TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548av-3p
miRNA Sequence: AAAACUGCAGUUACUUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX56486 4903 1347 563 303 --11432 --
NM_000110chr15920 481 317 247 228 ------
NM_000138chr1512077 21712 917 --12575
NM_000163chr542131 607 500 368 ----12336
NM_000176chr553750 3116 1541 182 70 --23720 1016 --
NM_000192chr121375 ------
NM_000202chrX31444 1036 217 ----12470
NM_000214chr2051557 534 413 348 49 --1153 --
NM_000267chr1773315 3147 3058 2891 2709 2576 130 1756 --11338
NM_000284chrX31540 598 514 --1156 11403
NM_000314chr1042725 1001 443 296 --11222 --
NM_000368chr984840 4549 3351 3313 1811 1717 606 161 1580 1421 14595
NM_000408chr252704 1095 738 725 251 --11264 --
NM_000449chr11422 ------
NM_000462chr15----11283 --
NM_000489chrX83125 2877 2592 2237 1124 634 133 99 11172 ----
NM_000492chr731410 1359 1074 ----1448
NM_000538chr133584 539 292 21439 1385 ----
NM_000555chrX97246 7131 6809 5537 2067 1611 1387 1173 752 15554 15864 11091
NM_000633chr18--23658 1675 24309 1504 --
NM_000808chrX1969 ------
NM_000811chr51634 ------
NM_000813chr575573 5325 5113 4497 4121 3699 3631 25202 929 ----
NM_000814chr1574115 3499 3080 2835 1431 965 312 3534 496 435 1757 --
NM_000818chr101206 ------
NM_000875chr1557021 5930 4595 2480 400 15896 12367 15703
NM_000899chr1252958 1495 1193 1179 408 ------
NM_001001419chr571949 1784 1123 1088 869 578 427 14241 ----
NM_001001420chr571949 1784 1123 1088 869 578 427 14241 ----
NM_001001483chr111458 --162 --
NM_001001890chr2154315 4265 3939 1643 672 ------
NM_001001928chr2258334 7992 6293 5104 3171 --31577 1488 1403 --
NM_001001995chrX11811 ------
NM_001002914chr17------1879
NM_001002926chr752846 1029 704 510 24 --22344 2045 1101
NM_001003652chr1898689 6768 6632 5970 5388 2685 1845 366 299 11245 28169 1102 22704 1489
NM_001003674chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_001003675chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_001003679chr152203 1737 605 467 212 12012 ----
NM_001003712chr1233844 3505 1281 21288 1214 13090 --
NM_001004065chr932442 541 435 13009 11532 23466 757
NM_001004304chr12----13168 --
NM_001004317chr663581 3533 3393 1629 1181 411 12865 ----
NM_001005375chrY51596 1261 748 230 109 1302 ----
NM_001005463chr101622 ------
NM_001005473chr584444 4304 4056 4048 1663 1223 561 471 --12315 --
NM_001005739chr22311 25 1765 ----
NM_001007257chr1----1386 1992
NM_001007278chr1365054 4954 4749 3334 1991 1384 --32075 945 23 --
NM_001007466chr651911 1435 1420 878 61 13362 1992 --
NM_001008239chr1873666 3569 3189 2713 1448 1213 344 12983 ----
NM_001008408chr746324 5903 2424 644 11846 46436 5847 4946 376 --
NM_001008495chr831867 1726 120 11779 31999 392 346 --
NM_001008541chr1032045 1651 336 1505 11582 --
NM_001008541chr1032045 1651 336 1505 11582 --
NM_001008925chr473221 3112 900 828 519 426 94 23373 2973 13183 --
NM_001009571chr711260 --21543 247 --
NM_001009899chr385987 4976 2324 827 794 517 503 118 ------
NM_001009993chr233568 3510 551 --34564 2876 786 --
NM_001010000chr1853336 3246 760 719 497 12177 13262 --
NM_001010854chr14----1211 --
NM_001010861chr122736 302 1999 --1775
NM_001010867chr196514 6279 5132 4244 2537 2469 2297 1591 923 --21285 1241 --
NM_001010891chr586668 5959 5923 4876 4478 4472 1393 388 1706 1727 --
NM_001011538chr4----1656 --
NM_001012393chr1155134 4795 4502 3360 1701 --13580 13307
NM_001012420chr1542633 1926 789 728 22077 140 ----
NM_001012423chr1542633 1926 789 728 22077 140 ----
NM_001012968chrX31718 152 66 1879 1430 --
NM_001014380chr1355430 5168 1410 1319 156 24260 1113 21732 340 --
NM_001015877chrX33073 2932 212 --43060 2726 2337 219 --
NM_001017523chr12------1539
NM_001017979chr41101 --1594 --
NM_001018057chr1131369 968 445 --1235 --
NM_001018065chr946031 4435 4200 1895 ----13676
NM_001018066chr946031 4435 4200 1895 ----13676
NM_001018067chr155251 5191 1472 539 200 1342 25289 844 --
NM_001018068chr155251 5191 1472 539 200 1342 25289 844 --
NM_001018069chr155251 5191 1472 539 200 1342 25289 844 --
NM_001018072chr12------1539
NM_001018074chr553750 3116 1541 182 70 --23720 1016 --
NM_001018075chr553750 3116 1541 182 70 --23720 1016 --
NM_001018076chr553750 3116 1541 182 70 --23720 1016 --
NM_001018077chr553750 3116 1541 182 70 --23720 1016 --
NM_001023567chr1531947 792 731 1140 1477 12133
NM_001023587chr31297 ------
NM_001024094chr553750 3116 1541 182 70 --23720 1016 --
NM_001024649chr532705 1182 182 12804 22508 407 --
NM_001024847chr332289 1724 1578 2761 737 ----
NM_001024948chr141010 796 477 456 13361 13073 --
NM_001025076chr10105895 5576 5460 4302 3859 1720 1559 520 472 188 14682 13909 --
NM_001025077chr10157253 6934 6818 5660 5217 5070 4633 2917 1878 1830 1546 1320 945 666 174 26040 1104 15267 --
NM_001025079chr363304 2637 2551 1544 461 237 1341 23434 1641 --
NM_001025108chr293934 3692 3167 3016 2694 2542 1329 1306 239 --24123 2601 --
NM_001025203chr21144 ------
NM_001025204chr21144 ------
NM_001025266chr394305 3648 3353 1419 1197 1187 1015 198 132 --12998 --
NM_001025580chrX84144 3901 3538 3282 1708 582 459 112 --24279 427 --
NM_001025603chr11422 ------
NM_001025780chr9----11504 --
NM_001029863chr632527 2360 817 13204 2140 57 --
NM_001029884chr632605 2526 2247 12699 1361 --
NM_001029989chr151126 ------
NM_001030006chr174679 581 510 169 --1312 --
NM_001030055chr14104720 4574 4432 4375 4328 4269 4242 3946 3689 2988 11776 13663 --
NM_001031710chr71830 ------
NM_001031716chr2----127 --
NM_001031732chr443636 3321 1379 391 11230 23439 2863 --
NM_001031804chr1643880 3796 3787 1489 23534 3448 13244 --
NM_001032282chr811043 ------
NM_001032367chr15----1424 --
NM_001033602chr1342685 2063 390 309 --2767 449 --
NM_001034850chr541650 1140 614 344 1366 ----
NM_001037164chr761896 1733 1474 769 654 445 ------
NM_001037317chr122736 302 1999 --1775
NM_001039538chr283631 3210 2711 1452 1282 1174 734 72 12349 ----
NM_001039547chr346381 1202 1113 797 --17037 --
NM_001039590chrX83717 3630 3578 3565 3420 714 470 386 ------
NM_001039591chrX83717 3630 3578 3565 3420 714 470 386 ------
NM_001039618chr11125209 4971 4945 4916 4302 3962 3835 1864 800 616 360 212 14077 12357 25257 4545
