TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548d-3p
miRNA Sequence: CAAAAACCACAGUUUCUUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000109chrX42300 1951 1879 262 --12118 1121
NM_000248chr352465 1142 1034 736 80 12761 13082 12234
NM_000332chr6107072 6367 5988 5273 4385 2484 2472 2466 1998 1495 34773 1955 1576 ----
NM_000333chr351112 1043 304 293 287 ------
NM_000346chr1751391 1278 125 107 99 ------
NM_000430chr1763349 3123 982 885 876 347 --21508 1191 --
NM_000523chr23428 217 131 1252 1357 1237
NM_000610chr1182096 920 894 887 880 874 576 144 --12953 --
NM_000618chr1285485 5099 4859 4409 4403 2326 1624 892 ------
NM_000788chr451219 1078 960 187 114 1105 ----
NM_000809chr4148921 8817 8339 6420 5929 5755 3311 2153 2120 1720 1412 1289 985 184 46990 5717 1648 65 21503 1277 --
NM_000813chr585131 5125 5119 4123 1983 1051 879 200 13634 14878 1922
NM_000891chr1742611 2425 651 260 33231 2456 344 --1241
NM_000950chrX53638 3166 3049 2440 2232 --12538 11208
NM_001001396chr154311 3288 2845 2832 756 11170 --13249
NM_001001419chr565208 5161 3960 2086 1786 1754 1872 11010 --
NM_001001433chr2022598 194 --22021 188 1427
NM_001001890chr212698 678 23428 1019 --23266 544
NM_001002860chr1474629 3358 1832 1534 179 173 129 11577 ----
NM_001003652chr18138459 7564 6306 6150 3448 2838 2767 1657 1378 1327 1048 675 665 11224 1658 16249
NM_001004317chr614446 24346 4252 --21021 553
NM_001005386chr272377 1990 1640 777 682 626 570 --12304 --
NM_001005473chr564633 4594 4042 1183 675 262 --12420 14191
NM_001006600chr52426 270 32021 764 626 --1227
NM_001007278chr1354332 4291 3355 2002 938 25204 2018 --14057
NM_001007466chr6114960 4937 4705 1752 1587 1581 1575 1568 1555 1542 277 13646 ----
NM_001007559chr1841624 1610 1604 106 --31926 1596 1430 --
NM_001008239chr1863803 3708 1348 1342 1317 346 13669 33154 2676 1327 --
NM_001008495chr831869 1759 253 1123 32178 1728 461 12266
NM_001008801chr1921761 1468 21897 1637 1279 32004 466 111
NM_001009554chr453365 3119 2984 1570 1467 13442 1419 14039
NM_001010891chr576549 6184 5458 5085 2670 2268 1220 ----11200
NM_001011666chr785414 4980 4305 2310 2126 1958 1891 1021 24130 862 12519 --
NM_001015508chr84576 221 215 208 1562 ----
NM_001017999chr152167 527 363 357 351 1736 1316 --
NM_001018067chr145290 431 409 367 25254 1639 24532 861 13849
NM_001025076chr1095879 5462 4037 3911 3818 1885 1299 1051 549 1523 12027 --
NM_001025077chr10107237 6820 5395 5269 5176 2657 2409 1907 1395 1322 34636 1881 669 ----
NM_001025079chr363436 2845 2832 2639 1248 239 23609 166 13840 --
NM_001032296chr1342613 617 30 24 32328 2050 253 ----
NM_001032999chr2051668 1355 1349 1213 705 --25236 1374 15182
NM_001034841chr1675335 5297 4983 4029 4023 3780 418 11963 35155 4017 3412 21052 362
NM_001037164chr772015 1773 1476 1448 1440 1434 37 11942 ----
NM_001037165chr7108860 8331 7647 7315 7309 6620 2743 1839 1159 575 ------
NM_001039590chrX43719 3632 3422 1492 --33734 3182 1499 --
NM_001039618chr1185686 4706 4693 4627 3883 2359 1474 1340 ----11803
NM_001039840chrX75338 5094 3773 2087 1170 493 437 15560 ----
