM_001001870chr174857 827 818 678 --1795 --
NM_001001890chr21133840 3725 3602 3578 3421 3060 1231 1106 1072 719 663 426 383 23669 1603 53567 806 650 494 389 --
NM_001001928chr22108376 8321 7770 7201 6619 5412 5388 3188 1652 1507 25609 574 28120 7165 18185
NM_001001933chr1--1428 190 --
NM_001001974chr1061764 1645 733 555 382 180 --21986 354 --
NM_001001994chrX4481 155 104 91 ----1117
NM_001001995chrX121936 1756 1740 1686 1543 1316 1206 757 731 678 574 497 1693 1545 11651
NM_001001996chrX4481 155 104 91 ----1117
NM_001002233chr852164 2068 1695 511 38 1410 22087 1766 --
NM_001002257chr273425 2701 2604 2442 236 192 170 31033 692 680 2788 145 12850
NM_001002258chr22517 482 31954 1902 143 2557 277 --
NM_001002295chr103941 835 287 ----1318
NM_001002814chr873867 3638 3248 1311 1146 511 38 22995 410 ----
NM_001002838chrX21370 542 11690 1752 --
NM_001002843chr1531221 1166 1049 --1967 --
NM_001002860chr1484414 3756 3375 3186 1344 1149 291 207 1349 23749 3727 24680 3220
NM_001002909chr1752262 2139 2080 1414 777 1358 --12213
NM_001003652chr18238588 8375 7417 7399 7140 7120 6652 6552 6183 6020 5755 5637 5523 5315 3264 3075 2878 2339 2287 2277 1781 1560 1333 26277 1290 78262 5535 5366 2938 1731 597 545 --
NM_001003674chr18116792 6084 5574 5340 1442 1002 875 827 817 464 342 26589 5087 56746 6656 6181 2736 1627 25973 1556
NM_001003675chr18116792 6084 5574 5340 1442 1002 875 827 817 464 342 26589 5087 56746 6656 6181 2736 1627 25973 1556
NM_001003679chr182176 2123 2084 890 810 781 639 488 11613 32099 582 230 1421
NM_001003681chr2282117 2007 1726 1563 857 297 225 108 ----1191
NM_001003683chr22299 43 ------
NM_001003688chr471205 1091 1082 1007 760 265 253 --1995 --
NM_001003712chr12134079 4051 4022 3753 3685 3463 3416 3296 3076 1268 1193 1133 878 --43097 1103 233 142 1913
NM_001003790chr81787 2656 271 2677 286 --
NM_001003791chr81787 2656 271 2677 286 --
NM_001003792chr361017 991 907 776 765 329 1971 ----
NM_001003793chr361017 991 907 776 765 329 1971 ----
NM_001003794chr332712 2296 135 --1566 1765
NM_001003800chr983446 3165 2522 1506 1159 989 773 169 12568 ----
NM_001004019chr32121 107 --2113 95 --
NM_001004065chr973777 3378 3209 2593 2556 1540 219 13753 23132 2906 1717
NM_001004106chr511035 ------
NM_001004125chr971020 968 945 925 845 797 344 ------
NM_001004127chr131777 ------
NM_001004317chr693690 3680 3614 3429 1046 728 678 651 129 13972 33799 1259 618 13794
NM_001004328chr1262398 2209 1949 1941 1591 452 2535 431 --1145
NM_001004329chr1281350 1023 944 505 460 183 106 73 2535 449 1421 --
NM_001004342chr196039 5948 5787 4330 4130 2126 1536 509 368 24416 939 25959 599 --
NM_001004356chr421515 1045 ----11479
NM_001004358chr421515 1045 ----11479
NM_001004360chr271888 1869 1671 1545 1308 517 329 11567 11385 11815
NM_001004419chr1274272 3462 3310 1530 1462 817 305 --24523 3805 --
NM_001004439chr1511229 ------
NM_001004722chr221046 801 1373 ----
NM_001005242chr1241619 1517 1438 1398 11450 --1157
NM_001005366chr123949 704 383 1629 ----
NM_001005375chrY91877 1733 1481 565 521 447 208 197 176 11517 21570 406 1612
NM_001005386chr2102357 2261 2056 1865 1619 1581 1545 387 163 153 3654 495 376 12390 22079 1895
NM_001005404chr1784417 3974 3475 1815 1684 1498 492 472 --13160 --
NM_001005463chr10111941 953 901 847 768 613 606 584 347 224 137 12177 21683 637 --
NM_001005473chr5146581 6279 4958 4871 4789 4768 4571 4275 2431 2145 1726 1188 1103 747 --66220 5175 4658 2625 530 256 22510 2152
NM_001005474chr341182 1162 296 180 1643 1278 --
NM_001005502chr1244269 3239 3196 2087 14673 44979 4803 3222 974 14568
NM_001005527chr34955 930 902 396 11149 11311 --
NM_001005739chr21546 ------
NM_001005746chr251158 498 312 280 76 --1585 --
NM_001005747chr251158 498 312 280 76 --1585 --
NM_001005781chr21420 --2457 168 --
NM_001005845chr881810 1778 1708 1550 1499 1305 1258 754 11535 11802 11755
NM_001005849chr17--2465 425 1472 --
NM_001005861chr35942 704 246 232 152 ------
NM_001006117chrY2251 194 1266 ----
NM_001006118chrY2251 194 ------
NM_001006120chrY2251 194 ------
NM_001006600chr592486 2443 2430 2230 1633 1619 1572 913 787 32360 2320 1833 62178 2033 1798 921 769 388 --
NM_001006605chr141125 1112 805 56 --1819 1259
NM_001006605chr141125 1112 805 56 --1819 1259
NM_001006635chr21221 2326 83 132 --
NM_001006636chr221035 53 --1814 --
NM_001006657chr2123170 2986 2454 2082 1013 820 718 686 456 404 302 131 --32599 2389 162 --
NM_001006681chrX147 ------
NM_001006682chrX147 ------
NM_001006683chrX147 ------
NM_001006684chrX5504 193 120 106 39 2559 394 ----
NM_001006945chr12181 170 2237 136 --2587 574
NM_001007023chr1475144 3828 3779 3246 1958 1640 655 --13256 34251 3891 3731
NM_001007024chr1794411 4399 4317 3947 3835 3192 3110 2666 1475 14333 24353 3708 --
NM_001007025chr1794411 4399 4317 3947 3835 3192 3110 2666 1475 14333 24353 3708 --
NM_001007026chr121454 ------
NM_001007033chr123860 690 92 --146 --
NM_001007067chr83991 871 220 --3921 318 239 --
NM_001007068chr83991 871 220 --3921 318 239 --
NM_001007069chr83991 871 220 --3921 318 239 --
NM_001007070chr83991 871 220 --3921 318 239 --
NM_001007097chr975030 4290 3965 3180 973 645 367 --34650 3863 526 11524
NM_001007102chr62327 181 --3595 528 486 --
NM_001007157chr7193 ------
NM_001007189chr5--1110 ----
NM_001007226chr175979 163 142 97 32 2916 489 11058 --
NM_001007227chr175979 163 142 97 32 2916 489 11058 --
NM_001007228chr175979 163 142 97 32 2916 489 11058 --
NM_001007229chr175979 163 142 97 32 2916 489 11058 --
NM_001007230chr175979 163 142 97 32 2916 489 11058 --
NM_001007245chr75631 233 134 95 32 --3454 437 105 --
NM_001007246chr21111529 1509 1427 1336 1291 1225 549 535 471 367 297 1147 31886 477 272 21486 784
NM_001007277chr112885 270 11086 ----
NM_001007466chr695215 4756 4627 4528 2021 1314 812 615 513 --13444 14540
NM_001007471chr92843 152 ----1830
NM_001007526chrY2251 194 ------
NM_001007544chr12424 54 1366 ----
NM_001007559chr1822027 320 --11784 --
NM_001007794chr12684 93 --2630 118 --
NM_001008225chr72740 193 --1210 --
NM_001008226chr1541773 1199 275 67 11690 11422 --
NM_001008237chr22149 65 ------
NM_001008239chr1893254 3197 3108 3013 2801 2428 1170 590 83 33406 258 245 1275 --
NM_001008391chr112644 266 ------
NM_001008392chr353088 3063 3016 988 513 --23349 436 --
NM_001008393chr4132417 2298 2189 1101 907 664 626 618 552 356 254 227 128 1733 11835 22205 397
NM_001008401chr1911329 1408 21375 1180 11498
NM_001008408chr7116406 5271 5019 4829 4559 4488 4176 4011 2266 2105 333 --76288 5824 5352 4542 4403 2010 1884 --
NM_001008491chr262036 1721 648 451 333 160 --31773 1630 149 --
NM_001008492chr262036 1721 648 451 333 160 --31773 1630 149 --
NM_001008495chr851972 1963 1389 502 137 --22074 540 12099
NM_001008539chr8124678 3450 3430 1977 1533 1262 967 721 602 559 462 125 55410 3531 3469 3461 3343 14626 35266 4396 449
NM_001008541chr1082331 1568 1540 1487 1469 634 273 242 21525 397 12311 --
NM_001008541chr1082331 1568 1540 1487 1469 634 273 242 21525 397 12311 --
NM_001008564chr1382185 2067 1892 1625 1383 833 213 141 --11671 --
NM_001008660chr1121511 975 1566 1486 --
NM_001008712chr8--179 ----
NM_001008738chr552396 2267 837 404 188 --62689 2622 2518 1967 398 238 --
NM_001008801chr1912181 --32055 2009 1626 11691
NM_001008895chr1361481 1418 1314 1192 1133 577 --1253 --
NM_001008925chr4113377 3022 2742 2546 2462 1414 1311 797 677 640 492 --2573 554 43394 3160 2713 1338
NM_001009185chr52563 516 ------
NM_001009554chr473737 3489 3255 3108 1054 732 558 13086 31580 681 445 11394
NM_001009554chr473737 3489 3255 3108 1054 732 558 13086 31580 681 445 11394
NM_001009555chr431803 1543 133 --31312 1264 171 11664
NM_001009571chr73497 468 295 11318 11245 --
NM_001009894chr1231416 270 130 2463 159 2332 299 2619 183
NM_001009899chr3156541 6457 6295 5731 5699 5633 4771 4636 4356 4247 4193 2589 1861 860 352 2615 332 34814 2141 1494 26183 4399
NM_001009909chr1183678 3207 2898 1544 1537 1519 571 101 1113 23513 2546 1123
NM_001009955chr12390 195 1167 ----
NM_001009955chr12390 195 1167 ----
NM_001009958chr7189 --1567 1616
NM_001009959chr272632 2422 2361 1768 1757 1688 1043 3835 824 196 1895 --
NM_001009960chr72735 267 22395 2118 21117 826 --
NM_001009993chr274581 3266 1224 953 804 228 94 11118 24474 1805 --
NM_001009994chr6186 ------
NM_001010000chr1893497 3410 3369 2429 2307 2199 1151 637 189 43225 2960 2844 2358 52903 2267 1196 418 200 --
NM_001010845chr16--1149 --1984
NM_001010846chr194549 4490 4350 4024 3654 1795 1721 1619 1239 11080 41654 1203 1196 304 14646
NM_001010853chr6133240 3037 2805 2612 2589 2567 2256 2139 2020 1125 1085 948 177 --42965 2909 986 674 --
NM_001010861chr1152654 2604 2524 1923 1869 1725 1713 1707 930 896 817 741 659 447 435 --1115 1125
NM_001010862chrX93294 2725 2471 2405 2383 2348 2115 2092 438 22100 812 22134 523 --
NM_001010867chr186509 6307 5521 5447 4991 4069 2387 761 --35438 5304 2146 --
NM_001010888chrX114390 3958 3701 3468 2942 2924 2899 2836 1793 1098 86 --33476 3198 578 13408
NM_001010891chr5246789 6742 6513 6470 6336 6022 5771 5060 4506 4295 4226 2499 2144 2048 1767 1328 1304 1064 989 383 366 352 175 125 52186 1914 1897 1890 1672 35247 4445 2664 36527 1127 522
NM_001010895chr962079 1687 705 695 129 96 1252 21974 1863 --
NM_001010908chr103635 570 279 ------
NM_001010922chr174105 3645 3037 2906 843 468 312 11051 43593 3043 650 441 --
NM_001010927chr61164 ------
NM_001010971chr15757 734 725 72 51 --3852 653 314 --
NM_001010984chr13799 729 148 32593 2446 2314 22260 213 11921
NM_001010986chrX112536 2512 2320 2306 2143 2046 1638 879 867 587 273 --42287 2180 2153 420 1843
NM_001011513chr483777 3347 3132 2972 2508 977 961 816 83514 2791 2712 2602 483 401 238 137 34031 1091 70 1305
NM_001011537chr392214 2134 2030 2007 1797 593 359 254 21 31941 581 85 --12037
NM_001011553chr72752 675 ------
NM_001011658chrX52091 2049 1863 1379 97 --42124 2069 748 416 --
NM_001011666chr7156440 5768 5040 4663 4407 4047 2573 2151 2062 1662 1494 977 947 658 353 35737 4056 2382 66428 4689 2533 2526 2242 1924 25811 4535
NM_001011708chr292627 2593 1902 1050 914 740 634 250 206 2924 509 ----
NM_001011713chr1451335 1152 564 471 98 11288 1334 --
NM_001011720chr841002 470 164 106 --21026 581 11035
NM_001011722chr11159 ------
NM_001011722chr11159 ------
NM_001011885chr1561525 1438 488 471 448 206 1403 21792 1413 1699
NM_001012267chr911950 157 ----
NM_001012337chr3187 122 ----
NM_001012393chr1195114 4871 4774 4538 3824 1635 1477 682 401 154 34993 3930 1641 --
NM_001012398chr1651110 1058 978 955 769 --1923 --
NM_001012419chr931225 1098 275 21159 452 2964 925 1511
NM_001012420chr1592887 2372 2283 1871 881 622 220 132 36 32833 2804 2646 ----
NM_001012423chr1592887 2372 2283 1871 881 622 220 132 36 32833 2804 2646 ----
NM_001012425chr1197 ------
NM_001012478chr191413 ------
NM_001012614chr41505 --1540 --
NM_001012732chr421256 88 --11111 --
NM_001012751chr1071944 1877 1682 1613 664 621 409 21782 1639 --21537 252
NM_001012754chr1382123 1755 747 702 577 503 434 334 11710 11669 --
NM_001012755chrX114642 4310 4160 4097 3787 3711 2004 1005 651 65 27 13640 54873 4628 4166 1349 920 24211 3844
NM_001012756chr1922830 2083 12007 33116 2636 2502 --
NM_001012761chr562553 1981 1691 780 443 208 150 ----
NM_001012968chrX102624 2522 2499 2374 2242 1119 1111 500 209 161 22184 121 12029 22468 1083
NM_001013031chr1043059 1409 694 105 --23217 495 23207 145
NM_001013399chr651157 1124 343 290 98 1774 2312 265 1439
NM_001013406chr741643 1401 1154 654 1576 41375 1177 644 511 --
NM_001013415chr451593 1102 541 271 256 11579 1440 11498
NM_001013620chr12258203 7340 7281 7181 7028 6969 6790 6655 6442 5905 5720 5296 3400 3362 2647 2591 2431 2353 2164 2007 1842 1264 802 750 343 35748 5274 2305 97967 6984 6954 6613 5218 2990 2662 2239 2108 22290 528
NM_001013703chr153442 409 83 ------
NM_001013746chr7122210 1938 1881 1765 844 580 496 416 370 266 164 97 1798 22075 826 11922
NM_001013843chr156320 211 150 111 88 34 157 1184 --
NM_001014797chr1098207 5714 3280 3038 2444 2098 1205 1073 1045 67370 6925 3060 2433 1505 586 26360 194 --
NM_001014972chr2177 --185 --
NM_001015045chr472233 2211 2024 1791 674 286 198 1422 32577 1971 985 --
NM_001015048chr1473051 3037 2988 2906 390 281 67 --32948 1981 186 --
NM_001015049chr1473051 3037 2988 2906 390 281 67 --32948 1981 186 --
NM_001015508chr83738 697 169 ------
NM_001015877chrX63120 2435 1090 542 426 381 32707 2662 952 43128 1954 496 99 11195
NM_001015880chr1031624 1410 450 1597 ----
NM_001015882chr92264 196 2323 166 ----
NM_001017365chr1148 ------
NM_001017366chr1148 ------
NM_001017367chr1148 ------
NM_001017368chr1732143 1063 283 --32831 2561 861 --
NM_001017369chr441076 1064 974 158 1995 1413 1722
NM_001017371chr25494 428 402 120 103 1236 1410 --
NM_001017395chr343287 1384 1303 471 23052 1394 12478 2691 436
NM_001017396chr252107 798 745 450 212 11463 21685 870 --
NM_001017415chr14777 635 214 84 1576 2712 171 --
NM_001017416chr14777 635 214 84 1576 2712 171 --
NM_001017420chr851400 529 470 435 269 --1946 --
NM_001017423chr103709 237 27 ------
NM_001017424chr161767 1574 1361 1239 466 414 11814 41550 1281 358 337 11424
NM_001017425chr161767 1574 1361 1239 466 414 11814 41550 1281 358 337 11424
NM_001017440chr7218237 8094 7640 7581 7121 6873 6106 5383 5287 5211 5141 5060 2984 2764 1734 1624 1545 1337 1253 742 460 12859 27672 1346 25842 5028
NM_001017523chr1261797 1336 489 473 160 35 --21377 1303 --
NM_001017923chr1471605 1448 1436 570 549 400 344 --1188 --
NM_001017926chr861726 1503 1348 1245 426 303 2440 250 31780 1460 1182 21620 1370
NM_001017928chr31244 --1265 --
NM_001017930chrX170 21474 50 21100 204 --
NM_001017962chr103753 301 278 1263 174 --
NM_001017969chr92164 63 --1600 --
NM_001017977chr1--291 80 1307 --
NM_001017979chr43319 311 189 ------
NM_001018038chr92590 568 1136 1122 --
NM_001018041chr62365 148 ------
NM_001018054chr121020 540 --11329 --
NM_001018064chr951816 487 376 258 190 ------
NM_001018065chr9105896 5602 5506 5222 4909 4304 3892 840 441 137 --1789 15847
NM_001018066chr9105896 5602 5506 5222 4909 4304 3892 840 441 137 --1789 15847
NM_001018067chr1175381 5325 5299 5238 5143 4972 3584 1998 1835 1759 1551 1410 1399 534 482 349 55 31115 498 141 64942 4673 3515 2105 1089 244 34311 4130 1723
NM_001018068chr1175381 5325 5299 5238 5143 4972 3584 1998 1835 1759 1551 1410 1399 534 482 349 55 31115 498 141 64942 4673 3515 2105 1089 244 34311 4130 1723
NM_001018069chr1175381 5325 5299 5238 5143 4972 3584 1998 1835 1759 1551 1410 1399 534 482 349 55 31115 498 141 64942 4673 3515 2105 1089 244 34311 4130 1723
NM_001018072chr1261797 1336 489 473 160 35 --21377 1303 --
NM_001018074chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_001018075chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_001018076chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_001018077chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_001018080chr1151458 1279 1198 948 479 --11388 --
NM_001018089chr15103461 3099 2502 1542 1126 784 583 430 305 55 13804 23809 948 --
NM_001018090chr1592854 2616 2602 2332 2280 1775 1050 223 54 --32091 310 163 1104
NM_001018091chr15102964 2726 2712 2442 2390 1885 1824 1160 333 164 --32201 420 273 1214
NM_001018100chr154741 704 623 317 1717 ----
NM_001018102chr1592854 2616 2602 2332 2280 1775 1050 223 54 --32091 310 163 1104
NM_001018111chr773672 3389 2922 2613 1603 1498 338 22892 270 23764 145 13213
NM_001020658chr181697 1558 1483 1362 1205 1139 1121 333 1368 --1184
NM_001020658chr181697 1558 1483 1362 1205 1139 1121 333 1368 --1184
NM_001020825chr531112 1002 300 --11298 11140
NM_001023560chr68864 836 760 716 693 401 181 166 ------
NM_001023567chr1582279 2195 1892 1610 884 625 132 36 22375 2225 ----
NM_001024024chr142703 35 --31054 863 416 1993
NM_001024070chr142699 31 --31050 859 412 1989
NM_001024094chr5123637 3527 3384 2825 2384 1393 1076 1025 904 389 380 340 11111 43823 630 578 49 23665 3137
NM_001024372chr852007 1699 1628 890 669 21833 1758 1900 12306
NM_001024380chr852366 2232 2176 2025 154 21712 518 2675 491 --
NM_001024381chr852366 2232 2176 2025 154 21712 518 2675 491 --
NM_001024455chrX72688 2528 2107 2093 2033 831 741 ------
NM_001024593chr105846 712 681 663 79 1904 2802 329 --
NM_001024647chr12167196 6888 6869 6773 6497 5755 2403 2066 1735 1526 1410 1110 967 368 229 104 35499 1541 1101 24753 350 --
NM_001024649chr592725 2616 2608 2566 2103 909 702 338 310 21936 994 22426 265 1155
NM_001024660chr32577 438 31652 377 292 1551 --
NM_001024688chr852121 1830 1678 417 149 21926 845 ----
NM_001024736chr1511488 ------
NM_001024807chr191229 ------
NM_001024808chr1262762 1829 1752 978 808 69 --22798 2743 --
NM_001024809chr171557 --1528 --
NM_001024912chr1951757 1530 244 110 46 --21857 382 --
NM_001024924chr42511 214 1104 ----
NM_001024934chr66649 632 610 493 456 222 --1135 --
NM_001024935chr66649 632 610 493 456 222 --1135 --
NM_001024936chr66649 632 610 493 456 222 --1135 --
NM_001024947chr531115 856 167 ----1208
NM_001024948chr1113378 3211 2748 2678 2532 2387 1153 998 905 696 486 22809 885 73424 3413 2849 1135 890 687 533 1360
NM_001024956chr11115725 5460 5279 4670 4555 4153 4130 1668 1559 493 483 44716 1521 292 198 55768 5401 5144 2347 892 --
NM_001025068chr341686 1441 1167 78 --31301 506 252 1337
NM_001025069chr341686 1441 1167 78 --31301 506 252 1337
NM_001025072chr392954 2803 2771 2355 2126 1163 809 317 24 22474 1157 22344 976 3935 632 311
NM_001025073chr392954 2803 2771 2355 2126 1163 809 317 24 22474 1157 22344 976 3935 632 311
NM_001025076chr1076233 5864 4262 1857 1431 1238 1145 24561 3783 46254 2136 1473 38 --
NM_001025077chr10157591 7222 5620 5019 4972 4857 4823 2789 2596 2503 1089 923 876 492 107 35919 5141 839 67612 2831 1377 1124 291 38 --
NM_001025079chr3154154 4129 4054 3883 3738 3486 3211 2881 2690 2590 1459 1440 1234 453 185 --43938 3450 3402 1355 --
NM_001025100chr1893964 3329 3203 3105 1380 1227 589 463 417 1566 22934 822 13953
NM_001025105chr541465 1115 326 139 176 31450 1281 1016 --
NM_001025108chr244107 3593 2676 384 14063 33212 2884 965 --
NM_001025201chr25733 694 663 134 60 ------
NM_001025233chr1262486 1934 1770 782 689 419 ------
NM_001025248chr151220 11274 --1113
NM_001025249chr151220 11274 --1113
NM_001025252chr883152 3116 2879 2601 2530 980 971 638 1751 --1114
NM_001025253chr883152 3116 2879 2601 2530 980 971 638 1751 --1114
NM_001025266chr3124882 4843 4633 4133 4107 4095 3071 1973 265 216 153 44 24255 1437 54526 3879 3407 1746 1583 --
NM_001025356chr1272976 2934 2633 2368 1209 924 457 32570 2542 254 3939 466 41 --
NM_001025366chr631440 1323 1274 --11463 11719
NM_001025366chr631440 1323 1274 --11463 11719
NM_001025367chr631440 1323 1274 --11463 11719
NM_001025367chr631440 1323 1274 --11463 11719
NM_001025368chr631440 1323 1274 --11463 11719
NM_001025368chr631440 1323 1274 --11463 11719
NM_001025369chr631456 1339 1290 --11479 11735
NM_001025369chr631456 1339 1290 --11479 11735
NM_001025370chr631440 1323 1274 --11463 11719
NM_001025370chr631440 1323 1274 --11463 11719
NM_001025389chr1141264 1099 205 88 21167 122 2256 29 21435 1412
NM_001025390chr1141264 1099 205 88 21167 122 2256 29 21435 1412
NM_001025580chrX73835 2641 1410 1247 1158 1073 279 2949 637 63627 3520 2753 2626 1539 243 --
NM_001025595chr451661 1430 1172 600 536 1129 3354 218 134 1590
NM_001025616chr451622 672 535 331 68 11257 31901 1289 1189 11228
NM_001025780chr951442 622 548 231 211 --31313 1079 604 --
NM_001029835chr71394 ------
NM_001029858chr693104 2814 2562 2315 2238 2104 336 261 195 12861 11358 12762
NM_001029860chr83235 111 49 ------
NM_001029863chr672876 2792 2481 1974 1200 872 754 32559 2331 1110 53095 836 696 632 341 1350
NM_001029875chr5102780 2172 2157 2064 1988 1146 1102 693 638 597 1233 ----
NM_001029991chr141140 ------
NM_001030007chr1683411 3294 3046 1410 1352 1225 928 697 1905 23458 3338 12921
NM_001030055chr14154229 3796 3696 3586 3356 3325 2969 1279 1172 979 736 485 430 416 318 34701 1812 1516 84706 3967 3245 3091 1683 904 828 206 33192 3049 1757
NM_001030287chr111139 ------
NM_001030288chr1623697 1960 --54588 4441 3691 3678 775 --
NM_001031679chr1243517 3149 486 222 12877 23475 3464 1204
NM_001031684chr251391 1195 412 277 162 11135 --11470
NM_001031689chr91158 1115 ----
NM_001031695chr2294878 4529 3669 3553 3396 3322 2086 1212 311 --35320 5234 1479 --
NM_001031700chr4102481 2442 2415 2218 1908 1716 1693 925 862 832 --32127 2068 1621 1132
NM_001031725chr11112 297 88 ----
NM_001031732chr452565 1252 1129 1093 986 1868 73591 3150 2817 2752 2451 1242 593 13386
NM_001031738chr22526 84 ------
NM_001031748chr122517 188 --2462 215 --
NM_001031804chr16104404 4026 3626 3132 1669 1478 1158 813 308 300 23915 946 44163 3563 3333 1104 1523
NM_001031812chr551742 1571 407 378 186 1205 --1763
NM_001032221chr911679 ------
NM_001032280chr631172 632 387 ----11705
NM_001032282chr851281 1012 880 350 233 --133 --
NM_001032283chr125961 933 923 242 184 ------
NM_001032284chr125961 933 923 242 184 ------
NM_001032288chr2021426 80 --1171 --
NM_001032296chr1331995 704 553 21003 817 1829 1259
NM_001032393chrX--1639 2570 279 --
NM_001032394chr682815 2645 2232 2134 1018 840 745 287 11076 32679 2661 2077 --
NM_001032395chr692682 2512 2099 2001 1052 885 707 612 154 1943 32546 2528 1944 --
NM_001032999chr2055295 5270 1264 1252 276 --11528 --
NM_001033002chr172109 91 1228 ----
NM_001033025chr131546 391 52 2978 93 --1618
NM_001033044chr14445 421 228 186 --21252 1163 --
NM_001033045chr2114210 4133 3875 3487 2989 2914 1773 1695 1681 988 203 53430 2837 1703 1116 1081 34222 3830 1661 13799
NM_001033047chr471849 1833 954 911 837 467 426 22513 995 1514 --
NM_001033049chr2142172 1899 773 378 --1865 --
NM_001033056chr14445 421 228 186 --21252 1163 --
NM_001033057chr351973 1428 796 401 270 11759 --11965
NM_001033059chr651999 1907 1814 1779 1519 31487 442 284 11642 --
NM_001033085chr2137 ----278 72
NM_001033087chr2072363 997 611 279 257 207 133 1431 23055 720 --
NM_001033112chr54763 608 594 359 1340 ----
NM_001033117chr384373 3644 3426 1912 1693 1315 1050 577 13018 44921 4065 2994 1076 --
NM_001033503chr55432 352 145 90 74 1387 2473 199 --
NM_001033504chr17--1607 ----
NM_001033506chr111372 1115 ----
NM_001033507chr141822 577 551 259 1567 1631 1487
NM_001033518chr73609 80 58 2216 115 22478 221 --
NM_001033519chr73609 80 58 2216 115 22478 221 --
NM_001033520chr73609 80 58 2216 115 22478 221 --
NM_001033557chr251355 1207 1021 227 213 1172 31324 1187 1118 11150
NM_001033559chr15--1367 1349 --
NM_001033566chr17--1685 1888 --
NM_001033568chr17--1685 1888 --
NM_001033576chr1732492 2093 1911 --1253 --
NM_001033578chr832377 1712 936 22185 1904 12125 1565
NM_001033659chr1781437 1410 1401 1374 1328 643 363 27 --11171 --
NM_001033678chr11--128 ----
NM_001033723chr882462 2277 1752 1725 492 362 264 79 --11855 --
NM_001033756chr631374 1257 1208 --11397 11653
NM_001033756chr631374 1257 1208 --11397 11653
NM_001033925chr1052101 2041 1944 1828 270 12006 21732 1334 11694
NM_001034841chr1675237 5193 4854 4183 3867 1034 539 45017 3648 2112 135 23905 1858 11919
NM_001034845chr441277 945 261 252 152 21400 908 --
NM_001034850chr551457 1063 541 450 375 41636 1162 228 102 ----
NM_001034954chr1043116 2980 2286 1985 13269 12739 12780
NM_001034955chr1043116 2980 2286 1985 13269 12739 12780
