TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548b-3p
miRNA Sequence: CAAGAACCUCAGUUGCUUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51421 --1130 --
NM_000084chrX44680 2709 2357 1892 36158 2172 1880 15093 --
NM_000088chr1721285 549 21358 174 ----
NM_000109chrX52416 2300 1951 1879 262 12512 12118 1121
NM_000125chr614171 33711 806 160 ----
NM_000162chr71175 --1835 --
NM_000165chr641698 1296 1068 325 ------
NM_000189chr251511 1503 815 245 135 1733 11754 --
NM_000192chr1241333 1323 1315 360 --11178 --
NM_000208chr1954129 4041 3598 1253 277 23452 327 3725 504 495 --
NM_000214chr2041471 393 380 52 --1711 --
NM_000217chr1244011 3645 1949 1486 --11294 --
NM_000245chr731471 691 528 --149 --
NM_000248chr373054 2465 1142 1034 951 736 80 12761 13082 12234
NM_000271chr182665 565 ------
NM_000314chr1072487 2328 2304 2154 1128 470 169 ------
NM_000318chr832266 1146 205 32815 1172 1162 12160 --
NM_000321chr13185 21583 386 ----
NM_000332chr6117072 6367 5988 5273 4385 2696 2484 2472 2466 1998 1495 34773 1955 1576 12732 16379
NM_000337chr576452 6269 6002 5262 2325 1699 1090 --35827 2125 628 15089
NM_000346chr1751391 1278 125 107 99 11262 ----
NM_000368chr943034 1894 1071 447 --1163 --
NM_000393chr2--12129 11565 --
NM_000430chr1773349 3123 982 936 885 876 347 --21508 1191 --
NM_000436chr52424 33 21278 237 1104 --
NM_000448chr111377 --32865 2313 29 --
NM_000462chr15----21715 302 --
NM_000489chrX62298 1347 1161 1112 495 486 22524 413 12737 --
NM_000495chrX21121 875 1849 --1421
NM_000523chr24428 223 217 131 1252 1357 1237
NM_000555chrX67831 6697 6685 4761 2038 1175 26741 107 ----
NM_000600chr7------1396
NM_000610chr1192096 920 894 887 880 874 576 158 144 --12953 --
NM_000641chr1911417 --1385 --
NM_000701chr11247 ----1230
NM_000767chr192232 226 --1969 --
NM_000793chr1425127 3363 --13901 14661
NM_000801chr202948 34 --1742 --
NM_000801chr202948 34 --1742 --
NM_000806chr521782 493 ------
NM_000817chr231180 387 182 ------
NM_000826chr41206 32633 2116 1963 12323 --
NM_000827chr552561 1751 408 196 143 --22582 2555 --
NM_000828chrX71872 1690 875 703 692 545 368 ------
NM_000829chr111348 --2930 229 --
NM_000840chr73518 371 23 132 ----
NM_000868chrX42606 870 503 179 1118 ----
NM_000875chr1596906 6531 6397 6182 5300 5284 4880 2584 1289 14727 26491 2600 --
NM_000891chr1763421 2656 2611 2425 651 260 33231 2456 344 --1241
NM_000899chr1263846 3556 3274 2780 1389 131 13957 ----
NM_000917chr103939 762 709 --1170 --
NM_000926chr11128627 8378 8293 7649 6914 6096 3729 2615 681 567 154 92 39294 1544 82 19127 1692
NM_000934chr17----1691 --
NM_000944chr42938 95 --1786 --
NM_000945chr232025 1416 734 --11938 --
NM_000958chr531298 1247 266 ------
NM_000962chr942820 2090 598 229 ----2360 259
NM_000965chr33864 357 92 ------
NM_000983chr131571 606 35 11080 ----
NM_000990chr1143645 1129 932 110 14050 31044 417 66 --
NM_001001132chr211405 ------
NM_001001331chr352414 2278 1687 475 249 12690 2389 368 --
NM_001001342chr1041201 1016 466 395 --1369 --
NM_001001394chr2125 ------
NM_001001395chr1262290 2182 2071 1819 617 251 12830 ----
NM_001001396chr194311 4051 3391 3288 2845 2832 2762 845 756 11170 13521 34333 3249 1111
NM_001001433chr2022598 194 --22021 188 1427
NM_001001481chr883381 2927 2204 1370 1248 1235 1049 337 12894 ----
NM_001001484chr1051990 1528 868 418 293 ------
NM_001001520chr19----2186 128 --
NM_001001586chr12471 120 ----1454
NM_001001664chr233975 1325 1218 24041 1389 12500 --
NM_001001852chr223938 738 177 --1871 --
NM_001001890chr2152940 2754 868 698 678 23428 1019 --23266 544
NM_001001936chr10----11191 --
NM_001002026chr32542 289 ----12348
NM_001002032chr17--1155 --1211
NM_001002838chrX41492 1276 218 88 --134 11546
NM_001002843chr1541285 1087 1031 273 1209 ----
NM_001002901chr12476 325 ----1115
NM_001003407chr1094800 4723 4713 3575 3460 3239 1698 1059 947 34362 3971 3379 14856 11019
NM_001003652chr18208459 8365 8296 7877 7623 7564 6306 6200 6150 3448 2838 2767 2147 1657 1594 1378 1327 1048 675 665 47297 5311 1363 1224 1658 16249
NM_001003674chr1855861 5434 4836 4725 2155 67045 6951 6153 5926 5734 4977 11980 --
NM_001003712chr1241349 886 805 629 23508 1236 ----
NM_001003792chr31125 2982 166 1473 --
NM_001003800chr942531 1325 1104 751 --12376 --
NM_001003810chr41634 --1333 --
NM_001003940chr1523818 97 12475 22457 358 1559
NM_001004065chr973937 3891 3821 3048 2607 1533 633 14011 12805 --
NM_001004127chr13----1688 --
NM_001004304chr1273094 3087 3046 2148 926 385 379 23171 214 --1505
NM_001004317chr634446 1360 22 24346 4252 --21021 553
NM_001004342chr133777 1606 1372 2912 905 --14265
NM_001005386chr272377 1990 1640 777 682 626 570 11765 12304 --
NM_001005404chr1774225 3653 3301 3009 1141 1086 641 33778 3542 1124 14349 --
NM_001005463chr1022072 1934 ------
NM_001005473chr594997 4633 4594 4042 2648 1183 675 315 262 16602 12420 14191
NM_001005782chr25993 830 715 401 60 ------
NM_001005849chr172433 38 ------
NM_001006600chr53718 426 270 32021 764 626 --1227
NM_001006610chr1641002 918 903 329 --1375 --
NM_001006946chr231488 534 512 --11223 --
NM_001007024chr1764301 3458 3398 2897 1384 237 1212 ----
NM_001007097chr964944 3550 3498 1531 1082 122 ----14732
NM_001007099chr12808 150 ------
NM_001007246chr2121667 250 1267 2626 458 --
NM_001007277chr112755 423 --1360 --
NM_001007278chr13104332 4291 3676 3529 3355 3327 2002 1633 938 333 25204 2018 --14057
NM_001007466chr6164960 4937 4705 4594 4571 1752 1587 1581 1575 1568 1555 1542 934 361 300 277 13646 1552 --
NM_001007546chr211449 11539 11238 --
NM_001007553chr141133 1106 891 66 ------
NM_001008222chrX41056 359 256 112 --1451 --
NM_001008226chr1531779 196 47 ------
NM_001008239chr1873803 3708 2716 1348 1342 1317 346 13669 43687 3154 2676 1327 --
NM_001008272chr3----1123 --
NM_001008392chr352535 2332 1047 858 151 22561 2378 ----
NM_001008393chr452928 2479 2070 677 138 22306 2088 22241 148 --
NM_001008408chr7115116 4948 4881 4054 2566 2282 1333 926 824 299 249 --24523 4232 --
NM_001008495chr852012 1869 1759 420 253 1123 32178 1728 461 12266
NM_001008540chr22357 137 2367 98 1437 --
NM_001008564chr1332124 1687 306 ------
NM_001008708chr21240 1527 ----
NM_001008710chr83424 418 182 --11417 --
NM_001008738chr512180 2806 393 ----
NM_001008801chr1931982 1761 1468 21897 1637 1279 32004 466 111
NM_001008895chr134970 309 209 197 ------
NM_001008925chr44902 730 533 428 13224 ----
NM_001009554chr473410 3365 3119 2984 1570 1467 492 13442 23870 419 14039
NM_001009555chr431322 1275 73 --11136 --
NM_001009571chr731112 216 50 --1179 1540
NM_001009881chr1--3421 239 197 ----
NM_001009899chr334722 1768 627 24004 2391 11322 11638
NM_001009955chr1----1376 --
NM_001009960chr732694 1143 1130 1992 --11041
NM_001010853chr652925 2883 2308 2236 83 --32150 1251 1235 --
NM_001010861chr122111 747 ----1467
NM_001010867chr175341 5144 2172 1962 1242 925 729 26041 5456 16230 --
NM_001010888chrX24582 3367 11247 24412 822 --
NM_001010891chr5126549 6184 5458 5085 4926 4863 4259 2670 2268 2128 1220 698 14487 --11200
NM_001010924chr102949 797 --11026 --
NM_001011537chr322316 1454 32173 1894 209 22186 139 --
NM_001011666chr795414 4980 4305 2310 2126 1958 1891 1021 108 24130 862 26297 2519 --
NM_001011713chr1451221 1001 615 450 211 --11060 --
NM_001012270chr1761973 1746 1480 412 404 388 --11337 --
NM_001012393chr1195013 3362 3297 2072 1304 795 205 135 100 --14054 --
NM_001012614chr42531 253 1271 ----
NM_001012761chr532510 1066 192 --32407 1027 24 --
NM_001012977chrX11366 11416 ----
NM_001013031chr1023461 859 12478 13451 1139
NM_001013399chr62215 150 --1416 1804
NM_001013415chr441615 1290 518 373 ------
NM_001013438chr33982 643 183 ------
NM_001013690chr1242043 810 730 402 1586 1214 --
NM_001014809chr43700 269 73 ------
NM_001015508chr84576 221 215 208 1562 ----
NM_001015877chrX42578 2479 2047 1068 1749 ----
NM_001015881chrX51287 1173 1029 68 54 ------
NM_001015887chr321613 317 ----11721
NM_001017371chr231136 1000 199 173 ----
NM_001017395chr363199 2684 2428 2293 195 139 1922 32692 863 725 --
NM_001017415chr1------2241 128
NM_001017440chr788273 7426 7382 6822 2341 2153 964 225 26216 610 15882 --
NM_001017930chrX5968 385 317 280 116 ----1592
NM_001017977chr11114 --1105 --
NM_001017995chr553475 2949 2934 1751 1447 --14706 --
NM_001018037chr941257 1075 505 227 --11089 --
NM_001018064chr951933 1696 1581 1365 569 1561 ----
NM_001020658chr131286 1211 1165 ----1399
NM_001023567chr1512361 --12242 --
NM_001024218chr141319 ------
NM_001024226chr11184 ----1389
NM_001024401chr16------12862
NM_001024596chr1963543 3515 3470 2486 1456 554 13652 22812 136 --
NM_001024649chr512707 2410 290 12030 --
NM_001024660chr341397 1349 1108 631 ------
NM_001024808chr1212025 ----1467
NM_001024948chr163254 3233 2400 1260 1234 268 --23175 2755 11130
NM_001024948chr163254 3233 2400 1260 1234 268 --23175 2755 11130
NM_001025076chr10146173 5879 5462 4037 3911 3818 2066 1885 1574 1299 1051 833 549 165 24306 523 12027 --
NM_001025079chr373436 2845 2832 2639 1391 1248 239 33609 3461 166 13840 --
NM_001025105chr51243 --1453 --
NM_001025201chr24651 524 197 145 ------
NM_001025232chr121295 --1373 --
NM_001025252chr8----22615 2179 --
NM_001025366chr621816 1649 --21382 1294 --