NM_001039762chr1021700 213 12216 12009 --
NM_001039840chrX65490 5336 4351 2305 1080 1065 21600 1233 14290 --
NM_001040147chr182654 618 ----1693
NM_001040284chr1685842 5149 4624 4308 3810 2309 1947 614 15928 15462 --
NM_001040665chr764381 3562 1863 1125 1067 1001 --1695 --
NM_001040712chr973194 2842 2355 1000 780 504 361 1184 ----
NM_001042355chr1663642 3451 722 699 545 72 15039 1978 --
NM_001042370chr1----1225 --
NM_001042412chr1663642 3451 722 699 545 72 15039 1978 --
NM_001042413chr963667 3332 1566 1253 780 773 13839 1341 --
NM_001042414chr131272 ------
NM_001042424chr432931 1294 839 --1643 1703
NM_001042453chrX51341 1255 1217 1194 217 11541 ----
NM_001042473chr1032034 1951 89 ----1126
NM_001042492chr1773315 3147 3058 2891 2709 2576 130 1756 --11338
NM_001042555chr1253601 1253 965 930 850 --11926 --
NM_001042599chr256954 5048 4983 4821 531 --31081 547 102 --
NM_001042603chr1264938 3752 1862 1780 1732 361 15121 14522 --
NM_001042604chr384185 3962 3738 3484 2977 1194 987 597 14460 1204 --
NM_001042749chrX31752 1468 214 22025 1244 1157 --
NM_001042750chrX31752 1468 214 22025 1244 1157 --
NM_001042751chrX31752 1468 214 22025 1244 1157 --
NM_001085487chr1179 ------
NM_001099678chr386088 4673 2390 2243 1272 1165 300 219 15759 25424 245 --
NM_001100108chr167921 6707 5816 2907 2115 155 12998 15223 12850
NM_001106chr3119727 9156 8863 8806 6988 6319 2438 2264 1025 850 196 19052 19702 --
NM_001119chr4------11418
NM_001160chr1232599 217 23 12143 12638 --
NM_001167chrX74820 4628 2400 2262 1322 1001 975 11214 36488 6048 1085 --
NM_001173chr14104720 4574 4432 4375 4328 4269 4242 3946 3689 2988 11776 13663 --
NM_001186chr2173192 2782 2555 2110 2019 969 423 12178 --1117
NM_001201chr463819 3630 2907 2594 2547 824 43366 3353 635 45 13839 13568
NM_001204chr2137733 7182 6694 6222 5683 5468 5460 5270 2449 1360 441 350 340 67040 6161 5135 2400 1652 520 ----
NM_001206chr983030 2919 2911 2887 2762 2735 2258 521 ------
NM_001233chr761878 1648 944 631 343 260 11997 ----
NM_001270chr5----1884 --
NM_001282chr174679 581 510 169 --1312 --
NM_001300chr10----1389 --
NM_001304chr1763599 3436 2970 2627 2580 2476 11379 23760 160 --
NM_001343chr511631 --1265 --
NM_001351chr331402 1235 142 --11570 --
NM_001378chr21493 ------
NM_001379chr19----1276 --
NM_001396chr2162462 2440 2259 2190 1834 1773 --12365 --
NM_001412chrX52282 1199 1021 649 458 ------
NM_001419chr1964717 4390 3361 1363 390 384 11490 44766 2986 1531 1063 --
NM_001497chr91431 --1717 --
NM_001609chr1053666 2933 1285 986 580 1660 ----
NM_001650chr1863755 2928 2761 1570 1372 854 ------
NM_001656chr5----11497 --
NM_001663chr1462493 1964 412 346 317 135 12354 ----
NM_001694chr161107 ------
NM_001695chr854229 1703 1501 794 191 43802 1308 1067 260 ----
NM_001730chr1311370 --1420 11092
NM_001730chr1311370 --1420 11092
NM_001742chr7------11517
NM_001746chr532705 1182 182 12804 22508 407 --
NM_001754chr2154315 4265 3939 1643 672 ------
NM_001759chr1263697 2070 1673 723 582 301 25271 938 24957 1878 --
NM_001777chr363304 2637 2551 1544 461 237 1341 23434 1641 --
NM_001859chr923227 3086 32760 1075 164 11593 --
NM_001951chr8----1587 --
NM_001969chr1453386 3217 1395 774 520 11012 2975 206 --
NM_002006chr475822 3616 1261 1180 472 454 101 24883 4544 13710 --
NM_002025chrX86432 6091 2690 2549 2312 2305 1044 809 --37745 3142 2259 17793
NM_002092chr4125066 4243 3812 3783 3172 1932 1587 1198 516 479 361 193 189 1611 --
NM_002126chr1762812 1077 976 562 436 43 14087 13161 13568
NM_002128chr1362380 2029 1738 878 865 648 --1310 --
NM_002135chr121555 ------
NM_002137chr741989 1740 1583 256 --12334 1871
NM_002210chr263363 3042 2348 1245 892 247 1461 22931 1345 --
NM_002214chr731988 1264 782 --25621 581 --
NM_002270chr575536 5272 5199 4581 1975 1923 981 --24927 4909 31088 994 862
NM_002285chr293934 3692 3167 3016 2694 2542 1329 1306 239 --24123 2601 --
NM_002296chr13624 569 150 11177 11546 --
NM_002374chr283631 3210 2711 1452 1282 1174 734 72 12349 ----
NM_002389chr111858 --31751 1301 190 --
NM_002395chr611091 ------
NM_002397chr5122 ----1754
NM_002430chr2252608 1889 1787 515 265 ------
NM_002486chr91254 --1962 12115
NM_002489chr7----1277 --
NM_002501chr1912576 --13193 13981
NM_002515chr1421806 328 ----1293
NM_002545chr1155134 4795 4502 3360 1701 --13580 13307
NM_002577chr343552 2756 658 532 11339 13929 --
NM_002581chr955504 4289 3990 3466 385 12060 14237 --
NM_002586chr611565 --21620 1594 --
NM_002610chr262666 2609 2549 2180 1965 310 --1239 --
NM_002655chr823266 501 --34156 3441 2029 --
NM_002706chr22274 109 --1532 --
NM_002731chr142351 2091 397 91 --12608 --
NM_002736chr71194 --1552 --
NM_002737chr1756610 6278 4225 1623 607 31507 616 230 16669 --
NM_002738chr16----1159 --
NM_002740chr341068 539 455 237 11727 12354 --
NM_002758chr17----1370 --
NM_002823chr21524 ------
NM_002834chr1233496 1304 295 33961 3447 384 ----
NM_002837chr1243824 3566 1666 889 13751 23394 194 --
NM_002839chr973194 2842 2355 1000 780 504 361 1184 ----
NM_002886chr334787 4156 1136 25063 1754 34466 3618 2076 --
NM_002892chr1421186 575 --31383 1340 30 --
NM_002959chr173947 3296 2981 1508 1429 1345 1293 11485 11717 --
NM_002977chr283429 3418 3121 2977 2564 1379 999 253 ------
NM_003003chr17----1276 --
NM_003011chr9----11177 1632
NM_003016chr1731617 1606 367 11744 --12010
NM_003020chr151377 ----1305
NM_003036chr1----1153 --
NM_003043chr314149 ------
NM_003045chr1364899 4794 4783 1898 1525 274 ------
NM_003108chr276670 6053 5760 5562 5304 5225 301 35175 1408 1271 36751 5817 237 --
NM_003112chr742848 2000 502 235 --2905 324 --
NM_003136chr141359 ------
NM_003155chr872515 2408 2389 2202 831 105 66 --1945 --
NM_003198chr1----1295 --
NM_003199chr1834525 1998 130 --11779 --
NM_003211chr123471 71 48 --2168 38 --
NM_003242chr332289 1724 1578 2761 737 ----
NM_003262chr3125007 4805 4229 4082 1966 1531 1151 897 449 413 312 137 1189 11159 --
NM_003298chr365751 5086 5009 4480 2233 2054 14398 25809 5796 --
NM_003319chr22927 787 --1106 --
NM_003348chr1221042 310 ----21530 386
NM_003369chr1162670 2633 2501 2405 1000 367 --12252 --