NM_001034956chr1043116 2980 2286 1985 13269 12739 12780
NM_001034957chr1043116 2980 2286 1985 13269 12739 12780
NM_001035chr1------11303
NM_001035005chr181441 1629 1224 --
NM_001035260chr1061075 1052 390 336 309 28 21543 1428 21120 419 --
NM_001035511chr142031 1790 1641 205 --1499 1587
NM_001035512chr142138 1897 1748 312 --1606 1694
NM_001035513chr142138 1897 1748 312 --1606 1694
NM_001037131chr221172 369 ------
NM_001037132chr762153 1843 1779 1734 1513 1484 --12270 11502
NM_001037133chr762153 1843 1779 1734 1513 1484 --12270 11502
NM_001037163chr74944 740 356 180 ----2777 35
NM_001037164chr772067 1678 1519 736 574 561 117 21651 312 11643 --
NM_001037172chr361419 1360 1212 940 443 363 ------
NM_001037174chr252310 1914 1755 1576 111 3315 306 52 --12108
NM_001037277chr12329 33 11675 21584 1291 --
NM_001037278chr12329 33 11675 21584 1291 --
NM_001037317chr1152654 2604 2524 1923 1869 1725 1713 1707 930 896 817 741 659 447 435 --1115 1125
NM_001037334chr1832126 1751 1736 32042 1910 75 31864 769 658 1569
NM_001037339chr181865 1571 1314 1298 501 484 354 190 --21485 709 --
NM_001037340chr181865 1571 1314 1298 501 484 354 190 --21485 709 --
NM_001037341chr181865 1571 1314 1298 501 484 354 190 --21485 709 --
NM_001037341chr181865 1571 1314 1298 501 484 354 190 --21485 709 --
NM_001037494chr12185 ------
NM_001037495chr12185 ------
NM_001037535chrX41419 1196 1104 588 --11245 --
NM_001037536chrX41419 1196 1104 588 --11245 --
NM_001037540chrX41419 1196 1104 588 --11245 --
NM_001037582chr451475 1281 667 512 188 21659 1652 31442 1351 369 --
NM_001037637chr5183 ------
NM_001037872chr21665 ----2742 102
NM_001037954chr11103505 3302 3112 3041 2493 2450 920 771 624 455 23189 2787 1856 2874 737
NM_001038640chr155951 692 379 299 208 ------
NM_001038702chr572610 2179 1827 1105 594 341 177 --22539 2161 12462
NM_001038707chr132324 2301 644 11550 11804 --
NM_001038707chr132324 2301 644 11550 11804 --
NM_001039091chrX6518 377 328 314 46 39 --1257 --
NM_001039199chr20104531 4251 4026 3905 3293 3146 1562 1113 1088 416 --44186 3388 3327 1246 15016
NM_001039348chr22890 854 ------
NM_001039349chr22890 854 ------
NM_001039468chr111288 ------
NM_001039469chr111328 ------
NM_001039535chr1841643 1549 1443 451 11803 5653 292 88 79 64 --
NM_001039538chr243380 2624 408 143 43476 3304 964 889 ----
NM_001039547chr3187958 7784 7138 7030 6911 6765 5168 5133 1922 1697 1513 1395 1129 921 903 515 480 124 55056 4991 2504 217 107 44981 2382 1770 619 35218 1291 681
NM_001039570chr2294520 4151 3665 3587 3114 1110 734 568 390 1726 14474 1375
NM_001039571chr2294520 4151 3665 3587 3114 1110 734 568 390 1726 14474 1375
NM_001039577chr184423 1700 1682 1088 1072 395 231 224 1526 34306 3628 1055 --
NM_001039580chr4123843 3756 3509 3474 3365 1678 1220 1152 862 663 573 511 --34739 3486 1396 14751
NM_001039585chr1153950 3907 3854 3518 3423 3275 2966 2572 1585 1440 1420 975 946 510 260 14123 11002 23298 3259
NM_001039590chrX163491 3480 3358 3350 3307 3295 3218 3139 2556 1472 1320 1026 900 749 502 286 34046 2506 1133 21336 334 --
NM_001039591chrX163491 3480 3358 3350 3307 3295 3218 3139 2556 1472 1320 1026 900 749 502 286 34046 2506 1133 21336 334 --
NM_001039618chr11135766 5409 5329 5130 5101 5035 3898 3695 2381 2291 1891 699 419 44997 4568 4008 1015 32001 1926 1146 --
NM_001039693chr2103382 3324 2790 1044 928 817 773 566 516 229 1786 1983 --
NM_001039709chr2055295 5270 1264 1252 276 --11528 --
NM_001039762chr1041714 512 479 278 --12386 --
NM_001039802chr131286 886 264 --1198 --
NM_001039840chrX206009 5943 5872 5795 5629 5570 5530 5369 5312 4958 4822 4724 3935 3862 3752 2334 2057 1574 865 414 66052 5826 4372 1352 644 210 3986 424 328 12238
NM_001039884chr1931094 1034 438 --1198 1937
NM_001039916chr1221150 980 ------
NM_001039917chr1221150 980 ------
NM_001039918chr1221150 980 ------
NM_001039919chr1221150 980 ------
NM_001039920chr1221150 980 ------
NM_001039937chr1383734 3549 3255 2854 1575 822 347 224 1597 84179 4025 3041 3029 1371 1082 768 379 11433
NM_001040001chr641963 699 431 206 2404 170 --1681
NM_001040057chr751396 948 484 381 99 --2972 444 --
NM_001040092chr8173 --1285 --
NM_001040100chr331196 1149 304 1391 11286 1226
NM_001040151chr1142948 1165 694 170 23281 1680 31627 1302 332 12830
NM_001040152chr754958 4889 3858 3289 3197 33181 1232 831 34035 3682 1602 25064 4666
NM_001040153chr134945 706 641 332 ------
NM_001040157chr472618 2548 2324 2306 1797 136 32 42442 2317 2079 79 42415 1858 851 687 11853
NM_001040158chr5----1465 --
NM_001040159chr441428 1354 389 290 1159 1347 11463
NM_001040181chr331122 1114 327 21055 411 188 --
NM_001040182chr331122 1114 327 21055 411 188 --
NM_001040183chr331122 1114 327 21055 411 188 --
NM_001040199chr331122 1114 327 21055 411 188 --
NM_001040200chr331122 1114 327 21055 411 188 --
NM_001040202chr482376 2196 1859 1824 1611 835 316 199 1601 --12351
NM_001040214chr652380 2367 2259 1464 47 12100 11936 --
NM_001040284chr16185667 5541 4655 4172 4154 3709 3620 1929 1910 1759 1400 1384 1346 1047 865 740 707 112 45878 4026 1881 1156 33828 1696 919 15264
NM_001040402chr463166 3024 947 935 677 273 12847 4963 764 511 344 12058
NM_001040409chr25989 951 776 762 85 --1939 --
NM_001040424chr2122192 117 12124 1123 1742
NM_001040429chr1393505 3461 3026 2841 2470 1384 882 436 393 ----13390
NM_001040432chr31336 171 2449 128 --
NM_001040441chr1144382 4164 3850 1827 1592 612 600 503 426 328 217 172 131 49 34814 3631 373 14914 1109
NM_001040446chr562629 2551 2444 2363 894 373 1440 12191 12617
NM_001040450chr1582611 2496 2311 737 727 612 282 159 42197 906 552 419 1709 --
NM_001040453chr1582611 2496 2311 737 727 612 282 159 42197 906 552 419 1709 --
NM_001040624chr852680 1824 1746 851 69 1990 1995 --
NM_001040625chr852680 1824 1746 851 69 1990 1995 --
NM_001040626chr852680 1824 1746 851 69 1990 1995 --
NM_001040627chr852680 1824 1746 851 69 1990 1995 --
NM_001040628chr852680 1824 1746 851 69 1990 1995 --
NM_001040629chr852680 1824 1746 851 69 1990 1995 --
NM_001040630chr852680 1824 1746 851 69 1990 1995 --
NM_001040665chr7154996 4736 4281 3926 3770 3504 3470 3322 1802 1594 355 218 193 133 61 44235 3970 1907 349 44102 4032 3063 162 --
NM_001040708chr851046 955 808 296 225 --3918 413 123 --
NM_001040712chr963431 2999 2775 2735 560 98 22916 598 32854 2407 1054 1769
NM_001042355chr1685346 4985 4289 3941 3519 3350 1852 435 45067 3638 309 262 35336 3292 1203 35073 1376 1257
NM_001042361chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042364chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042365chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042387chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042388chr182730 225 --186 1211
NM_001042393chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042396chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042397chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_001042403chr122206 133 1844 ----
NM_001042404chr132020 1362 550 21507 1449 1578 21229 132
NM_001042406chr641237 986 300 279 --3816 272 229 1877
NM_001042410chr2--1182 ----
NM_001042412chr1685346 4985 4289 3941 3519 3350 1852 435 45067 3638 309 262 35336 3292 1203 35073 1376 1257
NM_001042413chr954134 3144 2920 1269 1031 13973 23188 167 --
NM_001042424chr442503 2482 2175 1995 12242 32335 950 803 --
NM_001042425chr631172 632 387 ----11705
NM_001042440chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042441chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042442chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042443chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042444chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042445chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042446chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001042453chrX41505 1377 402 374 21652 681 31572 1088 203 --
NM_001042459chr32336 282 ------
NM_001042473chr1012163 1464 31525 1381 399 11701
NM_001042490chr52119 109 --1210 1298
NM_001042492chr17113308 3279 3207 3025 2596 1349 1295 1050 553 500 279 --62390 2372 964 795 788 198 --
NM_001042493chr651672 1635 1359 780 152 31884 587 457 1766 --
NM_001042498chrX11026 ------
NM_001042510chr871942 1591 1357 848 673 532 239 11583 2868 355 --
NM_001042511chr871942 1591 1357 848 673 532 239 11583 2868 355 --
NM_001042533chr343043 2637 2556 1034 2481 390 22612 804 12629
NM_001042537chrX112460 2299 2110 2022 1920 1817 1657 1615 1000 655 448 1666 2895 362 --
NM_001042539chr16--11098 ----
NM_001042543chr481619 1377 1249 1200 1187 549 393 142 31455 574 281 1540 21176 1075
NM_001042550chr931599 73 50 1677 11739 11526
NM_001042552chr121333 941 11308 1538 --
NM_001042555chr12144048 3945 3844 3829 3780 3719 3124 1835 1626 1406 490 344 188 112 13929 64608 4422 4403 4219 4129 3861 --
NM_001042599chr2247860 7223 7037 6940 6271 6184 6023 5970 5908 5618 5393 5014 4746 3049 2943 2761 2468 2305 2227 1175 709 590 582 160 13075 37539 6701 2079 24927 1101
NM_001042601chr373264 3252 3174 3137 2947 2903 571 1543 43292 752 592 32 --
NM_001042603chr1264571 4529 4015 2014 1718 961 14419 35037 3571 1622 --
NM_001042604chr3134648 4593 4241 3718 3585 3558 736 704 615 526 443 122 27 1632 34670 3398 854 34305 3810 1041
NM_001042635chr14153 ------
NM_001042646chr351746 1450 1436 1336 169 11992 ----
NM_001042669chr451622 672 535 331 68 11257 31901 1289 1189 11228
NM_001042681chr122605 62 --32639 2239 449 21896 549
NM_001042682chr122605 62 --32639 2239 449 21896 549
NM_001042682chr122605 62 --32639 2239 449 21896 549
NM_001042683chr661774 1678 1565 1480 1456 46 129 2731 527 2513 213
NM_001042749chrX62004 1763 1333 578 569 519 159 11878 --
NM_001042750chrX62004 1763 1333 578 569 519 159 11878 --
NM_001042751chrX62004 1763 1333 578 569 519 159 11878 --
NM_001042762chr72286 228 ------
NM_001043318chr1464116 3241 2595 1245 572 156 --11585 --
NM_001043351chr152335 2193 2129 1965 695 1604 32055 1560 395 --
NM_001044305chr681677 1626 1606 1437 1343 1161 629 211 1610 ----
NM_001044385chr2113848 3138 3058 2973 2959 2503 1266 578 499 326 185 --13035 12662
NM_001044722chr551742 1571 407 378 186 1205 --1763
NM_001044723chr551742 1571 407 378 186 1205 --1763
NM_001046chr5132869 2652 2624 2519 2462 2226 2064 1217 1149 867 839 398 127 --2289 105 12588
NM_001049chr1452452 2217 1940 1638 206 11829 --12004
NM_001071775chr1351507 726 669 499 386 51354 1248 1215 411 115 41742 1522 416 294 2289 147
NM_001078chr14750 668 479 256 --1553 --
NM_001079874chr141776 1523 1405 1367 --1430 1781
NM_001083620chr472522 2493 2040 747 474 400 258 1768 1878 11846
NM_001083621chr153390 3306 1382 1050 110 24727 4635 14732 --
NM_001099678chr3206378 5999 5868 5681 5048 4729 4567 4390 2441 2420 2089 2038 1962 1913 1756 1412 1307 950 619 205 --46274 4478 2361 329 --
NM_001100108chr1128230 7976 7817 7238 7019 6485 5241 2739 2674 1630 1376 466 27214 1550 37261 6799 3328 12856
NM_001106chr3299268 9250 9000 8933 8746 8708 8298 8207 8125 7919 7415 7315 7254 6875 6840 6434 6101 3197 2756 2506 1984 1886 1469 1403 1332 1313 1192 864 828 48242 6055 5905 2474 32516 2410 130 39604 8686 907
NM_001113490chrX122904 2897 2759 2506 2445 2300 2247 1104 1033 696 321 126 12846 23189 565 --
NM_001115chr8----178 --
NM_001117chr1862523 2478 2377 2255 1819 1011 12059 ----
NM_001121chr1041611 733 344 157 3544 204 122 61721 1201 617 580 507 388 --
NM_001122679chr531291 1199 1185 11146 --11249
NM_001123chr105808 678 570 266 129 ------
NM_001126chr13763 190 52 --2914 168 1818
NM_001128chr1683411 3294 3046 1410 1352 1225 928 697 1905 23458 3338 12921
NM_001144chr1651390 1317 1301 1171 920 1221 --11065
NM_001146chr852281 1730 1530 493 342 ------
NM_001148chr462100 1919 1487 1382 348 57 ------
NM_001149chr1041314 954 304 184 ------
NM_001151chr41227 ------
NM_001153chr26869 852 819 343 55 47 ------
NM_001159chr25804 736 664 500 298 1533 ----
NM_001160chr1262830 2777 1954 81 39 30 11781 52720 1724 1037 737 163 22249 2192
NM_001167chrX156521 5524 4769 4579 2663 2525 2352 2282 1793 1336 898 863 414 365 297 22310 971 55770 5642 4907 2018 1860 26651 71
NM_001173chr14154229 3796 3696 3586 3356 3325 2969 1279 1172 979 736 485 430 416 318 34701 1812 1516 84706 3967 3245 3091 1683 904 828 206 33192 3049 1757
NM_001174chrX32205 2047 1442 1203 22281 1874 22097 1556
NM_001186chr21103207 3146 2928 2792 2539 2423 2228 2134 1182 399 --43117 2770 405 34 12810
NM_001189chr461150 1141 778 398 297 199 ------
NM_001198chr6122204 2063 2046 1889 1649 690 655 537 487 440 368 42 1765 1884 11876
NM_001200chr202711 353 1121 21002 399 --
NM_001201chr493918 3728 3621 3522 3425 3178 699 351 200 23670 2621 33764 2971 663 11241
NM_001204chr2287476 7106 7059 6836 6784 6590 6173 5856 5657 5236 5145 2873 2575 2530 2435 2177 1803 1579 1548 1434 1107 1095 991 753 644 539 191 168 25581 2512 77197 6453 5867 5753 5547 2043 1345 47466 6774 5393 1165
NM_001206chr962671 2612 2180 1097 1039 747 32016 1015 382 32642 1029 558 --
NM_001207chr5183 ------
NM_001219chr752116 1929 1799 100 36 --2668 392 --
NM_001227chr1061149 291 180 170 141 105 --2234 217 11131
NM_001237chr45438 287 269 158 69 --11026 3784 205 83
NM_001237chr45438 287 269 158 69 --11026 3784 205 83
NM_001239chr51113 ----2147 70
NM_001241chr272044 1872 1733 829 140 121 106 12135 51947 1901 1753 1614 878 42438 2286 1746 665
NM_001241chr272044 1872 1733 829 140 121 106 12135 51947 1901 1753 1614 878 42438 2286 1746 665
NM_001249chr142351 328 ----1129
NM_001253chr62265 244 ----1281
NM_001256chr1782907 2623 1938 1133 1127 883 503 248 2716 659 42880 2630 2389 972 11808
NM_001259chr7175984 5583 5528 5323 5191 5010 4748 4680 4264 2442 2399 2291 2012 1948 1595 1056 825 65773 5516 4549 2420 509 200 25752 4960 45841 5644 5113 2328
NM_001271chr1573223 3147 3116 1309 1273 1066 711 --1679 --
NM_001289chrX21444 393 31681 1317 1285 1201 1658
NM_001304chr17133781 3725 3584 3231 3187 2722 2360 1195 1183 1159 832 251 109 23739 424 12794 1698
NM_001310chr1232841 2095 338 1767 33026 2155 180 --
NM_001315chr651642 1507 1494 1469 550 21981 1594 --1221
NM_001326chr11--2469 172 ----
NM_001328chr41505 --1540 --
NM_001330chr16----3979 316 304 --
NM_001333chr92238 230 3281 194 55 ----
NM_001343chr561638 1097 591 383 240 111 --11526 --
NM_001349chr22592 231 2627 465 ----
NM_001351chr391706 1455 1393 1365 467 423 348 109 88 1710 1681 21491 514
NM_001356chrX82268 1954 877 839 332 131 84 59 11596 32026 1556 276 22399 323
NM_001364chr1184409 4363 4020 3952 3772 1610 1356 705 1429 33216 1415 1134 1640
NM_001365chr171642 ------
NM_001380chr102937 319 --3968 858 794 --
NM_001386chr852298 2213 1962 1895 1644 1420 22044 790 --
NM_001389chr211560 ------
NM_001391chr181101 21227 884 1280 1752
NM_001396chr21112680 2640 2111 1996 1862 1810 1033 973 370 251 147 ----1345
NM_001400chr141355 1163 365 254 --21321 863 11347
NM_001401chr931539 302 185 11110 21458 1214 11126
NM_001402chr631961 1353 266 32059 2052 775 ----
NM_001407chr351169 1108 560 267 213 11101 11202 --
NM_001412chrX123778 3504 3286 3040 2887 2542 2535 1433 1342 1306 1186 866 1906 1718 11176
NM_001418chr111697 ------
NM_001418chr111697 ------
NM_001419chr19164599 4520 4345 4202 4088 3987 3932 3411 2971 1517 1214 984 861 830 94 59 14547 34337 4234 1133 --
NM_001420chr1973138 2464 2430 2267 2120 2104 634 --12077 --
NM_001427chr731854 440 53 ----1234
NM_001429chr2261051 783 684 106 74 55 --1710 --
NM_001430chr241568 276 269 235 1377 21676 568 11987
NM_001432chr4153852 3807 3742 3567 3515 3449 3428 3309 3030 2990 2380 1166 746 707 234 --43871 3401 3344 2540 11030
NM_001438chr182854 2537 2321 1104 952 541 150 125 21066 908 33090 2242 885 23085 409
NM_001439chr131546 391 52 2978 93 --1618
NM_001448chrX11708 --2150 79 21777 1581
NM_001451chr1621061 381 --11033 --
NM_001452chr61715 ------
NM_001453chr651780 1592 1482 522 511 1593 ----
NM_001455chr674694 4033 3560 3396 1089 540 433 13197 64874 4532 3420 1970 1264 408 --
NM_001463chr22806 327 ------
NM_001480chr1831123 895 481 41177 798 403 203 --1417
NM_001482chr155969 610 282 240 178 1872 2366 322 1929
NM_001483chr751102 1045 938 432 120 --1704 165
NM_001490chr9123530 3364 3311 3244 2913 2381 1322 1231 755 731 670 510 21462 384 12558 --
NM_001491chr652409 1094 458 116 73 21729 219 11786 1914
NM_001497chr952130 1880 766 438 351 --12082 --
NM_001498chr641203 920 407 364 --31405 1082 439 --
NM_001527chr6104888 4784 4595 4568 4414 3895 3680 1620 1233 548 --24219 1590 --
NM_001530chr1451090 931 394 151 130 --1343 21017 86
NM_001543chr554629 3760 3726 3480 3299 --14597 --
NM_001546chr651339 477 381 292 177 2396 348 11452 --
NM_001550chr75631 233 134 95 32 --3454 437 105 --
NM_001554chr11584 --1548 1603
NM_001560chrX12632 21806 358 ----
NM_001564chr4----1101 --
NM_001587chrX32256 2244 2016 1815 ----
NM_001608chr25922 781 707 211 72 --1379 1334
NM_001609chr10104144 3789 3702 3514 3317 3067 2979 1010 723 184 33713 3346 49 53682 3200 3030 3016 850 --
NM_001614chr172637 579 ------
NM_001614chr172637 579 ------
NM_001616chr2112613 2376 2309 2222 2172 1408 1307 952 424 396 236 22266 1245 --11151
NM_001619chr114400 205 48 33 ------
NM_001621chr762894 2821 2421 2271 1969 768 52942 2364 1025 291 146 21036 151 11130
NM_001621chr762894 2821 2421 2271 1969 768 52942 2364 1025 291 146 21036 151 11130
NM_001634chr651999 1907 1814 1779 1519 31487 442 284 11642 --
NM_001649chrX52105 1987 1817 760 548 --3557 177 146 1715
NM_001650chr1893999 3813 3563 2803 1490 1407 869 593 156 23070 280 23608 939 --
NM_001655chr1142064 1924 1736 33 1741 2518 230 --
NM_001656chr551908 1883 1677 170 95 --41667 1314 611 47 --
NM_001660chr3------1230
NM_001663chr14102457 2226 1789 1023 944 880 781 574 566 285 22565 2295 32444 2064 965 --
NM_001664chr331008 272 98 --31029 310 38 --
NM_001674chr111139 ------
NM_001677chr12796 277 31008 927 903 1133 --
NM_001679chr32730 577 --2700 618 --
NM_001682chr1272383 2249 820 599 414 391 169 1302 32682 2535 811 --
NM_001684chr1134164 4144 3955 3796 2692 1615 1527 1270 1029 905 480 193 81 --11251 --
NM_001689chr22517 482 31954 1902 143 2557 277 --
NM_001690chr332093 1607 108 --41807 786 500 399 --
NM_001695chr8104171 4009 3793 3427 3040 2842 1156 985 961 556 43505 3050 826 761 3885 719 664 --
NM_001699chr1921850 1414 --1578 --
NM_001701chr931619 1033 64 11114 2458 240 1116
NM_001709chr1132893 1834 464 22340 2241 --1102
NM_001713chr531094 995 184 --1905 1164
NM_001714chr122509 464 ------
NM_001716chr1111487 ------
NM_001718chr651176 1123 1099 167 104 1990 ----
NM_001721chrX192 ------
NM_001730chr1351622 1584 1355 1347 550 1572 21432 1278 11071
NM_001730chr1351622 1584 1355 1347 550 1572 21432 1278 11071
NM_001731chr124913 803 681 293 1154 1744 1201
NM_001742chr731723 1318 1277 --1441 --
NM_001745chr521163 272 --2901 460 --
NM_001746chr592725 2616 2608 2566 2103 909 702 338 310 21936 994 22426 265 1155
NM_001750chr591888 1630 1279 1270 1259 808 341 233 226 1266 2402 64 --
NM_001752chr112471 407 1157 ----
NM_001753chr771832 1441 1398 1227 301 221 202 21804 601 21557 50 --
NM_001754chr21133840 3725 3602 3578 3421 3060 1231 1106 1072 719 663 426 383 23669 1603 53567 806 650 494 389 --
NM_001755chr1672295 1909 1812 1440 871 358 265 --1240 --
NM_001759chr1274972 4113 3564 1466 1408 397 348 --21659 905 24329 1376
NM_001762chr72105 71 1324 193 1338
NM_001769chr122388 336 1373 --1114
NM_001777chr3154154 4129 4054 3883 3738 3486 3211 2881 2690 2590 1459 1440 1234 453 185 --43938 3450 3402 1355 --
NM_001781chr122135 101 1117 1850 --
NM_001786chr102143 129 ------
NM_001788chr72752 675 ------
NM_001789chr341215 1176 570 435 ----11240
NM_001791chr131286 886 264 --1198 --
NM_001792chr1841107 1077 971 886 1213 41179 902 893 87 --
NM_001797chr16--1667 ----
NM_001798chr1221121 725 ----1282
NM_001802chr166951 870 814 643 623 27 ------
NM_001806chr19172984 2884 2713 2265 2259 2147 2125 2042 1918 1181 1107 979 836 637 522 493 295 32066 798 22 22357 2348 12949
NM_001812chr41238 1114 ----
NM_001821chr1134674 4397 3867 3412 3331 1824 1485 1187 1139 823 809 664 54 --22995 567 24630 253
NM_001822chr25733 694 663 134 60 ------
NM_001830chrX63912 3818 3193 363 329 118 23580 1186 13739 1197
NM_001839chr11783 --2509 75 --
NM_001842chr93575 559 450 ------
NM_001845chr1361390 1320 1311 1245 967 202 --1375 --
NM_001854chr161403 1290 1251 1217 528 176 ----21121 465
NM_001855chr94813 750 636 36 2744 583 ----
NM_001858chr6174856 4313 4059 3802 3553 3540 3150 1978 1940 1930 1924 1866 1556 515 506 452 315 53876 3223 3215 954 385 33531 3518 3307 13571
NM_001859chr952965 817 422 358 332 23206 1191 53512 2922 2732 1137 318 --
NM_001872chr132394 39 ------
NM_001874chr1244269 3239 3196 2087 14673 44979 4803 3222 974 14568
NM_001875chr241097 903 842 75 --1278 --
NM_001880chr23298 105 45 --1239 --
NM_001881chr104389 198 178 152 1478 2435 136 1466
NM_001882chr52537 518 --1166 --
NM_001884chr51388 1371 ----
NM_001891chr41136 --121 --
NM_001892chr541465 1115 326 139 176 31450 1281 1016 --
NM_001894chr2281251 1224 1193 1181 1148 1131 1076 509 11235 ----
NM_001901chr61657 1368 ----
NM_001903chr55888 854 784 269 145 2877 792 1914 --
NM_001904chr321091 245 --1740 1225
NM_001914chr182372 315 ------
NM_001916chr8----1180 --
NM_001918chr1169286 9016 8896 8704 8470 8270 7909 7780 7616 7164 2911 1494 1223 229 159 26 26235 670 48832 7067 6909 1092 36241 1456 676
NM_001920chr126682 319 306 214 180 122 1579 ----
NM_001921chr421256 88 --11111 --
NM_001931chr1151291 1041 801 491 158 1461 ----
NM_001938chr151723 1174 299 227 220 41437 1228 395 249 31883 1572 86 --
NM_001940chr121454 ------
NM_001941chr18133716 3358 3108 2887 2855 2608 1500 1448 1077 804 776 547 111 43542 3320 2590 1423 43951 1392 853 505 12748
NM_001942chr1851904 1705 1597 819 194 11363 11343 --
NM_001944chr1872263 2146 2014 913 264 113 98 12333 ----
NM_001948chr151220 11274 --1113
NM_001949chr6143244 3233 3151 2878 2724 2702 2404 2234 2138 2085 2015 989 810 159 --43085 2765 2393 817 --
NM_001955chr61930 ----11099
NM_001957chr451894 867 729 322 208 1392 22259 341 --
NM_001961chr19------1321
NM_001963chr43676 543 229 ------
NM_001967chr31429 ------
NM_001968chr41694 --2667 647 --
NM_001969chr14113612 3106 2485 2476 1538 1307 885 477 330 45 22 13263 21447 960 12612
NM_001977chr471608 1572 1401 1294 1275 1113 71 11393 127 31351 1345 338
NM_001981chr192201 1875 1860 1827 1777 1767 656 515 262 42259 1539 688 137 41651 1565 960 905 --
NM_001987chr1274339 3726 2722 2709 1706 1239 973 --14300 --
NM_001992chr542097 2040 1591 1497 31526 605 84 ----
NM_001993chr181105 912 830 746 692 365 354 56 --21029 231 --
NM_001994chr1----2179 66 --
NM_001995chr461409 1370 1188 964 350 121 --179 --
NM_001998chr32121 107 --2113 95 --
NM_001999chr551091 313 231 164 133 ----181
NM_002006chr4205589 5423 5415 5184 5144 5097 4755 4690 4617 3822 3651 3507 2207 2185 1841 1110 1031 725 542 123 44936 4362 3839 3665 35321 2229 1441 24800 1290
NM_002009chr1552735 1868 585 299 78 22322 938 21749 283 11019
NM_002014chr122266 88 ------
NM_002015chr1393341 2940 2164 1096 857 733 657 628 462 11308 22498 895 22953 930
NM_002017chr1141389 1235 1093 976 --31328 1309 163 1447
NM_002024chrX92247 2081 2058 1940 1412 295 174 140 68 11839 1803 --
NM_002025chrX169318 8635 8494 8450 8321 8091 7411 6000 3420 3330 2321 2154 1368 625 502 464 37305 5722 1908 78347 7205 6581 2972 2068 1281 1176 1668