NM_001025580chrX74055 3971 3747 3090 611 482 310 23100 430 1251 --
NM_001029860chr82341 315 ------
NM_001029875chr572961 2868 2133 1980 1167 1088 934 1220 2315 94 --
NM_001029884chr632393 1838 1805 32598 2132 267 21822 541 --
NM_001030007chr1623670 3314 --13611 --
NM_001031684chr231383 1027 932 --11122 1206
NM_001031695chr2274741 4543 4210 1745 675 627 171 35449 3789 1721 14555 --
NM_001031709chr101112 ----140
NM_001031712chr6199 --1387 --
NM_001031716chr21372 2150 30 ----
NM_001031732chr442941 1055 489 325 22377 286 12988 --
NM_001031804chr1664063 3621 646 626 384 314 23356 1492 1726 --
NM_001031812chr522370 308 --21989 370 --
NM_001032293chr17------1247
NM_001032296chr1382777 2695 2613 2109 2014 617 30 24 42923 2328 2050 253 12197 --
NM_001032999chr2064713 1668 1355 1349 1213 705 --25236 1374 15182
NM_001033045chr223987 3037 23460 60 11138 --
NM_001033047chr432628 2047 582 21741 360 1146 --
NM_001033087chr20--13076 --12981
NM_001033503chr51115 1380 ----
NM_001033557chr211156 1250 ----
NM_001033659chr17------1375
NM_001034841chr1685523 5335 5297 4983 4029 4023 3780 418 11963 45155 4017 3412 1163 21052 362
NM_001034852chr1462039 567 371 284 252 163 ------
NM_001035260chr10--1608 11286 --
NM_001035chr111028 ------
NM_001037131chr21975 ------
NM_001037163chr71938 1807 ----
NM_001037164chr772015 1773 1476 1448 1440 1434 37 11942 ----
NM_001037165chr7158880 8860 8337 8331 7647 7315 7309 6620 3023 2743 2578 1839 1215 1159 575 --11502 --
NM_001037582chr441704 216 195 140 ------
NM_001037954chr1132231 1182 664 --11319 --
NM_001038702chr541922 1077 250 158 ------
NM_001039140chr20------1497
NM_001039348chr2--1412 --1954
NM_001039479chr1452230 2107 2035 1811 1802 ------
NM_001039538chr263644 3358 2462 1454 920 476 12302 ----
NM_001039577chr174199 2872 1641 1040 986 951 146 1517 ----
NM_001039590chrX43719 3632 3422 1492 --33734 3182 1499 --
NM_001039618chr11115686 4706 4693 4627 3883 2359 2166 1591 1474 1340 1163 ----11803
NM_001039690chr1642364 1883 1723 167 --11621 --
NM_001039762chr1042376 1900 918 206 11913 ----
NM_001039937chr1343872 1567 716 296 ------
NM_001040057chr721062 108 11503 ----
NM_001040110chr751618 1607 1506 1339 497 ------
NM_001040152chr764524 4006 3452 1791 1756 1463 ------
NM_001040158chr53416 399 158 1178 ----
NM_001040402chr443186 2541 2034 887 12744 --12874
NM_001040429chr1343016 1451 1191 156 ----12318
NM_001040441chr122144 2138 11476 --34375 3582 1089
NM_001040665chr754669 4093 1126 941 910 13950 13989 13198
NM_001040712chr993569 3384 3247 3234 3195 1002 986 846 506 --1647 --
NM_001042355chr1685033 4667 4534 1460 1343 622 547 441 --2743 223 --
NM_001042414chr132118 87 ------
NM_001042440chr5----1127 --
NM_001042473chr1012059 2857 633 11622 1742
NM_001042494chr1543828 3785 820 719 --23590 897 --
NM_001042506chrX11123 ------
NM_001042510chr851762 1754 842 722 335 11641 21710 878 --
NM_001042533chr343300 3237 2268 314 13131 1401 12398
NM_001042548chr21794 1319 1210 --
NM_001042555chr12114756 4450 4303 3797 3576 3523 3442 3168 989 852 776 22960 43 ----
NM_001042599chr256604 6394 6161 2962 1110 14986 22372 647 --
NM_001042601chr392893 2799 2429 1304 900 851 803 144 103 --1883 22941 246
NM_001042749chrX21378 216 31756 1471 475 ----
NM_001043318chr1454170 4136 3191 1166 269 ------
NM_001068chr3----1118 --
NM_001100108chr1128223 7319 5381 5083 3181 2489 2404 2397 2379 1500 902 74 18191 57626 6987 2747 2389 804 --
NM_001107chr14------148
NM_001109977chr42249 45 --130 1776
NM_001167chrX96511 5510 4994 4724 2234 1087 1046 977 812 41390 710 474 35 16659 12628
NM_001198chr632293 2169 747 ------
NM_001204chr2127736 7184 6794 6668 6614 6244 6216 2451 1512 1362 833 197 21726 444 ----
NM_001206chr973079 2970 2110 2056 1114 298 292 1165 2286 278 --
NM_001219chr7--11612 ----
NM_001226chr4--1647 1656 --
NM_001256chr1762499 2210 2204 1169 398 261 1389 22378 441 12519
NM_001278chr1041201 745 449 67 ----11226
NM_001280chr193224 211 127 --1588 --
NM_001290chr43925 785 291 --1904 --
NM_001293chr113559 529 126 ------
NM_001304chr1753819 3601 3073 902 491 13763 21113 440 --
NM_001326chr112384 307 1424 2140 94 --
NM_001332chr551585 1103 635 583 75 --11110 --
NM_001343chr521486 418 --11357 11323
NM_001351chr351858 1572 188 159 41 1320 ----
NM_001356chrX32186 2081 997 ----1853
NM_001365chr17----1514 --
NM_001380chr103735 716 678 1853 --1777
NM_001383chr17160 ------
NM_001386chr842020 1821 1680 96 --11829 12256
NM_001390chr1843201 2654 2646 2297 23659 862 13009 --
NM_001396chr212398 54 32368 2094 38 1279 22021 486
NM_001408chr121661 259 ----11540
NM_001412chrX92908 1152 1146 1139 1133 1127 616 536 206 11202 33219 2769 147 --
NM_001417chr1221771 1291 1407 21951 1659 --
NM_001419chr1964817 4448 4315 1574 1225 1154 54621 4241 1534 1166 393 --1139
NM_001420chr1932501 2470 1191 --1285 --
NM_001424chr161186 --188 --
NM_001427chr741940 1474 207 128 --1243 --
NM_001430chr24710 657 359 71 1229 21545 532 --
NM_001432chr421444 394 43554 3445 3370 139 --13690
NM_001440chr8------1314
NM_001448chrX41291 1117 441 306 1116 1330 --
NM_001455chr663969 3408 1618 741 418 386 ------
NM_001497chr942180 980 701 369 --11887 --
NM_001498chr631312 1103 371 1898 ----
NM_001530chr1431067 218 180 ------
NM_001560chrX32547 2098 335 ------
NM_001609chr1074109 3669 3656 1161 813 458 162 2442 251 ----
NM_001613chr101121 ------
NM_001614chr171643 --1592 --
NM_001635chr7------143
NM_001655chr11175 1715 21944 771 --
NM_001660chr33768 300 187 ----1624
NM_001663chr1452731 1688 863 320 160 ------
NM_001664chr3----1668 --
NM_001699chr1941602 385 335 303 --11440 --
NM_001709chr1162586 2565 592 568 430 145 12904 11958 --
NM_001718chr6----11328 --
NM_001755chr1641768 415 274 206 1534 11889 --
NM_001759chr12115294 4644 3758 3517 3413 1912 1851 1349 1108 75 69 14831 31940 1932 1680 15143
NM_001792chr1811047 1949 2795 23 --
NM_001795chr16----21467 1417 --
NM_001801chr5125 1438 ----
NM_001806chr1982890 2495 1095 822 713 568 370 192 1281 2364 209 --
NM_001830chrX23493 3218 23370 1570 33969 3144 438 --
NM_001859chr943448 3088 299 204 --1389 --
NM_001949chr642801 2793 2787 790 12266 22053 891 --
NM_001964chr551094 920 430 245 115 ------
NM_001965chr2----1427 --
NM_001969chr1453310 3219 1481 1351 306 ----13248
NM_001980chr1241816 1730 788 559 12016 12166 --
NM_001981chr122318 521 1892 --1392
NM_001995chr441425 934 577 305 11073 1138 --
NM_001999chr561490 1480 1400 1391 548 464 --11474 --
NM_002006chr475518 3902 3712 3642 1748 1308 523 ------
NM_002009chr1592782 2558 2552 2290 1946 1882 930 867 802 ------
NM_002015chr1363180 2978 2476 2087 728 372 22936 1108 1379 --
NM_002017chr113288 132 100 21023 322 --11036
NM_002025chrX109192 7747 7674 6985 5750 5658 2989 1111 775 734 38942 5768 118 --19049
NM_002026chr22189 91 --1858 --
NM_002039chr46905 884 643 356 350 313 1602 ----
NM_002048chr921280 839 11299 ----
NM_002056chr21872 ----1806
NM_002069chr73583 326 146 1615 ----
NM_002070chr3------1266
NM_002074chr121460 1098 ----1591
NM_002077chr91761 1815 --185
NM_002078chr32508 238 ------
NM_002126chr1743812 1446 977 705 21130 439 23557 1608 --
NM_002128chr1362382 2031 1686 1627 312 21 1117 1266 --
NM_002129chr41344 --1322 --
NM_002137chr732167 1992 435 --22074 1849 11478
NM_002202chr5--1281 ----
NM_002230chr1711080 --11094 --
NM_002232chr1----1538 --
NM_002264chr344240 3400 561 483 --24624 3420 13496
NM_002267chr1342442 2390 1762 938 ------
NM_002268chr3------11501
NM_002270chr5115575 5537 4929 4911 4771 3858 3807 2165 2155 1995 476 --34138 2109 592 --
NM_002271chr1362150 1885 1754 883 777 80 2826 716 1531 --
NM_002293chr142063 1817 1048 196 --12469 --
NM_002334chr1142010 1344 1320 683 --11332 --
NM_002336chr1274556 4329 1906 1710 1264 1025 898 --11277 --
NM_002356chr682515 2166 2064 1056 978 308 164 78 1800 ----
NM_002382chr1421142 1109 --1507 --
NM_002395chr621222 517 ------
NM_002401chr1742205 2145 1635 407 ----11560
NM_002442chr1221756 422 --11465 11517
NM_002449chr5------1254
NM_002455chr1----130 --
NM_002482chr13192 172 38 --2460 128 --
NM_002486chr912261 --130 1431
NM_002499chr1531535 975 543 12467 32169 1581 1543 --
NM_002501chr1934006 2578 2550 12572 --12628
NM_002519chr112545 335 1323 ----
NM_002524chr11821 --2298 261 --
NM_002547chrX64055 3576 3448 3442 1284 49 23115 964 14048 --
NM_002577chr394053 3931 3554 2792 2483 1598 1355 964 376 --13461 --
NM_002595chr1251715 1698 1580 1544 205 31771 447 162 11855 --
NM_002605chr1511099 11054 11197 --
NM_002607chr721286 1215 ------
NM_002641chrX31618 1465 91 1351 185 --
NM_002646chr11737 --1507 1485
NM_002655chr844076 3860 3268 1146 12032 --23444 1652
NM_002657chr2041527 1439 946 29 ----23909 3807
NM_002660chr20--1853 2845 69 --
NM_002670chr351613 1506 1102 341 332 ------
NM_002687chr1431262 947 484 2523 503 1820 --
NM_002699chr121238 1016 --1550 21227 561
NM_002707chr21268 ----1276
NM_002709chr262390 2289 905 840 397 353 23018 965 ----
NM_002710chr122403 209 --1760 --
NM_002711chr71102 ------
NM_002715chr531243 1010 468 11186 1912 --
NM_002716chr1142619 1429 854 181 3945 222 66 --1587
NM_002731chr163144 2970 2206 647 481 297 12750 ----
NM_002736chr742069 1940 810 634 --1109 12088
