TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548au-3p
miRNA Sequence: UGGCAGUUACUUUUGCACCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr54535 514 162 52 ------
NM_000038chr51662 --11306 150
NM_000074chrX1157 --189 --
NM_000081chr141867 1560 1420 496 21184 418 ----
NM_000084chrX86582 6308 4432 2633 1708 1023 991 408 55775 5646 2779 2722 1660 26757 4571 12654
NM_000093chr962498 2435 2055 2035 1658 225 31994 798 361 ----
NM_000109chrX42654 2440 1654 625 ----1641
NM_000110chr11238 1266 1327 --
NM_000114chr2041255 1146 1055 807 11279 ----
NM_000125chr683775 3741 3671 3026 1707 1268 1177 933 13855 ----
NM_000135chr162350 109 1984 2971 146 --
NM_000138chr1512116 12604 ----
NM_000142chr411190 11378 ----
NM_000155chr91118 ------
NM_000158chr3--163 ----
NM_000161chr141368 2262 43 --1230
NM_000168chr742382 1163 269 21 --1197 --
NM_000176chr542807 1244 878 514 --12404 --
NM_000210chr22383 328 --2408 226 --
NM_000214chr2031787 1725 1308 --161 --
NM_000216chrX43745 3377 677 28 13214 196 13866
NM_000217chr1275234 4572 1937 1681 742 543 441 --13282 24273 138
NM_000245chr752171 1870 1636 103 57 11660 11963 --
NM_000248chr372918 2374 2341 2043 1918 1138 488 12351 135 --
NM_000252chrX1387 1448 --1510
NM_000255chr61344 ------
NM_000259chr15135934 5869 5063 4805 4232 3923 2235 1968 1841 1741 1313 648 634 12509 14901 --
NM_000264chr923059 690 22557 857 172 --
NM_000266chrX139 ------
NM_000267chr1773376 3285 3221 1254 1187 252 184 1329 ----
NM_000271chr18130 ----1603
NM_000276chrX52201 2024 1849 672 538 1197 --11995
NM_000289chr12--1255 ----
NM_000304chr1731098 1015 985 --1813 --
NM_000309chr1133 ------
NM_000314chr1062986 2961 2470 1250 1040 644 ------
NM_000319chr1231217 864 312 11084 1132 1327
NM_000321chr1351752 1738 1255 475 273 ------
NM_000332chr697216 6484 6284 6025 5931 5144 2373 1280 679 12518 26525 934 1713
NM_000333chr321059 231 1432 1262 --
NM_000335chr362126 1673 1519 1415 500 270 11957 11812 11464
NM_000337chr535556 5447 2254 2266 67 1676 --
NM_000345chr42910 392 1762 ----
NM_000346chr1731654 1502 1267 --1733 --
NM_000348chr251560 1451 1083 68 59 ----153
NM_000359chr142188 50 ------
NM_000368chr9104856 4750 4641 3189 3171 3072 1342 1239 868 523 --23758 3051 11467
NM_000369chr1431851 710 184 --198 11352
NM_000378chr11--1260 155 --
NM_000380chr91482 ------
NM_000386chr172576 48 ----1294
NM_000393chr241837 1760 1422 604 ------
NM_000408chr243327 3138 2437 761 13388 23087 106 --
NM_000421chr171105 ------
NM_000424chr123125 57 22 ------
NM_000428chr1442228 1979 861 176 1813 22374 2216 11709
NM_000430chr1783468 3454 2794 2697 2638 2492 2479 1012 33047 2300 736 ----
NM_000439chr53978 399 144 ------
NM_000447chr13470 427 31 ------
NM_000451chrX31968 381 260 11341 ----
NM_000452chr1332069 1868 1398 ------
NM_000461chr344600 1475 737 62 13265 2579 154 --
NM_000462chr1581785 1635 1603 750 657 563 499 354 1425 ----
NM_000480chr113417 294 147 ----1281
NM_000489chrX52981 2422 830 608 88 ------
NM_000503chr82368 32 11354 ----
NM_000522chr721318 178 1209 ----
NM_000533chrX21923 262 ------
NM_000544chr6_cox_hap13476 402 294 ------
NM_000555chrX147796 7748 6474 6362 6210 6147 6070 2933 2514 1775 1710 1584 1421 823 11112 ----
NM_000572chr11805 ------
NM_000599chr233828 3155 3097 34119 3593 3256 ----
NM_000601chr71330 --141 --
NM_000602chr721548 446 2966 430 ----
NM_000609chr1082985 2330 2172 2112 1128 1070 733 682 22385 111 --12264
NM_000615chr1131906 886 621 12259 1783 --
NM_000618chr1245747 5553 5326 1132 15018 ----
NM_000618chr1245747 5553 5326 1132 15018 ----
NM_000619chr123503 362 190 ------
NM_000621chr1331337 905 24 11425 ----
NM_000625chr171463 --2349 27 --
NM_000627chr22650 126 ------
NM_000633chr1854587 3694 3611 1802 95 35215 1117 209 --1315
NM_000668chr41433 ------
NM_000673chr42742 315 ------
NM_000678chr202293 122 --1793 --
NM_000681chr1051127 1024 936 99 38 1186 --11222
NM_000684chr1011136 ------
NM_000685chr3--1573 1827 --
NM_000685chr3--1573 1827 --
NM_000689chr92397 385 ------
NM_000719chr1296727 5962 4453 2575 2407 1629 1460 1340 651 16028 --14401
NM_000721chr142301 1922 487 180 2474 211 ----
NM_000723chr1771585 1460 1400 1382 1277 1164 375 ------
NM_000724chr1031654 1482 254 ----1269
NM_000780chr8146 --1511 --
NM_000800chr541516 1067 346 207 --1262 --
NM_000806chr551795 1577 1348 1227 88 11737 ----
NM_000807chr42213 177 ----184
NM_000809chr479011 7930 6466 6373 3508 1841 1515 --31475 1087 752 12820
NM_000810chr151146 --1493 --
NM_000812chr43410 379 82 ------
NM_000813chr585037 5002 4815 3883 3721 1895 1684 1506 ------
NM_000814chr1513229 1798 13783 11630
NM_000817chr251176 1041 909 801 383 2448 351 ----
NM_000824chr43657 292 137 ------
NM_000826chr432347 1923 497 ------
NM_000827chr55958 753 645 624 325 11989 ----
NM_000829chr113484 339 37 --12211 --
NM_000831chr166169 4226 1783 1761 568 178 44797 4372 460 366 11257 2225 109
NM_000833chr1611233 ------
NM_000834chr121469 ------
NM_000838chr672751 2537 2179 2022 154 145 136 12146 ----
NM_000841chr62250 159 ------
NM_000860chr411407 --21297 577 --
NM_000868chrX32497 1752 1687 11736 ----
NM_000872chr1021439 409 ------
NM_000875chr15106282 6167 6123 2378 1873 1445 1273 717 580 133 --36985 5711 124 1367
NM_000880chr82890 41 ------
NM_000891chr1731203 784 390 22296 1213 --22541 524
NM_000899chr1263979 1755 538 397 321 256 11468 --23928 1536
NM_000912chr833558 2781 2544 12674 --12370
NM_000917chr101153 ------
NM_000919chr52454 99 ------
NM_000933chr202630 345 11798 ----
NM_000945chr241752 770 753 169 1721 --11769
NM_000950chrX83489 2955 2775 1198 1066 1051 885 387 12411 22733 325 --
NM_000953chr1441522 1198 608 468 ------
NM_000957chr11226 ------
NM_000958chr521256 390 ------
NM_000961chr2073250 2821 1481 1441 848 553 327 23583 3553 13705 --
NM_000965chr3181 --1473 --
NM_001001132chr2131451 131 70 ------
NM_001001323chr1273047 2883 1089 925 875 829 316 12023 ----
NM_001001330chr101165 ------
NM_001001331chr352213 2136 757 536 422 148 --11661
NM_001001344chrX62453 2250 2155 2044 1978 817 ------
NM_001001395chr1262686 2297 2107 1795 588 148 --22474 170 --
NM_001001433chr2042069 1236 942 232 21110 1077 22850 79 --
NM_001001436chr16190 --1730 --
NM_001001479chr222795 622 ------
NM_001001481chr853247 923 820 504 352 1623 ----
NM_001001484chr1041986 573 313 169 11728 ----
NM_001001485chr3--131 1331 --
NM_001001521chr21302 ------
NM_001001522chr112316 143 ------
NM_001001557chr821554 1362 --22094 407 11725
NM_001001664chr242733 2576 645 535 --21307 634 --
NM_001001706chr661241 786 261 255 249 227 --11162 --
NM_001001710chr91115 ------
NM_001001715chr132427 162 ------
NM_001001787chr1------1456
NM_001001890chr21114218 4130 3786 3108 2704 2658 2604 1560 1271 513 325 13020 11671 14034
NM_001001974chr1042397 700 647 113 1445 1833 --
NM_001001994chrX1347 ------
NM_001001995chrX41240 133 120 61 ------
NM_001001996chrX1347 ------
NM_001002009chr7149 1390 ----
NM_001002010chr7149 1390 ----
NM_001002032chr17123 --1542 --
NM_001002033chr172123 56 --2642 532 --
NM_001002243chr21344 ------
NM_001002257chr252538 1423 1331 1264 388 1110 1872 --
NM_001002258chr241647 1267 726 80 11776 ----
NM_001002269chr91444 ------
NM_001002295chr1031111 1073 753 1775 1790 1433
NM_001002762chr1062335 1174 1040 463 317 48 12212 --12599
NM_001002838chrX31755 1300 658 11471 1378 --
NM_001002860chr1454636 4208 1226 1218 1052 34041 3886 355 ----
NM_001002909chr1732106 1903 805 ----1296
NM_001002914chr17----11289 --
NM_001003398chr122179 93 ----127
NM_001003652chr1877676 7483 7131 7027 6569 3107 816 --17356 1689
NM_001003674chr18116971 6781 6497 5534 4642 4383 2569 1133 967 619 160 14573 12688 14423
NM_001003675chr18116971 6781 6497 5534 4642 4383 2569 1133 967 619 160 14573 12688 14423
NM_001003682chr141466 1020 981 181 2579 483 --11264
NM_001003688chr42869 126 --1907 --
NM_001003694chr32492 64 ----1658
NM_001003698chr621876 1499 11278 ----
NM_001003699chr621876 1499 11278 ----
NM_001003712chr1244001 3666 3236 603 13897 11383 --
NM_001003760chr623666 2695 12397 ----
NM_001003792chr31858 ------
NM_001003793chr31858 ------
NM_001003794chr353049 2952 2114 741 356 12315 ----
NM_001003800chr942577 537 259 222 12712 13281 --
NM_001003805chr14161 ------
NM_001003810chr41218 ------
NM_001003927chr172449 174 ------
NM_001003940chr1543785 3577 3221 3116 1762 23717 1232 --
NM_001003942chr1543785 3577 3221 3116 1762 23717 1232 --
NM_001003943chr1553789 3581 3225 3120 2347 1766 23721 1236 --
NM_001004065chr932942 2927 136 ----13772
NM_001004304chr122985 419 22006 865 13056 --
NM_001004317chr6104337 3990 3784 3566 3506 3048 3039 2771 585 122 23281 670 --1529
NM_001004330chr122345 176 ------
NM_001004342chr195998 5496 5486 5221 3715 2207 1796 1592 404 26115 202 34797 1779 1649 24017 196
NM_001004419chr1243861 3744 3324 753 21571 279 11780 --
NM_001004720chr21943 --149 --
NM_001004722chr211112 --1218 --
NM_001005158chr31170 ------
NM_001005159chr31170 ------
NM_001005209chr22724 496 168 ----
NM_001005332chrX2209 153 ------
NM_001005333chrX2209 153 ------
NM_001005366chr123242 44 38 1378 ----
NM_001005375chrY41849 574 250 29 ------
NM_001005386chr24486 480 434 303 2945 56 1200 12277
NM_001005404chr1754328 3996 787 534 447 --32795 964 330 --
NM_001005417chr13554 73 37 1268 ----
NM_001005463chr1092589 2494 2139 1984 1928 1598 694 578 327 1722 12353 --
NM_001005473chr585970 5935 5412 4140 1175 1096 771 145 --35926 4939 4707 --
NM_001005474chr32516 259 140 ----
NM_001005476chr21570 1701 ----
NM_001005505chr361655 1497 1423 337 318 220 --11161 --
NM_001005526chr2193 ------
NM_001005732chr212262 199 ------
NM_001005733chr211199 ------
NM_001005753chr262049 1663 726 409 377 283 ----149
NM_001005781chr22404 222 ------
NM_001005782chr23853 671 417 ------
NM_001005785chrY41849 574 250 29 ------
NM_001005786chrY41849 574 250 29 ------
NM_001005845chr82704 96 ------
NM_001005849chr17174 ------
NM_001006115chr3102773 2596 2475 2120 2110 1949 1915 1852 525 243 11103 ----
NM_001006600chr52690 319 ------
NM_001006617chr921116 932 1188 ----
NM_001006618chr9----157 --
NM_001006619chr921116 932 1188 ----
NM_001006620chr921116 932 1188 ----
NM_001006621chr921116 932 1188 ----
NM_001006623chr262214 2032 1968 943 536 259 21766 824 ----
NM_001006634chr162665 555 ------
NM_001006636chr2----1959 --
NM_001006657chr252438 2210 1267 179 26 ------
NM_001006665chr11815 ----1125
NM_001006681chrX1133 ------
NM_001006682chrX1133 ------
NM_001006683chrX1133 ------
NM_001006944chr114672 287 253 105 ------
NM_001007024chr1752716 604 578 382 86 1513 11129 1399
NM_001007025chr1752716 604 578 382 86 1513 11129 1399
NM_001007027chr111202 --1266 --
NM_001007067chr82739 434 ------
NM_001007068chr82739 434 ------
NM_001007069chr82739 434 ------
NM_001007070chr82739 434 ------
NM_001007094chr1033453 645 536 1810 --12995
NM_001007097chr964720 4514 1075 967 373 82 64457 4447 3225 1068 622 58 ----
NM_001007098chr13845 672 376 --2239 106 --
NM_001007099chr13214 204 192 ------
NM_001007100chr13214 204 192 ------
NM_001007102chr63546 505 196 --21147 554 --
NM_001007189chr5126 ------
NM_001007226chr172503 124 160 11385 --
NM_001007227chr172503 124 160 11385 --
NM_001007228chr172503 124 160 11385 --
NM_001007229chr172503 124 160 11385 --
NM_001007230chr172503 124 160 11385 --
NM_001007231chr21577 ------
NM_001007237chr172373 1765 952 925 849 657 163 --22584 772 --
NM_001007246chr2141243 708 515 449 ----1603
NM_001007257chr11150 1569 ----
NM_001007271chr101198 1432 1267 --
NM_001007553chr11288 ------
NM_001007559chr1822062 277 ------
NM_001008220chr553293 2505 1181 1145 334 42722 778 743 320 1860 13171
NM_001008222chrX51422 1097 524 387 108 ------
NM_001008225chr72689 567 ------
NM_001008239chr1822890 956 23143 2874 12422 1324
NM_001008392chr383601 3324 3305 2793 2226 1412 1234 603 31084 1010 843 1312 --
NM_001008407chr721387 321 1394 --1518
NM_001008491chr211858 11900 11967 --
NM_001008492chr211858 11900 11967 --
NM_001008539chr844387 4102 4069 1989 25048 4653 25354 4203 --
NM_001008541chr1052368 1857 1712 912 719 --12238 1701
NM_001008541chr1052368 1857 1712 912 719 --12238 1701
NM_001008564chr1331619 1438 85 12038 11576 --
NM_001008566chr222321 116 132 ----
NM_001008567chr92244 28 ------
NM_001008660chr1131152 366 212 --2350 83 --
NM_001008738chr562452 2354 2176 985 868 801 ------
NM_001008783chr61590 ----1878
NM_001009554chr494641 4503 4247 3764 3465 1133 1107 1043 706 21343 514 11251 --
NM_001009554chr494641 4503 4247 3764 3465 1133 1107 1043 706 21343 514 11251 --
NM_001009567chr102629 150 ------
NM_001009880chr2244406 4152 3805 416 24762 56 11014 --
NM_001009894chr122550 477 ----11182
NM_001009899chr385686 5643 5536 5527 5243 4177 2386 203 12421 12401 --
NM_001009958chr72576 459 ------
NM_001009993chr263906 1192 631 582 240 217 ------
NM_001009997chr101331 ------
NM_001010000chr1873270 3190 2984 2865 1121 1075 577 --1921 --
NM_001010854chr141540 1511 ----
NM_001010888chrX24636 3261 1228 ----
NM_001010895chr92291 73 ------
NM_001010898chr142739 2558 1082 616 11231 ----
NM_001010924chr1021222 868 1877 1821 141
NM_001010932chr71330 --141 --
NM_001010934chr74275 224 160 48 ------
NM_001010942chr12144 21253 263 ----
NM_001010986chrX42484 2399 1723 1569 ------
NM_001010989chr163488 439 72 ------
NM_001010990chr163488 439 72 ------
NM_001011513chr424145 515 ------
NM_001011537chr3150 --11950 --
NM_001011553chr72650 391 1703 --1373
NM_001011658chrX22116 1826 ------
NM_001011663chr10286 53 ------
NM_001011666chr765627 5443 4678 1367 1289 1118 --16062 15540
NM_001011713chr1451572 1394 1299 1107 75 ------
NM_001011885chr1531781 1747 1511 ------
NM_001012393chr1133468 3335 1717 --24730 4158 14326
NM_001012398chr16296 79 1117 1993 11122
NM_001012420chr1532912 944 24 1349 --12692
NM_001012423chr1532912 944 782 1349 --12692
NM_001012426chr673392 2578 2458 2364 2159 587 536 13366 23014 274 --
NM_001012427chr673392 2578 2458 2364 2159 587 536 13366 23014 274 --
NM_001012732chr41154 1357 ----
NM_001012751chr10----21968 74 --
NM_001012755chrX73605 3595 3528 1978 819 751 479 11759 --14486
NM_001012968chrX42015 858 692 195 --1885 --
NM_001012977chrX31132 412 278 ------
NM_001012979chrX--145 ----
NM_001012989chrX1558 1180 ----
NM_001013031chr1073415 3264 3005 2936 848 715 679 1474 ----
NM_001013399chr631140 981 446 ------
NM_001013415chr431383 1239 409 1570 ----
NM_001013437chr181303 ------
NM_001013620chr1276998 6735 6573 6297 5308 2786 22 26352 763 38423 7781 2129 --
NM_001013622chr49465 416 404 280 221 169 157 95 33 1343 ----
NM_001013635chr123889 218 107 --1826 --
NM_001013693chr132883 2555 2216 12709 2750 614 --
NM_001013693chr132883 2555 2216 12709 2750 614 --
NM_001013839chr1732273 720 307 ----12423
NM_001014380chr1354801 4392 3602 1530 136 34546 4042 1761 11604 --
NM_001014765chr11633 1643 2418 48 --
NM_001014797chr1067779 6239 5091 1594 1469 1375 17108 --36216 5817 248
NM_001015045chr410798 599 541 508 479 398 229 156 51 34 1515 ----
NM_001015508chr81662 --1516 --
NM_001015877chrX52548 2407 2398 2332 107 --1135 --
NM_001015880chr1051546 1401 1194 1117 83 --21646 1158 --
NM_001015887chr321597 1364 11648 1297 --
NM_001017368chr1731880 1013 493 --1721 --
NM_001017371chr221266 190 ------
NM_001017395chr383585 2804 2643 2383 2230 1009 328 160 --33277 2501 2326 --
NM_001017405chr44928 777 764 646 ------
NM_001017415chr1----1749 --
NM_001017416chr1----1749 --
NM_001017424chr141908 1867 1590 1491 ------
NM_001017425chr141908 1867 1590 1491 ------
NM_001017440chr7167834 7320 6678 6306 6170 5491 5156 5112 3228 3065 3058 1991 1936 1636 615 587 32588 758 633 --28167 7726
NM_001017523chr124687 281 268 127 1755 21680 118 --
NM_001017923chr14--11226 --11241
NM_001017926chr831566 720 391 ------
NM_001017962chr101153 ------
NM_001017969chr91615 ------
NM_001017979chr44739 244 145 36 ------
NM_001017989chr19380 46 34 21249 900 ----
NM_001017999chr171972 1615 937 748 742 420 25 ------
NM_001017999chr171972 1615 937 748 742 420 25 ------
NM_001018000chr171972 1615 937 748 742 420 25 ------
NM_001018000chr171972 1615 937 748 742 420 25 ------
NM_001018001chr171972 1615 937 748 742 420 25 ------
NM_001018009chr321085 978 --1114 --
NM_001018025chrX3879 583 177 --1125 1265
NM_001018037chr941253 1163 451 340 ------
NM_001018050chr2273319 2810 2145 1222 891 668 446 1709 ----
NM_001018052chr2273319 2810 2145 1222 891 668 446 1709 ----
NM_001018054chr131445 276 177 ------
NM_001018056chr9------1482
NM_001018057chr1131168 954 224 --11358 --
NM_001018064chr932049 749 95 --175 --
NM_001018065chr944963 1577 1361 430 16077 14693 --
NM_001018066chr944963 1577 1361 430 16077 14693 --
NM_001018067chr154837 4233 3661 2093 924 1108 --13953
NM_001018068chr154837 4233 3661 2093 924 1108 --13953
NM_001018069chr154837 4233 3661 2093 924 1108 --13953
NM_001018072chr124687 281 268 127 1755 21680 118 --
NM_001018074chr542807 1244 878 514 --12404 --
NM_001018075chr542807 1244 878 514 --12404 --
NM_001018076chr542807 1244 878 514 --12404 --
NM_001018077chr542807 1244 878 514 --12404 --
NM_001020658chr111434 11478 1226 --
NM_001020658chr111434 11478 1226 --
NM_001020818chr1911491 1658 21403 432 --
NM_001020819chr1911491 1658 21403 432 --
NM_001020820chr1911491 1658 21403 432 --
NM_001020821chr1911491 1658 21403 432 --
NM_001020825chr51282 ------
NM_001022chr19----129 --
NM_001023567chr1562304 2027 1597 785 323 24 1848 --12079
NM_001024094chr542807 1244 878 514 --12404 --
NM_001024218chr141242 ------
NM_001024226chr121116 1089 --191 --
NM_001024227chr121116 1089 --191 --
NM_001024228chr121116 1089 --191 --
NM_001024372chr862029 716 340 238 195 97 --1258 11930
NM_001024401chr1652529 2345 1873 1842 930 22666 2261 1858 --
NM_001024455chrX52670 2512 2245 991 779 21983 69 1226 --
NM_001024647chr1276898 6247 4708 2365 2156 933 124 24925 1290 26880 908 26983 6204
NM_001024649chr532854 1973 1178 ------
NM_001024668chr126970 832 788 771 744 164 ------
NM_001024808chr12102569 2392 2340 1862 1026 902 857 830 267 218 1518 ----
NM_001024934chr61659 ------
NM_001024935chr61659 ------
NM_001024936chr61659 ------
NM_001024937chr171209 ------
NM_001024947chr51320 --2749 81 --
NM_001024948chr173229 2920 2837 2166 2148 1344 1281 12199 22285 384 --
NM_001024956chr1145185 4231 1125 143 24722 2267 --1914
NM_001025068chr321183 204 --11589 --
NM_001025069chr321183 204 --11589 --
NM_001025070chr5152 --138 --
NM_001025071chr5152 --138 --
NM_001025076chr1075697 5252 4794 4687 4110 2431 775 34768 2112 1484 34325 4206 487 --
NM_001025077chr10107055 6610 6152 6045 5468 4684 2133 911 883 423 36126 2842 102 35683 5564 1845 --
NM_001025079chr332572 1477 375 ----13338
NM_001025081chr181400 1383 2217 50 --
NM_001025090chr181400 1383 2217 50 --
NM_001025092chr181400 1383 2217 50 --
NM_001025101chr181400 1383 2217 50 --
NM_001025105chr531521 1166 359 ----11146
NM_001025108chr273887 3748 3480 3159 2707 2554 104 1458 13333 --
NM_001025266chr354559 3449 3108 1617 1177 13789 34916 3250 534 11385
NM_001025356chr1241986 1882 1026 731 1119 1985 12707
NM_001025389chr113417 294 147 ----1281
NM_001025390chr113417 294 147 ----1281
NM_001025579chr1721041 73 ------
NM_001025580chrX64134 3801 3172 2864 2669 735 11678 --13389
NM_001025595chr41165 1629 ----
NM_001025616chr441542 1524 711 606 1196 11844 --
NM_001025777chr221020 341 --188 --
NM_001025780chr93446 385 47 1302 ----
NM_001029858chr63694 557 115 1375 13324 --