NM_003392chr334192 3810 3308 23531 1504 22989 1210 --
NM_003410chrX63100 2759 2182 1928 938 192 ------
NM_003412chr342023 960 869 300 22232 901 --12871
NM_003468chr274161 3893 3297 2811 2713 1389 671 11266 2629 64 1545
NM_003478chr1153173 2996 2901 2422 2152 22549 761 23272 2325 --
NM_003483chr1242766 1083 312 37 12623 22216 2124 --
NM_003566chr1273296 3249 3159 2732 2645 1221 862 1576 ----
NM_003574chr1874985 4807 4176 2180 2078 813 528 --14387 --
NM_003590chr243893 3672 2793 1054 12901 12885 --
NM_003601chr4142 --1151 --
NM_003615chr363644 3602 1280 852 731 580 12580 --13182
NM_003620chr174945 873 763 114 --1137 --
NM_003629chr133346 667 49 --12597 13278
NM_003633chr521965 1820 ----11981
NM_003671chr942465 1392 1116 336 --23529 3291 --
NM_003673chr17----1100 --
NM_003692chr91153 ----1933
NM_003701chr131893 ------
NM_003704chr41241 ------
NM_003710chr15----1424 --
NM_003758chr1521584 544 --1408 11288
NM_003758chr1521584 544 --1408 11288
NM_003759chr474217 3281 2675 1395 945 936 238 11479 ----
NM_003774chr1242892 2209 1344 1183 --1410 --
NM_003778chr31685 ----1740
NM_003784chr182654 618 ----1693
NM_003800chr612079 ------
NM_003822chr121001 936 ----11934
NM_003861chr1442189 2156 1065 942 ------
NM_003884chr351853 1543 571 556 66 ------
NM_003913chr653858 3721 3354 2687 261 11443 1856 165
NM_003966chr5107813 7606 6721 5833 2788 2607 2063 1992 1456 1144 13016 1639 16040
NM_003994chr1252958 1495 1193 1179 408 ------
NM_004028chr1863755 2928 2761 1570 1372 854 ------
NM_004067chr7------11463
NM_004081chrY51596 1261 748 230 109 1302 ----
NM_004094chr1412141 ----12688
NM_004097chr21692 ----1338
NM_004098chr1011073 ------
NM_004100chr662676 2626 2095 1666 1056 1010 --12368 --
NM_004124chr1473370 2633 2338 2219 1024 710 104 1824 --1381
NM_004136chr1563188 2966 2727 2343 523 348 --1724 --
NM_004171chr11109501 8826 7555 6188 5996 3431 3425 836 621 592 --17735 --
NM_004232chr18113558 3378 3234 2998 2638 2593 2364 1074 680 136 112 21146 62 --13713
NM_004330chr1511011 --1275 --
NM_004338chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_004349chr831273 1074 852 --1872 11168
NM_004370chr662086 1673 780 700 289 35 1206 --11719
NM_004385chr51248 --1593 1471
NM_004397chr1163722 3690 2654 1527 1129 706 ------
NM_004437chr183042 2585 2479 1402 1301 1228 924 139 ------
NM_004438chr243326 3264 2538 2030 140 11135 --
NM_004458chrX22539 177 1163 21034 343 --
NM_004501chr134054 884 533 --1497 1183
NM_004505chr1721601 101 --11279 --
NM_004586chrX55149 5084 4380 3695 1264 24976 382 11328 14854
NM_004612chr944406 1600 1192 476 --13947 --
NM_004622chr272433 1783 1707 1516 269 80 40 ------
NM_004663chr1541235 1201 1161 539 1219 11276 --
NM_004719chr1222646 711 --21873 683 --
NM_004725chr1041461 993 574 268 --1255 --
NM_004726chrX64243 4016 3709 3697 2254 984 --11410 --
NM_004733chr31451 ----142
NM_004745chr866795 6642 4861 1769 1629 1405 11062 14360 11087
NM_004747chr10------11311
NM_004772chr521492 171 --1488 1421
NM_004775chr1862253 2240 2139 2039 1945 562 --1396 --
NM_004834chr212122 21002 174 --11147
NM_004859chr1762682 2549 1936 1081 859 219 169 2979 970 --
NM_004866chr594815 4675 4012 3538 1743 1492 784 341 178 --14832 --
NM_004926chr1411331 1355 --11841
NM_004949chr1832176 1779 772 --21855 1753 11323
NM_004956chr734551 2886 1177 34315 4299 4215 --1504
NM_004966chr103995 954 68 1402 --1270
NM_004967chr4----1403 --
NM_004985chr1294010 3830 3642 3002 2959 1618 920 500 281 14003 11119 --
NM_004992chrX108278 5469 5423 5411 3270 2989 1966 1612 378 167 13015 --13147
NM_004992chrX108278 5469 5423 5411 3270 2989 1966 1612 378 167 13015 --13147
NM_005036chr2258334 7992 6293 5104 3171 --31577 1488 1403 --
NM_005056chr1275182 3996 2106 2024 1976 605 262 15365 14766 --
NM_005063chr1033785 3428 1386 --13480 12563
NM_005065chr1431818 1535 1140 24898 2147 --15198
NM_005066chr1129 --1530 1114
NM_005121chr1753516 3273 1044 965 732 1666 12530 --
NM_005156chr9115310 4967 4488 4325 4162 4023 3317 2150 1368 1216 322 --24316 3639 --
NM_005160chr2265657 5453 1825 1436 1370 856 --21282 755 --
NM_005171chr12--21260 1102 --11192
NM_005235chr256954 5048 4983 4821 531 --31081 547 102 --
NM_005339chr463787 3779 2690 1300 1238 879 13439 1961 22994 1736
NM_005342chrX22538 403 --1667 12388
NM_005359chr1885182 4578 4531 4268 3987 1108 761 615 16297 45334 2253 1932 1022 --
NM_005385chr331896 1833 358 ----11874
NM_005437chr10----11371 --
NM_005455chr111190 ----11732
NM_005461chr2021547 589 --31944 1769 769 --
NM_005497chr1786169 4690 4157 2112 804 558 371 291 137 36006 5435 4536 13970
NM_005504chr1296617 6098 5815 5768 5410 5176 4836 4084 1228 35107 4243 911 36112 5801 115 1321
NM_005509chr511678 ----1554
NM_005575chr51193 ------
NM_005578chr385107 3952 2021 1878 1668 1656 1126 358 11552 24471 1069 --
NM_005596chr994993 4938 3994 2329 1002 759 695 453 66 34726 1241 139 15200 --
NM_005611chr161834 --11126 1999
NM_005648chr8155 ------
NM_005655chr811043 ------
NM_005668chr554323 3392 1685 1578 236 --1427 --
NM_005725chr161915 1762 1748 925 573 386 11820 ----
NM_005738chr761896 1733 1474 769 654 445 ------
NM_005759chr21985 --24516 3545 13489
NM_005779chr553551 2716 1054 953 59 --1315 --
NM_005786chr1811294 ----1789
NM_005798chr1365054 4954 4749 3334 1991 1384 --32075 945 23 --
NM_005826chr1----1416 --
NM_005840chrX57180 5935 3078 2553 1826 25212 1911 ----
NM_005843chr241446 594 243 189 21681 1260 11231 --
NM_005880chr1631138 636 303 --11569 11410
NM_005898chr1132189 2097 783 12278 22634 1094 --
NM_005901chr1898689 6768 6632 5970 5388 2685 1845 366 299 11245 28169 1102 22704 1489
NM_005903chr571949 1784 1123 1088 869 578 427 14241 ----
NM_005907chr621586 216 --11520 11503
NM_005909chr564201 3993 1102 913 697 166 12978 ----
NM_005962chr1032045 1651 336 1505 11582 --
NM_005962chr1032045 1651 336 1505 11582 --
NM_005966chr242122 1814 487 458 2539 382 11856 --
NM_005968chr191204 ------
NM_005999chr11378 ------
NM_006007chr964132 3755 2980 1348 1320 279 ----23294 1671
NM_006039chr1711056 ------
NM_006047chr2043406 3074 2979 2465 1802 22917 2293 --
NM_006060chr734326 3989 3541 --23153 2719 --
NM_006079chr61238 ------