NM_001040284chr1682311 2284 2140 2128 1936 688 458 127 35564 4311 2152 24362 4355 --
NM_001040441chr122144 2138 11476 --24375 3582
NM_001042355chr1685033 4667 4534 1460 1343 622 547 441 --2743 223 --
NM_001042555chr1274303 3797 3442 3168 989 852 776 22960 43 ----
NM_001042601chr362893 2799 851 803 144 103 --1883 22941 246
NM_001042604chr364375 3486 3197 3119 1349 1196 23565 1650 13075 --
NM_001100108chr188223 7319 5381 3181 2489 2404 2397 2379 --22747 2389 --
NM_001106chr3129704 9650 9158 8638 8161 3639 3249 2654 2266 2092 1236 329 27216 199 12674 --
NM_001167chrX76511 5510 4994 1087 1046 977 812 31390 710 474 16659 --
NM_001201chr463359 826 622 501 465 70 23822 278 ----
NM_001204chr2107184 6794 6668 6244 6216 2451 1512 1362 833 197 21726 444 ----
NM_001206chr943079 1114 298 292 1165 2286 278 --
NM_001386chr832020 1821 96 --11829 12256
NM_001396chr212398 54 32368 2094 38 1279 22021 486
NM_001412chrX72908 1152 1146 1139 1133 1127 616 11202 22769 147 --
NM_001419chr1931574 1225 1154 54621 4241 1534 1166 393 --1139
NM_001432chr41394 43554 3445 3370 139 --13690
NM_001527chr693804 3778 3769 1443 1420 1306 173 147 141 ------
NM_001730chr1331332 592 422 21285 312 --1502
NM_001759chr1265294 4644 3517 1912 1349 69 --31940 1932 1680 15143
NM_001806chr1972495 1095 822 713 568 370 192 --1209 --
NM_001987chr1243400 328 322 316 ------
NM_002025chrX89192 7747 7674 5750 5658 2989 1111 734 25768 118 --19049
NM_002158chr243746 3240 2750 1260 1692 1134 1142
NM_002264chr323400 561 --24624 3420 13496
NM_002265chr175786 779 773 760 749 ------
NM_002270chr595575 5537 4929 4911 4771 3858 3807 2155 476 --24138 2109 --
NM_002310chr5106017 5979 5813 5390 5352 2217 1482 1461 705 356 36560 4819 4352 ----
NM_002356chr672166 2064 1056 978 308 164 78 1800 ----
NM_002655chr844076 3860 3268 1146 12032 --23444 1652
NM_002657chr202946 29 ----23909 3807
NM_002736chr731940 810 634 --1109 12088
NM_002737chr1746301 4290 4278 1110 35674 5479 4854 26492 4269 --
NM_002740chr322513 2399 42744 2497 2430 240 2966 231 --
NM_002886chr3114511 4468 3754 3330 2006 1954 1923 1858 943 937 457 13288 1395 14954
NM_002959chr174045 1784 1719 1519 1395 292 286 ------
NM_002977chr252610 2307 1381 645 255 33011 2197 2181 --1264
NM_003012chr883072 2800 2405 2305 2243 1209 995 938 ----1235
NM_003108chr2107282 5819 5708 5049 4847 1523 1067 1010 806 349 1240 15570 --
NM_003247chr672032 1863 1763 1410 1389 1383 1377 ------
NM_003274chr2142220 2020 922 799 22181 1137 --12739
NM_003338chr1021975 1872 31661 1349 329 151 1237
NM_003371chr931957 1670 1626 --42120 1897 1840 1635 12138
NM_003392chr323310 1579 23648 2992 173 181
NM_003406chr8184 ----21399 151
NM_003489chr2143421 2305 2294 574 1824 --12756
NM_003574chr1875360 4767 4389 1047 967 543 292 14050 --14436
NM_003583chr1253492 2590 1492 1278 452 4347 198 165 88 --13655
NM_003597chr261931 1621 1492 468 208 136 --1222 1377
NM_003887chr261564 1558 1551 1445 1415 187 1173 ----
NM_003913chr664087 3466 3356 1375 1316 988 11391 13027 --
NM_003934chr94498 349 325 309 --11161 21241 73