NM_001029863chr653124 2854 2770 852 571 12227 ----
NM_001029875chr522648 449 --32582 779 177 --
NM_001029883chr261993 1912 853 817 543 140 ----12612
NM_001029891chrX3866 119 23 ------
NM_001029896chrX143 ----1255
NM_001029998chr431250 1241 921 1199 ----
NM_001030001chr142471 336 ------
NM_001030006chr1721070 200 1476 ----
NM_001030007chr1673994 3371 3130 2804 338 149 90 --23056 122 --
NM_001030055chr1464628 3530 1829 1486 1212 240 ------
NM_001031677chr51372 ------
NM_001031679chr1231267 1171 193 ------
NM_001031680chr162554 2147 1774 648 305 222 --22535 2473 --
NM_001031690chr72571 534 13040 12648 --
NM_001031692chr72305 82 ------
NM_001031695chr22115413 5125 4230 4108 3891 3633 1659 1457 1379 1291 257 15002 34318 3314 2013 --
NM_001031700chr441978 1803 943 331 ------
NM_001031716chr241025 170 162 82 1396 ----
NM_001031723chr41368 ------
NM_001031732chr433310 809 501 --11169 1356
NM_001031746chr1051374 1367 1138 1085 431 2503 477 1495 --
NM_001031803chr17----1289 --
NM_001031812chr542289 1791 926 584 11775 ----
NM_001031848chr181316 ------
NM_001031855chrX278 42 ------
NM_001032280chr671678 1487 1106 171 142 121 109 21660 185 ----
NM_001032283chr122424 50 ------
NM_001032284chr122424 50 ------
NM_001032288chr2041602 1318 317 234 1488 11084 --
NM_001032289chrX3924 797 750 1621 194 --
NM_001032293chr172623 430 ------
NM_001032296chr1352516 1865 1187 886 565 32819 2640 2484 32532 2439 1159 --
NM_001032363chr11563 --21523 400 2298 86
NM_001032363chr11563 --21523 400 2298 86
NM_001032999chr2065328 4921 4404 4158 4091 341 11044 31318 228 91 --
NM_001033026chr192648 100 --1686 --
NM_001033044chr151468 1279 1174 621 273 --21477 1192 11420
NM_001033047chr422474 902 1522 --1921
NM_001033049chr2152290 1965 1459 456 273 ------
NM_001033056chr151468 1279 1174 621 273 --21477 1192 11420
NM_001033057chr341575 1311 601 554 1415 ----
NM_001033081chr141890 1779 1701 1495 1545 ----
NM_001033082chr141890 1779 1701 1495 1545 ----
NM_001033085chr21233 ------
NM_001033087chr2073256 3203 2769 904 796 418 143 12451 --13150
NM_001033112chr5--1114 --1823
NM_001033117chr394747 4464 3624 3508 3085 2972 837 670 609 11288 14348 13414
NM_001033518chr782807 2494 2421 2200 1861 798 464 259 12301 12679 --
NM_001033519chr782807 2494 2421 2200 1861 798 464 259 12301 12679 --
NM_001033520chr782807 2494 2421 2200 1861 798 464 259 12301 12679 --
NM_001033551chr1783578 3548 3331 2625 1602 1390 321 203 23969 3372 13792 2783 611
NM_001033557chr221078 48 ----1580
NM_001033566chr172834 160 --1983 --
NM_001033568chr172834 160 --1983 --
NM_001033581chr1149 ------
NM_001033581chr1149 ------
NM_001033582chr1149 ------
NM_001033925chr1011985 12193 ----
NM_001034837chr53771 686 271 1189 1584 --
NM_001034838chr53771 686 271 1189 1584 --
NM_001034841chr16105382 5291 3734 3527 1937 1792 1742 1457 713 335 1126 ----
NM_001034850chr521605 94 1660 ----
NM_001034954chr1073280 2491 824 630 523 492 341 13128 ----
NM_001034955chr1073280 2491 824 630 523 492 341 13128 ----
NM_001034956chr1073280 2491 824 630 523 492 341 13128 ----
NM_001034957chr1073280 2491 824 630 523 492 341 13128 ----
NM_001035chr121310 811 2436 266 1393 1104
NM_001035003chr421179 993 --21334 1276 --
NM_001035004chr421179 993 --21334 1276 --
NM_001035005chr182487 417 ------
NM_001035511chr131747 474 312 ------
NM_001035512chr131854 581 419 ------
NM_001035513chr131854 581 419 ------
NM_001035534chr941005 438 270 21 1335 11346 --
NM_001037163chr73717 330 85 ------
NM_001037165chr7148876 6832 6627 6367 5572 5520 2707 2605 2586 2486 2247 1578 971 423 26940 2495 1473 13301
NM_001037331chr184684 639 341 234 ------
NM_001037332chr552267 1673 894 842 747 --12576 12368
NM_001037333chr552267 1673 894 842 747 --12576 12368
NM_001037442chr41519 ------
NM_001037553chr2144701 4277 4081 1621 --23872 408 --
NM_001037582chr431757 1106 1077 ------
NM_001037631chr221100 937 ------
NM_001037637chr53314 68 49 ------
NM_001037954chr1163277 2720 2167 643 619 590 11284 13477 --
NM_001038493chr211463 1423 ----
NM_001038702chr53937 644 284 31040 510 97 --12032
NM_001039348chr211052 --1418 --
NM_001039349chr211052 --1418 --
NM_001039459chr72359 212 1270 1738 --
NM_001039479chr1461969 1753 1652 1506 566 465 1581 ----
NM_001039538chr253704 3199 354 286 125 --1397 --
NM_001039547chr396322 6186 5673 5032 3097 2246 1722 1066 611 --23043 942 --
NM_001039574chr1------21014 409
NM_001039577chr163117 3096 2829 1786 1365 694 14163 54172 3511 925 248 217 --
NM_001039590chrX53893 3597 1549 595 136 --13542 --
NM_001039591chrX53893 3597 1549 595 136 --13542 --
NM_001039690chr1631970 1764 1510 22054 59 ----
NM_001039709chr2065328 4921 4404 4158 4091 341 11044 31318 228 91 --
NM_001039762chr1052221 1859 1537 673 93 ------
NM_001039771chr1421235 873 --1829 --
NM_001039772chr11--282 25 ----
NM_001039840chrX106016 4146 4001 2368 1979 1910 1470 1372 566 318 1635 --23709 701
NM_001039937chr1343946 1226 691 663 --11648 --
NM_001040001chr631882 1435 216 1194 11910 --
NM_001040002chr1751233 1152 1038 578 292 21383 314 1140 --
NM_001040057chr731522 1296 62 11151 ----
NM_001040092chr81367 ------
NM_001040100chr321006 967 1415 ----
NM_001040101chr44471 200 158 117 1476 --11117
NM_001040110chr761864 1370 671 224 206 157 --1571 --
NM_001040142chr231977 1499 238 ----1374
NM_001040143chr231977 1499 238 ----1374
NM_001040144chr1631970 1764 1510 22054 59 ----
NM_001040146chr1631970 1764 1510 22054 59 ----
NM_001040151chr1153129 3021 2964 2925 952 13527 14417 14489
NM_001040152chr7105042 4804 4766 4573 3490 813 795 673 444 432 34925 1505 1405 ----
NM_001040153chr132970 827 --1257 --
NM_001040159chr431194 439 138 ----11143
NM_001040181chr31349 ----2812 29
NM_001040182chr31349 ----2812 29
NM_001040183chr31349 ----2812 29
NM_001040199chr31349 ----2812 29
NM_001040200chr31349 ----2812 29
NM_001040202chr432555 2540 1706 12068 1172 --
NM_001040214chr621794 468 1638 ----
NM_001040272chr942360 2280 873 797 ------
NM_001040284chr16135886 5808 5413 4343 4253 2322 1835 1267 1145 873 169 121 23 12022 12069 14326
NM_001040402chr493069 2646 2349 2230 2051 906 710 432 67 1453 12324 12889
NM_001040424chr2172793 2667 2359 2327 1839 917 33 --1865 --
NM_001040429chr1343210 399 372 165 --22892 2217 --
NM_001040441chr135202 4257 3927 --23545 3327 --
NM_001040445chr254983 4251 2191 726 347 2768 133 25234 3586 --
NM_001040450chr1512252 12332 ----
NM_001040453chr1512252 12332 ----
NM_001040455chr114859 512 244 103 1504 21112 189 --
NM_001040661chr741082 1034 731 378 ------
NM_001040665chr7124865 4711 4694 4591 4352 3918 1638 1622 1404 1287 790 249 --11853 44229 1786 759 25
NM_001040666chr73567 293 54 ------
NM_001040697chr11----1115 --
NM_001040708chr82988 898 1931 ----
NM_001040712chr953031 664 551 527 441 12682 23087 2545 1348
NM_001040876chr421756 1198 11660 1408 --
NM_001042355chr1684568 4510 1786 1211 924 515 155 90 21469 729 15024 13366
NM_001042388chr181829 ------
NM_001042406chr621020 193 11012 1836 --
NM_001042410chr21170 ------
NM_001042412chr1684568 4510 1786 1211 924 515 155 90 21469 729 15024 13366
NM_001042413chr973555 3262 3222 2898 926 235 79 ------
NM_001042424chr412306 12898 --1490
NM_001042425chr671678 1487 1106 171 142 121 109 21660 185 ----
NM_001042430chr143487 145 103 1411 --189
NM_001042440chr531857 1314 491 --1243 --
NM_001042441chr531857 1314 491 --1243 --
NM_001042442chr531857 1314 491 --1243 --
NM_001042443chr531857 1314 491 --1243 --
NM_001042444chr531857 1314 491 --1243 --
NM_001042445chr531857 1314 491 --1243 --
NM_001042446chr531857 1314 491 --1243 --
NM_001042453chrX11664 ------
NM_001042479chrX51923 1886 1400 832 306 11566 11536 --
NM_001042480chrX51923 1886 1400 832 306 11566 11536 --
NM_001042481chr1452554 2499 2162 1774 162 ------
NM_001042492chr1773376 3285 3221 1254 1187 252 184 1329 ----
NM_001042498chrX31061 934 887 1758 1231 --
NM_001042506chrX2412 278 ------
NM_001042510chr881991 1837 617 542 405 92 76 46 ----1641
NM_001042511chr881991 1837 617 542 405 92 76 46 ----1641
NM_001042517chr133714 705 77 ----1782
NM_001042537chrX3960 884 461 --12155 --
NM_001042555chr1254726 4567 4272 3597 3050 13904 ----
NM_001042599chr297814 6649 5960 5504 5134 2768 1968 717 288 16298 27766 7156 --
NM_001042604chr3114165 3995 3637 3498 3377 3320 1626 1116 1052 1009 836 23168 593 34435 1394 661 --
NM_001042616chr4----1210 --
NM_001042632chr2092529 2510 633 471 342 267 259 222 164 2111 25 11739 --
NM_001042633chr2092529 2510 633 471 342 267 259 222 164 2111 25 11739 --
NM_001042669chr441542 1524 711 606 1196 11844 --
NM_001042749chrX11631 --11670 1663
NM_001042750chrX11631 --11670 1663
NM_001042751chrX11631 --11670 1663
NM_001043318chr1473933 3915 3388 1222 1030 779 398 11312 13512 --
NM_001043351chr152185 2064 1951 874 771 --2723 164 --
NM_001044385chr223523 3199 22521 1427 11189 12923
NM_001044722chr542289 1791 926 584 11775 ----
NM_001044723chr542289 1791 926 584 11775 ----
NM_001046chr532439 455 410 --1832 11167
NM_001048183chr153753 3134 1363 331 103 ------
NM_001049chr1422385 1838 ------
NM_001068chr33322 234 204 ------
NM_001071775chr1321907 440 ------
NM_001076778chr352129 1602 661 512 28 11686 --21560 1547
NM_001077628chr13645 535 122 --1259 --
NM_001079874chr131571 535 100 ------
NM_001083620chr432345 1921 496 ------
NM_001092chr1782163 1808 829 663 611 598 181 78 12376 1410 --
NM_001095chr1261773 1294 675 501 272 252 1346 169 --
NM_001096chr17--1290 --1827
NM_001099678chr396432 5038 4454 2201 1880 1794 1665 1286 807 15783 32348 2100 498 1378
NM_001100108chr1118314 6919 6240 5812 3342 2304 1528 536 356 347 243 67903 5835 2955 2717 2615 1695 37121 6503 2831 18266
NM_001106chr379069 8578 2187 1660 1232 1163 113 38392 8176 6765 17245 16592
NM_001113490chrX33244 2767 1282 11183 --23334 955
NM_001116chr1652590 2215 1233 600 213 --11117 --
NM_001117chr1842487 963 783 529 11929 --12087
NM_001122631chr113647 149 107 ----1525
NM_001122679chr54535 514 162 52 ------
NM_001128chr1673994 3371 3130 2804 338 149 90 --23056 122 --
NM_001144chr164259 226 109 103 --2450 25 --
NM_001146chr841957 640 240 69 11470 1266 156
NM_001148chr452213 763 649 602 178 --1801 --
NM_001149chr101551 2949 40 --1439
NM_001153chr21142 173 1123 --
NM_001156chr103645 419 162 ------
NM_001167chrX86700 6205 5892 2249 2198 1732 1315 754 ------
NM_001172chr142739 100 ------
NM_001173chr1464628 3530 1829 1486 1212 240 ------
NM_001177chr1242384 2081 1874 125 --11851 --
NM_001186chr2163304 2798 2479 2059 511 314 ------
NM_001187chr21--1409 ----
NM_001191chr2031477 1270 401 21077 77 ----
NM_001197chr223142 88 49 ------
NM_001198chr6------1591
NM_001201chr4103987 3886 3745 3265 3009 767 421 285 273 179 43309 3038 162 94 ----
NM_001204chr247052 5356 2791 395 --184 12635
NM_001206chr953019 2134 2080 791 122 ------
NM_001207chr53314 68 49 ------
NM_001219chr732298 1975 1550 11410 ----
NM_001241chr23633 555 348 1204 ----
NM_001241chr23633 555 348 1204 ----
NM_001253chr61291 --139 --
NM_001256chr172739 185 1511 ----
NM_001259chr796243 5598 4994 4111 1978 1395 1094 270 117 2317 288 1375 --
NM_001265chr131283 ------
NM_001270chr541113 918 308 282 --170 --
NM_001271chr1533171 2038 691 13010 33242 2544 656 --
NM_001282chr1721070 200 1476 ----
NM_001290chr421089 56 127 ----
NM_001298chr231289 965 132 141 1922 --
NM_001304chr1743798 1228 864 124 11273 ----
NM_001310chr1263069 2250 1013 962 417 103 1232 ----
NM_001315chr672214 2033 699 654 648 593 299 ------
NM_001329chr1041545 1254 568 484 ------
NM_001331chr1152866 1052 708 143 114 --21828 270 1107
NM_001332chr511581 --11362 --
NM_001343chr521666 144 ------
NM_001346chr332879 2546 2090 11843 22013 721 --
NM_001351chr331828 476 155 ------
NM_001356chrX42484 2407 595 264 ------
NM_001362chr143914 645 365 --21040 202 --
NM_001364chr1173604 3034 2995 1451 655 328 146 --11437 1367
NM_001365chr171754 --170 --
NM_001383chr171608 1817 ----
NM_001385chr81165 145 ----
NM_001386chr832359 2205 1868 --2394 384 --
NM_001387chr563138 2969 2793 2588 2322 2149 ------
NM_001389chr21------1105
NM_001390chr1883388 3305 3134 3069 2796 2409 1149 891 12452 12518 --
NM_001394chr83917 799 222 ------
NM_001396chr2132265 1749 80 ----12157
NM_001400chr131237 106 89 194 ----
NM_001401chr92517 470 --21495 1257 21083 71
NM_001402chr631991 526 64 ------
NM_001406chr171177 21696 1205 ----
NM_001407chr31638 ------
NM_001412chrX33567 3485 2898 12789 12612 --
NM_001416chr17----1520 --
NM_001417chr1221767 633 1512 --1201
NM_001418chr112471 56 1302 ----
NM_001418chr112471 56 1302 ----
NM_001419chr1944407 1913 323 259 --23183 1099 --
NM_001420chr1913010 ------
NM_001427chr732046 1600 404 --11638 --
NM_001429chr2231109 1006 128 ----1737
NM_001430chr221970 1743 11658 1327 --
NM_001432chr433649 2556 2459 11347 ----
NM_001438chr153692 2948 1391 641 114 --13379 33242 1366 1348
NM_001448chrX3698 687 342 --11425 --
NM_001453chr651716 1144 631 498 256 --1583 --
NM_001463chr22255 79 1605 ----
NM_001482chr15193 ------
NM_001491chr661747 921 888 627 361 37 ----11967
NM_001497chr972756 2264 2015 1857 1784 322 270 12607 11735 --
NM_001498chr651225 1190 974 290 102 --11129 --
NM_001527chr654734 4046 3815 3795 3699 --13182 --
NM_001530chr1421132 463 --1917 --
NM_001542chr172373 1765 952 925 849 657 163 --22584 772 --
NM_001543chr584403 4349 3098 1822 657 323 246 101 33799 854 381 64204 4118 2936 1461 1422 1381 24857 1589
NM_001546chr621428 1100 --1247 --
NM_001547chr103272 157 34 ----11739
NM_001554chr12493 245 ----1163
NM_001567chr114610 593 489 156 ------
NM_001584chr1131232 819 388 ----148
NM_001587chrX52201 2024 1849 672 538 1197 --11995
NM_001616chr262251 1381 1268 1129 173 51 23396 374 22600 69 --
NM_001621chr752984 1089 1014 994 704 22762 226 --174
NM_001621chr752984 1089 1014 994 704 22762 226 --174
NM_001622chr31297 ------
NM_001626chr1983437 3406 3348 2672 1103 559 432 392 137 33482 1284 684 --
NM_001642chr1141129 514 422 158 292 75 ----
NM_001650chr1854046 3589 3049 2604 538 --32690 1389 44 --
NM_001655chr1131896 1855 649 ------
NM_001656chr541603 1558 707 411 ------
NM_001658chr121116 1089 --191 --
NM_001659chr1292618 2354 2120 2072 1788 645 564 435 195 154 ----
NM_001663chr1422629 2594 --1513 187
NM_001664chr32370 207 1642 ----
NM_001665chr112405 26 ------
NM_001668chr14851 773 485 219 ------
NM_001677chr11315 ----21094 88
NM_001679chr32763 196 --2634 180 1297
NM_001682chr1292761 2597 1031 1020 803 639 589 543 30 ------
NM_001683chr352213 2136 757 536 422 148 --11661
NM_001686chr12124 ------
NM_001689chr241647 1267 726 80 11776 ----
NM_001690chr332539 478 22 --1882 --
NM_001693chr8------1170
NM_001695chr864247 4066 2749 2715 1522 403 21643 497 ----
NM_001699chr1911675 151 ----
NM_001701chr9------21136 92
NM_001706chr311018 1198 ----
NM_001709chr1162082 940 815 456 298 110 --1333 --
NM_001718chr631083 417 250 ------
NM_001723chr63364 136 22 ------
NM_001731chr122641 633 ------
NM_001742chr721736 1391 1367 11132 --
NM_001743chr21464 2165 98 ----
NM_001744chr53473 389 166 ------
NM_001746chr532854 1973 1178 ------
NM_001750chr531857 1314 491 --1243 --
NM_001752chr111590 ------
NM_001753chr721720 1607 1497 21379 367 --
NM_001754chr21114218 4130 3786 3108 2704 2658 2604 1560 1271 513 325 13020 11671 14034
NM_001755chr1641560 331 135 73 --1559 1199
NM_001759chr1264685 3991 3243 1808 624 408 --35201 4837 3783 --
NM_001760chr62772 647 152 --1354
NM_001762chr75691 595 589 183 37 ------
NM_001777chr332572 1477 375 ----13338
NM_001788chr72650 391 1703 --1373
NM_001789chr351733 1669 500 265 230 1522 ----
NM_001797chr163540 147 33 --1604 --
NM_001800chr19198 ------
NM_001802chr162830 37 ------
NM_001823chr142165 49 ------
NM_001826chr1----1150 --
NM_001830chrX51594 1515 697 536 245 12993 12904 11625
NM_001833chr91284 ------
NM_001839chr11710 --1130 --
NM_001845chr1331371 412 99 11336 ----
NM_001854chr121146 475 ------
NM_001855chr91779 1564 ----
NM_001858chr6104649 4145 3693 1636 1283 1104 610 303 227 169 --11622 --
NM_001859chr993533 3330 3031 1435 1386 1358 1342 1236 1176 12838 ----
NM_001860chr951122 940 892 787 237 --176 --
NM_001873chr41676 ------
NM_001884chr5196 ------
NM_001892chr531521 1166 359 ----11146
NM_001904chr31680 1723 ----
NM_001918chr1159096 8650 8253 8120 7940 7752 7472 6408 6286 5688 5647 2807 1816 1502 1364 16555 12551 --
NM_001921chr41154 1357 ----
NM_001923chr112491 54 1525 2605 116 --
NM_001924chr12556 34 ------
NM_001927chr2152 ------
NM_001935chr22256 68 175 --1650
NM_001938chr121472 712 --1175 --
NM_001939chrX22368 1236 23809 941 23400 320 --
NM_001945chr551384 1268 501 150 71 138 ----
NM_001949chr662857 2754 2552 2161 578 473 22737 553 12123 1828
NM_001951chr82470 40 1431 ----
NM_001957chr472197 1970 1951 1427 740 513 67 ----11827
NM_001962chr51464 --171 --
NM_001967chr3------1571
NM_001969chr1443493 2842 2395 1060 ------
NM_001981chr112116 11560 ----
NM_001991chr173819 69 43 12195 31639 1432 168 1690
NM_001995chr431391 516 172 --1460 --
NM_001999chr5--11009 ----
NM_002006chr4105787 5403 5286 5051 4785 4030 3630 1717 1702 883 23612 1371 34414 1498 513 --
NM_002009chr1522378 1904 --21799 1038 --
NM_002015chr132800 292 12183 12868 --
NM_002017chr11------11363
NM_002024chrX32091 1889 1470 11515 11667 --
NM_002025chrX79009 8647 8227 7144 5832 3181 2282 19281 23630 3003 18933
NM_002026chr241067 944 667 215 ------
NM_002031chr63555 218 84 ------
NM_002033chr1193718 2901 2709 2571 2520 1009 701 396 80 ------
NM_002036chr1142 ------
NM_002040chr2142908 2847 2655 389 23084 2990 ----
NM_002046chr12159 ------
NM_002051chr1031111 1073 753 1775 1790 1433
NM_002056chr24894 846 707 30 ------
NM_002061chr12379 79 1720 ----
NM_002063chrX2884 187 11036 ----
NM_002065chr151468 1279 1174 621 273 --21477 1192 11420
NM_002072chr92826 108 ------
NM_002074chr131736 1551 1279 ------
NM_002076chr1243256 2369 2094 179 1733 --1851
NM_002077chr931780 1700 99 --22102 686 --
NM_002078chr33629 195 81 --197 --
NM_002080chr162755 639 ------
NM_002086chr1742264 1871 1686 236 --174 --
NM_002094chr16147 --1285 --
NM_002099chr41707 --11535 --
NM_002106chr41270 ------
NM_002111chr493699 3456 3373 3296 2869 2524 1271 897 321 23725 1507 13855 23612 2850
NM_002126chr1783503 3146 2794 1352 939 810 757 713 1629 ----
NM_002129chr41111 ------
NM_002130chr511634 1686 ----
NM_002135chr121104 ----1433
NM_002137chr741760 1747 1513 837 ------
NM_002138chr41218 ------
NM_002140chr9------1981
NM_002156chr23279 177 37 ------
NM_002158chr243603 3202 2583 163 --1779 33663 3525 3411
NM_002165chr202317 139 ------
NM_002166chr21652 ------
NM_002193chr21396 ----11496
NM_002196chr2041108 1099 847 31 ------
NM_002196chr2041108 1099 847 31 ------
NM_002199chr42649 281 ------
NM_002202chr51416 ------
NM_002203chr583962 3746 3375 3206 1070 612 373 140 12811 ----
NM_002207chr33658 571 296 ------
NM_002210chr231013 492 104 12564 12239 --
NM_002211chr10--186 ----
NM_002214chr784926 4725 4099 3742 2235 175 94 49 1738 --14528
NM_002221chr192916 2591 2484 1069 1048 746 369 196 111 1401 12514 --
NM_002222chr31358 1485 --11323
NM_002223chr1293730 3594 1349 1071 957 898 644 524 164 ------
NM_002224chr64667 534 68 49 --1759 --
NM_002226chr141855 --1827 1183
NM_002228chr15969 876 369 306 235 ------
NM_002232chr11345 ------
NM_002233chr11123 ------
NM_002240chr21------1610
NM_002241chr152425 2240 1969 336 182 12042 11128 --
NM_002247chr1022316 32 --1903 --