NM_002031chr64641 534 331 208 ------
NM_002033chr11153911 3489 3417 3187 3131 2687 1596 1351 1199 805 731 570 498 299 49 13967 13298 13918
NM_002035chr18153966 3900 3839 3641 3489 2619 1525 1414 1017 998 932 423 394 72 40 23746 3557 53991 2759 1090 1066 1010 --
NM_002040chr2183035 2930 2584 2436 2265 2178 2158 2084 31993 931 656 13121 13134
NM_002048chr951013 985 477 210 129 1856 ----
NM_002051chr103941 835 287 ----1318
NM_002054chr25474 441 405 308 132 ------
NM_002056chr22204 192 2695 681 ----
NM_002061chr151675 679 594 554 31 --11566 --
NM_002063chrX31079 967 517 21244 1090 --1871
NM_002065chr14445 421 228 186 --21252 1163 --
NM_002069chr741901 1352 699 458 41911 1858 592 433 11366 31713 706 301
NM_002074chr1--2368 275 1596 11682
NM_002076chr1263221 3158 3151 2220 1051 156 ----12775
NM_002082chr51998 ------
NM_002092chr474961 4761 1492 706 556 524 226 13424 54858 4316 3836 1455 379 11107
NM_002106chr41102 ------
NM_002107chr11201 ------
NM_002111chr422659 2639 12589 23846 2443 22369 594
NM_002114chr61127 2364 208 1537 1477
NM_002126chr1754178 4171 915 506 349 --23988 1030 --
NM_002128chr1362326 2279 953 595 495 454 --22537 2440 11973
NM_002129chr43358 314 96 --1417 --
NM_002130chr591590 1467 1454 1284 1127 446 386 368 119 11294 21709 1596 194
NM_002139chrX----3255 193 143 1184
NM_002140chr941012 957 791 257 ------
NM_002155chr14275 199 115 95 ------
NM_002158chr2173838 3281 2905 2895 2676 2605 2516 1358 1282 1008 627 489 471 407 353 252 149 21538 1067 43851 680 501 220 13478
NM_002161chr92412 169 ------
NM_002165chr201408 ------
NM_002182chr392806 2736 2600 2464 2432 2108 1828 628 481 12134 1667 12297
NM_002190chr6--21253 380 1293 --
NM_002193chr231861 1845 720 --11571 11607
NM_002194chr21157 ------
NM_002199chr441033 962 780 352 --1942 1875
NM_002202chr55894 854 768 749 368 ------
NM_002203chr5113654 3327 3246 2673 1606 1151 1111 911 737 329 285 --22556 999 23453 561
NM_002210chr2183575 3519 3511 3423 3394 3229 3211 3110 2943 2915 2330 2172 1220 969 764 673 204 69 82663 2253 1086 685 534 485 346 52 ----
NM_002211chr102894 881 --1135 2385 72
NM_002214chr7175582 5487 5090 5050 4694 4617 4437 4390 4191 3996 3872 3733 3461 2228 1152 839 254 35133 5061 4161 45237 3962 1328 182 169
NM_002223chr12124011 3938 3893 2732 2640 2570 1594 1463 1442 1433 706 606 ------
NM_002232chr131278 543 509 1362 11238 --
NM_002235chr1251581 1217 375 96 86 1563 11448 21570 1414
NM_002239chr231068 852 248 1763 1392 --
NM_002240chr21----1116 1660
NM_002242chr242008 1919 1562 782 1731 1535 --
NM_002247chr1062388 2355 2232 1939 916 560 --178 --
NM_002264chr3144016 3789 3676 3586 3447 3321 3281 2030 1760 1702 899 861 745 89 1412 23476 1061 --
NM_002267chr1362069 1926 1870 1548 962 546 21772 671 22423 710 --
NM_002268chr351862 1567 1459 1237 336 1255 ----
NM_002270chr5135307 4415 4332 4284 4034 3714 3644 1758 906 827 799 467 450 35563 5389 4566 75633 5543 4808 4705 4622 1594 768 15323
NM_002271chr1352306 2272 1650 912 572 21503 334 1294 --
NM_002285chr244107 3593 2676 384 14063 33212 2884 965 --
NM_002293chr182626 2145 2056 1764 875 843 732 703 12447 12388 --
NM_002296chr1111618 1433 1281 644 619 475 435 344 249 187 80 11755 --11201
NM_002310chr596422 5401 5297 4247 4036 2293 1847 896 642 56586 5061 1672 1424 849 76047 5791 5492 5217 1533 733 539 14022
NM_002312chr1351063 921 680 331 296 21015 659 3845 819 153 1148
NM_002317chr53372 124 71 1392 1359 --
NM_002332chr12----1732 --
NM_002336chr12154656 4320 4215 4123 3698 3607 3465 3426 3281 3067 1763 1731 1496 819 713 34830 3222 3158 44880 4158 4090 4049 24391 3937
NM_002349chr271594 1401 1234 1151 1137 317 24 11580 31487 519 382 11104
NM_002350chr831167 1152 803 ----1967
NM_002351chrX51710 621 183 163 39 11760 11571 21618 376
NM_002356chr671116 1102 861 671 344 155 35 1921 22720 1135 --
NM_002358chr42551 178 --2100 35 1538
NM_002360chr722657 2601 ------
NM_002373chr151425 ------
NM_002374chr243380 2624 408 143 43476 3304 964 889 ----
NM_002381chr251032 932 906 669 102 2355 221 2850 312 --
NM_002383chr16--1921 ----
NM_002384chr182991 944 2843 794 ----
NM_002392chr123429 228 176 --1466 1220
NM_002395chr651216 1114 476 429 180 11154 157 --
NM_002397chr562167 1808 1376 835 791 254 --11855 --
NM_002398chr241268 1225 610 324 ----11142
NM_002401chr1722136 1531 --12073 --
NM_002408chr141307 1269 ----
NM_002430chr2272191 2096 1706 1684 275 183 92 12226 12110 --
NM_002431chr141324 ------
NM_002445chr851319 392 352 144 87 21106 555 1121 --
NM_002448chr41493 1737 --1782
NM_002449chr521112 479 11062 1922 1798
NM_002451chr963912 3823 2454 1090 100 70 13931 32936 1238 836 --
NM_002467chr82174 157 --1377 1295
NM_002478chr111620 ------
NM_002480chr1251237 544 461 387 143 1974 21358 164 --
NM_002481chr1217840 7739 7542 7403 7187 6956 6567 6369 6331 5881 5845 5478 5362 5132 5080 4813 2950 2879 1416 1377 382 16425 58008 6866 4906 2835 573 12980
NM_002485chr852121 1830 1678 417 149 21926 845 ----
NM_002486chr962266 2055 1628 557 437 51 22357 516 22170 375 --
NM_002500chr241117 520 462 346 --21242 472 --
NM_002506chr12145 103 ------
NM_002508chr142022 1896 1295 139 --11626 --
NM_002514chr83891 293 229 ------
NM_002515chr1421636 189 ------
NM_002518chr221220 494 136 ----
NM_002520chr52101 33 ------
NM_002524chr161063 964 950 883 750 69 --2897 444 --
NM_002526chr631675 1663 469 4345 278 266 255 11730 11141
NM_002545chr1195114 4871 4774 4538 3824 1635 1477 682 401 154 34993 3930 1641 --
NM_002546chr8----1118 2627 499
NM_002568chr83402 277 131 --1319 --
NM_002569chr1511488 ------
NM_002570chr1511147 1115 11040 --
NM_002577chr344074 3976 1425 1040 23957 947 74047 4034 1062 872 422 306 179 13283
NM_002578chrX1170 ------
NM_002581chr995695 5486 5459 4838 4597 4218 4126 4116 1195 15430 --21899 140
NM_002590chr132469 450 --3229 211 184 --
NM_002594chr2042160 795 758 306 22442 980 22073 883 --
NM_002595chr1261842 1265 1233 546 269 189 11458 21942 488 21464 1393
NM_002600chr181865 1571 1314 1298 501 484 354 190 --21485 709 --
NM_002606chr21--1175 ----
NM_002610chr2153100 3056 2517 2453 2392 2370 2307 2160 2134 812 793 677 562 468 250 1579 --12169
NM_002612chr721955 1608 22009 548 12112 --
NM_002613chr1695376 5304 5273 5247 4723 4667 912 613 496 ------
NM_002618chr23474 431 371 ------
NM_002623chr203306 111 95 2684 595 163 --
NM_002628chr32943 876 --191 --
NM_002641chrX41441 302 245 104 --21819 1661 --
NM_002645chr1183120 2313 2087 2040 896 288 204 21 22453 1029 32541 2028 98 1628
NM_002646chr162041 1961 1762 783 494 465 --21557 356 --
NM_002648chr62991 825 --1814 --
NM_002649chr751162 1154 676 381 277 --21424 1392 11401
NM_002651chr11679 --1693 --
NM_002655chr8215218 4953 4675 4595 4574 4454 3664 3426 3318 3235 1973 1849 1086 539 452 441 327 285 244 167 122 12053 1154 --
NM_002656chr641111 857 839 402 --1949 2761 338
NM_002657chr2083577 3355 3181 2567 2549 1269 774 92 --1824 12725
NM_002658chr10------2895 158
NM_002670chr361397 1189 1024 600 531 190 --1381 1620
NM_002687chr143891 860 449 --51186 1111 996 844 175 11175
NM_002690chr8147 ------
NM_002697chr11264 --1215 --
NM_002699chr121412 125 ------
NM_002703chr481944 1807 1780 1585 1415 1296 1255 1224 --2658 633 --
NM_002706chr22638 490 --2607 470 --
NM_002709chr2163583 3562 3548 3422 2856 2379 2334 1428 1248 1222 875 736 553 268 149 120 63498 2784 2621 662 581 480 42995 2603 730 437 --
NM_002713chr14979 858 395 86 --21077 1035 --
NM_002715chr55988 927 846 495 336 ----1355
NM_002716chr1142785 600 444 148 22536 742 33302 1413 915 --
NM_002718chr3102643 2432 2266 625 555 536 458 169 133 95 11809 32684 2382 745 --
NM_002720chr161271 --1222 --
NM_002721chr92196 54 1138 ----
NM_002726chr6--1152 ----
NM_002729chr103838 324 312 --2305 181 1339
NM_002730chr1931262 530 115 ----1942
NM_002731chr151260 929 903 587 440 1897 62628 2022 1946 1228 556 502 --
NM_002734chr1782310 2095 1687 1680 1589 1546 864 222 22047 2005 ----
NM_002736chr761890 1830 1646 1564 561 491 1462 2594 228 --
NM_002737chr1796460 6193 5362 4845 4668 1989 1580 1248 1013 25451 81 --26163 1336
NM_002740chr342618 2290 436 193 32639 1023 494 2402 365 --
NM_002745chr2264306 4047 3864 1393 1319 658 --33145 2992 1527 --
NM_002747chr1821705 1636 ------
NM_002765chrX6518 377 328 314 46 39 --1257 --
NM_002767chr173521 191 150 1209 ----
NM_002788chr14299 88 ------
NM_002792chr20----128 --
NM_002812chr191426 ------
NM_002816chr171241 1110 ----
NM_002819chr1911030 --11205 --
NM_002822chr1251852 1537 1122 508 49 41138 654 599 279 2553 224 --
NM_002823chr2--1667 1490 --
NM_002824chr121479 ------
NM_002827chr202474 413 ------
NM_002828chr183946 818 251 ------
NM_002829chr931255 1187 429 ------
NM_002830chr23267 257 122 ------
NM_002833chr15------11474
NM_002834chr1263613 3324 3292 3236 3055 43 1837 63712 3569 3548 3396 2923 389 --
NM_002835chr72678 514 1486 1552 --
NM_002837chr12144519 3421 3048 3002 2815 1601 1433 1383 1099 662 492 277 151 115 2239 143 44386 3990 3641 3209 --
NM_002839chr963431 2999 2775 2735 560 98 22916 598 32854 2407 1054 1769
NM_002841chr33709 53 27 1213 ----
NM_002843chr1122900 620 --43322 3262 1364 131 --
NM_002847chr721573 235 ----170
NM_002851chr71187 1222 3694 670 117 1689
NM_002858chr121320 338 --11034 11111
NM_002860chr103709 237 27 ------
NM_002869chr1152221 2043 1878 1424 161 ----2518 246
NM_002874chr9102434 2314 2259 1877 1838 452 356 241 76 50 --32476 2306 281 --
NM_002886chr3124191 3812 3376 3297 1645 1451 1414 1321 1282 1226 1000 534 44933 3915 1596 1371 33264 1408 977 14537
NM_002892chr1441565 1155 1115 310 --1229 --
NM_002894chr182236 196 ------
NM_002902chr15144 2557 57 1142 1513
NM_002906chr1162243 2186 2020 1825 1502 1490 --32378 2340 2041 21760 1476
NM_002930chr18--139 ----
NM_002938chr432030 343 315 --31658 1564 1515 --
NM_002941chr331499 369 271 1157 21640 1604 --
NM_002942chr341423 1157 432 285 1446 2418 403 --
NM_002956chr1251332 933 923 412 219 ----1332
NM_002957chr91115 13359 23751 2558 13515
NM_002958chr35942 704 246 232 152 ------
NM_002959chr194459 3602 3476 1644 1163 1146 721 663 238 11096 34412 4398 1134 11553
NM_002968chr161344 1162 1231 11086
NM_002971chr321156 919 11040 ----
NM_002977chr2103237 2997 2785 2621 2583 1335 1093 1040 921 293 22521 1119 42959 2375 2166 506 23078 2954
NM_002993chr42804 693 ------
NM_002995chr14822 759 624 529 1641 ----
NM_002998chr891794 1412 809 559 503 384 269 57 42 1537 32014 1740 614 --
NM_003001chr142138 1897 1748 312 --1606 1694
NM_003010chr1732340 780 62 22079 1839 ----
NM_003013chr43738 672 322 2844 662 1714 --
NM_003017chr651410 1402 1267 1232 263 ------
NM_003022chrX31059 803 501 --2408 74 --
NM_003030chr331803 1785 1750 1504 11529 --
NM_003032chr332527 2425 2396 12724 ----
NM_003034chr12177973 6883 6048 5808 5610 5354 5276 5151 4924 2829 2429 1920 1803 1530 1516 1018 863 77910 7750 5551 2072 753 613 148 57008 6522 5495 5404 5080 11734
NM_003036chr13925 361 174 ------
NM_003040chr71106 ------
NM_003043chr394172 4102 4070 3883 1719 1288 472 301 259 183 1764 --
NM_003046chr8124678 3450 3430 1977 1533 1262 967 721 602 559 462 125 55410 3531 3469 3461 3343 14626 35266 4396 449
NM_003048chr2102597 2126 1141 982 958 804 673 489 429 302 32609 1795 358 32177 1975 1931 12172
NM_003051chr151650 1283 603 389 321 11740 31910 1510 251 --
NM_003054chr101318 1219 --1238
NM_003068chr811003 11070 1727 --
NM_003070chr95874 831 571 301 250 --1617 1129
NM_003071chr382042 1895 1881 684 586 308 257 226 --2821 806 31994 838 463
NM_003081chr20--2946 782 ----
NM_003082chr1421433 532 --129 --
NM_003087chr101234 ------
NM_003089chr191153 ------
NM_003099chr15125002 2482 2471 2205 2100 1916 1765 1660 1491 906 698 172 16448 26527 1694 11758
NM_003100chr5--1311 ----
NM_003106chr381103 833 805 757 383 352 226 35 1751 1816 --
NM_003107chr642454 1986 1858 1673 --32619 1652 1645 12076
NM_003108chr2176549 6478 6423 6406 6038 5276 5211 4468 2120 1176 1023 847 834 764 617 608 209 55847 5192 1567 1307 1123 34959 4870 623 15959
NM_003110chr1721092 748 1988 ----
NM_003111chr25494 428 402 120 103 1236 1410 --
NM_003112chr7143256 2983 2780 2552 2337 2319 2078 2040 2015 1199 1149 759 472 394 33030 699 166 11225 22529 2247
NM_003118chr54685 377 330 189 --21726 252 --
NM_003123chr1623697 1960 --54588 4441 3691 3678 775 --
NM_003126chr13507 497 486 ----1435
NM_003128chr292167 1889 1057 939 867 675 668 279 131 ------
NM_003131chr662261 1565 1532 1400 710 302 --1772 --
NM_003133chr131061 301 21 --1135 --
NM_003136chr14144 1291 ----
NM_003137chr651981 903 698 532 377 11711 ----
NM_003144chr631853 836 425 ----22226 657
NM_003155chr862593 2115 1070 839 602 337 31828 677 397 1550 2846 812
NM_003161chr17103217 3133 2955 2902 2844 2751 2367 2305 1290 437 1581 --21434 1386
NM_003162chr251075 832 771 350 309 ------
NM_003164chr111415 ------
NM_003178chr33561 445 221 137 --1290
NM_003184chr841124 1041 990 59 --11141 --
NM_003189chr192638 2246 2144 1280 1202 1046 1036 137 119 --22796 2485 --
NM_003194chr61442 ----1360
NM_003199chr18105180 4264 3918 1708 1370 708 687 396 368 227 35591 2072 1892 54194 2212 1639 1582 742 --
NM_003201chr1021002 653 2740 198 1714 2980 668
NM_003202chr521875 1348 --21354 522 --
NM_003203chr282263 2229 2202 1968 1910 1545 316 273 3703 224 31 41987 1846 1805 968 12253
NM_003204chr1721756 532 ------
NM_003211chr1231787 1696 232 --1202 21530 301
NM_003216chr2273027 3003 2665 2575 2520 1217 917 ----12448
NM_003217chr1232008 146 114 --11432 --
NM_003220chr631172 632 387 ----11705
NM_003221chr6144121 4001 3816 3572 3342 3041 1556 1190 1159 1003 720 425 355 158 31391 1268 137 23457 3368 4887 434 75 69
NM_003222chr204928 889 486 254 1952 31109 963 203 --
NM_003223chr162751 90 ------
NM_003234chr371845 1829 1658 852 821 153 75 2797 246 1507 11756
NM_003238chr11263 ------
NM_003244chr181391 ------
NM_003246chr1531814 1552 794 ------
NM_003253chr2161598 1341 1248 349 159 129 31631 1407 744 11280 21453 1418
NM_003257chr1561433 1254 1086 927 541 285 21006 373 2995 264 --
NM_003262chr3115160 4791 4035 3275 1886 1793 1775 1382 1065 739 303 35198 5003 3356 45034 4574 4366 966 43953 1166 351 225
NM_003272chr15718 270 225 218 72 ------
NM_003274chr2122581 760 22976 2746 32878 2359 1832 12452
NM_003275chr92532 479 1168 ----
NM_003286chr202398 244 11020 ----
NM_003288chr2041566 599 457 384 1631 --1559
NM_003291chr13--126 2818 312 --
NM_003292chr1122186 2026 1871 1726 692 646 574 468 460 421 355 216 1429 --11841
NM_003297chr12194 ------
NM_003298chr3146007 5586 5377 4943 4914 4851 4756 4428 4144 3880 2260 1954 1520 1475 26081 5998 45476 3868 2023 2004 26166 4819
NM_003299chr121166 ------
NM_003300chr141470 ------
NM_003304chr351387 1145 1058 1033 66 11397 131 1471
NM_003305chr4193 ------
NM_003309chr641366 1325 1292 1165 --41643 768 363 113 --
NM_003315chr171232 ----1252
NM_003320chr1194477 3888 3819 3254 3007 1775 1650 1014 113 1473 34464 3059 2767 --
NM_003326chr162627 2285 1946 775 735 543 12275 12673 1795
NM_003337chr581672 1531 1455 1438 1407 434 418 47 2589 77 ----
NM_003338chr1061917 1434 1286 747 664 417 --1719 1671
NM_003339chr531428 287 275 11371 --11052
NM_003340chr461407 1311 1107 306 252 184 149 --21059 118
NM_003342chr17113285 3183 2250 2072 1229 1061 920 656 530 481 24 12364 21113 848 --
NM_003344chr721257 88 11485 11600 --
NM_003347chr2231509 1478 1471 1282 1134 11497
NM_003348chr1251679 1562 1356 1246 1063 --11372 2486 392
NM_003349chr2021426 80 --1171 --
NM_003350chr83917 879 201 --1822 --
NM_003358chr91128 ------
NM_003359chr451290 1113 1001 841 499 --21021 266 --
NM_003360chr4148 ------
NM_003363chr33678 550 542 --1491 --
NM_003367chr19----1481 --
NM_003368chr14777 635 214 84 1576 2712 171 --
NM_003369chr113913 406 133 --12718 --
NM_003375chr101388 ------
NM_003376chr631440 1323 1274 --11463 11719
NM_003376chr631440 1323 1274 --11463 11719
NM_003385chr27930 922 877 734 637 397 316 21034 195 --1820
NM_003387chr2102836 2646 2413 1999 1973 1807 938 557 294 281 22158 636 22795 177 --
NM_003390chr1151103 957 783 697 124 --11070 --
NM_003392chr3104053 3996 3817 3620 3512 2797 1189 562 534 301 14073 --14135
NM_003400chr26816 806 658 337 182 151 1245 ----
NM_003403chr141749 2173 104 1577 --
NM_003404chr202299 109 12075 2349 260 --
NM_003406chr841437 1313 1291 240 --2786 627 --
NM_003409chr1881472 1420 1127 961 917 403 274 156 ----3942 553 433
NM_003410chrX52778 2341 2333 668 343 2835 284 22423 141 22481 355
NM_003411chrY91729 1614 1555 1507 1407 734 631 256 236 31357 493 273 2590 457 11589
NM_003412chr362362 2292 1958 1237 1220 380 13006 53078 2903 2796 2413 2224 --
NM_003413chrX81975 1424 1329 1271 772 712 638 450 --1589 --
NM_003420chr33572 207 172 1540 2512 329 --
NM_003423chr1951904 1634 172 133 87 --32296 1965 1658 31718 1606 996
NM_003427chr6----1672 --
NM_003431chr11177 1453 193 --
NM_003432chr51479 ------
NM_003442chr114901 699 332 242 --1886 --
NM_003453chr131645 --2300 257 --
NM_003454chr1651384 1352 335 233 51 --31523 1491 1361 --
NM_003462chr181774 1610 1395 1185 498 416 386 21 11215 ----
NM_003463chr692984 2238 2194 1310 1073 839 711 287 52 --21204 913 12065
NM_003468chr2114221 4196 3732 3391 2937 2841 2738 1255 841 267 247 24350 820 53827 2991 932 648 275 --
NM_003472chr62518 325 11271 11223 --
NM_003473chr104952 753 711 414 --1167 --
NM_003474chr1062325 823 602 202 127 82 11917 ----
NM_003477chr111563 ------
NM_003478chr11143345 3119 2782 2744 2656 2584 2289 2269 2256 2083 623 258 96 38 43258 2963 2075 1277 33316 2851 2477 --
NM_003483chr1242608 1878 889 273 12645 42772 2702 2087 585 12804
NM_003486chr1632656 308 235 ------
NM_003488chr174997 927 874 636 ------
NM_003489chr21103407 3362 3337 3201 3143 3101 2726 2111 1105 110 --31293 1113 165 --
NM_003503chr15466 446 371 264 105 ------
NM_003505chr721862 772 21689 1340 ----
NM_003506chr841312 1297 821 431 --31119 900 494 --
NM_003507chr222056 542 --1100 --
NM_003508chr71287 ------
NM_003557chr161446 519 392 352 298 87 11652 ----
NM_003563chr175979 163 142 97 32 2916 489 11058 --
NM_003566chr12112495 2268 2165 2141 1381 1170 1149 641 349 313 276 23019 2743 52790 1234 1031 730 233 11229
NM_003573chr191244 ------
NM_003574chr18165653 5117 5041 4840 4620 4573 4481 3992 3850 1975 1323 1266 1122 619 506 469 2776 356 35373 4250 4061 --
NM_003576chr1331995 704 553 21003 817 1829 1259
NM_003583chr1283923 3458 2419 1437 1195 679 634 214 23938 3901 13422 23159 136
NM_003589chr1361481 1418 1314 1192 1133 577 --1253 --
NM_003590chr293881 3514 3471 3390 2970 2962 2873 1560 645 24042 1246 52984 1523 1255 1001 744 43938 3843 3491 494
NM_003591chr10193 ------
NM_003592chr71489 ------
NM_003597chr272259 1936 1566 1551 1419 673 600 --42294 2190 363 156 --
NM_003601chr42186 51 ----131
NM_003603chr472091 1880 1583 1518 1452 606 237 --32034 1401 1384 --
NM_003607chr194373 4237 4069 4025 3726 1042 634 290 202 23318 847 13860 --
NM_003615chr3143818 3798 3583 3273 3018 2971 2685 1422 1297 1022 700 602 382 243 53759 3394 1597 1497 567 53473 3049 3041 588 362 --
NM_003617chr184928 4637 3836 1640 1292 1252 1235 95 23862 1162 23342 3194 --
NM_003618chr261050 1021 972 480 150 118 --1509 --
NM_003620chr1751059 1033 411 353 78 --1120 --
NM_003622chr1222598 540 --42405 2090 965 662 --
NM_003626chr1131246 1078 530 --1407 1310
NM_003629chr1102922 2737 2502 2394 1323 1264 1088 950 870 599 --13211 --
NM_003630chr62528 247 ----1716
NM_003632chr171864 ------
NM_003633chr562155 2046 958 805 633 579 ----1627
NM_003637chr131284 1198 132 --2313 138 --
NM_003642chr2137 ----278 72
NM_003645chr151102 174 ----
NM_003651chr122586 210 ------
NM_003659chr221022 35 1245 11101 --
NM_003660chr191277 ------
NM_003663chr3133189 3069 2943 2797 2587 2432 2193 1350 1182 771 724 683 416 43336 2752 1260 933 63429 1368 1090 919 872 738 1182
NM_003668chr12190 ----167
NM_003671chr993512 3314 3305 3055 2516 2350 703 466 167 --12608 1677
NM_003672chr111689 1347 --11869
NM_003675chr103484 380 153 1459 ----
NM_003677chr1231871 781 397 11550 2599 417 2811 756
NM_003686chr11221 --1272 --
NM_003690chr25624 545 214 186 74 ------
NM_003692chr9------1990
NM_003701chr131220 11003 11062 1833
NM_003702chr82734 720 1839 ----
NM_003713chr121704 101 --11555 1468
NM_003716chr33851 667 85 ------
NM_003722chr352059 1966 448 403 209 11918 1296 11683
NM_003728chr42504 484 --1246 --
NM_003741chr31298 ------
NM_003743chr231914 861 747 --1689 --
NM_003746chr12185 ------
NM_003749chr1362296 2156 2067 2012 682 332 22194 1614 ----
NM_003750chr104889 882 860 366 1667 2823 658 --
NM_003759chr4134228 3899 3458 3192 2861 2825 1631 912 882 873 761 629 362 23729 508 64241 4170 4066 3918 513 222 14328
NM_003762chr13990 254 64 21291 934 191 11208
NM_003763chr2083174 3075 2443 2267 2118 710 553 406 --53233 3132 1265 564 394 --
NM_003769chr121102 --1111 --
NM_003772chr1161307 1260 1253 1184 1174 959 --2292 68 1814
NM_003774chr1293125 3048 2723 2413 2323 2292 2094 2078 1085 43189 2962 2929 474 43334 2585 1149 498 13250
NM_003778chr32192 122 1250 155 --
NM_003783chr191248 1095 844 828 458 434 394 375 137 2424 328 ----
NM_003787chr1821548 1262 --51697 1280 1051 546 490 --
NM_003794chr36362 308 236 196 133 124 --31051 974 891 --
NM_003795chr62387 168 --170 --
NM_003796chr191600 2621 386 ----
NM_003799chr1882831 1822 1592 1211 638 630 291 174 1545 34249 2985 1473 --
NM_003800chr692303 2272 2043 1896 955 418 340 328 123 --12035 --
NM_003816chr861424 1392 1322 1164 1113 368 11149 11416 11369
NM_003822chr163161 2954 1970 1963 783 661 --23209 601 --
NM_003825chr1531571 1164 539 11307 --11300
NM_003829chr941244 1008 994 79 ------
NM_003831chr18101742 1458 1398 1282 699 692 672 275 160 77 --51717 1616 1588 573 304 1267
NM_003848chr35972 960 931 346 267 ------
NM_003861chr14102542 2285 2112 1976 1803 1096 919 909 657 124 1804 ----
NM_003870chr1541387 1299 777 324 ----11797
NM_003872chr252965 2594 2470 1890 543 --42895 2058 638 389 12164
NM_003873chr1052515 2292 2184 1774 204 12119 12242 12452
NM_003884chr361720 1479 1308 627 506 243 21812 431 31246 745 156 --
NM_003885chr1752641 2546 998 764 712 ------
NM_003887chr251603 560 443 179 151 --11628 --
NM_003888chr1541720 1300 478 338 ------
NM_003895chr2161719 695 635 540 332 289 22139 2099 1653 --
NM_003901chr1092725 2429 2404 1937 1096 658 510 186 79 1295 2650 287 --
NM_003902chr11735 --197 1779
NM_003913chr684331 4299 3647 3571 3254 1497 1128 934 54022 3423 2850 2722 804 44164 3922 3125 611 21148 773
NM_003916chrX41170 477 148 23 2489 167 ----
NM_003921chr1111844 1751 1555 1431 1408 1370 1350 704 403 360 214 21700 1282 259 22 21547 1227
NM_003927chr187881 742 735 388 265 122 31 --21049 716 --
NM_003931chr66649 632 610 493 456 222 --1135 --
NM_003934chr92474 145 1416 2988 821 --
NM_003938chr191115 ------
NM_003939chr1094000 3892 3270 3016 2953 2865 1256 337 264 --14055 --
NM_003940chr3149 ------
NM_003941chr7142563 2473 2441 2094 2076 1943 1861 1667 1640 1553 752 742 378 317 32051 908 542 11978 --
NM_003947chr341193 1174 855 480 11298 11006 1555
NM_003948chr482364 2208 1810 1076 1009 753 640 413 11763 22234 1725 --
NM_003955chr1731609 1563 367 ------
NM_003958chr683549 3513 2985 1542 1486 1290 1243 300 --32703 1065 911 2906 900
NM_003966chr5187511 7037 6878 6808 6766 6581 6288 6044 4777 2842 2601 2511 2383 2198 1659 975 495 339 11619 77258 7043 6834 6327 3092 1422 745 27065 7010
NM_003968chr31166 --1139 --
NM_003971chr172567 210 --1521 1136