NM_003955chr1761418 1302 1296 1290 1284 1277 --11387 --
NM_004171chr11117364 6700 5998 5832 5826 3835 3472 3119 2601 2392 1761 23434 2783 --16080
NM_004232chr181213 23001 498 --23510 1266
NM_004397chr1164213 3724 2991 1006 541 420 --24304 87 1249
NM_004437chr161310 1303 1191 917 630 589 --21027 269 1905
NM_004480chr145827 550 526 520 514 --1504 --
NM_004586chrX55435 4772 4382 4231 459 25087 4945 --14876
NM_004612chr974211 3182 1306 774 478 269 54 13719 21465 786 11560
NM_004731chr1251839 616 89 67 55 1162 ----
NM_004736chr132147 388 34 1796 11911 1417
NM_004815chr171213 1126 838 774 737 718 120 51820 1484 1182 1093 627 24003 23 --
NM_004852chr181212901 12107 12035 10406 9978 9216 8860 5179 4354 3336 1987 622 1188 32213 1101 997 212827 11957
NM_004906chr64534 470 143 130 1608 1117 --
NM_004985chr1273815 3399 3312 2861 1620 544 168 --1208 1427
NM_004992chrX78280 7944 7428 5759 5425 3056 187 --17016 37041 2754 1954
NM_004999chr663809 3744 3169 1714 965 791 21627 1253 12876 --
NM_005116chr2094472 4418 4372 4362 4324 4009 3272 1507 898 14449 ----
NM_005156chr9105085 4697 4327 4138 4033 3698 3319 1272 1200 1142 24970 1219 35056 1414 987 12005
NM_005207chr2252686 2659 2507 584 514 --33277 2884 550 1914
NM_005359chr1886551 4999 4270 4255 2271 1440 1110 849 --11503 --
NM_005433chr1852719 2353 2114 484 448 21738 108 1553 --
NM_005596chr9106232 5456 5202 4949 4379 2331 2236 1792 1769 1004 ------
NM_005665chr154248 1485 1442 502 484 14756 33102 1843 822 --
NM_005839chr17892 696 682 676 367 349 341 --1329 --
NM_005841chr4476 70 64 57 --1388 --
NM_005880chr164563 557 551 543 ----11247
NM_005895chr1283517 3506 3474 2639 1045 544 477 83 14024 13196 --
NM_005935chr455153 4919 4067 3646 453 23497 1442 13638 --
NM_006037chr294767 4755 4437 4427 3500 3391 1915 957 715 21710 1502 --11694
NM_006047chr2022686 304 12468 23515 628 1997
NM_006106chr113778 739 730 --2880 723 --
NM_006212chr165394 5127 5074 5047 3385 1468 11167 --1834
NM_006241chr392406 2066 1837 744 713 703 697 675 668 --1686 12005
NM_006252chr176591 5201 2995 2118 1255 1224 531 26465 2247 --24739 2284
NM_006306chrX44599 4104 1812 1680 11806 --23830 1939
NM_006352chr191801 1554 1448 550 366 359 351 213 127 ------
NM_006544chr1474225 3800 2354 2026 1596 486 167 55477 4127 4056 441 284 15503 --
NM_006614chr353118 1086 1014 694 622 --1358 11178
NM_006620chr631531 934 722 23761 107 23032 412 14289
NM_006885chr16144032 3848 3437 3430 2905 2899 2893 2689 2683 1505 1493 1468 567 558 12775 22887 1487 --
NM_006915chrX42496 2066 1649 689 1781 11903 195
NM_007006chr1693429 3210 2467 1306 944 862 794 98 90 12894 --11170
NM_007007chr1263993 3399 3048 809 562 329 41391 1320 955 700 13823 13200
NM_007175chr873239 2749 2739 1192 725 589 189 32828 2584 1057 11274 --
NM_007249chr1348908 3188 2178 665 19235 35931 2157 1638 12469
NM_007350chr1274376 4233 3497 3491 581 329 31 --13917 --
NM_012081chr562808 2741 890 882 874 282 ------
NM_012164chr966478 5503 5458 659 302 52 44859 2941 2689 2510 --17008
NM_012234chr343755 3559 3527 332 13261 22450 325 --
NM_012308chr1132296 2194 2175 ----22332 2183