NM_002737chr1756301 4290 4278 2086 1110 35674 5479 4854 36492 4269 1371 --
NM_002745chr2254107 3290 3023 67 54 --14120 24279 3132
NM_002748chr153407 133 127 21088 1075 ----
NM_002816chr171257 --182 --
NM_002819chr19--1139 21247 1014 --
NM_002834chr1253530 2545 1645 902 797 13934 11207 --
NM_002843chr1143218 3129 3103 504 183 --1992
NM_002844chr641057 921 550 447 21433 189 ----
NM_002851chr7--1735 --1776
NM_002868chr1242373 2342 2087 398 1547 22366 1906 --
NM_002869chr1122166 866 --12201 1806
NM_002892chr143462 446 249 21386 1189 11417 --
NM_002896chr11----1443 --
NM_002906chr1151536 829 612 188 27 ------
NM_002911chr1931678 560 330 --1548 --
NM_002918chr19----1865 --
NM_002941chr32505 315 21060 123 --21166 168
NM_002942chr341191 905 571 175 1348 ----
NM_002959chr194045 3526 3194 1784 1719 1519 1395 292 286 22825 1228 ----
NM_002971chr32303 296 21138 316 ----
NM_002998chr82857 86 1864 ----
NM_002999chr2031352 1312 670 --21245 177 --
NM_003010chr1731529 1518 697 2887 85 ----
NM_003017chr61320 1968 1492 11176
NM_003022chrX3865 464 124 ------
NM_003034chr1267965 6820 6380 5803 2522 49 --1450 --
NM_003036chr1----1494 11027
NM_003042chr352270 1775 1418 532 526 ----11373
NM_003069chrX1261 ------
NM_003070chr91328 ------
NM_003074chr372126 1860 1747 1429 799 755 350 --12182 --
NM_003076chr1221569 654 11552 21149 546 --
NM_003107chr622189 472 12448 12441 --
NM_003108chr2127282 5819 5708 5049 4847 2130 1800 1523 1067 1010 806 349 24478 240 15570 --
NM_003113chr24738 304 133 21 1114 1258 --
NM_003136chr14------1308
NM_003144chr612134 11550 31619 811 199 --
NM_003150chr17--1357 12339 11457
NM_003155chr822410 271 --12612 --
NM_003161chr1742874 2717 2360 1321 1917 12601 --
NM_003185chr20--11304 11032 --
NM_003200chr1942263 861 852 835 --1600 --
NM_003211chr1211635 1474 1189 --
NM_003221chr654130 3903 3210 746 201 --21353 260 --
NM_003234chr32922 715 --11666 12059
NM_003246chr1521916 1711 --11895 --
NM_003253chr2131617 135 117 21894 1848 ----
NM_003257chr154977 903 895 347 ------
NM_003275chr93194 136 120 ------
NM_003298chr386065 5947 5203 4332 4162 2275 794 293 15799 ----
NM_003324chr12------11466
NM_003338chr1021975 1872 31661 1349 329 151 1237
NM_003342chr1763315 3168 1276 1098 389 68 --12410 1802
NM_003344chr731505 1175 1088 11621 11216 1112
NM_003348chr1211414 1343 --11121
NM_003370chr192663 639 1802 ----
NM_003371chr942161 1957 1670 1626 --42120 1897 1840 1635 12138
NM_003390chr112975 776 1865 1884 --
NM_003392chr353338 3310 3285 1579 930 23648 2992 173 181
NM_003394chr122717 636 --1506 --
NM_003400chr24623 614 135 22 ------
NM_003406chr821332 84 ----21399 151
NM_003409chr1831307 576 566 11157 ----
NM_003410chrX73102 2621 2391 2306 2250 1930 1194 ----12062
NM_003413chrX31988 1712 147 --11924 --
NM_003423chr191703 11900 22138 1984 --
NM_003442chr112712 670 ------
NM_003452chr93896 710 671 11005 1382 1881
NM_003453chr133517 502 186 --1484 --
NM_003454chr1611399 ------
NM_003458chr323804 467 11160 ----
NM_003471chr322232 2121 ------
NM_003472chr61617 11506 --1306
NM_003478chr1132063 689 637 1425 23035 324 --
NM_003482chr1211923 32771 2299 840 12359 --
NM_003483chr1222816 2658 32055 1937 1810 ----
NM_003489chr2143421 2305 2294 574 1824 --12756
NM_003507chr241858 1507 594 142 11693 ----
NM_003557chr141636 1404 1214 436 --1485 --
NM_003566chr1253251 3118 2856 1187 416 1852 1616 --
NM_003574chr18105360 4767 4389 3940 1863 1047 967 543 292 279 14050 --14436
NM_003580chr82434 130 1517 ----
NM_003583chr1263492 2590 1492 1278 1041 452 4347 198 165 88 --13655
NM_003590chr22683 62 1795 ----
NM_003597chr271931 1621 1505 1492 468 208 136 --1222 1377
NM_003607chr154211 3361 2889 2781 811 --14080 --
NM_003615chr343646 3614 1282 871 1583 13684 2205 118
NM_003618chr241332 1287 1205 1164 ------
NM_003626chr1111279 2298 148 ----
NM_003629chr163372 1124 464 236 181 27 152 1264 --
NM_003651chr121418 ------
NM_003654chr11145 165 --1562
NM_003677chr1221679 323 11903 ----
NM_003685chr192897 837 2735 715 ----
NM_003692chr91244 1187 ----
NM_003701chr133953 918 709 ----1214
NM_003762chr121439 189 11184 ----
NM_003774chr1243305 2437 939 545 ----13212
NM_003787chr1841410 1353 682 512 ------
NM_003819chr13265 239 195 ------
NM_003822chr143131 2348 2018 1981 --22944 328 --
NM_003825chr155555 531 486 352 234 --1286 --
NM_003831chr1821575 1548 21518 1314 ----
NM_003861chr1452728 2648 1921 1875 318 ------
NM_003864chr4273 53 ------
NM_003873chr1041986 1784 1013 602 12064 ----
NM_003884chr331568 1430 68 --21781 649 --
NM_003885chr171779 --32485 2304 137 --
NM_003887chr271564 1558 1551 1445 1415 748 187 1173 ----
NM_003901chr1042374 2073 1975 155 --150 1182
NM_003902chr12827 103 2731 217 ----
NM_003913chr664087 3466 3356 1375 1316 988 21391 325 13027 --
NM_003922chr15--1171 ----
NM_003930chr742422 2136 1792 448 31890 1704 255 ----
NM_003934chr951259 498 349 325 309 --11161 21241 73
NM_003939chr1031294 1288 309 --24141 3065 --
NM_003941chr711563 ------
NM_003948chr452647 2631 2324 1690 100 11715 1288 --
NM_003955chr1761418 1302 1296 1290 1284 1277 --11387 --
NM_003957chr1121012 821 --1773 --
NM_003972chr101365 2389 287 ----
NM_003980chr641367 935 461 110 11188 --1526
NM_004064chr1211207 1267 1226 --
NM_004075chr12------1146
NM_004093chr1343171 2524 2121 837 13263 12896 --
NM_004094chr1443068 932 889 658 22387 782 ----
NM_004100chr612706 --1227 1879
NM_004102chr1----1168 --
NM_004114chrX2983 367 --11088 --
NM_004117chr662221 2004 1660 1545 459 348 22180 1529 ----
NM_004145chr19----1354 --
NM_004161chr231280 1030 457 --11497 11292
NM_004170chr931740 238 172 ----1355
NM_004171chr11138637 7364 6700 5998 5832 5826 3835 3472 3119 2601 2392 1761 280 23434 2783 --28394 6080
NM_004177chr1111181 --21798 1386 --
NM_004180chr21181 1419 1405 153
NM_004205chr111533 ----1541
NM_004229chrX21853 367 21652 1645 1356 --
NM_004232chr181213 23001 498 21511 188 23510 1266
NM_004238chr22306 229 1266 ----
NM_004272chr521567 585 11873 11396 --
NM_004274chr1473074 2902 2295 1062 1038 730 214 ------
NM_004279chr73797 569 335 --11458 --
NM_004281chr10------195
NM_004293chr932699 101 45 ----13267
NM_004302chr1232809 2674 1955 22758 1988 ----
NM_004305chr2188 --165 --
NM_004311chr1031978 435 88 12969 13038 --
NM_004329chr1021443 98 148 21347 232 1258
NM_004349chr831125 420 84 ------
NM_004364chr1931179 1133 1056 --11040 --
NM_004375chr172358 265 ------
NM_004392chr1361830 1815 934 552 321 128 22546 241 1687 --
NM_004393chr31398 22330 493 11459 --
NM_004396chr17132 --1190 --
NM_004397chr1174213 3724 3513 2991 1006 541 420 --24304 87 1249
NM_004426chr123695 495 203 --1424 --
NM_004428chr14785 758 743 166 1611 ----
NM_004429chrX21363 420 1371 11357 --
NM_004431chr11109 ----1571
NM_004432chr911554 ----1227
NM_004437chr172438 1310 1303 1191 917 630 589 --21027 269 1905
NM_004444chr72581 156 ----1828
NM_004447chr12133 ------
NM_004449chr2111163 11323 ----
NM_004458chrX32642 284 49 22649 256 ----
NM_004463chrX3613 601 592 --1148 --
NM_004480chr145827 550 526 520 514 --1504 --
NM_004501chr143034 1189 960 250 11633 1557 --
NM_004502chr17----1205 --
NM_004504chr251112 1052 648 640 477 --12481 --
NM_004516chr1921007 401 1175 11027 --
NM_004529chr931302 83 40 11463 154 --
NM_004559chr1----1244 1269
NM_004575chr411255 21514 356 --1566
NM_004593chr31771 --1300 --
NM_004596chr19----1217 --
NM_004612chr994211 3437 3182 1306 774 592 478 269 54 13719 21465 786 11560
NM_004615chrX1748 ------
NM_004643chr145866 714 706 690 684 ------
NM_004655chr1731215 896 881 --11024 --
NM_004666chr631366 1313 420 ------
NM_004696chr1------2857 814
NM_004701chr15----1159 --
NM_004725chr10----1145 --
NM_004730chr551813 1608 1467 1423 1366 21939 266 ----
NM_004734chr1322767 2048 13222 1649 --
NM_004736chr132147 388 34 1796 11911 1417
NM_004739chr111603 ----1632
NM_004742chr351758 1650 1594 1411 1374 1556 ----
NM_004745chr836666 4863 4395 27042 5579 16513 --
NM_004755chr141311 --1388 --
NM_004762chr1751985 1971 1853 1772 1454 ----11946
NM_004772chr5--1174 ----
NM_004774chr1713046 1622 23085 2519 12030
NM_004824chr621060 346 11431 ----
NM_004827chr431796 1787 76 ------
NM_004834chr273214 3146 3091 1011 738 389 138 21182 977 ----
NM_004849chr621281 1253 11080 ----
NM_004850chr231425 1419 1408 --1511 --
NM_004852chr181912901 12107 12035 11153 10406 9978 9717 9699 9216 8860 5179 4354 3384 3336 2333 1987 804 622 176 1188 49665 2213 1101 997 212827 11957
NM_004857chr1444642 4135 3939 2914 24562 412 11010 --
NM_004859chr1752620 2042 972 853 98 ----11187
NM_004898chr482841 2608 2271 1870 998 746 691 356 11940 ----
NM_004926chr1431863 1664 641 ------
NM_004930chr11655 --2639 249 --
NM_004948chr183406 295 94 ------
NM_004973chr651767 1714 1393 301 126 --11255 --
NM_004985chr1293961 3815 3399 3312 2861 1620 1528 544 168 --1208 1427
NM_004992chrX148280 7944 7428 7073 6310 6253 5804 5759 5425 5316 3056 1827 932 187 --28374 7016 37041 2754 1954
NM_005022chr171207 --1217 --
NM_005023chr531514 1095 1089 ----1221
NM_005044chrX64084 3780 3721 2920 501 219 --1289 --
NM_005057chr121871 641 11181 1707 --
NM_005065chr1444127 3721 1399 672 25023 352 ----
NM_005067chr33992 971 965 ----164
NM_005076chr132667 307 111 14214 ----