NM_003972chr10186 1220 11324 21097 446
NM_003980chr661442 1358 1342 1236 1040 379 --2181 169 --
NM_003986chr113240 123 100 ------
NM_003993chr11305 ------
NM_003994chr12114149 3109 2966 2952 2832 1720 1591 1443 1431 1318 460 64416 2812 1172 1070 566 80 34047 2682 1541 2378 147
NM_004006chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004007chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004009chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004010chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004011chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004012chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004013chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004014chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004015chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004016chrX42305 842 413 246 22278 1627 62194 1971 1778 1743 1704 664 --
NM_004017chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004018chrX42305 842 413 246 22278 1627 62194 1971 1778 1743 1704 664 --
NM_004020chrX42391 928 499 332 22364 1713 62280 2057 1864 1829 1790 750 --
NM_004021chrX42305 842 413 246 22278 1627 62194 1971 1778 1743 1704 664 --
NM_004022chrX42305 842 413 246 22278 1627 62194 1971 1778 1743 1704 664 --
NM_004023chrX42305 842 413 246 22278 1627 62194 1971 1778 1743 1704 664 --
NM_004028chr1893999 3813 3563 2803 1490 1407 869 593 156 23070 280 23608 939 --
NM_004035chr1794632 4265 4146 1112 1072 665 411 246 59 12060 63675 3516 3365 1159 743 285 --
NM_004040chr221162 1014 --1979 1511
NM_004050chr1472695 2497 2377 2262 2238 2213 1728 --22720 962 --
NM_004052chr104742 250 137 21 1766 --1292
NM_004056chr841069 987 146 84 ----1772
NM_004060chr51846 2888 427 31263 1205 1178 1296
NM_004063chr8----2300 95 --
NM_004064chr1271110 912 882 406 386 291 104 2165 84 11271 --
NM_004067chr721537 278 ------
NM_004071chr22212 85 166 157 --
NM_004073chr11306 ------
NM_004075chr123518 402 184 1390 2426 151 --
NM_004079chr162958 2693 1984 762 622 55 --42362 1966 1811 61 --
NM_004081chrY91877 1733 1481 565 521 447 208 197 176 11517 21570 406 1612
NM_004085chrX2662 152 --1310 --
NM_004086chr14------1649
NM_004087chr351784 1720 1411 525 395 21463 329 1550 1307
NM_004094chr1443024 2912 2833 834 1789 --21123 590
NM_004096chr1041965 1823 1426 1413 --32108 340 294 --
NM_004097chr21313 ------
NM_004100chr682082 1967 1914 1071 552 507 481 53 2289 171 31975 694 534 2519 405
NM_004101chr531811 1635 1592 32094 1997 1452 21791 432 12025
NM_004105chr22890 854 ------
NM_004109chr1192220 2132 1921 1827 1671 598 555 174 149 2276 35 31790 1615 727 22183 114
NM_004113chr361944 1585 1265 795 628 408 ------
NM_004114chrX1254 ------
NM_004124chr14153102 2670 2579 2347 2293 1432 1356 1255 1056 831 474 272 263 242 184 13446 31003 898 625 1813
NM_004128chr132211 134 ------
NM_004133chr892712 2562 2536 2334 2253 1851 1694 312 183 22612 993 21899 627 11078
NM_004134chr54669 581 134 125 ------
NM_004136chr1523003 811 13061 42387 2197 1182 1049 --
NM_004157chr3----1779 --
NM_004161chr261595 1450 1084 550 527 189 --21505 156 --
NM_004162chr341077 376 262 90 --1162 --
NM_004169chr174866 828 776 140 1715 --1810
NM_004170chr961720 1366 700 501 495 387 11653 ----
NM_004171chr11209538 9148 8628 8449 8130 8098 7768 7641 7496 6974 6901 6753 3277 2513 2412 2340 1822 1701 1428 75 13165 79648 9529 9438 9194 7068 2107 214 --
NM_004172chr541404 365 205 185 --11560 --
NM_004180chr21130 --1606 --
NM_004205chr113568 555 56 ------
NM_004209chr1611091 ------
NM_004215chr81507 --1461 2593 400
NM_004229chrX92018 1621 1604 1475 871 710 628 137 91 2416 105 11824 22198 1809
NM_004232chr18113836 3622 3343 1499 1445 1292 1174 917 846 650 70 12621 21358 959 33427 1311 1141
NM_004235chr91685 ------
NM_004241chr102646 605 2813 206 --182
NM_004242chr62307 50 --191 --
NM_004261chr131000 669 73 ------
NM_004268chr1161157 384 267 152 89 40 ------
NM_004272chr5112044 1915 1855 1781 1606 1561 1452 1243 775 468 390 1171 --11234
NM_004274chr1462532 2279 2056 845 314 139 --12701 --
NM_004277chr631658 1620 1472 --11683 --
NM_004279chr731849 848 345 --11864 1235
NM_004280chr62184 124 ------
NM_004281chr101120 279 54 --2490 435
NM_004289chr74494 472 463 431 ------
NM_004293chr983870 3639 3614 3306 3254 2681 1390 508 73047 2885 2828 1532 1463 1150 1017 23374 2332 11101
NM_004311chr1073118 2356 1944 1921 1055 384 64 11000 1731 --
NM_004323chr982697 2621 1830 1081 554 318 264 121 11683 12374 --
NM_004327chr2282080 2044 962 949 907 868 488 316 ------
NM_004329chr1091367 1237 1198 1190 1147 585 416 397 92 1215 1969 --
NM_004330chr153922 458 137 1796 21090 122 --
NM_004331chr872716 2672 2000 852 630 585 63 32345 435 364 31723 1686 295 --
NM_004337chr891831 1461 728 651 442 237 230 128 83 12276 11519 --
NM_004338chr18116792 6084 5574 5340 1442 1002 875 827 817 464 342 26589 5087 56746 6656 6181 2736 1627 25973 1556
NM_004342chr732067 799 251 12202 12025 11739
NM_004349chr821031 202 ----1992
NM_004360chr1672032 1769 1747 1636 1235 340 212 32020 292 270 2628 407 21785 144
NM_004369chr22733 460 --1507 2701 695
NM_004370chr632048 618 176 ------
NM_004379chr241497 1105 278 212 1536 11279 11317
NM_004384chr551742 1571 407 378 186 1205 --1763
NM_004392chr1392573 2513 2245 1954 1748 673 567 112 42 22141 884 32645 2251 315 --
NM_004393chr35890 470 231 202 193 --21575 534 --
NM_004397chr1154312 3653 3539 1606 1511 13666 53351 3343 1640 1542 992 --
NM_004404chr262036 1721 648 451 333 160 --31773 1630 149 --
NM_004407chr42733 77 --1251 1869
NM_004412chr10156044 5917 5760 5085 4907 4600 4364 4260 2345 2214 2048 1683 1054 874 440 44202 1631 309 280 45609 3946 890 883 25185 395
NM_004415chr65714 692 684 566 34 --1314 --
NM_004426chr1271610 1570 1515 533 431 184 77 11507 --1727
NM_004430chr852448 2375 2133 1991 1034 12802 12289 --
NM_004432chr992324 1941 1740 1728 1476 764 721 691 594 21692 68 21621 422 --
NM_004437chr183012 3003 2644 2231 232 199 133 100 12635 11097 --
NM_004438chr253230 3183 3136 3078 2689 23216 718 11004 --
NM_004440chr651875 1841 706 449 298 21587 1273 1474 11927
NM_004441chr3------11301
NM_004447chr124982 893 205 106 --11090 --
NM_004449chr2131468 1193 583 41279 956 323 109 ----
NM_004457chr231590 1056 252 --1342 11170
NM_004458chrX62632 1795 1747 990 695 172 21641 66 32528 2250 2099 11070
NM_004459chr1781967 1739 1427 1416 1381 381 255 163 --21459 794 11639
NM_004464chr4163860 3704 3620 3593 3529 3380 3236 3056 2984 2731 1626 1330 1283 1245 787 268 13873 83669 3446 3325 3081 2845 2759 407 316 --
NM_004480chr144818 736 646 316 2756 724 ----
NM_004482chr23857 720 108 1607 3897 669 267 --
NM_004483chr163511 336 94 --2459 163 --
NM_004496chr1431174 945 234 11359 11254 --
NM_004499chr53515 93 83 ----2415 370
NM_004500chr1451750 724 417 259 70 11299 31454 241 228 --
NM_004501chr1103960 3862 3624 3127 2952 1606 1474 1274 1028 132 24008 3500 53066 943 717 276 81 14001
NM_004504chr2113042 3029 2851 2732 2533 2522 923 852 824 494 32 --2872 734 42470 2244 337 97
NM_004505chr1741679 1266 204 146 --11760 11859
NM_004514chr1753000 2463 2083 864 494 1668 22709 847 13102
NM_004516chr1971158 1148 1058 412 389 234 34 1804 ----
NM_004520chr51143 193 2742 610 --
NM_004523chr1051505 1353 1182 1153 432 124 11400 --
NM_004526chr3----1639 --
NM_004530chr1621015 144 ------
NM_004535chr2041420 1412 1381 93 1612 21322 1114 11194
NM_004537chr1261445 1293 1169 978 605 280 1164 31204 965 191 11576
NM_004540chr215878 686 118 108 89 --1205 --
NM_004566chr1062456 2449 2119 1947 1743 47 --22516 2184 --
NM_004571chr21103082 2760 2644 2634 2162 1309 1059 992 844 828 11159 126 --
NM_004575chr431553 1443 1289 2500 445 --11598
NM_004580chr1541398 284 172 161 21667 1509 1626 1527
NM_004582chr1------1123
NM_004583chr171721 1206 1143 --
NM_004586chrX164868 4798 4511 3977 2165 2046 1944 1871 1452 1320 1248 1221 1104 1055 526 399 11865 24328 3688 24882 3928
NM_004598chr532812 2281 2218 13344 13100 --
NM_004600chr191297 1171 1141 1101 576 471 397 247 209 11475 --11275
NM_004602chr2061450 1370 1359 1295 965 500 --11034 11503
NM_004612chr9114840 3609 2972 1543 1392 1339 1200 923 759 455 59 11679 11021 21847 298
NM_004621chr1151263 1253 1205 865 119 --1157 --
NM_004622chr242364 1910 1562 197 12195 ----
NM_004631chr121020 540 --11329 --
NM_004643chr141833 ------
NM_004645chr172210 66 1555 ----
NM_004654chrY71427 1281 987 890 289 151 60 1862 1505 --
NM_004660chrY72174 1883 821 734 612 83 60 31639 1538 446 31951 1502 274 2321 315
NM_004663chr1561550 1050 550 488 186 118 --1563 1150
NM_004666chr621483 37 --1397 --
NM_004667chr152635 473 1692 --1446
NM_004670chr1031624 1410 450 1597 ----
NM_004673chr151306 1242 1061 1043 37 41577 1222 1129 127 11140 --
NM_004681chrY1618 ----1506
NM_004685chr1372717 2137 1074 1015 749 725 335 32874 2554 102 2996 406 12383
NM_004686chr831774 1271 523 21279 1230 2601 563 --
NM_004687chr1731819 1650 1390 21372 28 ----
NM_004689chr142381 174 1338 1462 --
NM_004690chr61168 1749 1710 --
NM_004694chr174823 673 354 186 1649 ----
NM_004696chr13655 648 125 1538 1293 --
NM_004703chr1732293 709 359 --1863 --
NM_004709chrX71711 1693 1339 1187 290 247 137 1300 1253 --
NM_004718chr23678 503 77 ----1672
NM_004719chr12102777 2630 2586 2383 2374 2064 1832 733 704 688 --62483 2196 1773 1078 765 297 --
NM_004721chr31350 ------
NM_004725chr1041257 1038 975 152 11022 --1106
NM_004726chrX95731 5649 1767 1530 1468 1356 746 695 312 45047 4660 1819 1520 11995 --
NM_004727chr152513 454 --11745 --
NM_004730chr541976 1476 1349 245 ----11498
NM_004731chr1241616 1349 543 192 21315 150 1292 2274 38
NM_004734chr1363242 630 477 354 309 136 23002 452 12711 --
NM_004736chr171949 1877 1812 824 545 447 423 --31631 556 201 1196
NM_004744chr4103725 3626 3349 3207 2971 2667 1468 1021 961 447 23517 1426 11496 53977 3939 3661 1167 383
NM_004745chr8126809 6760 6610 5801 5635 5179 4347 2804 2728 1738 835 504 35549 4466 2080 46681 5449 1528 943 --
NM_004748chr15164130 4105 4054 3971 3807 3789 3751 3487 3476 2706 2681 1356 1092 755 600 175 1358 3896 538 194 23907 3414
NM_004755chr1421084 1071 21098 464 ----
NM_004760chr732485 554 479 1456 4802 658 618 130 --
NM_004768chr171174 867 849 750 731 356 168 ------
NM_004772chr521125 572 --11249 --
NM_004775chr1861869 1532 607 429 295 275 21619 571 32197 1521 649 --
NM_004781chr181444 1274 1257 641 538 104 56 50 11381 1457 --
NM_004781chr181444 1274 1257 641 538 104 56 50 11381 1457 --
NM_004788chr11102767 2292 2202 2071 2007 1937 1904 1028 578 514 12098 2636 256 --
NM_004792chr21181 ------
NM_004796chr141849 22279 1520 22043 1923 1579
NM_004804chr282761 2404 2230 2024 1750 496 261 106 21799 57 ----
NM_004808chr1083287 3225 2828 2804 1330 1039 451 262 12837 21290 254 --
NM_004815chr1124834 4416 4373 4303 3987 3721 1850 1703 1586 907 791 767 31841 1401 474 33655 554 280 --
NM_004820chr82118 76 ------
NM_004824chr62541 110 --2941 293 1180
NM_004827chr451696 1269 1263 759 254 --11940 11282
NM_004834chr283367 3261 3026 2888 2780 2229 1036 821 12201 53246 3194 1075 866 596 --
NM_004835chr32166 142 1278 131 1882
NM_004835chr32166 142 1278 131 1882
NM_004836chr28984 953 946 738 721 639 168 109 1257 ----
NM_004837chr12329 33 11675 21584 1291 --
NM_004840chrX52431 2411 2404 499 454 ------
NM_004841chr121041 470 --21136 1063 11119
NM_004849chr621597 459 21713 381 41046 564 471 413 --
NM_004857chr14114783 4505 4050 3903 3883 3863 3562 3322 3231 1380 329 14022 43660 3370 1645 1456 --
NM_004859chr1732401 2141 1235 13000 ----
NM_004863chr1454093 3602 3530 1405 1081 44632 3957 2015 1319 ----
NM_004866chr5114764 4476 4399 3919 3221 1928 1871 1711 1157 868 590 43879 3871 3815 1280 24053 1016 13621
NM_004869chr1851537 601 582 490 300 11322 11092 --
NM_004871chr1794411 4399 4317 3947 3835 3192 3110 2666 1475 14333 24353 3708 --
NM_004872chr13399 181 62 1465 --1157
NM_004873chr1473051 3037 2988 2906 390 281 67 --32948 1981 186 --
NM_004879chr112763 148 1964 ----
NM_004890chr171256 ------
NM_004893chr5----1465 --
NM_004895chr12561 482 1455 1598 --
NM_004896chr105990 967 305 251 224 31458 1343 603 21035 334 --
NM_004898chr442922 2651 2585 1019 11102 21107 346 --
NM_004904chr7156440 5768 5040 4663 4407 4047 2573 2151 2062 1662 1494 977 947 658 353 35737 4056 2382 66428 4689 2533 2526 2242 1924 25811 4535
NM_004906chr6139 ------
NM_004912chr741643 1401 1154 654 1576 41375 1177 644 511 --
NM_004926chr1481818 1619 1579 1566 1413 1298 1170 209 --21216 388 11369
NM_004932chr541645 528 191 151 --41689 1339 1307 1287 11704
NM_004938chr91993 --2337 319 --
NM_004949chr1881594 1575 1408 397 389 279 162 152 31514 1478 1361 1252 --
NM_004954chr111288 ------
NM_004956chr7144513 4378 3854 3493 3232 3047 2927 1672 1636 1269 1242 676 598 391 --43484 2785 1338 1017 --
NM_004958chr12309 164 1944 2916 98 1290
NM_004965chr21--1656 1510 1683
NM_004966chr1041019 897 210 165 1950 ----
NM_004972chr981045 1007 833 796 335 303 289 148 --1463 11128
NM_004973chr631651 260 166 --1140 --
NM_004985chr12154043 3929 3861 3618 3593 3285 3230 1701 1642 1521 1026 967 787 400 343 --84439 3720 3554 1283 706 128 99 50 1884
NM_004987chr21365 1272 1303 --
NM_004992chrX77144 5476 3371 3296 2431 2343 886 11191 27124 241 --
NM_004992chrX77144 5476 3371 3296 2431 2343 886 11191 27124 241 --
NM_004999chr694334 3461 3022 2896 1656 1517 994 329 175 33441 2789 1102 34432 4237 1122 11051
NM_005006chr251018 920 307 167 105 11104 11027 --
NM_005010chr762153 1843 1779 1734 1513 1484 --12270 11502
NM_005016chr124358 327 255 112 ------
NM_005023chr551175 574 503 341 208 --1484 --
NM_005032chrX2137 112 --1391 1934
NM_005036chr22108376 8321 7770 7201 6619 5412 5388 3188 1652 1507 25609 574 28120 7165 18185
NM_005054chr24672 643 377 359 --31333 1308 1235 11605
NM_005056chr1254815 4773 4259 1962 1205 14663 35281 3815 1866 --
NM_005058chrY2251 194 ------
NM_005063chr1083816 3381 3240 3164 3110 2670 918 403 --13806 --
NM_005065chr14135403 5338 5270 5161 4879 4388 4116 4092 1964 1923 1641 770 233 1683 12026 --
NM_005066chr14826 730 293 189 ------
NM_005068chr651439 1248 528 250 107 --41482 1254 1231 440 --
NM_005069chr2131255 1191 92 --21729 1359 --
NM_005079chr883152 3116 2879 2601 2530 980 971 638 1751 --1114
NM_005093chr2055295 5270 1264 1252 276 --11528 --
NM_005095chr181452 1388 577 500 372 242 132 102 31806 1437 325 1359 12098
NM_005097chr10134 ------
NM_005099chr1--1529 21083 938 --
NM_005104chr61568 --3777 729 665 --
NM_005109chr362542 2521 771 721 656 469 1122 11699 --
NM_005114chr4296 28 173 1457 --
NM_005116chr2044460 3298 3073 1595 --44336 3924 3410 3154 --
NM_005117chr114917 837 664 212 --1361 1109
NM_005119chr16884 498 488 380 350 215 ------
NM_005121chr17123618 3408 3175 3034 2888 2591 2495 1519 1035 871 506 143 32854 1493 1484 53355 3027 2870 1362 1180 11008
NM_005124chr63728 675 128 129 2960 120 --
NM_005126chr342291 1973 1705 274 32191 2118 876 22018 1917 --
NM_005134chr182730 225 --186 1211
NM_005141chr42271 69 --1122 --
NM_005151chr1832126 1751 1736 32042 1910 75 31864 769 658 1569
NM_005153chr161183 1536 --1631
NM_005154chr153564 525 225 1629 1634 --
NM_005156chr9135138 2134 1986 1728 1643 1610 1228 1175 1042 417 259 86 40 43971 2019 1191 821 21460 645 1749
NM_005160chr22136338 5948 5202 4744 4718 4361 2580 2129 1970 1325 952 470 278 35089 4933 1246 56261 5285 2426 2418 1023 --
NM_005166chr191229 ------
NM_005168chr251670 1369 1144 492 220 21109 560 1383 --
NM_005171chr1271180 417 325 261 245 205 95 1968 ----
NM_005180chr1051324 1096 635 235 72 130 --11173
NM_005181chr82721 629 ------
NM_005188chr11148308 7150 7098 7024 6181 5968 5417 3334 2575 2305 1639 1156 1068 94 38183 7919 7819 38269 2161 1044 --
NM_005190chr651157 1124 343 290 98 1774 2312 265 1439
NM_005194chr202581 102 ----1147
NM_005197chr14145905 5873 5247 5107 4643 4544 4336 2174 1772 1307 722 256 157 91 22259 194 35890 2335 1419 --
NM_005204chr102786 744 1305 1694 --
NM_005207chr2283743 3702 3675 3631 3057 1232 800 115 --23163 738 --
NM_005215chr18242 31 ------
NM_005222chr7--1927 ----
NM_005224chr192569 539 ------
NM_005229chrX1980 ------
NM_005230chr121107 1218 ----
NM_005233chr321854 584 --32320 1998 620 --
NM_005235chr2247860 7223 7037 6940 6271 6184 6023 5970 5908 5618 5393 5014 4746 3049 2943 2761 2468 2305 2227 1175 709 590 582 160 13075 37539 6701 2079 24927 1101
NM_005238chr11133398 3313 3213 2754 2631 1363 1277 1069 1030 586 405 227 73 --11161 --
NM_005239chr2152017 1495 795 615 531 ------
NM_005241chr331063 476 223 --1449 --
NM_005254chr1551115 1074 1034 522 325 2476 166 ----
NM_005256chr111647 2976 227 ----
NM_005257chr1831188 901 362 --11079 1527
NM_005259chr241506 1397 60 25 ------
NM_005261chr84821 794 341 324 --1366 --
NM_005264chr101260 1848 ----
NM_005271chr1031158 488 45 --1992 1393
NM_005273chr7----1321 --
NM_005277chr441746 1582 504 122 11223 1380 11500
NM_005278chrX4481 155 104 91 ----1117
NM_005279chr22805 205 --2753 248 1715
NM_005295chr71120 ----1310
NM_005296chrX21042 296 --2288 47 --
NM_005313chr1551119 871 491 390 144 11159 1278 --
NM_005318chr2221254 849 11280 159 21272 118
NM_005324chr17102152 1969 1848 1371 832 612 451 343 269 59 --22020 67 --
NM_005328chr83755 544 518 --1770 --
NM_005336chr211663 22281 1939 12216 1378
NM_005339chr4134303 4139 4064 3939 3929 3188 3118 1515 1505 1333 919 771 463 21158 806 53989 3535 1481 1118 218 13320
NM_005342chrX52589 2070 1877 954 554 12172 12346 11862
NM_005358chr1321483 1367 21311 1171 2313 121 --
NM_005359chr18126415 6193 6077 4976 4541 4262 4047 1830 1646 1434 1137 174 --115935 5751 5699 5618 4096 2245 1891 1814 1518 1201 1054 55895 5479 1969 501 486
NM_005369chrX6621 535 496 444 424 173 ------
NM_005375chr651130 969 772 79 49 ----1781
NM_005384chr9180 ------
NM_005385chr352686 2379 542 278 53 --22497 764 --
NM_005388chr951594 1425 1125 1079 187 --11725 21355 451
NM_005391chrX--1133 ----
NM_005392chr931488 1442 557 11340 11460 11748
NM_005397chr773672 3389 2922 2613 1603 1498 338 22892 270 23764 145 13213
NM_005398chr1031181 118 30 175 1288 11322
NM_005399chr184356 4123 3857 3809 3641 3143 3029 752 34436 2838 173 33825 3303 646 --
NM_005400chr252774 2274 2114 2095 22 12921 22795 607 12987
NM_005402chr781437 1331 712 604 586 553 329 50 1361 11728 --
NM_005406chr1861499 1319 1073 1046 461 354 --11521 11126
NM_005428chr191173 ------
NM_005429chr41263 ----1145
NM_005433chr1862501 2471 2414 1801 706 673 --22257 1781 --
NM_005436chr10174062 3978 3696 3285 3236 3175 3114 3049 2766 2658 2503 1376 1305 552 298 200 98 13685 44144 3482 1388 1210 --
NM_005437chr1071471 1415 1257 1134 1010 556 107 --1129 --
NM_005450chr171232 ------
NM_005455chr171716 1684 1595 1566 1507 462 387 21186 669 ----
NM_005458chr932228 1971 617 --51990 1831 1786 1528 959 --
NM_005461chr2061810 1437 676 362 282 120 --11429 1707
NM_005465chr111551 1267 41867 617 407 279 --
NM_005475chr1293269 3247 3214 2775 2765 2047 701 588 375 32834 912 516 ----
NM_005476chr921375 257 --1116 --
NM_005487chr2282117 2007 1726 1563 857 297 225 108 ----1191
NM_005497chr17145952 4122 2430 1841 1791 1619 1460 1386 1307 1091 761 661 340 68 21989 228 26071 4860 --
NM_005499chr193568 515 105 ------
NM_005502chr963211 2888 2451 2136 1076 49 11059 12411 13228
NM_005504chr12175987 5400 5361 5085 4863 4794 4690 4595 4549 2087 1818 1679 471 391 367 212 198 14265 25685 4631 --
NM_005506chr492881 2760 2738 2145 683 488 387 358 298 1190 32754 1045 265 --
NM_005509chr571908 1704 1445 1321 1172 746 131 21733 1519 1709 --
NM_005513chr321419 166 11404 51478 1287 558 416 151 --
NM_005521chr102840 785 --1279 --
NM_005525chr12412 359 1332 ----
NM_005530chr1531149 481 191 --2970 364 --
NM_005536chr871170 1103 991 448 320 286 200 ------
NM_005537chr132940 377 --3881 866 334 --
NM_005544chr2----1776 --
NM_005570chr182804 178 --2784 101 --
NM_005573chr56704 516 468 260 140 112 --2498 268 --
NM_005575chr53700 682 640 --1254 1757
NM_005578chr385051 4746 4668 4331 1383 1295 599 532 --21907 283 11677
NM_005593chr123607 581 25 1412 ----
NM_005595chr13785 283 174 ------
NM_005596chr9206334 6173 6092 6036 5930 5874 5851 5344 5312 5176 5155 4811 4511 4504 4007 3978 2571 2199 1456 148 24784 1424 34045 976 418 --
NM_005599chr141216 524 429 327 --1962 1413
NM_005603chr1881830 1781 1771 1364 1345 738 185 70 11940 11555 11515
NM_005604chr651929 1765 725 595 89 --12449 12410
NM_005607chr83805 275 115 --1955 --
NM_005610chr14765 676 224 211 188 ----
NM_005611chr1631206 273 76 ----11306
NM_005613chr141896 1881 1449 216 --31945 1593 168 11912
NM_005614chr71776 2255 197 1269 11081
NM_005618chr62504 497 1658 ----
NM_005623chr173488 450 126 ------
NM_005625chr83991 871 220 --3921 318 239 --
NM_005626chr11202 ------
NM_005637chr1822027 320 --11784 --
NM_005639chr1251803 1270 592 528 144 ------
NM_005643chr62686 198 ------
NM_005655chr851281 1012 880 350 233 --133 --
NM_005665chr1144879 4712 4638 4444 4331 3696 3532 3415 1936 1359 1298 599 348 76 23728 1194 2969 661 44692 4194 3401 907
NM_005668chr593685 3240 3198 1696 1651 1502 1371 665 514 33228 611 503 42809 1313 1250 823 1196
NM_005685chr7153 ------
NM_005694chr32104 55 ------
NM_005697chr151178 ------
NM_005700chr11------1372
NM_005708chr13--1450 1372 --
NM_005711chr53808 373 187 ------
NM_005715chr682846 2561 2373 1781 895 339 320 263 --1628 1178
NM_005717chr151210 811 297 271 110 ------
NM_005719chr121191 ------
NM_005721chr241028 943 744 103 --21070 909 --
NM_005722chr2102357 2261 2056 1865 1619 1581 1545 387 163 153 3654 495 376 12390 22079 1895
NM_005725chr1142466 2367 2338 2267 2063 1628 984 860 749 739 345 335 110 36 11937 --11815
NM_005738chr772067 1678 1519 736 574 561 117 21651 312 11643 --
NM_005739chr1562296 1869 1591 601 388 222 32211 98 83 11843 --
NM_005746chr7102692 2622 2550 2115 940 458 432 361 287 212 1749 22223 2033 21893 1062
NM_005748chr1262835 2381 2273 2154 346 113 2858 847 13005 2978 710
NM_005749chr17177 --1633 --
NM_005752chr1651040 987 448 150 43 21189 1110 185 --
NM_005754chr561234 1167 1106 237 206 59 ----1127
NM_005756chrX31452 356 294 156 11489 --
NM_005759chr274112 3845 3797 1831 1733 1491 1474 --44751 3952 3347 1822 11330
NM_005760chr2----147 --
NM_005778chr31444 ------
NM_005788chr111657 ------
NM_005795chr272932 2599 2573 1916 897 809 291 --92741 2713 2559 2503 2217 987 489 443 99 --
NM_005796chr161396 ------
NM_005797chr1171763 1680 1321 311 235 220 73 31490 1152 1112 ----
NM_005802chr92813 150 1285 ----
NM_005807chr13747 609 51 2510 474 ----
NM_005808chr353088 3063 3016 988 513 --23349 436 --
NM_005810chr123864 233 113 1983 ----
NM_005813chr2132419 2233 2016 1976 1921 1786 916 501 401 296 223 212 64 12165 32667 2301 1963 --
NM_005819chr163314 3190 2983 2393 1270 734 11206 43423 1406 1222 125 --
NM_005828chr1774747 4510 3963 3727 1662 1374 868 44885 3373 524 472 55009 4972 1639 506 477 --
NM_005832chr331477 595 575 11335 21419 25 --
NM_005836chr81337 --284 46 --
NM_005840chrX117489 6760 6256 5996 4721 1709 1347 1092 735 393 28 45984 5866 4663 2329 32338 997 761 11933
NM_005841chr451024 761 293 93 32 --139 --
NM_005842chr131685 --1592 --
NM_005843chr251698 1547 1364 557 83 11603 21854 535 --
NM_005853chr163406 34 26 --1412 --
NM_005857chr171415 561 555 416 239 191 83 ----1996
NM_005859chr541525 1163 360 192 ----1470
NM_005860chr19180 ------
