TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548ax
miRNA Sequence: AGAAGUAAUUGCGGUUUUGCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr16624 590 558 261 225 148 1578 ----
NM_000024chr55452 195 188 176 144 ------
NM_000038chr582071 1716 1628 1517 520 294 180 161 ------
NM_000051chr1153238 1136 1049 921 61 182 22956 2295 13540
NM_000052chrX133432 3348 3297 3257 3033 2678 2191 2184 1367 620 531 314 191 22878 2813 ----
NM_000059chr133885 832 186 1803 --2782 193
NM_000074chrX1943 ------
NM_000081chr171757 1543 1295 1149 717 615 498 11799 ----
NM_000084chrX136950 6680 5659 4951 4806 2443 2331 2254 1951 1161 671 448 271 54944 4614 2396 2292 1419 15919 --
NM_000090chr24698 210 159 107 --1112 --
NM_000091chr282884 2859 2662 2487 2456 2274 1856 72 --11039 --
NM_000092chr2104154 4093 3714 2930 1796 1722 1378 736 262 230 43368 2998 1287 508 23823 3130 --
NM_000093chr932267 943 411 --22230 948 --
NM_000094chr3------1130
NM_000097chr331065 399 222 1773 21075 469 --
NM_000104chr2123070 2924 2909 2664 2412 2059 2037 1138 908 765 611 96 32934 2874 2625 2619 270 --
NM_000108chr761678 1567 1183 764 508 405 ------
NM_000109chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_000110chr11996 1861 11112 --
NM_000112chr5115476 5392 4989 4698 4271 4198 3553 2072 1775 1471 1086 ------
NM_000125chr664186 3374 3360 2616 809 148 --33247 1595 1571 --
NM_000129chr62510 86 1152 ----
NM_000138chr1542484 2224 1017 263 1510 1374 --
NM_000151chr1741897 1766 1720 501 ------
NM_000161chr1451477 1373 776 751 188 21906 1839 1144 --
NM_000163chr582393 2282 2092 2059 1939 1883 521 440 12205 ----
NM_000165chr641452 1396 1089 414 ------
NM_000167chrX81841 1682 1471 1390 674 588 443 109 --21427 713 --
NM_000168chr7103302 2876 2783 2368 2317 2289 1316 1104 860 493 --22347 2218 11167
NM_000176chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_000179chr2182 ------
NM_000189chr282242 1967 1902 1587 1465 830 808 105 ----21539 349
NM_000192chr1231358 1210 477 1506 ----
NM_000194chrX2477 180 1144 ----
NM_000196chr161503 --1542 --
NM_000208chr1974660 4256 3840 3445 3249 3145 1873 --24533 4319 --
NM_000210chr272231 1867 1809 1722 838 821 438 22204 1535 --12064
NM_000214chr2051580 1414 681 477 353 --11137 --
NM_000217chr12125370 5318 4522 3898 3327 3313 2068 1757 1649 889 579 314 1104 45323 5173 5153 528 --
NM_000222chr441933 1740 1345 67 21823 502 ----
NM_000230chr74953 788 492 177 --11895 11077
NM_000233chr25889 778 701 655 104 ------
NM_000237chr831709 698 154 ------
NM_000245chr732201 1520 130 21407 1363 ----
NM_000248chr3102892 2469 1215 893 869 839 828 753 149 37 --32474 1993 818 --
NM_000251chr21175 ------
NM_000252chrX61283 1065 1044 576 400 338 11411 11388 --
NM_000255chr63139 107 40 --1323 1126
NM_000259chr15156037 5737 5466 5458 5212 5114 5031 4395 4337 2197 2173 954 866 319 154 21514 1423 162 --
NM_000264chr9102874 2639 2623 2435 2237 421 404 379 168 155 1881 33358 2417 2386 --
NM_000267chr1763473 3127 2192 1037 759 212 12225 ----
NM_000276chrX52220 2169 1955 781 181 158 ----
NM_000278chr1012025 ------
NM_000280chr112994 259 ------
NM_000288chr6--1329 ----
NM_000289chr122344 301 --1306 --
NM_000297chr451835 1342 653 381 147 --22058 1626 --
NM_000314chr1072712 2623 2511 2342 2269 1265 992 11031 --22437 2432
NM_000315chr112344 103 ------
NM_000317chr112338 276 ------
NM_000318chr862726 2131 1065 842 359 294 ------
NM_000319chr1221174 948 ------
NM_000321chr13131717 1709 1603 1503 1460 1418 1331 1111 719 617 568 343 193 11696 11161 --
NM_000325chr41214 --1643 1676
NM_000328chrX2294 161 --1321 --
NM_000329chr12210 175 1798 1588 --
NM_000330chrX62235 2098 1647 1442 367 98 ------
NM_000332chr6185763 5751 5740 5468 5381 5225 4840 4442 4346 2786 2765 2420 2378 2132 2067 1869 1235 659 34499 2702 1946 24759 2599 37091 5665 1845
NM_000337chr5125811 5320 5162 4873 4522 4473 2329 1847 1835 1447 1254 1055 26239 5027 34137 1704 1471 11715
NM_000338chr15--169 3936 807 364 --
NM_000340chr351489 1410 519 228 110 --1532 --
NM_000345chr44982 890 863 180 --1294 --
NM_000346chr17111826 1713 1680 1576 1286 758 697 606 525 385 113 ------
NM_000354chrX1241 ------
NM_000362chr2263555 3378 2616 2492 1122 963 22469 1261 23657 366 22791 2409
NM_000368chr954844 4425 3124 747 732 --1281 --
NM_000382chr171406 21905 1889 --11650
NM_000388chr31802 11253 ----
NM_000389chr64326 236 179 101 ------
NM_000390chrX113318 3061 2844 2590 2077 982 627 517 410 399 332 23406 3365 ----
NM_000391chr1151653 545 484 442 429 21342 327 ----
NM_000393chr282132 1641 1407 1366 815 415 337 174 11604 1668 1317
NM_000399chr1041202 962 794 337 ------
NM_000408chr2103397 3262 3110 2813 2716 2631 2575 1330 1116 168 22700 179 23118 1356 32462 2149 814
NM_000415chr122948 746 ------
NM_000426chr6------1212
NM_000428chr1452431 2346 2294 863 191 22518 224 ----
NM_000430chr1743460 1489 1277 773 --13250 1693
NM_000435chr195860 405 341 335 186 ------
NM_000437chr152095 2038 2025 1427 155 1365 1544 --
NM_000439chr542270 1719 579 39 1207 12008 --
NM_000441chr781591 1475 755 532 494 147 135 69 ------
NM_000446chr711048 --11091 146
NM_000448chr11123252 3235 3167 3066 3034 2980 2848 2372 2136 809 777 181 33130 926 440 21052 816 --
NM_000452chr1332101 494 67 21605 1415 ----
NM_000461chr353681 3066 3041 1770 105 ----13848
NM_000462chr1571819 1569 520 465 339 316 249 --11223 --
NM_000474chr71583 ------
NM_000478chr12756 298 ------
NM_000480chr1171405 1322 536 464 353 267 184 ------
NM_000484chr213812 429 303 2403 370 --149
NM_000489chrX103349 2755 2302 2225 1321 1259 1014 719 443 53 33265 853 235 22278 139 13270
NM_000492chr741251 1134 1084 402 21012 229 ----
NM_000493chr641020 924 750 109 ------
NM_000495chrX4937 444 382 202 --21090 236 --
NM_000503chr841893 1725 636 480 21624 176 1436 --
NM_000508chr41620 --1869 --
NM_000510chr1121213 1202 11122 ----
NM_000522chr721237 57 ----11130
NM_000523chr221101 201 11147 11064 1373
NM_000527chr1932342 2239 871 11881 ----
NM_000531chrX------1275
NM_000533chrX51376 1325 653 346 115 ----1208
NM_000536chr112416 94 ------
NM_000538chr1341845 1516 1288 1179 --1297 --
NM_000551chr361883 1857 1749 1569 1377 134 --1257 --
NM_000553chr83621 425 246 --165 --
NM_000555chrX187810 7358 6303 6149 5921 5651 5644 5094 2751 2697 2304 2209 2017 1505 160 127 110 64 47532 1714 1303 976 35733 2415 1533 --
NM_000572chr13807 234 166 ------
NM_000575chr22412 182 ------
NM_000585chr4------1216
NM_000586chr42190 47 ------
NM_000588chr53315 287 254 ------
NM_000589chr5135 ------
NM_000590chr52135 111 ------
NM_000594chr63789 514 486 ------
NM_000595chr61388 ------
NM_000596chr73176 157 116 ------
NM_000598chr751574 1550 1408 103 44 ------
NM_000600chr71135 ------
NM_000601chr71382 ------
NM_000602chr751494 1400 1322 411 299 ------
NM_000609chr1063094 2897 2253 2126 2075 182 ------
NM_000610chr1192481 2173 2157 2145 1847 683 517 440 194 22618 1062 22920 632 --
NM_000611chr11126931 5470 5066 4954 4851 2674 1917 1438 801 695 324 252 ----17079
NM_000615chr1192888 986 968 844 791 599 473 464 420 ------
NM_000618chr12116356 5901 5190 4913 4750 4303 2479 814 649 630 420 15274 12641 24426 2259
NM_000618chr12116356 5901 5190 4913 4750 4303 2479 814 649 630 420 15274 12641 24426 2259
NM_000619chr123483 165 66 ------
NM_000625chr172365 159 --1127 1474
NM_000627chr22318 269 1601 ----
NM_000633chr1895068 5034 4959 4934 3699 1793 1514 259 229 15128 ----
NM_000637chr83156 104 97 1423 ----
NM_000665chr7------165
NM_000676chr171355 ------
NM_000684chr1071245 1177 1056 981 505 496 66 ------
NM_000685chr33600 323 97 --1331 1866
NM_000685chr33600 323 97 --1331 1866
NM_000686chrX61500 1268 621 492 63 42 ------
NM_000693chr1541615 1270 1248 333 ------
NM_000719chr1286691 6244 2031 1899 1348 895 781 33 ----11515
NM_000724chr1071841 1504 792 675 450 176 139 --21355 578 --
NM_000726chr221025 509 1997 21333 1059 --
NM_000773chr101151 ------
NM_000788chr441518 1360 1254 509 21435 44 31406 552 225 --
NM_000793chr1455030 4024 3218 1855 155 24709 78 21324 974 12057
NM_000800chr531625 1372 356 11313 2210 137 --
NM_000801chr202406 256 --1168 --
NM_000806chr561544 595 502 349 121 50 21861 1384 --1708
NM_000807chr42717 685 ------
NM_000808chrX2822 179 189 ----
NM_000809chr4329057 9035 8933 8914 8646 8371 8003 7776 6885 6770 6533 6454 6399 6047 5702 3651 3531 3463 3170 3146 3135 2927 2565 2522 2210 2062 1537 1457 874 793 698 201 17793 129081 9076 8791 8452 7943 7472 7076 6870 6827 6018 2832 2578 56502 3537 3519 2440 1969
NM_000812chr44381 334 162 33 ------
NM_000813chr5135543 5233 4958 4943 4900 4139 3711 1745 1660 1563 708 597 447 34724 1307 1123 43516 1185 1102 163 --
NM_000814chr15104152 4120 3663 3631 3296 2839 2710 2664 1518 1115 33994 1643 1218 22691 1200 1515
NM_000816chr52638 186 2568 550 ----
NM_000817chr23965 774 143 ------
NM_000820chr131248 ------
NM_000824chr42937 222 1376 ----
NM_000826chr472563 2440 2414 1703 1616 883 813 22158 1714 21641 603 --
NM_000827chr562525 2471 1976 1696 821 337 12130 1435 --
NM_000828chrX51924 1403 586 553 227 22065 60 --11967
NM_000829chr1152095 2014 1921 896 587 --21926 556 --
NM_000838chr662380 2199 2122 2005 1934 720 22130 765 21817 1089 --
NM_000839chr34494 463 376 337 ------
NM_000840chr71133 ------
NM_000844chr351113 991 813 351 48 ----1181
NM_000859chr541718 1559 1378 1143 21399 514 ----
NM_000861chr332584 2181 1810 --31945 1815 643 --
NM_000866chr331223 521 410 11666 ----
NM_000868chrX52509 1754 1047 246 217 3902 390 145 1839 --
NM_000872chr1061591 1526 1295 1264 569 318 1984 11386 --
NM_000875chr15106343 6315 6252 5051 2635 2461 1738 1420 952 781 36023 1667 347 32251 2116 764 --
NM_000877chr283084 2901 2418 2168 2133 1983 838 425 ------
NM_000879chr53323 243 233 1133 ----
NM_000880chr84892 301 212 91 1323 1897 --
NM_000882chr34398 375 327 313 ------
NM_000885chr231909 669 521 11770 21902 656 12139
NM_000891chr1773686 3596 3333 3304 2665 937 319 --63695 3264 3224 2981 2946 2377 22671 33
NM_000899chr12104318 3918 3824 3678 3375 3115 2821 1375 1077 1044 14394 128 163
NM_000901chr482398 2321 2233 2175 1846 1771 992 606 ----12576
NM_000908chr54794 718 701 669 ------
NM_000910chr451764 1250 274 265 210 --11501 11280
NM_000917chr102624 155 1324 1160 --
NM_000919chr52574 132 --1137 --
NM_000921chr121530 ------
NM_000922chr115420 392 316 278 250 1362 11097 --
NM_000925chr3135 ------
NM_000926chr11199259 9041 9015 8875 8794 8758 8596 8157 7009 6170 5852 3698 3547 3289 1446 1353 1210 416 162 11522 62243 1604 1569 1439 1418 385 38580 6192 284
NM_000933chr2031549 669 79 ------
NM_000935chr381005 886 809 507 373 346 172 33 --2950 243 --
NM_000937chr171393 ------
NM_000938chr41112 ------
NM_000944chr452311 2210 2175 1691 116 ------
NM_000945chr281867 1859 786 656 626 582 278 35 21783 774 21915 452 1459
NM_000949chr5--1877 1211 --
NM_000950chrX113545 3374 3179 2717 2588 2473 1449 1164 609 137 95 22878 2521 11212 13444
NM_000956chr1451022 954 777 767 347 11067 ----
NM_000957chr1----2509 195 --
NM_000958chr541328 1258 1065 871 --1996 --
NM_000959chr1183985 3080 2978 2687 2470 1549 1537 1459 1424 1318 1298 1193 902 702 433 369 315 272 164 22792 2501 11448
NM_000962chr9102950 2858 2824 2674 2369 2340 2246 2016 924 363 --12043 --
NM_000963chr1152504 2089 1774 1752 1703 1640 1515 684 516 431 422 261 91 58 23 ------
NM_000964chr171521 ------
NM_000990chr1143942 3192 1486 39 ------
NM_001001132chr212339 214 --1967 --
NM_001001323chr1283178 3157 2911 2647 2458 756 709 429 ----11207
NM_001001330chr1051299 809 496 484 100 --41136 168 153 128 --
NM_001001331chr351814 1724 957 774 640 ------
NM_001001389chr1192481 2173 2157 2145 1847 683 517 440 194 22618 1062 22920 632 --
NM_001001390chr1192481 2173 2157 2145 1847 683 517 440 194 22618 1062 22920 632 --
NM_001001391chr1192481 2173 2157 2145 1847 683 517 440 194 22618 1062 22920 632 --
NM_001001392chr1192527 2219 2203 2191 1893 729 563 486 240 22664 1108 22966 678 --
NM_001001394chr22679 532 ------
NM_001001395chr1292773 2186 2109 1958 1803 809 787 278 238 11857 32330 1095 365 1881
NM_001001396chr164290 3678 3305 2710 1047 323 --13253 --
NM_001001419chr5215133 5080 5064 4931 4613 4470 3688 3677 3661 3651 3610 2058 2051 1890 1843 1156 846 519 418 314 111 25121 5009 24400 1020 45236 3740 746 283
NM_001001420chr5215133 5080 5064 4931 4613 4470 3688 3677 3661 3651 3610 2058 2051 1890 1843 1156 846 519 418 314 111 25121 5009 24400 1020 45236 3740 746 283
NM_001001433chr2042978 2969 1990 889 ------
NM_001001436chr166856 789 702 609 578 569 --1869 --
NM_001001481chr8173361 3337 2964 2787 2709 2543 1277 1207 1170 1070 1025 944 848 784 268 262 122 1937 12780 1487
NM_001001484chr102245 210 --2851 355 --
NM_001001485chr31183 --1377 --
NM_001001486chr31125 --1319 --
NM_001001487chr31125 --1319 --
NM_001001549chr732303 2074 1149 22051 917 1376 12763
NM_001001550chr732303 2074 1149 22051 917 1376 12763
NM_001001555chr732303 2074 1149 22051 917 1376 12763
NM_001001556chr1531574 1554 1273 1165 11378 --
NM_001001567chr211178 ------
NM_001001568chr211178 ------
NM_001001571chr211178 ------
NM_001001572chr211178 ------
NM_001001573chr211178 ------
NM_001001574chr211178 ------
NM_001001575chr211178 ------
NM_001001576chr211178 ------
NM_001001577chr211178 ------
NM_001001579chr211178 ------
NM_001001580chr211178 ------
NM_001001581chr211178 ------
NM_001001582chr211178 ------
NM_001001584chr211178 ------
NM_001001585chr211178 ------
NM_001001664chr2103961 3257 2980 1606 1485 892 552 368 137 101 43675 3070 538 250 23089 2588 --
NM_001001668chr19134006 3518 3427 3353 2811 2716 1218 1153 977 757 622 198 21 13907 1127 --
NM_001001709chr942720 2651 925 575 ------
NM_001001852chr22--1924 ----
NM_001001890chr21164017 3795 3683 3660 3652 3642 3269 3253 1713 1474 816 644 599 547 486 334 12748 1589 --
NM_001001928chr22167973 6624 6532 6074 5961 5733 3011 2864 2136 1773 1440 1247 1191 785 298 177 --57418 6322 6278 5145 2433 36108 1410 500
NM_001001933chr13472 434 96 ------
NM_001001936chr102861 296 --11136 --
NM_001001938chr973367 3332 3132 3115 3086 2754 354 --64127 4057 3071 2896 1210 487 1859
NM_001001971chr1091317 1119 1054 1030 992 880 464 338 54 11201 --21218 998
NM_001001974chr1062189 2181 1522 865 720 559 12041 22247 781 --
NM_001001994chrX2451 198 ------
NM_001001995chrX21871 254 11432 11655 --
NM_001001996chrX2451 198 ------
NM_001002006chr25876 626 573 311 183 188 1115 1891
NM_001002026chr3102481 1891 873 850 729 426 369 244 202 89 ------
NM_001002033chr172540 322 1808 --1829
NM_001002233chr872193 2111 1811 1658 1571 1474 459 --11723 --
NM_001002255chr61347 ------
NM_001002257chr273336 2680 2310 886 825 119 101 --22219 1389 --
NM_001002269chr91420 ------
NM_001002295chr101768 ----1730
NM_001002759chr102634 528 ------
NM_001002811chr131351 1326 163 1271 31615 1219 320 11557
NM_001002812chr131351 1326 163 1271 31615 1219 320 11557
NM_001002812chr131351 1326 163 1271 31615 1219 320 11557
NM_001002838chrX71879 1854 1668 1638 1224 426 46 ----1119
NM_001002843chr1541171 1147 486 428 11182 11192 --
NM_001002860chr14124638 4539 4474 4097 3718 3661 2874 1596 1288 471 383 312 14317 63835 3814 3363 3224 1609 269 --
NM_001003652chr18238560 8419 7739 7189 7144 6637 6601 6463 6193 5996 5820 3140 2907 2889 2462 2180 1870 1640 1316 976 512 462 397 53254 2197 1927 1396 1072 57663 7641 2708 2331 1000 --
NM_001003665chr12960 142 ------
NM_001003674chr18146979 6156 5444 5367 5320 5189 4980 4616 2706 1951 1051 882 469 222 14513 46865 6556 4347 2512 --
NM_001003675chr18146979 6156 5444 5367 5320 5189 4980 4616 2706 1951 1051 882 469 222 14513 46865 6556 4347 2512 --
NM_001003678chr11193 ------
NM_001003681chr2242049 1606 363 175 --11364 --
NM_001003688chr431228 1167 1115 --11233 --
NM_001003694chr3------1618
NM_001003696chr211129 ------
NM_001003697chr211129 ------
NM_001003698chr631917 1454 350 2558 58 ----
NM_001003699chr631917 1454 350 2558 58 ----
NM_001003701chr211129 ------
NM_001003703chr211129 ------
NM_001003712chr1273495 3364 2664 2644 905 797 605 12652 23468 2890 1974
NM_001003760chr6193637 3581 3542 3511 3351 3341 3143 2881 2856 2798 2634 2607 2598 1371 1008 698 455 401 40 22271 513 12888 1243
NM_001003792chr361261 995 478 436 349 208 ------
NM_001003793chr361261 995 478 436 349 208 ------
NM_001003800chr963535 3468 3141 2912 1171 1050 141 ----
NM_001003810chr44721 638 582 195 1227 1210 --
NM_001004065chr983978 3808 3469 3446 3012 2771 572 422 22638 1578 ----
NM_001004128chr12681 494 ------
NM_001004303chr13765 717 283 2229 217 --2676 527
NM_001004303chr13765 717 283 2229 217 --2676 527
NM_001004317chr6114516 4163 3824 3739 3538 3514 1636 1435 961 938 372 3742 513 77 ----
NM_001004329chr1231516 1455 1061 11418 ----
NM_001004346chr46938 455 239 178 110 48 --194 --
NM_001004356chr411519 ------
NM_001004358chr411519 ------
NM_001004419chr1264409 4325 3944 3300 2817 1630 --24613 156 11475
NM_001004441chr531478 1458 234 --11079 11281
NM_001004720chr21864 ------
NM_001004722chr211033 ------
NM_001005217chr451111 890 838 452 59 21080 226 1829 --
NM_001005242chr1241504 1303 1086 115 --2529 409 --
NM_001005335chr19178 ------
NM_001005375chrY1270 2509 33 ----
NM_001005386chr272284 909 771 667 657 616 202 12479 ----
NM_001005404chr1774490 3836 3761 3215 3140 3126 190 --24386 4120 --
NM_001005407chr161768 ------
NM_001005463chr1062631 2365 1992 1858 190 154 11769 21647 1044 --
NM_001005473chr5166625 5869 5322 5297 5284 4732 4205 2613 2597 2280 2266 1625 636 322 304 220 36524 1558 191 45840 5183 4904 1472 26406 4414
NM_001005474chr331334 1307 531 1204 ----
NM_001005527chr351254 947 533 175 59 11237 2976 830 1189
NM_001005609chrX63225 3024 2936 2415 746 132 ----11461
NM_001005739chr24859 816 734 602 1335 ----
NM_001005746chr221025 509 1997 21333 1059 --
NM_001005747chr221025 509 1997 21333 1059 --
NM_001005781chr22245 238 ------
NM_001005782chr24785 694 687 45 ----1362
NM_001005785chrY1270 2509 33 ----
NM_001005786chrY1270 2509 33 ----
NM_001005845chr821904 438 1111 ----
NM_001005861chr34833 777 632 365 --1264 1375
NM_001005914chr31166 ------
NM_001006600chr582097 1655 1546 926 565 442 401 291 12148 ----
NM_001006605chr141174 959 889 861 --1469 11165
NM_001006605chr141174 959 889 861 --1469 11165
NM_001006618chr91209 --1277 --
NM_001006623chr262250 2243 246 158 151 137 --1946 --
NM_001006636chr21883 ------
NM_001006641chr921590 1087 --11444 11471
NM_001006642chr921590 1087 --11444 11471
NM_001006643chr921590 1087 --11444 11471
NM_001006657chr252532 2344 959 755 118 22115 947 32655 898 84 --
NM_001006658chr15704 563 528 474 33 ------
NM_001006684chrX3435 424 397 --186 --
NM_001006945chr14751 638 529 253 151 ----
NM_001007023chr1455030 4024 3218 1855 155 24709 78 21324 974 12057
NM_001007024chr1794305 4214 3842 3796 3433 3402 3243 2975 246 ------
NM_001007025chr1794305 4214 3842 3796 3433 3402 3243 2975 246 ------
NM_001007026chr12------1336
NM_001007075chr43943 431 344 --2910 389 --
NM_001007097chr995035 3921 3629 1941 1707 1484 884 320 263 11762 33845 611 376 14123
NM_001007098chr11806 1881 ----
NM_001007099chr14689 588 328 21 --1827 --
NM_001007100chr14689 588 328 21 --1827 --
NM_001007102chr681563 1439 1330 1308 1193 388 298 129 --1653 --
NM_001007156chr1551971 670 623 617 331 --11492 --
NM_001007189chr53157 113 48 ------
NM_001007214chr13743 342 162 11548 ----
NM_001007237chr122375 1860 12151 1530 22109 648
NM_001007245chr72237 127 152 1645 --
NM_001007246chr2121438 666 21247 352 ----
NM_001007257chr141244 1133 524 181 --11253 --
NM_001007277chr11158 2959 952 ----
NM_001007466chr6125204 5159 5121 5020 4730 4685 4543 3967 3260 1894 1696 266 23937 3321 34965 4497 1070 --
NM_001007467chr22------198
NM_001007468chr221245 ------
NM_001007538chr1361891 1648 1633 1479 1296 1166 --31432 1179 347 --
NM_001007559chr1852091 2044 1792 1326 355 --1773 1435
NM_001007793chr101195 --2277 45 --
NM_001007794chr12732 650 --1758 --
NM_001008222chrX11312 11275 ----
NM_001008225chr74306 240 169 85 ------
NM_001008239chr1863632 3368 3017 548 363 261 12725 33702 3385 3082 12974
NM_001008388chr42352 101 --188 --
NM_001008391chr113681 151 108 --1198 1275
NM_001008392chr393497 2637 2381 2352 1366 747 453 417 230 --22817 761 --
NM_001008393chr482922 2380 2229 2077 1041 993 322 47 1213 42543 945 898 789 1738
NM_001008401chr1921419 1291 --31509 1502 1281 --
NM_001008405chr751339 1312 580 553 494 --165 11865
NM_001008408chr7125513 5431 5275 4953 4885 4875 4816 4441 1849 1836 1171 603 24373 911 25767 1454 21966 214
NM_001008491chr262022 1949 1751 1647 509 185 21847 201 1502 --
NM_001008492chr262022 1949 1751 1647 509 185 21847 201 1502 --
NM_001008495chr892032 1945 1849 1812 1601 690 653 425 326 --2308 268 --
NM_001008528chr1711253 --1167 11229
NM_001008539chr8115308 4389 4248 3885 3489 1630 1600 1452 1349 1034 659 --21616 1569 --
NM_001008541chr1062134 2019 1714 1587 1505 544 11479 11963 1897
NM_001008541chr1062134 2019 1714 1587 1505 544 11479 11963 1897
NM_001008564chr1362279 2116 1961 1950 1927 1850 ------
NM_001008660chr112550 316 1384 164 --
NM_001008708chr24111 99 76 63 1469 ----
NM_001008711chr851749 1491 676 321 31 ------
NM_001008738chr5112849 2805 2662 2356 2185 2106 1973 1127 934 681 439 22462 774 1480 --
NM_001008779chr22312 275 ------
NM_001008783chr65686 661 648 175 41 1254 1275 --
NM_001008860chr152757 309 --1149 --
NM_001008892chr152757 309 --1149 --
NM_001008894chr152757 309 --1149 --
NM_001008895chr1331055 931 560 11080 11434 --
NM_001008897chr61136 1173 ----
NM_001008925chr493331 3280 2985 2976 2312 1407 1228 1143 496 --23228 925 32592 2439 1269
NM_001009185chr51184 --1581 --
NM_001009552chr82545 421 ------
NM_001009554chr4144454 4448 4249 4156 3970 3620 3573 1574 1448 1407 668 643 449 363 24558 1442 1927 --
NM_001009554chr4144454 4448 4249 4156 3970 3620 3573 1574 1448 1407 668 643 449 363 24558 1442 1927 --
NM_001009555chr441460 1413 654 352 ----1369
NM_001009571chr761195 1183 547 374 120 55 ------
NM_001009814chr131165 --192 --
NM_001009881chr13623 212 177 ----1401
NM_001009882chr13623 212 177 ----1401
NM_001009894chr122622 588 ------
NM_001009899chr3196526 6498 6380 6124 5692 4251 4132 3995 2476 1503 1118 991 968 887 701 671 256 222 215 45574 4677 1149 1069 35509 4082 1760 1981
NM_001009909chr11133830 3700 3630 3260 3247 3143 2903 2887 2465 1551 533 513 315 ----12909
NM_001009923chr202742 576 ------
NM_001009955chr1--1241 ----
NM_001009955chr1--1241 ----
NM_001009958chr71245 ----1534
NM_001009960chr792835 2426 995 967 859 805 775 671 505 12084 22581 812 --
NM_001009993chr2104335 3946 3731 1823 1795 1778 1195 1121 948 879 ------
NM_001009994chr6190 ------
NM_001010000chr1852883 1413 988 670 116 43185 3128 870 291 ----
NM_001010844chr6153 ------
NM_001010853chr6123114 2749 2599 2298 2159 2078 1997 1090 1042 922 893 872 13128 1915 11048
NM_001010861chr182502 1789 1076 1024 697 631 470 390 32403 992 588 32156 973 494 1527
NM_001010862chrX73298 2238 2107 1098 257 113 68 --1586 12411