NM_006089chrX41897 661 323 268 1303 182 --
NM_006094chr8--1567 1770 1736
NM_006095chr463557 3445 3295 3232 1424 1373 1338 24354 4237 --
NM_006106chr1141385 1366 849 393 --185 31120 1080 1062
NM_006139chr242749 2735 1819 537 22167 566 ----
NM_006154chr152806 41 --2669 357 --
NM_006195chr911408 --21419 943 --
NM_006197chr821990 103 --1283 1151
NM_006203chr551901 1862 1595 1382 171 14057 11482 --
NM_006226chr21156 ------
NM_006252chr1137378 6773 6589 6539 5662 5656 5199 4681 2837 2544 2222 1859 1222 44669 1737 1303 379 16462 15713
NM_006256chr11218 --1512 12107
NM_006264chr41362 ------
NM_006282chr2041711 1398 448 438 14497 14619 --
NM_006283chr854173 3081 441 297 239 --14128 --
NM_006315chr464545 4369 3891 1678 1335 398 1356 24400 3620 --
NM_006325chr123594 224 36 ----1171
NM_006352chr152038 1935 1799 517 394 11816 ----
NM_006372chr61337 ------
NM_006379chr722285 1935 --1696 11728
NM_006393chr1074464 4385 4183 3107 3006 2783 944 ------
NM_006409chr7------1242
NM_006449chr231624 783 530 --193 --
NM_006451chr52417 24 1210 --138
NM_006489chr1421806 328 ----1293
NM_006496chr121863 1676 11630 21697 1554 --
NM_006530chr12------1471
NM_006544chr1465908 3706 3689 2020 545 438 14574 24124 1706 --
NM_006561chr10105895 5576 5460 4302 3859 1720 1559 520 472 188 14682 13909 --
NM_006572chr17----23409 2181 2767 81
NM_006599chr16138145 7873 7777 6791 6571 5095 2657 2234 1900 1356 1335 1204 515 25423 308 --1785
NM_006603chrX31752 1468 214 22025 1244 1157 --
NM_006609chr222375 888 22663 475 32183 1840 415 --
NM_006620chr663438 3098 1293 640 421 68 --1352 --
NM_006624chr10----155 2650 149
NM_006628chr1584621 4447 4331 3536 2840 1751 1666 1106 1175 23935 734 1867
NM_006654chr1253601 1253 965 930 850 --11926 --
NM_006667chrX1256 ------
NM_006731chr9105821 5756 4560 4526 4475 3798 3774 3530 1267 1186 15723 15044 14579
NM_006758chr21144 ------
NM_006775chr642691 2322 2195 377 12105 12573 --
NM_006803chr831579 1554 712 11328 21844 1671 --
NM_006805chr511251 ----1394
NM_006827chr1452283 1153 1107 1059 961 ----13259
NM_006874chr441028 1012 783 333 ----1770
NM_006888chr1463350 3187 2705 2409 309 218 1825 12200 --
NM_006915chrX21647 687 --3778 241 194 --
NM_006930chr551561 1324 1286 230 186 11649 11966 --
NM_006939chr1441102 755 453 440 ------
NM_007007chr1234478 1731 1620 23419 1148 34762 339 75 14364
NM_007011chr1595877 5749 5171 4728 4454 1965 1224 300 262 11062 --12629
NM_007034chr1--1759 --164
NM_007038chr2165828 4983 4233 2167 1136 831 --12325 --
NM_007125chrY----11002 --
NM_007146chr1741873 1024 706 254 1205 ----
NM_007175chr823517 2737 ----1208
NM_007195chr1831485 780 454 --13550 162
NM_007203chr932442 541 435 13009 11532 23466 757
NM_007207chr1198 ------
NM_007212chr152155 1730 1415 442 312 1133 ----
NM_007249chr13118979 7961 7073 5885 3428 3332 3030 2098 1350 771 714 38952 8691 7220 ----
NM_007271chr6----1533 --
NM_007275chr31891 ------
NM_007276chr721131 211 ----1908
NM_007375chr132358 1886 540 ----12235
NM_012081chr563228 3041 2806 2739 1016 280 23409 3077 ----
NM_012129chr732247 2043 154 11715 1406 --
NM_012164chr977244 6476 6405 5374 2938 2686 1353 21049 506 37091 1728 657 --
NM_012197chr9----11543 --
NM_012234chr383275 3258 3032 2975 2456 2354 1000 462 --13753 --
NM_012249chr253053 2501 1172 733 98 23140 261 13180 --
NM_012262chr154825 4118 3457 1434 535 ------
NM_012297chr452057 1966 1916 1605 566 12558 ----
NM_012301chr751938 1797 872 754 44 1297 --41735 1610 1583 780
NM_012309chr1144190 4153 3262 863 11711 21979 207 --
NM_012322chr71278 ------
NM_012341chr10----1469 --
NM_012461chr14----1237 1678
NM_012464chr442512 2193 1791 680 32759 2269 310 ----
NM_012479chr722449 541 11734 12702 1589
NM_013229chr1232599 217 23 12143 12638 --
NM_013231chr1453987 3067 523 453 208 --13677 --
NM_013253chr1131369 968 445 --1235 --
NM_013255chr7117395 6401 6134 6074 3430 3181 2773 2571 1897 1739 1718 16298 15988 1312
NM_013281chr2011003 ------
NM_013282chr1911030 ------
NM_013286chr351424 1124 660 523 47 13241 --13792
NM_013300chr121156 ------
NM_013316chr7----1940 --
NM_013372chr1533164 1299 146 ----1971
NM_013437chr82273 82 189 --21240 1208
NM_013450chr21915 ----1398
NM_013943chr132596 151 111 12383 11191 --
NM_013995chrX31862 1590 367 12363 12424 --
NM_014011chr262427 1683 1010 527 431 247 11706 12303 1550
NM_014016chr321240 388 --1522 21400 644
NM_014043chr341484 1229 1088 198 21415 298 ----
NM_014048chr1644877 3502 1967 66 35023 1763 198 --1597
NM_014112chr845098 4440 3483 2036 ----21375 724
NM_014141chr751685 1621 1261 618 554 21280 922 35368 1005 705 --
NM_014155chr11107499 7468 5724 5323 5128 1813 1649 1069 294 67 15255 1275 --
NM_014181chr21529 ------
NM_014189chr4------11418
NM_014190chr4------11770
NM_014232chr17----1198 --
NM_014232chr17----1198 --
NM_014245chr32170 29 --1344 1417
NM_014253chrX62411 2376 1716 1651 845 259 --1354 --
NM_014278chr4----1130 --
NM_014331chr4116488 6116 5149 5133 4731 2334 1030 789 746 209 188 27854 4864 ----
NM_014363chr131872 11100 1291 1974
NM_014372chr141951 1501 632 344 1593 1478 --
NM_014393chr81917 1683 --12132
NM_014445chr33979 523 376 ----11859
NM_014583chr3----1203 --
NM_014606chr4----11462 --
NM_014615chr1642522 1084 409 233 --13071 13515
NM_014616chr343089 2572 1344 116 1925 12317 --
NM_014636chr994162 4081 3623 1692 1669 1644 1556 1412 1373 --14038 --
NM_014674chr343721 3222 3138 692 13229 12504 --
NM_014699chr16184 ------
NM_014702chr652404 1186 1106 904 212 1934 ----
NM_014707chr73832 376 233 152 11511 --
NM_014721chr687160 7150 7144 6822 6337 2898 1017 477 ------
NM_014729chr8181 22014 499 12179 11788
NM_014735chrX32087 859 168 --21444 144 --
NM_014743chr462407 2277 2169 751 330 308 ------
NM_014751chr862070 1975 1894 857 348 240 --12102 --
NM_014755chr252842 1678 947 756 138 --14276 1576
NM_014765chr152329 1726 636 327 60 --22669 2069 --
NM_014779chr3----11155 --
NM_014810chr143024 2875 2778 553 --12401 --
NM_014829chr552200 1595 565 549 53 32078 1797 1514 12113 168
NM_014872chr952093 1577 1496 664 65 1117 22208 255 --
NM_014873chr11397 34354 1019 999 --11699