NM_005095chr152209 2181 1575 871 199 22193 219 ----
NM_005112chr42918 171 2851 700 ----
NM_005116chr2094472 4418 4372 4362 4324 4009 3272 1507 898 24449 4288 11648 --
NM_005121chr1721454 392 33299 3152 459 ----
NM_005137chr2242500 2470 2260 345 ----12494
NM_005156chr9125085 4697 4327 4138 4033 3698 3577 3401 3319 1272 1200 1142 24970 1219 35056 1414 987 12005
NM_005157chr9----11933 11606
NM_005161chr1131822 1816 386 --11639 --
NM_005168chr231395 715 610 1210 1336 --
NM_005207chr2273476 2686 2659 2507 584 514 220 --33277 2884 550 1914
NM_005225chr2021062 1028 --11240 --
NM_005229chrX1453 ------
NM_005245chr42188 70 1698 --1743
NM_005254chr154927 289 216 150 11400 ----
NM_005316chr1141050 787 418 25 --2744 404 --
NM_005318chr22----1813 --
NM_005328chr81588 3779 615 512 ----
NM_005329chr1642346 1973 1744 382 --22238 2128 1778
NM_005338chr73648 642 206 --1635 --
NM_005349chr41247 --1575 --
NM_005354chr191653 --2561 491 --
NM_005358chr1321842 353 11495 --1369
NM_005373chr111245 11499 1516 --
NM_005375chr6128 --2861 345 --
NM_005381chr24335 329 299 172 --1397 156
NM_005387chr11------1679
NM_005389chr65790 722 671 317 189 ------
NM_005392chr931903 1517 1166 11660 ----
NM_005399chr164344 4046 3469 484 470 279 --14422 --
NM_005400chr262750 2638 2244 680 601 325 22010 1972 1202 11065
NM_005406chr1841025 469 448 133 --1169 --
NM_005407chr1411475 1109 --11355
NM_005414chr3----144 --
NM_005433chr1862719 2353 2114 2089 484 448 21738 108 1553 --
NM_005436chr1043691 3455 3443 1217 --23465 3422 --
NM_005458chr922285 2279 12471 ----
NM_005461chr2041967 1570 1505 1450 11868 --11818
NM_005475chr1242108 1066 430 229 ------
NM_005493chr6----1115 --
NM_005506chr441085 1054 795 220 --12910 12734
NM_005539chr1011296 1322 2535 226 --
NM_005542chr731925 1520 1413 --11442 --
NM_005573chr53688 586 286 ------
NM_005576chr15----1296 1228
NM_005578chr354450 1879 1658 360 102 11671 13369 --
NM_005584chr13------1821
NM_005585chr15----1389 --
NM_005596chr9136261 6232 5456 5202 4949 4578 4379 2331 2236 1792 1769 1173 1004 ------
NM_005599chr141535 1142 1086 310 --21456 1097 --
NM_005604chr672399 2386 1910 1849 691 491 101 1906 11739 --
NM_005611chr161836 ----11029
NM_005627chr64786 740 197 21 ----1697
NM_005631chr7----11087 --
NM_005647chrX33148 3131 2141 23267 179 1564 --
NM_005668chr564160 3493 1608 1380 1285 522 1634 ----
NM_005688chr341124 513 445 214 1221 ----
NM_005707chr1511265 --21282 194 1226
NM_005708chr13----1329 --
NM_005716chr19----1609 --
NM_005717chr131255 942 502 --1319 --
NM_005721chr26879 252 245 195 92 84 ------
NM_005724chr151668 ----1594
NM_005730chr1252708 2421 1206 768 726 ----11309
NM_005740chr223857 834 824 --187 1918
NM_005742chr21298 --1326 --
NM_005746chr732502 1805 1775 21013 812 11817 1654
NM_005748chr1242893 2544 604 559 --32588 624 456 --
NM_005762chr19------1130
NM_005765chrX3563 154 127 ------
NM_005801chr17----2746 739 --
NM_005822chr641960 1909 876 216 --31719 1712 1470 --
NM_005839chr18892 801 696 682 676 367 349 341 --1329 --
NM_005841chr4476 70 64 57 --1388 --
NM_005871chr102684 677 11101 ----
NM_005880chr164563 557 551 543 ----11247
NM_005895chr12104071 3517 3506 3474 3274 2639 1045 544 477 83 14024 13196 --
NM_005897chr11806 ----1869
NM_005898chr1172753 2679 2385 2211 2135 2072 950 13020 ----
NM_005904chr1841471 1437 135 113 11094 1215 --
NM_005907chr641667 1280 278 218 2232 117 ----
NM_005920chr151456 1340 843 537 518 ------
NM_005922chr6--1366 1482 --
NM_005923chr61484 ----1518
NM_005933chr111501 --12505 --
NM_005934chr19------12465
NM_005937chr1744160 3558 3316 1637 --21540 1526 --
NM_005938chrX----1219 --
NM_005941chr82801 212 --1416 11129
NM_005977chr13130 1251 ----
NM_005996chr1251523 1516 1040 1032 497 ------
NM_006011chr1563965 3179 1258 856 769 107 14223 ----
NM_006015chr11820 1398 11095 --
NM_006016chr652182 2170 1433 706 515 11787 12114 --
NM_006025chr121703 ------
NM_006026chr33178 53 47 ------
NM_006035chr1411220 ----11228
NM_006038chr2051822 1640 1611 315 286 --2854 273 --
NM_006047chr2022686 304 12468 23515 628 1997
NM_006089chrX4663 271 161 84 1654 ----
NM_006094chr841735 861 840 79 --11488 --
NM_006106chr113778 739 730 --2880 723 --
NM_006108chr1132076 1628 571 2919 691 11564 --
NM_006134chr2121574 236 --157 --
NM_006136chr731234 376 283 ------
NM_006139chr232489 2438 1781 --11864 --
NM_006141chr1642219 939 396 99 22266 887 12171 1982
NM_006145chr19--1921 1183 --
NM_006154chr151359 21141 29 --12764
NM_006160chr1721072 623 ------
NM_006164chr2136 ------
NM_006185chr11------1598
NM_006191chr122759 81 ----1969
NM_006195chr931144 146 79 ------
NM_006196chr2185 ------
NM_006202chr1921495 1313 --1136 --
NM_006241chr3102406 2066 1837 744 713 703 697 675 668 74 11855 1686 12005
NM_006251chr532986 964 506 --12766 --
NM_006252chr197041 6591 5201 2995 2118 1867 1255 1224 531 36465 4664 2247 12230 24739 2284
NM_006268chr113865 820 743 11215 ----
NM_006275chr2031647 1621 279 --1344 --
NM_006282chr2074482 4404 3037 878 588 338 310 34694 4366 1692 ----
NM_006306chrX75907 5879 4599 4104 1812 1680 835 11806 --23830 1939
NM_006311chr17150 2284 260 ----
NM_006313chr1231372 658 401 --11600 --
NM_006328chr11----1110 --
NM_006352chr191801 1554 1448 550 366 359 351 213 127 ------
NM_006354chr31340 --1382 --
NM_006364chr144902 827 807 229 ----1940
NM_006380chr1763829 3705 3369 3361 1242 522 24137 276 14256 --
NM_006390chr1221748 1188 --2618 320 11230
NM_006393chr1022804 1481 12900 23680 3200 --
NM_006401chr91393 ------
NM_006403chr6--21400 1359 21261 70 1202
NM_006409chr72337 130 ------
NM_006420chr2042829 552 484 446 12545 ----
NM_006421chr821250 289 ------
NM_006460chr1741791 638 235 180 1286 11229 --
NM_006469chr111526 21579 476 21285 393 --
NM_006472chr111295 1795 1354 1488
NM_006496chr111356 21700 513 1369 --
NM_006534chr2043006 574 243 194 22546 2470 1791 --
NM_006538chr273727 3469 2763 1283 896 588 107 --2333 261 --
NM_006546chr1766587 6397 4377 1722 408 341 ------
NM_006547chr741625 1351 1309 655 1109 1759 --
NM_006574chr32338 309 ------
NM_006575chr1441454 1145 448 417 --1997 --
NM_006595chr113450 286 179 ------
NM_006599chr16106432 6396 6196 6182 3131 1710 1653 1590 1367 377 18182 15622 --
NM_006601chr121146 ------
NM_006609chr262880 2630 2494 2399 1842 220 21066 418 ----
NM_006614chr373118 2803 1092 1086 1014 694 622 --1358 11178
NM_006620chr641531 934 722 669 23761 107 33032 1886 412 14289
NM_006624chr1061930 1694 589 452 280 180 --157 --
NM_006633chr5--2510 74 --1764
NM_006662chr16----1339 --
NM_006717chr953153 2779 2268 985 138 --32710 2121 859 --
NM_006729chrX44538 1799 1774 1246 --15422 --
NM_006734chr641605 1118 58 52 ------
NM_006743chrX2314 269 1139 188 --
NM_006750chr16187222 7166 6153 5328 5322 5316 5310 5304 5089 4899 3230 2770 2438 2138 1801 1505 1470 1349 --27814 757 12632
NM_006751chr23979 836 717 1801 ----
NM_006756chr821532 129 1234 ----
NM_006761chr17--2844 179 2231 144 --
NM_006775chr632988 2523 224 12576 13031 --
NM_006777chrX42399 2268 2187 303 12926 --11078
NM_006791chr152631 426 154 1539 --
NM_006801chr194662 266 246 201 --1582 --
NM_006815chr1241307 1203 1063 943 1282 1950 --
NM_006827chr1453113 2911 1155 384 219 ----11198
NM_006851chr1221912 378 --12771 --
NM_006852chr1732396 831 420 --22727 775 --
NM_006861chr121122 ----11475
NM_006885chr16184032 4023 3848 3437 3430 3407 2905 2899 2893 2843 2695 2689 2683 1505 1493 1468 567 558 12775 32887 1600 1487 --
NM_006892chr2021380 515 11124 --11181
NM_006902chr142812 2673 2328 404 11225 1733 --
NM_006915chrX62496 2111 2066 1649 689 321 1781 11903 195
NM_006939chr14150 31176 456 443 ----
NM_006940chr1221298 448 1629 1466 --
NM_006947chr421264 502 130 ----
NM_006948chr2122498 947 1363 ----
NM_006981chr942631 2432 1899 264 ------
NM_007005chr91540 --21070 531 --
NM_007006chr16113535 3429 3210 2467 1306 944 862 794 213 98 90 12894 --11170
NM_007007chr12114106 3993 3769 3399 3048 1544 1271 809 562 345 329 63659 3359 1391 1320 955 700 13823 13200
NM_007013chr82409 134 1798 --1915
NM_007033chr13812 494 155 1681 --1573
NM_007034chr11267 1791 ----
NM_007046chr2----1378 --
NM_007050chr2077899 6695 6000 5762 1630 694 679 ------
NM_007068chr22----195 --
NM_007106chr13--12094 22126 240 --
NM_007107chr33557 367 162 22168 99 ----
NM_007118chr51833 --1826 --
NM_007124chr621944 1439 21775 187 ----
NM_007146chr1732634 2483 2110 41962 1934 1027 468 ----
NM_007173chr1151796 1786 447 306 70 145 1439 --
NM_007176chr1431404 671 507 1597 ----
NM_007178chr12--1469 ----
NM_007190chr102726 422 --1806 --
NM_007192chr1441192 1108 1013 224 --21176 393 --
NM_007197chr1241039 205 189 69 ------
NM_007212chr151684 827 606 571 247 21835 1526 11536 --
NM_007229chr221281 ----1420
NM_007246chr421004 352 1294 1864 --
NM_007249chr1389055 8908 8514 8480 3188 2419 2178 665 29235 8891 45931 2157 1638 1395 12469
NM_007256chr1141668 1614 1053 1033 ------
NM_007260chr11759 --1749 --
NM_007347chr1522232 1991 --2943 451 --
NM_007367chr20----1294 --
NM_007375chr131023 973 477 22756 1030 1464 --
NM_012090chr131107 1065 1051 ------
NM_012098chr9----11526 --
NM_012104chr1123096 1440 13121 11485 --
NM_012124chr111344 ----1136
NM_012164chr9116478 6272 6207 5980 5741 5503 5458 2857 659 302 52 44859 2941 2689 2510 --17008