NM_001010887chr911860 ------
NM_001010888chrX104650 4530 4343 4202 4114 4011 3795 1658 1174 416 24573 868 12905 13417
NM_001010891chr5196421 6134 5759 5603 5064 4626 4333 2391 2329 2284 2262 1397 1189 1169 1147 1130 1006 709 356 25796 2457 46502 4315 1529 444 1497
NM_001010895chr931776 1294 686 21838 729 1135 --
NM_001010908chr10----1310 --
NM_001010923chr661565 1501 1362 1288 1102 257 1330 21617 287 11230
NM_001010927chr66563 549 414 389 214 158 1450 143 --
NM_001010932chr71382 ------
NM_001010934chr74962 383 265 129 --11131 --
NM_001010942chr1271279 1163 1070 1052 853 339 202 1323 ----
NM_001010984chr1112317 2251 2073 2064 2014 994 955 782 582 539 202 1487 ----
NM_001010986chrX52448 894 871 626 349 ------
NM_001010989chr161490 1421 --1514
NM_001010990chr161490 1421 --1514
NM_001011513chr464051 2955 2605 831 820 517 11024 63587 3117 3026 3004 2736 205 --
NM_001011515chr46855 784 693 386 302 123 --2419 51 --
NM_001011516chr46855 784 693 386 302 123 --2419 51 --
NM_001011537chr382305 1801 1503 538 307 127 121 52 ----21516 90
NM_001011546chr20--1570 2826 340 --
NM_001011551chrX157 --1432 --
NM_001011663chr105927 843 804 709 670 --3753 692 287 1857
NM_001011666chr7145445 5401 4707 4279 4227 4083 2550 1651 1570 1498 1138 810 673 256 55239 4818 2433 1625 1325 34321 2067 1505 1768
NM_001011705chr135277 255 246 239 232 ------
NM_001011708chr262930 2854 2733 210 135 129 22903 281 1946 1856
NM_001011713chr14101546 1434 1339 1301 1156 1114 1028 454 287 77 21622 1048 ----
NM_001011720chr851010 564 379 151 90 11062 1573 --
NM_001011724chr131202 ------
NM_001011725chr131202 ------
NM_001011885chr1521649 354 11457 --11182
NM_001012267chr9----11493 --
NM_001012279chr62210 48 2233 200 1132 --
NM_001012393chr11145027 4678 4351 4197 4079 3375 1720 1346 788 457 289 155 143 36 --1162 --
NM_001012398chr161892 --1187 --
NM_001012410chr31485 ------
NM_001012418chr6144287 4225 4202 3910 3657 3628 3413 3254 3204 2823 2585 1641 427 52 --33686 3180 285 13389
NM_001012420chr1562807 2382 2038 503 211 119 --1825 189
NM_001012423chr1572807 2382 2038 503 211 149 119 --2825 88 --
NM_001012425chr11134 ------
NM_001012614chr43766 493 297 ------
NM_001012751chr1061795 1582 1323 725 505 235 11511 11464 --
NM_001012754chr1381992 1945 1848 1639 622 268 182 90 22044 24 21951 1854 --
NM_001012755chrX124906 4772 4650 4443 4336 4183 4002 3607 3226 1793 522 332 14451 21876 70 --
NM_001012761chr552355 2331 2193 275 29 12697 22313 603 --
NM_001012968chrX112742 2542 2359 2298 1838 870 717 672 185 177 51 --32094 1933 660 21907 1725
NM_001012969chr152310 118 ------
NM_001012989chrX3491 129 64 ------
NM_001013031chr1073279 3199 3143 3025 2987 1332 1175 --13545 --
NM_001013398chr751574 1550 1408 103 44 ------
NM_001013399chr62283 133 ------
NM_001013406chr741512 1411 1181 589 1667 31725 385 83 11739
NM_001013415chr461582 1455 1438 1080 1027 305 --2621 298 --
NM_001013437chr181295 ------
NM_001013438chr33768 327 48 --1956 --
NM_001013439chr33614 269 173 --1802 --
NM_001013615chr13996 911 386 1327 31144 1013 931 --
NM_001013620chr12258478 8414 8379 8299 7926 7185 7019 6707 6532 6265 5486 5432 5317 5310 5194 5139 3330 3303 2708 2579 2224 2177 2144 1599 1187 48258 7574 325 200 77222 5656 5341 2358 2334 2155 429 11676
NM_001013659chr19115407 4958 3299 2058 2014 1635 1392 1261 937 793 405 ----11612
NM_001013699chr122227 49 ------
NM_001014286chr132300 72 ------
NM_001014431chr141986 --186 1217
NM_001014432chr141986 --186 1217
NM_001014434chr16764 685 677 311 78 70 --2818 316 --
NM_001014449chr161195 ------
NM_001014451chr161195 ------
NM_001014797chr10177601 7442 7412 7373 7307 7029 6766 5599 3183 3043 1831 1223 995 981 727 390 384 --1298 11114
NM_001015048chr1473018 2875 2768 2743 1262 722 50 197 13202 --
NM_001015049chr1473018 2875 2768 2743 1262 722 50 197 13202 --
NM_001015877chrX93045 2891 2613 2357 1019 983 955 920 299 --22666 927 12712
NM_001015880chr1031714 623 327 --31686 1279 86 11303
NM_001015882chr931006 64 47 ----11099
NM_001015887chr391758 1694 1506 1426 1323 725 608 383 145 --31725 1253 199 11685
NM_001017369chr42967 423 1168 2999 71 --
NM_001017371chr251162 524 489 210 34 11284 21082 151 --
NM_001017395chr362950 2842 2260 1307 892 809 13059 12657 --
NM_001017405chr45965 895 693 244 231 --1686 --
NM_001017420chr861458 1421 1392 1259 972 952 11125 11375 --
NM_001017424chr151781 1721 1508 1225 752 --11610 --
NM_001017425chr151781 1721 1508 1225 752 --11610 --
NM_001017440chr7168247 7067 6270 5308 5179 5076 2784 2313 2144 1513 1483 1455 1434 1275 1080 904 --17056 1271
NM_001017523chr1231418 550 24 1403 1620 --
NM_001017923chr14131704 1574 1402 1368 1108 620 589 430 323 270 209 198 67 --1610 --
NM_001017926chr861795 1354 1235 707 683 512 ------
NM_001017962chr102624 155 1324 1160 --
NM_001017963chr143687 222 82 1124 ----
NM_001017969chr93666 552 413 ------
NM_001017992chr571529 1515 1422 1293 1284 1242 1071 11042 1457 11551
NM_001017995chr551858 1795 1729 1417 234 24798 3171 13620 --
NM_001017999chr162345 2213 2102 2050 804 296 --11707 --
NM_001017999chr162345 2213 2102 2050 804 296 --11707 --
NM_001018000chr162345 2213 2102 2050 804 296 --11707 --
NM_001018000chr162345 2213 2102 2050 804 296 --11707 --
NM_001018001chr162345 2213 2102 2050 804 296 --11707 --
NM_001018004chr15185 --190 --
NM_001018006chr15185 --190 --
NM_001018007chr15185 --190 --
NM_001018020chr15185 --190 --
NM_001018037chr951370 977 533 398 267 ----1414
NM_001018053chr161997 1967 1852 1597 696 153 --21246 384 --
NM_001018054chr131295 562 498 --11226 --
NM_001018056chr91403 1196 1166 --
NM_001018064chr961967 1937 1774 1676 542 164 2477 291 --11893
NM_001018065chr994976 4213 3896 2258 1558 1384 1363 861 414 --75851 5585 4793 4638 4569 1580 1184 --
NM_001018066chr994976 4213 3896 2258 1558 1384 1363 861 414 --75851 5585 4793 4638 4569 1580 1184 --
NM_001018067chr1105391 5054 4779 4386 3469 3313 2145 1538 1202 274 24475 4323 55167 4691 1571 1119 735 --
NM_001018068chr1105391 5054 4779 4386 3469 3313 2145 1538 1202 274 24475 4323 55167 4691 1571 1119 735 --
NM_001018069chr1105391 5054 4779 4386 3469 3313 2145 1538 1202 274 24475 4323 55167 4691 1571 1119 735 --
NM_001018072chr1231418 550 24 1403 1620 --
NM_001018074chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_001018075chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_001018076chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_001018077chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_001018080chr1121213 1202 11122 ----
NM_001018100chr152809 307 ------
NM_001018837chr11167 ------
NM_001020658chr131679 1547 1215 1319 ----
NM_001020658chr131679 1547 1215 1319 ----
NM_001020825chr541303 1122 1006 960 --2929 244 --
NM_001023567chr1542378 1546 149 119 --2828 506 189
NM_001023587chr331142 991 953 11097 1335 1121
NM_001024094chr593828 3647 3531 3485 1467 1341 686 353 98 1796 23454 2769 --
NM_001024218chr144861 647 618 244 1136 ----
NM_001024226chr131198 988 168 ------
NM_001024227chr131198 988 168 ------
NM_001024228chr131198 988 168 ------
NM_001024380chr821615 104 ------
NM_001024381chr821615 104 ------
NM_001024647chr12197717 6811 6610 6536 6169 5979 4832 4794 2921 2282 2149 1147 1028 575 504 491 450 174 70 37209 6832 6468 25635 82 --
NM_001024649chr572656 2632 2043 1988 1801 1099 892 12677 1526 --
NM_001024660chr331361 1242 581 --21520 1035 --
NM_001024807chr192246 233 ------
NM_001024808chr1232808 2358 2203 --12012 --
NM_001024809chr171521 ------
NM_001024847chr352433 1855 1563 577 92 --2999 686 --
NM_001024912chr1961851 1823 1708 1641 604 29 1172 ----
NM_001024916chr9176 2108 65 --185
NM_001024947chr52926 244 ------
NM_001024948chr1103097 3026 2864 2724 2558 2441 2151 782 728 229 --23274 963 1342
NM_001024956chr11105300 4781 4501 3677 2281 1402 989 752 739 55 35795 2012 1287 45850 3549 1619 1525 --
NM_001025068chr381690 1633 651 630 544 475 381 265 ----2667 441
NM_001025069chr381690 1633 651 630 544 475 381 265 ----2667 441
NM_001025072chr372845 2385 2191 1088 635 579 190 --32060 1071 566 --
NM_001025073chr372845 2385 2191 1088 635 579 190 --32060 1071 566 --
NM_001025076chr10206137 5469 5372 4597 4525 4477 4161 3878 3793 2470 1920 1657 1648 1568 1105 913 866 791 460 338 --44530 3917 1667 1285 --
NM_001025077chr10297495 6827 6730 5955 5883 5835 5519 5236 5151 4999 4949 4781 3015 3006 2926 2463 2271 2224 2149 1818 1696 1077 905 842 660 587 305 200 128 --45888 5275 3025 2643 --
NM_001025079chr3154077 4006 3920 3913 3627 3309 3276 3259 3057 3005 2915 1226 745 677 250 22610 1622 21564 750 --
NM_001025108chr273864 3233 2894 2689 2656 1494 525 --1495 --
NM_001025201chr21541 --2738 87 1584
NM_001025233chr1252384 1901 1032 771 406 12257 ----
NM_001025248chr1541256 1057 382 368 1816 1142 171
NM_001025249chr1541256 1057 382 368 1816 1142 171
NM_001025252chr893007 2927 1260 1108 731 666 367 217 107 ------
NM_001025253chr893007 2927 1260 1108 731 666 367 217 107 ------
NM_001025266chr3114210 3666 3652 3290 3192 1952 1484 1389 1339 1316 832 11095 44018 3705 546 221 --
NM_001025366chr651844 1739 1370 1236 271 --1319 --
NM_001025366chr651844 1739 1370 1236 271 --1319 --
NM_001025367chr651844 1739 1370 1236 271 --1319 --
NM_001025367chr651844 1739 1370 1236 271 --1319 --
NM_001025368chr651844 1739 1370 1236 271 --1319 --
NM_001025368chr651844 1739 1370 1236 271 --1319 --
NM_001025369chr651860 1755 1386 1252 287 --1335 --
NM_001025369chr651860 1755 1386 1252 287 --1335 --
NM_001025370chr651844 1739 1370 1236 271 --1319 --
NM_001025370chr651844 1739 1370 1236 271 --1319 --
NM_001025389chr1171405 1322 536 464 353 267 184 ------
NM_001025390chr1171405 1322 536 464 353 267 184 ------
NM_001025579chr1731173 1082 363 ------
NM_001025580chrX144136 3912 3857 3782 3637 3583 3527 3047 2839 1273 1027 442 283 205 33760 3465 2683 43943 3880 3255 343 --
NM_001025595chr441588 593 264 43 1152 --1665
NM_001025596chr111430 ------
NM_001025616chr4101755 1657 1554 1548 1493 644 505 399 335 277 1267 31670 1182 421 --
NM_001029839chr331022 584 361 ----1499
NM_001029840chr331022 584 361 ----1499
NM_001029858chr682458 2269 2242 2206 2054 874 667 617 1442 ----
NM_001029863chr632364 786 483 --12783 12765
NM_001029875chr53523 305 114 22044 346 1125 --
NM_001029882chr12574 239 ------
NM_001029882chr12574 239 ------
NM_001029884chr672743 2510 1742 1049 256 129 38 12580 22646 2284 --
NM_001029955chr422164 854 23459 1234 --1177
NM_001030006chr1782615 2291 908 876 638 585 416 250 21742 203 ----
NM_001030007chr1653554 3085 662 222 209 22705 1198 32712 2678 1070 --
NM_001030055chr14144744 4505 4486 3909 2873 1854 1733 1588 1508 1344 1057 872 624 403 33100 551 83 1577 14553
NM_001030272chr111384 ------
NM_001030273chr111384 ------
NM_001031623chr671739 1697 585 444 380 352 126 11627 ----
NM_001031679chr1293447 3388 3368 3052 2977 2942 2524 642 139 ------
NM_001031684chr251487 1446 1372 209 35 --11172 --
NM_001031695chr2295332 3945 3931 3792 2186 2180 1040 697 150 --11047 --
NM_001031709chr10269 43 ------
NM_001031711chr521368 526 --11532 --
NM_001031712chr61380 ------
NM_001031715chr152202 178 ------
NM_001031716chr26882 795 717 286 221 70 ------
NM_001031717chr31283 ------
NM_001031722chr61169 --136 --
NM_001031723chr42377 41 ------
NM_001031732chr4103412 2970 2541 1048 952 884 538 369 311 86 11112 1946 11117
NM_001031804chr16144373 3636 3567 3401 2922 2852 1415 1409 1393 1365 1082 1014 906 497 12966 22914 527 --
NM_001031806chr171462 21961 1945 11253 11706
NM_001031812chr5132259 2127 2096 1948 1823 1699 1575 1564 1467 769 728 128 33 2811 137 --11532
NM_001032221chr941664 1333 359 312 21619 462 ----
NM_001032280chr621728 1094 1466 11545 --
NM_001032282chr841300 1148 1088 71 11315 1324 1320
NM_001032283chr123949 769 257 1128 --1281
NM_001032284chr123949 769 257 1128 --1281
NM_001032293chr172167 148 ------
NM_001032296chr1372871 2843 1017 774 621 509 231 --22294 245 --
NM_001032380chr1041703 1473 1467 281 --11305 22012 399
NM_001032393chrX1255 1660 ----
NM_001032394chr6112827 2717 2604 2151 1971 1114 1065 935 799 701 304 --1596 --
NM_001032395chr6112694 2584 2471 2018 1838 981 932 802 666 568 171 --1463 --
NM_001032730chr11134 ----2689 178
NM_001032999chr2035299 3793 725 1688 24211 4006 --
NM_001033002chr17295 84 ------
NM_001033044chr161563 1292 1176 517 275 146 --11571 11186
NM_001033045chr283667 3659 2977 2940 2918 1386 965 382 33403 2952 1781 --14402
NM_001033047chr442656 2594 2181 570 11648 12517 --
NM_001033049chr2122141 449 --2787 352 --
NM_001033056chr161563 1292 1176 517 275 146 --11571 11186
NM_001033057chr381968 1650 1387 1334 489 238 224 72 --11852 --
NM_001033059chr642043 1647 1493 334 1509 ----
NM_001033087chr20103206 3106 3079 2920 2438 2319 2295 1251 1002 735 ----22119 354
NM_001033117chr353924 3456 1560 556 80 ----24659 3241
NM_001033503chr51363 ------
NM_001033506chr111334 ------
NM_001033507chr12570 490 --21286 556 --
NM_001033557chr231254 1089 217 11081 1314 --
NM_001033564chr6--1216 1127 --
NM_001033566chr17140 --1663 1109
NM_001033568chr17140 --1663 1109
NM_001033578chr852215 1869 947 911 221 ------
NM_001033723chr872792 2567 1822 1800 1730 1018 857 --1454 --
NM_001033756chr651778 1673 1304 1170 205 --1253 --
NM_001033756chr651778 1673 1304 1170 205 --1253 --
NM_001033910chr132153 235 220 ------
NM_001033925chr1051447 858 615 142 101 1829 21898 1743 --
NM_001034837chr51814 ------
NM_001034838chr51814 ------
NM_001034841chr1695536 5199 5020 4777 4193 2031 1565 485 431 ------
NM_001034845chr491404 1216 1144 1095 1082 1059 553 547 201 ------
NM_001034850chr581482 1469 1378 1328 632 199 187 128 --1607 1114
NM_001034954chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_001034955chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_001034956chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_001034957chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_001035chr11524 --1182 1372
NM_001035003chr421156 941 21435 482 ----
NM_001035004chr421156 941 21435 482 ----
NM_001035260chr1041264 423 344 238 ----11341
NM_001035267chr122242 231 ------
NM_001035521chr24693 581 523 513 --1819 --
NM_001037131chr231336 942 831 ------
NM_001037132chr741879 680 371 199 --1278 21987 807
NM_001037133chr741879 680 371 199 --1278 21987 807
NM_001037164chr741907 1660 1350 182 22024 1951 21318 691 --
NM_001037165chr778869 8852 8763 7154 6816 6670 239 12489 12282 --
NM_001037174chr292265 1801 1776 599 448 430 350 180 144 ------
NM_001037277chr141689 1492 1472 37 --1319 --
NM_001037278chr141689 1492 1472 37 --1319 --
NM_001037290chr113950 934 376 1832 ----
NM_001037317chr182502 1789 1076 1024 697 631 470 390 32403 992 588 32156 973 494 1527
NM_001037324chr31716 ------
NM_001037332chr542578 2430 2284 896 22067 474 2942 332 --
NM_001037333chr542578 2430 2284 896 22067 474 2942 332 --
NM_001037334chr1892095 1778 1771 1725 1536 713 378 258 46 --21656 247 --
NM_001037339chr131223 702 125 --31304 626 582 --
NM_001037340chr131223 702 125 --31304 626 582 --
NM_001037341chr131223 702 125 --31304 626 582 --
NM_001037341chr131223 702 125 --31304 626 582 --
NM_001037494chr122223 208 ------
NM_001037495chr122223 208 ------
NM_001037535chrX91458 1225 1180 1108 996 973 551 516 166 21388 276 31025 535 249 --
NM_001037536chrX91458 1225 1180 1108 996 973 551 516 166 21388 276 31025 535 249 --
NM_001037540chrX91458 1225 1180 1108 996 973 551 516 166 21388 276 31025 535 249 --
NM_001037553chr2184936 4211 4133 3461 1797 1385 1262 990 1900 ----
NM_001037631chr22124 21 170 1461 --
NM_001037954chr11123368 3306 3227 3196 3080 2863 2133 1228 1167 995 571 381 33034 700 54 ----
NM_001038603chr54293 262 32 24 ------
NM_001038640chr153292 225 195 --1895 --
NM_001038702chr5112665 2522 2405 1793 981 859 708 598 587 403 333 --2866 464 --
NM_001039029chr1211985 ------
NM_001039091chrX4928 357 300 205 --1467 --
NM_001039199chr20104967 4548 3957 3318 3074 2009 1785 1230 842 279 24941 3405 --34884 4592 175
NM_001039348chr2173 1836 11059 --
NM_001039349chr2173 1836 11059 --
NM_001039350chr731800 498 154 21670 1220 ----
NM_001039372chr74678 633 627 500 --1479 --
NM_001039395chr962404 2325 2236 1854 1681 707 11790 52460 2332 2287 920 478 --
NM_001039457chr1138 ------
NM_001039468chr111269 ------
NM_001039469chr111309 ------
NM_001039538chr2153706 3427 2466 1402 1228 1067 1057 978 840 815 792 579 490 276 240 13470 12427 1414
NM_001039547chr3288032 7161 6849 6812 6782 6558 6420 6179 6155 5675 5178 3199 3099 2997 2981 2554 2468 2357 2248 2051 1595 1235 962 844 737 406 173 138 13221 26979 1295 16428
NM_001039570chr2254665 4641 4615 4493 3548 24344 199 24672 399 --
NM_001039571chr2254665 4641 4615 4493 3548 24344 199 24672 399 --
NM_001039577chr164497 1755 789 697 450 162 13241 31181 1163 1145 1440
NM_001039580chr4224796 4722 4647 4445 4409 4197 4127 3922 3814 3532 3360 2042 2024 1976 925 794 564 313 143 78 31 23 53301 3152 1768 639 602 23329 2033 33930 3145 696
NM_001039585chr1164242 3337 3235 2944 2727 1681 1575 1555 1450 1159 959 690 626 572 529 220 1321 23049 2758 11705
NM_001039590chrX143913 3808 3514 3405 2907 2870 2721 2702 2590 2463 1432 1418 1136 541 13080 33470 1513 755 --
NM_001039591chrX143913 3808 3514 3405 2907 2870 2721 2702 2590 2463 1432 1418 1136 541 13080 33470 1513 755 --
NM_001039618chr11215984 5447 5374 5000 4877 4712 4456 4435 4191 2369 2308 2253 2240 1986 1877 1564 1556 1479 1416 996 751 1341 25671 3674 35262 4245 4123
NM_001039661chr1141107 1071 1007 847 --1991 --
NM_001039693chr273739 3725 3275 2783 2674 1609 1127 ------
NM_001039709chr2035299 3793 725 1688 24211 4006 --
NM_001039802chr111266 11067 11145 --
NM_001039840chrX166021 5576 5373 5247 5226 3717 2429 2358 2270 2010 1981 1401 1274 1262 844 509 45018 4971 3686 1904 15550 14453
NM_001039885chr1931479 1417 1202 --2534 499 11039
NM_001039916chr1211003 ------
NM_001039917chr1211003 ------
NM_001039918chr1211003 ------
NM_001039919chr1211003 ------
NM_001039920chr1211003 ------
NM_001039937chr13123773 3553 3136 3106 2996 2885 1598 1043 609 435 259 182 1795 33559 1584 371 2847 29
NM_001039938chr1371527 1408 1394 1211 1180 1161 972 --1977 --
NM_001040001chr671599 1525 813 727 407 173 101 11937 11714 1180
NM_001040020chr761604 1530 1497 1431 1290 146 1383 --1475
NM_001040057chr741484 933 461 284 2581 408 ----
NM_001040092chr81355 ------
NM_001040100chr351050 796 487 275 47 ------
NM_001040142chr252065 1873 1797 1571 753 12403 1619 --
NM_001040143chr252065 1873 1797 1571 753 12403 1619 --
NM_001040152chr795092 4997 4822 4743 4683 4580 3816 3374 142 --34587 3352 1436 --
NM_001040153chr132849 274 21005 808 ----
NM_001040157chr472880 2692 2477 1826 1113 280 245 12269 --1502
NM_001040159chr43934 183 128 --11418 11210
NM_001040179chr62742 701 1879 1883 1262
NM_001040181chr361067 999 819 131 93 38 --1936 1190
NM_001040182chr361067 999 819 131 93 38 --1936 1190
NM_001040183chr361067 999 819 131 93 38 --1936 1190
NM_001040199chr361067 999 819 131 93 38 --1936 1190
NM_001040200chr361067 999 819 131 93 38 --1936 1190
NM_001040202chr472276 1792 1666 767 374 300 72 ------
NM_001040214chr61937 11579 ----
NM_001040272chr922395 90 --22089 99 --
NM_001040284chr16165863 5584 4773 4336 4255 4084 4035 2037 1981 1861 1287 820 784 561 302 235 34602 4413 2076 1930 --
NM_001040402chr4123078 3007 2793 2672 2497 2093 2061 1181 1155 652 586 94 1389 22400 317 1860
NM_001040429chr1373367 3212 2797 2607 2440 1200 353 --12527 --
NM_001040440chr54554 448 231 176 ------
NM_001040441chr195204 4842 4325 4292 3634 3528 1489 1134 814 24285 347 21559 255 1276
NM_001040446chr552689 500 343 229 158 1586 12506 --
NM_001040450chr15102681 2555 2483 2292 2281 1863 1786 640 561 142 --22519 1884 --
NM_001040453chr15102681 2555 2483 2292 2281 1863 1786 640 561 142 --22519 1884 --
NM_001040633chr74704 679 277 123 ------
NM_001040653chr3102596 2353 2332 2085 2025 876 841 695 494 312 22513 528 21984 199 --
NM_001040665chr7214584 4576 4336 3754 3657 3585 3437 3409 3367 3267 3201 3146 3077 1807 1677 1325 1310 1195 1049 508 52 43542 1510 951 274 --1267
NM_001040697chr112505 200 --1104 1616
NM_001040708chr811041 --2301 157 --
NM_001040709chr152485 1965 270 258 226 22223 800 1895 --
NM_001040712chr9153517 3214 3199 3187 3089 3064 2919 2824 2792 2344 1225 1072 834 324 248 1540 23526 631 --
NM_001040876chr421596 415 11829 1259 --
NM_001041chr32399 133 --1416 --
NM_001042355chr1695397 5229 4963 4880 4078 4050 1940 910 157 14181 35236 4163 1315 14854
NM_001042357chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042358chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042360chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042363chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042389chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042390chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042392chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042395chr1061488 1291 481 337 190 130 --2961 952 --
NM_001042403chr123385 181 46 ------
NM_001042404chr181971 1962 1940 1913 1907 1762 1385 135 --1441 --
NM_001042406chr64961 935 922 308 ------
NM_001042412chr1695397 5229 4963 4880 4078 4050 1940 910 157 14181 35236 4163 1315 14854
NM_001042413chr9113989 3710 3419 3339 3255 3243 2949 2641 2597 638 46 11431 32602 554 283 14114
NM_001042422chr17166 ------
NM_001042423chr17166 ------
NM_001042424chr442849 2233 2179 744 1880 ----
NM_001042425chr621728 1094 1466 11545 --
NM_001042437chr23176 92 73 ------
NM_001042453chrX61689 1643 1464 273 256 187 11188 --1692
NM_001042459chr32343 103 2312 259 ----
NM_001042472chr201607 ------
NM_001042473chr1092026 1859 1787 1762 1708 1681 845 391 107 1810 11658 --
NM_001042481chr1482629 2440 2174 1967 1853 823 380 80 32655 2187 1868 32686 2641 490 --
NM_001042492chr1763473 3127 2192 1037 759 212 12225 ----
NM_001042493chr641911 1352 590 373 31522 1370 552 --11290
NM_001042494chr1563882 3133 2456 2427 580 511 53233 3115 3035 1120 644 22403 739 12340
NM_001042495chr1563882 3133 2456 2427 580 511 53233 3115 3035 1120 644 22403 739 12340
NM_001042496chr1563882 3133 2456 2427 580 511 53233 3115 3035 1120 644 22403 739 12340
NM_001042497chr1563882 3133 2456 2427 580 511 53233 3115 3035 1120 644 22403 739 12340
NM_001042510chr862067 2059 1504 1367 366 305 11874 11519 11487
NM_001042511chr862067 2059 1504 1367 366 305 11874 11519 11487
NM_001042533chr3113210 1259 1214 1203 988 960 925 906 663 495 239 12850 13289 --
NM_001042537chrX42469 2434 2231 1873 31973 1904 910 2405 234 --
NM_001042555chr12134543 4364 4164 3968 3735 3550 3340 3188 1300 1157 1106 1051 879 2127 66 11067 1468
NM_001042573chr1722049 333 ------
NM_001042599chr2287639 7570 7484 7391 7298 7270 7129 7028 6621 6576 6474 6325 6141 5930 5912 5890 5439 5362 5302 4992 4887 3053 2972 1788 1537 1339 1104 991 32999 1570 794 ----
NM_001042601chr362853 2842 602 546 535 61 22066 1117 --21259 128