NM_014877chr17137632 7157 6632 6210 6031 5901 4768 2375 2236 1722 1624 569 67 26872 1584 15409 --
NM_014881chr10258 28 --1331 --
NM_014897chr17----1870 --
NM_014906chr1743817 3499 688 376 --21255 192 1600
NM_014947chr153001 2620 436 394 275 --12752 1338
NM_014950chr14------1499
NM_014953chr13114279 4223 4212 4130 3640 2700 1616 1509 1124 762 92 ------
NM_014962chr2032610 1002 300 2785 678 21912 853 --
NM_014978chr1011332 ------
NM_014982chr1435338 1092 1039 25062 3512 ----
NM_015025chr232269 1961 178 ----1945
NM_015026chr1253683 3501 1544 676 303 1762 14282 --
NM_015035chr2066496 5953 5194 4361 4207 2074 --45775 4286 4156 959 --
NM_015044chr1622943 2302 ------
NM_015076chr664240 3843 3299 641 564 409 ----13906
NM_015092chr1634291 3005 877 --33315 3083 1012 --
NM_015094chr22----1870 --
NM_015144chr1663862 2790 1555 1415 1401 534 23095 743 1682 --
NM_015161chr1631270 1182 207 --11515 --
NM_015191chr1132124 1094 968 --22565 835 1942
NM_015192chr2032333 2229 384 --22462 532 --
NM_015200chr422383 2263 22023 723 22466 358 --
NM_015208chr1863965 3259 1359 476 412 194 33373 2480 454 ----
NM_015216chr521496 1183 ------
NM_015233chr1342685 2063 390 309 --2767 449 --
NM_015247chr1663642 3451 722 699 545 72 15039 1978 --
NM_015260chr19----11576 --
NM_015271chr423423 403 --1232 11279
NM_015282chr232022 1104 790 11026 1303 --
NM_015285chr182927 659 11722 21691 243 1723
NM_015294chr1731142 240 58 21123 163 1283 --
NM_015310chr876801 5870 5735 5371 1775 1065 149 22388 1547 27913 401 --
NM_015314chr752303 2167 1885 448 65 11013 12065 --
NM_015315chr5------12506
NM_015328chr762634 1253 1111 799 770 679 --11041 --
NM_015349chr61462 11078 --12977
NM_015365chrX84144 3901 3538 3282 1708 582 459 112 --24279 427 --
NM_015436chr463040 2931 719 647 338 245 23192 2792 23002 1353 --
NM_015444chr3192 ------
NM_015458chr885179 4801 4278 3410 1717 1629 1280 532 34816 1601 1300 ----
NM_015508chr311194 ------
NM_015554chr1542832 773 320 272 ----12808
NM_015569chr144484 887 717 122 11231 1577 11502
NM_015571chr6------12082
NM_015602chr13244 193 99 ----21329 619
NM_015640chr155251 5191 1472 539 200 1342 25289 844 --
NM_015649chr191266 ------
NM_015866chr1----1386 1992
NM_015878chr82339 224 --1617 1483
NM_015879chr1845979 5647 1606 328 12204 18511 --
NM_015881chr1131369 968 445 --1235 --
NM_015906chr174796 3606 1627 895 831 725 568 13936 24651 3471 --
NM_016018chr852465 876 472 356 300 --12229 --
NM_016022chr1----1993 --
NM_016025chr16----11808 --
NM_016045chr2021708 1507 --2455 100 --
NM_016072chr1222051 2034 --22027 795 --
NM_016107chr51224 ------
NM_016132chr1553144 2965 676 311 302 1216 23065 798 --
NM_016248chr1363658 2653 1176 749 621 505 13102 1993 --
NM_016255chr653246 3079 2509 591 556 1421 ----
NM_016258chr11738 ----2227 131
NM_016260chr2137296 6971 6862 5487 5167 4989 2879 2804 2514 2507 1061 707 633 --47606 7171 5800 783 --
NM_016271chr1832306 1781 124 21760 863 21539 941 --
NM_016272chr2222767 2558 22729 380 21075 279 --
NM_016275chr322602 660 3519 510 423 22214 1090 12278
NM_016297chr233332 1152 625 23479 2416 22906 2823 --
NM_016356chr642854 2845 2087 870 --12621 1339
NM_016396chr1531134 575 550 --1301 1270
NM_016423chr14167 ------
NM_016470chr201402 ------
NM_016507chr1742890 2816 2807 342 23179 1238 12457 --
NM_016516chr22311 25 1765 ----
NM_016530chr1563918 3852 2522 1211 1009 273 13048 ----
NM_016542chrX51341 1255 1217 1194 217 11541 ----
NM_016587chr721131 211 ----1908
NM_016603chr542129 2118 1609 1523 --11506 --
NM_016626chr1831303 445 198 21572 244 --1564
NM_017412chr8----1456 --
NM_017447chr2163848 3815 3150 2835 1684 721 23569 1483 13101 --
NM_017519chr61860 ----11238
NM_017569chr13----1326 --
NM_017575chr17----11456 --
NM_017599chr1251674 1642 596 396 163 11498 21866 535 --
NM_017617chr911197 ----11524
NM_017628chr465240 3818 3635 3583 834 347 15066 1113 11080
NM_017641chr121186 ----1382
NM_017643chr17--1788 --12515
NM_017644chr341888 1378 1249 460 15148 11518 --
NM_017658chr1474386 3756 1239 882 772 284 70 34483 4153 3537 1164 --
NM_017730chr31108 ------
NM_017758chr1731491 1443 47 --11450 --
NM_017813chr854358 4188 4173 1381 834 25326 808 25435 4561 --
NM_017824chr1042323 1776 1010 26 22457 819 22207 828 --
NM_017845chr42585 294 ----1230
NM_017905chr13------1194
NM_017944chr1153016 1052 1027 976 778 ----11064
NM_017954chr711260 --21543 247 --
NM_018043chr11----11376 --
NM_018047chr5----195 --
NM_018133chr362220 1813 542 224 161 49 --1725 --
NM_018227chr4103206 3076 3056 2990 2489 2317 2146 1199 575 534 1542 ----
NM_018243chr453792 3681 3249 856 81 13048 ----
NM_018330chr1041752 1418 1337 1126 --159 --
NM_018351chr1274676 4061 3946 3342 3027 1775 1020 ------
NM_018360chrX162 ------
NM_018364chr164095 3931 3698 1507 978 60 --1526 --
NM_018374chr7115222 5103 4721 3969 3770 3517 3425 1170 1155 678 151 ------
NM_018387chr91468 ------
NM_018403chr363513 2566 1506 1495 933 487 13097 13251 --
NM_018429chr572892 2413 2368 2011 1810 1067 826 ------
NM_018437chr92458 376 153 --1504
NM_018440chr8118726 8217 6881 6543 5547 5418 3483 2894 2757 726 159 28601 2871 ----
NM_018471chr21201 ------
NM_018490chr111285 --11607 21360 138
NM_018566chr184801 4763 4639 3347 3135 1796 1219 924 23953 3286 ----
NM_018569chr4----11319 --
NM_018638chr1285090 4195 1345 1101 1027 1014 987 782 1251 24886 4230 --
NM_018684chrX----11241 --
NM_018837chr202911 706 ----1865
NM_018846chr71830 ------
NM_018939chr51553 ----1164
NM_018945chr622481 891 12497 --1670
NM_018947chr763814 1767 1137 1068 485 181 --24945 3722 --
NM_018970chr762522 2413 1957 1206 1050 790 --1108 --
NM_018999chr102871 389 14860 24436 3377 1230
NM_019000chr541650 1140 614 344 1366 ----
NM_019001chr384185 3962 3738 3484 2977 1194 987 597 14460 1204 --
NM_019028chr111458 --162 --
NM_019045chrX----1792 --
NM_019063chr241933 525 304 183 --12078 --
NM_019074chr15------1924
NM_019084chr1042620 1858 1043 870 --11780 --
NM_019590chr10----1955 --
NM_019842chr6131 ----1124
NM_019852chr141116 ------
NM_020066chr11802 ----1810
NM_020116chr4----11210 1352
NM_020122chr245783 2319 1765 1220 --34278 1287 956 12095
NM_020141chr132010 907 843 ----11612
NM_020159chr431698 1207 214 --1250 --