NM_005862chr32297 70 1291 11048 2991 383
NM_005868chr782437 2376 1786 959 681 432 243 130 21926 773 22299 532 1665
NM_005871chr104879 341 333 233 --41081 1043 916 181 --
NM_005872chr14352 187 69 58 --1366 --
NM_005880chr162379 163 31362 1316 183 1128 --
NM_005885chr591558 1477 1436 1380 1255 1112 381 294 119 1543 11080 --
NM_005895chr1254164 3500 2858 936 243 2448 424 23025 189 14109
NM_005896chr24213 202 108 101 ------
NM_005898chr1192792 2742 2350 2037 1275 969 566 478 160 23036 1217 32246 801 344 --
NM_005899chr1741221 443 274 188 --2545 371 --
NM_005900chr471205 1091 1082 1007 760 265 253 --1995 --
NM_005901chr18238588 8375 7417 7399 7140 7120 6652 6552 6183 6020 5755 5637 5523 5315 3264 3075 2878 2339 2287 2277 1781 1560 1333 26277 1290 78262 5535 5366 2938 1731 597 545 --
NM_005902chr1594623 4028 3882 3589 3082 2933 2879 1099 330 1971 34515 4468 4063 --
NM_005903chr5155202 4640 4394 4116 4042 3794 3758 1867 1774 906 685 638 350 299 61 11887 23213 1960 23821 51
NM_005906chr651609 1354 1132 1042 567 --11467 --
NM_005907chr671424 1409 1065 434 344 325 89 21114 1075 11602 --
NM_005909chr5153839 3721 3462 3444 3370 3319 3051 1405 1390 1366 1329 1319 954 290 36 13234 33656 2949 605 --
NM_005911chr251338 1159 993 502 90 1149 3960 340 154 --
NM_005918chr7276 33 ------
NM_005923chr63652 560 457 --1193 --
NM_005930chr142806 653 1186 131 1356
NM_005933chr1122868 2266 --11110 --
NM_005935chr4124874 4146 3749 3740 3222 1195 1121 690 606 506 420 264 11400 54819 4700 3359 1522 439 --
NM_005941chr864155 1579 1228 1036 532 49 23685 1281 11160 12680
NM_005955chr1135248 4878 4745 4338 4100 4063 3741 3500 2151 1846 1678 1099 809 --35503 2009 1571 --
NM_005962chr1082331 1568 1540 1487 1469 634 273 242 21525 397 12311 --
NM_005962chr1082331 1568 1540 1487 1469 634 273 242 21525 397 12311 --
NM_005966chr281737 1726 1630 1589 816 602 398 323 11957 ----
NM_005967chr121493 ------
NM_005968chr192194 71 --1235 --
NM_005977chr134783 706 679 404 1346 3806 415 264 1664
NM_005986chr1352604 2474 1923 521 251 32196 665 593 11945 11888
NM_005994chr172657 608 1624 ----
NM_005999chr171213 1185 1105 525 366 314 234 11168 21573 344 186
NM_006002chr13295 78 1110 ----
NM_006007chr994520 4001 3549 3224 3210 912 753 459 29 31716 1362 832 34009 1584 858 --
NM_006010chr3177 ------
NM_006016chr662308 1930 747 686 493 458 --32105 1965 290 22076 363
NM_006024chr7--2611 191 --1598
NM_006036chr292515 2268 1797 1726 534 388 141 98 90 1882 2217 113 11626
NM_006037chr2104684 4069 3804 3736 3573 3491 1614 1545 478 66 31587 1118 975 24218 1879 13697
NM_006038chr2042133 1954 702 657 11779 ----
NM_006047chr20102886 2846 2611 2526 1401 942 721 679 450 117 63426 3265 3040 2857 2674 2661 22988 2736 --
NM_006054chr115561 411 283 128 117 ------
NM_006055chr293203 2590 2350 2197 1070 987 835 453 446 33225 2226 897 42872 2613 887 125 1208
NM_006078chr22--2279 192 ----
NM_006079chr65847 832 783 771 256 ------
NM_006080chr792748 2710 2645 2456 2347 2196 650 616 84 22446 1869 2954 168 --
NM_006083chr51147 1109 ----
NM_006084chr14--1357 ----
NM_006089chrX121765 1560 1235 1178 756 673 639 440 289 185 155 59 --21609 1407 --
NM_006090chr12684 93 --2630 118 --
NM_006094chr852236 1829 1586 1499 54 ------
NM_006095chr4104028 3932 3917 3853 3619 3426 3126 3013 2913 1520 44530 4486 3067 2822 33079 1251 633 11218
NM_006100chr34529 170 146 59 ------
NM_006106chr1142811 2261 831 228 42788 2521 2385 1318 62970 2921 1343 1258 1013 687 12313
NM_006113chr141776 1523 1405 1367 --1430 1781
NM_006135chr12948 561 --2539 194 --
NM_006136chr751335 1287 1209 999 860 --1357 --
NM_006141chr1682669 2561 2152 1085 1034 878 836 626 42327 1940 1927 122 --11920
NM_006148chr1722932 2639 --22982 2518 22628 725
NM_006153chr3139 1631 2667 554 --
NM_006154chr15112695 2386 2119 1075 1037 981 572 314 300 69 61 --12839 12669
NM_006155chr262036 1721 648 451 333 160 --31773 1630 149 --
NM_006158chr871669 1478 1433 1280 692 524 135 2641 543 --11751
NM_006160chr17--11568 1555 --
NM_006164chr2--2439 147 ----
NM_006166chr1262519 2444 2379 692 163 126 32404 2338 1849 12655 --
NM_006180chr951816 487 376 258 190 ------
NM_006183chr121562 ------
NM_006186chr241105 1077 1012 279 21277 1131 ----
NM_006187chr121924 --22948 2403 --
NM_006190chr23994 331 155 --1895 --
NM_006191chr122957 385 ------
NM_006194chr1451169 1076 839 516 377 2482 319 1178 21302 207
NM_006195chr961437 1318 1054 898 424 271 1102 ----
NM_006196chr2294 63 2246 122 ----
NM_006197chr852109 1985 1708 1528 894 32162 1641 736 32240 2094 804 2786 371
NM_006202chr19--1255 ----
NM_006203chr5115613 5380 4825 4553 4107 3975 1291 816 734 686 494 44125 1983 845 744 34753 1436 487 35357 3476 1931
NM_006206chr4112966 2860 2096 2083 1850 1133 1035 892 482 283 183 --12531 1825
NM_006209chr8173 --1285 --
NM_006212chr1135439 4210 4163 4105 4088 3534 1761 1617 1435 1117 985 844 98 14279 ----
NM_006223chrX198 ------
NM_006226chr2111385 1367 1341 1307 1286 1039 936 477 458 431 161 --11154 --
NM_006241chr372233 646 593 338 293 271 89 11930 32400 2358 613 --
NM_006242chr2062095 2054 1625 1470 732 339 11435 21590 124 --
NM_006243chr131003 303 112 1252 ----
NM_006246chr145491 480 382 354 217 192 ----
NM_006251chr5153340 3166 2925 2915 2868 2830 2604 2595 2412 2136 1162 850 479 432 309 33214 1177 1144 32960 2403 659 42714 2232 921 869
NM_006252chr1247578 7268 6528 6030 5884 5862 5362 5330 5308 2959 2914 2728 2678 2456 2178 2002 1654 1365 1356 1162 1142 736 608 60 35387 4789 2200 65681 5606 2743 2718 1787 1049 36389 4814 1341
NM_006255chr1441111 730 705 151 ------
NM_006256chr1102759 2749 2017 1857 1838 1806 922 744 674 90 32150 2143 605 52420 2361 2097 646 334 22455 1019
NM_006265chr851247 1191 1176 1043 389 31349 1077 1001 21538 1143 --
NM_006267chr281779 1655 1593 746 682 598 399 87 11647 41693 1514 631 560 2406 322
NM_006273chr173414 51 35 1120 ----
NM_006275chr2052283 1937 764 425 390 --52453 2133 247 230 216 --
NM_006282chr2064635 4565 1883 1585 660 351 11528 44525 3379 3201 327 24520 3746
NM_006283chr8144888 4665 4509 4463 4390 4323 3661 3564 3238 3101 1793 1342 1146 1133 24873 765 21915 407 24210 3676
NM_006298chr653056 829 459 188 155 2504 105 2490 298 22905 1135
NM_006300chr19112264 2242 2181 1855 1782 1542 907 445 388 340 332 136 --12328
NM_006306chrX84724 4643 4268 3945 3797 2190 1569 1186 14005 ----
NM_006313chr1231660 1063 144 1180 1303 --
NM_006315chr4104355 4074 3828 3497 2770 1264 572 514 479 405 1370 33870 2764 127 --
NM_006320chr4------11016
NM_006325chr122842 182 ------
NM_006328chr11----1620 --
NM_006329chr142758 265 ------
NM_006330chr841440 1139 397 246 11505 21360 1098 --
NM_006333chr23640 434 223 1531 --1603
NM_006345chr41381 --21091 894 1871
NM_006350chr55318 91 83 57 41 ------
NM_006352chr1102065 2021 1877 1840 1704 530 522 432 161 121 1185 31979 1831 299 --
NM_006353chr641310 1012 374 92 11111 11449 --
NM_006359chrX112460 2299 2110 2022 1920 1817 1657 1615 1000 655 448 1666 2895 362 --
NM_006363chr202419 144 --1247 1619
NM_006364chr1441241 841 344 253 --1457 1380
NM_006369chr11453 ------
NM_006371chr384634 4131 4006 3781 3382 2091 849 438 34278 4261 1600 1377 --
NM_006372chr64464 454 446 83 --2383 193 --
NM_006375chrX41742 1635 1439 216 --11785 21713 1626
NM_006379chr782174 2139 2123 2062 1715 417 225 63 --1933 11706
NM_006380chr1794208 4010 3610 3439 3040 2883 1436 1220 387 43218 1601 1508 444 22920 651 13087
NM_006386chr2221627 280 1957 31648 825 123 11668
NM_006390chr1241579 1361 412 393 21570 1417 --11618
NM_006393chr10154534 4434 4125 4105 3897 3275 2929 2883 1702 1539 1029 1020 744 697 412 33640 301 27 24448 1378 13722
NM_006411chr61849 ------
NM_006416chr63744 529 254 1799 ----
NM_006420chr2073364 3325 3059 2615 2577 2222 874 23487 3194 43182 2783 2650 2184 --
NM_006431chr121157 ------
NM_006434chr1043116 2980 2286 1985 13269 12739 12780
NM_006449chr251950 1755 1730 571 481 32105 504 357 ----
NM_006451chr551076 758 673 283 182 3775 169 134 31030 406 139 --
NM_006452chr4250 21 21579 727 21827 1495 2523 89
NM_006457chr483777 3347 3132 2972 2508 977 961 816 83514 2791 2712 2602 483 401 238 137 34031 1091 70 1305
NM_006459chr1031660 1630 613 --31582 1323 1243 --
NM_006460chr1771411 1276 533 518 257 160 38 1717 ----
NM_006465chr151370 ------
NM_006469chr161374 1199 1057 1024 218 119 11626 1538 --
NM_006471chr182202 88 1308 --181
NM_006472chr161002 819 470 387 343 125 2906 27 ----
NM_006475chr132457 83 --2533 270 --
NM_006479chr1251024 935 921 909 827 144 1315 1341
NM_006482chr1283923 3458 2419 1437 1195 679 634 214 23938 3901 13422 23159 136
NM_006489chr1421636 189 ------
NM_006496chr151771 1736 593 316 162 1402 21705 1619 1392
NM_006502chr61110 ------
NM_006504chr1092981 2840 2765 2155 995 277 100 66 30 1989 1252 --
NM_006520chrX121670 1655 1356 1102 1066 596 588 579 545 453 286 34 --2507 498 --
NM_006526chr2041868 1447 684 314 168 1190 --
NM_006529chr491694 1368 1240 1191 1178 678 540 384 133 31446 565 272 21611 531 21167 1066
NM_006530chr122398 344 ------
NM_006534chr2093381 3274 2539 2374 1310 1168 689 306 113 --21270 1133 12339
NM_006536chr11666 --1386 1968
NM_006537chr153235 140 83 --1166 --
NM_006538chr2194205 4109 3883 3516 3206 3188 2896 2849 2772 2728 2535 1675 1565 1544 1518 1197 498 457 354 23692 392 1377 14190
NM_006540chr841435 1419 1255 462 --11291 --
NM_006544chr14176117 6064 5709 5225 4986 4882 4484 3786 2396 2305 2115 1976 1455 1423 1117 1011 373 115786 4355 3874 2378 2073 1694 1666 1551 1395 1148 226 45075 3959 1847 499 12414
NM_006546chr17156454 6432 5977 5875 5786 5776 5728 4833 2181 2015 1841 1704 1335 1327 1214 --25178 486 --
NM_006547chr762136 2003 1847 1363 749 143 2621 207 ----
NM_006548chr32616 513 21607 571 1531 --
NM_006554chr21221 2326 83 132 --
NM_006557chr9--21631 149 ----
NM_006558chr82517 191 --166 --
NM_006561chr1076233 5864 4262 1857 1431 1238 1145 24561 3783 46254 2136 1473 38 --
NM_006565chr162965 513 --2814 66 --
NM_006572chr1773464 2964 2505 2466 1166 838 120 22854 2300 53169 2717 1300 1221 882 1448
NM_006575chr143570 548 394 --1514 --
NM_006577chr24854 404 79 21 21140 474 1187 --
NM_006583chr42457 339 ------
NM_006587chr461633 1309 1111 621 241 23 51418 1280 1190 513 218 21138 159 --
NM_006593chr22552 217 --1682 1510
NM_006595chr113671 341 280 --22074 576 21853 1795
NM_006599chr16268199 7949 7809 7769 7335 6937 6900 6752 6566 5992 5980 5779 5511 5112 5055 4990 3061 2961 2891 2779 2770 2292 1855 1286 1268 1076 37894 5313 1106 48000 7882 5631 1889 28012 2491
NM_006601chr122242 43 2381 196 1920 --
NM_006603chrX62004 1763 1333 578 569 519 159 11878 --
NM_006609chr262928 2830 2281 2239 408 177 22848 470 2693 232 --
NM_006614chr393672 3460 2916 2854 2531 1290 1066 641 75 23580 530 33078 2558 408 --
NM_006618chr161474 1442 1108 562 463 187 1327 ----
NM_006621chr171591 1545 1484 1434 734 477 115 31388 1373 287 2667 70 --
NM_006622chr52498 399 --3451 437 182 --
NM_006624chr1041988 1584 466 136 3718 263 230 2636 616 --
NM_006626chr982473 2323 1945 1800 1709 1663 568 457 31692 862 366 72032 1978 1825 1697 1080 695 468 11809
NM_006628chr15194693 4174 4140 3771 3600 1821 1787 1584 1520 1300 1285 1087 1070 1059 931 767 583 253 111 51704 1463 550 536 302 2847 341 14322
NM_006629chr18102724 2484 2286 2248 2216 2056 1850 1057 851 807 --11074 --
NM_006633chr53727 255 168 ------
NM_006636chr25989 951 776 762 85 --1939 --
NM_006644chr134565 435 234 117 2660 559 2481 197 --
NM_006646chr13103012 2839 2584 2488 2409 2241 2228 1949 1865 583 22222 1014 12915 12527
NM_006654chr12144048 3945 3844 3829 3780 3719 3124 1835 1626 1406 490 344 188 112 13929 64608 4422 4403 4219 4129 3861 --
NM_006675chr1242930 2193 948 63 --42200 621 588 507 --
NM_006682chr772322 2142 2121 1765 1062 279 266 12600 11056 --
NM_006691chr1131083 999 834 --11020 --
NM_006693chr72844 660 --1600 --
NM_006699chr1102708 2481 2398 1762 1746 1062 1034 916 567 162 2955 903 21704 651 --
NM_006703chr62524 420 --1371 --
NM_006704chr134450 365 347 78 ------
NM_006706chr54787 615 282 56 ----1807
NM_006716chr75945 261 145 98 55 1355 11220 --
NM_006717chr962465 2312 2107 1126 1076 602 22136 747 33355 2144 525 23271 3265
NM_006718chr641111 857 839 402 --1949 2761 338
NM_006721chr105808 678 570 266 129 ------
NM_006722chr392983 2307 1100 1068 973 352 159 110 65 1261 42697 515 266 92 11989
NM_006726chr441067 504 412 87 11241 1161 --
NM_006727chr53355 132 109 1378 ----
NM_006729chrX115624 5292 5258 5136 4410 4371 3945 2084 1804 1339 1291 41357 1093 723 564 14111 23823 1838
NM_006731chr9145841 4983 4728 4276 4081 2191 1657 1579 1551 1027 952 499 274 174 2925 688 1971 13909
NM_006734chr64450 340 293 21 ------
NM_006738chr1554565 4025 3866 1504 1412 11765 13149 --
NM_006745chr441076 1064 974 158 1995 1413 1722
NM_006746chrX41419 1196 1104 588 --11245 --
NM_006750chr16128054 7517 6887 6047 5727 2911 2255 1956 1903 1460 622 442 47959 6483 882 766 67066 7006 6113 4946 2113 1358 17949
NM_006751chr24887 794 735 681 --1908 1187
NM_006754chr71128 --1256 --
NM_006755chr111138 ------
NM_006756chr84613 519 123 100 --41016 991 509 305 41076 443 198 60
NM_006763chr151650 811 787 667 605 --11808 --
NM_006766chr862543 2351 2324 2252 1678 123 --42300 1754 1704 727 --
NM_006769chr11684 ------
NM_006773chr251366 647 524 123 49 186 31558 1530 32 1266
NM_006775chr683101 3009 2877 2832 2583 2472 2448 187 --32608 2498 2150 --
NM_006777chrX102784 2523 2457 867 859 652 392 351 160 94 1940 1146 22885 2603
NM_006788chr1831542 1356 267 --21613 255 --
NM_006791chr151650 ------
NM_006805chr561721 1679 1666 1648 1317 312 1601 ----
NM_006813chr62728 625 2610 296 136 --
NM_006823chr841189 912 901 177 ------
NM_006826chr25447 397 389 224 144 1831 ----
NM_006827chr14123391 3003 2795 2479 2296 2228 645 572 499 416 198 112 13174 32650 840 465 --
NM_006832chr1431097 875 396 1740 --151
NM_006838chr12131844 1656 1647 1304 1205 1171 720 552 268 197 188 72 43 21620 631 ----
NM_006851chr1272910 2724 1075 684 657 494 220 1960 1459 --
NM_006852chr17102828 2463 2122 1160 1106 880 687 570 563 497 --12403 --
NM_006857chr25881 834 321 154 77 --1806 --
NM_006868chr1872954 2904 2839 2812 2628 1064 626 --42716 1272 689 477 --
NM_006873chr231126 791 93 22955 1161 1440 --
NM_006884chr331803 1785 1750 1504 11529 --
NM_006885chr1694166 4133 3837 3569 2834 1260 1036 790 611 --74056 2857 1301 944 819 686 662 23322 2732
NM_006888chr1482996 2825 2230 1403 1397 890 749 680 --11140 --
NM_006892chr2011314 1262 21389 426 --
NM_006892chr2011314 1262 21389 426 --
NM_006902chr1123224 2989 2968 2732 2593 2169 2150 2139 2077 2048 640 575 --12114 --
NM_006908chr761502 1416 951 404 370 125 11147 1143 1180
NM_006910chr165413 296 282 53 25 1159 ----
NM_006912chr172573 2320 2290 2258 2197 1801 365 12282 22522 2459 --
NM_006913chr61365 --1371 --
NM_006914chr931377 1024 371 1299 --1259
NM_006915chrX102539 2464 2253 2213 2165 1015 562 346 339 111 --62527 2386 1876 1595 848 797 12430
NM_006918chr11115725 5460 5279 4670 4555 4153 4130 1668 1559 493 483 44716 1521 292 198 55768 5401 5144 2347 892 --
NM_006920chr221793 1301 31716 1647 1411 11867 11629
NM_006922chr292247 2209 2200 1852 1790 1709 749 524 342 22136 719 32474 2288 597 --
NM_006924chr17104260 4253 4134 3963 3380 2869 2838 2788 1124 746 22955 1035 13345 13249
NM_006930chr551832 1689 1466 464 246 1428 31472 1363 545 --
NM_006931chr1262016 1520 821 462 285 276 1187 2610 504 1519
NM_006937chr17--2465 425 1472 --
NM_006939chr1461034 942 812 334 138 60 1999 21209 912 --
NM_006940chr1261817 1632 1378 633 419 298 2682 321 185 --
NM_006948chr2132364 2312 422 32224 1745 139 12264 --
NM_006965chr182470 235 1204 ----
NM_006977chr14121 ------
NM_006981chr9102577 2534 2334 2145 1093 1062 778 614 509 136 --22263 1068 --
NM_006996chr141851 1582 218 112 --31316 1260 230 1586
NM_007006chr16113438 3377 3184 3149 3016 2958 2587 1185 828 267 253 2981 972 12869 12818
NM_007007chr12204842 4702 4652 4604 4550 4489 4402 4049 3701 3412 3101 3017 2941 1927 1769 1361 1334 1061 915 712 24528 256 2720 246 14300
NM_007008chr2----1770 --
NM_007010chr1741466 1255 636 460 --31449 1226 329 2622 40
NM_007011chr15116735 5961 5835 4756 4692 2760 2106 2075 1853 1344 739 14776 46881 1886 1248 698 11220
NM_007013chr84907 641 226 103 1246 ----
NM_007017chr52753 685 ----1268
NM_007023chr21210 1408 21006 874 --
NM_007033chr12685 107 ------
NM_007034chr15880 846 672 323 244 --21043 821 1695
NM_007038chr21205887 5801 5576 5406 5265 5255 5167 5005 4326 3967 1868 1834 1554 1239 1231 1101 921 767 650 372 14134 55391 4900 4857 4652 1848 26067 2075
NM_007039chr1452305 2207 2009 1911 437 11854 2481 375 12299
NM_007042chr372432 2201 1725 1046 496 333 133 --1459 --
NM_007043chr1242160 2128 1626 89 21616 1319 11305 --
NM_007049chr62983 925 11076 ----
NM_007054chr5113821 3809 3203 3083 2980 1131 853 578 155 142 93 11569 32870 2806 647 --
NM_007064chr32577 438 31652 377 292 1551 --
NM_007067chr1731255 1215 994 ----11413
NM_007073chr653551 1624 988 286 189 34109 4020 467 2732 569 1402
NM_007078chr1052858 2841 2443 2211 300 --22922 2905 2858 138
NM_007084chr1331490 1098 585 31436 1077 1002 31329 1041 339 --
NM_007106chr13102833 2780 2600 2571 1814 1734 1088 888 869 317 1839 2971 667 --
NM_007107chr392395 2371 2189 2149 2029 1568 927 728 277 --2845 521 --
NM_007112chr1--135 ----
NM_007114chr3133191 3163 2987 2927 2902 2319 967 850 637 609 416 356 126 43228 2328 522 194 31049 988 532 --
NM_007118chr52302 61 --1277 --
NM_007123chr14907 834 412 72 --1119 --
NM_007124chr631674 1299 489 --21800 1432 22031 655
NM_007125chrY41433 1275 419 343 --21299 519 --
NM_007137chrX115333 5220 5200 5145 4968 4867 4402 4023 3893 3583 2007 15324 34527 813 793 1652
NM_007146chr1772366 1773 1135 619 606 544 183 1418 31918 712 58 --
NM_007150chrX72084 2039 1361 723 465 219 209 ------
NM_007156chrX2219 53 --137 --
NM_007157chrX82667 2125 2068 1901 911 485 219 53 12115 ----
NM_007159chr3111633 1493 1379 1274 1082 684 674 650 611 226 214 --1238 21771 193
NM_007166chr1121511 975 1566 1486 --
NM_007167chr13824 787 75 --1122 --
NM_007172chr2292395 2337 2057 988 915 773 233 121 113 ----11001
NM_007173chr1171973 1806 1711 1578 951 506 315 1724 ----
NM_007175chr872796 2660 2368 2332 1371 1015 216 12960 22886 2577 23103 271
NM_007187chr1341014 927 884 252 ------
NM_007191chr123611 260 122 1115 1465 --
NM_007192chr1421143 967 157 1921 11061
NM_007197chr122294 255 ------
NM_007200chr1554565 4025 3866 1504 1412 11765 13149 --
NM_007203chr973777 3378 3209 2593 2556 1540 219 13753 23132 2906 1717
NM_007207chr1----2235 173 --
NM_007212chr1102241 2119 2039 1809 1772 1602 1489 303 111 32 --3915 635 408 --
NM_007214chr65885 849 513 357 46 1373 ----
NM_007217chr31324 167 ----
NM_007218chr82876 610 1916 2349 275 --
NM_007222chr861726 1503 1348 1245 426 303 2440 250 31780 1460 1182 21620 1370
NM_007235chr122367 50 1543 2421 156 --
NM_007236chr1551997 947 816 638 554 11791 22102 1640 --
NM_007246chr44966 920 738 220 1368 21067 820 --
NM_007249chr13269287 9099 8968 8446 8384 7978 7893 7753 7545 7196 7026 6768 6463 3614 3354 3308 1972 1848 1715 1706 1648 1065 1039 1026 893 291 48024 7231 6122 433 13172 38777 6695 3658
NM_007257chr882854 2562 2403 2332 761 650 297 55 22013 1174 22682 1823 --
NM_007266chr23636 623 44 --1107 1645
NM_007269chr13241 176 80 1561 1570 --
NM_007270chr751464 622 404 394 293 ------
NM_007279chr191413 ------
NM_007281chr4----1183 --
NM_007282chr35852 285 145 98 58 1652 1664 --
NM_007283chr332712 2296 135 --1566 1765
NM_007285chr161451 ------
NM_007287chr363192 2164 995 672 240 106 32986 2419 929 33078 2261 748 11164
NM_007288chr363192 2164 995 672 240 106 32986 2419 929 33078 2261 748 11164
NM_007289chr363192 2164 995 672 240 106 32986 2419 929 33078 2261 748 11164
NM_007292chr1794632 4265 4146 1112 1072 665 411 246 59 12060 63675 3516 3365 1159 743 285 --
NM_007294chr171477 --21195 233 --
NM_007295chr171477 --21195 233 --
NM_007296chr171477 --21195 233 --
NM_007297chr171477 --21195 233 --
NM_007298chr171477 --21195 233 --
NM_007299chr171477 --21195 233 --
NM_007300chr171477 --21195 233 --
NM_007302chr171477 --21195 233 --
NM_007303chr171477 --21195 233 --
NM_007304chr171477 --21195 233 --
NM_007305chr171477 --21195 233 --
NM_007308chr4--2700 492 ----
NM_007325chrX52114 1985 1604 754 724 --1767 --
NM_007331chr462555 2493 2374 793 780 672 32770 1770 654 ----
NM_007332chr851225 1023 518 232 45 1637 160 --
NM_007345chr1862071 1866 1632 1521 857 411 11860 31819 1785 890 12202
NM_007347chr1542628 2573 615 344 23119 1169 22392 778 1314
NM_007349chr7--1183 ----
NM_007350chr12124552 4124 3768 3469 3316 3187 3097 983 970 913 262 219 33955 3842 390 54186 3609 2819 1729 1090 23678 290
NM_007353chr782972 2875 2748 1956 1934 1018 470 455 --12780 12515
NM_007358chr151868 1669 662 495 298 11596 1217 --
NM_007361chr142645 151 2638 238 ----
NM_007372chr175838 750 713 324 161 --3853 844 41 --
NM_007373chr1061810 442 432 364 352 160 1469 1674 --
NM_007375chr1102824 2801 2566 2446 1010 890 776 388 99 49 1184 12392 11983
NM_009585chr32166 142 1278 131 1882
NM_009585chr32166 142 1278 131 1882
NM_012069chrX42732 2315 1721 222 12445 21987 822 --
NM_012081chr572845 2661 2483 1434 1223 582 93 23142 963 53769 3122 3012 1494 238 --
NM_012082chr86939 694 640 374 201 145 1257 1329 --
NM_012084chrX2477 45 1523 --1382
NM_012089chr121596 1124 31548 340 34 1201 1442
NM_012092chr251693 1659 614 230 99 1589 --11510
NM_012093chr121177 798 --1854 --
NM_012095chr1052716 1309 691 505 196 23322 171 13327 --
NM_012096chr392680 2583 1396 1137 1083 504 301 280 161 33627 1422 106 33083 2810 1267 11431
NM_012097chr252310 1914 1755 1576 111 3315 306 52 --12108
NM_012102chr122605 62 --32639 2239 449 21896 549
NM_012104chr1153781 3692 3222 1043 870 --23450 3397 --
NM_012104chr1153781 3692 3222 1043 870 --23450 3397 --
NM_012111chr141215 ------
NM_012115chr63565 430 154 ------
NM_012120chr6152842 2740 2670 2337 2224 2159 1832 1069 1038 995 827 815 678 668 68 22731 1130 1959 12949
NM_012129chr781924 1890 1750 1544 849 468 197 188 1222 42081 1908 651 546 --
NM_012137chr11883 --22739 2011 --
NM_012141chr1383734 3549 3255 2854 1575 822 347 224 1597 84179 4025 3041 3029 1371 1082 768 379 11433
NM_012158chr1371821 1682 1280 1155 673 220 29 --31500 1396 662 --
NM_012160chr61517 --2363 52 --
NM_012164chr9177192 7052 6671 6606 6188 5753 5438 5382 4596 2739 2595 2165 1160 1141 444 379 225 --87034 6457 5607 2372 2191 1570 1188 30 --
NM_012175chr114956 642 608 581 1842 ----
NM_012176chr5----1244 --
NM_012177chr63617 454 63 194 ----
NM_012180chr45622 550 509 195 163 --2205 185 --
NM_012183chr14622 609 508 421 --1237 --
NM_012193chr11195395 5250 5147 5025 4951 4786 4606 4536 3886 3550 1714 1465 1203 1141 992 868 772 552 191 --35432 1021 389 11085
NM_012197chr931234 1222 83 11559 11228 --
NM_012199chr1114441 4135 3633 1755 1679 1635 1597 1274 953 935 40 --1726 --
NM_012207chr104207 194 71 55 193 1418 31001 867 334
NM_012214chr2125271 5232 2406 2065 1984 1940 1657 845 796 451 244 201 25736 5199 55281 5062 4902 2290 1861 11027
NM_012215chr1041481 1211 722 516 --11362 --
NM_012223chr241194 1116 1050 148 ------
NM_012224chr471222 1091 784 758 746 285 124 --1323 --
NM_012228chr104399 300 143 75 21119 993 1978 --
NM_012233chr22887 454 ----11155
NM_012234chr3123408 3307 3294 2953 2724 2662 1403 1253 936 375 301 131 --23343 2669 --