NM_001042603chr12155399 5369 5363 5134 4206 3871 3615 3350 1970 1690 1403 1314 1300 1195 409 1228 83937 3516 3458 3400 3342 1149 525 97 14822
NM_001042604chr3184437 3820 3532 3472 3347 3172 3039 1522 1512 1343 1240 1127 1003 912 860 843 602 510 31727 1016 651 33550 3404 464 --
NM_001042646chr361760 1615 1440 1348 1341 756 ------
NM_001042669chr4101755 1657 1554 1548 1493 644 505 399 335 277 1267 31670 1182 421 --
NM_001042683chr681837 1703 1425 1143 627 573 299 236 21769 1696 11842 --
NM_001042749chrX71737 1544 1392 718 633 358 239 ----1275
NM_001042750chrX71737 1544 1392 718 633 358 239 ----1275
NM_001042751chrX71737 1544 1392 718 633 358 239 ----1275
NM_001042762chr74429 419 175 49 1116 ----
NM_001043318chr1474120 4038 3889 1566 1270 801 618 --34125 3740 806 --
NM_001043351chr132026 773 641 --1629 --
NM_001044305chr641511 1365 248 222 11326 --1486
NM_001044385chr253817 3688 3580 2997 2513 23161 1511 2607 255 --
NM_001044722chr5132259 2127 2096 1948 1823 1699 1575 1564 1467 769 728 128 33 2811 137 --11532
NM_001044723chr5132259 2127 2096 1948 1823 1699 1575 1564 1467 769 728 128 33 2811 137 --11532
NM_001046chr562775 2591 2003 817 750 709 2935 40 22487 419 22541 2030
NM_001048183chr173543 2764 2596 1365 1104 650 45 13706 ----
NM_001049chr1452270 2029 2018 2011 210 --1411 12209
NM_001068chr3190 ------
NM_001071775chr1371758 1734 1706 1655 719 504 271 --21344 119 --
NM_001076chr41142 1166 --156
NM_001076chr41142 1166 --156
NM_001077628chr1161 ------
NM_001079874chr1112132 2066 1987 1848 1598 758 642 502 400 370 304 12119 1314 --
NM_001083620chr472561 2438 2412 1702 1615 882 812 22156 1713 21640 602 --
NM_001094chr173831 801 775 1843 --1757
NM_001099678chr3116231 5772 5536 5384 5159 2066 1851 1626 1586 1070 194 32204 1321 1179 36251 1856 887 12291
NM_001100108chr1137438 7180 6438 6242 5792 5745 3353 2833 1851 1605 1560 1283 1252 25287 1531 37191 6772 504 22993 726
NM_001105518chr12878 854 --1903 --
NM_001106chr3198894 8876 8837 8527 7559 6958 6828 6803 6270 6106 6003 2442 1972 1746 1375 1005 727 527 178 39766 8486 6647 43378 2546 2460 2246 25910 2272
NM_001109977chr41842 198 3768 663 543 1679
NM_001113490chrX93422 3270 3246 3127 2849 2232 1023 872 724 --1908 --
NM_001115chr8135 ------
NM_001117chr1892407 2320 2241 2160 1740 828 737 633 197 1574 ----
NM_001121chr1041818 1620 698 658 1365 1350 1288
NM_001122631chr111477 ------
NM_001123chr101729 --3287 202 53 1273
NM_001126chr131087 1046 961 165 2931 311 --
NM_001128chr1653554 3085 662 222 209 22705 1198 32712 2678 1070 --
NM_001135chr151344 ------
NM_001144chr161178 --11127 11323
NM_001146chr872339 2154 2049 1802 1558 894 304 1283 ----
NM_001148chr441991 1392 396 310 --1447 --
NM_001149chr1051410 1289 1008 419 116 ------
NM_001151chr41191 ------
NM_001152chrX------1210
NM_001153chr22838 282 --2275 100 --
NM_001156chr102591 180 1427 ----
NM_001167chrX166745 6702 6356 6207 5190 2590 2027 1883 1845 1758 1484 1131 1072 838 549 216 21811 1632 1883 12620
NM_001173chr14144744 4505 4486 3909 2873 1854 1733 1588 1508 1344 1057 872 624 403 33100 551 83 1577 14553
NM_001177chr1242423 900 468 226 31550 588 74 12348 --
NM_001178chr111384 ------
NM_001186chr2162671 2073 2052 947 760 640 --23307 952 12250
NM_001187chr211568 --1473 --
NM_001198chr682398 2297 2143 1653 1595 343 240 22 --22347 2223 --
NM_001200chr2061077 939 314 303 124 106 11132 ----
NM_001201chr4143788 3732 3245 3068 2978 1286 1194 881 859 652 611 307 236 48 13899 2952 121 23991 1259
NM_001202chr143286 184 109 ------
NM_001204chr2247485 7092 7054 6447 6320 6257 5828 5358 2971 2612 2565 2079 1829 1568 1478 1449 1399 940 900 821 615 175 133 32 35950 5310 2408 64798 1610 1467 826 678 424 27125 2714
NM_001205chr51433 ------
NM_001206chr9133064 3035 2863 2364 2086 2002 1118 889 801 776 759 668 314 1517 32652 2583 2346 --
NM_001219chr752226 857 260 182 40 ------
NM_001227chr1021356 1172 --11193 --
NM_001233chr772355 1470 661 414 381 265 44 --22247 2227 11603
NM_001235chr111663 ------
NM_001241chr2122441 2369 2179 1963 1789 1775 1717 668 451 417 383 339 1212 1132 --
NM_001241chr2122441 2369 2179 1963 1789 1775 1717 668 451 417 383 339 1212 1132 --
NM_001253chr61125 ------
NM_001254chr1741052 908 235 113 --1770 --
NM_001256chr1782897 2294 2121 2104 1821 987 392 370 11057 22413 2153 32913 2276 678
NM_001257chr1641328 559 285 136 1166 ----
NM_001259chr7205781 5204 5116 5088 4767 4723 4588 4509 4299 4224 4180 2082 1208 1178 1079 961 834 751 394 141 11638 65347 1530 1401 1328 898 480 --
NM_001263chr42464 163 --1363 --
NM_001270chr51220 --1126 --
NM_001273chr121365 ------
NM_001277chr1151082 1057 352 341 75 ----1173
NM_001278chr1061159 1054 966 903 480 312 ------
NM_001280chr191602 --1251 --
NM_001282chr1782615 2291 908 876 638 585 416 250 21742 203 ----
NM_001284chr51410 1525 ----
NM_001286chr152841 1758 1144 514 360 1495 11826 --
NM_001289chrX4619 272 190 48 21498 1167 1432 --
NM_001290chr43868 120 68 ------
NM_001299chr19--1498 ----
NM_001304chr1753860 2799 2778 2713 462 23681 1016 196 13698
NM_001305chr71825 ------
NM_001310chr12172976 2954 2743 2549 2483 2448 2207 2181 2053 1947 1913 770 493 487 325 173 78 12886 --11939
NM_001315chr642224 1570 894 554 --1912 21397 472
NM_001316chr205442 433 394 362 141 ------
NM_001326chr113427 393 321 ------
NM_001328chr43766 493 297 ------
NM_001331chr1152764 2267 468 250 39 --32627 2209 2182 12435
NM_001332chr541334 1054 986 643 11071 --1596
NM_001343chr531683 1622 1057 11578 1136 1485
NM_001349chr22412 184 1126 ----
NM_001356chrX82520 2409 1937 1823 1771 1708 1570 338 --11641 --
NM_001357chr1186 ------
NM_001363chrX2690 135 --1639 --
NM_001364chr1194465 3136 3095 2921 1582 1470 1300 1084 351 34799 4658 3435 24064 1677 --
NM_001365chr172772 115 --1120 --
NM_001380chr1011082 ------
NM_001385chr82300 282 1265 1392 --
NM_001386chr852340 2132 1908 1854 1847 ------
NM_001387chr562708 2699 956 725 376 180 --21960 512 12762
NM_001390chr1823170 2637 12446 23331 2691 11387
NM_001391chr1831180 943 44 170 2962 106 11206
NM_001399chrX63225 3024 2936 2415 746 132 ----11461
NM_001400chr141094 1008 425 39 1507 --31138 945 500
NM_001401chr941171 1016 581 395 ------
NM_001407chr331503 489 258 --21150 1065 --
NM_001412chrX153577 3540 3390 3158 2945 2861 2842 2517 2458 2379 1321 1194 1157 1091 834 12694 ----
NM_001415chrX61815 1545 1235 800 304 74 11358 11564 --
NM_001417chr122528 152 --1758 --
NM_001418chr112570 479 ------
NM_001418chr112570 479 ------
NM_001419chr19104416 4356 4206 4092 1642 1620 1230 1142 988 919 --63497 3366 2955 1170 1022 219 --
NM_001420chr1963168 3161 2955 2271 2179 2087 ----12189
NM_001422chr1121095 262 1473 ----
NM_001423chr1241658 1548 1424 208 --11915 12007
NM_001427chr721538 1493 ----11775
NM_001429chr2261036 894 794 378 335 38 ------
NM_001431chr63915 890 211 --21216 298 --
NM_001432chr4123876 3746 3633 3531 3259 2922 1247 942 872 723 153 142 1252 12756 22571 1002
NM_001438chr1123556 3293 3115 3026 2673 2644 2357 796 784 314 242 191 --33095 283 275 --
NM_001440chr842355 2227 382 342 11978 ----
NM_001444chr8--1148 ----
NM_001448chrX71797 1676 511 445 407 292 83 1659 ----
NM_001451chr165969 959 465 458 426 ------
NM_001452chr64681 640 513 159 ------
NM_001453chr661724 1383 1299 515 411 333 ----11203
NM_001460chr182939 2602 2233 2220 1157 1135 1104 1085 11242 22435 1215 22390 915
NM_001463chr23593 165 50 1235 3811 332 141 --
NM_001482chr153857 705 213 --2154 145 --
NM_001483chr73892 761 709 ------
NM_001490chr963471 3003 2523 1390 612 606 13643 1828 12534
NM_001491chr652494 1732 1672 986 845 12621 --1637
NM_001497chr942141 1961 1922 825 ------
NM_001511chr42492 153 ------
NM_001514chr13400 378 137 --1370 --
NM_001518chr74354 325 147 127 --21097 834 --
NM_001521chr24693 581 523 513 --1819 --
NM_001530chr1431029 319 276 ------
NM_001533chr19178 ------
NM_001542chr122375 1860 12151 1530 22109 648
NM_001546chr641379 1164 1102 360 ------
NM_001550chr72237 127 152 1645 --
NM_001554chr14626 532 214 153 1248 --1220
NM_001558chr1131563 1542 321 ------
NM_001560chrX42064 1936 361 326 --21810 1705 --
NM_001584chr115456 310 154 148 81 --21146 1018 --
NM_001587chrX52220 2169 1955 781 181 158 ----
NM_001604chr112994 259 ------
NM_001609chr1094188 4030 3623 3194 3001 2937 881 788 646 24168 737 ----
NM_001616chr2113361 3342 3200 3148 3127 2706 1383 1163 1043 688 81 12832 13164 1570
NM_001619chr11387 56 37 ------
NM_001621chr773012 1922 756 714 648 371 156 --62780 2286 2277 1029 848 346 --
NM_001621chr773012 1922 756 714 648 371 156 --62780 2286 2277 1029 848 346 --
NM_001624chr61680 21226 468 31873 330 50 --
NM_001634chr642043 1647 1493 334 1509 ----
NM_001642chr1151194 1153 1131 888 435 11350 ----
NM_001650chr1883991 3900 3837 2795 1302 891 609 384 1150 22959 551 --
NM_001655chr1161857 829 659 363 334 328 1698 12094 --
NM_001656chr5102032 1586 1532 1517 1461 814 474 414 263 154 21451 591 11651 21827 521
NM_001658chr131198 988 168 ------
NM_001663chr1482357 2346 2220 2027 1867 990 501 441 --21047 360 --
NM_001668chr151803 1784 1578 654 576 1585 ----
NM_001675chr22171 ------
NM_001677chr14999 930 800 330 1403 1820 --
NM_001679chr34770 642 528 143 ------
NM_001681chr123584 559 535 ------
NM_001682chr1282892 2871 2625 2361 2172 470 423 143 ----1921
NM_001683chr351814 1724 957 774 640 ------
NM_001684chr154007 3395 3022 764 40 --12970 --
NM_001685chr211129 ------
NM_001690chr3112487 2340 1801 1778 624 612 605 599 480 413 134 --32032 1692 92 --
NM_001694chr161294 ------
NM_001695chr8144249 3921 3864 3508 2776 1572 1362 1354 1311 615 263 243 100 79 --1105 23520 1146
NM_001701chr92230 223 21288 155 ----
NM_001704chr61457 1506 --1394
NM_001707chr71839 ------
NM_001709chr1152650 2533 2294 1053 513 ------
NM_001714chr122492 421 1430 ----
NM_001722chr81242 ------
NM_001730chr1331522 1306 405 --11506 --
NM_001730chr1331522 1306 405 --11506 --
NM_001731chr124821 714 237 55 1327 ----
NM_001742chr751629 1480 1313 379 172 --21213 409 --
NM_001743chr23501 184 48 ------
NM_001744chr5149 --1449 --
NM_001746chr572656 2632 2043 1988 1801 1099 892 12677 1526 --
NM_001748chr11112 11066 1284 --
NM_001752chr113592 412 167 ------
NM_001753chr731642 1551 240 1178 11599 --
NM_001754chr21164017 3795 3683 3660 3652 3642 3269 3253 1713 1474 816 644 599 547 486 334 12748 1589 --
NM_001755chr1692254 2132 2060 1475 578 498 451 307 163 --42300 1895 1588 96 21868 1611
NM_001759chr1295006 4812 4716 3774 1801 1578 1259 706 648 --24506 3502 --
NM_001777chr3154077 4006 3920 3913 3627 3309 3276 3259 3057 3005 2915 1226 745 677 250 22610 1622 21564 750 --
NM_001781chr123660 612 294 2890 882 1621 --
NM_001791chr111266 11067 11145 --
NM_001792chr184916 909 774 400 1372 ----
NM_001795chr1611440 ------
NM_001797chr164766 679 631 570 --1564 --
NM_001798chr1221114 900 1936 1346 --
NM_001801chr52477 427 ----131
NM_001806chr1921194 310 12100 32953 1112 964 --
NM_001812chr42229 89 ------
NM_001822chr21541 --2738 87 1584
NM_001829chr45920 394 224 89 46 ------
NM_001830chrX93871 2752 2651 1554 973 832 825 766 428 --33471 2777 491 23619 818
NM_001845chr1331262 897 41 1158 ----
NM_001854chr151473 1076 987 606 385 1944 21341 1100 11242
NM_001858chr6134962 4095 3974 3755 2029 1982 1732 1715 1461 1092 497 218 92 33196 1700 1676 34166 3631 3187 14708
NM_001859chr943392 2604 1562 345 13217 11079 --
NM_001870chr31252 198 ----
NM_001873chr42581 106 1186 ----
NM_001875chr2--1358 31055 285 120 --
NM_001880chr22207 117 ----1288
NM_001881chr101469 ------
NM_001882chr53483 438 174 --1179 --
NM_001891chr43337 314 33 --1321 --
NM_001894chr2251200 1080 1030 868 30 --21141 903 --
NM_001895chr2031262 1197 122 1255 ----
NM_001896chr161425 ------
NM_001901chr641015 986 681 97 1706 ----
NM_001903chr54869 800 613 201 ------
NM_001904chr33973 145 51 21049 909 ----
NM_001920chr122643 498 ----1255
NM_001924chr12501 481 ------
NM_001931chr1161193 1048 282 136 105 92 11177 --1466
NM_001936chr731800 498 154 21670 1220 ----
NM_001938chr141746 1546 626 25 ----11601
NM_001940chr12------1336
NM_001948chr1541256 1057 382 368 1816 1142 171
NM_001949chr683042 2780 2746 2693 2657 2131 1004 908 --1879 12454
NM_001951chr82187 138 ----1148
NM_001955chr631048 943 887 ------
NM_001956chr13566 535 90 ------
NM_001957chr4122219 2177 1944 1843 749 627 546 536 479 419 303 191 1818 ----
NM_001963chr43787 609 578 --1194 --
NM_001964chr531120 1085 481 --11104 --
NM_001968chr43868 859 167 1359 ----
NM_001969chr1482794 2447 1143 1118 1035 828 798 210 --23408 779 31495 1193 358
NM_001977chr461531 1354 1267 539 444 271 2503 229 --11543
NM_001981chr142180 1729 913 285 21817 955 1458 --
NM_001982chr121233 ------
NM_001992chr562263 2020 1679 1507 1369 322 ------
NM_001993chr121109 95 11120 ----
NM_001995chr441516 1454 1437 275 ------
NM_001999chr531539 1186 394 ----11000
NM_002006chr4105789 5719 5705 4629 4621 3981 2270 1049 384 267 --35747 5032 4676 14814
NM_002009chr1572284 2169 967 952 744 344 92 22277 736 12564 --
NM_002010chr134599 485 435 218 1407 ----
NM_002011chr51438 ------
NM_002014chr123558 270 109 ------
NM_002015chr1382716 2589 2540 1140 1086 832 698 690 22293 35 ----
NM_002017chr1131124 961 853 --1169 --
NM_002024chrX82096 2062 1828 1542 259 217 146 26 1663 11429 --
NM_002025chrX219297 8369 7953 7904 7460 7047 6969 6936 6699 6144 3635 3534 3190 3111 1518 1286 1125 748 697 199 124 37400 1316 448 13028 15727
NM_002031chr62251 154 1652 ----
NM_002037chr61395 ------
NM_002039chr41788 1371 ----
NM_002040chr21103150 3104 2700 2416 2329 1043 977 706 552 419 42980 2972 951 140 52295 2169 2061 170 97 --
NM_002041chr15189 ------
NM_002044chr1531574 1554 1273 1165 11378 --
NM_002045chr31309 ------
NM_002048chr961335 1196 1017 971 440 119 11003 ----
NM_002051chr101768 ----1730
NM_002056chr24833 777 257 119 1355 1810 --
NM_002061chr151871 635 573 271 200 11223 2382 358 --
NM_002063chrX41268 1199 847 809 ------
NM_002065chr161563 1292 1176 517 275 146 --11571 11186
NM_002069chr741203 539 436 317 1682 21242 1168 --
NM_002072chr92167 72 --1800 --
NM_002073chr2221178 1083 11577 ----
NM_002074chr121746 486 --11244 --
NM_002076chr1232198 1213 720 21083 358 23285 1987 --
NM_002077chr921375 631 ------
NM_002089chr43497 266 153 ------
NM_002090chr48549 476 445 261 214 175 163 142 ------
NM_002092chr4113704 3445 1715 1273 1052 1023 1001 941 888 541 446 --21980 140 13843
NM_002094chr162320 79 161 ----
NM_002099chr441660 1576 752 236 1201 ----
NM_002106chr4----1335 --
NM_002126chr1762982 1258 1120 1065 622 544 12840 23191 556 1355
NM_002129chr42158 56 --1383 --
NM_002130chr551547 1297 393 324 195 ------
NM_002136chr121202 ------
NM_002137chr762224 1883 952 728 541 197 --1957 --
NM_002138chr44721 638 582 195 1227 1210 --
NM_002140chr95943 780 348 288 108 1138 ----
NM_002146chr1731161 1107 169 --11400 --
NM_002147chr173723 221 135 --1817 --
NM_002148chr21262 1449 ----
NM_002158chr2103788 3545 3433 2964 2783 2393 2348 1491 431 107 23118 3016 32789 479 112 23303 697
NM_002161chr93385 349 102 ------
NM_002163chr1631257 354 244 --2480 117 --
NM_002166chr24535 213 192 86 ----1664
NM_002180chr111842 ------
NM_002182chr3112798 2774 2675 2577 2005 1940 1054 1018 659 422 160 ----12724
NM_002184chr51157 1186 ----
NM_002190chr63410 386 264 1331 2243 232 --
NM_002193chr241808 1514 1450 559 2588 219 11428 --
NM_002196chr2051057 983 820 786 775 --11025 --
NM_002196chr2051057 983 820 786 775 --11025 --
NM_002199chr43787 405 69 ------
NM_002202chr51901 11087 ----
NM_002203chr5113787 3721 3107 3003 2629 1529 1516 564 546 440 313 13579 ----
NM_002210chr2103300 3264 3006 2185 1004 992 973 909 569 349 33333 3101 292 41300 1136 813 465 12444
NM_002211chr1081148 909 818 812 804 467 299 153 1761 21042 1005 --
NM_002214chr7125639 5531 5454 5333 4833 4740 4445 3888 1911 607 564 258 65263 5161 4963 4904 4356 4035 25464 4638 --
NM_002221chr152572 2519 2126 1092 56 11794 1417 --
NM_002222chr321340 911 --11063 --
NM_002223chr1293917 3221 3088 3012 2933 598 551 516 441 ----22680 961
NM_002226chr143684 140 98 ------
NM_002229chr191421 ------
NM_002232chr151250 531 456 440 413 1156 ----
NM_002234chr123762 740 536 ------
NM_002239chr2125 ------
NM_002240chr213549 100 88 ------
NM_002243chr214996 376 338 199 ------
NM_002245chr11472 ------
NM_002247chr1071951 1773 1537 942 475 347 222 --12237 21621 166
NM_002252chr21166 ------
NM_002254chr252142 1609 870 190 176 11518 ----
NM_002264chr384794 4520 4168 3578 1726 1048 471 129 24912 462 44296 3332 1953 761 11231
NM_002267chr1372353 2151 2077 1753 1708 954 123 1609 ----
NM_002268chr341761 1705 1224 270 ------
NM_002270chr5145484 5204 5095 4990 4661 4540 4300 4288 3811 3664 2227 2183 1604 1051 44268 3871 1368 814 33439 1661 847 14145
NM_002285chr273864 3233 2894 2689 2656 1494 525 --1495 --
NM_002290chr641497 421 230 151 --21054 158 --
NM_002293chr172771 2515 2450 2401 2159 1730 631 ------
NM_002310chr5186547 5689 5636 5182 5119 4672 4649 4403 4329 4229 4174 4158 2264 1224 1128 828 724 436 24546 1968 55881 4188 4010 745 590 1755
NM_002312chr1361056 995 870 838 301 88 ------
NM_002332chr12----1178 --
NM_002336chr12124813 4767 3948 3940 3520 3456 3402 3246 1055 846 585 256 --23591 930 --
NM_002345chr125654 567 530 222 134 1169 2246 89 --
NM_002350chr831249 1232 458 ----1927
NM_002351chrX51763 1541 389 359 222 2271 26 ----
NM_002354chr24372 350 295 258 ------
NM_002355chr12111356 1101 889 508 495 475 423 405 180 129 117 11270 1566 --
NM_002356chr682864 2823 2548 1139 317 284 277 130 11910 1136 12036
NM_002358chr42531 158 ----188
NM_002360chr732491 2308 937 ------
NM_002372chr53664 605 82 ------
NM_002373chr151393 ------
NM_002374chr2153706 3427 2466 1402 1228 1067 1057 978 840 815 792 579 490 276 240 13470 12427 1414
NM_002381chr231050 859 707 ----1714
NM_002382chr1461342 953 878 449 140 105 --1837 --
NM_002384chr181982 ------
NM_002389chr141838 580 266 28 21759 1708 ----
NM_002392chr123475 144 31 ------
NM_002395chr6101414 1385 1342 1206 1194 981 454 384 356 205 ----31120 186 115
NM_002396chr183686 562 24 1488 ----
NM_002397chr582074 1625 1603 1516 757 696 328 145 11917 ----
NM_002398chr231545 1345 1125 --11146 --
NM_002399chr152955 436 21459 932 1444 --
NM_002401chr1772506 2448 2131 1761 400 382 81 ------
NM_002402chr731207 1140 1083 --1209 11011
NM_002408chr141272 ------
NM_002427chr116876 829 821 262 55 24 ------
NM_002428chr1631213 175 133 --11415 --
NM_002430chr2262519 2068 472 461 416 280 --12037 32258 1675 396
NM_002439chr53910 331 318 ------
NM_002440chr1153 ------
NM_002442chr1261788 1760 1649 1520 501 259 ------
NM_002444chrX61953 1637 808 517 286 267 12011 --11498
NM_002449chr531070 435 324 11160 --1803
NM_002451chr9101292 1266 1243 1219 841 747 458 404 372 323 1668 13781 --
NM_002460chr663211 2345 1362 1329 1310 1270 13711 13092 33529 1255 380
NM_002479chr12738 63 ------
NM_002480chr1241344 1094 1038 369 ------
NM_002481chr1117810 6703 6596 6514 6428 2960 2635 1311 1019 578 320 25331 5040 46554 1619 1253 1221 --
NM_002482chr11666 ------
NM_002486chr982305 1613 775 642 261 181 83 60 --1155 --
NM_002487chr151668 1594 --1764
NM_002499chr1592470 2066 1808 866 765 658 560 397 386 ------
NM_002500chr23815 438 200 --1913 --
NM_002505chr621447 595 21490 220 ----
NM_002507chr1711739 ------
NM_002515chr1431859 218 72 --41727 1700 1474 438 11828
NM_002518chr251141 1101 995 468 458 ------
NM_002519chr1151492 1229 598 197 182 ------
NM_002520chr51201 ----146
NM_002523chr731109 1051 953 ------
NM_002524chr131078 244 130 1687 ----
NM_002526chr631619 1482 400 --1636 --
NM_002527chr121106 ----136
NM_002536chrX21040 228 1336 ----
NM_002545chr11145027 4678 4351 4197 4079 3375 1720 1346 788 457 289 155 143 36 --1162 --
NM_002546chr83813 754 670 ------
NM_002547chrX83679 3648 3527 3431 3236 3137 452 355 1912 ----
NM_002575chr182573 104 167 ----
NM_002577chr3113994 3969 3224 2918 2494 2488 1559 1475 1293 455 347 --1297 11334
NM_002578chrX1174 ------
NM_002581chr9115490 5433 5119 4858 4555 4153 3816 3725 1655 844 764 35663 4483 3499 11560 12192
NM_002582chr162983 156 1943 ----
NM_002583chr122511 154 --1122 --
NM_002589chr41134 ------
NM_002590chr133512 401 128 ------
NM_002591chr204615 601 558 530 ------
NM_002594chr2052378 2364 1694 1583 151 12277 1247 --
NM_002595chr1291834 1614 1432 1396 1351 701 492 344 301 21442 1382 177 1143
NM_002600chr131223 702 125 --31304 626 582 --
NM_002601chr2--1427 165 --
NM_002603chr8----1133 --
NM_002606chr211178 ------
NM_002607chr721156 906 ------
NM_002608chr2251607 1587 1536 140 36 ------
NM_002610chr293073 2772 2374 2270 889 770 654 399 331 191 ----
NM_002612chr741777 1635 219 57 --1832 11373
NM_002613chr16125155 5132 5093 4403 4363 3715 3554 3414 1026 518 224 140 14207 13347 --
NM_002618chr22347 46 2113 37 159 --
NM_002623chr205694 283 157 120 25 --1777 --
NM_002627chr10167 ------
NM_002635chr123443 368 131 ------
NM_002636chr62482 447 ------
NM_002641chrX81959 1767 1699 1655 758 599 201 72 --11344 1659
NM_002643chr2122 ------
NM_002645chr1163153 2684 1957 1119 1080 636 13041 32627 2375 772 --
NM_002646chr132000 1806 361 1805 12146 --
NM_002648chr641291 909 840 509 ------
NM_002649chr751286 1243 463 322 207 ----11209
NM_002655chr8103874 3687 3487 3383 3372 1824 1698 1606 884 67 2480 81 23955 311 13327
NM_002657chr2053710 3652 3322 479 239 1835 33128 512 244 11516
NM_002658chr102878 602 1866 ----
NM_002667chr631285 359 205 ------
NM_002670chr381526 1239 1150 606 428 263 254 95 2637 240 1433 --
NM_002677chr872998 2916 2496 1018 938 166 101 21116 882 22830 59 --
NM_002687chr1461250 506 391 357 188 163 ----1385
NM_002699chr161433 1419 1342 1230 564 88 ------
NM_002703chr441948 1935 1751 575 --21659 1601 11773
NM_002706chr22537 89 ------
NM_002707chr21293 ------
NM_002709chr2103625 2918 2596 2304 1291 686 503 430 379 363 23268 50 ----
NM_002711chr71315 2770 286 --1826
NM_002715chr531067 858 475 2958 866 1269 --
NM_002716chr11143340 3286 3078 1476 1443 1279 996 987 870 804 719 590 448 210 ----12600
NM_002719chr1482094 1680 1550 792 696 642 510 69 1266 ----
NM_002731chr162759 2683 2047 986 388 322 21957 1254 33078 457 235 13067
NM_002734chr17112253 1845 1730 1638 1420 672 629 417 236 140 70 149 12211 --
NM_002736chr782148 1955 1948 1862 1669 1380 741 343 11659 ----
NM_002737chr17136597 6381 5955 5848 5435 5389 4673 4425 2183 964 814 694 321 --21467 1419 --
NM_002738chr163788 430 252 1456 ----
NM_002740chr382793 2747 2731 2642 2033 1919 627 571 --12820 --
NM_002742chr14191 ------
NM_002745chr22164500 4310 3842 3824 3732 3635 3315 3219 3108 1825 1688 1162 563 474 291 275 64558 4466 3792 3076 948 250 ----
NM_002748chr1541191 977 840 86 ----1939
NM_002750chr102221 197 ------
NM_002755chr153727 653 642 ------
NM_002758chr173535 495 386 ------
NM_002765chrX4928 357 300 205 --1467 --
NM_002767chr171467 ------
NM_002806chr141314 ------
NM_002814chrX2487 157 1739 124 --
NM_002819chr191108 ------
NM_002822chr1261495 454 374 335 268 110 ------
NM_002823chr22670 607 1249 ----
NM_002825chr72622 215 ------
