TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548l
miRNA Sequence: AAAAGUAUUUGCGGGUUUUGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr13625 576 262 1526 1148 --
NM_000024chr51145 1471 ----
NM_000038chr571943 1717 1693 628 516 181 148 2686 522 1161 11487
NM_000051chr11143505 3238 2956 2359 2295 2195 1256 1050 936 647 197 143 99 62 43540 3477 1138 923 --282 51
NM_000052chrX123479 3293 3150 3034 2811 2791 2783 2770 2617 1314 621 586 63434 3350 3299 3108 2485 2193 52164 1178 690 390 214 23272 2878
NM_000055chr32337 321 1157 132 --
NM_000059chr133886 833 89 1549 1186 1803
NM_000067chr85630 508 207 177 96 1673 ----
NM_000074chrX1948 ------
NM_000081chr151797 1544 1295 616 499 21163 192 21721 1144 31408 547 404
NM_000084chrX196679 5932 5919 5588 4942 4805 4612 4498 4278 2743 2332 2290 1160 620 549 496 449 267 92 36952 1953 943 56522 6004 5277 2443 2090 --
NM_000088chr1731366 1328 989 --21005 139 --
NM_000089chr73766 581 507 --1611 --
NM_000090chr25861 697 656 211 158 --1199 --
NM_000091chr2102858 2790 2764 2682 2488 2274 980 329 81 30 22886 1889 --22844 2810
NM_000092chr2174550 4416 4392 4092 3823 3715 3393 3201 1795 1734 1560 1379 1336 1285 878 736 495 31761 1724 232 21824 1775 23378 508
NM_000093chr932268 2238 588 --1380 --
NM_000097chr34756 469 348 221 11067 --1396
NM_000108chr761678 1619 1567 1182 406 190 --2266 22 1173
NM_000109chrX32572 2343 2017 32657 2207 418 1183 --
NM_000110chr141176 1004 859 347 --2988 965 --
NM_000111chr72361 102 --1249 --
NM_000112chr5165345 4990 4828 4699 4212 4080 4067 3554 2167 2077 1776 1472 1377 1287 1133 1087 1814 25476 1336 11396
NM_000125chr674187 3247 2708 2611 1030 890 810 1645 44044 3374 3360 2646 --
NM_000129chr651538 1380 511 150 87 --2477 164 --
NM_000138chr1562485 1881 612 508 350 327 --42258 2198 1842 63 --
NM_000141chr1051341 1238 585 447 432 --1579 --
NM_000142chr431352 1169 1142 ----11078
NM_000151chr1711372 11878 11547 11929
NM_000152chr171525 ------
NM_000161chr1471837 1578 1369 435 306 188 133 21375 778 2751 524 --
NM_000163chr572394 2341 2281 2092 1882 522 180 21682 578 --1220
NM_000165chr641237 1169 1090 413 --2564 367 --
NM_000167chrX101825 1681 1472 1427 1352 742 713 444 395 195 --41124 706 674 573 --
NM_000168chr7103303 2784 2384 2364 2318 1315 1105 932 860 715 32878 495 100 ----
NM_000176chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_000179chr2183 ------
NM_000183chr22347 334 ------
NM_000189chr262243 1903 1762 1587 796 779 ------
NM_000192chr1241557 1354 518 504 --1438 11194
NM_000194chrX1509 2479 144 ----
NM_000208chr1974661 4319 4255 3144 1017 1006 585 --2701 593 --
NM_000210chr282232 2090 1721 1533 839 817 439 228 --21867 1749 --
NM_000214chr2071498 1252 1137 630 497 482 359 --11414 --
NM_000217chr1285349 3323 3302 2069 1758 313 249 213 45149 3329 1020 891 45370 4094 522 341 1104
NM_000222chr431934 1821 68 --32015 1875 1740 --
NM_000232chr4132921 2640 2590 2461 2291 2120 2070 2048 1211 1010 882 381 207 21954 102 21978 561 22911 2172
NM_000237chr821891 1210 2369 156 1445 --
NM_000242chr1072731 2499 2312 1807 467 335 63 12332 42664 2152 288 216 22624 2144
NM_000245chr762200 2162 1521 1405 839 673 --11502 --
NM_000248chr3102932 2148 2135 1211 963 894 888 868 840 818 2830 187 32835 1111 1014 3750 146 123
NM_000251chr21176 ------
NM_000252chrX61409 1388 1156 1066 401 90 21285 340 1311 --
NM_000253chr441054 1001 100 70 ------
NM_000255chr62323 106 2126 42 ----
NM_000259chr15166037 5814 5738 5566 5557 5213 5199 5113 5030 4277 4157 2127 1781 1421 955 815 35922 2175 321 86004 5637 5458 5449 4002 2107 990 154 11514
NM_000264chr9123353 3279 3022 2873 2640 2417 2302 2238 422 179 167 156 --23005 2687 1449
NM_000267chr17123472 3128 3087 2475 2191 2132 1405 1102 1038 760 582 212 --21032 877 1613
NM_000268chr2243735 2942 2363 1451 ------
NM_000276chrX22219 2168 --2217 181 --
NM_000280chr111738 ------
NM_000291chrX6883 831 802 645 627 256 1603 1263 --
NM_000297chr441704 1626 654 382 1149 31911 1835 589 11482
NM_000314chr1022270 1029 22432 994 32712 2577 1078 --
NM_000315chr111102 ------
NM_000321chr13121766 1718 1694 1504 1492 1461 1419 1363 1112 720 618 343 41792 1711 570 282 1406 --