NM_012199chr164421 4044 3671 3457 1750 589 --13295 --
NM_012214chr221050 545 ------
NM_012223chr251284 434 245 115 59 ------
NM_012224chr431046 1025 294 --1390 1780
NM_012234chr363755 3559 3527 3283 432 332 23261 900 22450 325 --
NM_012238chr1031737 1404 143 11182 ----
NM_012249chr242972 2503 1242 406 23183 2833 12495 --
NM_012255chr20--188 ----
NM_012262chr195256 4120 3790 1065 1021 565 465 333 318 ------
NM_012281chr742353 960 905 862 22095 1595 ----
NM_012286chrX2592 85 2472 57 1527 --
NM_012290chr231520 1175 384 21247 1156 ----
NM_012293chr211883 ----1254
NM_012297chr432077 1795 1736 ------
NM_012301chr731823 728 47 --1804 --
NM_012308chr1152296 2194 2175 604 381 --1431 22332 2183
NM_012311chr10----1119 1485
NM_012316chr153462 1673 628 512 209 --25418 238 --
NM_012329chr1721072 492 --1468 --
NM_012347chr663019 2991 1967 1128 450 180 ------
NM_012382chr583541 3115 3040 1663 1636 1232 693 116 --13870 11376
NM_012388chr1533082 2932 200 22049 359 1179 --
NM_012395chr742891 2212 1108 685 --1603 21066 342
NM_012399chr2241897 1716 1360 170 1705 --1755
NM_012405chr113162 23860 1440 ----
NM_012409chr2033342 2335 446 12606 ----
NM_012430chr31782 --1519 --
NM_012479chr731968 701 303 12465 22346 2139 --
NM_013261chr453707 2494 1470 1137 639 --1974 --
NM_013281chr2021078 1006 --139 --
NM_013313chr2223285 929 --22790 2711 11054
NM_013346chrX------155
NM_013371chr1----1330 --
NM_013390chr931685 1570 1551 1295 21746 1700 --
NM_013396chr2131499 1277 624 297 48 ----
NM_013436chr22271 49 ------
NM_013442chr9------190
NM_013446chr731071 535 227 1483 11059 --
NM_013448chr141698 1633 1245 --
NM_013995chrX72540 2484 2474 2407 1946 1723 1713 22084 566 1182 --
NM_014011chr21397 12267 --1255
NM_014021chr153461 3206 2300 697 221 12392 12797 --
NM_014023chr1042866 1173 762 128 12733 ----
NM_014043chr341671 1594 1456 1259 ------
NM_014112chr865438 4746 4735 2065 1742 39 25361 630 14388 --
NM_014117chr1621825 898 1532 22351 1960 --
NM_014154chr32546 352 21075 116 ----
NM_014159chr32549 425 --1415 --
NM_014225chr19--1384 1357 --
NM_014246chr2222193 153 --12024 21920 1687
NM_014253chrX82474 2266 2130 887 616 329 205 75 145 21991 1758 --
NM_014271chrX2813 149 ----1331
NM_014279chr93933 629 243 --1727 --
NM_014283chr12240 46 11249 1451 --
NM_014286chr933185 512 338 --1646 --
NM_014331chr496782 6494 6118 2337 2116 986 690 382 368 12725 16195 16695
NM_014361chr111437 --1187 --
NM_014368chr91266 11438 1366 --
NM_014372chr141700 500 431 49 ------
NM_014382chr341285 639 581 545 11211 ----
NM_014394chr1041167 968 842 458 ------
NM_014398chr341649 1529 520 514 --11845 --
NM_014445chr321739 286 ----21526 411
NM_014452chr63938 279 173 --155 --
NM_014458chr121173 207 --21047 224 --
NM_014494chr1682373 1734 939 906 898 772 730 597 1476 12231 --
NM_014517chr331938 1809 760 ------
NM_014521chr2------1360
NM_014554chr1221722 1657 --21932 1844 --
NM_014572chr1341184 1164 670 505 31512 1114 727 21739 499 --
NM_014573chr1741807 1479 374 349 --11799 --
NM_014584chr1451393 1333 1215 1124 509 ------
NM_014606chr441464 1146 238 232 11431 ----
NM_014612chr941270 1209 1089 493 --1528 --
NM_014613chr5----12940 --
NM_014614chr211037 11091 11137 --
NM_014615chr1682626 913 897 732 371 365 253 235 21015 827 1932 --
NM_014620chr123720 529 263 --1114 --
NM_014636chr924001 314 13705 14244 --
NM_014637chr821221 167 --11073 --
NM_014646chr1843043 2630 2317 2005 ------
NM_014647chr1642205 594 346 145 --11808 --
NM_014663chr1----1965 --
NM_014667chr362397 2311 1557 622 616 159 11567 ----
NM_014670chr241544 1136 631 329 ----21317 76
NM_014674chr363954 2440 1484 1299 1127 694 ------
NM_014679chr113488 322 289 ------
NM_014682chr85821 741 452 335 237 11763 ----
NM_014686chr1922261 1927 11828 --2489 339
NM_014689chr2------1392
NM_014705chr721426 550 1357 ----
NM_014707chr732307 581 378 --11433 --
NM_014709chr2181 ----1406
NM_014711chr162822 808 11900 ----
NM_014720chr1031641 265 136 1156 ----
NM_014729chr83460 338 207 --1256 --
NM_014730chr12105270 4820 3589 3370 1754 1681 1191 973 875 63 15022 11352 --
NM_014751chr822104 1989 11897 11782 --
NM_014755chr283351 3041 2758 1680 1083 990 589 140 23585 1073 24084 3923 --
NM_014776chr1232909 2591 1197 12767 ----
NM_014779chr32941 67 11084 1928 --
NM_014795chr241288 1189 1044 920 ------
NM_014798chr171384 --1398 --
NM_014803chr1042803 2042 584 310 ----12608
NM_014819chr542408 2045 1862 1776 ------
NM_014824chr1171776 1718 1562 1490 1316 790 68 1289 21653 1546 --
NM_014829chr522347 510 ----1568
NM_014830chr12103290 2685 1514 1462 1271 395 337 261 240 218 --13380 13917
NM_014839chr152030 1898 739 289 258 12094 1642 --
NM_014841chr63996 965 353 ----1913
NM_014847chr11480 --1469 --
NM_014868chr123608 49 43 --137 1244
NM_014873chr194872 4620 4370 4001 3900 3736 1061 806 613 --34299 3441 1650 14327
NM_014877chr1797726 6273 5908 5649 5220 2707 1135 758 663 47291 6213 2239 732 21466 950 27592 6628
NM_014893chrY42210 1591 551 99 11923 11481 --
NM_014898chr1922265 420 12411 171 1930
NM_014901chr521936 790 --12098 12077
NM_014912chr1043438 2670 2330 993 12149 ----
NM_014918chr1571349 1102 1059 587 414 113 75 130 1566 --
NM_014932chr31144 2696 406 11914 --
NM_014947chr142783 2754 661 396 1439 ----
NM_014951chr1022136 1670 12619 1636 12515
NM_014962chr201130 1215 --21982 235
NM_014974chr1011215 --1378 --
NM_014978chr1041827 1780 1774 1335 11460 ----
NM_014982chr1495369 5191 3945 3495 3463 2040 2034 1655 286 14351 12051 --
NM_014988chr452557 2325 268 168 144 1522 1190 --
NM_014991chr432195 1193 564 12906 ----
NM_014996chr331045 1012 29 ------
NM_014997chr72840 796 --1154 --
NM_014999chr1251691 242 232 221 211 --11155 --
NM_015000chr1272881 2826 2536 2257 1214 977 538 --22543 569 --
NM_015001chr13965 737 628 1327 ----
NM_015025chr22180 52 --1642 --
NM_015027chr1672019 1862 1756 1600 1500 1345 386 11316 11402 --
NM_015032chr1372256 1945 1921 1180 1090 1047 652 2861 815 ----
NM_015035chr2096311 6142 5768 5196 2428 1749 960 222 211 --14614 --
NM_015040chr263334 3099 3093 3087 602 431 22094 622 2771 186 --
NM_015042chr1544379 4023 3478 1044 14365 ----
NM_015045chr1021889 1872 21996 1405 12245 --
NM_015050chr61502 11104 ----
NM_015051chr943370 2990 2604 2297 ----22126 131
NM_015074chr144873 4523 888 426 1246 ----
NM_015076chr654282 3492 1458 1357 1138 1928 --13968
NM_015082chr521691 829 --1184 --
NM_015092chr1674681 4293 4268 3364 3357 2935 1164 13074 13612 11460
NM_015100chr152036 2030 1960 1598 1462 --2397 251 --
NM_015101chr122408 976 1101 32097 225 49 --
NM_015110chr931910 1886 223 1953 --1727
NM_015130chr431316 74 59 1444 ----
NM_015144chr1673924 3464 3030 2680 1213 644 536 13989 --23934 692
NM_015155chr1053244 2069 638 347 134 --21248 972 12310
NM_015170chr842279 2010 1989 1659 --1216 11916
NM_015172chr131275 1269 434 11158 1416 --
NM_015192chr2042656 2606 2490 584 1339 32910 2663 2524 --
NM_015199chr373022 2493 589 583 574 559 260 12411 1460 --
NM_015205chr1314474 25164 1963 ----
NM_015215chr152604 2114 1949 1939 980 22257 66 --1633
NM_015216chr51109 296 52 ----
NM_015236chr421190 1029 --1472 --
NM_015239chr91458 ----155
NM_015263chr1511216 21200 368 1355 --
NM_015265chr272591 2345 146 99 93 86 71 21948 504 1107 --
NM_015271chr434125 3557 651 192 13992 --
NM_015272chr1632048 1306 646 --11905 --
NM_015278chr663411 3311 2416 903 535 207 23266 2545 22135 787 1795
NM_015291chr153463 3457 3141 2699 1341 12737 12750 --
NM_015294chr173883 430 212 ------
NM_015296chr131448 ----11179
NM_015305chr1431931 1628 324 --11549 --
NM_015310chr835161 1288 284 18277 45823 2415 1088 50 18338
NM_015317chr242865 2556 1969 638 1340 1160 --
NM_015326chr181921 1026 834 738 514 265 116 105 1244 ----
NM_015328chr753061 2942 2814 2254 313 ----12842
NM_015335chr1242190 2076 2038 809 11894 1632 --
NM_015336chr1242455 709 661 272 22545 2378 12057 1235
NM_015344chr841684 814 608 277 ----1748
NM_015349chr652476 963 495 304 163 1748 2543 471 12316
NM_015355chr176782 746 526 349 154 76 31974 1448 83 ----
NM_015359chr842691 2576 1170 333 22833 1885 11895 --
NM_015361chr2--1629 1227 --
NM_015374chr2221482 1176 ----11475
NM_015393chr43472 130 38 ------
NM_015396chr3----1220 --
NM_015443chr171176 1108 21159 486 --
NM_015444chr3----2631 481 --
NM_015455chr553349 3277 3220 3136 633 --1681 --
NM_015458chr883502 3257 1282 943 860 762 754 435 25236 899 ----
NM_015475chr2----11026 --
NM_015477chr153784 635 229 ----11040
NM_015508chr331532 1453 61 ------
NM_015550chr731087 978 836 13050 ----
NM_015557chr143652 3193 2693 226 --12433 --
NM_015569chr124801 3188 11909 ----
NM_015576chr342666 2397 1973 1872 ------
NM_015577chr521196 660 11787 ----
NM_015578chr1941917 808 142 131 21867 1294 2319 125 --
NM_015607chr12225 219 --1212 --
NM_015622chr71283 ------
NM_015649chr19----1406 --
NM_015651chr931789 1590 1510 ----12213
NM_015670chr17----1117 --
NM_015678chr1321064 172 --11356 --
NM_015691chrX42889 2696 2019 418 2270 59 52746 2255 2001 466 190 --
NM_015726chr11462 --1440 --
NM_015850chr831853 1795 1628 1794 11860 --
NM_015878chr842077 1704 1622 572 22203 342 1656 11500
NM_015879chr1856933 3392 2268 1423 614 28625 2548 ----