NM_002826chr14985 798 652 302 ------
NM_002827chr2031800 617 403 --2712 191 --
NM_002828chr181864 21001 287 ----
NM_002833chr1511512 ------
NM_002835chr72577 189 ------
NM_002837chr1294573 4495 4294 2907 1614 1456 1260 1219 94 --11224 168
NM_002838chr151087 768 760 342 200 --21013 49 --
NM_002839chr9153517 3214 3199 3187 3089 3064 2919 2824 2792 2344 1225 1072 834 324 248 1540 23526 631 --
NM_002840chr13480 436 291 ------
NM_002841chr32440 135 1622 1104 --
NM_002843chr1163396 3353 2542 1301 945 539 22357 2167 21339 639 11379
NM_002844chr62509 348 ------
NM_002845chr183669 157 101 1437 ----
NM_002848chr1251310 1016 1007 904 330 1520 21222 52 --
NM_002849chr121738 ----1762
NM_002851chr72231 191 ------
NM_002852chr31138 ------
NM_002855chr1143729 3675 1003 885 --33579 2556 187 --
NM_002858chr141355 1121 850 474 128 ----
NM_002859chr1241787 1763 1228 1156 1343 ----
NM_002865chr81240 ------
NM_002868chr1222242 550 --22383 2311 --
NM_002869chr1192152 2026 1963 1703 1657 1482 722 387 196 4793 374 306 224 11397 --
NM_002871chr131914 1869 163 11847 31875 1260 553 --
NM_002873chr52460 392 3134 65 31 ----
NM_002874chr962190 1989 1765 808 694 348 2505 181 1257 1760
NM_002886chr3145197 5189 5172 5017 4660 3864 3657 3565 3547 3353 1312 1205 267 81 --175 35023 3341 1267
NM_002890chr56962 846 835 650 630 211 --1967 --
NM_002892chr1431176 469 121 --1242 --
NM_002894chr182150 54 ----1212
NM_002897chr22228 130 ------
NM_002902chr15----161 1184
NM_002906chr1161629 1560 1459 904 662 400 11890 ----
NM_002912chr64819 738 632 607 1710 3765 388 303 --
NM_002922chr13648 472 459 ------
NM_002923chr12662 648 ------
NM_002924chr12527 127 ------
NM_002940chr421596 415 11829 1259 --
NM_002941chr341652 1590 1264 624 21138 477 21170 248 1280
NM_002942chr331196 449 95 ----11094
NM_002946chr11167 --1451 --
NM_002948chr33377 207 73 --1913 --
NM_002955chr631917 1454 350 2558 58 ----
NM_002956chr123372 321 102 11424 2892 349 1540
NM_002957chr963574 3210 2668 2536 1467 1275 13412 23251 171 --
NM_002958chr34833 777 632 365 --1264 1375
NM_002959chr183291 1765 1533 1488 1231 1022 676 124 12948 2790 246 --
NM_002968chr165961 923 348 204 183 ------
NM_002971chr321081 422 --1380 --
NM_002973chr123461 93 53 --1535 --
NM_002977chr25850 396 385 174 48 33137 2293 1239 11201 13301
NM_002979chr14689 588 328 21 --1827 --
NM_002982chr173139 75 41 ------
NM_002988chr17--1170 ----
NM_002994chr491957 1921 1635 1477 1464 601 357 250 116 11493 1712 1553
NM_002995chr13792 552 176 --1129 1520
NM_002998chr831699 591 159 11835 21814 376 11916
NM_003010chr1772330 2293 2224 1533 1493 932 542 1958 1498 --
NM_003011chr92469 161 ------
NM_003013chr43789 708 589 2812 682 ----
NM_003014chr741382 1133 1039 459 31057 357 162 ----
NM_003016chr1741971 1465 797 244 ------
NM_003017chr631004 572 255 --21254 373 2223 42
NM_003022chrX21309 50 --11222 31178 955 80
NM_003026chr951263 1177 1097 844 409 --11103 --
NM_003029chr121500 1039 --21201 1017 --
NM_003030chr351876 1838 1504 646 73 --21404 446 --
NM_003034chr12228115 7921 7688 7632 7029 6873 6831 6721 6690 6529 5626 5594 3209 2650 2104 1948 1680 1629 1051 830 795 467 45643 2512 2215 205 57978 7801 1488 628 152 26844 693
NM_003035chr13784 733 310 ------
NM_003042chr312128 ------
NM_003046chr8115308 4389 4248 3885 3489 1630 1600 1452 1349 1034 659 --21616 1569 --
NM_003048chr272786 2535 2190 361 341 234 115 2948 351 12017 12455
NM_003051chr161944 1754 1682 800 727 353 1451 --1429
NM_003054chr101222 ------
NM_003068chr831073 894 379 1802 --11079
NM_003071chr36811 789 545 385 361 344 21640 319 21754 244 --
NM_003073chr221245 ------
NM_003074chr362214 1909 1869 1497 368 355 12082 1528 --
NM_003079chr17133 --2716 416 --
NM_003082chr145560 483 427 343 280 11040 1125 --
NM_003088chr711090 --1323 --
NM_003092chr20139 --1325 --
NM_003095chr123352 340 35 ------
NM_003099chr15106548 5989 4793 4752 2497 1527 1423 773 527 421 11883 --22002 164
NM_003101chr1101669 1614 1523 1289 1271 1173 1125 1046 497 99 ------
NM_003105chr111104 ------
NM_003106chr33988 948 905 ------
NM_003108chr2177184 7113 6706 6566 5721 5653 5506 5442 5423 5251 4778 4738 4603 4504 2135 363 330 --56807 6347 5459 5001 782 14854
NM_003110chr1741062 991 953 946 --1290 --
NM_003111chr251162 524 489 210 34 11284 21082 151 --
NM_003112chr7102866 2673 2632 2474 2144 1204 464 368 352 213 --21076 646 --
NM_003114chr85642 553 278 269 133 ------
NM_003115chr14406 310 117 46 ------
NM_003128chr282871 2795 2696 2440 1946 1738 836 352 --1413 1873
NM_003131chr642203 716 691 49 ------
NM_003133chr14815 673 248 195 2935 85 1200 1151
NM_003137chr662261 1998 1557 794 771 154 ------
NM_003144chr621922 33 ------
NM_003149chr341313 1098 494 404 --21429 1395 --
NM_003150chr1722238 136 22388 2306 11921 --
NM_003155chr852743 2662 849 577 400 --12416 --
NM_003156chr112364 175 --11047 11365
NM_003161chr1773581 3345 2701 2664 2532 1403 722 --32393 1114 316 --
NM_003162chr22937 797 1977 2909 258 1889
NM_003170chr171457 ------
NM_003171chr10154 ------
NM_003176chr1169 --1226 --
NM_003176chr1169 --1226 --
NM_003178chr342151 1823 748 704 --11870 --
NM_003182chr72137 90 ------
NM_003182chr72137 90 ------
NM_003184chr841108 785 695 160 1217 2982 834 --
NM_003185chr2061263 1205 1079 928 406 330 --11287 --
NM_003188chr61153 ------
NM_003189chr153093 3003 2801 1041 225 --22491 643 --
NM_003194chr62395 182 --1463 --
NM_003199chr18145294 5094 5028 4424 4155 4082 4018 3831 3666 1921 1491 1323 847 437 25316 4668 2891 797 24130 27
NM_003202chr511899 11748 ----
NM_003204chr1731749 1731 1558 ------
NM_003211chr1281548 1506 1466 1375 1335 1132 710 536 1249 ----
NM_003220chr621728 1094 1466 11545 --
NM_003221chr664046 3990 2891 2725 1622 1448 21551 215 --13555
NM_003222chr201878 ------
NM_003234chr331767 888 723 1181 22344 376 --
NM_003242chr352433 1855 1563 577 92 --2999 686 --
NM_003243chr11880 --11192 --
NM_003244chr182300 75 ------
NM_003246chr1561936 1847 1756 1738 1430 240 ----1274
NM_003247chr661931 1855 1416 425 335 284 11728 11677 --
NM_003253chr2141856 1459 247 40 11392 ----
NM_003262chr3155182 3768 3279 1336 1299 1213 1140 996 787 778 771 759 580 455 272 44159 3301 1995 1607 11445 34334 4122 1717
NM_003269chr621176 450 ------
NM_003272chr14651 245 175 113 1205 ----
NM_003274chr2162749 2660 2073 1054 1008 849 --12701 --
NM_003275chr931241 1228 228 ------
NM_003286chr2041162 967 254 193 1205 ----
NM_003288chr201580 ------
NM_003290chr1941241 288 272 229 11215 ----
NM_003292chr121410 578 11523 ----
NM_003295chr131138 ------
NM_003298chr375631 3812 2417 1577 1565 972 95 15227 24791 2029 --
NM_003304chr361379 1365 1069 1024 474 265 --21581 614 --
NM_003305chr42180 55 ------
NM_003309chr661803 1691 1459 1308 1214 183 1496 --11346
NM_003319chr21253 ------
NM_003320chr1174405 4065 3442 2840 1739 1596 1161 ------
NM_003336chrX5989 828 361 280 216 3296 256 237 --190
NM_003337chr561633 699 592 328 304 172 11449 1446 --
NM_003338chr1031937 724 306 --1478 --
NM_003339chr531150 382 189 --11337 --
NM_003340chr431157 1011 121 ----1914
NM_003341chr34532 514 106 29 --1134 --
NM_003342chr1753011 2226 982 638 566 ----23157 35
NM_003344chr731757 1742 1594 --2352 38 --
NM_003347chr2241901 1482 410 399 2249 239 31894 1847 415 11771
NM_003348chr1261722 1455 1309 686 489 346 ------
NM_003350chr83863 844 375 1892 ----
NM_003352chr24785 694 687 45 ----1362
NM_003358chr91132 ------
NM_003360chr42250 62 ------
NM_003369chr1172822 2708 2475 2433 298 205 192 ------
NM_003370chr191652 ------
NM_003372chrX2227 132 1947 1320 --
NM_003373chr1071718 1633 1601 1578 1434 1413 1333 1655 ----
NM_003374chr51183 ------
NM_003375chr10158 --1412 --
NM_003376chr651844 1739 1370 1236 271 --1319 --
NM_003376chr651844 1739 1370 1236 271 --1319 --
NM_003383chr91403 1196 1166 --
NM_003384chr14180 ------
NM_003385chr23810 687 117 --1143 --
NM_003387chr2112734 2673 2579 2513 2016 1799 657 328 209 80 41 1612 12623 32564 976 215
NM_003392chr3144350 4326 4104 3906 3892 3145 1308 1194 863 538 224 185 97 46 --11519 --
NM_003400chr22601 202 ----1250
NM_003403chr14----190 --
NM_003406chr8141819 1808 1619 1600 1592 1521 1378 723 655 635 603 315 273 137 1417 1117 1739
NM_003407chr193560 512 497 ------
NM_003409chr1831386 1015 268 31210 1076 444 ----
NM_003410chrX92589 2428 900 641 618 507 498 310 293 --3605 233 130 --
NM_003411chrY71633 1363 1330 652 580 283 221 11605 1125 --
NM_003412chr342931 2787 2346 203 23043 694 2827 591 13025
NM_003418chr34736 623 119 50 ------
NM_003432chr52228 32 ------
NM_003439chr742592 1361 883 414 --22802 435 23463 53
NM_003442chr116862 845 836 826 686 641 ------
NM_003443chr1295 27 ------
NM_003452chr9----1921 --
NM_003453chr131231 ------
NM_003454chr1641449 1430 1206 316 --1536 --
NM_003457chr172167 148 ------
NM_003463chr6102815 2442 2286 1314 1299 952 784 592 545 486 22996 2760 13130 23060 2244
NM_003468chr294292 4132 1564 1466 1114 1055 1028 402 306 14008 --24211 3682
NM_003469chr23431 359 26 1153 1482 --
NM_003471chr382332 2176 1820 1548 911 674 645 533 22273 1591 ----
NM_003473chr1021009 431 --1827 --
NM_003474chr1042423 2054 818 353 12061 12206 --
NM_003477chr111117 ------
NM_003478chr1193349 3328 3167 2922 2808 2789 2200 331 89 --12865 1753
NM_003483chr1292874 2860 2847 2626 2029 1818 793 569 536 12204 22492 592 11136
NM_003489chr2173191 2954 2272 1333 624 553 170 2729 356 13442 --
NM_003490chr2231055 708 118 ------
NM_003498chr1682786 2499 2436 2384 1949 897 866 264 1595 ----
NM_003503chr131174 109 56 ------
NM_003505chr731305 1208 354 11263 ----
NM_003506chr831193 880 354 11093 1330 --
NM_003507chr231556 793 746 --11987 11737
NM_003508chr71274 ------
NM_003557chr121663 1588 ------
NM_003559chr172986 341 1397 21024 925 --
NM_003566chr12113453 3264 2722 2687 2344 1385 1127 979 949 913 688 12638 43308 1120 354 205 --
NM_003569chr66581 569 287 126 119 84 ------
NM_003574chr18185738 5082 4802 4747 4730 4577 4550 4513 4422 4325 4042 3612 2289 1575 1211 1010 391 335 25763 1023 1977 --
NM_003576chr1372871 2843 1017 774 621 509 231 --22294 245 --
NM_003579chr11140 ------
NM_003580chr81383 1553 1464 --
NM_003581chr21864 ------
NM_003583chr1293440 3394 1356 1247 831 733 445 204 91 --11253 1296
NM_003587chr6179 ------
NM_003589chr1331055 931 560 11080 11434 --
NM_003590chr2113499 3399 2860 2507 2488 1249 1221 1110 928 487 385 --1698 1800
NM_003597chr282269 2174 1972 1900 1870 1590 1452 283 ------
NM_003603chr442095 1391 848 223 22109 527 ----
NM_003607chr184195 4037 3515 3497 1475 1146 347 254 14342 33300 3206 1571 --
NM_003613chr155723 498 473 138 114 1270 2503 143 --
NM_003615chr3123667 3366 3291 2648 2583 1339 1286 1267 1055 1041 342 289 --22999 1140 2955 396
NM_003617chr1174965 4494 4421 3865 3433 3376 3335 3198 3055 2004 1540 1476 1165 1139 806 535 139 44943 3585 1267 394 44131 1549 459 40 --
NM_003618chr251271 1132 1012 992 302 --2978 111 --
NM_003620chr1751046 957 858 784 159 1814 ----
NM_003622chr1262617 2153 813 545 486 52 1914 --22139 1671
NM_003626chr1171369 1362 1335 1250 1000 247 29 --21129 252 --
NM_003629chr183224 2895 2486 2398 1241 1043 724 421 ------
NM_003630chr63589 499 154 --2728 41 --
NM_003633chr552558 2308 1866 1592 74 11772 ----
NM_003645chr152249 188 ------
NM_003651chr122529 494 --1499 --
NM_003658chr112848 183 --1720 1661
NM_003663chr3143509 3366 3183 2882 2767 2580 1312 944 818 579 535 429 359 351 13344 1904 3980 520 88
NM_003668chr121267 ------
NM_003670chr391287 1275 1209 1184 1068 422 251 46 29 ------
NM_003671chr993464 3415 2751 2672 1009 813 457 389 106 ------
NM_003672chr161287 1222 780 665 271 226 11337 --11797
NM_003675chr101203 1430 --1363
NM_003676chr14841 649 621 294 1715 --1633
NM_003682chr111832 1818 ----
NM_003688chrX----1301 --
NM_003692chr92203 93 2693 286 1379 181
NM_003701chr133700 432 29 ------
NM_003702chr82773 189 ------
NM_003709chr2----1329 2407 310
NM_003714chr543088 2953 2727 731 1706 12322 --
NM_003716chr35979 947 860 826 732 1308 ----
NM_003718chr74513 423 172 113 ------
NM_003722chr392672 2657 2553 2123 1954 1788 1773 622 452 --12132 --
NM_003725chr123419 393 21 1159 ----
NM_003728chr4--1472 ----
NM_003743chr262124 865 828 283 256 161 --12129 --
NM_003745chr163348 61 50 ------
NM_003746chr122223 208 ------
NM_003749chr1362457 2264 1836 1799 1600 735 21766 862 11687 --
NM_003750chr101334 176 --1232
NM_003758chr1561204 1157 1149 1132 450 129 1385 ----
NM_003758chr1561204 1157 1149 1132 450 129 1385 ----
NM_003759chr484095 4039 2839 958 861 639 277 213 43584 3574 1714 691 54004 2656 1483 228 109 --
NM_003760chr12785 234 ----1563
NM_003762chr131427 926 283 2313 242 11444 --
NM_003763chr2042978 2969 1990 889 ------
NM_003764chr63758 739 647 --1544 --
NM_003766chr173594 169 144 ------
NM_003768chr12307 272 ------
NM_003769chr12129 ------
NM_003772chr1141228 1120 350 180 11288 ----
NM_003774chr12183394 3215 3148 3074 2652 2511 2505 2425 2400 2393 2222 2057 1302 661 484 448 208 88 1195 ----
NM_003783chr111053 1771 11000 --
NM_003787chr1871656 1384 1250 1155 224 117 81 41239 1139 204 167 1537 11327
NM_003796chr192458 419 1182 1114 --
NM_003797chr111207 ------
NM_003800chr662361 2308 2276 1806 814 219 ----1733
NM_003809chr171485 ------
NM_003818chr201141 1692 1982 --
NM_003819chr11269 ------
NM_003822chr193079 3011 2882 2625 2468 2451 2090 1937 126 13177 22067 826 --
NM_003825chr1561486 1343 1281 373 367 292 1276 --11032
NM_003829chr92940 254 ------
NM_003861chr1462420 2080 2061 1949 856 407 --11852 --
NM_003870chr1531957 491 246 --12045 --
NM_003873chr1042390 1651 869 802 ----12335
NM_003877chr124971 913 204 187 1660 --1649
NM_003884chr341636 749 710 198 1269 21134 409 --
NM_003885chr1752666 2660 2171 2115 1922 ------
NM_003887chr272343 2245 1935 1437 547 390 255 1416 12199 --
NM_003888chr1571724 1605 1595 1537 1464 1383 106 --11711 1316
NM_003895chr2152105 500 442 212 33 3536 263 74 1744 11703
NM_003896chr23176 92 73 ------
NM_003899chr1352608 1777 882 555 540 12001 ----
NM_003902chr14643 311 296 187 ----130
NM_003909chr892749 2548 2145 1115 965 704 683 159 83 --22994 295 1830
NM_003913chr694275 3260 3175 2664 1013 656 575 149 93 13273 41691 1110 1095 777 11470
NM_003916chrX31487 595 568 11437 ----
NM_003921chr181314 1268 1129 618 247 204 165 129 ----11470
NM_003922chr153396 174 72 ------
NM_003927chr182948 198 2972 418 ----
NM_003930chr7122500 2492 2416 2405 901 718 534 390 345 258 131 114 --22220 2107 --
NM_003932chr2261874 1865 1537 1423 1358 766 1536 1739 1506
NM_003934chr951266 1172 897 340 203 --1468 1214
NM_003936chr211010 ------
NM_003939chr1063201 3096 3071 1513 1390 376 42842 1094 701 214 12693 --
NM_003941chr781835 920 699 454 361 321 131 55 ------
NM_003947chr321030 302 --11080 --
NM_003948chr462346 2122 1966 652 537 446 1252 --11634
NM_003953chr172845 2763 1128 764 499 366 262 ----1626
NM_003958chr683356 3097 2679 2612 891 842 273 236 23914 227 ----
NM_003968chr33578 441 45 --1249 --
NM_003971chr17273 54 --1246 1516
NM_003972chr101265 1347 ----
NM_003980chr621130 909 1225 ----
NM_003983chr1653451 3169 870 500 287 23230 1340 13285 --
NM_003987chr1012025 ------
NM_003988chr1012102 ------
NM_003989chr1011961 ------
NM_003990chr1011961 ------
NM_003994chr12104318 3918 3824 3678 3375 3115 2821 1375 1077 1044 14394 128 163
NM_003998chr43671 475 255 1631 2677 494 --
NM_004006chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004007chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004009chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004010chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004011chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004012chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004013chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004014chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004015chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004016chrX42485 2429 1930 1848 11020 32317 1649 714 12121
NM_004017chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004018chrX42485 2429 1930 1848 11020 32317 1649 714 12121
NM_004019chrX2115 102 2435 317 ----
NM_004020chrX42571 2515 2016 1934 --32403 1735 800 12207
NM_004021chrX42485 2429 1930 1848 11020 32317 1649 714 12121
NM_004022chrX42485 2429 1930 1848 11020 32317 1649 714 12121
NM_004023chrX42485 2429 1930 1848 11020 32317 1649 714 12121
NM_004028chr1883991 3900 3837 2795 1302 891 609 384 1150 22959 551 --
NM_004034chr102591 180 1427 ----
NM_004035chr1794642 4298 4271 3381 3371 1687 1062 1027 326 131 24967 4918 --
NM_004036chr22546 47 --1579 --
NM_004037chr11893 ------
NM_004040chr271267 1239 1062 1018 956 537 514 ------
NM_004047chr1138 ------
NM_004050chr1452725 2687 1998 1919 681 --12596 1310
NM_004052chr102600 110 1792 142 --
NM_004056chr83921 874 284 --1776 1820
NM_004067chr761530 1510 1471 1294 456 433 ------
NM_004071chr22277 74 ------
NM_004073chr13255 237 220 ------
NM_004075chr123216 71 56 ------
NM_004077chr1231180 1082 63 ------
NM_004080chr741362 1317 1230 1024 --11112 --
NM_004081chrY1270 2509 33 ----
NM_004086chr142635 189 ------
NM_004093chr1373150 3071 2692 2309 2181 2073 2011 --12426 --
NM_004094chr1482917 2596 2486 1057 1011 840 812 494 12473 1116 --
NM_004096chr1031365 707 247 1833 ----
NM_004100chr632066 1855 963 138 ----
NM_004105chr2173 1836 11059 --
NM_004109chr1142372 1848 488 179 42334 2276 2193 591 158 --
NM_004113chr362013 1782 614 461 444 187 11702 1752 1352
NM_004114chrX2276 183 1302 ----
NM_004124chr14153540 3333 3300 3151 3143 3040 2416 1394 871 774 737 384 228 97 73 ------
NM_004128chr133444 198 114 ------
NM_004133chr892600 1858 1830 928 741 663 612 542 332 12394 32518 2030 1919 --
NM_004136chr1583284 3161 2871 2834 2722 2515 982 784 22170 717 ----
NM_004152chr193282 263 148 ------
NM_004156chr82545 421 ------
NM_004161chr241510 1217 1079 257 --11636 --
NM_004162chr371176 1145 955 865 425 140 38 --2999 932 --
NM_004170chr92689 134 11397 ----
NM_004171chr11209247 8510 8147 7830 7389 7264 6915 6675 3516 3323 3227 2786 1834 912 890 874 825 233 116 105 49631 9163 5956 3298 46511 3438 2802 1859 26020 958
NM_004172chr551805 1425 1367 1310 1304 1495 12023 --
NM_004180chr23564 438 159 ------
NM_004202chrY4171 70 56 48 --162 --
NM_004207chr17166 ------
NM_004215chr82596 468 ------
NM_004225chr871326 1208 1087 978 950 574 460 --11381 --
NM_004227chr752950 2579 2291 1106 579 22826 867 ----
NM_004228chr192168 25 ------
NM_004229chrX21979 310 --11542 --
NM_004232chr1883885 3484 3318 2689 2462 1367 524 180 22785 108 1608 1511
NM_004235chr91553 --2626 58 --
NM_004236chr151499 ------
NM_004238chr21249 ------
NM_004241chr105733 609 288 132 46 ------
NM_004244chr122425 381 ----1433
NM_004253chr95826 734 371 332 323 ----1755
NM_004261chr151027 973 926 108 83 --188 --
NM_004272chr542014 1811 1277 394 2612 159 1675 --
NM_004273chr1095056 4278 3961 3516 1847 1379 1337 1296 395 14755 23619 785 --
NM_004274chr1472507 2236 2127 1108 756 702 583 --11257 1589
NM_004277chr641536 1153 575 145 --184 --
NM_004279chr762379 1976 853 353 208 116 11480 11936 21998 1630
NM_004280chr62157 104 ------
NM_004285chr136439 4036 3946 ------
NM_004287chr1712593 --1671 12405
NM_004290chr531259 1019 294 --1875 --
NM_004291chr52105 43 ------
NM_004293chr963123 2372 1535 1347 1325 1256 33849 783 684 23507 817 22816 246
NM_004295chr1741279 894 432 97 1170 2511 437 1865
NM_004296chr1433981 1557 1502 13372 --1797
NM_004297chr93221 73 62 ------
NM_004311chr1052982 2930 2766 2233 401 --22973 221 --
NM_004319chr193015 2404 2069 1056 846 655 580 259 232 12158 22485 248 12030
NM_004323chr942537 2525 1855 815 ----12611
NM_004326chr15832 400 267 232 218 ----1496
NM_004329chr1041013 986 485 218 11046 ----
NM_004330chr152998 984 ------
NM_004331chr852156 894 879 792 67 --1887 11807
NM_004337chr852259 2228 618 298 275 1711 2894 480 21575 1422
NM_004338chr18146979 6156 5444 5367 5320 5189 4980 4616 2706 1951 1051 882 469 222 14513 46865 6556 4347 2512 --
NM_004342chr752316 2219 1942 1931 117 --1552 --
NM_004349chr821263 297 2130 122 ----
NM_004354chr43692 256 232 1214 2863 297 1705
NM_004364chr1931033 936 359 --11144 --
NM_004365chr51338 ------
NM_004370chr6102172 2067 1820 1738 1705 1585 867 759 531 249 --22177 576 --
NM_004374chr81136 ------
NM_004379chr241707 1170 286 83 --1673 --
NM_004381chr62290 138 ------
NM_004383chr151404 ------
NM_004384chr5132259 2127 2096 1948 1823 1699 1575 1564 1467 769 728 128 33 2811 137 --11532
NM_004386chr1922289 372 --21901 1502 --
NM_004388chr14423 375 293 90 ------
NM_004392chr1362594 1776 1770 1752 1036 581 --1780 --
NM_004393chr371703 1608 1598 1534 557 215 209 --22334 2021 --
NM_004396chr17178 ------
NM_004397chr1194043 3697 3533 3384 1327 1159 575 443 99 11382 11349 --
NM_004402chr131605 1582 664 ----11252
NM_004404chr262022 1949 1751 1647 509 185 21847 201 1502 --
NM_004405chr251081 1027 923 828 55 ------
NM_004407chr42872 860 ------
NM_004411chr74750 523 274 216 2726 715 1704 --
NM_004412chr10125334 4682 4179 2228 2022 1827 1286 1110 679 459 435 107 --34496 4377 387 24712 468
NM_004415chr61619 1644 ----
NM_004417chr53590 568 106 ------
NM_004419chr103964 415 239 --1992 --
NM_004420chr1132282 131 119 ------
NM_004423chr352692 2214 2138 2006 1693 22606 895 182 32467 1679 501
NM_004429chrX31457 1446 564 ------
NM_004430chr832772 2097 892 --42778 2516 1753 134 --
NM_004431chr13809 590 96 --2843 101 --
NM_004432chr9112414 2304 2191 1919 1909 1897 1837 831 730 521 496 12251 ----
NM_004437chr133481 2979 2638 --33190 963 322 1692
NM_004438chr2113243 3002 2948 2772 2719 2243 1151 1140 708 236 144 21160 932 185 --
NM_004440chr671845 1828 1672 1590 1430 1293 1276 --11773 --
NM_004447chr126966 870 785 443 270 172 --1158 21007 235
NM_004451chr111617 ------
NM_004454chr352310 2236 1937 1896 698 --12169 --
NM_004457chr261247 1227 1060 620 412 396 --21391 116 1217
NM_004458chrX42570 2255 1062 722 32340 2202 386 1216 1168
NM_004459chr1751897 1782 1744 452 396 --11796 --
NM_004464chr4123565 3227 2939 2807 2768 2749 1620 1555 993 474 358 242 13889 53242 3219 3164 601 466 --
NM_004481chr132659 2595 933 ------
NM_004482chr23930 353 132 1215 ----
NM_004487chr331269 1109 924 ------
NM_004496chr1451215 1159 861 855 350 --11150 2176 130
NM_004498chr151124 ------
NM_004499chr54424 378 163 122 ------
NM_004500chr1451901 1561 693 594 233 21416 829 2365 38 1718
NM_004501chr174143 3508 1641 1372 678 313 32 23521 243 ----
NM_004503chr121850 ------
NM_004504chr232791 2189 1163 ------
NM_004505chr1761698 1316 1249 561 525 105 1763 ----
NM_004506chr64139 94 79 58 ------
NM_004516chr1931270 869 319 194 --1340
NM_004520chr53712 273 174 --1249 --
NM_004521chr102367 342 ------
NM_004523chr1051288 1194 520 171 27 11452 ----
NM_004525chr231430 409 156 191 21490 980 --
NM_004529chr951391 1365 1243 1232 160 ------
NM_004535chr2071543 1359 1340 1184 1171 1108 243 11204 ----
NM_004537chr1271237 1216 485 454 119 104 53 ------
NM_004540chr211866 1913 ----
NM_004561chr1121835 694 --1685 --