NM_020205chr121274 696 11182 --1593
NM_020336chr2073624 3571 3154 657 370 62 35 --1931 --
NM_020337chr442864 2759 2046 271 --1982 3641 619 595
NM_020346chr111263 ------
NM_020357chr33357 229 54 --1215 --
NM_020381chr61471 11640 3594 555 198 --
NM_020420chrY51596 1261 748 230 109 1302 ----
NM_020432chr732241 1690 1435 22047 514 ----
NM_020456chr1312029 --11578 1211
NM_020463chr241402 1339 1144 555 1296 11314 --
NM_020466chr684593 4399 4278 3912 3742 1450 1262 207 13228 13274 --
NM_020548chr2----1186 --
NM_020654chr3----1107 --
NM_020673chr2097649 7363 6334 5767 5417 5372 5138 1009 83 1457 21894 299 --
NM_020718chr1696250 6228 6072 5799 5624 2642 2197 1320 873 12264 ----
NM_020727chr2174005 3769 3310 2620 1455 1249 883 1727 21065 444 --
NM_020732chr61860 ----11238
NM_020734chr1273151 2891 2516 2375 2332 955 500 1718 --1508
NM_020748chr171775 1145 21807 1523 --
NM_020766chrX33351 1319 895 13622 --13273
NM_020772chr17108221 8087 7054 5301 2685 2208 1870 1651 1583 284 36148 5953 5543 17423 --
NM_020774chr1895956 5709 5388 5303 5064 1483 849 669 108 12062 11440 --
NM_020782chr1264458 4296 3965 3921 1147 650 11501 14867 --
NM_020841chr1233844 3505 1281 21288 1214 13090 --
NM_020844chr867302 7071 6424 5522 5275 1589 12563 17358 --
NM_020858chr15----32140 1606 480 --
NM_020870chr442034 1559 803 665 ----162
NM_020871chrX42059 469 98 32 22448 437 42163 2104 763 301 --
NM_020918chr101478 43410 2361 1328 646 23657 906 --
NM_020921chr1463349 1340 760 458 287 137 ------
NM_020925chr111325 ------
NM_020948chr133557 484 381 --31431 1004 101 --
NM_020975chr10----1140 --
NM_021038chr363353 3283 3069 2889 1352 319 --12650 --
NM_021090chr2274933 4458 4435 3345 1691 1666 1512 ------
NM_021111chr931134 855 81 ------
NM_021145chr761112 819 387 338 205 24 11158 ----
NM_021190chr151352 1250 1089 868 537 1249 11011 --
NM_021238chr122713 250 --31677 589 358 --
NM_021255chr1453992 3856 3843 3407 1617 ----13629
NM_021785chrX1109 ------
NM_021911chr575573 5325 5113 4497 4121 3699 3631 25202 929 ----
NM_021912chr1574115 3499 3080 2835 1431 965 312 3534 496 435 1757 --
NM_021956chr651509 1181 1122 576 155 ------
NM_021957chr12----1506 --
NM_021960chr142519 757 221 68 2599 61 12241 --
NM_021961chr1176810 6562 2861 2446 1276 1083 900 14906 26221 6143 --
NM_021964chr376562 5973 4388 2515 2283 2216 734 --32378 1880 1460 --
NM_022048chr1596152 6131 5789 4963 4863 4808 4609 1062 759 1343 12438 --
NM_022130chr5----150 --
NM_022459chr13125759 5753 5688 5145 4928 4696 4610 4045 4033 2221 1504 1270 12228 16029 --
NM_022726chr6----11640 --
NM_022753chr172793 2733 2534 2066 1926 979 242 --12697 --
NM_022771chr121176 ------
NM_022828chr51677 11426 1229 1254
NM_022841chr1552709 2208 954 867 306 --11014 --
NM_022977chrX22539 177 1163 21034 343 --
NM_023000chr1421186 575 --31383 1340 30 --
NM_023001chr1421186 575 --31383 1340 30 --
NM_023016chr262801 2550 1896 789 635 605 --22769 360 --
NM_023929chr862613 1768 1762 996 417 110 11967 11726 --
NM_024034chr20------1159
NM_024422chr1841968 1571 751 564 --21647 1545 --
NM_024430chr1861889 1833 1792 1219 1192 547 --1191 --
NM_024524chr332737 931 338 2352 101 22688 2624 --
NM_024639chr662839 2607 2596 1958 1829 887 ------
NM_024646chr153751 3611 3076 282 119 23718 3674 ----
NM_024665chr384662 4499 4036 3933 3710 825 528 323 11212 42859 986 460 414 --
NM_024704chr2021046 234 ----1868
NM_024715chr541518 405 271 67 1362 1423 --
NM_024721chr872511 2104 1820 973 798 604 76 21743 386 1662 --
NM_024744chr242074 933 583 110 42033 1024 1012 296 ----
NM_024745chr161852 --178 --
NM_024763chr1130 1173 2847 445 --
NM_024847chr161933 --1976 1304
NM_024947chr3139207 9156 8215 5924 3818 2743 2044 1213 777 682 638 582 406 28032 1017 133 --
NM_024949chr444358 1963 1892 1858 23701 1220 24757 4409 --
NM_024989chr2127347 6657 6191 5883 2932 2842 2543 1430 785 516 167 144 56390 6327 5195 800 422 27651 6247 --
NM_025054chr863970 3274 3115 2853 1574 1058 ------
NM_025073chr164586 4293 3498 3106 1897 808 11131 11021 --
NM_025079chr1------1256
NM_025134chr1662492 2346 2316 2130 793 360 21889 604 ----
NM_025146chr362700 2644 2507 2411 259 252 --21856 606 12562
NM_025201chr15------1372
NM_030594chr1521060 454 --21360 256 --
NM_030621chr1453420 944 622 450 204 --1198 --
NM_030625chr1042425 967 283 226 ----12362
NM_030627chr5114088 3895 3787 3718 3089 3045 2958 2550 1304 1202 432 13004 ----
NM_030647chr775789 5585 5034 4419 3994 1405 983 25405 1780 32362 1297 93 14931
NM_030648chr474618 4514 4438 3967 3404 1864 1462 21268 1174 ----
NM_030751chr1051892 1639 1601 1354 540 11269 31701 1433 242 --
NM_030751chr1051892 1639 1601 1354 540 11269 31701 1433 242 --
NM_030885chr362306 2029 1701 1562 616 140 ------
NM_030933chr1----182 --
NM_030934chr121389 69 --1143 11744
NM_030953chr511382 --1348 131
NM_031203chr191204 ------
NM_031243chr741989 1740 1583 256 --12334 1871
NM_031292chr1261501 1432 1293 1264 1193 530 11076 ----
NM_031418chr1142670 2399 986 592 3845 797 503 ----
NM_031427chr1465549 5439 2377 2246 1855 340 ----15225
NM_031442chrX53186 3007 2028 1114 350 --23151 110 12313
NM_031476chr1621100 467 ----12659
NM_031844chr134054 884 533 --1497 1183
NM_031845chr283631 3210 2711 1452 1282 1174 734 72 12349 ----
NM_031847chr283631 3210 2711 1452 1282 1174 734 72 12349 ----
NM_031942chr231007 300 275 --3977 877 203 --
NM_032021chr11------1945
NM_032102chr1153131 2389 989 598 142 2912 725 11206 11196
NM_032116chr1355430 5168 1410 1319 156 24260 1113 21732 340 --
NM_032149chr41192 ------
NM_032182chr1021664 1087 11296 21289 289 --
NM_032199chr1053833 3688 3379 2816 595 13728 ----
NM_032373chr1085448 5124 4877 4817 4609 2165 1458 1325 14212 21218 371 --
NM_032440chr1011988 ----22546 1924
NM_032458chrX53403 3262 542 227 162 --43390 3056 2667 549 --
NM_032505chr331857 1774 936 --1638 12664
NM_032802chr15----1227 --
NM_032804chr1051881 1863 1648 570 418 --11854 11833
NM_032859chr1353495 2695 1232 1127 153 1241 --23626 3138
NM_032873chr1114398 ------
NM_032961chr411121 ----1537
NM_032968chrX84136 3880 3459 3271 2943 1539 1357 499 33641 782 407 ----