NM_012238chr1071714 1661 1235 1188 1144 480 162 151 61783 542 313 263 200 156 --
NM_012242chr103303 246 156 ----1743
NM_012243chr15917 878 849 836 336 2724 650 ----
NM_012245chr142423 397 ------
NM_012247chr10----21057 811 --
NM_012249chr2103497 3386 3165 2883 2724 2477 1233 924 797 785 12864 22292 845 12997
NM_012250chr1151380 1197 1039 523 418 --2355 348 --
NM_012252chr7215302 4876 4781 4693 4640 4484 4283 4183 4023 3921 3568 3538 2041 1970 1846 1834 1515 955 595 572 406 75008 4428 3869 1621 1493 898 496 24472 2129 55180 5131 3373 2158 2010
NM_012257chr731038 830 755 --1866 --
NM_012259chr631053 901 225 ------
NM_012262chr1124801 4419 3999 3988 3918 3557 3424 3272 1676 1156 1130 1123 23943 1033 74843 4210 4181 4128 3296 2022 571 11085
NM_012281chr762362 2216 1635 748 569 375 --51906 1518 872 716 228 12187
NM_012287chr3164534 4088 3787 3107 3093 3058 3024 2796 2788 1793 1679 1534 1399 1225 439 71 21656 852 44246 4128 505 98 33942 3380 1098
NM_012290chr251646 1381 1212 593 294 --1220 --
NM_012297chr422138 197 --2935 67 --
NM_012300chr5122397 2298 2153 1835 1017 749 613 548 512 418 359 209 12218 32441 2176 1935 --
NM_012301chr741808 772 628 77 2823 354 22175 1588 21878 292
NM_012302chr161270 1119 1021 301 182 161 ------
NM_012309chr11104661 4565 4220 3359 3221 3126 1803 686 576 325 34670 3331 3072 23179 696 --
NM_012311chr102232 154 1417 1201 --
NM_012322chr72382 63 ------
NM_012327chr1871590 1467 1298 1269 1185 1090 444 --11073 --
NM_012328chr771435 1391 1251 1243 1207 422 69 21358 326 21275 235 --
NM_012329chr1771388 671 646 560 502 272 164 1486 11614 2287 111
NM_012330chr1051589 1477 728 560 367 --11396 --
NM_012334chr594518 3733 3556 3475 1880 1244 1011 554 304 2224 197 13287 --
NM_012338chr741143 878 486 55 --3789 430 253 --
NM_012343chr53741 461 453 1184 11112 --
NM_012347chr682998 2895 2446 2439 2387 2239 1082 694 22965 613 32529 2260 2225 12952
NM_012382chr594293 4078 2881 2762 1646 1383 1044 353 321 53780 3093 1126 973 855 54355 4060 1708 931 613 23861 1277
NM_012388chr1562444 626 375 323 316 208 12631 22242 523 22342 219
NM_012395chr763363 2993 2613 530 500 248 --3813 782 588 --
NM_012397chr1851803 1726 1651 1618 684 --51684 1457 1235 710 338 --
NM_012399chr2241339 1281 577 526 --11775 11288
NM_012412chr73849 276 83 1329 ----
NM_012414chr13316 292 145 3833 821 86 --1280
NM_012416chr941167 1114 987 890 --1959 --
NM_012417chr173536 436 143 1547 ----
NM_012419chr61478 --1534 --
NM_012420chr1092111 1893 1772 1476 1469 619 558 421 252 1607 21556 461 1767
NM_012426chr16----1332 --
NM_012428chr152785 61 --1794 --
NM_012434chr621326 467 1432 11404 11642
NM_012454chr61164 ------
NM_012460chr142350 23 ----1307
NM_012463chr1261738 1341 1334 296 60 26 1345 31548 1496 659 --
NM_012464chr452359 2000 1824 1113 267 12379 32889 2732 436 --
NM_012465chr1073123 2940 2556 1199 1040 454 36 13311 53190 1308 1079 852 789 43382 2729 1281 1180
NM_012471chrX51930 1573 1543 749 48 --11604 --
NM_012479chr792501 2358 2334 2280 2265 2034 1935 1829 277 --22364 1748 --
NM_012484chr52538 497 ----1104
NM_013229chr1262830 2777 1954 81 39 30 11781 52720 1724 1037 737 163 22249 2192
NM_013231chr1483974 3689 3568 1625 1349 1103 1007 136 11416 31390 1295 1079 --
NM_013233chr231392 1042 374 1546 1171 --
NM_013243chr1551462 1152 1089 86 55 --2484 159 --
NM_013248chr202285 227 ------
NM_013254chr123544 468 165 1726 --1190
NM_013255chr7228757 8707 8566 8439 8200 7830 7415 7121 6918 6372 6244 5642 5569 2424 2165 2142 2110 1176 1159 1105 971 573 36607 6252 857 58743 6506 5717 1988 742 22048 1366
NM_013257chr832377 1712 936 22185 1904 12125 1565
NM_013261chr4113327 3262 3169 2960 2868 2746 2613 1514 1193 674 259 12761 12340 --
NM_013264chr11----173 --
NM_013269chr1274199 3389 3237 1457 1389 744 232 --24450 3732 --
NM_013281chr20111416 1365 1347 1195 1148 1023 340 318 247 154 139 21553 941 --1479
NM_013282chr1951277 1020 983 936 90 --11119 11129
NM_013283chr51302 --2872 195 --
NM_013293chr74770 677 266 114 ------
NM_013301chr191382 ------
NM_013302chr1653785 3034 1474 1334 1117 2674 128 44310 3996 1874 455 --
NM_013309chr1572631 2544 2422 1892 394 289 183 11069 1194 --
NM_013316chr74922 685 196 125 --1666 --
NM_013322chr751504 1431 1393 1185 274 ------
NM_013336chr32168 94 1216 1279 --
NM_013341chr292627 2593 1902 1050 914 740 634 250 206 2924 509 ----
NM_013354chr831458 351 218 41237 938 514 291 ----
NM_013357chr83844 619 611 --2832 744 --
NM_013367chr4--1108 ----
NM_013371chr11252 ------
NM_013372chr1563316 2698 2413 2291 2192 1107 23003 2569 43356 2819 832 325 --
NM_013373chr22------11033
NM_013374chr372693 2676 2263 961 799 412 129 12640 42749 2352 1012 529 1461
NM_013377chr121123 --1151 --
NM_013380chr194546 307 63 26 1177 1661 --
NM_013381chr1282302 1893 1818 1725 929 868 521 128 21760 1684 ----
NM_013386chr161614 1289 1257 1133 149 38 --31602 655 60 --
NM_013390chr971663 1379 685 604 426 58 49 ----11460
NM_013400chr711000 ------
NM_013417chr92412 169 ------
NM_013423chrX31167 1009 404 --21243 836 21059 518
NM_013427chrX31167 1009 404 --21243 836 21059 518
NM_013433chr1932036 1827 723 --21820 1631 --
NM_013436chr22762 636 --1625 1228
NM_013437chr82551 408 11290 1968 167
NM_013438chr941773 383 332 32 159 41815 462 411 237 --
NM_013444chrX31123 746 467 --11051 --
NM_013448chr142645 556 2707 134 1741 --
NM_013449chr1252457 2032 2002 1943 1824 --22490 263 21889 1832
NM_013450chr231276 254 221 --1105 2945 424
NM_013937chr64838 776 372 155 11071 2163 83 --
NM_013943chr1153209 3026 2847 2694 2582 1231 1101 1012 917 563 450 340 280 262 239 2817 384 12735 --
NM_013975chr171549 ------
NM_013989chr1475144 3828 3779 3246 1958 1640 655 --13256 34251 3891 3731
NM_013995chrX72327 2088 1629 990 643 483 334 12190 22069 175 --
NM_014005chr5102861 2768 2204 1208 983 729 651 540 35 25 32814 404 95 32025 1200 923 --
NM_014011chr2102465 2452 2342 1988 1601 991 930 701 502 448 21934 657 1681 --
NM_014016chr341471 542 453 210 ----1611
NM_014021chr142407 581 185 97 21229 1048 4993 982 783 338 --
NM_014023chr1082831 2075 1964 938 780 737 678 520 ------
NM_014028chr6112832 2402 1306 1225 787 683 562 428 396 199 145 --43336 2990 2500 633 --
NM_014031chr5121 1347 2327 136 --
NM_014033chr125930 922 872 840 299 22264 1830 1603 --
NM_014034chr661383 1267 1244 1141 525 434 1513 21038 190 --
NM_014039chr1151392 1181 1098 1019 57 21350 393 21282 377 --
NM_014043chr341613 1582 1310 248 --1534 --
NM_014048chr1685292 4546 4344 4100 3967 3728 1282 551 34473 4448 1605 44757 4071 3454 930 12128
NM_014056chr3122249 2062 1974 1736 856 816 597 474 405 281 225 96 --31809 753 665 11989
NM_014057chr971529 1065 579 531 493 416 348 11561 ----
NM_014071chr20160 --273 44 2411 106
NM_014089chr1382185 2067 1892 1625 1383 833 213 141 --11671 --
NM_014106chr15102983 2875 2809 2273 1193 1171 1089 967 904 300 22659 2184 3735 489 455 22096 193
NM_014109chr851249 929 324 205 139 21264 791 --2814 350
NM_014110chr14979 858 395 86 --21077 1035 --
NM_014112chr8125377 5237 5185 4306 3548 1436 1347 1176 1036 1027 953 61 14061 24679 1849 24656 1340
NM_014117chr1662580 2237 2153 2061 1990 829 22165 634 12437 --
NM_014154chr361566 1482 1277 1063 596 466 ------
NM_014155chr11247408 7328 6993 6926 6740 6514 6500 6486 6291 5992 5771 5487 5317 5299 2213 2024 1919 1800 1412 846 811 754 525 344 22796 2425 57008 5821 4997 2111 350 25310 2490
NM_014160chr381366 1035 902 536 480 463 103 47 --11168 --
NM_014171chr22757 56 2635 212 ----
NM_014181chr2112945 2924 2629 2578 1909 1055 1040 972 948 597 520 11821 21091 448 --
NM_014182chr12----1777 --
NM_014183chr20136 ------
NM_014216chr14----1124 --
NM_014217chr161767 1574 1361 1239 466 414 11814 41550 1281 358 337 11424
NM_014220chr35814 624 252 84 51 ------
NM_014240chr353603 3563 3249 899 829 14125 33625 3428 1126 --
NM_014243chr451860 1776 1531 778 390 --2612 317 --
NM_014245chr351014 441 355 309 207 --2870 700 --
NM_014250chr2282117 2007 1726 1563 857 297 225 108 ----1191
NM_014253chrX42336 2153 907 741 --1788 --
NM_014264chr43603 577 78 2633 119 4645 216 53 41 --
NM_014267chr112659 614 --2753 98 --
NM_014268chr1851397 1137 948 530 363 ----11370
NM_014283chr161497 1293 1216 594 273 31 --3440 411 332 --
NM_014294chr851479 1416 479 346 194 2490 443 21004 469 1932
NM_014309chr2294868 4519 3659 3543 3386 3312 2076 1202 301 --35310 5224 1469 --
NM_014313chr141127 260 219 197 21564 246 21450 234 --
NM_014317chr10156 ------
NM_014319chr1251351 653 515 386 361 21566 1256 --1261
NM_014322chr141277 990 403 57 ------
NM_014323chr222850 826 1903 ----
NM_014325chr12102080 2073 1877 1483 788 498 268 258 231 216 1311 1437 --
NM_014329chr162293 268 ------
NM_014331chr4297729 7712 7686 7432 7081 7057 6950 6823 6792 6393 6337 5712 5678 5654 5360 5037 4905 2740 2280 2270 2003 1996 1972 1790 1216 1022 835 157 95 36071 5294 2395 76362 5992 5839 5428 2921 2653 1861 25729 4978
NM_014332chrX1395 172 ----
NM_014333chr1121029 916 12051 21762 227 12306
NM_014335chr1541201 1185 939 50 1916 1259 --
NM_014342chr111173 11411 1366 --
NM_014344chr112724 132 1818 ----
NM_014345chr61962 --1253 11046
NM_014350chr55758 464 425 301 83 1115 11094 --
NM_014363chr1321175 818 ----3929 508 340
NM_014368chr911713 ----1522
NM_014372chr172081 1923 1884 1746 1369 666 22 1829 22087 368 --
NM_014374chr711000 ------
NM_014382chr351730 1616 632 184 95 2235 148 21637 1396 --
NM_014395chr452001 1502 1353 691 435 --2781 503 --
NM_014397chr951224 1171 1119 552 466 ------
NM_014399chr73926 753 296 --158 --
NM_014409chr121096 883 ------
NM_014415chr331263 1178 538 11506 31498 1186 671 11538
NM_014417chr192901 86 --1923 --
NM_014421chr492134 2096 2058 1997 1633 1480 1386 498 431 1688 22089 308 11627
NM_014423chr5194996 4669 4653 4557 4397 4161 3937 3592 3489 2185 2135 2121 1987 1837 1806 1607 1244 778 741 54796 4026 558 437 302 44502 3801 3735 316 --
NM_014445chr342435 1691 706 381 22224 42 1117 --
NM_014447chr451660 1429 1171 600 536 1129 3354 218 134 1590
NM_014452chr641208 915 410 356 --2378 62 --
NM_014454chr621095 366 2390 374 1981 --
NM_014456chr1041818 716 481 154 2697 373 ----
NM_014458chr171306 1202 1156 1139 212 64 50 21450 97 21412 172 --
NM_014461chr3--1172 ----
NM_014469chr111306 ------
NM_014489chr112881 846 ------
NM_014491chr74898 784 413 85 ------
NM_014494chr1692415 2217 2123 1973 1901 1839 661 564 386 11467 22252 1639 --
NM_014495chr15547 513 458 224 29 1245 --1667
NM_014497chr2177 --185 --
NM_014504chr72761 233 1744 51918 1790 1549 646 503 1398
NM_014506chr981577 1505 1404 1252 656 479 396 116 11041 ----
NM_014515chr125864 700 379 239 206 ------
NM_014517chr361909 1492 1329 1318 718 680 --21625 1441 --
NM_014521chr211662 21875 1818 2304 217 11257
NM_014547chr155737 649 302 109 76 1213 ----
NM_014547chr155737 649 302 109 76 1213 ----
NM_014548chr1541564 1445 1335 127 --1406 --
NM_014552chr21572 41554 610 301 267 11465 11305
NM_014554chr1262291 2026 629 526 486 200 11469 11750 --
NM_014562chr22737 114 1801 ----
NM_014563chrX52091 2049 1863 1379 97 --42124 2069 748 416 --
NM_014572chr1321825 1216 --21474 316 --
NM_014573chr1751854 1575 1272 1143 338 ------
NM_014574chr1441441 1370 1159 536 --1431 11292
NM_014575chr31157 --1168 --
NM_014577chr226806 778 768 730 283 78 --2301 269 --
NM_014583chr31479 1466 ----
NM_014584chr1421197 423 1231 11383 --
NM_014585chr23465 405 175 ------
NM_014586chr21104878 4753 4501 4484 4145 4114 3448 1803 1763 1416 --23074 736 14773
NM_014587chr1611316 --21548 617 --
NM_014588chr205717 500 262 243 230 --1519 --
NM_014602chr3--125 195 --
NM_014606chr451575 1094 1074 391 116 21161 325 --11314
NM_014607chr291962 1699 1673 1534 717 692 511 441 385 --42099 1935 1789 1409 --
NM_014608chr151150 --1378 1138
NM_014612chr961218 978 437 358 333 121 --1371 --
NM_014613chr563063 3033 2379 1883 1213 883 --1521 --
NM_014614chr221176 1014 ------
NM_014615chr1663625 3345 2917 1374 750 537 --23313 646 --
NM_014616chr3153516 3381 3322 3261 2734 2439 2308 1320 1134 805 503 467 370 189 96 12156 23477 3162 --
NM_014620chr121656 1767 ----
NM_014629chr851347 1260 454 237 48 1506 --11254
NM_014630chr1533209 3198 1197 11290 11297 --
NM_014633chr113115 100 41 ------
NM_014635chr261270 1197 636 607 341 323 --21656 1276 11583
NM_014636chr974175 3709 3450 3215 3189 2862 25 13227 32727 1311 1291 --
NM_014637chr831448 342 190 ------
NM_014647chr1681631 1616 682 643 575 271 167 117 22292 1751 ----
NM_014660chr751128 1120 821 715 245 1991 --1841
NM_014666chr531277 298 36 11300 --1349
NM_014667chr351864 1725 1580 645 52 1518 11891 --
NM_014670chr261626 1607 1450 1286 372 286 1132 21532 553 --
NM_014671chr751459 1334 1326 316 210 ------
NM_014673chr8165 --1108 --
NM_014674chr383461 3337 2941 2800 2781 2690 381 211 33442 1614 306 34017 3044 1064 --
NM_014676chr181697 1558 1483 1362 1205 1139 1121 333 1368 --1184
NM_014677chr861288 1233 1191 1048 997 547 --11319 11183
NM_014678chr22193 ----1105
NM_014679chr1161275 1179 987 909 553 352 124 ----
NM_014682chr8102242 2054 2043 2033 1990 1948 1853 1668 392 310 --11511 1134
NM_014683chr1771422 726 635 602 533 497 100 --31998 1384 828 11327
NM_014689chr24140 131 84 38 --1175 --
NM_014700chr1611369 ------
NM_014701chr15123414 3381 3336 3220 3181 2704 2367 2351 1049 505 385 157 --52710 2144 1343 163 135 11300
NM_014702chr683237 3187 2576 1350 1283 927 605 190 22165 900 42810 2354 381 117 --
NM_014705chr772007 1927 1750 1631 1339 756 94 --21763 1719 21624 1472
NM_014707chr742202 1968 1717 671 --21795 408 --
NM_014711chr1692122 1953 1904 1667 1508 1410 1339 1312 486 21418 50 11532 21870 445
NM_014720chr1061623 1592 1503 1494 726 371 11568 41431 611 426 237 --
NM_014721chr6177376 6136 6043 5794 5534 5502 4975 2341 2201 2170 1923 1844 1826 1529 1371 716 111 36247 332 272 27066 6058 --
NM_014725chrX----11093 --
NM_014729chr852216 2161 852 627 374 --32167 1966 1654 --
NM_014730chr12105035 4154 3876 3375 1827 1586 1559 1101 703 610 24135 3357 22021 1655 --
NM_014730chr12105035 4154 3876 3375 1827 1586 1559 1101 703 610 24135 3357 22021 1655 --
NM_014732chr1655174 3975 2207 2177 2043 14067 25895 3788 --
NM_014733chr5121994 1939 1831 1685 1531 753 679 572 501 222 123 38 11840 11845 1212
NM_014735chrX41725 670 557 278 --12059 --
NM_014739chr6144033 3891 3691 3617 3404 3305 3142 1360 1306 578 450 245 236 131 33506 2761 103 23222 1174 --
NM_014746chr264314 2988 1507 593 329 282 --44413 3278 1261 657 --
NM_014751chr891879 1658 758 684 432 405 214 196 56 1306 1282 1355
NM_014752chr1181907 1656 666 535 519 443 279 236 2349 133 2512 318 --
NM_014755chr283732 3474 3311 3022 1510 1296 901 459 31159 1141 118 21588 1121 11617
NM_014757chr532083 583 462 22127 412 22266 2020 --
NM_014758chr1152321 1650 976 806 561 12301 --11610
NM_014761chr1651093 1018 952 913 36 ------
NM_014764chr1271262 1252 1143 1038 346 271 139 ------
NM_014765chr172266 2001 991 891 874 776 203 ----12552
NM_014774chr1113270 3234 3222 3185 2709 2427 2411 2389 2002 525 130 23070 987 11011 --
NM_014776chr1282934 1099 966 510 355 305 165 118 ------
NM_014781chr821199 344 1869 ----
NM_014787chr13629 433 140 12619 21906 820 12837
NM_014793chr151642 --1245 --
NM_014795chr281391 1378 1224 936 551 431 350 204 41170 1105 539 332 1895 21007 957
NM_014797chr6102867 2430 2127 1233 1217 882 841 801 521 98 2869 746 22500 958 --
NM_014802chr1210968 920 787 759 730 356 300 273 236 158 --1710 11147
NM_014803chr10102842 2459 2441 2413 2297 2002 1917 598 295 281 --21972 241 12149
NM_014807chr111839 ------
NM_014810chr183717 3567 3400 3015 2892 2838 1007 295 1631 33386 3126 3055 --
NM_014812chr132020 1362 550 21507 1449 1578 21229 132
NM_014813chr11563 --2415 47 --
NM_014819chr552228 1613 565 536 501 12019 1857 12240
NM_014822chr43628 481 151 --4421 233 118 66 --
NM_014824chr1111482 ----11849
NM_014826chr194373 4237 4069 4025 3726 1042 634 290 202 23318 847 13860 --
NM_014827chr11634 2528 443 21604 651 --
NM_014829chr5102341 2258 1975 1789 1766 1571 867 559 521 302 11501 12315 11846
NM_014830chr1273835 3453 3396 1110 913 645 624 23183 1556 22775 96 --
NM_014832chr1372119 2001 1969 1673 1594 1529 810 11907 51449 1297 837 748 293 1505
NM_014835chr2041996 1780 301 96 --32237 2179 1620 --
NM_014838chr2282738 2311 2091 1835 880 621 299 220 22887 2835 1428 --
NM_014839chr152240 2101 1676 888 331 --2901 131 1816
NM_014841chr661165 1080 929 872 492 124 --1379 --
NM_014848chr1572377 2229 2007 971 730 333 233 --2860 122 1716
NM_014850chr384373 3644 3426 1912 1693 1315 1050 577 13018 44921 4065 2994 1076 --
NM_014867chr863384 3344 3184 3123 2946 550 1756 33786 1288 1026 13328
NM_014868chr12--1162 2289 85 --
NM_014870chr153390 3306 1382 1050 110 24727 4635 14732 --
NM_014872chr952246 1997 1596 327 316 --11447 --
NM_014873chr164504 3055 1836 1753 676 45 --44736 3263 1367 716 --
NM_014877chr17287811 7627 7472 7450 7313 6899 6750 6705 6563 5051 4906 3011 2828 2767 2535 2327 1387 1245 970 791 742 561 520 473 235 214 205 38 24797 1907 57551 6069 2198 2047 158 --
NM_014883chr472233 2211 2024 1791 674 286 198 1422 32577 1971 985 --
NM_014890chr32336 282 ------
NM_014892chr63629 201 159 1406 ----
NM_014893chrY51842 942 698 669 597 1505 12346 22341 114
NM_014897chr1793106 2123 2076 1282 730 689 520 447 291 1285 31127 646 250 --
NM_014899chr552968 2950 2551 650 122 12983 33158 3083 2263 33146 1099 998
NM_014900chr231083 327 173 3849 356 233 1184 --
NM_014903chr1252400 884 632 313 30 --12001 1192
NM_014904chr10104055 4031 4002 3934 3358 3292 1286 896 816 404 43558 2798 1147 799 23311 3051 12513
NM_014905chr271883 809 652 502 305 266 234 21489 575 --11822
NM_014906chr17154110 3982 3841 3630 3559 3516 3442 2918 2681 2543 1162 734 654 402 325 11538 23430 3201 --
NM_014912chr10113466 3287 3155 2698 2611 2425 2265 2202 1388 1349 573 43455 3049 2355 902 2688 264 23345 2304
NM_014914chr221172 369 ------
NM_014917chr11193 ------
NM_014918chr1571359 1156 509 253 144 58 42 --21311 222 --
NM_014920chr673467 3414 936 756 680 313 301 33575 2503 1128 13058 --
NM_014923chr1342039 1984 281 201 --1936 --
NM_014924chr1463195 2806 2404 2091 1015 522 12547 12028 --
NM_014932chr361933 1681 1572 1542 628 135 1180 31889 394 252 --
NM_014934chr13123674 3120 3111 2491 1610 1011 940 831 721 578 329 66 21386 373 1317 --
NM_014936chr641892 1853 947 435 32749 1140 1100 31779 1756 962 --
NM_014937chr1041360 370 214 52 21220 161 --1446
NM_014939chr187562 529 483 439 215 129 82 1404 2604 541 --
NM_014942chr622511 924 22003 1010 12635 --
NM_014943chr851223 1215 785 446 315 21035 508 11072 --
NM_014946chr2163140 2892 2833 2734 2585 2439 2289 2233 1973 1052 939 814 527 414 309 105 33039 1037 874 21917 190 1964
NM_014949chr131050 389 237 --1884 --
NM_014950chr1451605 1238 675 563 441 1305 11556 --
NM_014951chr1062156 1908 1831 1625 486 260 1186 41689 987 967 327 12433
NM_014953chr1394183 4104 4050 3445 2719 1291 484 363 120 1396 33318 1116 320 --
NM_014961chr472143 2122 1686 1570 593 241 138 --2611 122 --
NM_014962chr20112779 2693 2668 824 769 725 648 477 443 135 102 42511 2492 2351 2077 42451 1115 886 321 22251 1110
NM_014969chr13986 907 886 ----11037
NM_014970chr11314 --164 --
NM_014974chr1071808 705 556 466 262 217 27 ------
NM_014978chr1051416 578 476 278 269 11251 51551 1373 557 146 38 --
NM_014982chr14175435 4606 4355 3887 3862 3772 3572 1803 1371 1333 1224 1176 1060 944 789 456 358 21163 541 54028 3738 3283 1119 564 31797 1487 1250
NM_014988chr432819 515 109 --22738 2549 --
NM_014989chr631410 833 802 31669 1458 265 1673 --
NM_014990chr1461291 991 831 471 331 324 1543 --1316
NM_014991chr493097 3012 2923 2290 1238 1081 1019 959 398 --33284 2970 2316 --
NM_014992chr144724 676 552 100 ------
NM_014997chr792144 2007 1995 1115 982 857 504 407 40 12763 ----
NM_014999chr1241182 1058 1036 663 --21260 399 11629
NM_015000chr1272605 2430 2392 2366 1135 1035 834 --22611 1013 22684 222
NM_015001chr16951 795 707 378 371 310 11010 ----
NM_015008chr343287 1384 1303 471 23052 1394 12478 2691 436
NM_015017chr12927 844 --2388 230 --
NM_015020chr1673852 2906 2762 2694 2509 899 854 --23569 1033 --
NM_015024chr81408 2966 492 11364 --
NM_015025chr2102679 2668 2521 2493 2464 989 874 697 413 66 21976 483 22609 586 --
NM_015026chr12124349 3872 3051 1577 1362 1354 922 871 833 785 681 632 34509 551 424 24270 1285 33306 3087 2976
NM_015032chr1372919 2773 2284 1961 848 693 36 31015 721 435 32023 310 21 22240 751
NM_015035chr20136490 5708 5261 5218 4918 4886 2304 1992 1864 1063 945 385 313 16339 1779 --
NM_015039chr184327 4194 3227 3115 1553 866 192 118 --11512 --
NM_015040chr2143386 3268 3053 2864 2632 2244 2187 1021 713 629 553 443 318 233 13223 32815 2780 2230 1671
NM_015042chr1543650 3422 3212 1455 34188 3826 1373 --11415
NM_015045chr1052039 1752 1610 537 518 --1528 12258
NM_015046chr942619 2464 499 187 32707 2568 412 22638 2632 --
NM_015049chr2103334 3327 2903 2225 2038 1208 1186 991 954 82 --13257 12970
NM_015051chr953027 701 556 308 122 12503 3924 774 136 22066 849
NM_015052chr731063 555 442 --21026 1008 --
NM_015055chr1162891 2882 2450 1104 900 82 157 22902 1015 11845
NM_015059chr1553962 3299 3084 2483 1597 ------
NM_015061chr92642 564 1686 ----
NM_015068chr763810 3741 2710 1473 1448 998 184 32887 2534 454 23916 3518
NM_015070chr1341628 1501 1178 1090 21350 1047 ----
NM_015071chr586174 6041 5720 5370 4239 4127 2215 914 21613 31 26547 5158 24841 2391
NM_015073chr1911948 ------
NM_015074chr1104731 4624 4279 4193 4037 3768 3592 3566 1858 689 13058 64792 3610 3536 1427 757 480 --
NM_015076chr664471 3515 3103 810 236 175 33501 3119 764 104556 4349 4110 3383 3312 2902 1176 1004 886 683 --
NM_015080chr1121011 379 --1369 --
NM_015082chr551888 1878 601 520 383 1620 --22634 2566
NM_015087chr1372335 2049 1988 581 478 417 52 32578 1794 140 42725 1807 1078 129 --
NM_015090chr196206 6067 5904 5603 4918 4663 4046 1091 367 ----11797
NM_015091chr14160 2698 248 1786 --
NM_015092chr16114420 3941 3813 3765 2997 2950 1330 1213 1183 1148 987 24084 1323 24543 2969 --
NM_015093chr661794 1229 629 390 371 342 --21610 737 --
NM_015097chr372218 1987 1737 1540 502 329 257 22149 366 31931 251 184 11702
NM_015100chr172019 1763 1726 1666 537 352 145 --31923 1907 259 1117
NM_015101chr152294 2230 1999 684 463 --22443 2144 12136
NM_015110chr952453 1795 1753 472 31 2540 344 12065 3586 432 361
NM_015115chr463166 3024 947 935 677 273 12847 4963 764 511 344 12058
NM_015124chr2252463 2328 2290 106 32 --22502 2387 --
NM_015132chr731343 664 381 31585 1491 718 ----
NM_015137chr8132572 2524 1918 1862 1639 989 968 962 399 296 212 174 64 --11742 --
NM_015138chr1592820 2281 2133 1933 1839 1804 828 789 577 ------
NM_015141chr352764 2146 1776 307 125 42680 2311 1896 403 22604 465 --
NM_015143chr431376 1234 1009 ------
NM_015144chr1683889 3424 1563 1326 1073 804 761 439 14024 23145 697 13837
NM_015153chr65801 763 738 588 105 1292 ----
NM_015155chr1043338 3297 2831 1146 11295 21327 1316 --
NM_015156chr14104034 3722 3689 3425 2783 2621 2561 2478 730 690 13814 12683 12752
NM_015163chr1471921 1733 748 538 409 353 294 --31341 395 300 --
NM_015170chr822377 1787 --1833 12127
NM_015172chr161478 1450 1443 1259 1251 296 11461 11565 21331 1213
NM_015173chr461703 1678 1124 731 641 616 ----1248
NM_015176chr161615 1364 1163 1142 288 47 21194 1181 31686 1199 253 11775