NM_004566chr1052359 2335 2324 2036 1782 ------
NM_004569chr144670 625 505 174 2597 216 ----
NM_004571chr2121301 1165 2695 113 166 --
NM_004575chr431557 1532 1213 31403 1249 1191 ----
NM_004580chr1541675 1565 1315 183 21294 220 1109 --
NM_004586chrX165410 5315 5033 4461 4431 4036 3956 3945 3699 3660 1239 1111 842 822 650 321 35302 1020 338 --13997
NM_004593chr33900 885 137 2808 718 ----
NM_004595chrX1130 ----1465
NM_004598chr592834 2556 2498 2442 1167 631 480 419 224 --13348 --
NM_004599chr222709 675 ------
NM_004600chr171564 1195 1155 618 346 279 69 --2955 605 --
NM_004602chr2061434 1270 1173 933 596 478 ------
NM_004607chr52187 64 1196 ----
NM_004612chr9104040 3851 3812 3722 3345 1423 1111 955 739 247 23836 995 33953 1564 110 14771
NM_004619chr132153 235 220 ------
NM_004620chr112625 144 ------
NM_004622chr272466 913 611 488 467 293 114 1240 12183 --
NM_004631chr131295 562 498 --11226 --
NM_004634chr3------1618
NM_004635chr32799 110 ------
NM_004636chr31166 ------
NM_004643chr142803 748 ------
NM_004654chrY81393 1182 1090 1037 558 333 141 21 --1992 --
NM_004657chr261526 1304 1205 1174 537 393 ------
NM_004660chrY42279 1753 1703 337 11459 22162 1585 --
NM_004663chr1541525 1475 1355 1240 11371 1259 1104
NM_004666chr651393 317 186 121 27 ------
NM_004667chr151499 1436 ----
NM_004670chr1031714 623 327 --31686 1279 86 11303
NM_004681chrY1126 1200 1150 --
NM_004685chr13112804 2759 2480 2231 2089 1102 845 756 628 476 391 --43018 2685 1964 863 11924
NM_004686chr84645 608 532 459 1116 1274 --
NM_004687chr1751759 1543 1479 1469 717 ------
NM_004689chr141341 --1351 --
NM_004690chr63806 741 131 --1665 --
NM_004696chr13848 805 721 --2835 792 --
NM_004698chr12211 68 ------
NM_004703chr174945 552 392 73 --1133 --
NM_004709chrX41343 1141 53 43 11707 21146 489 --
NM_004715chr183602 196 147 1664 ----
NM_004717chr731365 1299 304 21376 1289 2983 260 --
NM_004718chr23687 516 88 ------
NM_004719chr1282541 2441 2124 1979 1863 1757 1137 118 --12287 --
NM_004721chr31282 ------
NM_004725chr1051416 1366 1087 494 474 31154 441 431 21498 1266 --
NM_004726chrX145235 4811 4791 4586 3733 3613 1490 1224 1000 988 817 396 324 251 24372 188 24394 565 --
NM_004730chr561984 1942 1737 1690 1438 415 1356 2694 270 --
NM_004733chr36603 543 463 250 207 96 ------
NM_004736chr172110 1964 1956 799 629 564 538 12156 --21471 228
NM_004738chr2032553 2209 720 1731 ----
NM_004741chr102614 233 21539 556 152 --
NM_004742chr381821 1564 1265 385 372 354 132 88 11284 ----
NM_004744chr493534 2809 2749 1519 1330 1155 857 700 674 33770 732 579 1398 --
NM_004745chr8146860 6653 6165 5732 5677 5457 5334 5261 5207 2390 2297 1942 991 798 26936 4560 66832 6597 4711 1752 825 345 25604 2734
NM_004748chr15144190 4035 3875 2939 2823 2743 2716 1667 1650 1636 1418 1303 296 234 1528 24213 1309 21589 762
NM_004760chr761629 880 707 424 220 56 ------
NM_004768chr14967 841 348 153 1254 ----
NM_004772chr541090 612 355 128 --1620 --
NM_004774chr1783158 3076 2260 1033 809 589 576 252 12288 ----
NM_004775chr18102328 2303 2283 2229 2175 1923 1772 1749 685 447 21999 1941 31910 928 319 --
NM_004776chr2053290 2462 979 706 23 --23162 1119 --
NM_004781chr151201 1107 487 447 336 ------
NM_004781chr151201 1107 487 447 336 ------
NM_004787chr42121 44 ------
NM_004788chr1132374 1042 348 1417 12705 22482 316
NM_004789chr91338 --1440 --
NM_004791chr133690 125 32 ------
NM_004795chr1331643 1492 556 ----11861
NM_004796chr1432354 620 377 12022 21666 42 --
NM_004801chr231051 630 72 --2971 77 11382
NM_004804chr222803 157 ----12440
NM_004805chr231221 902 361 1333 --1997
NM_004808chr1063391 2070 1268 1187 632 585 22415 2187 12841 1661
NM_004815chr1154850 4268 4069 4054 3972 1610 1199 1116 1032 991 755 529 398 367 43 1967 11662 31709 1617 1276
NM_004817chr92766 261 ----1267
NM_004820chr8299 66 ------
NM_004824chr651480 1249 968 557 223 1902 ----
NM_004830chr62735 131 --1839 --
NM_004831chr192951 706 ------
NM_004834chr273207 3183 2862 2718 2580 1150 951 ------
NM_004835chr33600 323 97 --1331 1866
NM_004835chr33600 323 97 --1331 1866
NM_004836chr26880 851 793 610 124 52 ------
NM_004837chr141689 1492 1472 37 --1319 --
NM_004841chr131147 1027 936 1100 1713 --
NM_004842chr691753 1553 1483 1144 1104 515 352 133 47 1374 11310 --
NM_004845chrX73736 3712 800 694 588 469 381 --23507 2823 23674 3388
NM_004849chr63654 356 329 --21336 175 172
NM_004850chr231290 560 530 ------
NM_004857chr14114582 4043 3918 3748 3709 3279 1839 1827 830 472 423 21909 1805 33753 3423 1197 13771
NM_004859chr1752907 2181 2056 527 202 ----2175 113
NM_004860chr171555 ------
NM_004865chr62347 317 ------
NM_004866chr5154733 4720 4703 4502 3972 3743 3698 3172 3132 1949 1695 1608 1431 467 112 1190 13663 31955 271 167
NM_004869chr1851701 1210 372 167 154 11411 ----
NM_004871chr1794305 4214 3842 3796 3433 3402 3243 2975 246 ------
NM_004873chr1473018 2875 2768 2743 1262 722 50 197 13202 --
NM_004874chr81498 1441 ----
NM_004879chr11--2837 830 ----
NM_004888chr931089 933 213 --1106 --
NM_004891chr21205 ------
NM_004896chr1041179 338 259 153 ----11256
NM_004897chr104743 605 112 103 --1647 --
NM_004898chr472341 1988 1156 927 887 759 412 --32546 2027 508 --
NM_004902chr202798 72 ----1769
NM_004904chr7145445 5401 4707 4279 4227 4083 2550 1651 1570 1498 1138 810 673 256 55239 4818 2433 1625 1325 34321 2067 1505 1768
NM_004906chr63268 192 76 --1226 1185
NM_004912chr741512 1411 1181 589 1667 31725 385 83 11739
NM_004924chr19------1779
NM_004926chr1461800 1777 1443 1386 1165 1133 ------
NM_004929chr861365 1047 987 432 398 263 11014 1444 --
NM_004932chr561671 1311 471 267 196 56 --11411 11501
NM_004938chr931197 781 416 1836 2305 232 --
NM_004941chr172457 430 ------
NM_004946chr52401 122 1424 ----
NM_004947chr342357 2231 1817 216 ------
NM_004949chr18142089 2079 1792 1725 1699 1579 1451 862 831 682 584 465 417 324 ------
NM_004953chr31309 ------
NM_004954chr111269 ------
NM_004956chr7184495 4237 3966 3737 3667 3443 3437 3107 1510 1359 1230 1107 909 581 362 272 180 104 12813 34470 266 85 --
NM_004960chr16165 ------
NM_004964chr1180 ------
NM_004966chr102983 379 1240 --128
NM_004985chr1294234 4191 2867 1673 1451 1184 951 296 146 23185 2811 21225 290 --
NM_004991chr31363 --155 --
NM_004992chrX168346 7226 6999 6200 5585 5571 5521 5440 5416 5403 3067 2812 2736 2140 1849 977 26828 2215 47458 7045 6372 943 28302 2952
NM_004992chrX168346 7226 6999 6200 5585 5571 5521 5440 5416 5403 3067 2812 2736 2140 1849 977 26828 2215 47458 7045 6372 943 28302 2952
NM_004993chr144980 589 457 34 11052 ----
NM_004999chr684396 1630 1411 1331 911 653 350 192 1472 21381 102 --
NM_005006chr23808 672 355 --3747 712 79 1991
NM_005010chr741879 680 371 199 --1278 21987 807
NM_005022chr17181 ------
NM_005023chr541199 507 432 240 11367 ----
NM_005026chr121643 144 ------
NM_005028chr1052084 2019 1643 1508 202 --22116 823 11695
NM_005030chr161244 ------
NM_005032chrX61003 854 790 395 354 62 --1302 --
NM_005036chr22167973 6624 6532 6074 5961 5733 3011 2864 2136 1773 1440 1247 1191 785 298 177 --57418 6322 6278 5145 2433 36108 1410 500
NM_005037chr3----1171 --
NM_005045chr72396 185 1681 ----
NM_005053chr19192 ------
NM_005054chr261769 1760 1677 1158 462 56 21594 1496 11700 11530
NM_005056chr12155643 5613 5607 5378 4450 4115 3859 3594 2214 1934 1647 1558 1544 1439 653 1472 84181 3760 3702 3644 3586 1393 769 341 25066 3463
NM_005063chr1063789 2905 2612 1128 1102 669 --1196 --
NM_005065chr14115139 4347 1927 1831 1754 1492 929 893 774 575 163 43590 3341 1327 1232 55027 1660 1131 935 687 1335
NM_005066chr12721 213 1313 1206 --
NM_005067chr3130 --1396 --
NM_005076chr144187 4169 2723 2615 32820 1477 125 ----
NM_005078chr1531574 1315 527 ------
NM_005079chr893007 2927 1260 1108 731 666 367 217 107 ------
NM_005086chr1231702 1193 491 ------
NM_005087chr33614 269 173 --1802 --
NM_005093chr2035299 3793 725 1688 24211 4006 --
NM_005095chr162087 1495 881 391 267 22 ------
NM_005097chr102303 292 ------
NM_005105chr162078 2023 717 550 263 239 --1175 --
NM_005109chr332387 1864 831 1276 22109 60 1230
NM_005114chr45673 494 488 121 100 1259 ----
NM_005116chr2074383 4377 3340 3276 2799 1115 193 23476 3032 23522 3120 1310
NM_005117chr115955 942 921 687 70 ------
NM_005120chrX1181 ------
NM_005121chr17183796 3686 3315 3117 2880 2703 2457 2328 2321 1406 1352 1149 1091 611 597 535 483 445 22563 936 --1124
NM_005124chr63688 646 71 ------
NM_005125chr111154 ------
NM_005126chr352194 2107 1687 845 516 --21659 679 --
NM_005128chr213692 650 109 143 ----
NM_005130chr41221 164 ----
NM_005135chr1563882 3133 2456 2427 580 511 53233 3115 3035 1120 644 22403 739 12340
NM_005146chr112718 62 ------
NM_005151chr1892095 1778 1771 1725 1536 713 378 258 46 --21656 247 --
NM_005154chr151495 ----1215
NM_005156chr9135332 4462 3518 3458 3271 1440 1407 1037 942 852 792 403 369 --34777 1621 1508 23465 1566
NM_005159chr15102226 2145 1766 873 548 471 237 150 135 52 1367 12043 --
NM_005160chr22125881 5664 5648 5586 5272 4809 2584 1632 1440 1425 1061 531 16281 56771 5633 5379 1586 1495 34976 2111 1482
NM_005163chr141986 --186 1217
NM_005164chr1262563 2336 2203 1821 1025 975 22547 895 ----
NM_005166chr192246 233 ------
NM_005171chr1231083 854 101 ------
NM_005180chr10111605 1498 1488 1381 1341 1334 1189 1147 626 541 110 --21541 1520 --
NM_005181chr83714 574 154 197 1173 --
NM_005188chr11168260 8215 7852 6298 6082 6030 6004 5942 5809 5597 5357 5151 3201 2852 2775 194 16069 15444 --
NM_005190chr62283 133 ------
NM_005194chr202506 229 ------
NM_005197chr14156062 5544 5314 5211 5045 4665 4655 3818 1833 1541 1480 1374 624 197 146 36130 5350 3904 1303 --
NM_005203chr10154 ------
NM_005207chr2253711 3686 3253 1166 416 11151 23552 1118 12531
NM_005214chr2187 133 1424 --
NM_005219chr541747 1676 1366 510 ------
NM_005221chr71264 --1329 --
NM_005229chrX2959 269 1249 21228 409 --
NM_005230chr121497 --1545 --
NM_005233chr362407 2110 642 218 167 21 12103 12412 22497 2209
NM_005235chr2287639 7570 7484 7391 7298 7270 7129 7028 6621 6576 6474 6325 6141 5930 5912 5890 5439 5362 5302 4992 4887 3053 2972 1788 1537 1339 1104 991 32999 1570 794 ----
NM_005238chr1193483 3231 2802 2401 1178 870 670 575 97 --1410 --
NM_005241chr331312 1232 429 1857 ----
NM_005243chr22143 1128 ----
NM_005249chr141703 ------
NM_005252chr144761 687 651 491 ------
NM_005254chr1551343 1255 1232 1081 1012 --2976 31 21214 171
NM_005256chr114736 611 168 158 --1243 2784 660
NM_005257chr1841323 933 348 124 11116 ----
NM_005259chr251425 1414 1285 1000 342 11095 41493 1430 1384 1005 --
NM_005261chr86952 901 856 717 671 656 --1192 --
NM_005273chr71314 ------
NM_005277chr471953 1573 661 635 611 389 97 11716 41801 1599 1297 354 --
NM_005278chrX2451 198 ------
NM_005281chr12715 621 ------
NM_005284chr61360 ------
NM_005296chrX5852 729 442 412 310 ------
NM_005302chr72358 31 ------
NM_005311chr732303 2074 1149 22051 917 1376 12763
NM_005313chr152333 223 11081 ----
NM_005316chr111909 ------
NM_005324chr1741583 755 230 49 11756 1237 --
NM_005328chr81145 --4783 732 565 207 --
NM_005329chr1662362 2302 2139 1988 1661 1553 ------
NM_005339chr4164056 3919 3896 3863 3732 3008 2854 2803 1739 1692 1441 1425 1022 994 444 65 63663 2655 1078 1008 282 213 1810 43742 3325 713 322
NM_005342chrX62637 2354 791 335 227 71 12132 ----
NM_005348chr143687 222 82 1124 ----
NM_005358chr1391684 1504 1461 1314 628 555 379 188 96 ------
NM_005359chr18176480 6343 5383 5090 5075 4551 4121 4073 4010 2525 1862 1768 1523 778 741 620 420 32396 453 85 55388 4649 2082 1773 1631 --
NM_005375chr611186 2766 382 ----
NM_005378chr2--1598 196 1683
NM_005384chr91236 ------
NM_005385chr362661 2572 2536 2014 290 30 52159 742 555 303 87 --1606
NM_005387chr114562 519 440 433 ------
NM_005388chr991694 1672 1279 1167 1129 430 377 230 63 --11599 --
NM_005389chr62293 166 ----1274
NM_005391chrX2253 136 ------
NM_005392chr931760 1395 1206 21897 1309 11816 --
NM_005393chrX2300 248 ------
NM_005398chr1031408 449 248 11426 21271 496 --
NM_005399chr184215 3777 3710 3272 1064 887 193 97 24303 1732 13997 --
NM_005400chr272955 2833 1975 1019 999 477 93 --1412 13016
NM_005401chr13247 182 163 ------
NM_005402chr741831 1732 1694 1600 ----3212 163 93
NM_005413chr22409 340 ------
NM_005414chr34304 276 210 58 ------
NM_005415chr24272 264 138 111 --1668 --
NM_005430chr121895 ------
NM_005433chr1852777 1980 897 351 293 1208 12190 --
NM_005436chr10114079 3226 3134 1642 1240 1003 810 580 303 219 102 2876 280 23333 1120 --
NM_005439chr121519 ------
NM_005445chr101276 ------
NM_005455chr161235 375 326 257 230 181 21381 36 31155 673 380 21417 342
NM_005458chr921937 195 11772 1211 --
NM_005460chr52584 525 1387 ----
NM_005465chr112054 123 ----
NM_005466chr142122 103 186 ----
NM_005475chr1222407 502 11176 12028 1631
NM_005479chr1031545 404 265 ------
NM_005486chr172648 256 1542 ----
NM_005487chr2242049 1606 363 175 --11364 --
NM_005493chr62719 189 --2858 133 --
NM_005497chr1795800 5058 1524 1410 1311 1081 675 378 317 24189 4044 31954 1124 437 --
NM_005499chr191596 ------
NM_005502chr973253 2988 2066 1152 1050 1038 737 12698 22241 971 --
NM_005504chr12106580 6074 5563 4747 4003 2661 2174 2147 1065 862 25884 298 1760 14898
NM_005506chr472835 2297 1144 1015 926 833 690 2746 374 32924 2423 1965 --
NM_005509chr551693 1466 628 294 120 11510 ----
NM_005517chr141443 1392 1175 31 --1101 --
NM_005520chr51491 ------
NM_005521chr101272 ----1264
NM_005522chr731369 1347 523 ------
NM_005524chr32342 147 --1118 --
NM_005530chr1551466 524 382 212 94 1978 ----
NM_005536chr881364 1288 1194 1030 982 962 140 33 1220 ----
NM_005537chr133986 781 341 1325 --1366
NM_005540chr171365 278 268 261 242 120 25 ------
NM_005542chr721447 1249 1323 21946 746 --
NM_005544chr21418 189 --1164
NM_005561chr133833 827 821 1112 ----
NM_005563chr13799 686 77 1255 1669 --
NM_005566chr111447 ------
NM_005568chr17155 ------
NM_005570chr1831138 1027 410 123 1818 2918 81
NM_005575chr55849 770 555 262 197 1837 ----
NM_005576chr152241 231 1189 ----
NM_005578chr3144830 4817 4771 4556 4455 4362 4176 3894 1972 1861 1758 1472 1319 492 24627 3941 43717 3430 3397 1084 14708
NM_005584chr136824 685 652 642 582 525 --1787 --
NM_005587chr155975 899 873 387 26 ------
NM_005593chr124552 430 215 191 ------
NM_005596chr986417 6271 6168 5998 5915 4278 1122 990 22580 318 --14193
NM_005600chr1------1236
NM_005604chr672476 2005 1948 1770 629 446 107 11960 22366 121 11004
NM_005605chr8159 ------
NM_005610chr14938 809 589 280 --1616 --
NM_005611chr1611072 ------
NM_005613chr162186 2085 2063 2023 1506 1494 --1495 12075
NM_005614chr741103 1049 231 86 ----1366
NM_005618chr62593 423 ------
NM_005627chr63878 778 676 ------
NM_005634chrX4672 621 272 93 ------
NM_005637chr1852091 2044 1792 1326 355 --1773 1435
NM_005638chrX51556 1445 1250 504 474 1443 21652 245 1549
NM_005639chr1221258 256 --1302 --
NM_005655chr841300 1148 1088 71 11315 1324 1320
NM_005656chr2111485 11025 161 --
NM_005657chr151120 ------
NM_005665chr1114917 4611 4313 3731 3143 1857 1607 1205 988 839 32 --24423 1509 11275
NM_005667chr22434 152 ------
NM_005668chr5124491 3903 3609 3244 2915 1756 1208 1003 975 640 622 48 34204 1265 472 33690 2822 1769 --
NM_005669chr552138 1616 387 153 85 2604 322 1158 --
NM_005686chr121500 453 ------
NM_005688chr321352 359 ------
NM_005690chr12175 ------
NM_005704chr11958 ------
NM_005707chr1541334 1304 1293 1194 ------
NM_005711chr55956 948 781 197 36 --1245 2932 824
NM_005715chr6102731 2673 2604 2475 2422 2402 2324 2077 1751 167 42527 2467 1865 388 ----
NM_005717chr15846 482 474 344 122 --11059 --
NM_005721chr22398 389 1383 ----
NM_005722chr272284 909 771 667 657 616 202 12479 ----
NM_005724chr153827 817 301 1840 ----
NM_005725chr142348 1719 796 305 11690 1805 11735
NM_005730chr1273632 3535 3496 3430 3227 2450 1146 --12957 --
NM_005733chr51191 ------
NM_005734chr11194 ------
NM_005738chr741907 1660 1350 182 22024 1951 21318 691 --
NM_005739chr1531491 471 138 1111 31734 393 360 --
NM_005746chr752473 914 829 343 100 ------
NM_005748chr1283334 2897 2391 2217 1269 703 634 384 12443 22647 2397 --
NM_005754chr561248 1218 995 387 381 273 --2278 131 11094
NM_005756chrX31483 1468 461 11391 21287 440 --
NM_005759chr284605 4461 3549 3286 1786 989 968 880 11549 14301 1517
NM_005765chrX2821 132 196 --1733
NM_005766chr132512 379 ------
NM_005776chr147724 710 668 617 591 160 135 ----1117
NM_005779chr573194 2544 2500 1263 982 528 380 ------
NM_005786chr185798 507 287 215 180 ------
NM_005788chr111719 ------
NM_005789chr1762120 1925 1650 1355 1319 202 11856 ----
NM_005795chr2102969 2895 2705 2537 2268 1177 943 885 703 36 --22734 2586 11843
NM_005797chr1161767 1589 525 381 215 53 ------
NM_005801chr171796 ------
NM_005802chr96779 752 658 525 240 166 1737 --1297
NM_005806chr2171299 1263 1138 1096 949 888 824 ------
NM_005807chr12736 206 ------
NM_005808chr393497 2637 2381 2352 1366 747 453 417 230 --22817 761 --
NM_005813chr262543 2499 2473 2458 1994 1048 ------
NM_005819chr152736 2478 2461 2204 593 12169 ----
NM_005822chr661604 929 881 505 496 206 1909 ----
NM_005826chr12615 167 ------
NM_005828chr17125073 4979 4543 4235 3762 1782 1726 1122 1023 909 111 43 24935 537 11802 --
NM_005830chr13------122
NM_005832chr341047 549 492 250 --21170 230 --
NM_005839chr12384 33 ------
NM_005840chrX187689 7515 7062 6893 6858 5789 5229 4725 3013 3004 2545 2453 2311 2168 1884 1196 887 632 35686 5024 2370 21399 560 --
NM_005842chr134663 642 627 583 ------
NM_005843chr261981 1964 1838 1796 570 437 11349 31931 1814 254 --
NM_005850chr11160 ------
NM_005853chr16162 --1573 --
NM_005857chr181352 1171 1040 1019 985 510 288 262 11137 31080 434 41 --
NM_005859chr5----1340 --
NM_005860chr19157 ------
NM_005862chr34680 674 386 39 --11016 1899
NM_005870chr1331293 903 29 ------
NM_005871chr104854 438 317 82 1831 --11062
NM_005875chr31107 ------
NM_005876chr21717 ------
NM_005880chr1631286 1142 1052 11150 21587 1414 --
NM_005882chr45965 895 693 244 231 --1686 --
NM_005885chr541206 1155 576 319 21550 550 --11585
NM_005888chr123443 368 131 ------
NM_005891chr6------1145
NM_005895chr12114017 3267 3175 2782 2528 1563 1420 986 471 265 58 --21050 428 13245
NM_005896chr21218 1695 1754 --
NM_005898chr1162728 2535 2413 2263 313 262 1284 22640 415 --
NM_005899chr1751420 1347 577 474 85 ------
NM_005900chr431228 1167 1115 --11233 --
NM_005901chr18238560 8419 7739 7189 7144 6637 6601 6463 6193 5996 5820 3140 2907 2889 2462 2180 1870 1640 1316 976 512 462 397 53254 2197 1927 1396 1072 57663 7641 2708 2331 1000 --
NM_005902chr1553257 3191 2942 1617 1069 11485 --11397
NM_005903chr5215133 5080 5064 4931 4613 4470 3688 3677 3661 3651 3610 2058 2051 1890 1843 1156 846 519 418 314 111 25121 5009 24400 1020 45236 3740 746 283
NM_005904chr1861376 1321 1286 1081 87 55 ------
NM_005906chr65542 529 476 157 88 --31320 1307 162 --
NM_005907chr661595 1558 1364 1318 1078 524 1550 ----
NM_005909chr573580 3068 2633 1704 1658 985 198 13672 ----
NM_005920chr133764 3331 114 ------
NM_005922chr61503 ------
NM_005923chr61184 --1522 --
NM_005924chr771090 921 434 428 281 275 217 --1927 --
NM_005927chr531116 896 186 11291 1812 11128
NM_005930chr143698 189 70 1209 --1180
NM_005933chr112991 765 ----21871 1074
NM_005935chr4104807 4761 4510 4348 4010 3716 3288 2079 1618 1062 25056 827 33696 2060 1426 --
NM_005937chr1744125 3665 1289 910 ------
NM_005941chr893299 2784 2692 1284 1217 972 811 452 348 13600 --33615 3135 2685
NM_005943chr6--11080 ----
NM_005955chr1175559 5434 5353 5271 4860 4605 4532 4147 3669 3653 3595 3436 1875 1125 932 455 265 25471 4414 ----
NM_005957chr144511 3543 3507 67 34898 4620 4586 ----
NM_005962chr1062134 2019 1714 1587 1505 544 11479 11963 1897
NM_005962chr1062134 2019 1714 1587 1505 544 11479 11963 1897
NM_005964chr1721532 1465 31214 519 157 ----
NM_005966chr262188 2128 773 410 385 295 21603 837 22402 1576 --
NM_005967chr124743 726 714 470 ------
NM_005977chr133778 254 72 ------
NM_005985chr20--2744 534 ----
NM_005986chr1352504 2052 1949 989 668 --42556 2059 639 389 11757
NM_005994chr17193 ------
NM_005999chr141521 1435 1096 67 2281 76 21231 319 --
NM_006002chr13137 ------
NM_006007chr9104479 4408 3562 3280 3067 1674 1353 1291 428 39 23090 1132 11327 11567
NM_006010chr3181 ------
NM_006011chr1564197 4147 3273 3252 3245 3221 13743 11196 --
NM_006015chr131081 290 77 11213 ----
NM_006016chr652200 1620 1438 1412 232 12259 12061 1813
NM_006024chr75632 588 347 249 138 ----1299
NM_006029chr14147 --1531 --
NM_006033chr1841839 1754 1734 826 --12275 11704
NM_006036chr2102584 2390 1983 1810 1774 1641 553 165 145 127 145 32013 539 57 --
NM_006037chr2134920 4304 3884 1947 1713 1701 1662 1442 1428 1183 1110 895 482 --24229 3400 --
NM_006041chr172200 98 ------
NM_006047chr2093360 3043 2582 2570 2211 2153 1093 431 77 22189 562 22219 527 --
NM_006054chr1131308 426 65 ------
NM_006055chr2133179 3022 2993 2743 2646 1021 787 605 508 457 300 78 70 22913 1245 22803 173 --
NM_006060chr773772 3667 3529 3419 1726 193 175 24115 597 --33391 3062 947
NM_006067chr1641073 904 801 332 ------
NM_006079chr61690 ------
NM_006080chr782910 2637 2109 2034 1946 1897 959 787 11080 1885 --
NM_006089chrX81804 1544 1265 1254 1182 570 219 70 11734 21599 585 --
NM_006090chr12732 650 --1758 --
NM_006091chr1511781 ------
NM_006094chr872439 2315 1692 739 692 358 163 1314 1263 11479
NM_006095chr4124539 4006 3872 3651 3564 3285 2839 1400 1291 824 747 724 54151 3074 2884 1769 670 64425 4011 3775 3666 1773 600 11104
NM_006100chr3144 ------
NM_006106chr1183420 3358 2828 2769 2712 1239 895 600 31069 375 133 2541 235 --
NM_006108chr1181998 1746 1699 1485 736 668 166 63 ------
NM_006113chr1112132 2066 1987 1848 1598 758 642 502 400 370 304 12119 1314 --
NM_006118chr11167 ------
NM_006135chr131404 1298 982 1412 1377 11382
NM_006136chr761219 918 871 553 366 167 11280 ----
NM_006139chr272521 2294 1164 1143 810 734 684 ------
NM_006141chr1682760 2487 2286 2210 2066 1954 863 608 --1829 --
NM_006143chr121112 ------
NM_006154chr15112767 2338 2307 2009 1917 1895 1097 853 595 521 163 1469 1629 --
NM_006155chr262022 1949 1751 1647 509 185 21847 201 1502 --
NM_006157chr112384 342 ------
NM_006158chr891788 1579 1538 1515 1420 614 560 457 195 ----124
NM_006159chr124643 589 562 528 ------
NM_006164chr21362 188 ----
NM_006166chr1241976 1865 524 321 --1343 --
NM_006178chr1731406 1348 1296 ------
NM_006180chr961967 1937 1774 1676 542 164 2477 291 --11893
NM_006183chr121391 ------
NM_006186chr241170 1112 972 186 ------
NM_006190chr22306 99 1940 ----
NM_006194chr1421295 165 --1886 --
NM_006195chr931443 412 316 11235 ----
NM_006197chr842027 1920 1761 424 ------
NM_006202chr191243 ------
NM_006203chr5155475 4972 4900 4849 4781 4282 4115 3653 1702 979 882 747 668 351 282 13717 54424 4352 3739 887 596 --
NM_006204chr101228 ------
NM_006206chr442651 2478 2254 446 22948 291 ----
NM_006209chr81355 ------
NM_006216chr22484 40 ------