NM_012382chr563115 3040 1663 1636 693 116 --13870 11376
NM_014155chr1197240 7030 6520 6059 5325 4729 732 301 68 56859 5082 2665 2251 1652 12565 --
NM_014181chr24479 473 467 460 ------
NM_014253chrX42474 2266 887 75 145 21991 1758 --
NM_014331chr486782 6494 6118 2116 986 690 382 368 12725 --16695
NM_014445chr321739 286 ----21526 411
NM_014456chr1051824 340 188 170 75 ----11308
NM_014615chr1662626 913 897 732 253 235 21015 827 1932 --
NM_014755chr263351 3041 1680 1083 589 140 23585 1073 14084 --
NM_014774chr172970 2513 2507 2501 2122 1246 501 12958 ----
NM_014830chr1293290 2685 1514 1462 1271 395 337 261 240 --13380 13917
NM_014868chr123608 49 43 --137 1244
NM_014873chr144620 4370 4001 3736 --34299 3441 1650 14327
NM_014877chr1766273 5908 5649 1135 758 663 36213 2239 732 21466 950 27592 6628
NM_014924chr1472741 2634 2435 2054 608 484 470 1708 ----
NM_014936chr662788 2711 2624 2355 1916 374 22701 2491 ----
NM_014962chr20------21982 235
NM_014982chr1485191 3945 3495 3463 2040 2034 1655 286 14351 12051 --
NM_014999chr124242 232 221 211 --11155 --
NM_015026chr1284724 3992 3685 3126 2966 1037 892 386 14493 ----
NM_015040chr253099 3093 3087 602 431 22094 622 2771 186 --
NM_015051chr933370 2990 2297 ----22126 131
NM_015144chr1643924 2680 1213 644 13989 --23934 692
NM_015199chr363022 589 583 574 559 260 12411 1460 --
NM_015265chr25146 99 93 86 71 11948 1107 --
NM_015278chr633411 2416 903 12545 1787 1795
NM_015315chr583053 2901 2467 2461 2455 2449 2238 890 ------
NM_015349chr63963 495 304 --1471 12316
NM_015355chr175782 746 526 349 76 21974 83 ----
NM_015458chr883502 3257 1282 943 860 762 754 435 ------
NM_015554chr1592950 2430 2424 2388 2300 1978 1079 1008 586 --1105 --
NM_015578chr193808 142 131 21867 1294 2319 125 --
NM_015878chr832077 1704 572 22203 342 1656 11500
NM_016132chr1563368 3362 3146 1327 432 313 1239 11321 1188
NM_016206chr3138680 7375 6239 5866 5644 5561 5441 1561 1041 736 604 284 141 46714 5934 988 659 37359 1582 74 --
NM_016248chr1363659 3623 3279 2710 1041 281 32646 996 494 23554 2442 --
NM_016275chr352421 1092 825 414 277 ----12354
NM_016530chr1584075 3920 3226 3143 2524 1109 865 241 11127 ----
NM_017420chr1453599 1318 967 397 320 ----12368
NM_017594chr972684 2247 2058 1058 897 879 778 1710 ----
NM_017628chr4114855 4842 3552 1652 1639 1632 1626 1620 1158 1041 115 ------
NM_017637chr9129241 8329 8165 7882 7557 3659 3556 3451 2424 2029 1534 486 29276 717 ----
NM_017643chr1732599 2479 2463 12618 --12864
NM_017650chr755944 5401 2215 1837 1346 --21339 1118 --
NM_017655chr13357 318 80 --1498 1249
NM_017658chr1484541 4492 4387 3572 3328 884 774 578 ------
NM_017664chr136895 813 804 798 244 104 ------
NM_017684chr1561992 1561 1416 395 149 140 21816 166 2406 381 --
NM_017736chr1693164 3105 2967 2154 1080 488 453 163 93 32749 2695 357 ----
NM_017758chr1771197 146 117 110 103 79 73 --197 --
NM_017813chr855513 5065 4411 4405 4076 65708 5438 4805 3988 1821 670 15056 --
NM_018011chr13393 87 81 1590 174 --
NM_018048chr123483 286 279 --11277 180
NM_018330chr1041613 1375 1100 412 --2444 419 --