NM_002254chr242389 684 458 21 22311 1507 2893 330 --
NM_002264chr374750 4031 3231 3104 1947 1417 1317 ----11407
NM_002265chr171876 ------
NM_002267chr13102463 2343 2270 1935 1896 1695 906 808 284 212 --1333 --
NM_002268chr321296 411 ------
NM_002270chr595685 5554 5468 4238 4090 3671 3662 1766 1395 ------
NM_002271chr1342053 980 690 375 ------
NM_002278chr171204 --1181 --
NM_002285chr273887 3748 3480 3159 2707 2554 104 1458 13333 --
NM_002293chr132647 1728 122 32610 2311 1023 ----
NM_002296chr11545 --1698 147
NM_002298chr1341608 1185 315 46 ------
NM_002310chr5156378 6113 6099 6036 5890 5687 5360 5324 5036 4758 2101 1876 1249 1222 331 151 --21646 1171
NM_002334chr114635 401 371 127 11688 1271 --
NM_002336chr1274997 4456 1872 1490 891 741 25 --24535 3546 --
NM_002356chr652565 2492 1150 888 805 1460 ----
NM_002359chr1763914 3746 3317 1644 794 63 --1814 --
NM_002360chr782630 2607 2006 1716 948 474 340 194 ------
NM_002373chr1551340 973 882 470 63 31180 554 280 ----
NM_002374chr253704 3199 354 286 125 --1397 --
NM_002375chr391996 1804 1779 1561 748 716 688 618 402 --12324 --
NM_002376chr14--1420 ----
NM_002381chr22940 751 183 ----
NM_002382chr1421278 1070 --2442 33 --
NM_002385chr181400 1383 2217 50 --
NM_002387chr595071 4984 4377 4196 3379 1565 896 477 44 11369 --14460
NM_002390chr1751973 1716 1607 255 62 1290 1687 --
NM_002397chr522112 898 12030 1154 --
NM_002401chr1782425 2090 1940 1814 1733 975 592 517 --2674 23 --
NM_002407chr112161 121 ----1112
NM_002408chr141279 ------
NM_002429chr1221151 303 ------
NM_002438chr102629 150 ------
NM_002442chr1241501 1339 170 131 11269 ----
NM_002465chr121295 ------
NM_002467chr8----1143 --
NM_002473chr2241203 1110 1038 99 ------
NM_002480chr1241139 1092 245 31 21217 102 11413 --
NM_002481chr1157997 7711 6231 6119 6040 5945 5804 5105 3154 3034 2459 1626 849 530 47 ------
NM_002499chr1582353 2151 2063 1881 1727 1519 479 338 12101 22298 1875 --
NM_002500chr24880 151 94 58 ------
NM_002501chr1963986 3405 2954 1090 1010 626 --2490 348 --
NM_002505chr651505 1368 1170 365 156 ------
NM_002515chr1482018 1925 1775 1614 1535 819 558 422 --11288 11254
NM_002519chr1131395 581 246 ------
NM_002537chr1541004 320 301 259 2747 365 1914 --
NM_002539chr22247 26 180 ----
NM_002544chr17--1329 ----
NM_002545chr1133468 3335 1717 --24730 4158 14326
NM_002546chr82248 62 1594 --1203
NM_002547chrX33691 3646 906 --22749 1196 --
NM_002552chr221273 135 ------
NM_002556chr1131826 1504 562 --11668 --
NM_002577chr363173 3148 3097 2690 1238 159 --24021 2804 13738
NM_002581chr985017 4299 4003 3961 3717 1679 1521 77 22118 674 35057 4644 4270 1486
NM_002583chr12--2560 461 ----
NM_002586chr611399 21468 1245 ----
NM_002588chr511315 11441 1235 --
NM_002589chr41108 ------
NM_002590chr13--1355 1366 --
NM_002595chr1261521 459 431 335 263 115 --11574 --
NM_002601chr2158 ------
NM_002603chr81177 --127 --
NM_002607chr721064 144 21126 109 ----
NM_002608chr2241221 475 380 59 --11268 --
NM_002613chr16164994 4883 4559 4538 4338 4315 4234 4077 3680 1737 1507 1481 1164 693 383 22 31614 793 33 ----
NM_002628chr33986 191 74 1806 131 --
NM_002629chr103869 119 23 ------
NM_002632chr141107 1834 1689 --
NM_002634chr171852 --1908 1235
NM_002636chr61343 ------
NM_002641chrX21585 425 ----21852 1692
NM_002645chr1153129 2736 2153 551 456 --22115 1074 --
NM_002651chr12268 153 ------
NM_002655chr855138 4980 4835 3909 934 1223 ----
NM_002656chr64876 350 232 155 ------
NM_002657chr2053171 2416 859 831 473 --1383 --
NM_002660chr2051166 1124 738 328 219 21186 781 --1964
NM_002667chr62321 246 1328 ----
NM_002670chr321374 487 ------
NM_002677chr832988 967 56 ------
NM_002687chr1441144 1085 101 90 ------
NM_002697chr11231 259 22 ----
NM_002698chr1922625 96 1649 1517 --
NM_002703chr441877 1355 465 189 --11844 --
NM_002706chr2179 ------
NM_002709chr211020 22704 1123 23137 1112 --
NM_002710chr1221028 733 ------
NM_002715chr51289 129 ----
NM_002716chr11103555 3444 3423 3367 3352 3158 2943 1277 924 747 ------
NM_002718chr32806 82 22420 483 ----
NM_002731chr163162 3138 3027 1145 837 517 2404 136 12912 22840 1210
NM_002733chr12150 ------
NM_002734chr1742169 1863 1472 234 --164 --
NM_002738chr161213 2329 84 ----
NM_002742chr143703 194 123 ----2640 85
NM_002744chr1149 ------
NM_002745chr22124542 4415 4202 3961 3095 1598 1412 1329 1172 500 289 264 24474 1186 13569 --
NM_002747chr1831869 1838 98 --1162 --
NM_002748chr1531205 791 348 ------
NM_002752chr52201 153 ------
NM_002753chr41768 2730 628 ----
NM_002755chr153320 314 170 1580 ----
NM_002758chr17----1194 --
NM_002763chr1--1432 ----
NM_002788chr14181 ------
NM_002813chr1221479 438 1983 ----
NM_002815chr171208 ------
NM_002821chr61667 ------
NM_002828chr183259 198 174 ------
NM_002830chr2----139 1306
NM_002833chr151239 ----1183
NM_002835chr71211 ------
NM_002836chr202100 35 ------
NM_002837chr1224358 4081 --13807 --
NM_002839chr953031 664 551 527 441 12682 23087 2545 1348
NM_002841chr31246 --1619 --
NM_002843chr1153316 2786 2380 1325 147 12297 ----
NM_002844chr611134 11375 --11143
NM_002845chr183187 165 155 ------
NM_002847chr7195 ------
NM_002849chr121359 21086 427 ----
NM_002851chr72789 498 1812 ----
NM_002855chr1153403 3343 2486 864 809 33395 3386 3265 21001 114 23544 2386
NM_002859chr1241226 573 228 51 ------
NM_002869chr1152126 851 134 69 41 12228 ----
NM_002871chr141413 1303 90 81 1684 --11932
NM_002873chr51381 ------
NM_002874chr922268 1763 32334 1813 614 1934 --
NM_002890chr51950 --1887 --
NM_002892chr1431205 1138 387 137 --1500
NM_002893chrX2263 249 ------
NM_002896chr113363 278 41 ------
NM_002906chr1121996 233 ----11678
NM_002912chr64868 663 106 58 --1367 --
NM_002918chr193367 191 85 ------
NM_002922chr11509 1230 --1444
NM_002924chr11187 ------
NM_002931chr62219 207 ------
NM_002938chr431876 1523 1295 11650 1127 --
NM_002940chr421756 1198 11660 1408 --
NM_002941chr32351 311 ----1455
NM_002953chr11815 ----1125
NM_002955chr621876 1499 11278 ----
NM_002956chr1211289 --1154 --
NM_002959chr164257 3895 1662 1610 1333 1009 --34168 974 647 --
NM_002968chr161305 ------
NM_002973chr122492 51 ------
NM_002979chr13214 204 192 ------
NM_002998chr852261 2168 2073 1752 1623 --12114 11862
NM_003001chr131854 581 419 ------
NM_003010chr1762287 2202 2182 2023 1762 463 21712 807 12328 --
NM_003011chr91259 --11358 --
NM_003013chr43558 317 101 ------
NM_003016chr1751764 1408 499 289 214 ------
NM_003017chr611251 --1435 --
NM_003026chr931318 419 59 --1254 --
NM_003028chr963829 3310 2586 1421 1355 1287 12795 13583 --
NM_003030chr31337 ----1456
NM_003032chr342550 2120 1843 811 21682 314 32179 2051 2029 --
NM_003036chr11972 ------
NM_003038chr252638 562 425 238 84 --12670 1282
NM_003042chr321940 370 11601 1865 1769
NM_003043chr383948 3619 3289 2793 1693 1618 1254 822 --13496 --
NM_003045chr1364836 3869 3790 3317 3108 1996 --44934 640 304 211 --
NM_003046chr844387 4102 4069 1989 25048 4653 25354 4203 --
NM_003047chr141438 925 558 479 11428 2227 201 --
NM_003054chr10----179 --
NM_003055chr101368 ------
NM_003069chrX------2216 182
NM_003072chr191112 ------
NM_003074chr31671 ------
NM_003076chr1241599 1547 59 29 ------
NM_003081chr2031107 1039 358 1381 ----
NM_003082chr143875 308 136 186 ----
NM_003091chr201294 ------
NM_003099chr15126420 5894 5843 5716 5231 4927 1212 1158 1007 783 54 39 22577 1221 1139 --
NM_003107chr622581 2019 ------
NM_003108chr2105659 4548 4457 2798 2739 1516 1504 754 701 513 --15750 --
NM_003110chr172373 87 --21006 127 --
NM_003111chr221266 190 ------
NM_003112chr713037 ------
NM_003114chr82655 575 ----1600
NM_003115chr1162 ------
NM_003118chr532026 1604 408 2797 703 ----
NM_003128chr242793 2784 1873 268 ----1599
NM_003131chr631583 684 515 --11865 --
NM_003133chr11881 1874 --1799
NM_003137chr62848 544 32129 609 398 --12137
NM_003142chr2----1240 --
NM_003144chr641803 1610 1404 523 ------
NM_003150chr1752267 2193 1720 823 21 ------
NM_003155chr862027 1923 1881 729 575 136 --21993 667 --
NM_003161chr1722328 738 1806 23512 386 --
NM_003164chr111139 2566 71 1480 1124
NM_003165chr9----150 --
NM_003173chrX41189 1087 398 65 190 11435 --
NM_003174chr105589 282 266 187 145 ------
NM_003178chr31482 32128 2023 1497 ----
NM_003183chr21694 ------
NM_003184chr8------1399
NM_003185chr2021309 1191 --1297 --
NM_003186chr112316 143 ------
NM_003188chr64747 608 330 264 --1121 --
NM_003189chr143245 2530 2228 302 --1465 --
NM_003196chr12394 247 ------
NM_003198chr11313 ------
NM_003199chr1894902 4587 4286 4182 3808 2176 2019 1288 527 --24823 1377 --
NM_003200chr1972145 2012 1879 1644 1628 583 288 ------
NM_003202chr561665 1389 748 463 122 52 1597 2392 73 --
NM_003204chr1761577 1566 1493 1310 1272 135 ------
NM_003211chr1221395 340 1406 ----
NM_003216chr2243287 2387 362 31 --11129 --
NM_003220chr671678 1487 1106 171 142 121 109 21660 185 ----
NM_003221chr633183 1446 1317 12751 ----
NM_003234chr32980 586 1815 1269 --
NM_003236chr262998 2597 2327 993 470 247 22816 77 12902 12464
NM_003243chr121185 1070 159 ----
NM_003244chr183376 68 43 ------
NM_003246chr1551830 1375 1270 514 238 21767 748 ----
NM_003248chr5----125 --
NM_003255chr1762614 2474 845 822 687 31 ------
NM_003257chr151279 ------
NM_003262chr374959 4903 4164 3632 3433 2022 1138 14949 --14855
NM_003269chr631168 1109 921 1244 ----
NM_003275chr951526 1504 1498 1349 968 11109 ----
NM_003281chr144821 4174 3766 1732 11774 25024 4538 --
NM_003284chr2------176
NM_003286chr2011153 ------
NM_003291chr131319 --1578 --
NM_003292chr151784 1548 896 249 25 11795 21404 452 --
NM_003297chr12273 33 ------
NM_003298chr3115991 5835 5768 4865 4800 4649 1793 1563 1146 1111 487 15670 --1849
NM_003305chr4------1422
NM_003317chr14----1161 --
NM_003319chr23802 290 79 --1904 --
NM_003320chr1194449 4282 3594 3081 1637 1265 1023 904 518 1938 ----
NM_003325chr221188 ------
NM_003330chr1241278 1138 723 31 --1542 1297
NM_003334chrX1150 ------
NM_003336chrX2794 109 ------
NM_003338chr102691 535 1698 ----
NM_003339chr551621 1447 1170 204 83 ------
NM_003340chr42337 210 --1198 --
NM_003342chr1742776 2066 1039 227 13118 ----
NM_003344chr73640 502 349 --1292 --
NM_003345chr163548 363 138 --1173 --
NM_003347chr2242339 2209 456 236 --11884 --
NM_003348chr1231410 428 324 1180 ----
NM_003349chr2041602 1318 317 234 1488 11084 --
NM_003352chr23853 671 417 ------
NM_003368chr1----1749 --
NM_003369chr1152305 1845 991 569 61 --1521 12485
NM_003373chr102649 441 31405 661 483 175 --
NM_003375chr101287 ------
NM_003380chr10----1259 --
NM_003383chr9------1482
NM_003385chr22827 24 ------
NM_003387chr272692 2347 439 323 220 61 38 ------
NM_003392chr344262 1341 954 112 ------
NM_003403chr14--1726 ----
NM_003404chr2021914 507 ------
NM_003405chr221508 ------
NM_003406chr831364 721 527 --2339 313 --
NM_003410chrX32361 781 692 --12015 --
NM_003411chrY2723 684 1426 ----
NM_003412chr372526 1917 1058 970 767 535 388 --22896 818 --
NM_003413chrX41551 1515 504 128 --1726 --
NM_003418chr32764 699 ------
NM_003421chr1033453 645 536 1810 --12995
NM_003432chr52132 70 1176 ----
NM_003439chr742876 1280 798 642 ----23253 2789
NM_003441chr42992 178 ------
NM_003457chr172623 430 ------
NM_003458chr373235 3046 1434 1391 1257 659 441 33580 1569 757 1203 12595
NM_003462chr12564 316 11110 11758 21686 290
NM_003463chr633378 1336 1164 ------
NM_003468chr263174 2689 539 507 375 219 23197 3052 23482 3402 23583 3318
NM_003470chr1661450 1174 712 600 350 172 --21665 553 1260
NM_003471chr342048 1996 1538 26 1823 21761 919 --
NM_003472chr631242 179 127 --1958 --
NM_003473chr102347 308 ------
NM_003474chr1072102 1824 1627 920 892 858 138 1804 ----
NM_003478chr1112947 1657 13309 --
NM_003482chr1292706 2387 2094 2012 2002 1990 768 742 113 --1625 --
NM_003483chr1262894 2829 2762 2428 2316 2200 2693 89 1237 --
NM_003486chr1652488 2222 1995 1093 21 12198 2468 104 --
NM_003487chr17--1238 --153
NM_003489chr2143386 408 339 248 ------
NM_003498chr1642515 864 335 199 1766 ----
NM_003513chr6124 ------
NM_003528chr121538 1506 --11733 --
NM_003558chr93258 238 228 1275 ----
NM_003559chr1763719 3489 3314 2561 629 137 ------
NM_003563chr172503 124 160 11385 --
NM_003565chr123620 521 336 11430 21659 256 --
NM_003566chr1232522 1212 478 --13003 12675
NM_003567chr11148 ------
NM_003569chr63625 206 22 ------
NM_003574chr1895127 4562 4526 3899 2060 1673 1502 595 181 11653 --14686
NM_003576chr1352516 1865 1187 886 565 32819 2640 2484 32532 2439 1159 --
NM_003581chr21943 --149 --
NM_003583chr1263699 3501 3124 2466 769 527 1305 1592 23623 2439
NM_003590chr2--1766 --13269
NM_003591chr101420 140 ----
NM_003592chr7----1166 --
NM_003595chr222321 116 132 ----
NM_003597chr232159 883 82 ------
NM_003603chr441870 1414 521 515 ------
NM_003607chr154401 4174 3818 1693 741 12755 ----
NM_003613chr153631 264 208 ----174
NM_003615chr333429 3222 660 11203 ----
NM_003620chr172920 403 ------
NM_003622chr1252636 2227 2124 1967 1804 --12679 --
NM_003626chr1111404 ------
NM_003628chr21570 1701 ----
NM_003629chr163313 3001 2806 2592 2576 90 13134 13140 --
NM_003632chr172309 194 --1350 --
NM_003633chr542553 2426 468 443 --11636 --
NM_003637chr1------1620
NM_003642chr21233 ------
NM_003644chr1786393 4886 4630 1891 1631 1079 940 745 25520 319 14982 --
NM_003654chr11170 --1521 --
NM_003658chr113818 732 101 --1263 --
NM_003659chr22900 55 1292 ----
NM_003663chr353181 2891 2880 2217 477 1392 22494 301 --
NM_003664chr5163 1224 --1524
NM_003671chr962397 2224 772 546 89 50 --23105 1359 --
NM_003672chr121428 1219 11969 ----
NM_003677chr1242070 1749 277 269 2357 332 ----
NM_003679chr173288 3238 2521 2466 829 404 153 2918 77 ----
NM_003690chr21503 1553 ----
NM_003692chr91201 ------
NM_003701chr1321046 283 1850 ----
NM_003709chr2194 ------
NM_003711chr5--157 ----
NM_003713chr151634 1618 1531 1501 40 --1420 --
NM_003714chr572446 1192 1053 918 703 662 641 ------
NM_003716chr341023 916 752 698 ----2639 130
NM_003722chr351766 1731 1059 276 219 1922 12121 2227 42
NM_003735chr511315 11441 1235 --
NM_003736chr511315 11441 1235 --
NM_003743chr232122 2060 2019 --11845 12257
NM_003750chr10----1721 --
NM_003758chr1551621 1120 651 502 448 1186 ----
NM_003758chr1551621 1120 651 502 448 1186 ----
NM_003759chr453425 3397 3337 1597 1127 1715 --1968
NM_003763chr2042069 1236 942 232 21110 1077 22850 79 --
NM_003768chr141809 1481 1255 1146 11153 11630 --
NM_003779chr11146 ------
NM_003780chr13554 73 37 1268 ----
NM_003783chr11214 ------
NM_003787chr1851619 1463 1116 1099 571 ------
NM_003796chr19--1219 1171 --
NM_003797chr112189 167 ------
NM_003798chr91190 ------
NM_003812chr21251 ------
NM_003816chr81318 ----1449
NM_003818chr2051001 913 775 343 107 ------
NM_003819chr11110 ------
NM_003822chr132757 2271 212 12424 33033 2892 98 --
NM_003825chr1521550 178 1314 ----
NM_003829chr91111 ------
NM_003831chr1811792 ----151
NM_003849chr2126 ------
NM_003850chr132588 148 ----1112
NM_003860chr111334 ------
NM_003862chr5159 ------
NM_003870chr1532065 1825 1662 --11432 --
NM_003872chr213011 12696 --2661 593
NM_003873chr1032510 689 583 --1479 --
NM_003877chr121977 ------
NM_003878chr8153 ------
NM_003884chr31317 --1588 --
NM_003885chr1762525 1855 1735 830 350 308 11628 --22455 461
NM_003887chr292216 2110 2028 2022 901 824 696 124 89 --1410 --
NM_003895chr2141864 1822 1730 1486 1823 --1406
NM_003901chr1042571 2565 2004 1677 12615 1883 12266
NM_003902chr12703 612 ------
NM_003908chr202526 180 --11320 31303 1293 107
NM_003913chr663561 1092 1072 969 673 226 --13086 1219
NM_003914chr13----1195 --
NM_003924chr441373 1328 1052 583 1108 ----
NM_003930chr732383 2234 899 12530 ----
NM_003931chr61659 ------
NM_003932chr221369 ----11816
NM_003934chr92180 102 ------
NM_003936chr231180 995 831 --11061 --
NM_003942chr114672 287 253 105 ------
NM_003947chr351327 1263 1240 1024 349 ------
NM_003948chr452571 1835 856 531 215 --21703 122 --
NM_003954chr1771434 1392 1202 1050 1003 66 31 ------
NM_003958chr663043 2538 2453 674 632 384 31238 181 34 33176 3141 224 --
NM_003966chr577669 7587 6517 1224 1162 488 64 1145 26548 5284 27723 5772
NM_003971chr171505 ------
NM_003972chr1031388 236 26 ------
NM_003980chr6------11265
NM_003983chr1664039 3720 3440 1486 1336 1067 43590 3360 1750 1511 ----
NM_003988chr106823 657 612 347 62 56 ------
NM_003994chr1263979 1755 538 397 321 256 11468 --23928 1536
NM_004006chrX42654 2440 1654 625 ----1641
NM_004007chrX42654 2440 1654 625 ----1641
NM_004009chrX42654 2440 1654 625 ----1641
NM_004010chrX42654 2440 1654 625 ----1641
NM_004011chrX42654 2440 1654 625 ----1641
NM_004012chrX42654 2440 1654 625 ----1641
NM_004013chrX42654 2440 1654 625 ----1641
NM_004014chrX42654 2440 1654 625 ----1641
NM_004015chrX42654 2440 1654 625 ----1641
NM_004016chrX42568 2354 1568 539 ----1555
NM_004017chrX42654 2440 1654 625 ----1641
NM_004018chrX42568 2354 1568 539 ----1555
NM_004020chrX42654 2440 1654 625 ----1641
NM_004021chrX42568 2354 1568 539 ----1555
NM_004022chrX42568 2354 1568 539 ----1555
NM_004023chrX42568 2354 1568 539 ----1555
NM_004028chr1854046 3589 3049 2604 538 --32690 1389 44 --
NM_004034chr103645 419 162 ------
NM_004035chr1764945 4887 4071 3915 943 341 --14615 --
NM_004037chr14842 601 276 138 --1684 --
NM_004050chr1432095 786 506 --11765 12426
NM_004055chr112696 689 1255 --2347 246
NM_004067chr741440 1242 1213 121 11483 --1990
NM_004071chr2--1113 ----
NM_004077chr12----11073 11321
NM_004080chr721464 421 ------
NM_004081chrY41849 574 250 29 ------
NM_004085chrX--1644 1298 --
NM_004086chr144769 730 204 162 1619 1551 1813
NM_004087chr351910 1683 1437 1422 405 --11940 --
NM_004090chr1753015 2678 2643 2492 477 --1925 169
NM_004093chr1393030 2779 2536 1130 772 766 755 497 245 --12640 --
NM_004104chr173682 605 125 --1208 1714
NM_004105chr211052 --1418 --
NM_004114chrX2866 858 1248 1406 --
NM_004116chr23431 305 117 ------
NM_004117chr631798 888 169 12145 ----
NM_004124chr1432897 2772 2167 32825 2679 841 ----
NM_004133chr852685 1960 1791 691 330 --1246 12447
NM_004136chr154739 557 365 40 12543 --12617
NM_004145chr195791 391 323 289 68 ------
NM_004157chr33827 576 91 1117 ----
NM_004161chr23626 204 93 --170 --
NM_004162chr31294 11247 ----
NM_004170chr941848 632 287 67 ----11801
NM_004180chr21237 ------
NM_004183chr115773 625 554 304 197 ------
NM_004185chr13689 669 574 ------
NM_004187chrX21256 1229 ------
NM_004197chr62154 61 ----1375
NM_004209chr1651163 459 360 237 166 --1334 --
NM_004215chr81100 ------
NM_004225chr851465 1323 1193 548 234 ------
NM_004227chr742417 1973 206 113 12643 1991 1926
NM_004229chrX21867 405 ------
NM_004232chr1843316 3270 1429 398 31248 97 78 ----
NM_004235chr9168 132 1544 --
NM_004236chr15186 1559 ----
NM_004253chr94819 349 174 167 ------
NM_004272chr531341 490 44 ------
NM_004274chr1442865 780 250 122 --23135 3055 --
NM_004277chr631717 1564 1264 11408 ----
NM_004287chr1772109 2027 1768 1708 601 356 115 1540 ----
NM_004293chr953455 2919 801 378 232 1942 ----
NM_004301chr31339 --1312 --
NM_004311chr1062374 2092 1180 1141 523 30 ------
NM_004316chr1231094 1031 865 ------
NM_004319chr142297 1204 1124 755 22167 27 --12849
NM_004323chr941981 896 219 27 --11776 --
NM_004326chr12858 60 ----1300
NM_004329chr1051439 480 266 43 34 1562 1322 11304
NM_004330chr1531156 213 165 1915 ----
NM_004331chr842447 841 790 646 12249 --11927
NM_004337chr841809 1565 1418 345 31640 216 196 ----
NM_004338chr18116971 6781 6497 5534 4642 4383 2569 1133 967 619 160 14573 12688 14423