NM_006224chr1722488 2246 --32418 429 321 --
NM_006226chr231264 1258 1246 1148 11379 --
NM_006237chr1342014 1811 1429 834 11536 22157 734 --
NM_006239chr46765 728 714 659 619 613 1140 1719 --
NM_006241chr331612 944 342 1205 32226 250 66 --
NM_006242chr2052152 2080 1856 787 382 --1755 1870
NM_006243chr14960 947 872 423 ------
NM_006245chr6----1830 --
NM_006246chr141325 --1982 --
NM_006251chr572948 2461 2235 1087 1013 257 66 --53218 2734 2417 2197 21 --
NM_006252chr1227569 7395 6811 6369 6014 5302 4749 4672 4618 3019 2134 1972 1800 1410 1386 1243 911 817 479 430 350 173 17246 57150 2904 383 117 71 --
NM_006255chr141986 ------
NM_006256chr1112753 2728 2592 2478 1900 1788 1012 721 570 272 162 22415 190 ----
NM_006258chr1031309 285 21 --1556 11531
NM_006264chr43501 366 203 1186 ----
NM_006267chr251905 1797 1469 1218 657 21456 209 ----
NM_006275chr20102447 2388 1790 1741 1725 748 735 634 363 355 21755 320 ----
NM_006279chr11367 ------
NM_006282chr2084683 4290 3612 2910 2880 1672 1601 961 11893 ----
NM_006283chr8114752 3937 3885 3789 3653 3276 1986 1494 599 428 44 13870 2457 319 --
NM_006285chr91245 ------
NM_006287chr2142525 2477 2275 1899 1883 793 778 767 560 515 447 226 182 160 --1914 --
NM_006290chr641986 1845 1379 1221 1349 21815 745 --
NM_006291chr1422001 124 ------
NM_006298chr653379 2725 2370 359 273 11276 ----
NM_006299chr62236 225 ------
NM_006300chr1971739 1691 1619 616 383 290 214 1936 11683 --
NM_006304chr71119 ----199
NM_006306chrX94040 3982 1949 1768 1700 1668 1557 1412 702 --15921 12278
NM_006313chr1261711 1538 1460 1332 1210 356 --1591 --
NM_006315chr473919 3426 3184 2873 1504 805 321 1246 32754 1373 793 14268
NM_006320chr43752 436 169 --1283 1729
NM_006323chr43773 744 604 ------
NM_006330chr891589 1343 1241 1158 1131 1104 612 593 425 --21046 628 11562
NM_006333chr21147 2544 466 1250 --
NM_006334chr91109 ------
NM_006343chr21178 ------
NM_006345chr46949 943 899 313 262 239 21199 289 1513 --
NM_006346chr131117 2399 182 ----
NM_006348chr74801 363 140 124 1163 ----
NM_006357chr21393 ------
NM_006359chrX42469 2434 2231 1873 31973 1904 910 2405 234 --
NM_006363chr202557 148 --183 --
NM_006364chr1481312 1269 1254 1041 968 511 430 201 --1894 --
NM_006371chr395324 5001 4511 3818 3687 3517 1709 746 686 34441 3564 1104 ----
NM_006372chr62185 166 ----1518
NM_006375chrX31929 1346 612 11334 11759 --
NM_006378chr961416 1407 1047 493 477 381 ----11040
NM_006379chr752113 1443 758 241 27 --22006 743 11896
NM_006380chr17124316 4023 3659 3379 3307 2994 1655 1387 1275 795 776 750 34087 3400 1213 ----
NM_006386chr2262294 2229 1972 1963 960 786 --31977 1672 610 --
NM_006389chr1121357 60 ------
NM_006390chr1251679 1374 1295 702 435 ----147
NM_006391chr111238 ------
NM_006393chr10103668 3019 2936 2869 1256 1250 901 428 97 75 14235 54035 3831 3174 1707 605 14402
NM_006399chr141296 ------
NM_006411chr6----1854 --
NM_006413chr102972 138 1220 1242 --
NM_006415chr941291 1198 1172 173 2985 402 ----
NM_006416chr63802 703 644 1549 ----
NM_006420chr2042548 2442 2126 913 2231 182 33278 2656 2488 --
NM_006421chr81825 ----11261
NM_006425chr531443 555 254 1125 31135 650 239 11521
NM_006430chr21409 --2220 93 --
NM_006431chr122248 161 ------
NM_006434chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_006439chr42427 387 ----1576
NM_006449chr282092 1964 1543 868 810 629 444 402 12214 1720 --
NM_006451chr55948 848 734 711 321 ------
NM_006457chr464051 2955 2605 831 820 517 11024 63587 3117 3026 3004 2736 205 --
NM_006459chr1032029 1498 549 11291 ----
NM_006464chr2154574 4564 4534 4232 4175 3900 3607 3459 3205 1520 1392 1369 697 573 267 33826 1580 1448 21756 508 --
NM_006465chr1522299 874 22333 707 1375 --
NM_006466chr204767 371 151 45 ------
NM_006467chr5102314 2302 2291 2230 2127 2051 1535 759 448 329 1768 31873 1610 76 --
NM_006469chr161118 445 226 209 169 157 --21439 232 --
NM_006476chr11141 ------
NM_006482chr1293440 3394 1356 1247 831 733 445 204 91 --11253 1296
NM_006489chr1431859 218 72 --41727 1700 1474 438 11828
NM_006496chr151945 1419 554 543 413 11602 1406 --
NM_006504chr1042730 1921 1156 224 --12941 172
NM_006506chr3141 ------
NM_006516chr121182 260 11449 ----
NM_006519chr61326 2320 231 ----
NM_006526chr2052148 2139 2098 1929 870 22161 1951 --22080 73
NM_006527chr42757 135 --1147 --
NM_006532chr1921765 68 1730 ----
NM_006534chr2083324 3087 2711 2698 2088 1245 724 545 1604 ----
NM_006536chr13984 899 632 --1376 --
NM_006538chr2144133 4087 3892 3593 3040 2883 2872 2672 1633 1157 568 479 237 43 ------
NM_006540chr831441 1176 395 11338 122 --
NM_006544chr14275761 5733 4691 4444 3942 3932 3830 3711 2090 1895 1883 1875 1831 1678 1621 1028 971 812 756 702 696 661 537 478 349 203 171 44601 1823 765 60 34913 4256 3723 24936 2035
NM_006546chr1786543 5946 5683 5620 2284 1798 1667 533 --11191 --
NM_006547chr72479 56 31945 630 176 21983 716 11594
NM_006548chr321544 1391 ------
NM_006549chr1252825 820 557 275 132 1934 12713 --
NM_006558chr83500 355 139 --1199 --
NM_006560chr111430 ------
NM_006561chr10206137 5469 5372 4597 4525 4477 4161 3878 3793 2470 1920 1657 1648 1568 1105 913 866 791 460 338 --44530 3917 1667 1285 --
NM_006566chr1851041 994 982 867 495 21214 141 2466 123 --
NM_006571chr81114 ------
NM_006572chr17113251 2936 2259 2165 1201 1081 1026 570 546 307 140 1286 13425 --
NM_006575chr1461283 1270 942 475 215 95 1134 ----
NM_006577chr291225 1199 1130 1043 984 951 451 363 340 ------
NM_006578chr1531374 1270 387 --2343 70 --
NM_006587chr441681 1041 459 172 ----1199
NM_006591chr111149 --11648 --
NM_006595chr1131946 625 206 --21953 1857 --
NM_006599chr16258261 8015 8005 7921 7631 7619 7533 7011 6941 6904 6651 5996 5744 5490 5071 3071 2761 2455 1581 1536 1390 648 636 385 275 36774 2653 2531 48227 5118 867 370 2891 79
NM_006601chr121955 1120 1773 --
NM_006602chr205853 702 573 561 340 ----1648
NM_006603chrX71737 1544 1392 718 633 358 239 ----1275
NM_006609chr2102995 2589 2029 2007 1984 970 903 746 611 128 42564 1898 1886 1875 --12701
NM_006614chr392722 1343 1265 1101 945 522 450 202 157 23693 883 1649 22737 414
NM_006620chr6124082 4055 3495 2982 1330 1272 1232 970 886 831 605 324 --1253 --
NM_006621chr131342 759 75 --1686 1174
NM_006622chr51504 ------
NM_006624chr1041307 848 575 217 --31821 598 93 --
NM_006625chr151141 1063 483 462 429 ------
NM_006625chr151141 1063 483 462 429 ------
NM_006625chr151141 1063 483 462 429 ------
NM_006626chr9112395 2386 2141 2133 1952 998 810 803 671 601 512 185 42652 2148 2053 607 --
NM_006628chr15144589 4429 3608 3427 3115 3074 3033 1671 1532 990 553 358 69 60 23045 458 64035 3762 1630 1094 76 43 1325
NM_006633chr52808 699 1709 ----
NM_006640chr1731904 1374 82 11771 11617 --
NM_006646chr1373095 2306 2208 2030 1978 1962 661 --22548 126 --
NM_006653chr65433 378 366 133 100 ------
NM_006654chr12134543 4364 4164 3968 3735 3550 3340 3188 1300 1157 1106 1051 879 2127 66 11067 1468
NM_006660chr151235 ------
NM_006675chr1222419 514 12282 11147 11074
NM_006691chr1131025 1008 993 ------
NM_006698chr2021440 1041 --1442 --
NM_006699chr172418 2343 2169 2092 958 870 441 1623 42738 2501 2443 1026 --
NM_006704chr134411 321 141 112 ------
NM_006706chr51530 ------
NM_006708chr63975 459 231 1141 1302 --
NM_006713chr54781 737 564 136 --1201 1527
NM_006717chr9113274 2757 2731 2725 2409 2099 715 589 222 74 50 --12898 --
NM_006721chr101729 --3287 202 53 1273
NM_006722chr3102892 2469 1215 893 869 839 828 753 149 37 --32474 1993 818 --
NM_006724chr61503 ------
NM_006726chr461079 978 957 461 444 155 ------
NM_006727chr52534 196 --1125 --
NM_006729chrX175652 5435 5270 4275 3925 3433 2098 2038 1623 1609 1419 1306 1184 1125 856 726 555 35544 778 765 2918 902 --
NM_006731chr9145790 5326 5004 4803 4375 4189 2141 1919 1457 835 626 607 456 240 54879 4589 3610 2261 1234 ----
NM_006735chr74305 91 84 72 ------
NM_006738chr15114595 4411 1612 1567 1443 1419 1290 1284 627 371 200 13418 14060 --
NM_006745chr42967 423 1168 2999 71 --
NM_006746chrX91458 1225 1180 1108 996 973 551 516 166 21388 276 31025 535 249 --
NM_006749chr831106 380 260 11271 --1307
NM_006750chr16158122 6733 6597 5769 5562 5144 4921 3063 1513 845 799 769 744 678 47 15686 56647 6253 2884 460 273 --
NM_006751chr251074 234 142 91 36 ------
NM_006754chr751215 886 425 368 76 --11126 --
NM_006756chr841106 1007 573 273 11199 --11439
NM_006763chr161768 1753 748 644 522 118 ----12143
NM_006764chr31101 ------
NM_006766chr882670 2529 2501 1654 967 601 353 137 1474 21930 302 --
NM_006769chr12716 678 ------
NM_006775chr693061 2205 2108 1163 1119 999 932 724 90 12914 12554 11047
NM_006777chrX52896 2314 2241 2108 1020 22615 1910 11931 --
NM_006788chr1872131 2122 1332 855 455 329 242 11580 ----
NM_006790chr51143 ------
NM_006793chr105707 630 593 515 84 ------
NM_006800chrX4637 596 575 540 --2510 214 --
NM_006803chr861821 1601 809 608 313 51 --11850 --
NM_006805chr541219 1146 506 267 --1398 --
NM_006806chr212353 125 ----1332
NM_006807chr171431 --1994 --
NM_006813chr61333 1736 ----
NM_006815chr1271227 1114 880 553 536 528 90 1361 21015 289 --
NM_006818chr12977 152 ------
NM_006819chr111296 ------
NM_006822chr172747 545 ----1275
NM_006826chr251139 1102 1082 896 838 ------
NM_006827chr1453107 2852 2341 1320 1111 --12960 --
NM_006832chr1431102 1078 424 ------
NM_006838chr1271924 1818 386 332 302 115 33 1642 ----
NM_006839chr2--133 ----
NM_006842chr111109 ------
NM_006851chr127922 522 403 358 343 197 84 11010 32956 2704 837 12119
NM_006852chr1762571 884 841 606 131 123 22136 354 1721 12804
NM_006854chr72447 331 --12020 11625
NM_006857chr24780 353 242 134 ------
NM_006861chr1232081 827 100 ------
NM_006868chr1843179 2793 852 495 1399 22287 503 12051
NM_006870chr20--1570 2826 340 --
NM_006873chr2123091 2926 2695 2626 2455 959 912 858 706 663 538 176 23206 2226 1242 11366
NM_006875chrX2898 283 --2639 259 --
NM_006884chr351876 1838 1504 646 73 --21404 446 --
NM_006885chr16113392 3383 2790 2580 1694 1607 1447 1320 1313 1238 1175 14226 13862 13498
NM_006887chr22679 217 ------
NM_006888chr1473500 3126 3103 3085 2582 556 59 12762 --11067
NM_006908chr71269 ----11078
NM_006910chr161138 ------
NM_006914chr961542 1364 515 404 187 131 1333 1345 --
NM_006915chrX132058 1720 975 966 720 662 643 548 392 368 300 157 123 --32506 2469 493 --
NM_006916chr251255 1156 1106 948 354 21373 426 11172 --
NM_006918chr11105300 4781 4501 3677 2281 1402 989 752 739 55 35795 2012 1287 45850 3549 1619 1525 --
NM_006920chr2102083 1773 1726 1719 1541 1448 1311 1262 724 640 --11525 11639
NM_006922chr272401 2368 1742 927 854 817 681 12589 1573 --
NM_006924chr17124235 3810 3574 3009 2883 2823 2743 1205 973 686 625 345 1898 34358 4240 3855 --
NM_006930chr572008 1875 1571 1530 1270 639 452 31738 316 80 ----
NM_006931chr1252119 1524 1323 594 473 --1191 --
NM_006939chr1431133 1039 92 1840 1447 --
NM_006940chr1221772 666 1578 31383 766 550 1108
NM_006947chr461716 1675 1486 1176 597 343 ------
NM_006948chr2192316 2249 2141 1668 1601 822 631 396 24 11726 1637 --
NM_006952chr351082 397 275 260 183 ------
NM_006959chr193451 354 342 ------
NM_006965chr1821098 903 --3456 337 265 --
NM_006980chr72561 225 --1130 --
NM_006981chr972878 2503 2251 1960 525 455 373 --22497 595 22886 917
NM_006982chr12----154 --
NM_006988chr2111175 11101 21190 268 1435
NM_006996chr191894 1861 1692 1562 1166 696 645 594 204 1308 2650 477 1194
NM_006997chr101120 ------
NM_006999chr52688 523 ------
NM_007005chr951537 1324 1198 1052 292 11302 ----
NM_007006chr16123544 3111 3077 2821 2621 2305 1062 701 384 261 224 201 12733 2453 206 13053
NM_007007chr12134192 4161 3438 1749 1735 1625 1199 945 673 459 210 197 180 11349 44720 4201 975 80 --
NM_007008chr23803 678 131 1615 1292 --
NM_007010chr1771562 1306 1259 1205 629 396 63 --21738 1210 --
NM_007011chr15146522 6353 5937 5577 4527 4438 4288 4279 2044 1324 1303 1167 336 278 11542 46820 5826 1994 1905 --
NM_007013chr82791 358 1174 1740 --
NM_007015chr135277 255 246 239 232 ------
NM_007018chr93384 371 354 --1136 --
NM_007023chr23984 939 180 --1978 --
NM_007026chr174604 524 485 140 ------
NM_007034chr16809 644 412 318 289 248 1872 11003 1213
NM_007036chr51869 ------
NM_007038chr21185722 4672 4388 4206 3827 2184 2113 2107 1852 1785 1666 1416 1105 1094 1046 905 711 454 55185 871 497 177 102 12052 --
NM_007039chr1492047 1865 897 765 739 588 516 395 79 ------
NM_007040chr193980 446 222 --1987 --
NM_007042chr362662 2523 1732 1068 439 49 1801 ----
NM_007043chr1251907 1687 648 606 77 --1354 --
NM_007045chr63539 531 174 ------
NM_007052chrX3589 160 60 ------
NM_007064chr331361 1242 581 --21520 1035 --
NM_007074chr161105 ------
NM_007078chr1033057 1905 321 1246 11068 --
NM_007084chr1341252 1127 974 287 11063 ----
NM_007106chr1372647 2419 2164 2021 1961 1719 382 --1199 21076 78
NM_007107chr331881 1556 330 12283 ----
NM_007111chr132742 224 1329 ----
NM_007114chr3123030 2569 2485 1171 1157 1083 1007 801 744 224 197 174 ----2628 275
NM_007115chr24442 332 98 91 ------
NM_007118chr51587 ----1839
NM_007121chr191359 ------
NM_007124chr651493 1340 792 658 482 --1677 21780 442
NM_007125chrY31279 983 295 31413 194 163 133 --
NM_007126chr91454 ------
NM_007129chr131999 ------
NM_007135chr9--1166 ----
NM_007144chr1731324 180 85 ------
NM_007145chr1931360 1236 1226 ------
NM_007146chr1762894 2767 886 863 331 238 ------
NM_007147chr193891 333 170 1110 ----
NM_007157chrX112792 2580 2488 2437 1076 885 716 519 437 257 227 12888 32532 2252 37 --
NM_007159chr361447 1234 498 308 218 140 11415 ----
NM_007166chr112550 316 1384 164 --
NM_007173chr1171800 853 689 476 232 143 48 ----1328
NM_007174chr1242123 1818 1544 480 1367 22159 1511 --
NM_007175chr8113561 3522 3358 3352 3295 3177 2587 2545 538 362 47 --23311 692 1195
NM_007176chr1431153 678 333 11131 ----
NM_007187chr135871 795 691 275 164 --2966 354 --
NM_007190chr10125 2925 899 2877 351 --
NM_007195chr18133381 3126 3107 3094 3079 3069 2879 2873 2799 2774 1136 529 46 --53535 2768 2568 2485 232 --
NM_007198chr841657 1522 1455 1431 11583 --21558 169
NM_007200chr15114595 4411 1612 1567 1443 1419 1290 1284 627 371 200 13418 14060 --
NM_007202chr172763 102 --1718 --
NM_007203chr983978 3808 3469 3446 3012 2771 572 422 22638 1578 ----
NM_007207chr14967 900 791 145 ------
NM_007212chr131794 161 47 --178 --
NM_007214chr641059 1005 524 518 ----21310 229
NM_007218chr82973 853 --1179 --
NM_007220chrX184912 4325 3841 3834 3222 3213 3203 1929 1852 1681 1593 1583 793 687 595 555 35 29 1136 14876 --
NM_007222chr861795 1354 1235 707 683 512 ------
NM_007231chrX52045 540 309 197 66 1254 --12411
NM_007235chr121512 127 ----
NM_007236chr15112136 2116 963 889 776 655 589 548 434 399 206 12347 1427 --
NM_007242chr161195 ------
NM_007245chr163805 795 326 --2914 128 --
NM_007246chr45774 767 321 275 164 --1378 --
NM_007249chr13129271 8761 7618 7418 5767 5692 3374 3156 2818 2693 1321 1224 27009 2204 18943 --
NM_007250chrX1595 ------
NM_007276chr711018 --2216 182 11094
NM_007282chr32655 102 1179 126 --
NM_007285chr161186 --1126 1408
NM_007292chr1794642 4298 4271 3381 3371 1687 1062 1027 326 131 24967 4918 --
NM_007294chr1731199 1130 298 11086 1398 --
NM_007295chr1731199 1130 298 11086 1398 --
NM_007296chr1731199 1130 298 11086 1398 --
NM_007297chr1731199 1130 298 11086 1398 --
NM_007298chr1731199 1130 298 11086 1398 --
NM_007299chr1731199 1130 298 11086 1398 --
NM_007300chr1731199 1130 298 11086 1398 --
NM_007302chr1731199 1130 298 11086 1398 --
NM_007303chr1731199 1130 298 11086 1398 --
NM_007304chr1731199 1130 298 11086 1398 --
NM_007305chr1731199 1130 298 11086 1398 --
NM_007308chr42583 180 --1294 --
NM_007325chrX51924 1403 586 553 227 22065 60 --11967
NM_007327chr91236 ------
NM_007331chr472529 2288 2251 1946 803 522 182 32306 2013 238 1428 --
NM_007332chr851439 1030 997 468 255 11190 31071 1049 1042 --
NM_007345chr1852205 2029 1885 1776 1627 --32132 2122 1570 --
NM_007347chr15113149 2966 2906 2532 2192 696 663 487 297 89 60 ----23169 1121
NM_007351chr441040 466 162 66 --1269 --
NM_007358chr181999 1945 1480 1456 1436 1302 1258 754 --31625 1486 1324 21812 425
NM_007373chr104611 446 322 252 --21203 679 11338
NM_007374chr141415 ------
NM_007375chr142695 2160 1826 1798 ----1712
NM_009585chr33600 323 97 --1331 1866
NM_009585chr33600 323 97 --1331 1866
NM_012062chr122940 75 ----1947
NM_012063chr12175 ------
NM_012064chr1231008 111 104 ------
NM_012073chr551584 1363 1001 554 80 ------
NM_012074chr1451017 919 438 271 121 ------
NM_012081chr573557 3415 3392 2978 914 692 44 22998 271 43303 158 153 134 --
NM_012082chr84924 247 240 205 1724 ----
NM_012089chr171524 1052 1034 428 374 229 103 11274 ----
NM_012090chr151204 1180 976 841 135 ------
NM_012096chr393671 3498 3409 3313 2837 2483 2283 583 115 11372 --23545 3449
NM_012097chr292265 1801 1776 599 448 430 350 180 144 ------
NM_012099chr194990 397 313 185 ----11262
NM_012104chr1143337 3124 1250 479 ----13406
NM_012104chr1143337 3124 1250 479 ----13406
NM_012108chr4----166 --
NM_012110chr4159 --1265 1196
NM_012115chr64582 385 227 200 ------
NM_012120chr6162936 2874 2744 2361 2040 1998 1175 1116 914 896 885 698 424 316 251 75 32965 2835 2352 32131 520 205 12992
NM_012124chr114917 607 299 289 --134 --
NM_012128chr13295 155 80 1325 ----
NM_012129chr752512 2240 1690 1530 252 --31002 533 202 22432 428
NM_012137chr1102792 2726 2538 2485 2342 2294 1170 979 369 315 --62549 2312 2147 2026 481 453 2890 149
NM_012141chr13123773 3553 3136 3106 2996 2885 1598 1043 609 435 259 182 1795 33559 1584 371 2847 29
NM_012153chr1162276 2195 323 176 133 90 2718 79 22052 185 --
NM_012157chr31896 ------
NM_012158chr1351786 1505 1445 1181 61 --21749 1208 --
NM_012161chr461078 925 791 462 414 191 2304 29 --2767 472
NM_012164chr9117444 7358 7142 6107 5391 5196 5141 4820 2877 2208 1446 65991 5055 4947 2904 2682 1702 46224 6069 5669 2514 12199
NM_012177chr63559 504 473 --1518 --
NM_012180chr43634 600 463 ----135
NM_012186chr12731 482 ------
NM_012188chr511087 ------
NM_012193chr1174349 4091 3511 1676 1148 927 617 23359 1649 ----
NM_012199chr194688 3906 3900 3680 3277 2982 2829 1260 1186 1403 44338 1615 1119 667 --
NM_012207chr1051092 236 189 177 129 ------
NM_012214chr2176293 5974 5849 5825 5073 5043 5012 4538 2546 2416 1236 855 650 533 509 365 349 --65341 4746 1967 1871 1836 78 24765 747
NM_012219chr333080 461 446 ------
NM_012223chr241138 972 68 21 ------
NM_012224chr441200 847 841 94 1236 11153 --
NM_012233chr241189 1079 941 923 ------
NM_012234chr373195 3129 2514 2339 512 380 266 22654 1423 13334 --
NM_012238chr1091742 1603 1504 1360 1305 1198 695 502 75 11279 2621 171 --
NM_012242chr103817 526 255 ------
NM_012243chr13800 635 201 1668 ----
NM_012244chr1441735 1729 1674 494 --11699 --
NM_012247chr104963 942 703 48 ------
NM_012249chr2113186 2875 2867 2593 2487 2465 1257 999 586 560 421 32699 2665 219 13068 33086 1159 224
NM_012250chr1131044 878 866 1206 --11178
NM_012252chr7125281 5056 4675 3889 3786 2150 1110 1078 1069 829 94 84 35313 3932 1189 11868 14120
NM_012255chr205403 165 134 115 106 ------
NM_012257chr751090 952 333 223 166 ----11066
NM_012259chr621356 1134 --11405 --
NM_012262chr1174939 4686 4283 4215 3708 3428 3336 3226 2034 1769 1072 880 869 786 650 459 199 24695 693 33757 3178 2058 --
NM_012281chr751964 967 798 649 266 11537 22317 1760 22388 2131
NM_012286chrX--1626 ----
NM_012287chr3174342 4300 4266 4221 4136 4119 3976 3725 3607 3541 1823 1229 1028 817 673 584 232 22910 614 24400 3071 --
NM_012288chr675644 4677 3822 3549 2006 1958 888 13750 54788 4782 4742 4327 354 --
NM_012290chr251720 1495 424 392 302 21365 676 2665 40 --
NM_012294chr763611 3489 3465 781 707 73 1357 1395 --
NM_012297chr452414 2396 2106 2044 1974 --22013 163 --
NM_012300chr552221 1779 948 587 368 ----12529
NM_012301chr751975 1881 1835 695 81 ------
NM_012302chr131123 846 216 ------
NM_012304chr551751 1579 985 545 140 1458 12472 --
NM_012307chr184898 878 735 694 --1835 --
NM_012308chr1122047 665 --12038 --
NM_012309chr1184312 4112 4075 3697 3094 1871 1825 690 13105 34225 3305 705 23668 1551
NM_012316chr1135611 5575 5444 5438 4266 3876 3531 1280 891 846 556 345 339 --21945 1132 14293
NM_012318chr441340 1278 1218 70 ------
NM_012322chr72316 282 --1295 --
NM_012323chr2221540 1051 --11545 --
NM_012325chr2061670 1542 1269 1126 611 422 21641 1244 ----
NM_012328chr711374 --41440 1160 930 197 --
NM_012329chr1761709 1598 1419 1239 1185 434 1517 21192 389 137
NM_012330chr1041513 1352 303 131 --1228 --
NM_012333chr121241 609 11285 ----
NM_012334chr542987 1450 1250 998 --23561 3387 1731
NM_012338chr721169 768 --21218 364 11100
NM_012342chr104527 193 160 144 ------
NM_012345chr1361552 1441 1365 1292 505 258 31849 1629 1567 11853 --
NM_012347chr662234 1169 270 215 206 162 1389 32038 1201 430 1505
NM_012382chr5154365 4259 3806 3760 3354 3306 1693 1534 1187 885 843 830 697 199 22 11811 43232 1240 918 879 1437
NM_012388chr15112607 2573 2503 2034 1177 806 784 362 248 232 212 32642 2518 2309 23016 428 --
NM_012395chr7143299 3239 3207 3052 2474 2363 1247 1132 986 750 609 570 252 187 ----11071
NM_012398chr191258 ------
NM_012399chr2251955 1298 1291 708 492 --1635 --
NM_012414chr14862 836 710 62 --1255 --
NM_012416chr91796 2882 215 ----
NM_012419chr61548 ------
NM_012420chr1051876 1847 1605 1577 76 1150 --21882 1853
NM_012424chr12619 87 --2777 563 --
NM_012425chr1082740 2696 2641 494 400 308 139 112 --21997 553 --
NM_012428chr155862 678 319 237 136 1187 ----
NM_012430chr32748 540 --1527 --
NM_012431chr7122854 1392 1257 1084 621 483 441 389 297 260 213 91 23067 936 43002 2288 762 303 11422
NM_012434chr631621 328 44 1216 11447 --
NM_012443chr102866 102 1151 ----
NM_012446chr52556 485 --1133 --
NM_012448chr1742422 2347 1649 1585 11851 1308 12386
NM_012454chr66563 549 414 389 214 158 1450 143 --
NM_012463chr1251528 1279 494 348 260 --21288 333 --
NM_012464chr452900 2858 2772 2558 514 2559 247 21932 572 --
NM_012465chr1073370 3314 2455 2264 2160 371 287 12859 22852 207 --
NM_012471chrX81848 1822 1628 723 315 294 192 126 --21896 181 --
NM_012479chr772644 2252 2152 643 598 410 53 ----12678
NM_012482chr12142 52 ------
NM_012484chr52674 168 ----131
NM_013227chr151344 ------
NM_013230chrY51694 1391 1339 1170 511 --11151 --
NM_013231chr14124416 3608 1747 1594 1452 1419 1011 928 909 861 698 223 33527 1216 189 14264 13657
NM_013233chr261328 1131 1034 549 393 353 21290 429 1414 --
NM_013235chr52248 31 --1239 --
NM_013246chr113904 887 297 ------
NM_013254chr122677 495 1699 ----
NM_013255chr7318780 8355 7956 7385 7100 6929 6890 6791 6518 6325 6146 6004 5770 5648 5550 2741 2671 2397 2130 2051 2014 1968 1902 1722 1630 1504 1030 985 975 696 228 78404 7181 6499 2688 2327 1732 442 57835 7037 6256 3368 333 2502 268
NM_013257chr852215 1869 947 911 221 ------
NM_013261chr473032 3026 2826 2670 2415 1109 263 33582 3052 107 12436 --
NM_013262chr641398 1348 1264 924 --21095 411 --
NM_013263chr16139 ------
NM_013269chr1264336 4252 3871 3227 2744 1557 --24540 83 11402