NM_018362chr1173798 3172 3166 3159 2672 2652 590 33478 657 236 23925 2641 --
NM_018364chr134097 3571 3506 1373 --33969 3450 2723
NM_018374chr744827 3427 1185 553 24524 379 21597 1590 --
NM_018440chr878124 7343 6883 6763 2759 1904 1826 48362 7020 3177 3057 1391 11260
NM_018444chr841653 1633 552 494 11640 --1674
NM_018638chr1274343 1831 1325 1225 854 380 326 44198 3622 1720 1042 33842 2265 2100 --
NM_018650chr131870 1596 57 21961 642 --1384
NM_018717chr452646 2159 2148 93 86 32441 2223 2166 11138 --
NM_018841chr133226 2954 2835 13668 --12865
NM_018999chr1074837 4613 4525 4438 1915 1901 1894 14447 12993 --
NM_019022chr1853217 2837 2194 534 516 12596 13145 --
NM_019057chr52324 307 1314 1299 --
NM_020122chr275560 4280 4175 2061 1950 1289 1222 2900 782 21070 381 --
NM_020205chr143479 3328 2976 2554 33294 2698 2650 12307 13497
NM_020443chr176715 6639 6480 6137 5157 982 908 ----1834
NM_020466chr645004 3920 3744 3060 --13048 11902
NM_020673chr2047602 7056 2917 2747 --17063 11394
NM_020718chr16105719 5703 4435 4112 2378 2047 1901 1491 1222 339 26231 1667 --12216
NM_020734chr1273356 2893 1326 1199 557 354 334 23318 2811 ----
NM_020772chr17107866 7840 5510 2222 2135 2127 1610 964 509 286 21078 293 22594 268 11206
NM_020774chr18116264 5951 4948 3790 2147 1610 1442 850 379 192 185 45251 1746 1486 817 11854 --
NM_020794chr131127 255 249 1262 ----
NM_020803chr421968 765 --2940 391 12041
NM_020810chr1443516 3006 755 669 23191 677 --190
NM_020921chr1453356 845 308 300 139 11036 1315 --
NM_020964chr1831774 944 514 34780 2967 229 --11900
NM_021148chr761674 1005 845 814 808 692 22313 1740 3822 794 750 --
NM_021215chr2072349 2335 2251 2243 2118 2092 272 --22237 1678 --
NM_021255chr1433417 534 301 --21467 942 1290
NM_021813chr6135519 5023 4281 4275 4268 2235 812 806 800 790 771 727 694 --45633 2339 2229 1577 15646
NM_021964chr356564 1343 794 576 376 55587 4510 2381 2219 1803 35605 4121 2185 --
NM_022048chr1594766 4615 4603 4597 4583 4577 1619 824 761 16239 --1356
NM_022166chr1665676 4763 4051 4045 1877 1630 15850 --11147
NM_022459chr1385695 5596 4698 4240 1826 782 631 592 --24247 1506 --
NM_022574chr721517 342 --3350 336 196 --
NM_022898chr1484560 3064 1866 1572 609 568 340 242 --2822 603 11295
NM_024524chr372487 2034 1040 933 647 618 340 12691 32880 880 326 --
NM_024665chr3113935 3833 2861 1832 1355 1023 797 758 752 485 325 24339 1254 44468 3812 3294 995 --
NM_024947chr378913 8709 8217 6414 3826 2427 640 39159 7676 2530 ----
NM_024989chr275914 3181 2191 1659 1610 518 180 38075 7350 5261 ----
NM_025040chr1962484 2222 2017 950 939 932 ----12236
NM_025146chr352646 2465 1924 692 121 12414 11715 1441
NM_025191chr172753 2455 2432 2395 1139 1061 406 11146 11133 --
NM_025214chr18------22108 354
NM_025248chr1773220 1124 1097 955 189 183 177 ------
NM_030621chr1464219 4126 478 318 312 206 13133 ----
NM_030627chr533595 632 434 53898 3790 3721 3451 2631 --1343
NM_030647chr765726 5692 2150 2130 985 629 12060 --25836 452
NM_030648chr445478 3889 1329 1260 11867 44961 518 357 332 --
NM_030816chr123405 1342 41296 922 708 296 --12655