NM_015891chr632009 620 179 11646 ----
NM_015907chr41276 --163 --
NM_015976chr11245 1258 ----
NM_015981chr563060 3048 948 932 740 74 --12220 --
NM_016061chr2------1372
NM_016072chr1262317 1910 1690 936 281 107 --1557 --
NM_016084chr17----1656 --
NM_016127chr81235 ------
NM_016132chr1573376 3368 3362 3146 1327 432 313 1239 11321 1188
NM_016156chr11--1835 1476 --
NM_016205chr431246 326 312 ----1520
NM_016224chr611469 1381 11486 12140
NM_016226chr12----132 --
NM_016230chr61544 --164 --
NM_016231chr1751533 1052 438 321 308 ------
NM_016248chr1394015 3961 3659 3623 3279 2745 2710 1041 281 43613 2646 996 494 33554 2442 1402 --
NM_016255chr611263 12876 1708 --
NM_016258chr13608 311 290 ------
NM_016270chr19--1443 1467 --
NM_016289chr242068 1625 872 142 12075 22178 122 --
NM_016301chr121123 ----1521
NM_016306chr3181 2363 88 167 --
NM_016308chr131977 451 157 21563 1391 ----
NM_016320chr112729 243 ----11046
NM_016322chr951999 1990 1027 977 465 12179 12143 --
NM_016337chr141320 --1184 --
NM_016396chr1542830 1194 954 577 --11157 --
NM_016424chr1741662 799 517 367 ------
NM_016442chr5----21476 310 --
NM_016531chr433968 3146 577 --11010 13546
NM_016604chr511040 11307 11033 --
NM_016620chr131274 550 327 1203 1575 --
NM_016625chr3------159
NM_016626chr181466 --11137 11306
NM_016653chr21121 --2848 67 --
NM_016831chr141732 1516 571 516 22348 779 ----
NM_017420chr1493599 3303 2626 2457 1318 967 932 397 320 --11053 12368
NM_017508chr1162527 2321 2204 1814 214 180 22475 419 ----
NM_017526chr1----1104 --
NM_017548chr34850 805 485 233 --1756 --
NM_017612chr12182 ------
NM_017635chr1131273 1174 327 --11353 11097
NM_017638chr1189 --173 --
NM_017640chr64759 741 358 92 ------
NM_017643chr1732599 2479 2463 12618 --12864
NM_017650chr785944 5401 5167 2215 1837 1367 1346 709 --21339 1118 --
NM_017658chr14104541 4492 4387 3572 3328 1751 1744 884 774 578 ------
NM_017660chr191313 11187 23131 904 --
NM_017666chrX41655 883 518 253 21785 1667 ----
NM_017672chr15127 ------
NM_017758chr1781197 193 146 117 110 103 79 73 --197 --
NM_017769chr1432827 2494 2290 32970 2520 542 1175 --
NM_017778chr81288 2384 303 1295 --
NM_017779chr132090 927 565 42435 533 330 227 ----
NM_017798chr20--2796 304 11234 --
NM_017799chr1431503 574 65 ------
NM_017807chr141180 --1173 --
NM_017813chr895513 5487 5162 5065 4411 4405 4076 3976 28 65708 5438 4805 3988 1821 670 15056 --
NM_017822chr124773 681 108 48 ------
NM_017826chr131685 1772 1678 --
NM_017848chrX34378 3143 460 14270 2450 362 --
NM_017893chr10------11299
NM_017902chr1094712 4131 3534 1790 1748 1610 1001 831 536 ------
NM_017907chr11------1470
NM_017913chr9----2171 109 --
NM_017919chr944388 4181 3749 764 34376 4354 4268 25260 4203 --
NM_017988chr121181 ----1230
NM_017994chr762864 771 584 576 570 556 --1379 --
NM_018010chr321603 1407 1659 139 --
NM_018011chr13393 87 81 1590 174 --
NM_018013chr662002 1995 1985 944 476 436 --1739 --
NM_018017chr1062685 2352 1901 785 603 206 22824 674 12815 --
NM_018026chr1161306 1277 1018 995 509 257 --11434 --
NM_018028chr19----2985 977 --
NM_018043chr1131388 181 109 ------
NM_018045chr131990 284 106 --12986 --
NM_018048chr123483 286 279 --11277 180
NM_018061chr12243 222 11102 --1626
NM_018078chr431047 307 73 1965 ----
NM_018084chr253249 3053 2836 740 241 --1770 --
NM_018092chr1621148 519 1148 ----
NM_018105chr811097 --2276 187 --
NM_018115chr43638 632 623 1152 --1506
NM_018121chr1033058 2137 1192 21077 595 12185 --
NM_018126chr451562 1023 498 486 253 --11284 --
NM_018128chr172430 173 ------
NM_018133chr341861 1644 1521 67 32129 546 208 12017 --
NM_018151chr21791 1723 3762 230 27 --
NM_018159chrX31466 1290 640 --21146 363 --
NM_018164chr12--1257 --1112
NM_018178chr141944 1893 1708 1362 ------
NM_018180chr101343 1219 ----
NM_018181chr1821867 1242 2431 327 ----
NM_018201chr942542 2475 1867 927 ------
NM_018243chr433298 1361 75 --13501 --
NM_018247chr642962 2956 2589 1089 32689 926 726 ----
NM_018254chr121707 292 1304 32421 837 329 --
NM_018312chr1172046 1352 822 812 569 553 407 ------
NM_018362chr1193798 3172 3166 3159 3124 2672 2652 2514 590 33478 657 236 23925 2641 --
NM_018364chr134097 3571 3506 1373 --33969 3450 2723
NM_018388chrX1382 11080 --1499
NM_018416chr1292620 848 793 532 437 368 219 208 123 ------
NM_018424chr92298 128 ------
NM_018426chr64603 593 573 392 --2585 562 --
NM_018440chr888701 8124 7343 6883 6763 2759 1904 1826 48362 7020 3177 3057 22218 391 11260
NM_018444chr851653 1633 552 508 494 11640 --1674
NM_018465chr9168 ----160
NM_018482chr882547 2332 2128 2116 1928 1040 427 165 --11976 --
NM_018486chrX----1515 --
NM_018489chr172128 2035 1995 1742 785 677 183 1769 1328 --
NM_018557chr231183 149 141 --11620 --
NM_018569chr431248 1142 1030 21204 1164 11150 --
NM_018590chr1031711 1615 117 21657 602 ----
NM_018638chr1284343 3919 1831 1325 1225 854 380 326 44198 3622 1720 1042 33842 2265 2100 --
NM_018650chr141870 1596 354 57 21961 642 --1384
NM_018660chr872926 2524 2223 2202 1969 1230 986 23077 2214 22333 687 --
NM_018667chr1632816 2718 2693 --22756 351 --
NM_018685chr751046 884 856 750 398 --133 --
NM_018691chr52998 176 --11136 --
NM_018710chr83228 194 47 ------
NM_018712chr11----11098 --
NM_018715chr12560 308 --1291 --
NM_018717chr462663 2646 2159 2148 93 86 32441 2223 2166 11138 --
NM_018834chr51201 2390 53 145 --
NM_018836chr12973 814 ------
NM_018951chr73946 931 904 11271 125 --
NM_018959chr191563 ----1170
NM_018970chr722816 707 --1685 --
NM_018976chr122691 170 --1127 --
NM_018977chrX2968 873 11010 1985 --
NM_018992chr162335 255 --11551 --
NM_018999chr1084837 4613 4525 4438 1915 1901 1894 371 14447 12993 --
NM_019004chr711630 21960 1795 1744 --
NM_019006chr152461 136 --161 --
NM_019022chr1853217 2837 2194 534 516 12596 13145 --
NM_019042chr71313 1137 1900 1195
NM_019044chr254330 3965 1620 499 79 14764 ----
NM_019045chrX--1795 ----
NM_019057chr52324 307 1314 1299 --
NM_019071chr71804 ------
NM_019072chr533836 682 389 1696 11339 --
NM_019080chr1321330 1306 --1152 --
NM_019084chr1022349 900 21862 1783 1448 --
NM_019091chr241085 1046 722 83 11126 11160 --
NM_019094chr1252646 1246 296 139 119 --12390 --
NM_019114chr922150 196 1811 22042 439 --
NM_019116chr1673532 2785 1225 605 576 449 355 --12538 --
NM_019117chrX42369 1241 383 85 23349 177 ----
NM_019558chr21135 ----1262
NM_019593chr2033007 1242 148 ------
NM_019885chr252870 2856 2701 2071 311 12780 11167 --
NM_019896chr2----1299 --
NM_020122chr285560 4280 4175 2061 1950 1505 1289 1222 2900 782 21070 381 --
NM_020127chr151538 1236 1219 1139 481 1461 ----
NM_020148chr1852327 2282 901 293 89 ------
NM_020159chr42443 421 21245 1193 11706 --
NM_020177chr552408 1156 715 448 270 ------
NM_020205chr163479 3328 2976 2554 407 384 33294 2698 2650 33322 2307 1094 13497
NM_020210chr15------1953
NM_020211chr1511393 --11576 --
NM_020337chr442714 2652 2161 2048 22275 2099 148 --
NM_020338chr1011016 23251 3089 23239 376 --
NM_020342chr232567 745 731 --1696 11898
NM_020348chr1031963 1933 336 1696 11087 22104 1831
NM_020363chrY41598 283 254 129 1420 ----
NM_020381chr621851 1767 --1349 --
NM_020390chr384075 3215 3114 785 606 334 234 62 1730 ----
NM_020403chr131153 11592 11414 --
NM_020443chr1106715 6639 6480 6137 5157 5087 2169 1516 982 908 --1154 1834
NM_020466chr665004 3920 3820 3744 3060 1245 1211 13048 11902
NM_020474chr1821935 752 --11866 --
NM_020546chr552437 2380 1207 340 85 --11954 --
NM_020630chr101156 --1707 --
NM_020640chr31319 --1922 --
NM_020647chr81315 21813 440 11909 --
NM_020651chr24448 284 86 58 1661 --11493
NM_020673chr2067602 7056 5905 3056 2917 2747 --17063 21394 358
NM_020689chr2021504 1317 ------
NM_020699chr155284 5023 4029 1495 213 --12007 --
NM_020752chr1012832 22545 1848 1827 --
NM_020760chr231435 799 238 ------
NM_020768chr511181 22746 966 2432 337 --
NM_020772chr17127866 7840 5510 2341 2222 2135 2127 1610 964 509 342 286 36665 1078 293 22594 268 26516 1206
NM_020774chr18136264 5951 4948 3790 2147 1610 1442 920 850 404 379 192 185 45251 1746 1486 817 11854 --
NM_020782chr1294298 3967 3928 3889 1524 1494 508 406 43 1907 ----
NM_020783chr1832378 2062 2022 11998 --135
NM_020796chr572769 2107 2008 1994 1116 1104 71 22366 1968 ----
NM_020803chr431968 1721 765 11866 2940 391 12041
NM_020812chr19------1195
NM_020814chr21423 11375 11383 --
NM_020818chr141384 --1364 --
NM_020824chr102540 312 ------
NM_020830chr273270 3264 3244 3178 3117 2561 2394 --23280 398 --
NM_020834chr1451403 1231 657 306 123 ------
NM_020845chr123922 465 273 --1814 --
NM_020850chr1633185 3128 276 --11151 1302
NM_020854chr1861586 1574 1500 294 244 104 ------
NM_020856chr1941398 1303 466 86 1100 ----
NM_020858chr1511941 ----12396
NM_020870chr442101 556 358 187 --12113 1717
NM_020871chrX1921 12194 1743 --
NM_020872chr331290 1197 87 2679 251 ----
NM_020873chr32859 48 ----1220
NM_020898chr122506 251 --1602 --
NM_020925chr11209 --11395 11067
NM_020927chr1632214 2018 159 --1261 --
NM_020935chr264644 4613 4455 1519 1451 1017 14062 14603 13164
NM_020940chr1042186 2080 648 209 12397 ----
NM_020962chr1552428 2025 2003 1771 610 ------
NM_020974chr11----1173 --
NM_020975chr1061648 1611 1588 637 163 132 ------
NM_020981chr25823 308 136 116 105 ------