NM_032969chrX84136 3880 3459 3271 2943 1539 1357 499 33641 782 407 ----
NM_032973chrY84128 3872 3455 3266 2938 1539 1357 499 33633 782 407 ----
NM_032983chr721067 901 --12379 12915
NM_033012chr131893 ------
NM_033020chr174796 3606 1627 895 831 725 568 13936 24651 3471 --
NM_033224chr745573 4979 2236 772 25995 1165 25910 810 --
NM_033227chr5----127 --
NM_033228chr5----167 --
NM_033285chr874471 4344 3884 3665 3378 1451 118 13083 ----
NM_033331chr942465 1392 1116 336 --23529 3291 --
NM_033360chr12104131 3951 3763 3123 3080 2848 1739 1041 621 402 14124 11240 --
NM_033393chr42679 351 ----12927
NM_033428chr951959 1716 1672 738 634 11678 ----
NM_033430chr433909 2919 63 23823 3599 11625 --
NM_033437chr433909 2919 63 23823 3599 11625 --
NM_033449chr51303 ------
NM_033495chrX130 ------
NM_033551chr5------12506
NM_033656chr21115970 5333 5193 4726 4397 4339 3846 3656 1610 398 343 35562 2067 1059 23676 375 15947
NM_052811chr1365054 4954 4749 3334 1991 1384 --32075 945 23 --
NM_052832chr852939 1981 1946 238 149 ------
NM_052834chr182927 659 11722 21691 243 1723
NM_052879chr1273838 3280 3037 1514 1260 720 627 ----12636
NM_052885chr1274636 3114 1553 1279 872 451 109 ------
NM_052904chr631206 1076 556 ----11373
NM_052905chr231475 1304 565 11511 11355 --
NM_052910chr1352087 1935 699 451 341 ------
NM_052932chr1132255 1868 542 21770 74 --12083
NM_052998chr11181 ------
NM_053016chr9107497 7457 7063 5491 2140 1746 1542 1326 683 121 17422 ----
NM_053023chr1123188 2751 --12485 --
NM_053025chr341466 559 485 154 11545 124 --
NM_053026chr341466 559 485 154 11545 124 --
NM_053027chr341466 559 485 154 11545 124 --
NM_053028chr341466 559 485 154 11545 124 --
NM_053031chr341466 559 485 154 11545 124 --
NM_053032chr341466 559 485 154 11545 124 --
NM_053043chr746324 5903 2424 644 11846 46436 5847 4946 376 --
NM_053056chr1142099 2093 2055 1990 --32442 2140 1079 --
NM_054016chr161736 1597 1335 185 115 53 21814 1239 --11853
NM_054016chr161736 1597 1335 185 115 53 21814 1239 --11853
NM_054016chr161736 1597 1335 185 115 53 21814 1239 --11853
NM_057175chr43663 642 199 22610 1772 --21656 981
NM_080645chr662086 1673 780 700 289 35 1206 --11719
NM_080683chr41362 ------
NM_080684chr41362 ------
NM_080685chr41362 ------
NM_080717chr121375 ------
NM_080867chr1454938 4128 1973 1563 843 11439 24693 1007 --
NM_130391chr973194 2842 2355 1000 780 504 361 1184 ----
NM_130392chr973194 2842 2355 1000 780 504 361 1184 ----
NM_130393chr973194 2842 2355 1000 780 504 361 1184 ----
NM_130436chr2162462 2440 2259 2190 1834 1773 --12365 --
NM_130438chr2173039 3017 2836 2767 2411 2350 2165 --12942 --
NM_130439chr1032045 1651 336 1505 11582 --
NM_130439chr1032045 1651 336 1505 11582 --
NM_130809chr533121 2287 1187 11029 22982 106 --
NM_130838chr15----11283 --
NM_130839chr15----11283 --
NM_133330chr432931 1294 839 --1643 1703
NM_133331chr432931 1294 839 --1643 1703
NM_133334chr455575 5098 2455 544 350 15366 14695 --
NM_133335chr432931 1294 839 --1643 1703
NM_133367chr633206 2596 1080 12783 23291 601 --
NM_133370chr443636 3321 1379 391 11230 23439 2863 --
NM_133378chr22927 787 --1106 --
NM_133432chr22927 787 --1106 --
NM_133437chr22927 787 --1106 --
NM_138270chrX83125 2877 2592 2237 1124 634 133 99 11172 ----
NM_138288chr1452225 2209 1886 1688 548 1831 1211 --
NM_138423chr15------11767
NM_138444chr1384351 4169 3922 1945 1279 803 592 320 --11461 11191
NM_138459chr643372 3334 3247 2705 ----11400
NM_138713chr16138145 7873 7777 6791 6571 5095 2657 2234 1900 1356 1335 1204 515 25423 308 --1785
NM_138714chr16138145 7873 7777 6791 6571 5095 2657 2234 1900 1356 1335 1204 515 25423 308 --1785
NM_139283chr122573 310 ----1694
NM_144568chr14175 ------
NM_144571chr4115469 5463 5389 5245 5019 4894 4743 2636 1882 1583 1080 16471 16352 --
NM_144578chr1454736 4471 4303 1601 1149 12020 11377 11555
NM_144581chr141271 ------
NM_144657chrX1505 ----1261
NM_144728chr1198 ------
NM_144729chr1198 ------
NM_144778chr1352521 1893 1067 300 127 1363 11840 --
NM_144949chr262427 1683 1010 527 431 247 11706 12303 1550
NM_144973chr1253423 3264 1398 1261 164 11270 ----
NM_145018chr111204 ------
NM_145025chr62991 109 ----11109
NM_145055chr1873666 3569 3189 2713 1448 1213 344 12983 ----
NM_145203chr13178 ------
NM_145259chr286721 6032 5563 5336 4873 4862 2179 1251 ------
NM_145307chr1021173 1137 44145 3988 686 526 34588 3248 226 --
NM_145686chr212122 21002 174 --11147
NM_145687chr212122 21002 174 --11147
NM_145698chr1032034 1951 89 ----1126
NM_145808chr753059 2626 2265 2019 678 12114 12472 12526
NM_145810chr231007 300 275 --3977 877 203 --
NM_147150chr932442 541 435 13009 11532 23466 757
NM_148174chr82339 224 --1617 1483
NM_152261chr1261949 783 692 438 423 287 12300 12320 --
NM_152283chr51186 ------
NM_152332chr1452652 2093 1806 1032 842 --1947 --
NM_152409chr562740 2308 2277 1260 970 349 22813 2419 11373 --
NM_152607chr11406 ------
NM_152622chr573328 3262 2879 2731 1180 985 783 42514 2200 878 613 ----
NM_152624chr567075 6462 5814 2483 2313 180 --27472 1793 22053 1017
NM_152629chr963667 3332 1566 1253 780 773 13839 1341 --
NM_152665chr11867 ------
NM_152687chr5----11308 --
NM_152699chr363535 3093 2639 1490 1445 192 ----13402
NM_152737chr64813 763 590 366 11731 21589 573 --
NM_152756chr563989 3228 2641 1403 233 129 24302 862 ----
NM_152773chr3----198 --
NM_152787chrX53782 2721 2534 2446 1269 1377 22993 2850 13079
NM_152838chr2043406 3074 2979 2465 1802 22917 2293 --
NM_152910chr13----1120 --
NM_152924chr1595877 5749 5171 4728 4454 1965 1224 300 262 11062 --12629
NM_152999chr764381 3562 1863 1125 1067 1001 --1695 --
NM_153050chr2274933 4458 4435 3345 1691 1666 1512 ------
NM_153051chr2274933 4458 4435 3345 1691 1666 1512 ------
NM_153188chr575536 5272 5199 4581 1975 1923 981 --24927 4909 31088 994 862
NM_153207chr121766 13848 24080 1530 1363
NM_153223chr5--2440 248 --11563
NM_153256chr1051603 1517 1218 564 555 11819 ----
NM_153262chr152328 1077 459 408 22 ------
NM_153616chr15----32140 1606 480 --
NM_153617chr15----32140 1606 480 --
NM_153618chr15----32140 1606 480 --
NM_153634chr1261565 1153 1135 119 106 97 ------
NM_153686chr451849 802 678 374 279 12473 22360 1909 --