NM_004342chr742156 2019 934 199 --1334 --
NM_004346chr42489 394 11054 ----
NM_004349chr82377 150 --1890 --
NM_004350chr162554 2147 1774 648 305 222 --22535 2473 --
NM_004352chr162534 124 ------
NM_004356chr111477 ------
NM_004370chr692161 2141 2121 2017 1991 1946 1695 1600 612 ------
NM_004379chr241705 1192 365 168 1460 1119 --
NM_004380chr162886 96 12170 ----
NM_004384chr542289 1791 926 584 11775 ----
NM_004385chr5--1506 ----
NM_004386chr1942239 1760 1496 370 1861 ----
NM_004392chr1321069 793 --12680 --
NM_004393chr371797 1746 914 555 421 389 92 12130 ----
NM_004395chr51732 ------
NM_004396chr173108 96 41 ------
NM_004397chr1141717 1658 1251 702 11244 23458 241 --
NM_004404chr211858 11900 11967 --
NM_004420chr1182353 2236 2126 2016 590 332 313 201 --1864 --
NM_004423chr322296 535 --1136 --
NM_004427chr11854 ----1949
NM_004432chr92879 251 12078 1325 --
NM_004436chr11574 ------
NM_004438chr282801 2237 1178 1087 290 188 167 71 22213 319 11276 --
NM_004440chr631598 1422 37 ------
NM_004449chr212593 521 11059 ----
NM_004450chr141284 ------
NM_004454chr332272 1479 872 --21641 1604 --
NM_004458chrX42155 714 680 83 11920 1768 --
NM_004472chr5------1154
NM_004475chr1741185 1177 856 456 1213 ----
NM_004480chr143800 568 73 1303 ----
NM_004481chr142042 1803 1036 795 --22577 193 --
NM_004482chr2152 ------
NM_004484chrX2368 28 ------
NM_004491chr1993700 3475 3354 3317 3285 1674 1353 993 295 23886 174 11590 --
NM_004492chr15193 ------
NM_004494chr111262 --2531 320 --
NM_004496chr1421213 532 11065 1838 --
NM_004499chr51101 ------
NM_004501chr162819 2536 1588 468 449 177 21470 1457 13909 22612 2581
NM_004503chr122590 306 ------
NM_004504chr221029 950 1782 ----
NM_004505chr1731926 1534 535 11365 ----
NM_004506chr62189 92 ------
NM_004516chr191264 ----1904
NM_004521chr102322 254 ------
NM_004527chr1751233 1152 1038 578 292 21383 314 1140 --
NM_004529chr92981 386 ----11042
NM_004530chr165478 471 378 297 39 1309 ----
NM_004538chrX1532 ----1335
NM_004554chr1441610 1521 189 140 11784 1339 --
NM_004566chr1032275 2030 799 --11027 --
NM_004571chr2162798 2627 2544 2367 1356 415 1316 12107 1432
NM_004575chr421316 1211 ------
NM_004576chr51277 ------
NM_004578chr12900 628 ------
NM_004583chr173596 273 23 ------
NM_004586chrX114986 4759 4482 4389 4240 3401 2150 2139 1237 495 102 25256 4905 11393 --
NM_004598chr543302 2031 503 40 --1145 --
NM_004600chr121401 441 136 ----
NM_004602chr2031268 555 265 11393 2245 63 --
NM_004607chr5--177 ----
NM_004612chr943849 3380 1048 688 --11380 13263
NM_004615chrX3762 322 54 ------
NM_004631chr131445 276 177 ------
NM_004634chr32492 64 ----1658
NM_004637chr321184 372 --2955 879 1121
NM_004640chr6180 ------
NM_004642chr122677 278 --1211 --
NM_004650chrX41815 1309 516 241 ------
NM_004654chrY1370 --199 --
NM_004655chr174336 263 73 28 1282 155 --
NM_004660chrY42277 2229 262 210 ------
NM_004663chr1531519 1297 180 --1450 --
NM_004670chr1051546 1401 1194 1117 83 --21646 1158 --
NM_004671chr181239 --143 --
NM_004673chr131547 1178 980 ----11057
NM_004686chr821482 530 ------
NM_004687chr1752053 1943 1924 534 162 21793 1465 ----
NM_004703chr1732530 2004 1908 12583 ----
NM_004709chrX31676 1372 123 ----11229
NM_004711chr22123389 3300 3027 2349 2317 2266 1389 990 640 633 171 80 1717 22753 1132 --
NM_004717chr72514 341 11250 ----
NM_004719chr1252796 2749 2342 1156 88 --1541 --
NM_004723chr13713 394 106 ------
NM_004726chrX75674 3814 1689 1222 1183 773 562 15315 24308 1779 --
NM_004729chrX31443 552 110 12027 22091 1533 1531
NM_004730chr551638 1460 640 485 438 --1362 --
NM_004734chr1332300 2152 853 22272 708 1983 --
NM_004738chr202685 538 --12512 2932 894
NM_004742chr341841 1228 531 258 --11613 --
NM_004745chr8126712 5557 5194 5125 4355 4328 2694 2276 1656 1443 1314 927 25055 4994 ----
NM_004748chr1574188 3768 3513 3308 3084 1580 984 11501 1731 --
NM_004753chr12273 140 ------
NM_004759chr162144 756 739 473 318 297 --1710 --
NM_004760chr752015 1948 704 542 418 ----12172
NM_004768chr141064 367 274 27 ------
NM_004772chr531502 1303 352 1531 21623 1261 --
NM_004774chr17----12285 12643
NM_004775chr181551 ----1519
NM_004776chr2062684 2166 2075 766 437 330 12761 ----
NM_004781chr121217 408 --125 1297
NM_004781chr121217 408 --125 1297
NM_004783chr162677 202 --1493 --
NM_004786chr18159 ------
NM_004788chr1111839 --22606 144 --
NM_004789chr9--1303 ----
NM_004792chr2--1190 ----
NM_004796chr1442377 1866 1637 1540 1687 196 --
NM_004798chr2063037 2647 2364 1139 100 70 ------
NM_004801chr221475 452 ----2961 440
NM_004804chr262783 2484 2413 2006 1076 155 1846 ----
NM_004807chr282491 988 940 742 736 496 279 122 2803 82 22451 454 --
NM_004808chr1093261 3203 2894 2698 2402 1199 1113 881 381 23213 1361 13386 21238 69
NM_004815chr164863 4460 4204 3355 603 383 1107 --1620
NM_004817chr91631 ------
NM_004821chr51291 ------
NM_004824chr621412 274 ------
NM_004831chr191218 --189 --
NM_004834chr273317 3290 2970 1303 1217 846 87 --11108 --
NM_004835chr3--1573 1827 --
NM_004835chr3--1573 1827 --
NM_004836chr22377 77 ------
NM_004839chr152570 484 ------
NM_004840chrX72047 979 658 628 408 379 345 --22342 574 --
NM_004842chr621551 124 1340 ----
NM_004844chr321085 978 --1114 --
NM_004845chrX84205 3412 2721 2566 1260 793 752 103 ------
NM_004859chr1723026 1950 22651 473 1275 --
NM_004862chr1661237 1079 534 291 281 181 ------
NM_004863chr14125307 4852 3844 1835 1788 1326 1017 940 834 575 376 114 24979 1999 24024 176 13804
NM_004866chr541192 969 647 334 13937 ----
NM_004870chr173645 451 423 ------
NM_004871chr1752716 604 578 382 86 1513 11129 1399
NM_004872chr1--1323 ----
NM_004884chr151126 31193 395 75 ----
NM_004887chr541071 1044 463 199 1777 ----
NM_004898chr462669 2507 2444 1902 921 158 2396 276 22722 2289 --
NM_004902chr201207 1105 ----
NM_004904chr765627 5443 4678 1367 1289 1118 --16062 15540
NM_004906chr62616 55 1446 ----
NM_004921chr141702 1606 1018 1011 ------
NM_004925chr93195 58 32 ------
NM_004926chr1431476 1433 508 11191 ----
NM_004929chr841301 568 106 54 11515 1418 --
NM_004938chr921256 38 1829 ----
NM_004939chr2173 ------
NM_004947chr362604 1015 623 410 320 148 1641 ----
NM_004948chr182954 444 11429 ----
NM_004949chr182666 633 12018 ----
NM_004956chr753789 1320 1060 929 66 13838 ----
NM_004961chrX41386 962 396 162 11246 ----
NM_004968chr72628 514 ------
NM_004973chr661515 1376 698 324 268 158 11463 1216 --
NM_004976chr11114741 4658 3970 3666 3426 3330 1987 868 758 549 50 13980 ----
NM_004978chr131177 1160 187 ----21677 1072
NM_004979chrX11134 ------
NM_004982chr121481 162 1512 --
NM_004985chr1274505 4165 3573 3193 3087 2878 864 1562 ----
NM_004992chrX97095 6825 6192 6075 3238 3187 2809 2020 1895 38126 2180 1386 12280 23029 2190
NM_004992chrX97095 6825 6192 6075 3238 3187 2809 2020 1895 38126 2180 1386 12280 23029 2190
NM_004999chr631378 1367 1236 13546 --14423
NM_005006chr22699 50 ------
NM_005011chr761864 1370 671 224 206 157 --1571 --
NM_005020chr7--2425 33 --1411
NM_005023chr541506 413 269 44 ------
NM_005026chr14390 350 123 93 11537 ----
NM_005028chr1042029 1785 1674 455 11840 1817 --
NM_005030chr16----1263 --
NM_005037chr31203 123 ----
NM_005044chrX84533 4337 3461 3352 3217 3007 1544 62 --14256 --
NM_005045chr7------1784
NM_005054chr241781 1559 1538 1204 1275 ----
NM_005057chr111538 11820 ----
NM_005063chr1042465 1207 936 275 13712 21504 628 --
NM_005065chr14135089 4628 4372 4228 3643 1915 1849 1657 1508 1378 1169 513 141 11001 ----
NM_005066chr11607 ------
NM_005067chr31763 1379 ----
NM_005076chr173845 3497 2876 1417 1141 929 268 43758 3636 766 74 ----
NM_005093chr2065328 4921 4404 4158 4091 341 11044 31318 228 91 --
NM_005094chr93596 159 126 --1446 1145
NM_005095chr141620 619 311 50 1549 ----
NM_005096chrX21001 112 --2809 411 11134
NM_005097chr10--2123 23 --1329
NM_005105chr121799 381 12116 11664 --
NM_005109chr331994 600 554 185 12185 --
NM_005116chr2044584 3897 1605 130 11743 ----
NM_005121chr1753736 3684 3396 1260 526 12510 ----
NM_005126chr351615 1583 865 190 38 1489 ----
NM_005131chr18131 ------
NM_005134chr181829 ------
NM_005137chr2242185 1932 236 111 12201 41619 1589 878 827 1423
NM_005153chr161656 1637 1560 --
NM_005156chr934791 4295 2037 13736 --13830
NM_005168chr221690 1654 ------
NM_005171chr12--21215 1026 ----
NM_005174chr10144 ------
NM_005178chr19177 ------
NM_005183chrX----123 --
NM_005187chr1641286 556 158 149 --11662 --
NM_005190chr631140 981 446 ------
NM_005194chr20------1395
NM_005197chr1444209 2350 1678 1147 26114 5652 35372 4426 912 15934
NM_005201chr31897 1308 ----
NM_005202chr172293 1491 1399 732 632 542 23 ------
NM_005206chr1721378 474 --1278 1192
NM_005214chr221063 900 ------
NM_005219chr561809 1340 1313 539 271 48 11509 1174 --
NM_005220chr1721090 165 --11069 --
NM_005221chr71303 ------
NM_005225chr202960 388 --1823 --
NM_005230chr121165 --1564 --
NM_005233chr332311 901 216 ------
NM_005235chr297814 6649 5960 5504 5134 2768 1968 717 288 16298 27766 7156 --
NM_005238chr1143564 3197 2309 707 ------
NM_005241chr341341 1100 217 78 ------
NM_005245chr4--1176 ----
NM_005249chr143645 605 253 ------
NM_005254chr1541328 1265 1010 61 ------
NM_005256chr11190 ------
NM_005257chr183962 515 92 --1878 --
NM_005259chr211378 11255 ----
NM_005266chr141776 1531 205 102 21261 94 ----
NM_005271chr1011213 1969 --1788
NM_005277chr411429 --11757 --
NM_005278chrX1347 ------
NM_005284chr62368 341 ----1378
NM_005295chr7--176 ----
NM_005296chrX21067 690 1208 --1430
NM_005302chr71286 ------
NM_005313chr152166 155 --1327 --
NM_005316chr112978 347 --1327 --
NM_005324chr1721581 640 --11556 --
NM_005328chr81107 ------
NM_005333chrX21059 78 --11077 --
NM_005335chr3127 ------
NM_005336chr232063 2009 884 1664 11580 1484
NM_005339chr443660 3580 3127 408 14038 --1800
NM_005342chrX72608 2024 1790 1739 676 388 207 1600 ----
NM_005346chr6--1249 ----
NM_005347chr941511 1505 1396 152 ----1128
NM_005358chr1351773 1256 704 622 407 11748 ----
NM_005359chr18106351 6112 5626 4925 4394 2366 1961 1716 1130 136 --14067 1962
NM_005375chr641156 1091 1070 1029 ------
NM_005378chr21587 130 ----
NM_005380chr161203 1159 1074 386 182 137 11193 --1841
NM_005385chr372649 2264 2252 2094 665 401 388 1375 12355 21786 1040
NM_005399chr164289 1712 1520 1494 1153 434 1393 21167 450 --
NM_005400chr252903 2215 2020 255 127 ------
NM_005402chr73671 394 141 163 2742 220 --
NM_005406chr1831135 571 276 ------
NM_005415chr2----1152 --
NM_005429chr4147 --167 --
NM_005430chr121269 ------
NM_005436chr1023879 2992 --12803 13565
NM_005437chr10164 11212 21159 404 --
NM_005442chr31594 ------
NM_005445chr10167 ------
NM_005450chr171187 ------
NM_005455chr11599 --11620 --
NM_005458chr932104 1698 78 --1417 22390 510
NM_005460chr51395 ------
NM_005461chr2051831 1675 596 394 385 ----11386
NM_005465chr131952 589 247 129 ----
NM_005475chr1253288 2404 1173 774 624 1357 2123 32 --
NM_005476chr931365 1233 106 ------
NM_005493chr61670 ------
NM_005497chr1725399 4619 --25575 365 --
NM_005499chr191152 ------
NM_005502chr973135 2597 1991 1137 915 840 562 --1825 --
NM_005504chr1262466 1976 1390 1320 172 44 --12095 --
NM_005506chr452833 791 761 591 29 22493 1110 12768 --
NM_005509chr52723 192 21554 696 ----
NM_005517chr1124 ------
NM_005520chr51781 ------
NM_005521chr103238 117 96 ------
NM_005529chr12705 291 --1282 --
NM_005537chr1321055 63 1435 --1994
NM_005539chr1051273 1045 553 186 88 1332 1999 --
NM_005540chr131557 1019 402 2417 35 ----
NM_005544chr22389 196 ------
NM_005561chr132973 27 ------
NM_005562chr141439 1388 478 281 ------
NM_005563chr13893 631 349 ------
NM_005566chr11130 ------
NM_005569chr222210 47 ------
NM_005576chr151266 ------
NM_005578chr393820 3764 3149 2041 1931 1723 1062 1035 879 --1944 11330
NM_005587chr151393 ------
NM_005593chr121483 ------
NM_005596chr9116432 6380 5972 5819 5465 4767 4342 3918 1096 288 249 36372 5068 1983 25896 4909 16300
NM_005598chr141275 441 336 59 ------
NM_005602chr311336 ------
NM_005603chr1821325 89 ------
NM_005604chr642395 2002 1650 1624 ------
NM_005607chr831025 755 372 ------
NM_005610chr12936 909 1739 ----
NM_005611chr161354 21295 226 1194 --
NM_005613chr141972 1619 895 124 ----1696
NM_005614chr73833 744 402 --158 --
NM_005617chr5152 --138 --
NM_005625chr82739 434 ------
NM_005626chr12515 93 ------
NM_005637chr1822062 277 ------
NM_005638chrX51715 1545 1242 1133 300 ------
NM_005639chr1241565 1467 1446 194 11545 ----
NM_005647chrX63477 2977 2429 1395 457 84 ------
NM_005648chr8124 ------
NM_005650chr2211034 ------
NM_005664chr153418 85 55 ------
NM_005665chr154651 4537 3933 3268 1118 23874 206 1365 --
NM_005668chr554478 2991 2858 793 324 1317 ----
NM_005669chr552078 1990 850 465 165 ----12270
NM_005678chr1531048 646 160 1666 ----
NM_005682chr1651393 927 257 245 58 ------
NM_005688chr331235 851 226 143 1930 --
NM_005690chr122155 54 ------
NM_005708chr13128 --1187 --
NM_005711chr53820 725 65 ------
NM_005715chr622598 1015 --12134 --
NM_005717chr1280 42 --1868 11036
NM_005720chr72288 34 --1257 --
NM_005722chr24486 480 434 303 2945 56 1200 12277
NM_005724chr151255 ------
NM_005725chr121546 23 11608 ----
NM_005734chr112607 525 --1278 --
NM_005736chr1061586 1509 1127 1000 457 428 --187 --
NM_005737chr282869 2837 2485 1120 1102 643 414 193 --1761 --
NM_005739chr153738 636 59 --1925 --
NM_005746chr74765 602 490 122 ------
NM_005748chr1221384 840 --1368 11057
NM_005751chr71315 ------
NM_005754chr51794 --1109 --
NM_005756chrX41090 1070 975 350 11226 11215 --
NM_005761chr121123 ------
NM_005766chr1331062 967 954 11143 ----
NM_005768chr122683 532 1140 ----
NM_005776chr141321 ------
NM_005779chr561196 1115 1098 824 520 375 ----33132 1419 624
NM_005786chr182410 53 11147 --1901
NM_005789chr1742131 1567 1450 54 --11910 11973
NM_005795chr221849 395 --12012 22135 1974
NM_005802chr9--2554 229 ----
NM_005808chr383601 3324 3305 2793 2226 1412 1234 603 31084 1010 843 1312 --
NM_005813chr242337 2185 752 465 22248 1793 ----
NM_005819chr173414 3377 2588 591 273 114 79 --11190 --
NM_005822chr62905 416 --179 --
NM_005826chr12506 85 1113 ----
NM_005828chr17134815 4173 3868 3830 3567 3506 3479 1549 1167 801 648 363 136 13786 14801 --
NM_005833chr91174 ------
NM_005839chr12110 63 ------
NM_005840chrX106856 5746 4682 2815 2166 1797 1768 1482 1104 474 12644 25564 1642 --
NM_005841chr44842 410 402 195 ------
NM_005843chr251885 1389 1287 781 590 ------
NM_005845chr1331562 1276 346 ----11427
NM_005853chr163602 502 377 --1595 --
NM_005857chr121244 1134 11500 11433 --
NM_005859chr531105 295 250 --11574 --
NM_005862chr311007 ------
NM_005870chr1351179 505 470 401 235 183 --11411
NM_005871chr101153 ----1168
NM_005876chr22765 677 ------
NM_005877chr2252211 2155 2009 581 542 --11815 --
NM_005882chr44928 777 764 646 ------
NM_005885chr541621 613 442 190 ------
NM_005895chr1253338 3173 2731 910 32 ------
NM_005898chr1153074 2424 1022 599 465 ------
NM_005899chr1711395 --127 --
NM_005900chr42869 126 --1907 --
NM_005901chr1877676 7483 7131 7027 6569 3107 816 --17356 1689
NM_005902chr1564355 3671 1750 1356 1242 377 --11067 11467
NM_005906chr641564 1271 1103 192 1497 11441 11480
NM_005909chr543968 3714 3559 1436 ----12783
NM_005910chr1773628 3289 2665 1455 1193 357 101 22961 2627 33446 2525 957 11660
NM_005911chr231391 1095 331 --1251 --
NM_005923chr62638 614 ------
NM_005924chr72453 300 --1792 --
NM_005927chr511296 ----1144
NM_005930chr142776 318 --163 --
NM_005933chr1152774 2673 2561 792 753 22862 2309 ----
NM_005934chr1982244 2164 1739 1619 570 355 330 100 12337 12267 --
NM_005935chr465235 5069 4464 4233 1269 657 44266 4095 1291 793 25102 1979 --
NM_005937chr1753365 3249 1633 1174 214 --21268 741 --
NM_005941chr842873 2734 881 561 11401 ----
NM_005955chr1105440 4780 4240 4136 3815 1333 748 696 353 237 11766 13915 --
NM_005962chr1052368 1857 1712 912 719 --12238 1701
NM_005962chr1052368 1857 1712 912 719 --12238 1701
NM_005964chr1751405 532 474 174 115 ------
NM_005966chr211573 11559 ----
NM_005990chr552239 2031 764 382 146 1861 ----
NM_005996chr1231081 1018 46 ----11026
NM_006002chr13130 ------
NM_006007chr943151 3086 942 739 ------
NM_006011chr1593994 3078 2653 1179 1046 959 843 594 188 --43438 3012 399 337 --
NM_006015chr14833 467 459 393 1849 ----
NM_006016chr642275 2237 1975 243 --11512 --
NM_006022chr1321062 865 ----1787
NM_006030chr361655 1497 1423 337 318 220 --11161 --
NM_006037chr234913 4649 4275 --24038 337 --
NM_006038chr2011486 1746 ----
NM_006040chr1621225 137 ----11386
NM_006047chr2063490 3304 706 615 375 108 23478 1411 --23381 2423
NM_006048chr131080 777 453 --180 --
NM_006062chr22195 100 --1490 --
NM_006076chr782354 2344 2222 1215 1098 987 745 154 23136 1121 1893 --
NM_006079chr62557 314 1173 1339 --
NM_006080chr752489 2054 1072 391 346 1327 12969 --
NM_006094chr852042 2019 1907 260 160 --22330 804 --
NM_006095chr464478 4316 4232 2880 1074 177 1333 14297 --
NM_006096chr811365 11347 --1296
NM_006100chr32118 108 ------
NM_006106chr1112767 22432 654 12710 --
NM_006107chr171330 ------
NM_006113chr131571 535 100 ------
NM_006133chr116825 808 697 534 356 286 --1343 --
NM_006135chr121077 503 1206 ----
NM_006136chr71313 --182 175
NM_006139chr242382 1844 509 60 12014 1987 --
NM_006141chr1662823 2683 2635 2582 2162 992 --1701 --
NM_006145chr191120 11104 ----
NM_006147chr11374 --1431 --
NM_006153chr32643 23 ------
NM_006154chr1542482 622 550 385 135 --12467
NM_006155chr211858 11900 11967 --
NM_006156chr14187 ------
NM_006157chr11------1122
NM_006158chr821808 1418 1222 ----
NM_006160chr1721112 1033 --1432 --
NM_006162chr1831446 615 485 11710 ----
NM_006163chr12----125 --
NM_006167chr841961 1602 1592 790 --21573 39 11824
NM_006178chr1721579 73 --11185 --
NM_006180chr932049 749 95 --175 --
NM_006185chr11171 ------
NM_006186chr231199 453 177 11140 1110 151
NM_006192chr2041150 1044 905 395 1366 ----
NM_006194chr141270 ------
NM_006195chr911112 ------
NM_006196chr22380 56 ------
NM_006197chr841942 1918 1794 112 ------
NM_006202chr1951918 1727 592 384 318 ------
NM_006206chr482755 2728 2705 2379 1945 1938 899 471 22676 1895 1946 --
NM_006209chr81367 ------
NM_006211chr8165 ------
NM_006212chr195377 5274 5060 4236 4224 1315 1129 479 37 --21657 1101 --
NM_006218chr3192 ------
NM_006223chrX3484 197 79 ------
NM_006224chr1722243 2035 1890 31679 829 354 --
NM_006228chr8--1370 ----
NM_006237chr1331936 1565 1415 12049 ----
NM_006241chr341714 1656 1649 242 2882 126 ----
NM_006243chr151023 883 861 388 125 ------
NM_006246chr141290 1439 ----
NM_006251chr553265 3032 2519 2188 1216 ------
NM_006252chr186990 6645 6004 5134 2812 2554 727 557 35633 2111 1762 16896 --
NM_006256chr152612 2196 1864 659 612 --12525 --
NM_006257chr102418 67 1774 1345 --
NM_006258chr10------2640 61
NM_006265chr811336 --153 --
NM_006267chr241290 1172 715 125 ------
NM_006268chr1131137 215 147 ------
NM_006270chr191236 1278 148 --
NM_006275chr202498 380 ----12087
NM_006277chr22718 64 ------
NM_006281chr83863 258 239 ------
NM_006281chr83863 258 239 ------
NM_006282chr2044646 3364 1599 792 11012 24763 768 13166
NM_006283chr854993 4979 1508 1419 135 34831 1901 156 53609 3358 3056 580 87 24486 4400
NM_006285chr9----1268 --
NM_006287chr232550 2080 180 --22194 583 --
NM_006290chr63737 661 345 11598 --188
NM_006301chr121638 ------
NM_006305chr15--1208 ----
NM_006306chrX115892 5844 5654 5529 5304 4929 4686 4460 4249 1907 1730 24742 131 21958 519 --