NM_021003chr142552 275 ------
NM_021005chr154868 819 463 420 --11063 --
NM_021012chr1711051 ----1376
NM_021038chr343245 3085 3042 3018 11355 ----
NM_021072chr51347 --12198 --
NM_021132chr1031070 1037 345 1540 ----
NM_021136chr141300 1147 --1232
NM_021140chrX1894 --174 --
NM_021148chr772527 1674 1005 845 814 808 692 32313 1740 1712 3822 794 750 --
NM_021149chr1631242 1233 1138 11075 11102 --
NM_021155chr1992701 2428 2296 2263 2140 1864 1163 165 77 --12209 --
NM_021174chr81764 --1740 --
NM_021183chrX32056 734 627 31778 983 273 ----
NM_021190chr141186 430 108 102 21320 540 ----
NM_021215chr2082349 2335 2251 2243 2118 2092 272 89 --22237 1678 --
NM_021238chr1211378 21688 592 ----
NM_021252chr1071967 1915 1752 1612 1457 735 204 --11370 --
NM_021255chr1443455 3417 534 301 --21467 942 1290
NM_021637chrX41341 1254 1227 76 ------
NM_021643chr241895 1503 1381 64 --11735 --
NM_021813chr6145519 5023 4281 4275 4268 2235 812 806 800 790 771 727 694 51 15595 45633 2339 2229 1577 15646
NM_021914chr1422055 78 --21895 85 --
NM_021943chr621588 882 135 ----
NM_021946chrX3423 166 160 ------
NM_021954chr1342636 2385 2357 853 22773 181 --12734
NM_021960chr142785 2680 2179 759 12244 1969 12332
NM_021961chr1176811 5537 4853 2542 1660 1612 253 ------
NM_021964chr376564 6246 5747 1343 794 576 376 55587 4510 2381 2219 1803 35605 4121 2185 --
NM_021970chr42671 617 ------
NM_022037chr21989 1833 ----
NM_022048chr15106047 4766 4615 4603 4597 4583 4577 1619 824 761 26239 666 14465 1356
NM_022049chr131176 510 338 11337 --1603
NM_022058chr222057 1871 1495 ----
NM_022059chr172954 589 1901 ----
NM_022063chr1021234 1127 --11348 --
NM_022075chr12770 764 --1849 --
NM_022080chr2052532 1949 1927 1852 406 22196 316 ----
NM_022118chr131537 1243 ----
NM_022123chr14----1461 1592
NM_022160chr9133 --1136 --
NM_022170chr71216 ----1166
NM_022336chr211772 ------
NM_022351chr833747 2834 1205 43693 3570 3489 51 1608 --
NM_022465chr1232938 2653 213 11182 ----
NM_022473chr1573943 3652 2945 1189 1086 195 183 23378 380 ----
NM_022474chr1442412 930 894 635 1129 1216 --
NM_022574chr731517 791 342 --3350 336 196 --
NM_022735chr171828 1757 1480 1399 1385 1359 1309 --1753 --
NM_022753chr172828 2778 2306 2197 254 244 69 11837 ----
NM_022756chr12451 358 2979 466 21522 488 --
NM_022758chr61251 22091 580 13222 --
NM_022763chr332567 984 91 12851 ----
NM_022780chr231505 729 722 --2708 259 --
NM_022781chr953092 2763 2734 2348 1239 --52724 2713 813 602 267 --
NM_022824chr52754 88 1241 ----
NM_022841chr1542768 2546 956 217 1169 ----
NM_022843chr1311098 21465 449 --1147
NM_022893chr253133 2752 714 348 191 13026 1760 --
NM_022894chr24371 362 269 67 1311 1143 --
NM_022898chr1494560 3064 1866 1572 1021 609 568 340 242 --2822 603 11295
NM_022912chr241178 565 480 358 22552 433 ----
NM_023009chr12719 186 ----1493
NM_023039chr51119 1387 --1110
NM_023927chr511356 1913 1178 1983
NM_024055chr5----1644 --
NM_024065chr2------195
NM_024086chr1753356 3131 1541 1123 944 1782 ----
NM_024104chr193930 861 84 --2996 945 --
NM_024345chr956023 5674 3976 1333 259 16042 --25868 119
NM_024430chr1841491 1194 267 193 --11911 --
NM_024501chr21503 --1739 --
NM_024522chr131873 456 257 21842 273 21855 250 --
NM_024539chrX1277 --1409 --
NM_024545chr23551 304 68 --3781 627 75 --
NM_024546chr139950 882 337 293 287 281 275 188 29 ------
NM_024607chr864473 4187 3800 1346 765 593 54263 4243 1523 1469 1416 ----
NM_024617chr9------1308
NM_024624chr251640 1150 598 245 227 --1273 --
NM_024665chr3123935 3833 2861 1832 1355 1023 797 758 752 485 466 325 34339 3041 1254 44468 3812 3294 995 --
NM_024674chr173042 1189 1000 861 734 445 215 ------
NM_024692chr231911 316 149 11160 1190 --
NM_024713chr1511435 --133 11298
NM_024721chr872570 2513 2423 2327 1822 256 134 ------
NM_024725chr11164 1654 ----
NM_024749chr14719 713 562 497 12226 1433 --
NM_024757chr911089 --11022 --
NM_024761chr964490 4024 1746 1319 899 347 1469 23663 422 --
NM_024789chr10296 63 --173 --
NM_024824chr142200 184 1212 ----
NM_024885chrX2907 77 1691 1868 --
NM_024921chrX61282 785 693 659 424 40 ------
NM_024945chr911043 11137 --1793
NM_024949chr454881 3864 1067 366 76 --24390 95 --
NM_024953chr1282352 2318 2162 1802 868 623 612 403 --12335 --
NM_024989chr2126400 5914 3221 3181 2821 2191 1659 1610 1547 1279 518 180 38075 7350 5261 ----
NM_024993chr231514 1180 114 11049 1339 --
NM_025054chr823349 266 23973 1577 13046 12861
NM_025074chr421946 1052 --21130 946 --
NM_025113chr131202 1912 2252 239 --
NM_025133chr21896 1297 ----
NM_025134chr1612402 --1652 --
NM_025146chr372646 2465 1924 1672 692 121 115 12414 11715 1441
NM_025160chr154342 3542 2781 1235 988 --12961 --
NM_025164chr1162154 833 312 177 166 157 --1276 --
NM_025179chr124786 847 14796 24864 258 --
NM_025181chr22121 70 ------
NM_025191chr172753 2455 2432 2395 1139 1061 406 11146 11133 --
NM_025208chr1162401 2392 2080 821 697 297 22360 1793 1764 --
NM_025224chr2042240 2016 1607 1587 --12342 --
NM_025235chr1072069 1986 1797 890 848 356 200 ------
NM_025237chr1741562 1509 1400 330 11331 --11454
NM_030621chr1474219 4126 1369 478 318 312 206 13133 1659 --
NM_030627chr543595 2936 632 434 53898 3790 3721 3451 2631 --1343
NM_030631chr14----1584 --
NM_030647chr785863 5726 5692 4751 2150 2130 985 629 12060 --25836 452
NM_030648chr455478 3889 1329 1260 256 11867 64961 3431 654 518 357 332 --
NM_030753chr17------1230
NM_030761chr122321 298 --1122 --
NM_030771chr11164 ------
NM_030780chr821465 161 11511 ----
NM_030809chr1252443 1698 1688 1015 931 1667 22474 945 --
NM_030885chr331884 388 143 32249 2236 604 ----
NM_030915chr242314 289 153 59 1442 --1746
NM_030934chr14183 83 72 21 1462 11476 --
NM_030939chr64829 823 797 50 --21055 358 1895
NM_030949chr65961 186 175 112 106 --1196 --
NM_030962chr1121188 116 --11437 --
NM_030963chr6----1603 --
NM_030964chr5113687 3610 3120 2874 2589 2550 2432 2384 799 86 45 1926 11325 1757
NM_031283chr2--1850 1858 --
NM_031296chr432219 434 190 22375 383 12198 --
NM_031306chr11167 ----181
NM_031417chr1911035 --11015 1846
NM_031442chrX43165 1017 701 254 22548 811 ----
NM_031445chr223288 977 13307 12367 --
NM_031453chr1052503 2356 1741 785 650 22548 762 1336 --
NM_031954chr1222535 272 --22578 790 --
NM_032017chr1------1208
NM_032042chr512776 --1471 12540
NM_032047chr311715 2689 509 --1821
NM_032124chr1821204 505 ----1385
NM_032132chr13438 131 35 ------
NM_032145chr61465 21729 593 21353 408 1289
NM_032153chr342368 2321 2241 546 ------
NM_032160chr1854265 2766 646 604 308 --11369 --
NM_032181chr21812 ----1668
NM_032182chr1041389 1276 297 36 --162 --
NM_032208chr252731 1007 1000 983 561 12478 12895 --
NM_032221chr2022057 354 --21837 627 --
NM_032233chr142860 116 --1141 --
NM_032242chr333311 2048 1018 --12198 --
NM_032268chr1632957 2673 148 --2555 529 --
NM_032271chr1621436 1238 1309 ----
NM_032299chr111211 ------
NM_032320chr111782 --2249 166 --
NM_032373chr1065404 5311 4836 1759 1753 498 24820 1461 23864 479 13664
NM_032379chr113843 743 323 ------
NM_032408chr721200 1138 --1844 --
NM_032410chr841059 946 781 508 ----1182
NM_032434chr24549 340 227 195 ------
NM_032457chr421501 28 ------
NM_032458chrX42908 2809 2377 168 11079 ----
NM_032552chr91238 ------
NM_032558chr941268 1078 947 165 ----11463
NM_032560chr142287 47 2851 813 ----
NM_032632chr144751 665 629 437 --1117 --
NM_032682chr333443 3391 1231 22302 726 13072 --
NM_032725chr111256 --1268 --
NM_032737chr1962664 2481 2329 1737 563 82 --1396 12638
NM_032810chr1021279 119 1598 ----
NM_032829chr1221111 907 --1320 --
NM_032846chr1431245 997 430 --1208 --
NM_032857chr15--1207 2176 45 --
NM_032873chr1134109 2766 1146 31622 512 141 ----
NM_032875chr17------1340
NM_032880chr1153 ------
NM_032905chr101386 11247 1164 --
NM_032983chr743154 2421 2414 402 --22655 346 12388
NM_033030chr231506 1159 589 --21319 229 11098
NM_033049chr321251 254 --1119 --
NM_033088chr11266 ----1685
NM_033132chr131880 --12258 --
NM_033222chr93437 377 50 2967 391 ----
NM_033224chr7107409 7145 6986 3141 2413 2157 1834 1612 1469 662 ----12875
NM_033267chr5193 1716 1763 --
NM_033285chr8104425 4075 4050 3999 2955 2781 1791 1569 1463 1336 14303 1569 --
NM_033389chr1794866 3552 3540 3249 923 896 633 290 146 14826 11826 --
NM_033393chr442908 1938 894 338 1354 ----
NM_033426chr1422542 928 --22843 37 12755
NM_033512chr852915 2349 1049 283 149 13040 ----
NM_033515chr621029 295 1992 ----
NM_033656chr2165574 5284 4411 1952 1679 898 14795 22331 612 12200
NM_052851chr1322161 467 1928 11516 --
NM_052879chr1283827 3333 2995 2898 1491 888 277 271 23431 2785 12650 1184
NM_052885chr1274881 3528 1331 1281 1260 874 614 23679 1185 21865 94 21407 786
NM_052905chr241798 1477 1357 671 1287 --11368
NM_052910chr132738 343 1813 1832 --
NM_052911chr181180 1340 ----
NM_052927chr541943 1755 1445 859 3808 328 82 ----
NM_053002chr33961 840 378 ------
NM_053025chr31448 ----11564
NM_053056chr1192259 2142 2057 1054 983 917 544 486 140 22445 322 ----
NM_057175chr452547 2538 651 141 115 31915 666 279 ----
NM_057749chr81287 11257 1457 --
NM_058172chr41397 1426 ----
NM_058237chr142967 877 2857 94 1108 --
NM_080617chr201959 --1850 --
NM_080626chr12----1348 --
NM_080764chr2283239 3108 3087 2971 2381 1047 460 198 --1916 --