NM_030939chr64829 823 797 50 --21055 358 1895
NM_031465chr123859 86 80 --174 --
NM_032256chr1231042 1036 1029 1332 ----
NM_032373chr1024836 1753 24820 1461 23864 479 13664
NM_032510chr1842494 2323 2165 93 2367 317 --1472
NM_032828chr1983454 3307 1947 1632 1507 1385 613 325 1309 ----
NM_032859chr1363932 2823 1078 698 571 155 23761 2698 12837 --
NM_033030chr221506 589 --21319 229 11098
NM_033224chr787409 7145 6986 3141 2157 1834 1469 662 ----12875
NM_033285chr884075 4050 3999 2955 2781 1791 1569 1463 14303 1569 --
NM_033656chr2155574 5284 4411 1952 1679 --22331 612 12200
NM_052879chr1273827 3333 2995 2898 1491 277 271 13431 --1184
NM_052885chr1254881 3528 1281 1260 874 23679 1185 11865 21407 786
NM_052907chr1263995 1086 766 714 172 44 14307 1651 --
NM_080664chr144604 304 298 290 ------
NM_080867chr1444546 1975 1089 1009 21262 228 34172 874 221 --
NM_080927chr373120 3100 2493 2312 2047 1265 1024 33326 2204 511 32264 2088 2061 12299
NM_138348chr575181 4492 4325 1870 1515 1182 999 25065 1537 ----
NM_138444chr1364422 4353 3999 3381 1281 1274 33925 1886 1828 13510 --
NM_139281chr553404 2569 2194 1189 1045 11438 11021 --
NM_144567chr142661 510 244 47 ----22461 1719
NM_144571chr486734 6451 6256 2536 2162 1372 656 319 21365 230 24929 678 --
NM_144578chr1495479 4751 4413 3942 3779 1603 1379 613 234 1680 ----
NM_144599chr1585227 4864 4586 4513 4024 2118 1855 1476 1517 ----
NM_144664chr1131954 545 361 2702 467 2450 348 --
NM_145206chr1052968 1279 813 591 223 13291 --11084
NM_145259chr236664 2273 72 32785 2182 316 --16341
NM_152470chr1853793 3544 732 708 657 1715 ----
NM_152557chr751108 338 267 260 253 ------
NM_152594chr1542024 904 893 472 1653 --11560
NM_152624chr5107473 7092 2672 2489 1882 1860 1305 876 387 272 16204 15182 --
NM_152734chr653772 3758 2198 1723 1080 23526 1853 --15490
NM_152744chr742669 2333 504 97 --21177 173 13268
NM_152756chr564283 4244 3047 1074 527 292 --33318 1170 706 --
NM_153184chr341861 1705 563 339 ----1311
NM_153207chr1223769 870 24087 1533 33225 859 768 13249
NM_153367chr1053337 3073 2929 2617 735 --22919 2908 --
NM_170606chr751845 628 329 297 285 1500 21765 1369 --
NM_172071chr1127069 6751 6482 5719 5161 4638 2998 2991 2958 668 373 252 37081 6049 682 11193 --
NM_173468chr4116043 5448 5336 5330 5249 5019 3973 1281 263 244 94 52086 1404 378 233 80 11258 --
NM_173470chrX42887 2337 2163 476 2975 527 22134 305 21776 984
NM_173602chr1243699 3435 3283 719 13735 --12883
NM_173642chr147576 3329 948 823 19224 16303 2868 174
NM_173808chr144391 3460 3115 3008 ----13499
NM_177966chr361835 336 330 324 318 303 ----11308
NM_178135chr461260 907 900 261 206 191 11307 2879 871 --
NM_182485chr473521 3205 3196 2546 1129 236 169 --12604 1366
NM_194071chr795337 5252 5009 3415 1501 1416 1302 1294 898 ------
NM_194314chr123575 779 35436 4723 4109 34844 4659 666 --
NM_199342chr12233 227 --1242 --
NM_206854chr664953 4290 3540 3486 3428 1957 13756 1188 --
NM_207406chr476420 6369 4673 2047 1987 1921 595 14986 34667 1408 1356 --
NM_213589chr285553 5449 5435 4831 3707 2183 2127 523 --14057 --