NM_013281chr2021445 1220 --21108 294 --
NM_013283chr51865 2702 96 1813 --
NM_013286chr3103795 3634 3118 2961 2493 2437 822 267 110 51 ----23027 2443
NM_013293chr73637 277 123 ------
NM_013300chr122213 90 ------
NM_013302chr16104683 4322 3481 3003 1865 1851 1834 1606 1464 79 1135 24467 614 --
NM_013309chr155714 675 649 350 32 32515 587 282 --1549
NM_013320chr12140 ------
NM_013322chr771652 1597 1473 1192 1141 658 170 ------
NM_013336chr33544 441 172 ------
NM_013341chr262930 2854 2733 210 135 129 22903 281 1946 1856
NM_013352chr64908 690 652 267 ------
NM_013354chr861444 1423 1127 528 313 21 --2356 28 --
NM_013357chr81583 2228 135 1766 --
NM_013367chr41111 ------
NM_013372chr1573013 2944 2744 1091 1079 753 80 ----12762
NM_013374chr342925 698 474 303 2889 656 12985 --
NM_013381chr1271798 1644 1616 1497 879 172 145 ----3574 391 256
NM_013386chr1131794 1772 1516 1509 1498 1370 1351 1199 1159 726 697 629 519 1229 1342 1592
NM_013390chr941111 588 151 53 --1299 --
NM_013396chr213425 111 78 11142 1287 --
NM_013411chr132272 831 640 --21968 278 --
NM_013417chr93385 349 102 ------
NM_013433chr1921831 1359 --11282 --
NM_013436chr23602 301 243 --1310 --
NM_013437chr891432 1298 1211 1032 1012 959 935 366 57 ------
NM_013438chr961542 598 471 400 300 36 --11530 178
NM_013444chrX4434 193 169 38 --41136 1085 262 91 --
NM_013448chr141539 ------
NM_013449chr1292252 1852 1835 538 514 375 334 320 280 --22529 2372 --
NM_013450chr271240 1189 795 495 434 401 22 --1390 --
NM_013943chr162474 2235 1322 832 598 185 --32897 2724 618 12527
NM_013956chr8141 ------
NM_013957chr8141 ------
NM_013958chr81432 --1142 --
NM_013959chr81432 --1142 --
NM_013960chr83758 717 191 ------
NM_013961chr81432 --1142 --
NM_013962chr81432 --1142 --
NM_013964chr8141 ------
NM_013979chr51433 ------
NM_013986chr22143 1128 ----
NM_013989chr1455030 4024 3218 1855 155 24709 78 21324 974 12057
NM_013995chrX102530 2429 2245 1617 1607 917 818 788 492 210 32165 708 278 22616 2389 --
NM_013996chr72137 90 ------
NM_013996chr72137 90 ------
NM_013997chr72137 90 ------
NM_013997chr72137 90 ------
NM_013998chr72137 90 ------
NM_013998chr72137 90 ------
NM_014000chr1071718 1633 1601 1578 1434 1413 1333 1655 ----
NM_014003chr161404 ------
NM_014005chr551179 1059 374 209 98 ------
NM_014007chr92385 128 1438 ----
NM_014011chr25980 382 314 236 150 32335 2060 354 ----
NM_014016chr361525 1280 1071 433 374 356 31662 1212 674 21685 1356 11299
NM_014021chr173507 2950 2620 2592 2312 758 378 22382 566 23254 2898 --
NM_014023chr1052878 2855 2683 2661 864 --1190 --
NM_014028chr6133195 3083 2687 2433 2424 2060 1235 772 731 702 659 627 273 1799 23034 1188 21063 673
NM_014031chr52303 115 ------
NM_014034chr651454 1327 252 209 56 --11549 1388
NM_014043chr351631 1586 470 412 26 ----2644 288
NM_014048chr16154931 4890 4777 4687 4633 4137 1930 1515 902 876 856 631 600 456 253 1625 21574 1538 11313
NM_014055chr123456 69 30 1550 --1448
NM_014057chr951567 1502 1492 1458 639 --41574 1310 1231 645 --
NM_014079chr32843 76 --11066 1892
NM_014089chr1362279 2116 1961 1950 1927 1850 ------
NM_014106chr15152621 2431 2187 2099 1956 1182 1103 1015 884 565 429 254 121 62 44 22995 2212 12755 --
NM_014112chr8185448 5389 4963 4444 4323 4012 2040 1948 1911 1834 1663 1548 1485 1378 1002 844 809 779 198 --11442
NM_014117chr1652259 1772 762 746 335 --22198 2179 1397
NM_014141chr7105098 4932 3488 1993 1305 983 546 494 293 190 34292 1449 78 74391 3311 2145 2105 1415 1238 440 12025
NM_014143chr92466 222 ------
NM_014145chr202742 576 ------
NM_014153chr16----1614 --
NM_014154chr361444 1434 1293 1058 560 295 ----21137 1042
NM_014155chr11167272 6964 6606 6333 5177 4986 4762 4733 4693 2335 1849 1608 1423 799 781 438 32993 2957 2383 57047 2360 1777 460 413 26318 5804
NM_014160chr351370 1152 1124 432 295 ----11326
NM_014171chr25547 307 269 245 195 --2652 42 --
NM_014181chr292862 2621 2585 1840 1157 1044 938 819 533 --22421 873 --
NM_014191chr122347 322 ------
NM_014212chr12370 63 47 ------
NM_014217chr151781 1721 1508 1225 752 --11610 --
NM_014220chr33527 198 118 261 42 ----
NM_014223chr11693 1230 ----
NM_014225chr192401 387 --1325 --
NM_014231chr1232156 1900 715 --2632 578 --
NM_014232chr171156 ------
NM_014232chr171156 ------
NM_014243chr452051 1965 1847 508 160 ------
NM_014246chr2232008 1882 471 --12237 --
NM_014249chr151523 --1390 --
NM_014250chr2242049 1606 363 175 --11364 --
NM_014253chrX72460 2341 2241 1702 911 630 560 ------
NM_014258chr203694 626 480 2600 26 ----
NM_014263chr1041442 1006 549 70 11196 11365 --
NM_014264chr42566 458 ------
NM_014268chr1841392 1309 1303 1237 --11380 --
NM_014271chrX1334 --2806 340 1304
NM_014278chr41388 1343 ----
NM_014280chr13707 108 54 1297 1915 --
NM_014283chr141297 1006 422 343 ------
NM_014289chrX31179 1137 47 21295 1094 ----
NM_014294chr841360 542 259 248 --11485 --
NM_014309chr22105322 3935 3921 3782 2182 2176 2170 1030 687 140 --11037 --
NM_014313chr111627 --2481 101 --
NM_014319chr1261953 1845 1259 763 470 33 11793 11779 21210 197
NM_014320chr6----2234 129 --
NM_014321chr163800 755 654 ----1729
NM_014322chr131219 976 889 --21179 996 --
NM_014325chr1282141 2084 734 552 462 400 390 285 1812 22261 793 --
NM_014331chr4177810 6584 6310 6289 5881 5153 5138 4889 2817 2710 2593 2403 2143 1802 1540 478 123 --37360 4921 500 57775 6769 5971 5818 65
NM_014333chr1172656 1978 1888 1873 1857 1825 474 --52519 1019 465 355 233 --
NM_014342chr1141253 1201 482 235 21423 518 1421 --
NM_014344chr112821 781 1893 ----
NM_014345chr641067 1049 781 269 --1704 --
NM_014350chr581130 1024 1001 404 343 165 148 38 21063 104 21032 378 --
NM_014361chr114416 161 32 22 2499 463 ----
NM_014363chr1351280 1064 1046 994 467 21140 66 31254 1228 1184 11055
NM_014368chr972133 2015 1610 1370 459 397 389 11478 ----
NM_014372chr191819 1726 1619 1578 1468 1344 786 596 348 ------
NM_014376chr542578 2430 2284 896 22067 474 2942 332 --
NM_014379chr82938 733 2744 156 --2880 139
NM_014382chr391765 1704 1126 674 663 484 354 257 22 1471 ----
NM_014388chr1164800 4180 4095 3827 2442 1866 1632 1591 1238 1153 889 782 623 424 391 81 45309 3914 958 878 65882 5859 1659 1474 1401 1086 11379
NM_014393chr8112274 2245 2106 2041 1865 1711 1569 1473 921 179 122 1357 42187 2181 1639 944 --
NM_014395chr461985 1912 1663 1319 704 571 11364 1614 --
NM_014397chr931473 1432 49 --11083 --
NM_014409chr121141 1119 ------
NM_014411chr722028 151 1634 --21950 1589
NM_014415chr341100 549 434 226 ----21396 350
NM_014423chr5155317 5285 5062 5046 4629 3616 3606 2055 1594 988 861 418 305 201 183 11389 21820 359 1686
NM_014432chr661304 391 359 347 319 126 2620 598 1131 --
NM_014445chr331910 1662 1541 21830 131 --1790
NM_014447chr441587 593 264 43 1152 --1665
NM_014448chr1----1519 --
NM_014456chr1021627 376 --1463 --
NM_014458chr131101 199 103 1149 2383 304 --
NM_014462chr84307 250 131 121 ------
NM_014487chr4----1678 1702
NM_014488chr111265 1648 1506 --
NM_014489chr111863 ------
NM_014494chr1611682 ------
NM_014496chrX2212 99 ----1295
NM_014503chr121406 ------
NM_014504chr792030 1499 765 755 554 274 190 95 27 ------
NM_014505chr123469 377 369 --1448 --
NM_014515chr12----1251 --
NM_014517chr361789 1715 1637 1531 1201 732 11477 21932 726 --
NM_014547chr152827 195 1667 ----
NM_014547chr152827 195 1667 ----
NM_014548chr1541044 299 194 158 ------
NM_014552chr251566 1505 1157 960 321 ------
NM_014554chr1242344 1700 1459 802 ------
NM_014569chr71364 ------
NM_014570chr225855 251 147 112 24 ------
NM_014572chr1381767 1723 1532 1446 1196 510 339 272 11467 --21382 123
NM_014574chr1441271 1190 496 35 11580 --1975
NM_014575chr33174 161 40 --2150 46 --
NM_014577chr224864 717 591 337 1855 1141 --
NM_014584chr1461610 1567 1185 1102 559 116 1211 ----
NM_014585chr261114 943 428 409 266 57 --1971 11203
NM_014586chr2174547 4473 4338 3998 3562 3294 1751 14190 11526 --
NM_014587chr1681413 1407 1375 1366 1357 1250 622 598 11292 11347 --
NM_014588chr202764 143 2495 183 ----
NM_014592chr51814 ------
NM_014600chr241577 599 425 354 1619 --11505
NM_014606chr4101521 1415 1345 1079 1011 991 626 576 372 25 1534 ----
NM_014607chr272144 1927 1357 542 336 275 202 2308 284 11691 --
NM_014612chr941333 1296 1252 1203 ------
NM_014613chr542702 2689 592 364 23057 2475 3691 527 432 12177
NM_014614chr231099 394 334 ------
NM_014615chr1673580 3421 2829 2530 963 509 413 22641 774 32543 524 278 32837 835 467
NM_014616chr372395 2278 2159 1113 866 589 401 21193 905 13189 --
NM_014620chr123735 292 70 ------
NM_014629chr831369 850 459 11150 ----
NM_014630chr1583603 3129 3118 2682 2673 1017 238 220 1883 21326 212 --
NM_014633chr111437 ------
NM_014635chr251747 1738 1121 452 426 21566 1468 11678 11502
NM_014636chr931725 1296 754 14347 24372 833 14331
NM_014637chr841171 1080 1042 171 ------
NM_014647chr1652221 661 599 414 219 1905 22080 351 --
NM_014655chr182077 1622 1495 620 524 453 443 354 --12012 --
NM_014660chr74844 271 207 167 11036 1375 1722
NM_014663chr131095 1054 389 ------
NM_014666chr53949 866 355 1168 11304 --
NM_014670chr241186 1160 540 135 --11600 --
NM_014671chr781560 1527 1415 1261 556 198 183 42 1244 ----
NM_014673chr8169 ------
NM_014674chr3113841 3753 3710 2572 2434 1311 1224 948 736 523 399 22810 313 ----
NM_014676chr131679 1547 1215 1319 ----
NM_014677chr81890 --1951 11201
NM_014679chr1161240 1208 530 464 388 294 1516 170 --
NM_014682chr8122287 2119 2110 2058 1985 1783 1538 759 396 314 221 137 11899 1247 --
NM_014683chr1752125 1654 1434 1394 673 11791 21365 782 --
NM_014685chr161490 1421 --1514
NM_014686chr1932524 2133 2100 ------
NM_014689chr22543 88 --1628 --
NM_014693chr31716 ------
NM_014699chr162366 337 ------
NM_014701chr15133373 3224 3102 2747 2177 1265 1197 881 762 729 293 227 140 32648 2589 66 22677 723 23055 359
NM_014702chr6133430 2976 2951 2880 2595 2315 2148 1097 1074 985 833 738 423 22850 2444 33354 2885 1041 --
NM_014705chr7112056 1976 1844 1836 1768 749 675 578 565 424 131 11564 --1698
NM_014707chr751939 1590 1455 304 58 31493 1473 614 2656 278 11985
NM_014709chr26570 512 427 193 71 24 189 ----
NM_014711chr1682077 2068 2021 2013 2004 243 53 32 --32098 2032 305 --
NM_014713chr23365 348 129 ------
NM_014720chr1031596 1284 315 --21400 732 1550
NM_014721chr6187316 7310 7024 6974 6474 6326 6009 5909 2430 2305 1982 1974 1832 1662 1502 1048 602 58 55873 2255 1569 921 422 --27244 6663
NM_014723chr20193 ------
NM_014725chrX31109 1038 856 ------
NM_014727chr191265 ------
NM_014729chr872078 1854 723 702 180 170 63 ----1549
NM_014730chr1295285 4059 3730 1931 1901 1665 1279 620 549 31914 1238 197 14307 14633
NM_014730chr1295285 4059 3730 1931 1901 1665 1279 620 549 31914 1238 197 14307 14633
NM_014733chr561808 1476 791 505 280 201 2672 439 1686 --
NM_014735chrX62138 1563 1502 1495 707 614 21862 641 ----
NM_014739chr684174 3230 2790 1657 941 642 426 95 12556 22879 2569 --
NM_014741chr1152185 2116 1379 562 299 21807 1518 2805 510 --
NM_014742chr2031746 297 231 ------
NM_014743chr433023 2099 149 --33202 2421 835 --
NM_014746chr231491 1458 696 13921 53803 1573 1566 1545 1302 13538
NM_014751chr81453 1377 --12171
NM_014752chr1161672 1575 787 556 240 230 2390 304 ----
NM_014755chr2133694 3091 3060 2860 2766 1448 1261 1076 690 548 409 144 90 21703 1467 14268 --
NM_014757chr552101 1980 1521 428 78 --42360 2178 2025 616 --
NM_014764chr1231125 424 307 11077 ----
NM_014765chr172680 2521 2309 1988 1041 899 164 11073 1137 --
NM_014766chr763474 3414 2651 2604 674 29 1278 33192 3187 2495 --
NM_014772chr1853124 3111 2729 724 706 ------
NM_014774chr1133146 2998 2582 2394 2370 2044 1289 1276 1004 184 158 115 70 33244 792 359 ----
NM_014775chr22------198
NM_014779chr35995 887 790 441 430 ------
NM_014781chr811108 2267 123 1144 --
NM_014782chrX1333 ------
NM_014783chr1571550 1542 1526 1161 1116 633 168 --1182 --
NM_014787chr142797 2273 1991 1754 --12332 --
NM_014793chr152612 579 ------
NM_014795chr271176 1010 998 977 879 869 479 1275 --11016
NM_014797chr663163 2906 2462 2046 431 109 12071 ----
NM_014802chr1231150 1040 55 --1809 --
NM_014803chr1092672 2545 2375 1038 995 766 509 458 135 191 ----
NM_014806chr91467 ------
NM_014810chr151011 913 606 211 96 13674 22743 1284 1515
NM_014811chr92205 154 ------
NM_014812chr181971 1962 1940 1913 1907 1762 1385 135 --1441 --
NM_014819chr582346 2243 2113 1925 1919 1811 1529 835 11565 32263 2208 862 --
NM_014820chr361856 1517 1430 1373 127 107 --11397 --
NM_014824chr1131852 1798 171 ------
NM_014826chr184195 4037 3515 3497 1475 1146 347 254 14342 33300 3206 1571 --
NM_014827chr131657 1587 596 --11525 1184
NM_014828chr1431685 1638 1544 11998 3699 547 207 --
NM_014829chr562081 1749 823 781 659 362 1925 22283 1894 --
NM_014830chr1263920 2751 2689 2650 1502 1265 --11088 --
NM_014832chr1311741 12048 --21814 672
NM_014835chr2032189 2172 743 12049 1586 --
NM_014836chr1041703 1473 1467 281 --11305 22012 399
NM_014838chr2252401 2141 1760 611 407 --12891 --
NM_014839chr182296 2011 1986 1969 867 828 759 725 1550 2753 314 --
NM_014840chr1273428 3202 3183 3140 2921 349 233 22853 2596 22747 1190 --
NM_014841chr631226 554 227 11345 --1900
NM_014850chr353924 3456 1560 556 80 ----24659 3241
NM_014857chr1186 ------
NM_014858chr141032 998 767 275 --1150 --
NM_014859chr1711260 ------
NM_014860chr291748 856 812 703 632 603 571 556 334 21980 796 2683 169 11042
NM_014862chr1544126 3237 2661 1360 ----23984 3329
NM_014864chr154229 3873 3678 3541 1614 13104 ----
NM_014873chr1134604 4553 4538 4508 4422 3859 3831 1537 1507 1195 919 837 67 --23348 3299 14650
NM_014876chr2232194 293 246 ------
NM_014877chr17317653 7595 7354 7329 7191 7054 6886 6875 6619 6502 6308 6228 5664 5463 5082 4829 4800 2719 2529 2488 2443 2247 1348 1325 1233 982 700 456 450 180 133 27276 1357 46390 4976 2457 2380 --
NM_014888chr761604 1530 1497 1431 1290 146 1383 --1475
NM_014890chr32343 103 2312 259 ----
NM_014892chr62656 211 ------
NM_014893chrY52250 1958 1552 878 674 ------
NM_014897chr17103097 3000 2764 2158 1168 840 573 556 319 232 2779 629 --12369
NM_014898chr1952453 2300 1747 933 127 1388 --196
NM_014899chr572804 2708 2698 1254 1190 1042 268 13041 12664 --
NM_014900chr2--11050 --1793
NM_014903chr1232485 769 34 11607 32464 1817 201 --
NM_014904chr10173883 3297 3019 2927 2771 2754 2743 2721 2615 2609 2542 2495 1623 1554 1345 1264 837 1673 ----
NM_014905chr272041 2025 1942 1480 794 289 75 ------
NM_014906chr1793367 2955 2535 1645 1247 993 742 692 674 195 23726 1014 1341
NM_014909chr1432738 973 212 ------
NM_014912chr10173391 3372 3316 3166 3034 2803 2620 2601 2322 2307 1190 1157 873 856 606 400 154 --13227 --
NM_014913chr1831254 543 340 1270 --2179 134
NM_014914chr231336 942 831 ------
NM_014917chr13972 824 716 ------
NM_014918chr1551583 1252 1217 1160 46 ------
NM_014920chr6133755 3675 3426 3366 3168 2369 1420 1413 1131 440 240 214 49 32343 811 503 1632 --
NM_014923chr1382233 1677 739 652 491 465 71 39 --161 --
NM_014924chr1422686 2517 ------
NM_014926chr32371 269 ------
NM_014932chr362000 1484 1461 409 226 200 ------
NM_014933chr43379 308 133 ------
NM_014936chr692778 2559 2436 2218 1760 893 752 298 94 22605 1849 42793 1111 917 138 --
NM_014937chr1041292 985 237 36 --11267 --
NM_014939chr1831245 194 124 1506 11565 1453
NM_014942chr662438 2389 1935 698 624 212 1892 11014 11637
NM_014946chr2113058 2460 2386 1092 946 834 628 562 485 424 36 --22634 954 --
NM_014947chr173054 2285 2230 913 784 759 532 --21219 126 --
NM_014949chr12983 362 --1177 --
NM_014950chr1441731 1680 1123 1103 ----1703
NM_014951chr10132654 2536 2480 2436 2363 2307 2105 1975 1849 1814 1022 919 749 ------
NM_014952chr1512059 11997 ----
NM_014961chr441762 1555 651 585 1552 1254 --
NM_014962chr2072791 2417 1856 905 708 389 354 11067 32427 1887 536 12271
NM_014964chr1762427 1614 920 782 695 471 ------
NM_014969chr141068 1050 1016 926 1376 2977 446 31192 1074 1042
NM_014974chr101648 ------
NM_014977chr142523 517 ------
NM_014978chr1061801 1648 1490 1463 1272 44 --1564 --
NM_014982chr14214587 4511 4486 4394 4388 3877 3600 3515 3309 2135 2079 1779 1253 1155 1130 1123 1002 926 892 636 609 43342 1558 1534 729 24006 1167 --
NM_014988chr452357 2097 2009 856 579 22278 764 ----
NM_014989chr6111837 1827 1672 1547 1484 759 689 438 238 153 39 169 32084 502 393 --
NM_014990chr1441029 521 354 288 ------
NM_014991chr4113039 2941 2832 2826 2788 2536 2372 2234 1233 1023 346 --12500 --
NM_014994chr1532303 2287 658 --1176 --
NM_014996chr32960 743 ----1422
NM_014997chr772705 2579 2550 2316 188 116 58 --1200 12738
NM_014999chr1241425 1197 655 90 21563 1071 ----
NM_015000chr12102942 2871 2735 2651 2408 2199 1071 828 210 61 12418 52863 2163 2083 1019 971 --
NM_015001chr11780 ------
NM_015002chr1231803 814 579 22027 842 11424 --
NM_015005chr1431735 587 316 --11293 --
NM_015008chr362950 2842 2260 1307 892 809 13059 12657 --
NM_015011chr132743 390 --1436 --
NM_015012chr112378 363 ------
NM_015017chr141159 1033 252 91 --1127 --
NM_015018chr6146 ------
NM_015020chr1673219 2456 1188 1129 905 659 276 12778 23503 2767 --
NM_015024chr831322 1242 145 --11329 --
NM_015025chr262570 1062 554 284 152 30 12649 32010 1004 92 --
NM_015026chr12214699 4538 4249 4243 4132 3877 3505 3284 3072 2943 1749 1626 1572 1431 1311 938 692 625 613 543 330 33969 1055 355 34291 3254 1269 11660
NM_015027chr1621604 1376 1113 11826 --
NM_015032chr1342753 2123 1784 894 22495 2436 1137 1663
NM_015035chr20126666 6589 5957 5944 5779 2287 1929 1801 1727 1483 1352 626 36741 6699 1277 ----
NM_015037chr101238 ------
NM_015040chr283363 3328 3320 2616 2598 2522 745 453 12416 32672 2345 83 --
NM_015042chr1584339 4293 3193 2802 1459 1277 1237 823 --13605 13053
NM_015044chr1672922 2882 2834 2116 1004 820 547 23235 2776 149 12821
NM_015045chr10102280 2163 2150 2125 2083 1677 1623 483 477 302 --2661 267 --
NM_015046chr931820 681 486 --22210 2040 22414 1811
NM_015051chr9113051 2964 2494 2488 2194 2154 1317 1202 567 509 100 1840 12348 --
NM_015052chr741210 1035 503 120 --1348 --
NM_015054chr123506 411 93 1146 ----
NM_015057chr132462 191 --1448 --
NM_015059chr1593993 3983 3741 3427 3031 2729 1571 1058 651 ------
NM_015060chr72219 27 ----1226
NM_015068chr783944 3849 3674 3595 3535 3432 2668 1264 1987 23439 288 --
NM_015070chr1371490 1353 1185 646 227 157 120 ------
NM_015071chr556045 5379 2098 987 435 --32158 1664 1268 11572
NM_015074chr1114817 4321 4286 3647 1867 1552 785 694 442 348 117 --11908 --
NM_015076chr624521 4197 2538 418 1907 --
NM_015080chr112301 279 ------
NM_015082chr562089 1696 785 591 503 497 12406 ----
NM_015087chr13102433 2377 2146 1029 784 769 573 468 368 225 1758 12668 --
NM_015092chr16164632 4412 4369 4045 3630 3576 3192 3135 3056 3026 1217 1177 951 844 749 486 34405 3512 741 54425 3205 3010 1310 613 1727
NM_015093chr671861 1771 1702 1350 699 688 380 ------
NM_015094chr2244688 3940 1671 661 --13391 11789
NM_015097chr382188 1694 1629 777 672 433 396 285 ------
NM_015100chr11332 ------
NM_015110chr982383 2074 1734 833 775 765 323 105 1597 31625 1544 369 --
NM_015115chr4123078 3007 2793 2672 2497 2093 2061 1181 1155 652 586 94 1389 22400 317 1860
NM_015116chr1341725 1378 1248 253 --11639 --
NM_015120chr21280 --169 --
NM_015122chr191229 ------
NM_015124chr2212507 ------
NM_015125chr192556 485 ------
NM_015129chrX31704 1586 206 21426 127 21541 246 --
NM_015130chr441270 1249 1166 1085 1528 31236 1139 238 --
NM_015132chr741747 1481 1312 1225 ------
NM_015137chr892468 2457 2322 924 907 216 184 96 76 21665 626 ----
NM_015138chr1542803 2564 1859 21 --22744 1849 --
NM_015141chr342015 571 502 281 12470 22212 1803 12070
NM_015143chr461336 1300 580 283 273 263 --11328 --
NM_015144chr1693950 3275 3261 2802 2769 1427 1135 949 652 --1120 --
NM_015149chr142074 1783 786 504 ------
NM_015155chr1072739 1298 1229 1186 1123 527 208 23255 2632 11267 --
NM_015156chr1484004 3972 2815 2745 2465 924 398 133 23883 2538 1908 --
NM_015158chr9124 --1792 --
NM_015161chr1651541 1507 409 353 271 --21532 1437 11406
NM_015163chr1451662 736 289 283 200 --31693 1667 1428 11680
NM_015169chr81373 1337 ----
NM_015170chr8112352 2308 2020 1993 1867 1813 1642 1605 840 822 123 ------
NM_015172chr11511 ------
NM_015176chr141432 1305 402 162 --1198 11112
NM_015185chrX62762 2238 705 477 352 323 --22370 526 --
NM_015186chr94333 315 158 25 ------
NM_015191chr1152653 2391 1731 912 87 --1165 12406
NM_015192chr2092926 2764 2416 1999 928 895 544 507 405 22672 366 12774 --
NM_015199chr342873 2793 2671 533 32525 896 686 22532 978 --
NM_015200chr481661 1043 1007 635 558 504 364 285 --1152 --
NM_015203chr1181 ------
NM_015206chr1563620 3048 2925 2915 1209 811 13434 1502 --
NM_015208chr18173581 3498 3407 3226 3044 2682 2672 2610 2552 1514 1094 939 881 779 522 214 169 32826 1401 1344 ----
NM_015209chr162345 2213 2102 2050 804 296 --11707 --
NM_015213chr114686 244 183 171 ------
NM_015215chr173048 2501 2308 1123 840 562 39 --32124 819 462 --
NM_015216chr551565 1533 588 548 354 ------
NM_015225chr972614 2095 1199 942 603 289 187 21102 266 1925 --
NM_015226chr1653409 2419 713 636 477 --1448 --
NM_015230chr471871 1650 1617 1354 256 192 31 11384 1653 --
NM_015236chr441355 1301 1016 942 ------
NM_015238chr5168 ------
NM_015239chr91188 --159 --
NM_015245chr662737 2709 2535 2119 1912 1104 --11989 --
NM_015247chr1695397 5229 4963 4880 4078 4050 1940 910 157 14181 35236 4163 1315 14854
NM_015251chr1642373 2224 495 115 1278 --11542
NM_015252chr22928 332 2133 122 2751 47 --
NM_015256chr51184 --1581 --
NM_015263chr1561187 981 970 940 893 749 ------
NM_015265chr292313 2117 2071 1970 1761 1025 621 212 119 ------
NM_015269chr13623 212 177 ----1401
NM_015270chr1232155 1765 225 32346 1971 590 ----
NM_015271chr494003 3879 3664 3100 2625 1716 1558 1080 697 33483 413 181 33169 520 132 23576 3343
NM_015272chr165686 493 389 338 160 --1176 --
NM_015275chr1261966 1772 1696 683 636 180 11326 1793 1363
NM_015277chr1831271 588 504 31325 538 466 2403 367 --
NM_015278chr6103247 3108 3043 1138 746 653 591 570 247 241 21221 1040 --23323 2550
NM_015282chr262958 2702 2579 2484 1915 580 --1398 --
NM_015285chr1851732 1020 698 301 153 --11580 11846
NM_015286chr155595 551 393 211 71 1664 22093 115 --
NM_015288chr563659 3592 3567 2936 2369 131 ----1369
NM_015291chr173508 3418 3062 2539 2202 1315 225 11207 22607 1141 --
NM_015294chr1721062 786 --21127 106 --
NM_015296chr1321188 156 11104 1265 --
NM_015305chr1441943 1897 1641 341 ------
NM_015310chr8148110 6187 6120 5884 5433 3139 2219 2180 1779 1694 1682 1550 647 186 28154 1246 22636 1709 13048
NM_015313chr11184679 3975 3697 3652 3618 3392 3236 3085 3056 3008 1711 1678 1621 975 851 600 387 346 13169 14493 1557
NM_015314chr752267 564 408 328 171 --1494 11818
NM_015315chr51726 ------
NM_015317chr292526 2255 2062 2038 999 880 839 621 450 12237 12068 --
NM_015321chr1953587 3569 3325 1797 585 ----11003
NM_015323chr661747 1604 1078 567 488 258 2396 287 ----
NM_015328chr782771 2162 1015 925 864 539 137 90 11243 2776 668 --