NM_006310chr1721272 261 --11012 --
NM_006312chr124842 747 357 80 ------
NM_006313chr1251588 1330 1271 459 432 1641 ----
NM_006317chr51171 --1343 --
NM_006320chr4266 39 1178 11008 1893
NM_006321chr342252 1747 1508 449 31945 1872 59 ----
NM_006322chr13285 26 149 ----
NM_006323chr42611 602 ------
NM_006328chr111467 ------
NM_006330chr831555 1351 423 1290 ----
NM_006333chr21497 ------
NM_006335chr11209 ------
NM_006352chr172084 2073 1573 1371 666 608 423 ------
NM_006359chrX3960 884 461 --12155 --
NM_006366chr631298 318 98 1504 ----
NM_006367chr11814 1939 2261 106 --
NM_006371chr384972 4535 4473 4350 4213 1374 1216 143 34871 3989 3922 1610 11583
NM_006372chr61405 --1164 1436
NM_006374chr22221 67 ------
NM_006378chr931183 1057 1045 --11092 --
NM_006380chr1733769 3171 1763 1579 --13264
NM_006386chr225841 749 689 490 57 1179 21751 778 --
NM_006389chr1131382 1164 207 1319 ----
NM_006393chr1074293 4254 3520 3427 1799 1573 808 --23033 468 13996
NM_006400chr122349 273 ------
NM_006401chr9250 31 ----1461
NM_006403chr63235 62 27 ----11562
NM_006408chr71986 ------
NM_006416chr63727 522 103 ----1170
NM_006434chr1073280 2491 824 630 523 492 341 13128 ----
NM_006449chr221828 1652 1579 ----
NM_006451chr51931 ------
NM_006454chr472893 2418 986 148 138 126 101 22442 653 22329 178 --
NM_006457chr424145 515 ------
NM_006467chr512180 --1336 --
NM_006469chr121157 525 ------
NM_006472chr121209 923 11068 --11165
NM_006476chr11--175 ----
NM_006482chr1263699 3501 3124 2466 769 527 1305 1592 23623 2439
NM_006489chr1482018 1925 1775 1614 1535 819 558 422 --11288 11254
NM_006491chr14--1308 ----
NM_006496chr141953 1753 1235 751 ----1807
NM_006497chr171159 ------
NM_006504chr1042900 2562 2219 455 --2808 766 --
NM_006516chr121446 625 --21418 1392 --
NM_006517chrX--2650 423 --1351
NM_006526chr2021368 856 ----1546
NM_006532chr1951680 674 503 455 235 21313 358 ----
NM_006534chr2033406 2869 2557 13052 --1620
NM_006538chr264158 4146 3539 3454 1088 545 11038 1468 14125
NM_006544chr1445558 4383 4306 4211 11633 11356 14362
NM_006546chr17116445 6384 4632 4502 4144 4108 2221 2031 1918 864 208 26132 1009 12488 1569
NM_006547chr731785 1580 465 ------
NM_006548chr311693 ----11436
NM_006549chr1262784 2001 733 533 367 273 11038 --22482 2236
NM_006555chr761555 1535 1420 1404 696 56 11613 11949 --
NM_006557chr931763 610 335 11439 11696 --
NM_006561chr1075697 5252 4794 4687 4110 2431 775 34768 2112 1484 34325 4206 487 --
NM_006565chr1631270 465 418 ----11041
NM_006575chr14181 --1923 --
NM_006577chr211125 1901 2949 103 --
NM_006580chr31119 ------
NM_006585chr211146 ------
NM_006589chr11446 --1480 --
NM_006595chr113517 151 126 --11382 11673
NM_006599chr16148274 7373 7363 7282 6764 6500 5772 3008 1631 995 703 557 140 106 --18047 --
NM_006601chr121871 1722 ----
NM_006602chr201663 1596 ----
NM_006603chrX11631 --11670 1663
NM_006609chr232572 2490 66 ----12233
NM_006614chr331222 834 723 12574 22647 2494 13312
NM_006620chr674749 4637 4314 3898 3469 658 142 ------
NM_006621chr12757 389 ------
NM_006624chr1052098 1882 1796 657 389 11509 ----
NM_006628chr1554388 3851 3831 1723 694 14212 1610 --
NM_006633chr53604 132 95 ------
NM_006634chr2----1224 --
NM_006646chr1333001 2626 869 12690 1352 --
NM_006650chr553293 2505 1181 1145 334 42722 778 743 320 1860 13171
NM_006654chr1254726 4567 4272 3597 3050 13904 ----
NM_006660chr151316 ------
NM_006667chrX41136 730 425 209 ------
NM_006670chr62647 439 --1454 --
NM_006675chr1243350 2687 2382 37 --12768 11099
NM_006682chr71940 --11010 --
NM_006690chr2061709 1576 951 755 705 482 ----1215
NM_006698chr20--21423 1201 1314 --
NM_006699chr111922 ----1719
NM_006704chr131315 --1423 --
NM_006713chr51253 ----1585
NM_006717chr942687 2235 581 370 12594 ----
NM_006718chr64876 350 232 155 ------
NM_006722chr372918 2374 2341 2043 1918 1138 488 12351 135 --
NM_006726chr42439 135 ------
NM_006729chrX55560 5485 4863 1644 535 24841 1217 21582 1012 --
NM_006732chr1921846 669 1158 11697 --
NM_006736chr231724 582 451 --21754 97 --
NM_006738chr1594532 4331 3920 2894 2810 1524 1266 219 102 23962 999 129 13050
NM_006742chr1652005 1274 354 314 272 12024 11505 --
NM_006750chr16137733 7091 6654 6606 5163 4958 4919 3060 3026 1108 724 631 502 41277 917 281 34 35630 1854 131 25357 1184
NM_006751chr23399 376 342 ------
NM_006759chr21302 ------
NM_006762chr131312 1250 171 --145 1922
NM_006763chr181737 585 576 365 225 186 83 43 --11643 --
NM_006769chr11146 ------
NM_006772chr651689 1213 219 138 102 ------
NM_006775chr662725 2169 787 670 584 233 --11924 12895
NM_006777chrX21116 378 1634 --11991
NM_006790chr51351 ------
NM_006791chr151260 1208 ----
NM_006800chrX1565 --130 --
NM_006805chr531337 1157 1120 --11511 11307
NM_006815chr1241291 374 218 100 1515 ----
NM_006823chr841212 525 475 363 ------
NM_006826chr241200 1044 203 118 ------
NM_006832chr141299 ------
NM_006838chr1241722 1339 1238 211 21521 321 ----
NM_006841chr31677 ------
NM_006846chr5----1265 --
NM_006852chr1772690 2503 2233 808 718 521 25 ------
NM_006854chr731719 1515 711 ------
NM_006861chr1241711 442 256 27 --12143 11530
NM_006874chr4----1206 --
NM_006876chr111263 ------
NM_006884chr31337 ----1456
NM_006885chr1684089 3818 3309 2863 2637 1573 1165 81 12959 21143 654 --
NM_006888chr1413435 --12677 --
NM_006892chr2041360 1151 1061 444 ------
NM_006892chr2041360 1151 1061 444 ------
NM_006908chr721333 1205 11228 ----
NM_006910chr16----1305 --
NM_006912chr162365 2311 827 779 197 33 22133 2061 ----
NM_006914chr921399 286 ------
NM_006915chrX32490 755 490 ----1703
NM_006918chr1145185 4231 1125 143 24722 2267 --1914
NM_006920chr251998 1985 1381 237 171 ----1371
NM_006922chr231942 1928 231 ------
NM_006924chr17114378 4322 4267 3646 1189 1053 770 666 623 120 88 1854 12741 --
NM_006930chr531299 754 445 --1438 --
NM_006937chr17174 ------
NM_006939chr141205 2786 230 1888 --
NM_006940chr1241683 1592 263 113 --11231 11766
NM_006941chr2231085 875 154 ------
NM_006943chr2083094 2941 2617 2432 2350 1088 815 692 --13027 --
NM_006946chr111535 --193 3519 141 51
NM_006948chr2142377 1570 771 500 ----1524
NM_006951chr10--1758 ----
NM_006952chr3--21073 120 ----
NM_006965chr1811201 1109 ----
NM_006981chr951862 869 819 335 276 --21855 27 --
NM_006982chr12299 84 ------
NM_006986chrX2209 153 ------
NM_006996chr1----152 --
NM_006997chr10260 30 ------
NM_006999chr591644 1638 1283 783 603 464 434 276 44 ------
NM_007005chr921492 1372 ------
NM_007006chr1632940 2154 1359 12974 --1125
NM_007007chr12104792 4696 3968 2966 1684 1538 1511 536 422 203 11616 ----
NM_007008chr22931 208 1177 ----
NM_007011chr15126875 6613 5575 5128 4662 4622 4553 4436 4416 2595 1106 47 --21531 867 --
NM_007013chr82398 60 ------
NM_007014chr1631606 1193 345 21769 128 1628 --
NM_007023chr2--186 ----
NM_007027chr31183 ------
NM_007030chr575170 3602 3392 1398 913 763 28 64029 3540 3361 1237 1119 944 ----
NM_007034chr12642 126 --1952 --
NM_007038chr2196089 6073 5629 5099 4801 4616 1783 725 174 34936 4759 3935 25222 295 --
NM_007040chr1951027 916 440 140 122 --1769 --
NM_007050chr20107647 7249 5315 5259 5186 2338 732 466 458 343 15088 26943 6348 --
NM_007054chr531119 773 372 ------
NM_007067chr172185 136 1400 ----
NM_007068chr222857 22 ------
NM_007073chr643905 3734 3408 1348 34237 2929 2606 11053 --
NM_007075chrX143 ----1255
NM_007084chr1331284 1051 513 ------
NM_007096chr91284 ------
NM_007107chr332297 1945 1740 --11689 12001
NM_007111chr132715 643 1690 ----
NM_007112chr1--1231 ----
NM_007114chr343092 2684 567 460 --11164 12849
NM_007118chr54733 172 165 121 --197 --
NM_007122chr1286 36 ------
NM_007124chr611485 --11640 --
NM_007125chrY51315 1113 460 154 87 ----1242
NM_007129chr1331082 983 347 ------
NM_007137chrX115442 5288 4718 4249 3937 3696 2148 1846 1536 1489 1306 --24815 932 --
NM_007144chr1721113 1006 --1956 --
NM_007146chr1722609 1929 ------
NM_007150chrX32134 422 194 1860 21768 1412 --
NM_007158chr11288 ------
NM_007159chr321153 597 11509 ----
NM_007166chr1131152 366 212 --2350 83 --
NM_007172chr223889 293 179 3740 483 31 22789 202 --
NM_007173chr1132025 641 153 11532 ----
NM_007175chr873454 3442 3212 2721 811 486 99 --12420 --
NM_007177chr352129 1602 661 512 28 11686 --21560 1547
NM_007178chr122447 82 ------
NM_007187chr131374 ----1237
NM_007189chr771534 1436 960 610 155 115 51 ------
NM_007191chr121455 ------
NM_007192chr142903 74 1431 ----
NM_007195chr182912 115 1426 13738 --
NM_007198chr82506 432 11512 ----
NM_007200chr1594532 4331 3920 2894 2810 1524 1266 219 102 23962 999 129 13050
NM_007203chr932942 2927 136 ----13772
NM_007212chr141863 494 456 187 --11698 --
NM_007217chr3--1139 150 --
NM_007219chr203788 749 726 1804 --1106
NM_007221chr11365 1164 ----
NM_007222chr831566 720 391 ------
NM_007235chr122453 342 ------
NM_007236chr152369 114 11915 11873 --
NM_007238chr20144666 4588 4555 3695 3475 3449 3384 3300 1727 1389 512 461 343 69 --14765 --
NM_007245chr162204 176 ------
NM_007249chr13139335 8928 8143 6298 3786 3097 2211 2125 1786 1422 932 818 804 15953 --13666
NM_007260chr11799 ------
NM_007269chr12406 139 ------
NM_007271chr641883 1786 1427 176 2746 618 --11285
NM_007276chr711079 ------
NM_007282chr32822 742 ------
NM_007283chr353049 2952 2114 741 356 12315 ----
NM_007285chr16----134 1428
NM_007292chr1764945 4887 4071 3915 943 341 --14615 --
NM_007331chr442598 2189 2147 622 1107 148 --
NM_007345chr1842318 2149 1728 750 --11584 --
NM_007347chr1532825 603 169 ----22855 249
NM_007350chr1234327 3152 1133 21816 1559 ----
NM_007358chr141997 1692 1619 539 --11910 --
NM_007373chr1021343 114 144 ----
NM_007375chr121912 618 --21101 237 --
NM_009585chr3--1573 1827 --
NM_009585chr3--1573 1827 --
NM_012062chr123277 155 54 1363 ----
NM_012063chr122155 54 ------
NM_012081chr553340 908 812 690 176 32291 1377 1068 --11265
NM_012084chrX----1568 --
NM_012089chr121502 549 ------
NM_012090chr131178 1144 1058 --1129 --
NM_012095chr1053400 3387 3191 2158 574 --1477 12646
NM_012096chr353496 2293 1241 726 252 21295 823 ----
NM_012098chr921439 295 21348 37 ----
NM_012104chr1141349 1331 1216 528 13009 13529 --
NM_012104chr1141349 1331 1216 528 13009 13529 --
NM_012105chr212870 152 ------
NM_012115chr6----1400 --
NM_012120chr642755 809 772 213 22910 2280 ----
NM_012124chr111281 ------
NM_012134chr161275 422 373 311 285 40 41735 1722 1361 1297 --11385
NM_012137chr152568 2074 682 664 145 --12422 --
NM_012141chr1343946 1226 691 663 --11648 --
NM_012155chr19162 ------
NM_012156chr2053311 3253 2275 209 106 1118 ----
NM_012164chr977285 6013 5887 5347 5113 704 80 ------
NM_012166chr981564 1513 1365 1266 1073 591 314 67 --1411 --
NM_012174chr1252916 2245 2062 758 704 22860 215 --1726
NM_012175chr113817 783 324 ------
NM_012193chr11105311 4980 3853 3589 2108 1541 1524 1412 561 141 14832 32165 1658 1441 --
NM_012199chr183162 3107 1832 1537 1490 1357 1029 807 11287 --1612
NM_012207chr103851 365 269 ------
NM_012210chr931500 1039 215 --11462 11556
NM_012214chr254781 4430 4222 4022 1711 55958 5146 5087 1900 608 26145 5801 14691
NM_012215chr1021962 42 --124 --
NM_012219chr342128 635 487 69 ------
NM_012223chr221220 518 ------
NM_012229chr1041486 1361 1186 253 ------
NM_012234chr393622 3172 2613 2304 2286 1446 1414 1026 749 1122 ----
NM_012238chr1031288 1244 529 11440 --11106
NM_012242chr101276 ------
NM_012247chr102676 163 11008 1746 --
NM_012249chr262748 2485 1312 996 701 647 12400 42696 2587 322 30 13450
NM_012250chr1131220 1028 370 ------
NM_012252chr764619 1449 1317 836 454 338 ----11036
NM_012255chr201125 ------
NM_012257chr72913 399 --3878 374 217 --
NM_012262chr131813 1612 442 13892 ----
NM_012264chr223754 269 221 12055 11645 --
NM_012264chr223754 269 221 12055 11645 --
NM_012281chr72761 740 ------
NM_012282chrX1240 --1251 --
NM_012286chrX1249 ------
NM_012287chr331804 1019 80 --1404 --
NM_012290chr231490 244 135 --11323 --
NM_012293chr25809 564 298 79 72 --12202 1455
NM_012294chr743134 1593 559 416 13257 24071 866 33870 3532 2974
NM_012297chr472176 2156 1751 1656 1019 982 958 ------
NM_012300chr532456 2365 678 12257 ----
NM_012301chr751973 1849 1562 671 420 22218 90 ----
NM_012302chr1--1868 ----
NM_012304chr542297 1876 1845 651 --22256 455 --
NM_012306chr1263206 2946 2896 1045 412 126 12357 --43469 938 859 100
NM_012307chr182949 390 --1801 --
NM_012308chr1152464 1788 1631 830 568 --22582 732 --
NM_012316chr194132 3526 3425 3410 1740 1562 1465 653 116 12192 45286 4417 1223 644 --
NM_012320chr1641255 1152 894 510 1925 1247 --
NM_012323chr2251521 1033 1024 604 433 --1340 --
NM_012325chr202630 59 ------
NM_012329chr1731313 656 101 11653 --1641
NM_012330chr1021300 604 --11632 --
NM_012333chr131260 1059 529 ------
NM_012334chr574606 4291 3548 1857 1347 885 334 23705 277 33615 353 103 --
NM_012382chr554551 3481 2839 1224 43 21165 803 13581 --
NM_012384chr2052311 2067 1778 1505 714 --11746 --
NM_012388chr1542362 1954 1175 804 --33162 2949 415 --
NM_012398chr1962736 2600 2184 1119 67 52 22575 745 ----
NM_012399chr2231908 422 38 11268 11424 --
NM_012405chr1113871 3673 3538 3499 3455 3354 2353 1309 1005 304 60 33199 3095 79 --13134
NM_012416chr9190 --1222 --
NM_012417chr17187 ----1445
NM_012419chr61630 1623 --2418 208
NM_012425chr1062355 2247 2042 834 805 256 ------
NM_012428chr152657 119 1364 ----
NM_012434chr631648 1585 175 1674 --2511 452
NM_012446chr55617 576 470 228 190 --1214 --
NM_012460chr14147 139 ----
NM_012463chr1221821 108 ------
NM_012464chr472864 1952 883 855 762 429 323 12172 ----
NM_012471chrX41756 1581 492 91 11861 ----
NM_012474chr12209 64 ------
NM_012479chr742183 957 927 583 11870 ----
NM_012482chr12560 499 166 ----
NM_012484chr51697 ----1111
NM_012486chr13470 427 31 ------
NM_013231chr1423703 2928 24176 1303 12729 12719
NM_013233chr231437 452 249 --11337 --
NM_013253chr1131168 954 224 --11358 --
NM_013254chr121660 ------
NM_013261chr473135 2939 2570 2349 1275 1054 197 --13562 11187
NM_013262chr631274 936 43 11237 ----
NM_013266chr10156 ------
NM_013269chr1243788 3671 3251 680 21498 206 11707 --
NM_013275chr165742 333 126 55 46 --1207 --
NM_013279chr1162365 1882 1763 1723 1436 849 --21979 1659 11973
NM_013281chr2031130 367 186 11141 11484 --
NM_013283chr51779 --1667 --
NM_013286chr383719 3521 3372 2550 2417 427 280 241 33338 1500 541 ----
NM_013313chr2263481 2798 2242 2203 119 50 12364 ----
NM_013316chr72865 392 ------
NM_013336chr341693 1235 201 31 21949 231 ----
NM_013354chr8----1568 --
NM_013363chr3140 ------
NM_013368chr19----2545 146 --
NM_013372chr1513200 1816 21281 117 --
NM_013374chr342881 2345 522 233 ------
NM_013377chr122491 68 ------
NM_013388chr21133 140 ----
NM_013396chr212159 121 --11035 --
NM_013399chr1611145 11166 21385 637 1563
NM_013436chr22713 324 --1543 --
NM_013437chr831420 1169 1010 11197 21225 541 --
NM_013444chrX------11094
NM_013446chr721338 553 --11421 1249
NM_013448chr142749 716 ------
NM_013449chr1252274 1964 1928 881 84 ----12939
NM_013450chr22493 67 ------
NM_013960chr81651 ------
NM_013995chrX72613 2095 2021 786 722 262 205 12373 ----
NM_014000chr102649 441 31405 661 483 175 --
NM_014001chr1751626 1394 1137 267 46 31022 480 369 1156 11200
NM_014011chr262298 2104 1043 978 725 475 ------
NM_014016chr351201 1080 600 482 168 ----21597 628
NM_014021chr163427 3068 3027 2877 2748 2640 ------
NM_014023chr1082769 2585 2521 2296 2142 1154 421 384 22402 2135 --11869
NM_014034chr611498 ------
NM_014041chr3152 ------
NM_014043chr321407 217 11193 11144 2527 462
NM_014048chr1685068 4281 4007 3549 3341 3292 3282 919 24656 694 ----
NM_014057chr911031 --11582 --
NM_014062chr161172 ------
NM_014089chr1331619 1438 85 12038 11576 --
NM_014106chr1552731 2613 2369 477 398 ------
NM_014112chr874778 4466 4268 4160 4070 3713 3577 11427 33916 1235 342 14972
NM_014117chr1652614 792 460 295 69 1409 1692 --
NM_014141chr775139 4476 4328 4094 3699 1162 782 21855 1114 15016 --
NM_014153chr162698 85 1218 ----
NM_014154chr321460 1130 ------
NM_014155chr11166902 6635 6446 6135 5959 5893 5280 2883 2453 2395 2164 1511 1058 1014 997 688 32823 2265 1118 ----
NM_014160chr331409 280 211 --1361 --
NM_014181chr222913 2186 --2775 727 --
NM_014210chr172449 174 ------
NM_014211chr511756 --21271 1085 --
NM_014217chr141908 1867 1590 1491 ------
NM_014223chr14745 714 677 487 1625 ----
NM_014225chr191374 ------
NM_014231chr1241757 1378 861 453 134 1344 --
NM_014232chr1731260 1244 1117 21298 617 ----
NM_014232chr1731260 1244 1117 21298 617 ----
NM_014240chr374166 3948 3783 3206 1522 1109 533 11553 22696 930 1391
NM_014243chr431838 761 585 ------
NM_014245chr311020 ------
NM_014246chr2231820 256 68 1796 1705 11839
NM_014251chr72796 749 --1720 --
NM_014253chrX62483 2363 2162 1696 367 36 1438 32301 532 128 --
NM_014263chr1021268 1004 11172 ----
NM_014267chr11166 ----1571
NM_014271chrX2696 80 --1676 --
NM_014278chr41378 ------
NM_014279chr91222 --163 --
NM_014280chr12362 257 1900 ----
NM_014283chr141537 1244 1099 459 ------
NM_014289chrX21434 943 1512 ----
NM_014309chr22115403 5115 4220 4098 3881 3623 1649 1447 1369 1281 247 14992 34308 3304 2003 --
NM_014319chr1221858 435 ------
NM_014322chr121176 983 --2363 136 --
NM_014323chr222752 43 --1120 --
NM_014325chr12--1103 ----
NM_014333chr112771 631 --1488 --
NM_014335chr152870 153 ----1365
NM_014342chr1111467 11225 ----
NM_014345chr6--1748 ----
NM_014350chr5155 2928 184 ----
NM_014352chr1131494 174 86 ------
NM_014363chr133263 213 57 182 ----
NM_014372chr141817 1601 1544 529 ------
NM_014376chr552267 1673 894 842 747 --12576 12368
NM_014379chr84678 374 175 105 ------
NM_014382chr321414 38 1568 ----
NM_014392chr44471 200 158 117 1476 --11117
NM_014393chr841541 887 265 208 --11468 --
NM_014399chr72770 254 ------
NM_014400chr191408 ------
NM_014408chr12439 157 ------
NM_014415chr32224 83 ------
NM_014421chr441345 599 462 27 11421 ----
NM_014423chr564898 4717 4627 1879 943 694 --11968 169
NM_014445chr352464 1813 1778 962 372 1858 1478 --
NM_014447chr41165 1629 ----
NM_014452chr621035 252 ------
NM_014454chr641046 837 265 161 1219 ----
NM_014456chr1031625 1188 396 1313 ----
NM_014458chr121247 1112 ------
NM_014460chr2271764 1435 1316 569 336 257 85 ------
NM_014482chr22105 32 ------
NM_014488chr111230 --139 --
NM_014489chr112830 38 ------
NM_014491chr74819 756 268 180 1381 ----
NM_014494chr1662339 1834 1554 1512 1498 644 ------
NM_014504chr741890 1535 716 93 --1310 --
NM_014515chr122185 77 --1850 --
NM_014517chr33621 398 22 2178 172 1259 --
NM_014548chr1531250 1175 365 1465 --11212
NM_014552chr231422 453 69 --1591 --
NM_014554chr122250 82 12058 11617 --
NM_014563chrX22116 1826 ------
NM_014572chr132559 32 21664 1139 ----
NM_014573chr1751437 1426 1391 581 76 --11615 1636
NM_014574chr142374 177 164 ----
NM_014575chr31367 ------
NM_014584chr1431601 1377 472 ------
NM_014592chr53771 686 271 1189 1584 --
NM_014606chr451448 1372 1126 1086 530 ------
NM_014607chr24805 628 462 83 1220 ----
NM_014612chr941489 1201 1071 587 --11469 --
NM_014613chr572811 2288 2152 1985 877 181 147 --1501 22112 1002
NM_014614chr21951 --195 --
NM_014615chr1642330 1127 980 225 13114 22454 1104 12761
NM_014618chr91168 1395 ----
NM_014630chr1572865 1025 824 798 365 305 282 22636 1346 13139 1143
NM_014633chr112469 245 ------
NM_014634chr2293574 2610 2518 2436 2296 1143 1122 974 179 32914 2889 1151 ----
NM_014635chr251767 1531 1510 1167 450 1239 ----
NM_014636chr973746 3619 3355 3145 2845 2662 441 23176 1032 --13675