NM_153687chr1231416 1349 628 --21431 1362 --
NM_153713chr1----1192 --
NM_153810chr1044713 4211 3746 3600 31705 1427 889 ----
NM_170606chr711604 1617 21195 626 --
NM_170665chr1274549 4291 3316 3270 817 725 640 ------
NM_172071chr176318 2573 2443 1917 1334 1115 43 11060 12957 --
NM_172103chr662676 2626 2095 1666 1056 1010 --12368 --
NM_172105chr662676 2626 2095 1666 1056 1010 --12368 --
NM_172115chr41103 ------
NM_172354chr111858 --31751 1301 190 --
NM_173157chr121555 ------
NM_173214chr16138145 7873 7777 6791 6571 5095 2657 2234 1900 1356 1335 1204 515 25423 308 --1785
NM_173468chr4115893 5790 3922 2237 2124 1475 1469 1434 1401 1325 1234 25125 515 15446 14187
NM_173470chrX32555 524 474 1841 22161 1021 --
NM_173533chr1------1257
NM_173576chr10----1820 --
NM_173582chr1186184 6156 5767 5693 5484 5009 2446 897 25657 1133 --23952 547
NM_173642chr157385 3520 2674 1825 1610 1778 154 11914
NM_173808chr154233 3871 2955 1519 73 23701 2982 --22794 336
NM_173829chr5105950 5683 5516 5461 2443 1813 1770 1031 497 355 12228 1983 --
NM_175607chr331547 1396 460 ----1250
NM_175612chr331547 1396 460 ----1250
NM_175634chr831273 1074 852 --1872 11168
NM_175635chr831273 1074 852 --1872 11168
NM_175636chr831273 1074 852 --1872 11168
NM_175861chr1275602 5435 4762 3738 3716 1835 1419 --35620 5244 5186 --
NM_175863chr61860 ----11238
NM_175874chr12----2151 68 --
NM_175876chr161998 1920 1714 1072 288 93 12643 ----
NM_175920chr51193 ------
NM_176801chr4------11770
NM_177438chr1453420 944 622 450 204 --1198 --
NM_177969chr22274 109 --1532 --
NM_177974chr15------11767
NM_178009chr13----183 --
NM_178011chr1053055 2704 736 461 405 ----11035
NM_178151chrX97246 7131 6809 5537 2067 1611 1387 1173 752 15554 15864 11091
NM_178152chrX97246 7131 6809 5537 2067 1611 1387 1173 752 15554 15864 11091
NM_178153chrX97246 7131 6809 5537 2067 1611 1387 1173 752 15554 15864 11091
NM_178424chr5------1219
NM_178509chr173635 314 204 ------
NM_178815chr1052526 2197 1869 1750 1103 22636 861 11921 11741
NM_181077chr1531945 792 731 1140 1477 12126
NM_181358chr154030 2859 2779 574 282 14167 12747 --
NM_181443chr2032610 1002 300 2785 678 21912 853 --
NM_181481chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_181482chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_181483chr1886947 6073 5923 5860 4834 1570 1530 88 46691 5252 2777 917 12450 15186
NM_181486chr121375 ------
NM_181504chr553091 2842 1020 882 844 ----13558
NM_181523chr553091 2842 1020 882 844 ----13558
NM_181524chr553091 2842 1020 882 844 ----13558
NM_181642chr15----1424 --
NM_181714chr641768 1629 176 137 ------
NM_181836chr542530 466 338 256 --32194 1019 641 --
NM_181861chr1232599 217 23 12143 12638 --
NM_181868chr1232599 217 23 12143 12638 --
NM_181869chr1232684 302 108 12228 12723 --
NM_182485chr473691 3393 3379 3131 1050 942 717 13612 ----
NM_182493chr1654465 4211 3809 2165 1539 ------
NM_182643chr8--1567 1770 1736
NM_182646chr473691 3393 3379 3131 1050 942 717 13612 ----
NM_182691chr721424 1153 ----1210
NM_182692chr721424 1153 ----1210
NM_182763chr142508 746 210 57 2588 50 12230 --
NM_182765chr1032131 1800 533 --1281 1481
NM_182789chr52417 24 1210 --138
NM_182948chr142351 2091 397 91 --12608 --
NM_182975chr11978 ------
NM_182976chr1--1190 --1549
NM_183004chr1453386 3217 1395 774 520 11012 2975 206 --
NM_183323chr52417 24 1210 --138
NM_194247chr283719 2905 2756 1537 1490 405 399 207 23916 3670 33754 1719 445 1556
NM_194292chr131276 709 620 ----1154
NM_194314chr184320 3930 1651 1412 1184 875 124 103 --11390 --
NM_194434chr1874985 4807 4176 2180 2078 813 528 --14387 --
NM_194442chr13624 569 150 11177 11546 --
NM_197978chr92458 376 153 --1504
NM_198097chr71199 ------
NM_198128chr1832306 1781 124 21760 863 21539 941 --
NM_198181chr1532823 802 741 4209 179 151 121 --12510
NM_198212chr761840 1610 906 593 305 222 11959 ----
NM_198268chr154030 2859 2779 574 282 14167 12747 --
NM_198269chr154030 2859 2779 574 282 14167 12747 --
NM_198270chrX83436 2635 2412 2385 1229 970 236 187 11058 ----
NM_198273chr553114 2821 2511 2249 182 --22090 769 --
NM_198391chr2011003 ------
NM_198400chr152806 41 --2669 357 --
NM_198465chrX72879 2762 2001 604 280 147 90 12308 ----
NM_198468chr664572 3022 1463 1081 1003 875 44482 3824 3515 1211 ----
NM_198581chr255657 2143 1490 513 355 47331 2268 2233 85 --11877
NM_198793chr363300 2633 2547 1540 457 233 1337 23430 1637 --
NM_198880chr31108 ------
NM_199072chr722632 204 13007 12025 1374
NM_199168chr101307 ----11329
NM_199188chr1273838 3280 3037 1514 1260 720 627 ----12636
NM_199190chr1273838 3280 3037 1514 1260 720 627 ----12636
NM_199421chr1454938 4128 1973 1563 843 11439 24693 1007 --
NM_201999chr441028 1012 783 333 ----1770
NM_203342chr183042 2585 2479 1402 1301 1228 924 139 ------
NM_203343chr183042 2585 2479 1402 1301 1228 924 139 ------
NM_203350chr111085 ----11627
NM_203463chr243978 3887 574 75 --13577 --
NM_203504chr452057 1966 1916 1605 566 12558 ----
NM_203505chr452057 1966 1916 1605 566 12558 ----
NM_205768chr152038 1935 1799 517 394 11816 ----
NM_205860chr121001 936 ----11934
NM_206853chr663087 1393 1278 932 844 272 24083 833 13849 --
NM_206854chr644348 3724 2105 1533 35344 2094 762 25110 3538 --
NM_206855chr665313 4689 2498 692 198 59 36309 3918 1727 36075 4503 530 --
NM_206866chr2173192 2782 2555 2110 2019 969 423 12178 --1117
NM_206909chr876801 5870 5735 5371 1775 1065 149 22388 1547 27913 401 --
NM_207292chr363353 3283 3069 2889 1352 319 --12650 --
NM_207293chr363353 3283 3069 2889 1352 319 --12650 --
NM_207294chr363353 3283 3069 2889 1352 319 --12650 --
NM_207295chr363353 3283 3069 2889 1352 319 --12650 --
NM_207296chr363353 3283 3069 2889 1352 319 --12650 --
NM_207297chr353378 3308 3094 2914 344 --12675 --
NM_207303chr1084022 3411 2534 1638 1292 382 210 122 12590 11305 --
NM_207304chr1342408 1780 954 187 1250 11727 --
NM_207396chr1----31808 1332 1318 --
NM_207406chr435376 1465 726 --25921 750 --
NM_207647chr921867 58 22412 791 --11670
NM_212460chr761896 1733 1474 769 654 445 ------
NM_212543chr31685 ----1740
NM_213590chr1365054 4954 4749 3334 1991 1384 --32075 945 23 --