NM_015178chr812691 ------
NM_015185chrX52604 2426 877 466 261 --12885 2474 26
NM_015192chr2072969 2625 2207 1961 540 428 291 ----13001
NM_015196chr41126 ------
NM_015199chr392985 2974 2803 2415 2309 2205 1996 699 254 1359 ----
NM_015200chr4142540 2508 2500 2424 2255 2162 972 932 923 904 732 528 344 251 2826 623 1473 --
NM_015208chr18123507 3430 2884 2796 1502 1279 1082 860 788 728 696 518 33315 1290 1053 --12679
NM_015215chr182775 2744 2345 2184 2016 614 224 218 11282 1806 --
NM_015216chr561321 1192 1131 571 428 24 11209 ----
NM_015225chr952626 2455 2279 1088 560 1600 --12918
NM_015230chr421532 303 ----1189
NM_015236chr431427 1054 140 --11417 --
NM_015245chr652724 1113 858 307 253 --12572 12086
NM_015247chr1685346 4985 4289 3941 3519 3350 1852 435 45067 3638 309 262 35336 3292 1203 35073 1376 1257
NM_015250chr941748 1467 824 117 1188 --1512
NM_015254chr873104 2028 1994 1087 966 168 23 --23157 3034 --
NM_015256chr52563 516 ------
NM_015263chr1531237 463 293 --11126 --
NM_015265chr272676 2648 2462 2321 934 834 468 12091 22642 691 --
NM_015268chr33664 299 222 1716 ----
NM_015271chr4124251 3961 3714 3502 3439 3396 3106 2695 1724 1468 162 119 33565 3062 888 63842 1626 1572 1321 356 286 --
NM_015272chr1652015 1863 1524 437 253 --11805 --
NM_015275chr1292090 1986 1600 1492 862 840 572 328 54 --12194 11963
NM_015277chr1851391 752 742 560 74 --1629 --
NM_015278chr6113243 2753 2620 2504 2405 1156 1094 954 715 608 586 ------
NM_015282chr282768 2747 2632 2176 1078 1017 576 147 --12663 11089
NM_015286chr1562035 1707 865 389 226 67 2613 208 ----
NM_015291chr183414 2943 2878 2534 2138 1195 859 37 12553 23470 781 12164
NM_015292chr121696 ------
NM_015294chr175924 252 135 49 24 ------
NM_015296chr131277 11141 --21185 1155
NM_015299chr1463973 3938 3312 1583 227 218 13906 ----
NM_015310chr8178045 7694 7668 7512 7503 6966 6930 5703 5298 5120 2848 2631 1414 1229 1018 643 342 98410 7584 6764 6006 5558 5430 3150 2946 2406 77701 6480 5199 1297 1172 742 124 15085
NM_015313chr11134533 4341 3890 3423 3360 3224 3182 2927 1905 1429 1267 351 284 53787 3734 1860 1126 848 64365 4048 3969 1456 1152 382 24182 1614
NM_015314chr7102570 1918 1857 1787 987 948 685 546 486 142 22091 1020 11900 22320 2251
NM_015316chr1441211 1148 338 221 ------
NM_015317chr2102781 2630 2601 2272 1097 310 149 99 50 30 32568 2416 877 1788 1129
NM_015320chr211040 ------
NM_015323chr661685 1568 1434 328 247 180 11155 21583 1322 1271
NM_015328chr752877 2760 1102 388 26 --12829 --
NM_015329chr1982962 2916 2292 2089 2046 897 845 538 11998 12833 --
NM_015331chr1179 ------
NM_015335chr1262571 1872 1865 613 550 453 11984 22271 230 21678 641
NM_015336chr1252676 1709 806 637 264 21916 130 21970 1925 21874 225
NM_015339chr201405 --3992 833 818 --
NM_015344chr882171 2117 2066 1991 1893 1696 1653 1453 1709 11709 --
NM_015349chr642378 2354 776 359 32725 2144 1085 22289 1070 12812
NM_015350chr12532 383 ------
NM_015352chr2033926 3771 2968 --1359 --
NM_015355chr1781804 1608 1501 1322 758 647 513 324 ----31256 720 571
NM_015358chr2161287 1171 344 334 314 55 21298 983 173 --
NM_015359chr872920 2458 2344 2315 964 849 380 --21856 284 12020
NM_015365chrX73835 2641 1410 1247 1158 1073 279 2949 637 63627 3520 2753 2626 1539 243 --
NM_015375chr174574 4139 3186 1678 1394 1337 479 --24820 3672 --
NM_015378chr142499 2416 665 175 --2270 215 12154
NM_015379chr7------173
NM_015381chr2222036 1754 ------
NM_015385chr1043116 2980 2286 1985 13269 12739 12780
NM_015387chr262103 1413 1338 1308 758 96 --41672 1619 1359 457 1576
NM_015393chr473660 3578 3555 3188 2929 1339 1208 --13475 --
NM_015394chr1252296 2234 793 768 715 --11632 137
NM_015396chr361393 1349 1169 577 284 186 1494 ----
NM_015397chr971806 1614 1488 1267 571 390 36 2553 214 21928 1735 --
NM_015412chr392954 2803 2771 2355 2126 1163 809 317 24 22474 1157 22344 976 3935 632 311
NM_015419chrX2434 275 ----2938 762
NM_015423chr1161744 1533 1414 1188 706 123 189 21247 479 --
NM_015431chr183475 3010 2489 1286 1233 752 705 305 --32897 651 196 1609
NM_015435chr831434 1175 304 ----1990
NM_015436chr4113196 2841 2561 2365 2281 1233 1130 616 496 459 311 --2392 373 43213 2979 2532 1157
NM_015442chr31193 --1212 --
NM_015443chr1721169 97 --1164 --
NM_015446chr171684 1054 551 426 181 110 89 11631 11322 --
NM_015455chr5103210 2926 2887 2875 1654 745 602 541 491 116 44009 2815 1478 1044 42573 1483 1308 860 --
NM_015458chr8165132 5077 4569 4484 3750 3636 3332 3247 1808 1611 1068 992 950 833 407 308 --24262 1412 --
NM_015460chr372064 1898 1855 1687 1489 1365 531 21661 797 11999 1321
NM_015462chr172288 224 ------
NM_015469chr91115 ----1666
NM_015474chr201436 --2143 103 --
NM_015475chr23377 300 231 --1866 --
NM_015477chr1551000 861 813 215 24 2774 736 1336 --
NM_015483chr721149 850 3724 229 119 ----
NM_015485chr11133 193 2326 314 --
NM_015497chr1551107 937 904 761 296 --1406 --
NM_015508chr341470 1280 516 323 11578 --1573
NM_015509chr1251248 501 350 341 131 11070 11384 --
NM_015520chr352671 2126 1918 1099 968 12457 --12663
NM_015530chr2178 --1895 1786
NM_015532chr1592854 2616 2602 2332 2280 1775 1050 223 54 --32091 310 163 1104
NM_015534chr13882 419 226 ------
NM_015535chr294161 3507 2937 2709 1437 1315 783 220 162 1574 43820 1585 1042 175 --
NM_015541chr341374 1251 1067 305 --2945 344 --
NM_015544chr17--1607 ----
NM_015548chr62944 725 --2786 165 --
NM_015549chr141450 ------
NM_015550chr793590 3448 3417 3210 2507 2492 2235 444 118 32379 1116 292 32369 927 303 --
NM_015553chr6105079 4981 4805 4622 3883 1606 1358 1317 874 742 31699 1352 345 34930 4184 1228 --
NM_015554chr1572800 2290 2032 1088 797 515 482 32365 2095 413 --21095 912
NM_015556chr14--1214 ----
NM_015564chr593506 3213 3191 2841 2567 1306 748 461 208 --43157 156 105 77 --
NM_015565chr2161996 903 896 770 260 202 52024 1948 1865 1479 591 --1174
NM_015568chr20104187 4140 4096 3772 3431 2982 2661 1695 1246 1029 ------
NM_015569chr1104769 4616 3425 1677 1543 1478 1329 938 777 556 14160 44387 3355 2997 2989 11485
NM_015571chr6122453 2440 1886 1818 1762 935 879 325 236 194 139 108 11944 32548 1683 47 1585
NM_015575chr23945 921 690 23454 3273 43665 3494 777 555 --
NM_015576chr362576 2523 2216 2168 2126 709 12388 --1806
NM_015577chr551807 1203 694 451 118 ------
NM_015578chr1961503 649 538 497 246 153 --31367 678 592 --
NM_015601chr1011030 1273 4938 799 365 332 --
NM_015602chr171806 1720 1583 1359 515 460 349 --11340 11787
NM_015605chr1061564 1474 1135 1040 408 253 --2569 24 21516 1123
NM_015609chr151920 652 558 369 115 --12315 --
NM_015610chr73609 80 58 2216 115 22478 221 --
NM_015626chr175410 206 150 112 71 2372 64 --1936
NM_015630chr241129 955 765 397 --21051 449 --
NM_015640chr1175381 5325 5299 5238 5143 4972 3584 1998 1835 1759 1551 1410 1399 534 482 349 55 31115 498 141 64942 4673 3515 2105 1089 244 34311 4130 1723
NM_015657chr241040 418 297 165 --1893 --
NM_015676chr141325 1410 ----
NM_015678chr1331560 355 306 --21293 648 1511
NM_015687chr62527 95 --1393 --
NM_015691chrX3412 344 288 ----1387
NM_015695chr621540 1383 --11449 22115 2022
NM_015833chr2142172 1899 773 378 --1865 --
NM_015844chr182991 944 2843 794 ----
NM_015846chr182991 944 2843 794 ----
NM_015847chr182991 944 2843 794 ----
NM_015852chr7203430 3106 3041 2951 2892 2699 2477 1453 1350 1091 1085 1001 749 665 581 497 413 329 245 161 43485 2858 1303 1270 23144 2879 23059 2403
NM_015853chr11124 ------
NM_015872chr121830 310 ------
NM_015878chr8132168 1890 1839 1681 1421 1371 721 587 552 424 275 158 79 22252 806 21968 1734 --
NM_015879chr18187810 6746 6726 6537 6223 6143 6107 5933 5880 5775 5545 3359 2948 2787 2406 2339 1890 546 37719 2233 1465 1624 --
NM_015886chr8125594 5448 4262 3846 3713 3584 3547 2141 1982 535 455 77 32071 1482 1396 35728 3816 1033 14644
NM_015888chr1133272 3235 2949 2804 2430 1330 1069 885 658 622 477 330 278 23395 1106 5916 744 591 340 152 22235 166
NM_015891chr651423 723 630 155 86 --1217 --
NM_015902chr85684 609 260 158 45 1861 ----
NM_015906chr1114109 3542 3114 3038 1901 1888 997 952 420 382 80 13064 54631 4424 3637 693 140 --
NM_015912chr862122 2004 1566 609 372 204 153 12500 1381
NM_015914chr16--168 ----
NM_015934chr21212 ------
NM_015939chr204663 618 500 26 162 ----
NM_015954chr122528 414 --1233 --
NM_015975chrX51284 1167 530 521 349 1635 1418 --
NM_015984chr12581 531 1460 ----
NM_015986chr1721341 103 21210 200 2556 510 --
NM_015995chr1585450 5330 4991 4728 4018 1957 1077 114 35531 4592 4584 14281 13607
NM_015999chr14570 522 171 56 1653 1583 --
NM_016002chr15793 735 725 705 156 ------
NM_016003chr73609 80 58 2216 115 22478 221 --
NM_016009chr1164924 4909 4733 4041 3910 3823 3755 3226 3201 1730 1498 1386 474 420 318 190 11564 24792 37 --
NM_016018chr8102701 2439 2338 2298 1742 1075 973 509 291 84 31870 1043 168 21837 1082 --
NM_016021chr6112736 2640 2632 2529 2062 1214 1038 1013 460 320 249 1871 11190 43048 853 551 514
NM_016023chr8121987 1966 1840 1824 1752 1575 1344 705 577 380 355 311 52096 1765 515 193 167 11368 --
NM_016035chr91128 ------
NM_016037chr13388 294 61 --2945 222 --
NM_016040chr162298 2102 893 484 366 277 22665 2391 2535 267 32558 877 130
NM_016045chr20101851 1835 1691 1587 1429 1420 652 635 313 144 --21229 340 --
NM_016061chr261428 675 628 435 396 170 --1228 --
NM_016072chr1251591 807 547 500 96 1913 3955 884 643 11749
NM_016073chr1531141 800 210 1908 1786 --
NM_016076chr153094 2558 2311 1283 188 --22884 704 --
NM_016078chr172988 793 21115 126 11098 --
NM_016081chr472066 2045 1857 1646 1484 899 440 11626 --11804
NM_016083chr683904 3802 3193 2733 1163 509 344 37 --43471 855 832 632 2589 99
NM_016093chr5169 1140 --1153
NM_016096chr871942 1591 1357 848 673 532 239 11583 2868 355 --
NM_016101chr1651180 1071 303 90 48 1550 ----
NM_016103chr55432 352 145 90 74 1387 2473 199 --
NM_016106chr14----1134 --
NM_016107chr541325 1075 385 272 --1855 --
NM_016120chrX4972 346 281 259 ------
NM_016125chr172535 409 --1425 --
NM_016131chr262198 2043 1920 1760 881 384 21787 362 62001 1886 677 630 502 180 21835 170
NM_016132chr15163090 2975 2899 2872 2796 2621 2569 2270 1301 1245 1143 1119 1039 665 129 110 --2381 163 --
NM_016133chr281601 1533 1062 545 527 468 283 223 11423 31201 643 295 --
NM_016138chr1671599 1393 1324 1314 1305 109 43 --1264 --
NM_016152chr351163 811 329 192 173 1202 ----
NM_016156chr1172062 1896 1546 1495 954 895 307 1924 21965 1934 --
NM_016195chr102343 196 132 --1140
NM_016200chr74744 584 252 197 1697 1751 --
NM_016206chr3328955 8786 8380 7264 6947 6923 6856 6769 6539 6379 6331 6193 6073 5771 5671 3305 3286 3135 2924 2340 2185 2173 2017 1987 1966 1758 1681 1381 972 833 798 725 58227 6660 5996 3507 3064 58860 6115 3356 3099 1733 38617 3497 1569
NM_016217chr693218 3060 3040 2780 1289 1281 566 101 89 1265 33343 749 367 11025
NM_016218chr52880 361 1193 126 --
NM_016220chr7122210 1938 1881 1765 844 580 496 416 370 266 164 97 1798 22075 826 11922
NM_016224chr681711 830 818 352 318 264 69 46 --12225 --
NM_016227chr161497 1293 1216 594 273 31 --3440 411 332 --
NM_016230chr62469 158 1395 ----
NM_016231chr1751457 1229 660 569 170 --141 199
NM_016248chr1393878 3848 3292 2893 1452 888 875 853 567 33305 3272 946 53115 3024 542 383 132 --
NM_016252chr21182 ----1631
NM_016255chr6113327 2984 2918 2739 2612 2514 1087 1068 784 316 208 1338 --1615
NM_016258chr14640 104 95 84 ------
NM_016260chr2237566 7465 7057 6672 6608 6508 5726 5599 5517 5393 4938 4788 2651 2558 2347 2250 1537 1207 1188 831 617 468 397 12935 66763 6060 5738 4982 2922 2307 22236 427
NM_016262chr66575 544 459 199 77 32 ------
NM_016271chr18112044 1737 1711 1503 803 752 683 480 378 293 84 22156 1576 31773 1526 1477 2580 205
NM_016275chr3132796 2669 2651 2610 2013 1986 1893 1042 986 841 818 581 494 11012 31056 309 231 12034
NM_016277chr631308 1038 96 1289 41461 1329 399 211 --
NM_016287chr14544 305 231 211 22112 330 11287 1166
NM_016289chr252359 2341 814 626 616 1462 --22200 689
NM_016290chr5--1275 ----
NM_016300chr31421 ------
NM_016308chr182076 1918 1449 557 434 303 199 146 1664 11326 --
NM_016312chr122547 113 ------
NM_016315chr281745 1344 1292 1242 1200 663 544 129 1517 31533 381 171 --
NM_016316chr21665 ----2742 102
NM_016322chr982988 2835 2693 2526 1217 1105 358 234 12269 12513 1603
NM_016328chr7153 ------
NM_016338chr511250 21067 299 --1207
NM_016351chr73641 518 48 1511 --1548
NM_016356chr63944 501 466 21095 377 21888 353 22577 162
NM_016357chr1221280 108 --3949 473 124 21185 203
NM_016359chr153848 61 43 ------
NM_016374chr131378 337 135 --11430 11092
NM_016374chr131378 337 135 --11430 11092
NM_016376chr17113590 3459 3200 2725 2717 2658 1278 1122 893 463 336 33953 3892 636 14080 --
NM_016396chr1593022 2463 2362 2242 2109 569 354 245 90 1165 12773 11853
NM_016422chr1163021 2708 2153 885 704 641 32889 2033 824 2672 540 22335 575
NM_016427chr181105 --1267 --
NM_016436chr2062021 1919 923 578 463 113 --41958 1882 1820 377 --
NM_016441chr2102295 2196 2066 1875 1854 1797 928 915 775 110 11840 11656 --
NM_016442chr5132153 1979 1765 1646 1516 1504 536 520 339 248 205 171 78 21675 947 --12335
NM_016447chr71196 --2216 207 --
NM_016448chr151871 1363 357 54 29 11320 --1471
NM_016451chr112278 38 128 --1312
NM_016467chr241427 1416 1100 327 128 11294 --
NM_016472chr1471458 1445 1294 1222 493 426 415 11409 ----
NM_016480chr54763 608 594 359 1340 ----
NM_016485chr642153 1974 338 312 21662 527 22074 404 --
NM_016486chr11333 ------
NM_016488chr1271961 1899 1639 1253 1243 622 581 2609 191 11316 11779
NM_016499chr111491 ----1542
NM_016507chr1733165 2924 2056 2740 429 12545 --
NM_016513chr673467 3414 936 756 680 313 301 33575 2503 1128 13058 --
NM_016516chr21546 ------
NM_016519chr43547 470 49 1414 ----
NM_016522chr1141645 1516 654 586 ------
NM_016525chr91935 ------
NM_016526chr1112487 ------
NM_016530chr1594105 3530 3392 3281 2867 1390 1044 757 601 43805 3550 3356 833 12625 --
NM_016531chr464162 3490 3156 843 644 102 11671 21100 1036 --
NM_016536chr191135 ------
NM_016542chrX41505 1377 402 374 21652 681 31572 1088 203 --
NM_016544chr2133855 3768 3628 3529 3476 2964 2903 2528 2493 2413 1411 250 48 ------
NM_016557chr35941 838 818 770 270 --1284 1714
NM_016559chr371489 1245 968 613 591 558 478 1519 21394 524 --
NM_016562chrX11027 ------
NM_016577chr364154 3804 3169 1585 298 67 ------
NM_016578chr114637 239 172 28 --2112 82 --
NM_016588chr61892 1240 1310 2680 296
NM_016599chr421079 576 11333 1223 11452
NM_016603chr572238 1770 1426 595 352 335 320 1298 --11813
NM_016604chr531253 1068 885 --11274 --
NM_016605chr552655 2645 2379 1895 686 ------
NM_016617chr1372129 1938 752 630 509 435 293 1587 31926 1793 303 --
NM_016618chr25576 436 412 223 110 ------
NM_016620chr111213 11051 ----
NM_016625chr34444 332 164 97 --177 --
NM_016626chr1851798 1691 1185 611 585 11246 1514 11588
NM_016631chr212971 56 1778 11043 --
NM_016644chr5--1400 2371 34 --
NM_016651chr145952 773 719 363 276 ------
NM_016654chr1551115 1074 1034 522 325 2476 166 ----
NM_016824chr1041611 733 344 157 3544 204 122 61721 1201 617 580 507 388 --
NM_016831chr152308 2080 1524 855 75 --12102 --
NM_016937chrX1708 ------
NM_016940chr212438 412 ----185
NM_016946chr142816 2584 640 286 --43272 2822 2650 2258 --
NM_016950chr441428 1354 389 290 1159 1347 11463
NM_016953chr2125935 5773 5521 5197 4699 4491 4133 4003 3826 1209 1191 469 25818 4653 75549 4918 4145 4080 1714 1168 938 24123 1882
NM_017412chr851235 1035 449 410 333 --11428 --
NM_017413chrX42513 2393 2000 1596 --22367 251 --
NM_017415chr564560 4272 3540 1454 1372 134 33239 3007 1624 33918 2992 589 14577
NM_017420chr1453468 3084 1078 905 751 33856 684 131 ----
NM_017423chr471544 1358 685 408 396 264 215 22161 1890 21697 1645 1445
NM_017437chr1452315 1907 1609 845 71 --22157 603 --
NM_017440chr124654 590 120 73 --3246 176 45 --
NM_017443chr961494 1019 572 464 351 74 1494 11254 --
NM_017444chr891894 1872 1664 1626 1288 1243 745 618 461 21777 313 21813 318 --
NM_017447chr21124355 4254 3658 3344 3252 3226 3117 1597 1498 813 629 60 74012 3900 1696 1226 1064 415 237 44112 3496 664 348 14416
NM_017452chr2061450 1370 1359 1295 965 500 --11034 11503
NM_017453chr2061450 1370 1359 1295 965 500 --11034 11503
NM_017454chr2061450 1370 1359 1295 965 500 --11034 11503
NM_017455chr152785 61 --1794 --
NM_017489chr831175 93 85 --31155 1059 529 --
NM_017490chr111288 ------
NM_017519chr61163 --1910 1350
NM_017520chr132595 587 --1440 --
NM_017522chr121020 540 --11329 --
NM_017548chr351926 1844 837 656 191 --22048 772 --
NM_017551chr1072492 2240 2126 1032 247 197 54 --1238 --
NM_017563chr3146305 6121 6046 5377 5333 5080 4340 2529 1843 1499 1372 539 364 191 15187 56106 4832 4154 3957 1073 --
NM_017569chr132378 35 ------
NM_017578chr3189 122 ----
NM_017580chr1092392 2349 2139 1925 1748 537 520 352 242 1193 11770 1227
NM_017582chr161535 1484 452 349 271 209 --11264 --
NM_017588chr921978 1963 --1278 --
NM_017599chr12158 32034 1838 1416 31940 1710 1603 21729 603
NM_017610chr15112113 2070 1628 1517 801 625 409 385 334 195 79 2845 741 --11355
NM_017617chr92581 232 11539 1140 --
NM_017626chr103690 462 54 ------
NM_017628chr4135164 5140 5106 4050 3832 2089 1989 1891 1793 1729 1365 722 620 55124 3787 3493 2068 312 23660 1049 13543
NM_017629chr181667 1540 1250 676 474 275 239 94 1288 2529 495 --
NM_017632chr43303 166 91 --157 --
NM_017633chr673905 3506 3446 3117 2793 2702 2599 11544 1343 --
NM_017634chr871952 1467 1437 1284 1223 719 368 21213 445 1172 1487
NM_017635chr1171321 1307 1267 1057 379 284 180 ----11299
NM_017637chr9209460 9436 9309 9302 9207 9008 8474 7302 6864 6529 6405 3537 3321 2839 2770 1912 1469 1380 998 199 59404 7225 6890 2255 479 68216 7503 6752 2002 598 585 16804
NM_017641chr1231057 991 260 --31080 843 799 --
NM_017643chr17103049 2966 2505 2278 1181 1009 240 228 208 184 --63085 2635 1910 1251 1027 300 --
NM_017644chr3195221 4926 4831 4512 4407 4372 3293 3215 1853 1783 1772 1554 1523 1479 1399 803 397 196 122 11718 25153 3828 41910 1805 589 507
NM_017650chr7126023 5808 5802 5720 4743 4391 2226 2048 1984 461 376 267 11159 12284 45765 2402 1226 180
NM_017654chr761756 1701 1625 1304 635 137 31744 1293 1098 21489 51 --
NM_017655chr161622 1504 1435 1384 561 109 11311 3348 154 145 --
NM_017658chr1484412 4222 4112 3349 1423 602 235 108 23675 3337 34234 1595 856 23019 878
NM_017660chr1943185 2282 1143 931 13210 ----
NM_017661chr1531221 1166 1049 --1967 --
NM_017664chr134964 864 364 120 --1916 --
NM_017666chrX102257 2143 1924 1858 1850 1624 698 345 271 148 --31474 1467 809 11637
NM_017672chr1541099 1051 521 439 1212 41176 1125 284 243 11171
NM_017693chr1321626 1368 11475 1347 11336
NM_017694chr252025 1323 371 243 193 1587 12033 --
NM_017709chr1114288 4144 3750 3580 3374 2981 1334 1089 893 715 511 1469 34071 3338 517 --
NM_017719chr311655 12381 21013 217 1233
NM_017737chr162087 1920 1457 1387 612 148 11518 32133 2122 1558 --
NM_017738chr951239 894 470 381 39 ------
NM_017742chr1871569 1514 749 733 410 394 231 11628 11235 --
NM_017745chrX5735 647 563 550 179 ------
NM_017747chr5192 ------
NM_017752chrX41472 854 364 238 --1538 --
NM_017753chr981025 705 417 392 359 310 234 160 5902 778 401 218 196 ----
NM_017754chr6185019 4543 4152 4049 3932 3336 3248 3074 1917 1710 1601 1566 1538 1364 1276 1242 991 470 14994 14601 --
NM_017761chr161556 1390 1363 454 287 259 11307 1210 --
NM_017762chr1582498 2427 2300 1844 692 574 189 43 1590 11794 42278 660 614 96
NM_017769chr14102776 2744 2644 2105 2057 750 450 391 212 104 22615 2545 22658 2629 22305 1207
NM_017770chr662598 2424 2220 1839 1057 100 12167 ----
NM_017774chr63383 365 100 ------
NM_017778chr82941 257 11398 11095 --
NM_017779chr182568 2115 1803 1015 993 890 286 39 2964 272 ----
NM_017784chr321096 22 --11170 --
NM_017785chr51530 1543 ----
NM_017786chr82612 520 ------
NM_017791chr1461641 643 562 385 352 295 --11259 --
NM_017794chr91325 ------
NM_017799chr1471825 1814 1805 1784 605 253 235 ----1674
NM_017801chr361684 832 793 417 338 194 22484 2408 12382 --
NM_017810chr165737 698 566 209 53 --2601 90 --
NM_017811chr983076 3039 2958 2758 2101 1158 694 602 1466 12492 12995
NM_017813chr8194947 4940 4787 4771 4631 4594 4278 3953 3624 1879 1753 1698 1399 1169 1119 985 637 455 112 34500 4386 576 64533 3760 2256 2106 1102 793 24143 404
NM_017824chr1062750 2644 2560 2150 1759 428 22496 640 42680 2669 2191 681 --
NM_017831chr18104630 4548 4371 3996 3892 3293 1050 966 884 507 14078 44150 3219 1827 917 1167
NM_017848chrX74145 4074 4002 3789 3281 2923 45 34298 3293 1672 84320 3771 3386 3021 1552 611 547 355 --
NM_017849chr232900 2585 318 12889 12441 --
NM_017866chr861082 897 768 126 120 103 ------
NM_017890chr841811 1374 598 423 11176 11706 --
NM_017902chr1085578 5199 5180 4991 4074 4042 1076 277 15732 15501 --
NM_017905chr133642 560 181 --1545 --
NM_017910chr23119 110 26 157 1133 --
NM_017913chr91148 ------
NM_017915chr1221195 181 --2996 66 --
NM_017919chr995322 4719 4583 4410 4396 3737 3600 1582 1096 35190 5030 3614 22270 1541 --
NM_017935chr43666 568 277 1630 1700 --
NM_017938chrX61909 1899 1712 1383 1371 603 --21764 1529 --
NM_017943chr1411049 --1747 --
NM_017944chr1182461 2245 1945 1249 1232 954 411 370 --33060 1069 1034 --
NM_017948chr9--2399 110 ----
NM_017953chr171122 1041 760 358 293 178 108 ----11185
NM_017954chr73497 468 295 11318 11245 --
NM_017964chr25967 934 921 871 69 11013 1848 --
NM_017987chr10102048 1969 1932 1852 1825 1774 1618 1538 887 404 22223 1814 22025 1366 --
NM_017994chr752760 1983 1962 1954 1841 --22976 1155 --
NM_017998chr95965 544 520 456 395 --21120 995 --
NM_018014chr231337 1155 1143 1417 1444 1911
NM_018015chrX71005 410 344 278 268 159 76 1388 2358 212 --
NM_018017chr10112861 2803 2319 2031 1918 711 663 517 254 190 76 42875 2742 2244 1124 12691 --
NM_018018chr1261931 1809 1795 1269 1241 616 11839 ----
NM_018025chr192243 186 ------
NM_018030chr18166 --1199 2329 323
NM_018036chr14144273 4252 4187 3904 3239 2762 1358 1252 1215 745 731 664 392 136 --34350 1733 1429 31437 1182 91
NM_018051chr71125 ------
NM_018061chr131297 1202 430 ------
NM_018070chr12390 195 1167 ----
NM_018078chr43910 783 420 --21006 958 --
NM_018079chr2----1481 --
NM_018084chr292827 2559 2309 1317 1121 864 750 230 140 21273 1140 32791 2496 1262 13022
NM_018086chr251616 1479 1357 1182 583 1423 11744 --
NM_018087chr1--1250 ----
NM_018089chr2--1182 ----
NM_018092chr1651361 1285 1156 1121 428 11185 21614 1096 --
NM_018098chr351209 907 260 221 66 2779 318 1290 --
NM_018105chr83440 178 164 11111 ----
NM_018112chr981010 944 844 792 403 332 276 35 2383 326 3773 740 69 11060
NM_018115chr42569 143 ------
NM_018117chr102777 299 2640 263 1291 1565
NM_018120chr821252 617 2955 302 ----
NM_018121chr1042689 2149 1179 395 12876 42854 890 527 445 12397
NM_018125chr11159 ------
NM_018126chr491576 1436 1342 1312 1139 1001 474 297 114 2586 193 1437 --
NM_018132chr6136 1555 1534 --
NM_018133chr341946 774 266 80 11747 2829 383 --
NM_018139chr144332 142 122 21 ------
NM_018142chr8----1207 --
NM_018151chr26727 534 524 505 162 143 ------
NM_018155chr3103267 3141 2488 2480 2204 1066 963 901 778 387 23462 3114 63440 3347 2728 2679 2513 1191 23062 332
NM_018156chr142499 2416 665 175 --2270 215 12154
NM_018157chr1263194 3109 2258 2150 2070 519 11240 12088 21992 989
NM_018169chr123510 465 168 ------
NM_018177chr4--1220 --1814
NM_018181chr182493 292 --2436 220 --