NM_014637chr811503 --1998 --
NM_014646chr1892809 2730 2621 1280 1242 1076 872 527 159 12292 2470 436 11305
NM_014647chr1631997 1922 41 ------
NM_014655chr141740 1576 1507 406 --2468 157 --
NM_014660chr711088 ------
NM_014662chr222471 45 ------
NM_014663chr12832 304 ------
NM_014665chr872533 1442 1389 1365 685 278 250 12589 --1637
NM_014667chr342328 946 715 292 --2551 468 --
NM_014670chr221197 142 ----11145
NM_014671chr71503 21207 256 ----
NM_014673chr8138 ------
NM_014674chr373871 3743 2723 2599 1554 1222 594 11160 22737 238 --
NM_014676chr111434 11478 1226 --
NM_014682chr83592 499 349 180 21755 1431 --
NM_014683chr1741560 1494 616 95 11726 ----
NM_014685chr163488 439 72 ------
NM_014686chr1982290 1961 1899 896 807 773 742 684 1842 ----
NM_014690chr72571 534 13040 12648 --
NM_014699chr16----1390 --
NM_014700chr1631393 638 474 1166 ----
NM_014701chr1583290 3093 3030 951 818 800 196 86 11027 11381 --
NM_014702chr632733 939 798 11297 13068 13311
NM_014707chr761538 779 683 645 602 333 11609 ----
NM_014711chr1621718 204 ------
NM_014719chr7--11102 ----
NM_014720chr1041324 1279 327 289 1277 ----
NM_014721chr6157343 6800 6697 6020 5931 5845 5303 5242 4997 2262 2209 1010 847 368 217 67424 5576 5101 2394 1557 1240 17234 --
NM_014729chr842318 1982 721 298 --1287 1790
NM_014730chr1275277 4109 4032 3364 3343 2103 652 22066 1003 54886 4694 4334 4264 1707 --
NM_014730chr1275277 4109 4032 3364 3343 2103 652 22066 1003 54886 4694 4334 4264 1707 --
NM_014732chr16144866 4529 4439 4406 1963 1914 1864 1645 1609 1440 1294 1279 1109 126 41705 1603 1241 422 ----
NM_014733chr532227 1570 662 ------
NM_014735chrX3509 192 99 1496 12161 --
NM_014738chr171747 ------
NM_014739chr664166 3538 1461 856 711 433 14184 ----
NM_014742chr2071535 1459 1368 1144 596 383 66 --1722 --
NM_014743chr462548 1964 1086 326 304 287 ------
NM_014746chr273911 2757 1709 1336 898 868 449 1387 13028 --
NM_014747chr1105723 5466 5079 4913 4843 4060 3823 3664 1248 380 23517 2200 ----
NM_014751chr872167 1863 1586 1524 824 786 35 ------
NM_014752chr1111731 ----1652
NM_014755chr253707 2764 1655 1025 331 --33838 3509 534 --
NM_014757chr562322 2164 1825 639 368 321 --11967 --
NM_014764chr121817 --169 --
NM_014765chr122693 284 ----12093
NM_014767chr1083355 3027 2850 2508 1382 1251 259 22 --33431 3328 1242 --
NM_014772chr1863362 2810 2579 2564 2390 1165 1973 13547 --
NM_014773chr521257 537 ------
NM_014774chr172809 2580 2552 860 537 384 31 1612 --1245
NM_014779chr311028 ----1806
NM_014781chr81860 --1324 --
NM_014782chrX180 ----1122
NM_014790chr51110 ------
NM_014795chr25916 303 230 188 69 ------
NM_014800chr72359 212 1270 1738 --
NM_014806chr9----1173 --
NM_014810chr121332 788 33358 2276 576 12315 --
NM_014819chr521978 1941 1329 ----
NM_014820chr342034 2022 1998 82 21973 74 ----
NM_014822chr4----1592 --
NM_014824chr1141841 1239 578 557 128 ----
NM_014826chr154401 4174 3818 1693 741 12755 ----
NM_014830chr1253446 2468 2390 1412 1060 ------
NM_014835chr2061935 777 740 666 477 160 1169 ----
NM_014838chr2272685 2042 1890 725 551 414 39 --12791 --
NM_014839chr11976 21548 776 --1143
NM_014841chr621094 536 ------
NM_014846chr83270 245 101 ------
NM_014850chr394747 4464 3624 3508 3085 2972 837 670 609 11288 14348 13414
NM_014862chr1524101 2650 --14192 --
NM_014869chr341364 1181 1112 21 --2965 571 --
NM_014871chr122628 527 1491 1416 --
NM_014872chr91338 12049 196 --
NM_014873chr154726 4439 4252 3093 3082 --21125 817 14547
NM_014877chr1796592 5681 5615 4997 4937 2191 1794 1231 131 27769 5361 26519 5247 --
NM_014882chr21577 ------
NM_014883chr410798 599 541 508 479 398 229 156 51 34 1515 ----
NM_014893chrY72176 1918 1740 643 306 241 41 --11467 --
NM_014897chr1712418 1191 12758 --
NM_014899chr542976 2811 1244 367 1954 ----
NM_014900chr231063 973 406 ------
NM_014903chr1262101 1949 1614 892 824 174 181 11652 1604
NM_014904chr1073253 1466 989 716 669 566 417 1647 ----
NM_014905chr231632 1573 543 ------
NM_014906chr1733720 2622 1170 --33351 1231 830 --
NM_014907chr9----1124 --
NM_014909chr1483894 3688 3479 2955 2746 2432 722 151 13675 22463 341 13154
NM_014912chr1061235 1219 863 334 199 66 23086 305 1804 --
NM_014917chr1--2759 248 ----
NM_014925chr124882 746 651 333 125 ----
NM_014931chr19193 ------
NM_014932chr331874 1590 198 ------
NM_014933chr4--132 1160 --
NM_014934chr1354012 3813 2872 2863 2704 ------
NM_014935chr183629 3017 2526 2472 1016 904 512 441 43355 3349 2977 169 ----
NM_014937chr1031143 502 82 ------
NM_014942chr662433 2362 1613 932 513 56 --11876 --
NM_014945chr52807 102 1132 ----
NM_014947chr163062 2966 2283 2274 235 167 13111 1216 --
NM_014949chr13838 802 667 ----1961
NM_014952chr1541823 1357 804 63 11753 ----
NM_014961chr412231 ------
NM_014962chr2032198 2082 2017 22155 1135 12177 --
NM_014964chr1731928 1840 1551 22298 1962 1702 --
NM_014969chr121180 750 --11109 --
NM_014974chr1031482 1191 228 --11644 --
NM_014978chr1021697 457 ------
NM_014982chr1484570 4421 1213 994 695 555 299 181 1849 33845 644 225 1379
NM_014988chr442699 2170 957 401 --164 12246
NM_014989chr651892 1808 1428 1418 1325 ------
NM_014990chr1441217 1155 484 140 ----1390
NM_014991chr452901 2872 2401 2070 838 --32737 1111 468 --
NM_014992chr14175 1792 ----
NM_014994chr1551935 1466 482 439 51 1498 ----
NM_014996chr341033 771 370 229 ------
NM_014999chr1231647 51 40 170 ----
NM_015000chr1293126 2733 2091 1971 483 329 277 271 45 ------
NM_015001chr12961 803 1113 2350 90 --
NM_015008chr383585 2804 2643 2383 2230 1009 328 160 --33277 2501 2326 --
NM_015012chr112322 57 1131 1341 --
NM_015018chr6163 ------
NM_015020chr1653484 3056 2925 1482 1287 ------
NM_015023chr141774 1510 1183 354 --1341 --
NM_015024chr84904 591 142 68 ------
NM_015025chr22676 251 --22157 925 12075
NM_015027chr1651981 661 608 542 75 1474 11475 --
NM_015032chr1362896 2751 2470 2048 1164 109 ------
NM_015035chr2036664 6604 2411 2370 84 26303 4747 11909
NM_015040chr283171 2985 2278 2197 1344 737 411 142 --13377 12934
NM_015042chr1553515 3031 2776 923 332 --23630 694 --
NM_015044chr1632614 912 322 23007 615 21127 1075 12747
NM_015045chr1052274 1976 1811 1420 564 --1355 --
NM_015051chr933422 2467 2211 21033 290 ----
NM_015052chr721354 1164 --1165 1219
NM_015056chr214892 849 360 30 1483 --12310
NM_015057chr13----138 --
NM_015064chr1292770 2605 2509 2271 1343 905 648 273 207 ----23059 622
NM_015068chr773894 3656 3618 3425 1509 1466 1225 43777 1553 357 257 --11345
NM_015069chr162628 433 ------
NM_015071chr596017 5992 4556 4446 4296 1839 1403 1036 896 21246 693 34528 53 23 --
NM_015074chr154942 4075 1700 1239 633 --23508 1266 11811
NM_015075chrX41982 1722 591 258 1303 ----
NM_015076chr674432 3600 1367 859 525 518 487 --24234 626 13624
NM_015077chr1773303 3256 3023 1830 1450 1321 852 24024 2953 13389 14242
NM_015079chr15143231 3154 3133 2892 2851 2425 2416 2338 1302 1222 767 592 559 229 22386 1142 22103 1985 22570 676
NM_015080chr115881 728 354 219 106 126 132 --
NM_015082chr532101 494 267 2776 367 12140 --
NM_015087chr1322550 2026 ----12209
NM_015090chr1106171 5684 4838 2433 2129 2001 1547 1121 796 302 21750 1054 35660 5129 2501 25512 1713
NM_015092chr1643518 1421 305 173 --12962 --
NM_015093chr63455 245 238 182 ----
NM_015094chr2274683 4583 4083 1732 1617 842 137 --14598 --
NM_015097chr352349 1954 1615 710 408 ------
NM_015107chrX31852 1778 42 --11760 --
NM_015115chr493069 2646 2349 2230 2051 906 710 432 67 1453 12324 12889
NM_015116chr1341723 561 315 228 --11072 --
NM_015132chr731515 1319 1244 --1242 --
NM_015137chr862320 984 719 465 457 347 --21702 1030 --
NM_015138chr1592834 2771 2293 2099 2072 1909 773 722 399 ----1127
NM_015143chr421409 294 --11112 --
NM_015144chr1643826 3357 3073 1190 33403 299 176 ----
NM_015149chr122137 560 12228 --1577
NM_015153chr6276 39 ------
NM_015155chr1052699 2504 2476 2423 2225 --13332 --
NM_015156chr1453549 3257 1405 1044 528 1522 33924 2535 673 --
NM_015158chr92673 44 1165 ----
NM_015161chr16143 --1432 --
NM_015162chr152542 386 --2597 536 --
NM_015163chr1421947 1794 11325 127 --
NM_015170chr852169 1865 1531 797 153 --1199 --
NM_015171chr162163 129 140 2428 391 --
NM_015173chr421152 40 21548 1490 ----
NM_015176chr131411 1346 681 --11465 --
NM_015180chr141803 144 ----
NM_015184chr31147 ------
NM_015185chrX31920 1889 399 --1688 --
NM_015192chr2052356 2219 2088 78 28 --1451 --
NM_015194chr1741934 1488 187 64 --11572 1844
NM_015197chr1463068 2948 2914 2837 2247 54 --1184 1581
NM_015198chr721283 23 ------
NM_015199chr352617 2157 525 432 44 ------
NM_015200chr441812 1777 843 283 --12008 --
NM_015206chr1533711 2410 682 --1746 --
NM_015208chr1883745 3133 2701 2662 748 620 569 69 1145 ----
NM_015209chr171972 1615 937 748 742 420 25 ------
NM_015215chr173107 2866 2663 2359 1074 370 163 22136 1957 13137 --
NM_015216chr531199 1138 137 ------
NM_015219chr1732273 720 307 ----12423
NM_015236chr41456 ----2192 36
NM_015239chr92557 26 ------
NM_015245chr6102747 2519 2406 2276 2180 1896 1717 825 800 553 31724 342 63 1571 --
NM_015247chr1684568 4510 1786 1211 924 515 155 90 21469 729 15024 13366
NM_015251chr1662320 2193 2013 519 415 391 2620 469 1584 --
NM_015252chr21298 1900 ----
NM_015263chr15--1900 ----
NM_015264chr2244406 4152 3805 416 24762 56 11014 --
NM_015265chr251926 1795 726 574 452 12329 ----
NM_015267chr124607 593 424 195 --21461 793 --
NM_015268chr33737 278 87 ------
NM_015271chr444148 2885 1660 227 13609 1775 --
NM_015272chr161638 12144 --1203
NM_015275chr1241872 1454 663 593 11802 ----
NM_015278chr663319 3053 2679 2126 893 568 13089 13177 --
NM_015282chr252495 2313 835 607 84 --22320 2225 --
NM_015284chr151745 1366 430 159 60 21795 374 ----
NM_015288chr532771 2640 352 3507 333 112 13156 33211 753 70
NM_015291chr173309 3251 2936 2405 1203 893 262 22970 438 --13092
NM_015294chr174957 870 378 144 ----1315
NM_015296chr1311204 ------
NM_015299chr1473266 2558 2515 2507 1297 875 24 --13646 --
NM_015308chr112220 205 ------
NM_015310chr8198108 7083 6657 6425 6253 6131 5648 5515 3313 2685 2439 2277 1885 1741 1582 1061 786 396 334 --17899 --
NM_015313chr1173695 3274 1317 1274 1102 184 25 14065 41365 1235 933 459 33597 3566 2958
NM_015315chr542978 1275 463 453 22327 1168 ----
NM_015319chr124397 347 149 38 ------
NM_015320chr22807 285 ------
NM_015326chr12227 190 22942 374 ----
NM_015328chr782147 1079 885 862 501 255 195 87 11148 1106 --
NM_015332chr783479 3184 3164 1249 1085 960 195 59 --13038 11238
NM_015336chr1232572 931 739 1188 ----
NM_015338chr2051933 1917 486 295 214 21292 142 ----
NM_015339chr2031042 90 64 ------
NM_015344chr852028 2004 1690 656 546 11963 ----
NM_015345chr672650 2434 2179 1893 1711 993 244 --12716 --
NM_015346chr1421214 514 ------
NM_015347chr1242790 2250 331 309 1854 ----
NM_015349chr632971 2904 574 1588 ----
NM_015350chr12522 490 ------
NM_015355chr1721495 1393 ------
NM_015358chr2121340 280 ------
NM_015359chr851926 913 729 615 47 1833 42223 858 515 182 --
NM_015365chrX64134 3801 3172 2864 2669 735 11678 --13389
NM_015375chr134310 3879 1789 24103 1093 --13806
NM_015378chr1122877 2520 2304 2297 2082 2074 1879 1106 895 449 381 279 --12176 --
NM_015379chr71210 ------
NM_015381chr222442 434 2522 397 11870 --
NM_015385chr1073280 2491 824 630 523 492 341 13128 ----
NM_015387chr231536 811 271 ------
NM_015396chr31106 11217 1962 --
NM_015415chr1192 ------
NM_015416chr126970 832 788 771 744 164 ------
NM_015429chr32933 850 ------
NM_015435chr841494 1459 1161 430 ------
NM_015446chr131700 1371 1299 --21613 1121 --
NM_015447chr93808 272 260 1571 ----
NM_015455chr561586 1162 971 884 592 348 1202 11572 --
NM_015457chr111273 ------
NM_015458chr885152 4937 4655 4337 3795 2104 1778 882 --11490 --
NM_015460chr33807 557 34 22118 2105 1391 --
NM_015461chr181141 1594 ----
NM_015463chr21799 ------
NM_015464chr7184 1998 ----
NM_015470chr271188 1157 1036 801 477 314 48 ------
NM_015472chr32449 152 ------
NM_015472chr32449 152 ------
NM_015475chr2----2263 253 --
NM_015481chr121774 ------
NM_015483chr731111 961 441 ------
NM_015493chr1931878 1579 533 ------
NM_015497chr153978 882 230 --1397 --
NM_015508chr331437 468 208 11415 ----
NM_015509chr1221407 1021 ------
NM_015520chr322273 2009 11113 ----
NM_015530chr21267 1254 1634 1830
NM_015534chr141124 1098 1001 753 --1850 --
NM_015535chr244078 3549 3130 1287 172 11139 --
NM_015541chr31545 11210 ----
NM_015549chr141632 ------
NM_015554chr1582936 2659 2244 1986 1872 788 673 161 --1337 --
NM_015556chr14----1240 --
NM_015557chr182774 2577 2226 1210 1040 931 880 454 ----197
NM_015559chr183735 429 422 1327 ----
NM_015564chr542380 2286 785 389 23130 2247 12677 1808
NM_015565chr2142016 1971 1841 1771 ------
NM_015568chr2074238 2740 2674 1605 1563 1515 152 23075 491 23519 2996 14293
NM_015569chr184711 3909 3334 2942 1842 1342 994 298 24198 513 1469 1196
NM_015570chr721847 1681 ------
NM_015571chr642577 2173 539 272 12002 ----
NM_015575chr243684 2649 1393 306 2550 544 --11305
NM_015576chr342692 1980 603 123 ------
NM_015577chr52165 26 177 1181 --
NM_015578chr1941889 1720 1408 352 1630 ----
NM_015584chr174407 394 250 65 11303 1423 1262
NM_015599chr61266 ----158
NM_015601chr102995 175 ------
NM_015608chr101619 ------
NM_015609chr182439 2413 2224 1982 1842 668 73 33 --12914 --
NM_015610chr782807 2494 2421 2200 1861 798 464 259 12301 12679 --
NM_015626chr174927 921 262 223 ------
NM_015630chr241162 819 748 465 ------
NM_015634chr10----1200 --
NM_015635chr951868 1389 737 603 73 ----12001
NM_015640chr154837 4233 3661 2093 924 1108 --13953
NM_015646chr12144 21253 263 ----
NM_015651chr932218 2156 112 32166 1818 682 11483 --
NM_015670chr171335 ------
NM_015686chrX82468 2239 2192 1986 1629 892 809 198 1736 1788 --
NM_015695chr652135 632 516 336 295 31430 1339 823 ----
NM_015702chr2--167 ----
NM_015713chr843327 2961 2447 473 32885 2780 779 ----
NM_015716chr171209 ------
NM_015723chr71477 ------
NM_015833chr2152290 1965 1459 456 273 ------
NM_015850chr872453 2093 1905 1769 888 288 119 22001 229 ----
NM_015866chr11150 1569 ----
NM_015869chr31203 123 ----
NM_015878chr862157 2115 1765 841 499 477 11661 11671 --
NM_015879chr18118588 8489 7468 6953 6739 6093 5869 3288 1625 1586 145 28430 5668 26645 296 18387
NM_015881chr1131168 954 224 --11358 --
NM_015885chr113280 174 42 ------
NM_015891chr641781 1286 568 139 21793 747 21938 1807 --
NM_015892chr1042185 829 475 81 ------
NM_015902chr83810 339 322 ------
NM_015905chr71612 ------
NM_015906chr133684 3435 1927 --24735 4562 --
NM_015908chr7--195 ----
NM_015912chr832174 937 905 ------
NM_015920chr151520 ------
NM_015955chr21420 ------
NM_015975chrX31671 138 113 1406 ----
NM_015976chr11279 ------
NM_015980chr531322 1078 288 ------
NM_015981chr553117 2411 1986 294 67 --12394 12097
NM_015984chr11549 ------
NM_015986chr1721083 71 ------
NM_015995chr1565145 4875 3869 1877 1810 196 12076 15188 --
NM_016003chr782807 2494 2421 2200 1861 798 464 259 12301 12679 --
NM_016009chr194819 3148 3007 1979 1687 1316 1136 1019 285 ----11659
NM_016018chr842801 1897 1749 211 --1460 1999
NM_016019chr73832 674 350 ------
NM_016021chr653027 2512 1124 498 308 22005 673 137 --
NM_016022chr141037 927 83 47 ------
NM_016025chr1631378 667 292 11642 22027 1610 --
NM_016032chrX51422 1097 524 387 108 ------
NM_016045chr2021153 390 ------
NM_016048chr5----1998 --
NM_016059chr6--1323 ----
NM_016061chr221138 104 173 1651 --
NM_016070chr172228 81 ------
NM_016072chr1232355 2077 319 12377 ----
NM_016073chr151813 ------
NM_016075chr1343024 2903 1016 616 22220 1266 ----
NM_016076chr132823 2764 906 13124 2201 31 21180 394
NM_016079chr262049 1663 726 409 377 283 ----149
NM_016081chr451539 448 426 249 181 11475 ----
NM_016083chr6103898 3498 3264 3179 3101 2938 2411 1146 1116 574 11394 1369 --
NM_016090chr112160 85 ------
NM_016096chr881991 1837 617 542 405 92 76 46 ----1641
NM_016098chr61171 144 ----
NM_016100chr202371 336 ------
NM_016121chr12869 348 11124 ----
NM_016131chr22254 158 11870 1914 --
NM_016132chr1523276 2472 ----1699
NM_016133chr221663 233 ----194
NM_016141chr32783 647 1221 ----
NM_016144chr5--2278 70 ----
NM_016147chr1131051 986 79 --1954 --
NM_016151chr161417 ------
NM_016152chr3181 --1473 --
NM_016156chr1152387 2244 2165 590 153 --12097 --
NM_016162chr121256 1908 ----
NM_016169chr1072723 2711 1113 1103 1041 118 42 2953 653 ----
NM_016170chr23545 219 60 ------
NM_016185chr172123 56 --2642 532 --
NM_016201chr371958 1779 1480 828 804 507 404 1730 ----
NM_016206chr398408 8372 8285 7911 7318 3029 1477 232 66 22813 1434 37014 6968 1516 12366
NM_016211chr4--132 1160 --
NM_016213chr15153 ------
NM_016217chr643417 1417 920 149 --12290 1898
NM_016221chr541731 333 174 70 4791 766 511 499 1444 --
NM_016224chr631758 1666 133 1531 ----
NM_016226chr121148 ------
NM_016227chr141537 1244 1099 459 ------
NM_016231chr1711353 ------
NM_016248chr1362608 1508 1307 1191 1124 338 1660 12506 --
NM_016252chr2--1270 ----
NM_016257chr123040 701 11207 --1990
NM_016258chr12769 22 ------
NM_016260chr297510 7456 6961 5503 4805 1860 1182 457 43 --36799 2021 1748 --
NM_016269chr41100 2197 165 1743 11122
NM_016272chr2242504 1930 472 419 11729 1340 --
NM_016275chr321119 809 --1638 --
NM_016277chr631346 475 191 ------
NM_016279chr5141 1432 ----
NM_016281chr1241040 940 853 459 ----11156
NM_016282chr951765 1702 1379 521 67 11160 ----
NM_016289chr241732 1609 755 168 197 ----
NM_016299chr10198 ------
NM_016322chr993234 2568 2532 2192 2025 973 825 395 70 --1474 1160
NM_016329chr31170 ------
NM_016337chr141494 --1443 --
NM_016338chr561193 1165 1150 388 270 22 ------
NM_016339chr1741577 1308 693 663 ----11660
NM_016351chr7135 ------
NM_016357chr123816 784 55 --1876 --
NM_016374chr11278 --1182 --
NM_016374chr11278 --1182 --
NM_016376chr1753676 3575 3477 810 53 11219 24315 3992 --
NM_016377chr621551 124 1340 ----
NM_016396chr1521059 942 174 --13052
NM_016399chr123703 609 209 1721 1329 --
NM_016401chr11----1113 --
NM_016424chr1751835 779 757 529 363 ----1485
NM_016433chr1231442 1428 1401 --190 --
NM_016436chr2032413 1659 525 --11874 --
NM_016448chr131831 1470 1410 --1120 --
NM_016454chr151316 --1299 --
NM_016467chr221134 72 --11065 --
NM_016472chr1451197 1114 506 441 312 21359 304 ----
NM_016480chr5--1114 --1823
NM_016489chr7149 1390 ----
NM_016506chr112706 171 --127 --
NM_016507chr172489 307 --12830 --
NM_016525chr92810 133 --1211 --
NM_016526chr112812 324 21829 1611 11883 12469
NM_016530chr1574050 3879 3721 883 688 475 22 ------
NM_016531chr454016 3687 3253 3191 2894 1387 ----
NM_016538chr171161 ------
NM_016542chrX11664 ------
NM_016544chr283809 3783 3495 1571 1247 816 688 101 11062 ----
NM_016556chr173621 217 31 ------
NM_016569chr1231081 1018 46 ----11026
NM_016575chr1295221 1733 1621 1512 1288 613 427 396 24 35490 4407 4121 24893 31 --
NM_016577chr3104489 3969 3920 2852 2818 1409 1096 825 819 258 1250 34536 3737 687 --
NM_016578chr111188 ------
NM_016587chr711079 ------
NM_016588chr61717 ------
NM_016603chr552153 1991 722 476 216 ------
NM_016604chr52413 154 --1266 --
NM_016605chr572554 2292 1826 1085 1068 483 406 12595 12574 12160
NM_016607chrX1225 11122 --193
NM_016620chr131434 281 232 11424 ----
NM_016621chr11104385 4192 4099 3742 3398 3237 3174 3099 3032 2981 ------
NM_016623chr81446 ------
NM_016626chr1841369 685 426 256 1441 11416 1601
NM_016628chr104790 707 76 41 ------
NM_016631chr213699 209 83 ------
NM_016651chr1431140 978 843 ------
NM_016654chr1541328 1265 1010 61 ------