NM_015330chr2222540 1990 ------
NM_015335chr12102650 2263 2248 2175 2156 2129 2030 1840 644 603 12377 ----
NM_015336chr12122586 2564 2548 2492 2398 2298 1942 1713 1683 912 618 379 11791 12443 --
NM_015338chr2071935 1622 1592 1461 1329 1249 427 ------
NM_015339chr2021005 273 1766 1148 1182
NM_015344chr842103 751 645 414 --32014 1614 1555 --
NM_015347chr12112995 2781 2694 2498 2272 1854 1121 1012 690 293 182 --12538 1404
NM_015349chr6122980 2906 2860 2815 2703 2006 1924 1112 681 486 426 293 12458 12404 --
NM_015352chr2063824 3804 3786 3335 3254 567 ------
NM_015353chr1742307 2152 440 236 1355 21129 956 --
NM_015354chr91161 ------
NM_015355chr1751990 1685 1654 771 356 3245 224 160 11789 1306
NM_015358chr2131222 1090 1060 ------
NM_015359chr832944 1981 1914 12782 22837 524 --
NM_015361chr25741 692 368 285 272 ------
NM_015365chrX144136 3912 3857 3782 3637 3583 3527 3047 2839 1273 1027 442 283 205 33760 3465 2683 43943 3880 3255 343 --
NM_015367chr2221553 455 11587 ----
NM_015375chr184312 4118 3993 3919 3898 3797 3092 327 --137 --
NM_015379chr72217 76 ------
NM_015381chr2251720 1327 461 450 444 ------
NM_015382chr141739 --3702 583 556 1227
NM_015385chr1083258 3188 2988 2836 2625 2267 232 27 ------
NM_015387chr261993 1777 1345 813 679 154 1745 ----
NM_015393chr473510 2694 2623 1519 1156 964 43 1887 2375 347 --
NM_015396chr341078 528 476 427 ------
NM_015397chr92520 183 --1231 1340
NM_015409chr1242694 2621 2250 1926 ------
NM_015412chr372845 2385 2191 1088 635 579 190 --32060 1071 566 --
NM_015423chr1131632 1589 1295 ----194
NM_015429chr33350 315 281 11085 2980 368 --
NM_015431chr183470 2753 2727 2477 1290 1011 513 225 1334 2621 550 --
NM_015432chr162643 521 ------
NM_015435chr861385 1249 1107 1097 269 209 ------
NM_015436chr493150 3099 2804 2795 2131 1226 1047 962 315 --33047 1310 744 32411 2258 1088
NM_015446chr151569 1507 1400 1180 400 1262 11336 --
NM_015455chr583955 3032 2836 1164 655 261 130 94 2700 395 ----
NM_015457chr1111095 ------
NM_015458chr8134839 4287 3581 3224 2106 1780 1604 1512 1475 1220 1024 668 245 13391 34306 1616 610 14685
NM_015460chr362080 1945 1448 429 300 91 11332 ----
NM_015462chr171265 ----160
NM_015463chr25830 529 265 138 49 ------
NM_015464chr74920 675 659 60 ------
NM_015469chr96653 575 564 493 306 93 1205 1190 1682
NM_015475chr271013 851 764 758 437 316 192 ------
NM_015484chr19956 924 855 814 654 263 239 209 176 1777 2797 787 --
NM_015496chr81227 ------
NM_015497chr1531082 411 219 1891 ----
NM_015508chr381592 1522 1381 1045 1032 399 199 26 --1522 --
NM_015509chr1251221 1202 1147 533 179 --21352 1278 1356
NM_015511chr203361 310 161 --21122 71 --
NM_015513chr3195 ------
NM_015514chr145600 557 505 145 138 ------
NM_015520chr382666 2348 2085 2032 1923 936 922 770 --12550 --
NM_015535chr254137 1522 908 466 188 --24212 3596 1168
NM_015541chr331359 1309 318 --31342 1283 963 --
NM_015548chr66870 729 672 150 130 44 ------
NM_015550chr7133594 3531 3484 3467 3452 3228 3053 2931 2833 1146 1091 818 35 --13458 11250
NM_015553chr6135183 4033 3862 3780 3771 2037 1860 1512 1119 1113 1020 967 731 1560 14462 --
NM_015554chr1582685 2396 2322 1874 1794 1158 865 388 22476 242 22377 935 1810
NM_015555chr671739 1697 585 444 380 352 126 11627 ----
NM_015560chr382819 2629 2583 2491 1958 1089 720 309 --11134 1920
NM_015564chr523577 2543 ----1243
NM_015565chr21112303 2143 2104 2034 659 492 446 243 182 167 132 12196 42264 1584 675 103 1780
NM_015569chr1124844 4703 4626 4576 4546 3852 3627 901 789 394 300 259 21398 1130 34595 1925 843 2642 502
NM_015570chr751318 737 532 504 229 --1460 1411
NM_015571chr682482 2278 1947 964 941 916 214 29 22367 376 --12397
NM_015575chr273484 3473 3276 2427 1479 1260 347 23635 2724 22369 951 1822
NM_015576chr3122972 2954 2752 2740 2372 2108 1885 1189 626 374 350 208 --22604 2464 --
NM_015577chr511269 --21533 1284 --
NM_015578chr1942119 1571 1455 847 1278 32038 502 176 12034
NM_015601chr106975 962 836 391 326 109 1290 ----
NM_015602chr121655 1309 --11821 --
NM_015608chr102663 138 ------
NM_015626chr1761054 833 288 183 163 107 ----1325
NM_015630chr241140 353 224 197 1844 1216 --
NM_015634chr10------1556
NM_015635chr941498 1478 352 272 1863 --22096 1846
NM_015640chr1105391 5054 4779 4386 3469 3313 2145 1538 1202 274 24475 4323 55167 4691 1571 1119 735 --
NM_015641chr751221 1194 1133 995 945 ------
NM_015646chr1271279 1163 1070 1052 853 339 202 1323 ----
NM_015652chr102581 54 ------
NM_015657chr2----2423 305 --
NM_015660chr72291 22 ------
NM_015675chr191558 --1620 --
NM_015676chr141287 ------
NM_015678chr1361409 1393 1327 464 450 428 --1162 1255
NM_015691chrX132941 2523 2308 2036 1971 1847 752 427 358 348 283 229 45 ------
NM_015695chr652147 2025 1860 1721 527 1234 ----
NM_015696chr12540 170 178 1527 --
NM_015702chr21304 --2266 96 1111
NM_015713chr8123512 3370 3314 3273 2790 2619 2352 2335 2290 2206 1375 677 ------
NM_015832chr182219 138 150 ----
NM_015833chr2122141 449 --2787 352 --
NM_015844chr181982 ------
NM_015846chr181982 ------
NM_015847chr181982 ------
NM_015850chr862239 1639 834 821 525 450 1898 11881 --
NM_015866chr141244 1133 524 181 --11253 --
NM_015869chr3----1171 --
NM_015872chr131715 1385 304 ------
NM_015878chr81709 12036 12221 --
NM_015879chr18158647 8157 7986 7888 7814 7085 6902 6675 5492 5215 2767 2075 1735 1566 576 37503 5230 633 18537 11359
NM_015885chr113803 766 357 ------
NM_015886chr8195433 5152 5074 5063 4825 4721 4715 4237 4223 4196 3795 3760 3731 2295 1964 1738 937 849 619 12209 44784 4308 2157 1400 15312
NM_015888chr1123401 3332 3308 2986 2833 2168 1277 1045 980 860 826 804 --21061 499 1922
NM_015902chr82888 668 2772 704 1928 --
NM_015904chr21519 ------
NM_015906chr1164720 4543 3990 3904 3836 3440 3031 3008 1599 1503 1136 1098 975 759 710 605 34495 962 496 24835 4485 21854 1658
NM_015912chr85940 769 757 715 208 1585 ----
NM_015938chr33931 395 380 1895 ----
NM_015946chr53764 733 668 ------
NM_015948chr61386 ------
NM_015949chr72946 734 ------
NM_015980chr531324 1306 184 ------
NM_015984chr13479 414 33 --1380 --
NM_015986chr17101345 1271 1256 1199 1174 1157 343 298 203 73 ------
NM_015990chr43943 431 344 --2910 389 --
NM_015994chr14189 --3698 233 151 --
NM_015995chr1585598 5173 5147 4803 4599 1748 1273 1141 11036 ----
NM_016006chr31258 ------
NM_016009chr1134840 4710 4410 4360 3914 3901 3773 1461 1451 659 572 412 259 1166 11589 24576 711
NM_016018chr8122856 2729 2672 2598 2509 2367 2252 1992 1899 1821 1046 304 22829 1832 32808 2794 2706 1612
NM_016021chr672941 2425 975 624 517 297 93 42318 1979 908 40 --1556
NM_016023chr8102172 1642 1478 849 830 694 591 561 455 55 --11992 11662
NM_016025chr1611955 11235 31597 1239 153 11360
NM_016027chr83445 72 30 2374 124 1189 --
NM_016032chrX11312 11275 ----
NM_016037chr141185 1091 769 206 ------
NM_016040chr152255 2169 2129 816 620 22281 1791 ----
NM_016045chr2071293 1184 1131 669 238 71 64 ------
NM_016048chr52936 239 ------
NM_016060chr1751109 956 723 165 48 ------
NM_016061chr271404 1311 1251 1187 1143 1085 595 --11273 1419
NM_016072chr12102444 2096 1801 1735 930 702 413 378 345 43 22219 575 1517 1972
NM_016073chr152911 220 ------
NM_016075chr13102440 2204 2136 2037 1944 998 942 528 370 167 13180 ----
NM_016076chr193235 2506 2441 2047 2033 999 826 809 382 22826 460 22067 241 --
NM_016078chr1741060 901 833 129 --3440 408 169 --
NM_016081chr482182 2123 2056 1864 1742 1685 874 350 11831 ----
NM_016083chr673836 3763 2963 1411 944 661 609 --33666 3607 2790 13883
NM_016087chr731651 1134 561 11536 --11206
NM_016090chr113809 770 306 ------
NM_016096chr862067 2059 1504 1367 366 305 11874 11519 11487
NM_016098chr61446 --1196 --
NM_016100chr202145 56 ------
NM_016103chr51363 ------
NM_016107chr561365 1151 402 250 244 167 21389 355 1427 --
NM_016121chr121156 140 ------
NM_016125chr171232 ------
NM_016131chr282388 2230 2008 1533 786 618 365 138 --21973 791 11527
NM_016132chr15123355 3125 2931 2728 2573 2378 1197 1130 1123 1074 968 579 12253 2766 588 --
NM_016133chr21488 ----21655 186
NM_016138chr1651528 1431 1195 313 92 11286 21560 1163 --
NM_016144chr54289 191 104 49 --1488 --
NM_016147chr1131153 1139 448 ------
NM_016185chr172540 322 1808 --1829
NM_016194chr1531374 1270 387 --2343 70 --
NM_016200chr73529 271 141 1282 ----
NM_016201chr321644 214 --11429 --
NM_016203chr74704 679 277 123 ------
NM_016205chr431376 590 400 2928 320 --1106
NM_016206chr3288947 8761 8470 8164 7995 7200 7185 7156 6674 6047 5753 5493 3408 3267 3199 3180 2541 2282 2189 2137 1975 1942 1518 1238 976 775 260 199 47970 7940 7839 5634 58416 8107 6268 3487 208 --
NM_016211chr43379 308 133 ------
NM_016213chr151214 1180 ----
NM_016217chr683304 2822 2632 2586 2442 1396 1032 922 12970 33399 2409 117 148
NM_016218chr581253 902 837 379 289 138 94 45 1413 1197 --
NM_016221chr532366 2205 811 177 1821 11698
NM_016224chr651801 1745 208 171 141 --1414 --
NM_016226chr121387 ------
NM_016227chr141297 1006 422 343 ------
NM_016231chr1711474 ------
NM_016240chr811662 ------
NM_016248chr13163945 3837 3777 3691 3616 3540 3348 3105 3066 2957 2815 2512 1230 765 647 176 33019 736 520 13934 --
NM_016252chr24720 317 197 159 ------
NM_016255chr6133351 3237 3147 2946 2849 2764 2122 1230 969 915 348 277 257 22314 1035 12769 --
NM_016258chr11250 ------
NM_016260chr2247625 7475 6963 6580 6481 6444 6177 6010 5932 5383 4975 4758 2910 2361 1999 1657 1244 1046 851 675 509 240 139 105 11520 87582 6586 6199 5862 5709 1362 748 562 25898 5389
NM_016269chr41855 1847 --1998
NM_016271chr1892344 2330 2208 2196 1579 905 768 310 284 32292 2064 265 --1343
NM_016272chr2262305 2223 2154 918 247 224 --1120 12145
NM_016274chr1176 ------
NM_016275chr352492 2384 2252 1734 811 1467 22586 2464 --
NM_016277chr641497 1391 649 430 ------
NM_016281chr123829 469 347 --21088 878 --
NM_016282chr941584 589 571 138 --51714 1470 1334 124 118 21330 657
NM_016284chr161959 --1621 --
NM_016287chr151723 1590 489 101 47 1828 ----
NM_016289chr222216 1684 3913 758 707 1693 --
NM_016299chr10185 ------
NM_016300chr32182 35 ------
NM_016302chr32796 128 1182 1325 --
NM_016306chr32383 91 ------
NM_016308chr162053 2004 1858 1847 1276 45 --42020 1767 1415 608 --
NM_016312chr124515 443 405 89 1180 1530 1379
NM_016315chr231860 210 176 11634 11818 21737 72
NM_016322chr952700 2121 951 703 62 --2538 444 --
NM_016339chr1711369 ------
NM_016340chr541186 954 448 164 --1360 --
NM_016351chr71565 --1584 143
NM_016355chr121419 ------
NM_016356chr652448 2201 1016 859 187 12333 3961 454 192 --
NM_016357chr124915 501 206 112 ------
NM_016374chr131269 992 400 11224 ----
NM_016374chr131269 992 400 11224 ----
NM_016376chr1724298 1063 33393 3173 1741 33914 3259 1183 --
NM_016377chr691753 1553 1483 1144 1104 515 352 133 47 1374 11310 --
NM_016395chr1551947 1283 733 468 379 31665 1345 559 ----
NM_016396chr15122957 2881 2752 2417 2335 1875 1856 1003 655 456 359 114 ----1411
NM_016410chr94627 598 165 141 ------
NM_016422chr11103008 2607 2486 2442 1137 830 545 355 225 120 1440 1877 1567
NM_016423chr141318 ------
NM_016424chr1761805 1774 522 492 467 444 ------
NM_016436chr2062670 2103 2013 1014 880 367 1985 11094 --
NM_016441chr262209 2130 865 686 401 85 1849 12257 --
NM_016448chr181806 1625 1583 1341 1248 1231 608 474 ------
NM_016451chr112286 117 ------
NM_016454chr152233 45 ------
NM_016456chr1178 --1886 --
NM_016472chr1421412 569 2509 277 1119 --
NM_016475chr1431279 1022 496 --21173 251 --
NM_016485chr611406 1265 21979 379 1692
NM_016499chr112545 514 163 153 --
NM_016506chr114571 453 259 191 1485 1617 --
NM_016507chr1783217 2705 2497 2467 2292 2159 620 576 12229 1924 1227
NM_016513chr6133755 3675 3426 3366 3168 2369 1420 1413 1131 440 240 214 49 32343 811 503 1632 --
NM_016516chr24859 816 734 602 1335 ----
NM_016522chr1151465 1399 1208 1195 164 --21471 1075 --
NM_016530chr1583963 3829 2746 1586 1352 1113 491 51 1321 32890 584 291 43757 3689 2764 1525
NM_016531chr474103 4084 4069 3865 3853 2896 1271 34156 3462 1381 --13800
NM_016536chr191256 147 178 --
NM_016538chr171348 --1455 --
NM_016542chrX61689 1643 1464 273 256 187 11188 --1692
NM_016547chr1------1733
NM_016559chr351495 1329 1047 972 501 1987 ----
NM_016575chr12125446 5294 4768 4516 3932 2180 1876 1753 1424 430 121 84 13767 24965 2185 --
NM_016577chr363851 2775 865 329 196 40 1238 153 --
NM_016584chr124297 278 250 217 ------
NM_016587chr711018 --2216 182 11094
NM_016588chr62724 182 --1159 --
NM_016599chr421455 1344 ----1186
NM_016603chr521847 1736 21995 1534 12135 1250
NM_016604chr531247 1101 415 --11204 --
NM_016605chr522225 2112 --32323 2169 2127 1340
NM_016607chrX31346 249 211 --21322 1314 --
NM_016613chr4112592 2571 2408 2255 2206 2191 2135 1895 1749 649 555 12782 22486 840 11004
NM_016614chr62806 171 --1744 --
NM_016620chr121436 1019 1486 11353 11298
NM_016621chr1174608 3873 3765 1303 1026 869 401 14526 23125 1044 --
NM_016623chr82496 104 --1111 --
NM_016626chr1891773 1752 1371 1309 1249 1165 1150 534 471 --11257 --
NM_016631chr213220 150 29 --2348 179 --
NM_016639chr161500 ------
NM_016640chr51115 ------
NM_016644chr55549 493 425 182 160 ------
NM_016647chr811453 ------
NM_016651chr1431156 980 268 197 ----
NM_016652chr2051358 671 136 125 32 187 2602 291 --
NM_016654chr1551343 1255 1232 1081 1012 --2976 31 21214 171
NM_016655chr15189 ------
NM_016824chr1041818 1620 698 658 1365 1350 1288
NM_016836chr22228 130 ------
NM_016839chr22228 130 ------
NM_016929chr6144622 4488 4440 4205 4034 3798 3651 3214 2970 2842 2826 1083 802 542 11346 14318 --
NM_016936chr1611952 ------
NM_016940chr213535 223 88 --1444 --
NM_016941chr191394 --154 --
NM_016946chr153016 2668 1121 128 97 --22576 1266 --
NM_016950chr43934 183 128 --11418 11210
NM_016952chr1153449 3378 344 175 112 --24018 1289 --
NM_016953chr2125897 5883 5707 5534 4980 4888 3837 1722 1634 1231 493 364 25252 972 33791 3720 420 14638
NM_016954chrX8656 650 568 494 470 256 115 54 ------
NM_017412chr831053 250 146 --2462 428 11383
NM_017413chrX52494 2410 1968 154 70 1953 ----
NM_017414chr222571 133 1372 ----
NM_017415chr584537 4261 2939 1665 1591 941 674 92 1575 23676 2909 11837
NM_017420chr14103828 3801 3545 2329 1181 1094 937 913 755 687 --33438 807 406 12566
NM_017423chr492209 2050 1902 1785 1637 809 633 438 358 21778 569 1872 --
NM_017426chr41553 --2700 653 1230
NM_017437chr1452327 1493 549 404 292 21552 1542 32371 609 465 12449
NM_017440chr126519 487 442 139 106 57 ------
NM_017447chr21154320 4171 3618 3433 3292 3243 2897 1331 1177 950 700 581 491 443 383 1527 32671 1583 798 24234 3892
NM_017450chr1721509 1488 ------
NM_017452chr2061434 1270 1173 933 596 478 ------
NM_017453chr2061434 1270 1173 933 596 478 ------
NM_017454chr2061434 1270 1173 933 596 478 ------
NM_017455chr155862 678 319 237 136 1187 ----
NM_017457chr192168 25 ------
NM_017489chr81197 ------
NM_017490chr111269 ------
NM_017516chr1141066 783 701 161 --21107 245 --
NM_017519chr62922 916 11223 --11072
NM_017520chr131578 1214 ----
NM_017522chr131295 562 498 --11226 --
NM_017545chr204505 161 52 32 --1577 1155
NM_017548chr351849 1345 868 831 779 ------
NM_017549chr741460 1398 1307 250 11529 11134 --
NM_017569chr133337 244 109 --152 --
NM_017577chr341599 1546 521 154 11573 ----
NM_017580chr1071979 1675 958 712 627 525 441 ----1419
NM_017581chr42277 124 ------
NM_017588chr911898 ------
NM_017596chr1114623 4159 3535 1373 1243 1237 1229 1222 449 105 85 22900 1215 13204 --
NM_017599chr1272017 1841 1492 1479 1384 443 237 --21628 1472 --
NM_017610chr1552132 1900 1524 1358 1331 21304 427 22121 745 --
NM_017617chr94353 195 164 155 ------
NM_017626chr1051761 1330 1288 542 225 --11425 --
NM_017629chr151722 1468 782 666 145 2567 434 11257 --
NM_017633chr683954 3323 3112 2683 2654 2633 879 860 11251 12798 33339 2778 2689
NM_017634chr861883 1570 1562 1553 1297 307 --22004 587 --
NM_017635chr1141471 1373 462 191 21334 37 11448 --
NM_017637chr9219266 9245 8459 8337 7667 7390 7094 3435 3362 3199 3121 3022 2940 2464 2439 2039 1995 1928 1150 861 158 49137 6022 1237 892 29320 6458 12762
NM_017640chr61822 --1128 --
NM_017641chr1271146 1035 823 809 443 295 231 ------
NM_017643chr1762925 2496 1123 791 649 611 --1537 --
NM_017644chr3175197 5136 5112 5023 4919 4806 4691 4623 4411 4035 2042 1954 1788 1563 925 366 225 34507 3635 1904 13223 --
NM_017649chr102346 267 11017 ----
NM_017650chr7135895 5578 5386 5276 4983 4566 4517 3711 3673 2420 2062 1924 1048 34083 1199 1143 35281 3886 1469 11479
NM_017655chr161604 1467 1281 1076 605 273 ------
NM_017658chr14214618 4606 4545 4263 3932 3749 3689 3340 1427 1405 1346 1316 898 616 562 516 507 444 347 147 96 1462 21711 1251 --
NM_017661chr1541171 1147 486 428 11182 11192 --
NM_017666chrX72203 2158 1752 1691 1676 1640 543 1762 1874 --
NM_017672chr1531315 1207 1181 ------
NM_017673chr12878 854 --1903 --
NM_017680chr931011 844 139 ------
NM_017691chr153388 353 40 --1377 --
NM_017693chr1351665 1563 1443 1072 531 11230 --21614 491
NM_017694chr261571 443 398 388 256 117 ----1751
NM_017705chr1553810 3674 2966 2442 271 31322 1040 253 --2872 361
NM_017709chr174233 4178 4049 3762 2757 1633 539 11035 24092 3402 --
NM_017714chr201796 --2377 256 1672
NM_017719chr392331 2211 2194 1866 1705 1590 979 728 114 --22481 1596 --
NM_017724chr33741 625 235 ------
NM_017734chr13211 156 84 ------
NM_017736chr16113134 3123 3117 2913 2888 2770 923 838 707 460 98 1649 12699 --
NM_017737chr171806 1735 1573 1433 860 439 266 --11983 --
NM_017739chr11198 --1203 --
NM_017741chr462432 2263 2004 1993 1814 831 ------
NM_017742chr1861934 1892 1872 1818 1683 1663 21806 1523 31224 756 399 1784
NM_017745chrX4709 635 260 74 --1221 --
NM_017752chrX82146 1979 1813 1544 1451 467 398 267 21891 278 ----
NM_017753chr91817 156 ----
NM_017754chr6134716 4638 4485 4387 4187 3941 1762 1702 1252 1136 739 656 169 13808 33965 822 349 --
NM_017758chr1731455 367 331 ------
NM_017761chr111439 1994 ----
NM_017762chr1582281 2232 1932 1812 936 567 170 156 --1447 --
NM_017766chr11583 ------
NM_017768chr15692 665 342 276 195 ------
NM_017769chr14133214 3050 2621 2383 2241 2145 2061 1197 1154 986 503 413 285 33006 2041 238 11183 22945 64
NM_017772chr641790 1720 581 353 ------
NM_017779chr182274 2009 1798 795 708 275 218 105 --1401 1593
NM_017780chr82871 196 ----1765
NM_017784chr341236 1150 1100 897 ------
NM_017786chr82616 488 ------
NM_017789chr22834 52 ------
NM_017798chr204359 342 167 160 ------
NM_017799chr142663 616 11359 1691 1622
NM_017811chr9103158 3095 2805 2741 2564 2557 1998 1984 778 745 --22798 796 13030
NM_017812chr71288 1563 --1733
NM_017813chr8255814 5520 5329 5177 4709 4503 4442 4257 4039 2317 2221 2215 2026 1943 1428 1237 1156 1054 1039 917 527 345 211 186 145 54894 4864 4393 4123 1494 25771 1530 34450 4204 1322
NM_017819chr31216 ------
NM_017822chr125777 729 515 234 62 --124 --
NM_017824chr1092469 2460 2448 2254 925 868 796 643 214 1669 12485 --
NM_017826chr131643 1758 ----
NM_017831chr1894210 4193 3429 3203 3069 1471 1369 981 970 14359 ----
NM_017845chr41778 --1649 --
NM_017848chrX144542 4446 4022 3901 3683 3193 2859 1656 1266 1142 623 616 604 272 14103 34160 3149 51 24370 2972
NM_017864chr8127 ------
NM_017867chr4--133 ----
NM_017870chr111205 ------
NM_017880chr2------1305
NM_017890chr841659 1196 381 264 1291 ----
NM_017902chr1075618 4668 4399 4055 2072 1970 1767 --23998 1647 --
NM_017905chr131197 --1475 --
NM_017913chr9196 1436 ----
NM_017915chr1241137 328 245 104 --11164 --
NM_017919chr985851 5658 5426 5358 3726 1729 1404 1121 14367 21804 1531 15335
NM_017921chr1742274 1963 664 369 --11689 --
NM_017922chr142501 54 --1208 --
NM_017933chr251571 1305 1163 596 257 ------
NM_017935chr44559 520 228 46 1177 2791 645 --
NM_017938chrX42139 2014 507 47 154 --11857
NM_017944chr1163035 2993 2198 1898 1188 570 32725 2283 2164 --2991 423
NM_017946chr761386 358 352 108 96 73 --21048 267 --
NM_017952chr284564 4041 3303 1616 1502 909 782 476 --33893 3839 3700 --
NM_017954chr761195 1183 547 374 120 55 ------
NM_017964chr23779 349 55 ------
NM_017969chr22198 172 ------
NM_017974chr231314 1249 1046 ----11255
NM_017987chr10112064 2007 1936 1834 1574 1521 891 645 627 471 164 --12094 --
NM_017988chr123339 314 93 1822 1959 133
NM_017998chr971402 1171 983 411 359 106 84 11057 ----
NM_018000chr241929 1691 1578 104 21822 349 11540 --
NM_018003chr15102365 2103 2001 1917 1874 870 703 585 336 191 ------
NM_018004chr31302 ------
NM_018008chr3----170 --
NM_018010chr371500 1376 1234 1061 1039 1023 551 158 11565 --
NM_018011chr13------1595
NM_018014chr23487 431 174 --11377 --
NM_018018chr1231842 1591 1575 ----21852 699
NM_018027chr1032892 2736 2194 --12201 --
NM_018030chr183797 363 219 ------
NM_018048chr1261943 1927 1827 1314 163 55 1369 2820 430 1625
NM_018051chr73273 264 129 ------
NM_018061chr121450 1087 --11411 --
NM_018062chr22477 396 ----1366
NM_018063chr102437 37 1353 ----
NM_018064chr6------1113
NM_018070chr1--1241 ----
NM_018078chr45945 750 652 378 109 ------
NM_018079chr22145 33 ------
NM_018084chr2123186 1285 1208 1156 1033 882 687 588 565 536 403 395 22523 2084 32809 2281 79 --
NM_018086chr221715 371 --51558 1496 1402 1362 774 1720
NM_018092chr1661447 1167 643 609 406 229 2574 501 11017 --
NM_018094chrX173 1297 ----
NM_018095chr114571 453 259 191 1485 1617 --
NM_018098chr321050 782 --11043 --
NM_018105chr821039 98 11220 21211 951 --
NM_018112chr94796 707 408 240 ------
NM_018115chr42509 155 ------
NM_018117chr102283 249 1697 ----
NM_018120chr83512 312 202 ------
NM_018121chr1062781 2693 2001 1957 1124 460 12024 12209 --
NM_018126chr431364 602 57 --1590 --
NM_018131chr102929 767 183 ----
NM_018133chr351750 1724 1703 818 800 11983 11990 --
NM_018142chr81178 ------
NM_018150chr11606 ------
NM_018155chr3133445 3183 3087 2558 2543 2414 2266 1244 943 879 497 448 166 11232 12521 12303
NM_018157chr1263198 3162 1048 992 96 32 12614 11055 --
NM_018159chrX31695 660 539 1493 ----
NM_018164chr122222 70 ------
NM_018169chr124559 483 394 64 1133 1534 --
NM_018171chr124857 843 389 205 ------
NM_018177chr42796 740 1768 152 --
NM_018178chr131968 1633 1535 11520 1187 21369 1323
NM_018184chr371963 1849 1737 1548 777 515 317 1383 2741 127 --
NM_018195chr1161600 1528 1487 1471 518 230 --22034 732 --
NM_018200chr1582366 1954 1808 1787 451 445 118 45 --22477 2163 --
NM_018202chr11225 ------
NM_018203chr12280 90 ------
NM_018211chr142176 1590 1369 1355 --1405 --
NM_018214chr64511 498 420 64 21148 479 ----
NM_018221chr21457 ----136
NM_018227chr4133227 3210 2627 2562 2498 2270 2253 2165 2068 1281 1099 1029 787 --32786 2074 1974 1985
NM_018241chr42904 790 ------
NM_018243chr4163862 3753 3574 3450 3359 3333 2768 1103 959 913 766 575 532 288 244 86 --13172 --
NM_018247chr662543 2402 1219 1196 557 251 31105 1008 759 1147 1899
NM_018254chr152169 1762 1619 568 316 ------
NM_018257chr20102597 2320 2185 2099 2016 1938 1728 1663 574 402 --22531 2437 --
NM_018270chr203803 755 742 1643 ----
NM_018279chr1242589 1094 853 325 12669 --11207
NM_018286chr172846 205 --2