NM_018184chr372187 2085 1956 1921 1478 419 402 32048 2007 256 ----
NM_018195chr1131922 1640 454 11480 ----
NM_018196chrX----21360 267 --
NM_018197chr20----1262 --
NM_018199chr1431124 817 319 11165 11102 --
NM_018200chr1572629 2566 2078 1712 367 355 224 ------
NM_018202chr12275 193 1215 --1731
NM_018206chr161702 1558 ----
NM_018211chr181938 1742 1700 1683 847 443 234 70 --21407 665 --
NM_018214chr651174 1106 465 315 221 21013 458 --11161
NM_018221chr21394 192 ----
NM_018227chr462672 1228 1056 940 662 227 --12914 43005 2750 377 122
NM_018230chr14572 486 477 188 162 ----
NM_018237chr101249 --1220 --
NM_018243chr474002 3744 3705 3001 1392 1281 1180 23184 1028 13034 13762
NM_018246chr882791 2647 2445 2039 1949 1045 738 221 21128 299 --21980 1069
NM_018247chr6103028 2594 1251 995 974 950 904 416 299 164 12563 52493 2216 572 115 64 --
NM_018254chr182379 2370 2276 2042 1500 790 380 160 22080 588 41598 767 443 31 11606
NM_018257chr2051919 1737 973 635 481 --22216 619 --
NM_018261chr42511 214 1104 ----
NM_018263chr262561 2286 868 629 576 211 --1984 --
NM_018270chr202822 630 --1655 --
NM_018279chr1272819 2627 2370 2307 1201 703 62 1677 22845 775 --
NM_018290chr461019 511 300 266 235 56 1876 ----
NM_018293chr372963 2743 2616 2493 2300 2052 542 1804 11115 1103
NM_018299chr8183464 3414 3214 3043 2978 2904 2670 2446 2300 1295 1273 1062 1037 892 835 706 324 279 23164 80 ----
NM_018302chr421691 502 --31932 871 653 --
NM_018307chr17--1685 1888 --
NM_018312chr1162115 1976 1727 1405 515 211 --1370 --
NM_018313chr342663 2580 2146 1933 1897 1102 1195
NM_018314chr113772 739 150 1702 2519 299 1212
NM_018315chr451593 1102 541 271 256 11579 1440 11498
NM_018318chr122601 168 1298 ----
NM_018323chr441799 1458 1221 470 1413 21641 322 1266
NM_018325chr921690 1667 21086 505 21383 379 --
NM_018327chr2071671 1382 678 634 357 104 33 ------
NM_018330chr1031709 1212 472 ----11309
NM_018334chr71547 ------
NM_018335chr141521 ------
NM_018339chr961861 1784 1642 1345 593 317 ----21532 1335
NM_018342chr461736 1680 1254 1158 1085 650 11193 --21701 1494
NM_018348chr1691119 953 937 908 788 413 402 77 43 127 ----
NM_018351chr1294494 3988 3867 3188 3115 1625 660 201 157 23659 1886 ----
NM_018360chrX3373 332 89 --148 --
NM_018361chr8104052 3554 3178 2676 2501 1409 1228 736 637 335 43933 2702 722 194 --13168
NM_018362chr11143908 3897 3762 3755 3147 2944 2931 2827 2502 1627 1360 1137 962 61 --23887 3334 --
NM_018364chr1103837 3782 3052 2990 2785 2767 2511 1439 1106 42 13160 43410 1152 814 32 1338
NM_018367chr1142216 1717 1630 852 --21025 122 12287
NM_018369chr53662 507 75 ------
NM_018370chr1212060 1422 2449 221 --
NM_018372chr12181 170 2237 136 --2587 574
NM_018373chr14126477 5957 5721 4878 4832 4547 1985 1945 1826 981 428 251 25971 4997 35582 1893 1030 --
NM_018374chr7184943 4452 4353 4334 4148 3800 3302 3204 1882 1868 1433 1372 1230 1220 631 418 366 352 64682 4041 2002 1491 1004 763 53210 1534 518 497 335 --
NM_018375chr1451831 1522 1473 1405 169 11791 21931 1450 --
NM_018383chr282002 1929 1899 1820 1316 829 636 546 --21711 1381 11952
NM_018386chr134322 306 294 263 --1135 --
NM_018387chr92494 457 --1512 1507
NM_018394chr371565 1446 1369 1298 570 419 193 ------
NM_018400chr1142948 1165 694 170 23281 1680 31627 1302 332 12830
NM_018403chr343259 3205 1090 480 44094 3222 1459 1407 23901 2690 11201
NM_018409chr473084 3013 2702 2465 475 448 427 1493 33301 2565 2448 1335
NM_018413chr12139 ------
NM_018416chr1231609 853 317 --1902 --
NM_018424chr94673 642 179 169 --11197 1568
NM_018426chr6178 ------
NM_018427chr1661612 1446 1385 411 321 298 21456 455 ----
NM_018429chr572871 2314 2069 1837 1044 898 148 12630 22670 2522 22377 1144
NM_018433chr23235 215 70 1534 --1560
NM_018439chr1851958 1866 1611 221 28 --32097 1909 137 1250
NM_018440chr8218583 8201 8021 7751 7088 6773 6623 5806 5446 5405 3377 3163 3155 2997 2521 2436 2395 2310 1736 1099 486 12988 56826 6651 2190 1931 1800 38171 7313 430
NM_018442chr1--291 80 1307 --
NM_018444chr872172 2155 2128 1679 1453 924 263 2944 747 1152 --
NM_018448chr1241173 856 373 341 21204 1000 1435 --
NM_018454chr153848 61 43 ------
NM_018456chr3146 --1100 --
NM_018469chr1751279 1151 398 368 211 --21142 1016 11212
NM_018471chr22389 65 --1170 --
NM_018477chr14----21039 158 1867
NM_018482chr862568 2269 1909 1640 1608 446 11815 ----
NM_018489chr122386 1905 22314 1877 1212 --
NM_018490chr1151785 1729 1398 564 243 11200 21651 693 1420
NM_018553chr1711690 11143 11243 --
NM_018555chr1942205 1657 594 254 2609 120 --21592 526
NM_018557chr281737 1609 1577 1524 1482 606 569 326 --11374 --
NM_018566chr1185141 5036 4890 4493 4101 3810 3272 3241 1781 1671 1431 1354 1266 1120 1005 975 668 122 54879 2023 800 423 316 24630 966 15113
NM_018569chr461604 1576 1419 480 378 307 --21548 1169 1321
NM_018571chr22564 246 ------
NM_018590chr1041263 569 468 460 ----11667
NM_018602chr1551574 1429 1112 179 167 11681 ----
NM_018638chr12215545 5430 5288 5077 4942 4709 4367 4062 3968 3656 3603 1842 1753 1517 1392 632 514 407 267 255 102 23740 793 74467 3975 1992 1901 1796 1247 887 25137 1366
NM_018640chr1252757 2633 2592 2555 863 21763 658 1459 2990 737
NM_018650chr152167 2061 739 411 194 41722 1528 1414 535 11557 --
NM_018652chr155951 692 379 299 208 ------
NM_018657chr32603 202 1694 1551 --
NM_018658chr1751985 781 640 202 185 ----12202
NM_018660chr873050 2837 2787 2780 2736 321 154 --32932 2756 2570 --
NM_018662chr184240 4228 3468 3153 1752 1727 623 511 --14064 --
NM_018672chr173824 655 119 --2859 59 154
NM_018682chr73666 574 494 ------
NM_018685chr741004 727 437 235 1166 ----
NM_018695chr592486 2443 2430 2230 1633 1619 1572 913 787 32360 2320 1833 62178 2033 1798 921 769 388 --
NM_018698chrX51988 1972 1489 1428 1399 1180 41905 1242 557 384 21388 740
NM_018700chr541488 1343 1159 281 11649 31426 367 238 --
NM_018703chr165413 296 282 53 25 1159 ----
NM_018704chr162027 1828 1738 1642 860 537 1616 ----
NM_018710chr83901 520 127 --11074 1466
NM_018712chr1141524 1016 383 278 21477 467 ----
NM_018713chr171154 1110 1069 857 391 171 74 ------
NM_018717chr442819 2676 2378 405 ------
NM_018718chr762002 1907 1798 1607 880 426 --11474 11660
NM_018834chr52918 249 --2936 696 1812
NM_018837chr205857 646 616 369 183 ------
NM_018841chr173591 3131 3038 2928 1573 990 762 13000 23021 2909 11404
NM_018844chr731938 1482 359 31803 1544 1510 2109 47 --
NM_018847chr951979 1697 1559 1381 643 --11369 11797
NM_018890chr761502 1416 951 404 370 125 11147 1143 1180
NM_018898chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018899chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018900chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018901chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018902chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018903chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018904chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018905chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018906chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018907chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018908chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018909chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018910chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018911chr562226 2082 2050 1755 1604 562 51804 1669 1518 1511 182 11919 --
NM_018931chr55866 745 669 303 137 --1117 1833
NM_018939chr54513 233 211 53 2530 111 --1227
NM_018940chr521130 764 --2916 864 --
NM_018945chr653721 3434 3147 2448 564 --1528 2971 628
NM_018963chr2131086 494 117 1987 1385 --
NM_018970chr742983 2493 1212 1191 1423 12467 1406
NM_018976chr1252623 2008 393 322 151 2507 250 52779 1960 882 638 284 --
NM_018979chr1262512 2438 1742 594 348 218 --42263 1824 795 655 --
NM_018981chr271373 1101 977 919 504 209 172 ------
NM_018992chr1621558 657 ------
NM_018993chr2031460 1019 493 1159 11511 1549
NM_018999chr1093727 3691 3253 3154 3076 1716 1481 1235 347 23633 53 --1784
NM_019000chr551457 1063 541 450 375 41636 1162 228 102 ----
NM_019001chr3134648 4593 4241 3718 3585 3558 736 704 615 526 443 122 27 1632 34670 3398 854 34305 3810 1041
NM_019003chrX147 ------
NM_019004chr762292 1543 787 480 154 76 1925 31977 558 209 32256 2204 1861
NM_019006chr153583 279 52 1203 --1237
NM_019022chr1893166 2716 2503 2462 2414 2188 2075 914 610 1905 53116 2863 2164 656 474 1583
NM_019026chr11467 ------
NM_019027chr462613 2553 2435 2421 1679 341 21047 529 --12529
NM_019028chr112447 165 --1354 --
NM_019030chr5----1168 --
NM_019035chr452018 1995 1291 628 227 2777 242 1452 --
NM_019036chr641237 986 300 279 --3816 272 229 1877
NM_019040chr112192 64 ----1221
NM_019045chrX----2613 95 --
NM_019049chr13711 600 102 ------
NM_019050chr461525 1476 728 631 578 116 32284 1556 835 62185 1896 1815 1691 1659 714 2873 258
NM_019057chr5----170 --
NM_019063chr262298 897 874 720 660 503 ------
NM_019067chrX24891 1803 --54899 4883 4302 3976 3285 --
NM_019072chr594234 3771 3221 2718 1328 1281 1084 1049 819 34181 3371 3236 54262 3888 1658 1491 499 --
NM_019074chr151951 ------
NM_019080chr1361247 1110 1083 1043 593 365 174 31535 1029 951 11100
NM_019083chr151608 434 271 134 47 1107 31470 335 146 21149 1050
NM_019084chr1092363 2051 1960 1632 693 571 549 490 464 --42320 1686 659 435 12605
NM_019087chr551693 1634 1580 1308 1171 --1477 21389 69
NM_019091chr24795 397 341 207 1813 1764 --
NM_019094chr1293376 2969 2741 2658 2598 596 555 533 211 22376 486 53657 2994 2858 1401 1060 --
NM_019095chr202232 224 ------
NM_019106chr2263241 2619 1212 1193 1176 735 13428 12867 1890
NM_019114chr971682 840 817 776 657 577 382 22141 1806 2899 153 --
NM_019116chr1642557 349 174 97 ----1181
NM_019117chrX103516 3410 3194 2566 893 712 614 540 135 41 21389 1219 33301 1314 1198 12158
NM_019555chr331813 1545 590 11495 1562 --
NM_019556chrX41384 972 938 153 1270 ----
NM_019590chr1011132 1337 1976 1467
NM_019592chr94882 583 276 252 1132 --2677 169
NM_019593chr2092886 2530 2481 2422 1151 1056 1017 671 342 11263 ----
NM_019596chr2152868 2786 2444 1884 995 22262 2089 32344 2270 330 11913
NM_019597chrX--1639 2570 279 --
NM_019600chr15----1758 --
NM_019605chr12224 21 162 1698 --
NM_019610chr12833 733 12208 31669 264 147 2198 188
NM_019613chr173855 821 275 --41337 1291 1090 1023 --
NM_019860chr1031704 1593 221 ------
NM_019884chr19----1392 --
NM_019891chr131143 237 92 1327 1226 --
NM_019895chr331122 1114 327 21055 411 188 --
NM_019903chr1041611 733 344 157 3544 204 122 61721 1201 617 580 507 388 --
NM_020061chrX189 ------
NM_020066chr13987 971 42 1161 ----
NM_020116chr441783 1737 1697 1373 21546 1501 182 --
NM_020122chr2156053 5969 5281 5226 4364 4076 2378 2099 1310 1235 1160 986 806 472 93 11675 45741 1630 511 178 44629 4569 4551 1046
NM_020123chr1021183 24 --21199 528 --
NM_020130chr861095 1029 957 909 492 398 ----11066
NM_020133chr6156460 6092 5641 5378 5366 5340 5116 5046 4333 4324 2452 2225 2111 1598 267 15469 26371 6168 --
NM_020139chr451956 1916 1513 1439 721 22067 1629 11830 --
NM_020141chr132382 2117 412 --12159 11906
NM_020144chr762118 1986 1737 1400 360 331 41374 1326 810 661 22000 1692 1637
NM_020147chr156872 691 682 388 123 99 1964 --11073
NM_020148chr1852940 2831 2318 1907 570 11007 1923 12308
NM_020150chr1062158 1829 1814 1622 811 72 --31910 860 383 11377
NM_020157chr201833 1663 187 --
NM_020159chr441333 1220 145 112 11567 31301 487 103 --
NM_020177chr5122872 2425 2346 2316 2145 2118 2079 1194 959 702 667 96 33147 2718 347 43069 3056 1293 638 --
NM_020178chr175814 489 475 400 357 ----1986
NM_020180chr181527 21008 309 ----
NM_020182chr2063486 3216 2335 1117 522 338 23644 684 --1350
NM_020193chr113934 244 158 1471 21335 946 --
NM_020198chr1761576 1530 1307 1081 997 205 --21569 1157 --
NM_020199chr541099 1079 514 503 --31277 162 47 134
NM_020205chr172762 2492 2325 2240 2215 227 129 --32817 2484 1008 --
NM_020227chr51301 ------
NM_020228chr11132375 2158 2005 1815 1777 1746 1716 1692 874 772 592 570 479 --11738 --
NM_020232chr181181 1197 ----
NM_020239chr132324 2301 644 11550 11804 --
NM_020240chr572610 2179 1827 1105 594 341 177 --22539 2161 12462
NM_020243chr22171 --195 --
NM_020245chr695121 4662 4533 4434 1927 1220 718 521 419 --13350 14446
NM_020307chr3----1172 --
NM_020336chr2073445 3132 2582 1170 1092 246 166 33874 3027 267 12664 --
NM_020337chr411996 22490 1941 63052 2707 2312 2059 2013 959 22090 1044
NM_020338chr1013277 12847 33744 3387 899 --
NM_020341chr2062003 1934 1802 1542 599 473 1634 21945 449 --
NM_020342chr2122536 2504 2422 2317 2245 2231 1676 1645 484 385 264 49 1364 21726 757 --
NM_020345chr34912 833 823 319 --1402 1905
NM_020346chr1121675 226 21244 68 --11402
NM_020347chr3102326 2212 2177 2167 2110 2032 1989 1481 600 121 22017 864 1666 --
NM_020348chr1092407 2393 2344 2305 2042 1952 1835 435 46 1536 32785 2232 412 --
NM_020353chr361889 1847 1762 1749 1305 355 --31583 133 35 --
NM_020354chr103711 244 188 --1753 --
NM_020357chr351533 1505 1199 492 170 --1208 --
NM_020368chr4149 197 1296 --
NM_020381chr641974 1779 1674 1654 --2697 91 --
NM_020384chrX21782 560 --1129 --
NM_020390chr3174904 4826 4239 4066 4015 3952 3352 3263 3200 3055 1836 1436 1303 742 269 200 56 24738 1570 54870 3178 797 189 162 23101 1314
NM_020401chr121213 --275 27 --
NM_020403chr1341585 559 244 192 166 21721 122 130
NM_020405chr1753651 3480 3427 1485 29 --174 2631 355
NM_020416chr462689 2499 2209 778 349 171 --1370 --
NM_020420chrY91877 1733 1481 565 521 447 208 197 176 11517 21570 406 1612
NM_020423chr1--3412 402 23 ----
NM_020425chr651672 1635 1359 780 152 31884 587 457 1766 --
NM_020432chr731999 1782 1418 11674 2880 388 --
NM_020438chr9------1145
NM_020439chr1134 ------
NM_020440chr1103383 3245 3089 3079 2765 1130 586 505 307 248 22830 2613 43208 2155 325 274 --
NM_020443chr1126535 6157 5420 5117 4772 2451 2358 1755 1427 1117 785 288 45107 2645 2005 1216 35900 2692 253 --
NM_020453chr492077 1804 1797 1713 1418 467 389 250 82 --1563 --
NM_020455chr682815 2645 2232 2134 1018 840 745 287 11076 32679 2661 2077 --
NM_020456chr1322074 739 167 21796 408 12299
NM_020463chr23611 459 83 31227 1069 365 21351 990 11346
NM_020465chr1631684 1546 216 --11731 --
NM_020466chr694381 3650 3123 1892 1570 1527 1198 1041 432 13313 24163 3114 --
NM_020473chrX41441 302 245 104 --21819 1661 --
NM_020474chr1851883 1758 1541 1246 737 --2788 157 --
NM_020532chr2----1770 --
NM_020640chr392222 2152 1823 1626 861 737 622 610 526 2298 136 11960 11662
NM_020644chr112907 325 1806 41017 343 331 237 --
NM_020651chr281811 1789 1480 1452 612 501 261 121 --21795 405 --
NM_020652chr173479 177 121 1215 ----
NM_020653chr17247 36 ------
NM_020654chr331103 488 97 1233 31486 1336 1025 --
NM_020657chr1941960 1740 1459 569 --22003 1543 21796 1598
NM_020673chr20177698 6900 5784 5472 5452 4879 3069 2679 1764 1711 1455 1312 1292 1260 1072 822 394 37499 6294 1583 55802 5737 5696 5202 1900 --
NM_020686chr1622484 320 12268 22857 930 --
NM_020693chr111363 ------
NM_020697chr821058 904 --21138 293 --
NM_020699chr175397 4438 4394 4317 4092 3807 3458 --55366 4850 4423 1698 1354 --
NM_020708chr2031606 828 652 --22350 2168 12535
NM_020711chr272632 2422 2361 1768 1757 1688 1043 3835 824 196 1895 --
NM_020715chr1422063 187 1914 52185 1698 624 483 355 --
NM_020717chrX134954 4475 4329 4192 4101 3607 3083 1721 1690 1127 799 688 498 14422 ----
NM_020718chr16145067 4910 4852 4816 4702 4538 4152 2335 1719 1700 1367 1330 1031 854 34960 2565 1763 74995 4592 4046 2269 1374 814 320 11685
NM_020726chr52573 455 ----1135
NM_020727chr2153918 1482 1368 1307 187 23427 501 43503 3493 2558 921 32836 1520 174
NM_020728chr783162 2491 1202 884 838 780 180 95 12444 42449 2403 2025 893 --
NM_020731chr553376 3368 3334 3305 178 --13164 --
NM_020732chr61163 --1910 1350
NM_020734chr12103052 2882 2745 2391 1166 903 570 443 381 40 33340 2839 496 23078 2665 22448 1206
NM_020738chr21271 11558 ----
NM_020739chr15164130 4105 4054 3971 3807 3789 3751 3487 3476 2706 2681 1356 1092 755 600 175 1358 3896 538 194 23907 3414
NM_020742chrX72733 1012 1006 713 684 611 130 --12419 12414
NM_020747chr52947 83 1847 ----
NM_020748chr1771784 813 695 649 566 336 236 2704 153 41732 1698 585 307 11546
NM_020750chr651470 1450 1435 557 484 ------
NM_020752chr1092927 2763 2657 1905 736 696 456 305 194 2880 669 42243 769 581 568 11995
NM_020760chr221964 252 1710 32022 1409 314 11490
NM_020762chr122796 36 --2188 82 1788
NM_020766chrX43811 944 889 114 24485 4130 33473 3203 207 11779
NM_020768chr562944 2753 2152 1126 887 418 11141 2478 425 --
NM_020772chr17288448 8266 7404 7385 7208 7136 7092 7046 7032 6922 6865 5883 5354 3013 2970 2795 2516 2465 2367 2150 1818 1778 1329 1236 1154 1067 1016 733 98693 7434 6951 6914 6391 6211 2333 2062 758 67987 6532 5965 5375 2704 1915 27790 7266
NM_020773chr422669 160 ----22640 998
NM_020774chr18205860 5836 5564 5454 4865 4779 4663 4464 4451 2409 2096 1677 1597 1408 1257 787 651 311 238 93 46150 4800 4152 1240 85422 5351 4620 3877 2290 1469 930 606 12126
NM_020778chr1594963 4880 4408 3983 3263 1780 1712 410 73 24196 3676 --14454
NM_020779chr2123170 2986 2454 2082 1013 820 718 686 456 404 302 131 --32599 2389 162 --
NM_020782chr12134748 4486 4351 4083 1859 1819 1704 1594 958 951 928 899 190 11239 43624 1929 1906 970 --
NM_020783chr18102125 1984 954 862 697 425 210 179 157 54 1559 32003 1621 662 --
NM_020792chr361857 980 789 569 527 184 --32672 305 162 --
NM_020794chr181367 1349 1332 1113 1080 978 302 78 1541 --11405
NM_020796chr572909 2482 2037 1063 1037 889 598 1538 11122 --
NM_020800chr33990 936 364 128 --1583
NM_020801chr532532 464 211 42301 2285 528 476 12619 --
NM_020803chr43622 335 147 --1497 --
NM_020805chr1851912 1840 1428 284 244 51976 1963 1300 697 256 ----
NM_020809chr1121431 188 12174 12234 --
NM_020810chr1463477 3306 2950 2516 2265 995 42227 546 149 76 33131 278 231 --
NM_020819chr63418 380 128 3778 271 167 2879 801 31026 963 208
NM_020824chr104589 563 556 527 ----1144
NM_020825chr1653744 3432 2599 2459 883 1686 ----
NM_020830chr272443 2168 1143 970 739 647 502 12300 2987 784 --
NM_020832chr1------1249
NM_020834chr1451912 1611 1319 648 115 --11278 --
NM_020841chr12134079 4051 4022 3753 3685 3463 3416 3296 3076 1268 1193 1133 878 --43097 1103 233 142 1913
NM_020844chr8147423 7248 6732 5570 5366 4836 2849 2791 1982 1747 1295 978 396 273 1575 47337 7277 7142 6702 16181
NM_020853chr1282593 2287 2015 1985 1940 1847 989 297 --31890 1103 280 --
NM_020854chr1821368 448 --2303 262 1118
NM_020856chr1941420 418 233 77 11340 11290 --
NM_020858chr1542210 1957 934 731 1782 22216 137 --
NM_020859chr463562 2512 1500 1352 636 573 23515 832 34012 3730 2763 --
NM_020860chr42766 432 1332 --192
NM_020861chr651156 971 871 248 194 1458 2887 345 --
NM_020865chr34455 153 99 64 ------
NM_020866chr132849 244 11073 ----
NM_020868chr271888 1869 1671 1545 1308 517 329 11567 11385 11815
NM_020870chr472212 1863 550 388 337 312 253 21938 1837 21974 722 --
NM_020871chrX52470 1608 819 632 198 1664 62456 1746 1646 834 376 331 --
NM_020872chr341222 659 234 193 1580 31490 1162 109 --
NM_020892chr71363 ------
NM_020897chr11185 --1887 1868
NM_020909chr2174123 4070 4046 3729 3576 3299 2837 2686 2648 1495 1433 946 749 514 449 223 126 11571 11264 11257
NM_020918chr1082350 1368 1153 924 915 698 402 313 --21142 1123 --
NM_020921chr14133566 3466 3412 3067 3038 2560 2384 2356 2264 1233 1128 1094 1020 42480 1260 396 231 33637 3397 2416 --
NM_020922chrX21370 542 11690 1752 --
NM_020925chr141080 992 579 561 ----11203
NM_020926chrX2399 109 ------
NM_020927chr1622337 2280 1764 ----
NM_020935chr2104358 4340 4117 3887 3543 2919 2895 1213 614 184 1899 44517 3821 1373 471 --
NM_020940chr1032367 867 575 11957 62538 2484 2004 565 444 318 32655 2027 437
NM_020948chr1193411 3050 2435 2427 2398 2346 2321 2263 1466 1283 1263 1254 964 918 843 808 772 754 54 23335 2613 63378 2688 1026 746 371 289 1128
NM_020952chr92843 152 ----1830
NM_020961chr46526 500 456 405 247 114 ----180
NM_020964chr18114857 4464 3990 3023 1920 1718 1541 1397 1164 950 455 14700 74540 4221 3533 1102 159 74 54 --
NM_020975chr1071899 1699 1641 1577 1333 1285 150 ------
NM_020977chr462100 1919 1487 1382 348 57 ------
NM_020987chr1041314 954 304 184 ------
NM_020993chr1262762 1829 1752 978 808 69 --22798 2743 --
NM_021003chr143255 71 60 192 ----
NM_021005chr155845 837 297 186 70 --1737 --
NM_021032chr361944 1585 1265 795 628 408 ------
NM_021033chr1392939 2768 2744 2270 1390 1253 1209 1104 592 33194 1062 231 23150 1171 1784
NM_021038chr312323 11252 53359 3091 2947 2444 411 1827
NM_021069chr472091 1880 1583 1518 1452 606 237 --32034 1401 1384 --
NM_021072chr572269 2190 2088 1881 1674 684 421 1827 1721 --
NM_021083chrX183580 2792 2748 2741 2698 2511 2351 1456 1446 1069 1048 1021 985 975 913 852 622 481 1687 43652 2603 1416 1123 --
NM_021088chr252107 798 745 450 212 11463 21685 870 --
NM_021090chr2294537 4043 4008 3454 1648 1253 1186 724 231 14991 33588 3422 251 --
NM_021097chr252811 2786 2733 2680 2524 12747 11910 --
NM_021101chr372563 2449 1800 907 737 531 87 32400 2263 894 1499 --
NM_021109chrX1384 --180 --
NM_021109chrX1384 --180 --
NM_021110chr83796 569 252 ----1671
NM_021116chr7119047 8972 8857 8467 8451 7874 7428 2744 2037 1487 1079 15902 ----
NM_021120chrX22176 514 11038 1653 --
NM_021127chr1841483 1322 1121 1099 ----11220
NM_021132chr101389 21016 921 11185 --
NM_021136chr141536 --1237 1651
NM_021137chr1752385 2321 2066 2059 2044 --21742 1572 --
NM_021140chrX71003 815 750 439 358 279 225 3875 734 418 ----
NM_021144chr9--1545 ----
NM_021148chr722184 392 --22455 996 12469
NM_021151chr741069 1047 445 94 1290 41116 1011 401 315 --
NM_021155chr1943033 2675 977 959 1187 32412 2283 735 --
NM_021159chr481720 1486 1270 611 552 387 309 38 11165 1189 --
NM_021167chr732783 2246 1005 12097 12222 --
NM_021179chr12159 45 ------
NM_021183chrX82505 2258 2162 2005 1868 1784 1707 522 31792 1605 81 42568 1952 302 262 12427
NM_021190chr121175 1065 --31380 1001 254 11136
NM_021191chr1242483 2432 2070 620 22141 780 32232 2164 310 --
NM_021201chr1151878 175 159 121 65 2401 235 32044 1498 1422 11792
NM_021204chr43934 148 83 1883 ----
NM_021215chr2062390 2214 2189 2178 336 233 ------
NM_021229chr1261238 1166 777 455 143 90 4873 866 805 55 ----
NM_021238chr1282086 1304 1284 835 802 411 315 49 --2725 243 --
NM_021239chr1471380 1286 569 145 130 67 60 1385 1104 --
NM_021249chr1441561 419 410 346 149 11228 --
NM_021252chr1051714 1352 616 467 430 1251 1276 --
NM_021255chr14143767 3570 3009 2867 2796 2531 1583 1425 1371 898 680 621 597 571 34000 330 27 32667 1396 690 11630
NM_021572chr64414 395 359 296 ------
NM_021574chr2282080 2044 962 949 907 868 488 316 ------
NM_021614chr53309 233 32 1270 2243 62 --
NM_021620chr6------1669
NM_021622chr1061764 1645 733 555 382 180 --21986 354 --
NM_021629chr3154461 4224 4136 4036 3844 3823 2024 1520 1485 1437 1082 793 507 217 133 24200 1508 31708 1469 353 --
NM_021638chr4124973 4941 4630 3803 3790 3112 2014 1261 1140 504 223 210 24878 1567 ----
NM_021639chr12741 633 ------
NM_021643chr231248 427 386 ----11354
NM_021644chr104207 194 71 55 193 1418 31001 867 334
NM_021645chr1332116 2029 1997 31701 500 279 11606 --
NM_021647chr473737 3489 3255 3108 1054 732 558 13086 31580 681 445 11394
NM_021722chr73600 477 4