NM_016733chr222210 47 ------
NM_016823chr1721248 344 --1148 162
NM_016831chr131503 946 542 ----11947
NM_016834chr1773628 3289 2665 1455 1193 357 101 22961 2627 33446 2525 957 11660
NM_016835chr1773628 3289 2665 1455 1193 357 101 22961 2627 33446 2525 957 11660
NM_016841chr1773628 3289 2665 1455 1193 357 101 22961 2627 33446 2525 957 11660
NM_016929chr693696 3555 3017 2950 1143 1124 1080 724 88 1303 --33451 1306 1021
NM_016937chrX2300 219 ------
NM_016938chr111410 ------
NM_016950chr431194 439 138 ----11143
NM_016952chr11113931 3649 3411 2840 2725 1562 1451 1006 763 73 47 23277 3121 23037 1480 --
NM_016953chr2105881 5364 5016 4737 2321 1081 1051 453 408 23 25589 4874 1535 --
NM_017412chr851357 1249 497 484 318 ------
NM_017415chr584593 3269 2965 1502 1280 623 482 46 --23793 727 --
NM_017420chr1463172 3046 2723 1092 368 179 ------
NM_017423chr451876 1729 1430 199 152 41995 1522 664 466 ----
NM_017447chr2144386 4347 3943 1677 --34277 3721 993 --
NM_017452chr2031268 555 265 11393 2245 63 --
NM_017453chr2031268 555 265 11393 2245 63 --
NM_017454chr2031268 555 265 11393 2245 63 --
NM_017455chr152657 119 1364 ----
NM_017519chr61468 ------
NM_017522chr131445 276 177 ------
NM_017540chr532012 976 235 ----22752 635
NM_017544chrX1702 ----1923
NM_017548chr341892 604 162 40 ------
NM_017550chr193370 253 49 1233 11068 --
NM_017553chr154942 833 534 252 ------
NM_017563chr3125614 5529 4839 4451 2256 2122 1679 1584 1576 1552 1476 37 45044 842 520 27 --15640
NM_017580chr101579 1881 --11478
NM_017582chr141283 376 187 82 --11431 21216 1170
NM_017596chr173779 3466 3142 1340 1176 667 82 --24142 1392 --
NM_017599chr1221440 405 --1228 --
NM_017602chrX2669 175 2839 182 ----
NM_017610chr1552083 1962 1418 696 316 ------
NM_017628chr454206 2053 2019 1839 1015 14267 14498 --
NM_017629chr131315 780 156 1736 11690 --
NM_017633chr653777 1423 897 651 509 11491 13135 11384
NM_017634chr831777 1734 242 1679 ----
NM_017635chr111335 ------
NM_017637chr9109149 8335 7957 7475 6565 6358 6049 3635 2462 2092 25990 885 39347 8486 6131 2993 61
NM_017640chr61341 ------
NM_017641chr12----1134 --
NM_017643chr1743042 2852 2445 2339 ----1383
NM_017644chr3104463 4356 4027 3739 3641 3543 1333 1003 602 390 13422 ----
NM_017650chr795593 5229 5154 4020 810 471 404 148 133 24916 1714 11875 24695 1085
NM_017651chr62315 261 --127 --
NM_017657chr21344 ------
NM_017658chr1463833 1517 934 614 442 89 ----11764
NM_017664chr131884 2295 282 21064 158 1745
NM_017668chr16158 ------
NM_017670chr117866 752 664 210 186 32 24 --1860 --
NM_017672chr15--1380 ----
NM_017680chr91339 1794 ----
NM_017684chr1531796 1753 512 ------
NM_017693chr131275 11291 --144
NM_017709chr143327 3239 665 537 11521 11161 --
NM_017714chr202335 126 ------
NM_017728chr17102659 2526 1968 1955 1148 908 767 758 628 449 1369 --12479
NM_017737chr161938 1629 1546 875 857 53 1606 ----
NM_017738chr91151 1232 --1397
NM_017742chr1841730 1294 1221 329 --1517 --
NM_017744chr162459 868 692 625 344 200 ------
NM_017747chr51125 ------
NM_017748chr173787 343 49 ----1855
NM_017753chr94907 425 378 85 1700 ----
NM_017754chr684520 4214 3588 3530 3444 1407 1190 78 34904 4894 4031 ----
NM_017761chr141467 1043 467 435 ------
NM_017769chr1441244 741 321 40 13235 12401 --
NM_017772chr621166 29 21372 191 ----
NM_017778chr841425 969 357 167 ------
NM_017780chr8--1920 --1890
NM_017786chr83587 571 482 ------
NM_017793chr152843 220 ------
NM_017798chr2021203 1196 ------
NM_017799chr1451400 561 340 276 85 1741 --11436
NM_017811chr962795 1242 1083 671 503 28 ------
NM_017813chr844702 4424 3827 3691 15044 21248 940 --
NM_017824chr1082658 2336 2202 2160 1955 1855 303 101 ----1814
NM_017831chr1864530 3782 3440 1516 927 38 11300 23055 158 11252
NM_017842chr122477 52 2693 620 ----
NM_017847chr132213 907 236 1115 1163 --
NM_017848chrX44303 4157 4012 770 33872 2991 1150 11278 --
NM_017849chr263074 2960 2181 1214 1046 332 11173 ----
NM_017856chrX51923 1886 1400 832 306 11566 11536 --
NM_017860chr11689 ------
NM_017866chr841096 1000 862 442 --164 --
NM_017873chr983052 3029 2940 2766 2535 799 608 201 ----12275
NM_017880chr2----1109 --
NM_017893chr1021304 64 --1941 --
NM_017902chr1054420 4389 4374 1058 1009 138 14462 --
NM_017910chr2174 ------
NM_017913chr9--1431 ----
NM_017919chr965424 3914 3882 3745 2277 1284 35058 4133 245 13760 --
NM_017921chr1782248 1544 909 858 849 688 566 446 22192 347 188 --
NM_017925chr921829 1413 --1230 --
NM_017926chr141298 --1343 --
NM_017933chr2--198 11149 --
NM_017938chrX52177 2121 2053 2033 532 22158 364 ----
NM_017944chr1132120 774 128 --12108 --
NM_017952chr284104 3933 3407 2984 2812 344 173 42 1612 23377 1553 --
NM_017953chr131212 269 44 ------
NM_017972chr141298 --1343 --
NM_017983chr171130 ------
NM_017988chr121864 ------
NM_018014chr221406 1180 ------
NM_018015chrX286 44 ----1419
NM_018026chr111467 2149 39 --1447
NM_018027chr1063173 3010 2921 2324 1050 160 1696 32822 1221 894 1791
NM_018030chr1841058 1017 256 129 ----11040
NM_018045chr122765 534 21193 768 2144 132 --
NM_018047chr51216 ----1195
NM_018051chr7--1307 ----
NM_018054chr162665 555 ------
NM_018061chr1--1476 --1338
NM_018062chr21358 ------
NM_018063chr101417 ------
NM_018067chr11439 ------
NM_018071chr141152 ------
NM_018083chr19171 ------
NM_018084chr233087 1021 550 ----1223
NM_018086chr241853 1758 687 99 ----11725
NM_018087chr1133 --1192 --
NM_018089chr21170 ------
NM_018092chr1641686 1084 332 305 1255 ----
NM_018094chrX179 --1269 --
NM_018095chr112706 171 --127 --
NM_018099chr12161 ----1106
NM_018103chr12312 289 ------
NM_018105chr821190 1084 ------
NM_018107chr14122 ------
NM_018110chr163475 40 29 21394 407 1122 --
NM_018113chr122200 50 141 ----
NM_018115chr4----3744 692 123 --
NM_018117chr101750 ------
NM_018120chr831352 1070 968 --1246 171
NM_018121chr1042482 2438 2253 999 --23207 2500 1162
NM_018128chr1721109 112 ------
NM_018131chr101664 1265 1102 --
NM_018133chr31426 32169 2106 879 ----
NM_018139chr142136 73 ------
NM_018144chr101337 --1373 --
NM_018151chr21752 ------
NM_018155chr331368 711 587 --21322 1094 1251
NM_018156chr1122877 2520 2304 2297 2082 2074 1879 1106 895 449 381 279 --12176 --
NM_018159chrX31643 1338 563 --11174 --
NM_018171chr121946 ------
NM_018172chr1141177 1069 962 155 --11503 6629 577 525 473 421 369
NM_018178chr12792 528 22026 48 1467 11563
NM_018181chr1841555 1438 559 97 ------
NM_018182chr1741856 1766 242 93 --12013 --
NM_018184chr351994 1788 1407 310 141 11489 1109 --
NM_018195chr11------21352 827
NM_018198chr131178 509 217 --1545 --
NM_018200chr1562521 2000 1861 734 695 573 --11054 12235
NM_018202chr13965 667 110 --1170 --
NM_018211chr151951 739 421 127 63 ------
NM_018214chr631145 982 137 1813 ----
NM_018216chr12103 72 ----1206
NM_018217chr20155 ------
NM_018221chr21122 ------
NM_018243chr483898 3788 2766 1437 1321 628 606 457 --33848 3555 3074 --
NM_018245chr101152 ------
NM_018246chr862702 2312 1757 948 277 53 12709 --11965
NM_018247chr632907 828 311 --2798 227 --
NM_018252chr1----129 --
NM_018254chr13625 540 22 ------
NM_018263chr232507 1741 962 12492 ----
NM_018287chr103946 322 202 ------
NM_018293chr332926 2168 838 ------
NM_018299chr853247 923 820 504 352 1623 ----
NM_018307chr172834 160 --1983 --
NM_018312chr1151953 1721 1655 95 34 ------
NM_018313chr332429 2271 1065 ------
NM_018315chr431383 1239 409 1570 ----
NM_018320chr111365 --1265 --
NM_018323chr461666 1593 1394 480 399 29 --1733 11631
NM_018325chr91115 ------
NM_018330chr1051672 1620 1411 1068 667 11648 1209 --
NM_018334chr72511 58 ------
NM_018351chr1253803 3325 3310 670 547 198 1452 11273
NM_018361chr853145 1579 1388 1104 630 11460 ----
NM_018362chr1133068 3031 367 1498 ----
NM_018364chr143710 3235 1411 725 1880 1598 --
NM_018374chr745209 981 741 580 ------
NM_018383chr241837 1670 213 166 1171 ----
NM_018387chr91391 --1368 --
NM_018398chr32318 67 ------
NM_018400chr1153129 3021 2964 2925 952 13527 14417 14489
NM_018403chr333876 1281 972 1673 13336 13290
NM_018413chr121229 ------
NM_018416chr1242411 2397 267 156 1731 ----
NM_018429chr552084 1917 336 230 95 12330 1648 --
NM_018433chr22210 106 ------
NM_018434chr51128 ------
NM_018439chr1862598 2322 2313 415 405 97 --1292 --
NM_018440chr8108257 7630 6710 6574 6014 2174 2152 1939 978 330 35748 5679 372 26644 1543 11015
NM_018445chr15----163 --
NM_018449chr91759 ------
NM_018452chr6_random32827 1358 1230 --23551 2924 --
NM_018469chr1741259 1111 197 119 --2932 188 --
NM_018482chr882594 2421 2402 2024 1727 650 87 47 2884 771 1304 --
NM_018489chr142396 2331 899 368 --1594 12118
NM_018490chr1161685 1373 746 493 479 103 21495 1311 ----
NM_018527chr132418 162 ------
NM_018553chr1751525 1513 687 565 376 --126 --
NM_018557chr21209 1550 11464 --
NM_018566chr145013 3125 1977 206 13617 ----
NM_018569chr441473 1138 1089 1003 ----11299
NM_018593chr63752 285 76 ------
NM_018602chr1541382 1240 1201 131 11411 ----
NM_018638chr1254301 4294 1971 1235 566 23593 191 --15123
NM_018640chr1262686 2297 2107 1795 588 148 --22474 170 --
NM_018650chr15868 844 677 558 152 1763 --1829
NM_018657chr32152 23 --2300 265 --
NM_018667chr1662870 2320 2026 409 148 42 1369 1217 --
NM_018682chr74625 564 532 47 1691 ----
NM_018684chrX11018 11251 ----
NM_018685chr72814 803 ------
NM_018686chr121254 ------
NM_018689chr1542080 1994 1784 983 22707 169 1105 12046
NM_018695chr52690 319 ------
NM_018698chrX51804 1515 1203 514 166 --11882 1151
NM_018703chr16----1305 --
NM_018704chr121836 503 1405 --11749
NM_018710chr831146 1117 412 --1453 --
NM_018712chr1161534 1105 1087 408 199 40 ----11362
NM_018717chr482774 2743 2656 1773 653 619 330 121 ------
NM_018718chr741698 894 819 271 ------
NM_018834chr52952 711 ------
NM_018841chr133542 972 717 198 12477 --
NM_018890chr721333 1205 11228 ----
NM_018898chr5----12033 --
NM_018899chr5----12033 --
NM_018900chr5----12033 --
NM_018901chr5----12033 --
NM_018902chr5----12033 --
NM_018903chr5----12033 --
NM_018904chr5----12033 --
NM_018905chr5----12033 --
NM_018906chr5----12033 --
NM_018907chr5----12033 --
NM_018908chr5----12033 --
NM_018909chr5----12033 --
NM_018910chr5----12033 --
NM_018911chr5----12033 --
NM_018912chr511315 11441 1235 --
NM_018913chr511315 11441 1235 --
NM_018914chr511315 11441 1235 --
NM_018915chr511315 11441 1235 --
NM_018916chr511315 11441 1235 --
NM_018917chr511315 11441 1235 --
NM_018918chr511315 11441 1235 --
NM_018919chr511315 11441 1235 --
NM_018920chr511315 11441 1235 --
NM_018921chr511315 11441 1235 --
NM_018922chr511315 11441 1235 --
NM_018923chr511315 11441 1235 --
NM_018924chr511315 11441 1235 --
NM_018925chr511315 11441 1235 --
NM_018926chr511315 11441 1235 --
NM_018927chr511315 11441 1235 --
NM_018928chr511315 11441 1235 --
NM_018929chr511315 11441 1235 --
NM_018945chr653587 2343 1249 384 204 13262 32629 1034 998 --
NM_018951chr71315 ----11136
NM_018963chr2121142 203 ----21535 1122
NM_018970chr752458 2194 1032 671 232 1194 12371 --
NM_018976chr1262476 2304 2277 2251 1852 493 ------
NM_018979chr1242379 1756 1674 600 ------
NM_018981chr221152 904 21142 128 ----
NM_018993chr201221 ----1518
NM_018994chr11488 ------
NM_018999chr1044873 4006 3391 1940 --14036 --
NM_019000chr521605 94 1660 ----
NM_019001chr3114165 3995 3637 3498 3377 3320 1626 1116 1052 1009 836 23168 593 34435 1394 661 --
NM_019003chrX1133 ------
NM_019010chr172384 330 1253 ----
NM_019022chr1822481 128 1385 ----
NM_019027chr422534 1970 --11032 --
NM_019030chr5----124 --
NM_019036chr621020 193 11012 1836 --
NM_019045chrX1765 1203 ----
NM_019050chr431993 1508 515 --151 --
NM_019057chr53280 266 22 151 ----
NM_019063chr241727 854 624 37 ----11464
NM_019071chr71774 ------
NM_019084chr1052539 2504 978 750 33 ----12315
NM_019094chr1263519 3318 2812 2678 749 231 23507 2536 197 --
NM_019102chr71378 1155 ----
NM_019102chr71378 1155 ----
NM_019106chr2262205 2169 896 716 677 227 43149 2101 944 706 12351 --
NM_019116chr16103712 3538 1348 1194 1124 980 696 665 425 52 12579 ----
NM_019117chrX63217 2770 2487 2329 769 149 ----23110 2419
NM_019556chrX41054 168 121 59 11169 ----
NM_019557chr13859 770 578 --157 --
NM_019558chr22326 124 ------
NM_019590chr1031333 1220 67 ------
NM_019592chr91237 187 ----
NM_019593chr2043043 2804 1146 461 23170 559 --1190
NM_019595chr22718 64 ------
NM_019596chr2172874 2580 1017 355 322 261 100 ------
NM_019600chr152741 621 ------
NM_019613chr171105 21209 1203 ----
NM_019842chr63438 147 93 ------
NM_019849chr191178 ------
NM_019854chr121311 ------
NM_019859chr1021470 440 ------
NM_019885chr251901 1810 1036 755 521 --1329 --
NM_019891chr1------21175 530
NM_019895chr31349 ----2812 29
NM_020039chr1261773 1294 675 501 272 252 1346 169 --
NM_020116chr421817 303 --11528 --
NM_020120chr221020 341 --188 --
NM_020122chr2135941 5658 5386 5250 4889 4616 4223 2369 2074 1578 1516 626 309 --25844 346 --
NM_020123chr102198 185 1471 ----
NM_020127chr16511 473 99 81 59 35 124 ----
NM_020132chr2144701 4277 4081 1621 --23872 408 --
NM_020141chr132298 1961 1580 ----130
NM_020144chr731953 1655 471 ------
NM_020150chr1042092 573 197 149 11650 ----
NM_020152chr212143 41 --1125 --
NM_020168chr1551280 1127 963 536 375 --11115 --
NM_020177chr553137 3015 2629 1015 676 11127 ----
NM_020178chr172877 47 11235 --11073
NM_020180chr1841367 1262 173 113 11123 ----
NM_020182chr20103622 2974 2824 2571 2490 1024 983 795 429 300 --43571 3431 3310 1190 --
NM_020193chr1141253 1081 910 228 --11278 --
NM_020194chr2129 ----1707
NM_020198chr1731296 1285 454 ------
NM_020225chr41124 ------
NM_020240chr53937 644 284 31040 510 97 --12032
NM_020243chr223697 275 172 --163 --
NM_020310chr1762710 2595 2493 2026 957 492 1687 12840 --
NM_020318chr1130 ------
NM_020336chr2053701 3141 2557 1231 923 ------
NM_020337chr4103192 3103 2176 2108 1217 1091 998 628 505 168 ----12042
NM_020341chr2022041 1341 11578 ----
NM_020342chr21492 11822 ----
NM_020346chr1131299 1212 536 11707 ----
NM_020354chr101795 1907 ----
NM_020357chr351334 603 349 336 282 ------
NM_020363chrY41849 574 250 29 ------
NM_020364chrY41849 574 250 29 ------
NM_020374chr1232022 1699 1557 ------
NM_020381chr621275 383 ----1162
NM_020382chr1251293 1253 1228 1080 428 21645 1135 1622 --
NM_020386chr31133 ------
NM_020390chr354349 3371 3168 644 45 --23329 391 1511
NM_020403chr1331760 1273 279 1420 ----
NM_020420chrY41849 574 250 29 ------
NM_020426chr17181 ------
NM_020428chr1961136 1018 371 221 209 105 ------
NM_020432chr742277 2171 698 131 --160 --
NM_020440chr192976 2776 2589 2340 2332 1347 1108 447 242 --1605 --
NM_020443chr1157037 6797 6442 6357 5489 5013 4672 4590 4467 2765 2739 2505 2304 2115 1490 2702 475 32587 1907 653 11159
NM_020449chrX2248 39 --179 --
NM_020453chr442050 1549 1485 532 ------
NM_020456chr1331480 930 530 ----12040
NM_020463chr241497 1124 1021 50 ------
NM_020465chr1621808 653 ------
NM_020473chrX21585 425 ----21852 1692
NM_020474chr1832005 324 202 --1796 --
NM_020532chr22931 208 1177 ----
NM_020640chr3159 --11592 --
NM_020642chr111549 ------
NM_020647chr842315 1865 464 376 --1413 --
NM_020651chr221470 1154 --21653 1549 --
NM_020654chr321561 613 ------
NM_020689chr2031432 1330 1197 ------
NM_020696chr31299 ------
NM_020699chr193858 3752 3611 3473 1739 1323 1241 200 22 --23301 1254 34622 1581 532
NM_020702chr92511 150 ----11646
NM_020704chr721021 53 --11998 --
NM_020706chr211123 ------
NM_020713chr2012023 32347 535 183 --1780
NM_020717chrX74876 4210 1643 1612 1515 451 211 11842 11416 --
NM_020718chr16136264 6154 5877 5777 5545 5508 4138 2418 1976 1259 1147 465 164 25135 666 ----
NM_020728chr762923 2804 1151 1107 825 769 --12256 --
NM_020732chr61468 ------
NM_020734chr1233305 2060 260 --12231 --
NM_020739chr1574188 3768 3513 3308 3084 1580 984 11501 1731 --
NM_020742chrX11038 --21884 260 --
NM_020747chr52858 641 1297 ----
NM_020748chr1721323 383 1324 11837 --
NM_020750chr6--3611 109 88 11359 --
NM_020752chr1032754 812 721 22393 452 ----
NM_020755chr651087 623 366 194 138 11439 ----
NM_020760chr241649 1517 1456 1244 1246 150 --
NM_020766chrX54456 3023 1119 606 72 --12980 --
NM_020768chr563125 2905 2827 971 796 141 12144 ----
NM_020770chr1------1326
NM_020771chr631444 1400 256 --1335 1419
NM_020772chr1788137 6993 6562 6125 5660 5431 1889 906 21752 1284 37713 2776 2248 12739
NM_020773chr472616 2477 2325 2025 678 663 214 --12544 --
NM_020774chr1866189 4297 2012 1563 898 293 --13947 21655 1145
NM_020777chr43578 548 371 --22119 1549 12460
NM_020778chr15124478 4091 3992 3531 3299 3205 1701 1537 1486 726 715 303 1217 --14282
NM_020779chr252438 2210 1267 179 26 ------
NM_020781chr752578 2538 2372 583 504 1721 12754 1733
NM_020783chr1842436 2290 1731 746 ------
NM_020787chr1751363 1345 1124 974 618 --1264 --
NM_020791chr1741302 1240 512 190 --154 11088
NM_020792chr322808 2290 --11974 --
NM_020794chr151535 1013 598 362 87 ------
NM_020795chr1732060 1736 712 ------
NM_020796chr532630 967 903 --22068 79 --
NM_020801chr551815 863 818 184 43 1736 ----
NM_020804chr652688 2497 1839 363 42 --12143 --
NM_020805chr18------41719 1596 454 102
NM_020806chr141242 ------
NM_020809chr1121830 747 11819 32225 1884 876 --
NM_020810chr1463584 2888 1146 862 791 785 2847 363 ----
NM_020819chr611205 ------
NM_020821chr1531796 1753 512 ------
NM_020832chr12679 59 ------
NM_020834chr1441663 448 278 58 ------
NM_020841chr1244001 3666 3236 603 13897 11383 --
NM_020845chr1252355 2155 1753 1614 448 12212 ----
NM_020850chr1693151 3098 2906 2542 2242 959 869 720 641 23052 1211 157 --
NM_020853chr1232787 2728 2715 ------
NM_020854chr1841492 191 160 147 ------
NM_020856chr195281 148 110 48 26 ------
NM_020858chr15--1352 ----
NM_020860chr43904 454 166 --1159 --
NM_020861chr621068 75 ----1861
NM_020870chr432181 867 229 ------
NM_020871chrX42579 2519 1814 1019 --1166 1970
NM_020872chr31273 ------
NM_020886chr113506 165 40 ------
NM_020888chr152045 1668 1489 1278 26 1739 ----
NM_020890chr31535 1468 ----
NM_020895chr19168 ------
NM_020897chr121345 99 5497 402 393 278 142 ----
NM_020898chr12----1130 --
NM_020899chr1711877 11548 ----
NM_020914chr1732276 606 363 ----11692
NM_020918chr1043572 2888 2577 2460 --12873 12698
NM_020920chr142371 344 ------
NM_020921chr1433009 2838 640 --1922 199
NM_020922chrX31755 1300 658 11471 1378 --
NM_020925chr121462 1141 11112 ----
NM_020927chr1612261 ----11805
NM_020935chr254579 3490 1729 1125 48 1606 ----
NM_020940chr1071122 857 844 717 484 295 223 22453 2294 --12733
NM_020946chr951699 648 154 132 53 11381 ----
NM_020948chr122446 1205 ------
NM_020951chr191150 11984 ----
NM_020956chr19134518 4206 4131 4035 3818 3165 1772 1116 976 751 553 411 256 1931 62931 1851 1695 1458 1098 777 --
NM_020958chr141265 ------
NM_020960chr9104760 3929 3895 3748 1719 1507 836 472 40 28 24394 3889 ----
NM_020962chr1542045 896 533 509 --11935 --
NM_020964chr1884567 4514 4171 4147 4043 1826 753 84 13149 1655 --
NM_020975chr1041740 1366 491 369 ------
NM_020977chr452213 763 649 602 178 --1801 --
NM_020987chr101551 2949 40 --1439
NM_020993chr12102569 2392 2340 1862 1026 902 857 830 267 218 1518 ----
NM_021003chr14----2602 329 1776
NM_021005chr1521115 769 1176 ----
NM_021007chr231977 1499 238 ----1374
NM_021033chr1363303 2952 2786 2358 807 114 12329 ----
NM_021038chr343025 2571 2295 606 21165 989 23388 1295 1479
NM_021061chr853534 3056 1785 679 39 23807 1351 --13485
NM_021069chr441870 1414 521 515 ------
NM_021072chr542569 2028 1821 939 1587 --11920