NM_080872chr853610 3523 3415 1624 759 23097 629 --1361
NM_080927chr393120 3100 2991 2493 2312 2047 1265 1024 385 33326 2204 511 32264 2088 2061 12299
NM_130387chr341227 1185 1170 93 ------
NM_130809chr562431 2084 2070 2064 1233 341 1109 12656 --
NM_133265chrX52606 2476 2422 1453 114 --171 --
NM_133433chr53827 713 332 1319 ----
NM_133445chr973439 2821 1132 599 588 394 207 ----1322
NM_133496chr194464 3766 2898 2890 2884 976 593 526 304 43520 3491 3077 676 13212 21604 259
NM_133638chr53979 415 73 ----1504
NM_138288chr143382 213 173 1766 ----
NM_138316chr102526 170 --21063 209 --
NM_138344chr143390 381 375 ------
NM_138357chr1021763 714 31270 377 106 --11681
NM_138395chr22805 413 --1329 --
NM_138423chr1552329 2006 1781 1584 1545 12218 12253 --
NM_138426chr71175 12252 11603 --
NM_138440chr161540 --1569 --
NM_138468chr255999 4699 1107 616 585 45631 4666 4029 444 14561 --
NM_138473chr1275196 4982 1823 1753 1382 763 654 --23541 1246 11347
NM_138689chr11--1216 1179 --
NM_138782chr52259 64 21991 1976 12207 --
NM_138795chr1--1170 ----
NM_138927chr212325 163 --180 --
NM_138959chr1106429 5900 5624 2272 2041 1836 1151 1000 601 516 32718 2686 1830 24346 533 --
NM_139015chr1211742 21749 269 --1656
NM_139076chr411373 2108 70 ----
NM_139167chr8------1537
NM_139207chr124805 799 179 83 1845 1247 --
NM_139283chr1242406 2053 1995 252 --12168 --
NM_139321chr2063946 2949 2601 2574 399 327 21021 845 ----
NM_144567chr152661 510 375 244 47 167 --22461 1719
NM_144571chr4146734 6614 6561 6451 6256 4965 4746 2536 2475 2162 1799 1372 656 319 21365 230 24929 678 --
NM_144578chr14115479 4751 4413 3942 3779 3368 1603 1379 613 274 234 1680 24211 949 --
NM_144633chr3----1354 --
NM_144664chr1131954 545 361 31972 702 467 2450 348 --
NM_144723chr53751 688 615 1104 ----
NM_144778chr1332571 1944 130 ------
NM_144778chr1332571 1944 130 ------
NM_144973chr1265352 5177 3771 3640 1952 1026 13426 15306 --
NM_144979chr42634 105 ----1676
NM_145025chr62953 283 1112 11003 --
NM_145049chr541007 850 383 133 11059 ----
NM_145071chr3----1348 --
NM_145117chr1122108 620 --23228 811 11030
NM_145257chr111226 14163 2264 122 --
NM_145753chr31172 1283 11163 --
NM_145800chrX3921 900 693 ------
NM_147128chr741382 580 403 27 21664 469 ----
NM_147189chr852242 828 706 625 493 31797 1592 313 2821 304 --
NM_148894chr431035 985 506 --11175 --
NM_152259chr151135 --1925 --
NM_152261chr122536 440 2930 647 22234 1708 1209
NM_152265chr12990 265 --2257 243 --
NM_152272chr82496 283 --2552 398 --
NM_152277chr521897 1820 --2535 53 --
NM_152280chr173031 2390 2341 1319 540 529 187 1173 ----
NM_152292chr452215 1521 599 337 231 1238 1788 --
NM_152344chr17--1354 ----
NM_152383chr2--1121 --299 87
NM_152400chr411705 41677 1603 731 351 ----
NM_152409chr543083 1262 459 67 11256 1128 --
NM_152417chr831034 465 169 11017 11303 --
NM_152424chrX74638 3798 3523 963 855 238 149 13430 21701 1076 --
NM_152440chr121319 145 1865 --
NM_152450chr1542127 1663 1350 695 2200 133 ----
NM_152470chr1863793 3544 732 708 690 657 1715 --13861
NM_152527chr21313 ------
NM_152546chr531060 283 49 ------
NM_152556chr742480 2398 1731 998 ------
NM_152594chr1562223 2024 904 893 472 145 1653 11434 11560
NM_152622chr553216 2674 818 504 409 --12498 --
NM_152641chr1272921 2317 1101 992 776 706 546 --12482 --
NM_152660chr14661 370 363 275 ------
NM_152678chr312702 12013 1629 --
NM_152707chr102983 869 1332 122 1351
NM_152716chr1131597 630 388 21274 75 ----
NM_152729chr641276 1100 618 308 ------
NM_152731chr61435 11206 ----
NM_152737chr62148 88 --21834 821 --
NM_152744chr742669 2333 504 97 --21177 173 13268
NM_152753chr631823 1329 776 ------
NM_152756chr5104283 4244 4097 3302 3047 1470 1074 719 527 292 11628 43318 1707 1170 706 --
NM_152758chr862681 2443 2195 1895 923 153 1411 --11992
NM_152772chr121352 ----1385
NM_152787chrX21490 797 22853 780 --1941
NM_152835chr162711 2694 2467 2205 2019 604 12734 1510 --
NM_152857chr62734 716 ------
NM_152896chr92744 646 ------
NM_152903chr1322823 2016 157 12408 --
NM_152996chr152095 2013 1539 1509 206 ------
NM_153184chr341861 1705 563 339 ----1311
NM_153207chr1233769 870 551 24087 1533 33225 859 768 23719 3249
NM_153226chr103403 210 204 11081 1217 --
NM_153235chr632341 2222 197 ------
NM_153262chr162685 2330 1173 441 269 94 ------
NM_153354chr52652 360 ------
NM_153365chr432794 2365 2316 1501 ----
NM_153367chr1063337 3156 3073 2929 2617 735 --22919 2908 --
NM_153607chr543073 3013 1244 709 1396 12429 --
NM_153619chr1553179 2622 2236 506 442 ----13634
NM_153634chr12--31138 426 321 11122 --
NM_153687chr1271455 1364 1321 641 630 264 211 ------
NM_153757chr431200 58 52 --196 --
NM_153812chr142267 2035 1860 855 --12089 1608
NM_170606chr751845 628 329 297 285 1500 21765 1369 --
NM_170662chr33694 540 197 ------
NM_170665chr1213568 33897 928 728 1374 --
NM_170707chr12891 175 --1126 --
NM_170711chr191739 ----1346
NM_171998chrX12290 --1969 --
NM_172071chr1147069 7027 6751 6482 5719 5161 4638 2998 2991 2958 2615 668 373 252 37081 6049 682 11193 --
NM_172127chr441900 1416 750 647 --1457 --
NM_173083chr141094 949 52 41 ------
NM_173156chr172192 2185 2179 2131 1744 1738 803 --12159 --
NM_173354chr2152189 2108 1993 1936 1725 --11930 --
NM_173359chr33531 263 43 ------
NM_173463chr453708 3017 2903 1623 1123 ----1514
NM_173468chr4116043 5448 5336 5330 5249 5019 3973 1281 263 244 94 52086 1404 378 233 80 11258 --
NM_173470chrX42887 2337 2163 476 2975 527 22134 305 21776 984
NM_173475chr163447 331 321 --1310 --
NM_173491chr511211 21202 1015 --127
NM_173496chr1072917 2790 2678 1216 1113 837 134 ----179
NM_173511chr273988 3251 2463 920 700 605 273 --13124 --
NM_173517chr7--1441 --169
NM_173552chr322130 590 1206 1452 --
NM_173576chr1042318 1861 1685 35 ------
NM_173582chr1176292 5970 5695 4832 3847 2514 573 1689 ----
NM_173595chr1275310 5254 4411 3539 3420 992 694 11950 ----
NM_173642chr197576 6904 3329 2504 2498 1624 948 823 599 19224 37658 6303 414 2868 174
NM_173647chr24934 831 719 320 --2449 355 --
NM_173698chrX31713 1583 1454 ------
NM_173797chr52296 104 ------
NM_173808chr154391 3460 3115 3008 819 ----13499
NM_173829chr586066 5463 4389 3912 1772 1219 672 499 45953 4968 4170 44 --21816 1741
NM_173854chr151930 1876 887 425 388 --1226 --
NM_174890chr10----1785 1573
NM_174911chr873966 3682 3633 3032 2622 1439 807 23301 2881 12843 --
NM_174916chr1522388 2095 ------
NM_174938chr93475 469 73 --1463 --
NM_175736chr1297734 7521 7204 6633 2631 2293 1896 1890 350 --1690 --
NM_175768chr621387 1328 ----133
NM_175854chr1382719 2668 2386 2354 1860 1760 404 273 22340 589 2870 852 --
NM_175866chr12585 213 1498 1411 11414
NM_176814chr7--11185 11084 --
NM_177966chr361835 336 330 324 318 303 ----11308
NM_178011chr1012706 --2658 637 11079
NM_178496chr34409 248 137 81 --11469 --
NM_178539chr1231976 786 287 ------
NM_178565chr831732 1104 39 21484 1322 133 --
NM_178566chr971617 1591 1538 1324 1253 413 57 1510 ----
NM_178812chr811469 31330 1037 587 ----
NM_178815chr1032544 2428 2327 42522 2091 1974 1753 ----
NM_180989chr1352398 1962 1849 1520 612 12150 1634 --
NM_181354chr841615 1420 187 173 31301 1110 534 ----
NM_181358chr144197 2920 1578 898 23429 57 1149 --
NM_181528chr20--1408 --174
NM_181670chr1241474 1361 234 162 ------
NM_181672chrX31993 540 455 ------
NM_181711chr12----1686 --
NM_181723chr812142 42279 1662 633 506 ----
NM_181782chr61540 --1473 --
NM_181784chr222068 393 12564 ----
NM_182485chr483521 3205 3196 2546 1129 1052 236 169 11453 23453 2604 1366
NM_182511chr1831419 169 163 ------
NM_182557chr11163 ----12175
NM_182691chr721321 331 --11453 --
NM_182700chr7----11501 --
NM_182830chr1441741 1614 484 368 ------
NM_183238chr1252949 2745 1094 494 341 1167 --1660
NM_194247chr264189 3907 3869 3630 877 407 21318 28 1751 --
NM_194249chr51432 ----1356
NM_194250chr2----1329 --
NM_194314chr155668 5630 4614 3575 779 35436 4723 4109 44844 4659 2150 666 --
NM_198097chr71283 ------
NM_198243chr152154 134 2759 621 ----
NM_198270chrX63050 3028 2956 1336 1326 222 12315 12422 11079
NM_198511chrX2460 62 ----1713
NM_198513chr81703 --1337 --
NM_198549chr132759 2590 2303 32457 2371 337 ----
NM_198562chr34924 327 251 174 1941 ----
NM_198567chr5----1539 --
NM_198578chr12----11507 --
NM_198581chr287315 6939 6059 6013 5140 4846 922 767 22423 2363 ----
NM_198859chr354887 4007 3693 331 176 14748 13205 --
NM_198935chr2062636 2282 2127 1068 1046 667 12063 23268 3025 --
NM_198963chr2------1539
NM_199000chr712038 --1541 12170
NM_199054chr1951995 1767 1398 1352 1344 11959 3172 158 60 --
NM_199072chr733079 3044 2391 --12003 --
NM_199131chr1042837 2687 1063 335 11449 11072 --
NM_199168chr101973 --1265 --
NM_199320chr442628 2474 2160 1166 --1388 11860
NM_199342chr12233 227 --1242 --
NM_199423chr1661153 1143 1102 1088 1017 427 ------
NM_203364chr112927 234 1282 ----
NM_203406chr522262 316 12860 1422 --
NM_203459chr142612 2552 2388 798 22186 758 32545 2395 1043 --
NM_205848chr151113 1045 454 431 336 12815 22638 345 --
NM_206853chr663692 3029 2802 934 847 696 --21006 988 --
NM_206854chr684953 4290 4063 3540 3486 3428 2108 1957 13756 1188 --
NM_207429chr1152323 2232 1912 1895 192 22555 562 12389 --
NM_207578chr12623 237 ------