NM_021076chr221550 --1115 --
NM_021079chr1732953 2943 868 11253 42824 2509 2084 267 12569
NM_021082chr31391 ------
NM_021083chrX73590 2964 2820 567 360 160 125 ------
NM_021090chr2264199 3507 3416 1411 515 35 24501 3886 53531 3310 1101 308 300 13431
NM_021097chr222603 2306 --1598 --
NM_021109chrX2125 47 ------
NM_021109chrX2125 47 ------
NM_021111chr9169 2476 248 11332 --
NM_021116chr7189112 9041 8661 8295 8263 6437 3558 3437 3426 3360 3231 2634 2530 1604 1448 1383 1349 1096 12244 48200 7203 3174 625 15781
NM_021120chrX83165 3048 2319 2102 980 843 437 365 --1916 --
NM_021132chr1011115 21214 205 11152 --
NM_021140chrX31183 167 109 --1795 --
NM_021144chr91532 ------
NM_021155chr1953019 1971 1904 833 292 ------
NM_021159chr421390 1155 31412 1245 1239 --1593
NM_021163chr763156 3023 3004 1457 872 767 12926 23841 2612 --
NM_021176chr231575 1445 306 ------
NM_021183chrX1769 --11849 --
NM_021184chr62692 195 1740 ----
NM_021190chr1--1858 --1196
NM_021191chr121433 --12177 --
NM_021194chr1142 ------
NM_021215chr2062017 1942 1713 1635 753 468 --1287 --
NM_021220chr20--136 ----
NM_021238chr1231610 1500 580 11532 ----
NM_021239chr1421309 338 ------
NM_021240chr91633 --1511 --
NM_021249chr1431448 397 34 1322 ----
NM_021252chr1011300 ----175
NM_021255chr1452933 2817 2616 1280 760 13608 ----
NM_021260chr1421392 1016 --1508 --
NM_021619chr941260 1225 1156 909 ------
NM_021622chr1042397 700 647 113 1445 1833 --
NM_021627chr33832 399 28 ----1472
NM_021629chr325023 1561 ------
NM_021633chr141073 1026 261 249 ------
NM_021638chr4114374 4211 4107 3351 1689 1454 1095 923 412 101 34 23897 1913 --1649
NM_021639chr11875 ------
NM_021643chr211471 1746 183 --
NM_021644chr103851 365 269 ------
NM_021647chr494641 4503 4247 3764 3465 1133 1107 1043 706 21343 514 11251 --
NM_021648chr631684 710 294 1621 1550 --
NM_021705chr651505 1368 1170 365 156 ------
NM_021722chr7135 ------
NM_021723chr7135 ------
NM_021728chr143888 765 625 ------
NM_021738chr105589 282 266 187 145 ------
NM_021785chrX--1295 ----
NM_021800chr102112 40 153 ----
NM_021809chr201496 32162 615 97 22220 369 1339
NM_021813chr675804 4471 4020 2331 2000 600 242 24733 3932 34165 4070 3682 13791
NM_021814chr641213 349 262 84 ------
NM_021818chr1431080 235 64 ------
NM_021905chr652145 2076 849 572 40 11448 ----
NM_021911chr585037 5002 4815 3883 3721 1895 1684 1506 ------
NM_021912chr1513229 1798 13783 11630
NM_021913chr1911675 151 ----
NM_021914chr1422123 565 22373 173 ----
NM_021943chr641759 1578 292 105 ------
NM_021945chr6103510 3422 3217 2756 2356 2245 1235 944 472 423 --23498 98 --
NM_021946chrX31357 1116 88 ------
NM_021947chr1731099 1018 480 1848 ----
NM_021948chr13378 38 23 --1251 --
NM_021949chrX62748 2545 2450 2339 2273 1112 ------
NM_021951chr93835 603 102 ------
NM_021954chr1363552 3463 2740 561 505 315 --12565 --
NM_021956chr641385 1072 414 327 --134 --
NM_021959chr61697 3992 370 271 1278 --
NM_021960chr12881 199 --12108 --
NM_021961chr11116946 6672 6588 6117 5236 4815 4561 4551 2888 2023 1502 15040 11911 14636
NM_021962chr1782163 1808 829 663 611 598 181 78 12376 1410 --
NM_021963chrX1566 --133 --
NM_021964chr395684 5328 4445 2049 1199 1162 1068 688 152 46281 6189 4142 1908 1187 --
NM_021977chr623795 3635 22574 2528 --13180
NM_021980chr102329 29 --11036 --
NM_021984chrX41386 962 396 162 11246 ----
NM_021987chrX41386 962 396 162 11246 ----
NM_021988chr2041602 1318 317 234 1488 11084 --
NM_021990chrX41386 962 396 162 11246 ----
NM_021999chr132655 213 ------
NM_022037chr22674 304 1274 ----
NM_022041chr1682444 2429 2360 611 435 358 289 183 ------
NM_022047chr6----1350 --
NM_022048chr1596394 5444 5352 4360 4325 646 256 240 225 44343 1267 1184 320 ----
NM_022066chr176916 777 711 297 175 117 1896 ----
NM_022068chr182602 422 --1531 --
NM_022073chr1431441 1188 1148 ------
NM_022079chr102995 175 ------
NM_022093chr13720 668 654 1616 1604 --
NM_022114chr1134625 4388 4362 4250 3803 3757 3373 3064 2952 1633 1106 461 338 14048 34517 4026 276 --
NM_022118chr132559 206 ------
NM_022121chr62979 62 ------
NM_022130chr5--1214 ----
NM_022133chr83376 179 87 ------
NM_022136chr21--1179 ----
NM_022143chr71297 1266 --11537
NM_022144chrX----132 --
NM_022166chr16176362 6113 5893 5390 5272 4352 4154 3903 2375 2060 2031 1465 1065 536 401 229 194 35241 4104 827 24959 1670 1787
NM_022169chr1151241 1052 1031 291 152 11174 ----
NM_022173chr22674 304 1274 ----
NM_022307chr72628 514 ------
NM_022336chr221914 1528 186 --11477
NM_022351chr843212 2780 2618 443 --1394 13668
NM_022361chr62395 158 1132 ----
NM_022366chr11101 ------
NM_022367chr1----1706 --
NM_022373chr73992 628 315 ------
NM_022374chr21138 ------
NM_022442chr2041602 1318 317 234 1488 11084 --
NM_022456chr1276898 6247 4708 2365 2156 933 124 24925 1290 26880 908 26983 6204
NM_022458chr742729 2339 1982 1138 12414 1476 --
NM_022459chr13126255 6214 6153 6147 5592 4687 4441 984 892 877 466 54 24536 1741 --24295 1303
NM_022465chr1252674 2267 1119 1079 39 11982 ----
NM_022469chr173015 2800 2156 1347 705 507 99 43116 1207 980 92 ----
NM_022474chr1441957 1762 1017 64 ----151
NM_022476chr16296 79 1117 1993 11122
NM_022477chr2011733 --1573 --
NM_022479chr751303 975 543 384 295 --31343 188 73 --
NM_022497chr373443 2957 2877 1561 1235 434 184 2876 650 12932 --
NM_022644chr172323 25 ------
NM_022648chr274611 1731 1426 1343 695 249 153 34528 3047 1387 1403 --
NM_022650chr51950 --1887 --
NM_022658chr1221170 1106 188 ----
NM_022716chr152735 2374 629 408 399 ------
NM_022719chr2283378 2900 2824 1232 1100 719 378 339 ----1238
NM_022726chr631492 627 21 ------
NM_022728chr71706 ------
NM_022733chr151176 924 781 280 115 125 ----
NM_022735chr131844 1319 345 ------
NM_022737chr1941243 1135 202 195 ------
NM_022739chr171229 --11033 --
NM_022745chr142755 2328 907 483 12787 11123 12084
NM_022749chr851317 568 458 128 71 1979 154 --
NM_022753chr152488 2226 2102 1989 159 --42586 917 628 279 --
NM_022754chr52661 143 ------
NM_022755chr9102634 2564 2178 1852 1699 997 782 740 217 131 1955 11886 --
NM_022758chr673126 2128 2096 2058 2026 872 821 ------
NM_022763chr333166 547 510 12617 32776 2332 635 13109
NM_022771chr121821 ------
NM_022780chr211164 1742 ----
NM_022782chr121331 ------
NM_022802chr1041545 1254 568 484 ------
NM_022817chr242268 1984 437 170 11463 11769 11905
NM_022818chr1621551 1472 --21676 569 --
NM_022824chr551805 1602 1449 1312 564 21212 333 --196
NM_022833chr941005 438 270 21 1335 11346 --
NM_022841chr1542503 1746 615 419 ------
NM_022845chr1641514 285 89 27 --1513 1153
NM_022893chr233124 2315 2014 32762 2586 2382 ----
NM_022894chr231641 553 275 ----31602 235 152
NM_022896chr2061628 1296 1080 217 193 187 --11663 --
NM_022898chr1474113 3244 1909 1471 1431 1345 214 34236 4066 1581 ----
NM_022900chr721041 408 ------
NM_022902chr5197 170 ----
NM_022910chr1621808 653 ------
NM_022912chr23997 935 583 1557 12129 12639
NM_022917chr941208 1077 1002 837 1400 ----
NM_022965chr411190 11378 ----
NM_022977chrX42155 714 680 83 11920 1768 --
NM_023000chr1431205 1138 387 137 --1500
NM_023001chr1431205 1138 387 137 --1500
NM_023009chr17539 478 120 88 66 43 34 ----1694
NM_023010chrX2767 33 ------
NM_023012chr122545 269 ------
NM_023016chr252327 951 482 465 420 ------
NM_023018chr131119 1043 37 --21149 279 1406
NM_023033chr121182 1372 1526 --
NM_023071chr1231157 1121 299 ------
NM_023074chr191876 ------
NM_023076chr1662922 2767 2272 1940 432 422 22471 2126 ----
NM_023079chr1721179 349 ------
NM_023105chr872453 2093 1905 1769 888 288 119 22001 229 ----
NM_023106chr872453 2093 1905 1769 888 288 119 22001 229 ----
NM_023110chr872453 2093 1905 1769 888 288 119 22001 229 ----
NM_023111chr872453 2093 1905 1769 888 288 119 22001 229 ----
NM_023112chr1452380 2126 1115 918 45 --1683 --
NM_023923chr153753 3134 1363 331 103 ------
NM_023929chr842579 2544 1738 129 ------
NM_023940chr42988 772 ----1145
NM_024007chr592960 2612 2313 2243 2144 1060 757 657 123 ----12159
NM_024017chr17167 2622 520 ----
NM_024034chr2041024 300 81 31 ------
NM_024046chr311287 ------
NM_024052chr1772929 2702 2605 2134 1023 994 553 --1496 --
NM_024061chr72576 459 ------
NM_024085chr27994 988 926 694 372 330 49 1292 --1347
NM_024087chrX1615 ------
NM_024090chr461863 1758 775 549 401 225 ------
NM_024092chr1151185 886 360 318 48 --11029 11023
NM_024117chr921116 932 1188 ----
NM_024165chr61119 ------
NM_024294chr673126 2128 2096 2058 2026 872 821 ------
NM_024295chr87598 540 443 234 225 203 71 --11788 11609
NM_024296chr1247 25 ------
NM_024297chr17196 ------
NM_024319chr12328 22 ------
NM_024329chr151281 1196 1007 482 297 --1275 --
NM_024345chr945930 4946 4360 52 15604 15923 --
NM_024410chr81127 ------
NM_024411chr201587 11002 ----
NM_024416chr911031 --11582 --
NM_024421chr182444 236 11221 ----
NM_024424chr11--1260 155 --
NM_024425chr11--1260 155 --
NM_024426chr11--1260 155 --
NM_024430chr181357 --1211 --
NM_024491chr32514 417 ------
NM_024494chr13689 669 574 ------
NM_024496chr142337 129 --1523 --
NM_024501chr23470 191 27 ----1252
NM_024513chr3103620 2601 2339 1117 725 635 578 122 90 45 --23233 1290 --
NM_024524chr342680 2658 1034 678 --22548 639 --
NM_024539chrX1497 --1258 149
NM_024541chr1041929 1513 85 31 21760 1647 11499 --
NM_024546chr132446 359 ------
NM_024551chr1221821 494 ------
NM_024551chr1221821 494 ------
NM_024581chr61203 ------
NM_024582chr41368 1712 ----
NM_024594chr52326 117 --11491 --
NM_024605chr43686 470 188 ------
NM_024612chr171999 ------
NM_024613chr811221 ------
NM_024617chr91765 ------
NM_024626chr141577 1485 1182 1059 1503 ----
NM_024627chr2284909 4269 3916 1697 953 666 515 28 1755 ----
NM_024638chr352321 971 697 292 218 --2668 149 --
NM_024639chr61613 22158 2121 1161 12150
NM_024643chr143459 117 75 1383 1202 161
NM_024645chr821190 61 ------
NM_024646chr1103859 3624 3251 3096 730 711 413 390 219 144 11063 1807 --
NM_024657chrX--1612 ----
NM_024659chr2----1959 --
NM_024665chr384693 4434 4247 1639 1380 1297 160 59 21180 78 --12978
NM_024667chr1241498 1441 599 138 11540 ----
NM_024670chr1021788 1497 --1342 --
NM_024674chr153074 2423 1028 664 552 22969 104 13269 --
NM_024689chrX31282 621 72 --11744 --
NM_024692chr211444 1612 ----
NM_024699chr81309 ------
NM_024700chr12779 120 --1311 1841
NM_024704chr2011119 --1934 --
NM_024713chr1541237 97 90 52 ------
NM_024719chr13181 ------
NM_024721chr892707 2216 2044 1766 1732 1068 475 300 72 2863 671 ----
NM_024742chr1661526 1414 1328 521 463 70 2118 62 ----
NM_024745chr1631123 1047 50 169 ----
NM_024749chr132249 393 78 ----12104
NM_024770chr266763 4407 4139 2587 2187 2157 36442 1491 1215 46404 5128 4660 4108 11855
NM_024778chrX278 42 ------
NM_024780chr1621011 387 --193 --
NM_024824chr1441200 1063 280 131 ----11229
NM_024825chr191291 ------
NM_024828chr951249 1181 1064 978 197 --1596 --
NM_024830chr522016 112 11636 ----
NM_024834chr10136 1520 ----
NM_024845chr1681471 1449 1394 1111 1052 378 274 136 --11242 1100
NM_024852chr1----1216 --
NM_024857chr171257 ------
NM_024871chr361404 1369 1184 1116 68 28 ----1248
NM_024874chr161401 1367 369 296 81 42 1924 ----
NM_024900chr431762 847 834 1529 --1163
NM_024900chr431762 847 834 1529 --1163
NM_024909chr611005 11126 ----
NM_024913chr721684 715 --11398 --
NM_024915chr842183 815 255 160 31917 699 310 1112 12277
NM_024920chr42589 368 11569 --11469
NM_024941chr5--11348 147 --
NM_024944chr212435 113 ------
NM_024948chr101108 ----1659
NM_024949chr454917 3293 3169 1723 1670 1269 --1114
NM_024953chr1212613 ------
NM_024963chr755689 5257 1790 654 46 14486 12150 --
NM_024969chr22754 274 --1796 --
NM_024989chr2106816 5530 5328 5128 2983 2889 1512 1485 1011 297 14995 ----
NM_024991chr1073280 2491 824 630 523 492 341 13128 ----
NM_024993chr241598 1510 1385 167 --11611 --
NM_025004chr112536 116 ----1765
NM_025047chr31196 ------
NM_025054chr843991 2878 1316 178 22939 2663 14214 --
NM_025073chr153923 3586 391 72 53 1584 24254 3326 --
NM_025076chr21180 ------
NM_025126chr121291 1568 ----
NM_025133chr23389 365 255 --1922 --
NM_025134chr1622373 505 --1138 --
NM_025141chr154620 539 412 403 ------
NM_025146chr321940 474 1999 22028 650 --
NM_025147chr22783 294 1854 ----
NM_025160chr11253 11248 33750 3576 1177 13644
NM_025164chr1131999 644 122 --187 --
NM_025182chr91374 ------
NM_025187chr162227 39 21272 406 ----
NM_025191chr173173 2902 2560 1022 764 468 49 12382 1194 --
NM_025202chr2181 --11024 --
NM_025211chr9------185
NM_025219chr2071671 749 428 386 351 296 69 21844 571 22204 310 11730
NM_025221chr421179 993 --21334 1276 --
NM_025222chr352845 2446 2034 1861 380 --12597 1238
NM_025235chr1082268 2130 1947 1897 1484 473 402 310 ------
NM_025237chr1741255 1172 458 409 11272 ----
NM_025238chr1531578 1544 1308 ------
NM_025246chr3--151 ----
NM_025250chr762905 2513 1994 1209 1195 60 32290 583 227 ----
NM_025263chr65627 458 405 351 288 --11408 --
NM_030576chr1722450 1665 42556 2232 1061 368 12565 --
NM_030621chr1443535 2737 1672 720 --11210 --
NM_030625chr1042606 1931 749 163 ------
NM_030627chr543677 3456 1639 1237 1210 ----
NM_030629chr1651949 1209 776 568 425 11898 ----
NM_030631chr142195 111 ------
NM_030634chr132356 2065 84 1731 --1429
NM_030637chr142562 275 ------
NM_030647chr765463 4842 4197 1660 1027 116 14149 ----
NM_030648chr485584 4572 4546 3534 2007 1842 1233 88 ------
NM_030661chr771707 1560 1441 1176 1144 1130 414 ------
NM_030664chr1041986 573 313 169 11728 ----
NM_030674chr1275584 5418 4078 3657 1765 1479 1328 24015 544 35862 4347 1341 --
NM_030755chr1433055 2269 81 ----12201
NM_030756chr101293 ------
NM_030761chr152646 2369 1703 250 145 3739 265 214 42460 2274 2074 2062 --
NM_030762chr1211641 11753 1497 --
NM_030766chr1251081 905 750 691 213 1878 ----
NM_030771chr11171 ------
NM_030773chr2021831 694 11177 ----
NM_030791chr142546 497 1562 ----
NM_030799chr542080 1686 1468 320 --31402 749 81 --
NM_030806chr1107048 6868 6518 6396 3115 2939 2432 1925 1507 202 38371 7612 2817 25943 2787 26599 1938
NM_030808chr171955 ------
NM_030809chr1261990 1944 859 229 92 80 22061 800 12193 --
NM_030816chr142597 2303 1481 604 --12906 22558 2476
NM_030820chr61282 ------
NM_030881chr225841 749 689 490 57 1179 21751 778 --
NM_030884chr391996 1804 1779 1561 748 716 688 618 402 --12324 --
NM_030885chr31772 12071 ----
NM_030915chr262158 1995 633 466 244 53 --1886 --
NM_030918chr174866 4779 4739 3932 3657 1226 320 15054 ----
NM_030920chr142106 1584 1575 659 ------
NM_030927chr1061473 1250 1125 1021 645 207 21623 296 ----
NM_030934chr12262 65 ------
NM_030937chr1281 60 11127 21136 475 --
NM_030940chr92389 289 182 1480 --
NM_030958chr8166 ------
NM_030962chr1131587 1346 280 2506 48 --11419
NM_030964chr5103489 3453 2930 2750 2294 705 680 331 325 68 23240 1179 1428 --
NM_030965chr12309 298 --1742 --
NM_030979chr13185 ------
NM_031216chr1822108 2048 11728 ----
NM_031243chr741760 1747 1513 837 ------
NM_031262chr9------1924
NM_031263chr9------1981
NM_031266chr51101 ------
NM_031268chr16164994 4883 4559 4538 4338 4315 4234 4077 3680 1737 1507 1481 1164 693 383 22 31614 793 33 ----
NM_031283chr21910 ------
NM_031284chr152713 110 ------
NM_031291chr41716 ----165
NM_031296chr412301 ------
NM_031305chr441542 1524 711 606 1196 11844 --
NM_031369chr41218 ------
NM_031370chr41218 ------
NM_031371chr11278 --1182 --
NM_031371chr11278 --1182 --
NM_031372chr44670 539 389 142 ----1154
NM_031411chr5----12033 --
NM_031412chr1251264 1210 1123 1017 985 ------
NM_031417chr1962462 2213 1935 642 78 72 --2826 172 --
NM_031418chr1122725 297 1480 1522 --
NM_031419chr32516 259 140 ----
NM_031427chr1455691 4788 4327 1489 1121 1712 15446 14782
NM_031431chr1361845 1499 1467 679 646 139 --1233 --
NM_031439chr851875 1390 1331 1204 123 ------
NM_031442chrX22034 335 13018 1488 --
NM_031445chr213238 11362 12684 --
NM_031461chr831713 492 71 2889 842 ----
NM_031468chr7167834 7320 6678 6306 6170 5491 5156 5112 3228 3065 3058 1991 1936 1636 615 587 32588 758 633 --28167 7726
NM_031469chr683983 3570 1371 887 737 672 358 166 --1384 11326
NM_031475chr13671 654 219 --2723 557 --
NM_031483chr201374 11437 12723 --
NM_031492chr112440 22 ------
NM_031844chr162819 2536 1588 468 449 177 21470 1457 13909 22612 2581
NM_031845chr253704 3199 354 286 125 --1397 --
NM_031847chr253704 3199 354 286 125 --1397 --
NM_031849chr5----12033 --
NM_031850chr3--1573 1827 --
NM_031850chr3--1573 1827 --
NM_031857chr5----12033 --
NM_031858chr1711395 --127 --
NM_031860chr5----12033 --
NM_031862chr1711395 --127 --
NM_031889chr431844 1726 104 1500 11924 --
NM_031892chrX1760 ------
NM_031911chr41316 12169 ----
NM_031935chr12677 76 ----1919
NM_031936chr12570 522 1208 ----
NM_031957chr17151 --127 --
NM_032013chr2011733 --1573 --
NM_032042chr552772 1838 824 685 62 22108 236 22181 299 1176
NM_032047chr341991 1835 332 183 132 ----
NM_032049chr3--1573 1827 --
NM_032049chr3--1573 1827 --
NM_032050chr222752 43 --1120 --
NM_032052chr2231137 428 394 1994 1505 --
NM_032088chr511315 11441 1235 --
NM_032092chr511315 11441 1235 --
NM_032102chr114745 654 410 98 ------
NM_032116chr1354801 4392 3602 1530 136 34546 4042 1761 11604 --
NM_032120chr7190 ------
NM_032121chrX2714 359 22493 2177 ----
NM_032124chr183867 447 160 ------
NM_032132chr1--1143 ----
NM_032138chr13--136 ----
NM_032139chr19--2867 31 ----
NM_032144chr211788 ------
NM_032145chr621554 1197 1444 1751 --
NM_032146chr3--1462 ----
NM_032153chr322450 855 1710 ----
NM_032154chr10286 53 ------
NM_032160chr1883958 3478 3313 2896 1492 1306 383 335 31051 815 367 11009 --
NM_032174chr121301 1025 ----1162
NM_032182chr10--11459 31383 1210 90 --
NM_032186chr131434 281 232 11424 ----
NM_032189chr1343846 3651 1948 1737 --21885 1320 --
NM_032193chr1171426 1282 785 572 532 203 27 --1353 --
NM_032195chr211120 ------
NM_032199chr1073804 2832 2773 1547 1250 933 717 --21071 1020 --
NM_032208chr282727 2680 2434 2268 2229 2220 381 268 --13410 1184
NM_032228chr1153022 2330 1143 738 309 ------
NM_032246chr1511003 ------
NM_032256chr124705 337 327 231 ------
NM_032268chr1633093 2192 384 2601 435 12092 1214
NM_032281chr1913010 ------
NM_032283chr11152 11350 1353 196
NM_032288chr3150 --11950 --
NM_032291chr141267 683 659 323 ------
NM_032307chr91113 ------
NM_032312chr21174 ------
NM_032316chr372257 2153 1970 1902 1894 1741 529 1405 12162 --
NM_032321chr243311 2712 2495 2051 11111 32904 962 320 --
NM_032327chr10--1424 ----
NM_032338chr122649 608 ----183
NM_032352chr14----11303 --
NM_032373chr1075940 4711 1872 1349 1025 636 490 ----11298
NM_032382chr162460 119 ------
NM_032403chr511315 11441 1235 --
NM_032424chr1131497 503 143 ------
NM_032430chr19161 ------
NM_032435chr1175 ------
NM_032436chr131123 ----1778
NM_032438chr63546 505 196 --21147 554 --
NM_032439chr1051569 629 421 310 246 1115 ----
NM_032440chr1042890 2873 2187 1863 ------
NM_032445chr1552343 1968 1036 485 103 --22288 1954 --
NM_032446chr533709 3063 1146 22366 1221 23613 47 --
NM_032449chr131979 822 615 ------
NM_032454chr62154 61 ----1375
NM_032457chr463903 3256 3203 2665 1261 332 ------
NM_032458chrX52878 2737 2728 2662 437 --1465 --
NM_032471chr62268 92 ------
NM_032472chr2136 ------
NM_032482chr1952664 2562 2188 1696 184 --11057 --
NM_032491chr1211202 ------
NM_032499chr1541655 1578 415 119 ------
NM_032505chr322761 672 ------
NM_032510chr1862397 2385 1903 1802 156 69 --11863 11889
NM_032521chr2052971 2721 2670 2364 371 ------
NM_032532chr62643 102 1537 -