NM_000328chrX4346 293 157 49 --1174 1432
NM_000329chr15755 740 718 251 209 --1348 2798 321
NM_000332chr6156984 6930 5752 5467 5382 5371 4347 2766 2391 2333 2131 1870 1236 737 658 35742 2021 1845 65225 4840 4472 2786 694 176 1621
NM_000337chr596633 6506 6497 6174 4872 1704 1471 1056 75 24524 1715 34212 1765 1102 --
NM_000338chr154936 927 807 414 169 2816 782 --
NM_000340chr391490 545 532 515 371 363 229 160 111 11412 3961 262 182 --
NM_000345chr441018 983 900 311 1892 ----
NM_000346chr1791825 1681 1575 759 607 591 526 386 114 1438 31862 500 446 --
NM_000353chr1641237 1148 896 141 ------
NM_000362chr2273379 3238 2615 2493 1109 660 302 ------
NM_000368chr994644 4424 3324 3124 1903 589 526 373 281 ----13825
NM_000388chr3--11253 1505 --
NM_000390chrX133363 3057 2927 2843 2667 2589 2163 2077 786 612 518 411 387 11074 13014 13406
NM_000393chr261913 1365 1357 1309 416 170 21441 176 51952 1641 1407 1348 214 --
NM_000397chrX52444 2414 1950 469 462 ------
NM_000399chr103977 961 338 1293 31202 1013 1003 --
NM_000401chr1131109 1088 709 ------
NM_000408chr293118 2814 2717 2632 2142 1356 1329 1316 1013 32149 814 179 43317 1274 339 218 --
NM_000411chr21113136 3125 3110 3075 2930 2427 2369 2027 1264 644 471 --1330 --
NM_000415chr123949 880 745 1229 1815 --
NM_000430chr1773250 2643 1276 772 755 628 589 --33170 1395 711 11248
NM_000434chr62516 423 ------
NM_000435chr196922 911 859 406 342 336 ------
NM_000439chr572141 2008 1815 1720 1576 101 38 --42418 2326 2294 2072 --
NM_000441chr732296 2135 756 --42215 923 635 494 --
NM_000448chr11143301 3251 3067 3035 2491 2373 2179 1291 1162 1093 1052 924 816 810 12982 33235 2136 408 13245
NM_000449chr131446 1311 1295 ------
NM_000452chr1372026 1603 1543 1391 567 519 59 22064 496 11611 12098
NM_000458chr17--1935 ----
NM_000459chr91343 --2336 259 1751
NM_000461chr384552 3824 3789 3743 3040 1771 556 172 23848 3683 44481 4335 1570 686 --
NM_000462chr1571361 1223 521 504 465 312 250 21571 318 11684 --
NM_000474chr7----2673 640 --
NM_000478chr12755 299 ------
NM_000489chrX153350 3094 2659 2425 2167 2115 1260 1013 851 720 450 315 233 139 54 23265 528 33409 3034 443 --
NM_000492chr771505 1219 1130 1083 1010 401 227 21173 1136 ----
NM_000493chr62947 110 ------
NM_000495chrX4445 383 236 203 --21060 289 --
NM_000503chr831316 635 436 --11500 11163
NM_000508chr45958 880 869 621 117 ------
NM_000509chr4127 --166 --
NM_000510chr1131214 1090 964 21296 1060 ----
NM_000521chr5----1102 --
NM_000522chr771236 1226 1046 1000 918 82 58 --11022 --
NM_000523chr241102 1081 1064 301 1373 ----
NM_000527chr1952240 1547 872 683 118 ------
NM_000533chrX41674 1634 1377 345 11981 ----
NM_000536chr112417 51 ----1205
NM_000538chr1371846 1628 1515 1450 1237 520 297 --21709 61 --
NM_000550chr94953 884 239 80 --3984 316 145 11055
NM_000553chr82622 88 3602 427 248 1594 161
NM_000555chrX227811 7398 6319 5650 5095 5078 2936 2696 2415 2275 2088 1506 1423 1301 1200 606 309 161 128 111 97 63 12211 35921 2353 1555 21269 1245
NM_000560chr1--1696 ----
NM_000565chr132013 1542 71 --11503 --
NM_000574chr131239 1043 857 31278 1027 934 1116 1521
NM_000586chr43204 68 55 ------
NM_000590chr51136 ------
NM_000594chr61661 ------
NM_000596chr74177 116 54 37 ------
NM_000598chr741437 1409 102 45 21576 1552 11073 --
NM_000599chr244494 3890 1693 764 --23925 1851 --
NM_000600chr73362 152 136 1128 1349 --
NM_000601chr72333 276 1384 ----
NM_000602chr731493 1481 1321 ----21524 1472
NM_000609chr1063094 2969 2898 2254 252 183 13047 1143 11946
NM_000610chr11132961 2920 2785 2616 2482 2158 2146 1848 682 632 516 441 195 --12173 --
NM_000611chr11106895 6689 6648 6128 5067 4955 1918 1347 325 251 21158 803 32746 1282 87 --
NM_000615chr1173018 2887 2779 987 969 792 465 2846 601 32499 473 420 --
NM_000618chr12156356 6288 6274 6042 5902 5272 4909 4606 2503 1972 912 815 664 650 515 65192 4925 4752 4426 2458 632 46552 6416 5092 4710 24933 2277
NM_000618chr12156356 6288 6274 6042 5902 5272 4909 4606 2503 1972 912 815 664 650 515 65192 4925 4752 4426 2458 632 46552 6416 5092 4710 24933 2277
NM_000619chr12256 23 1400 184 --
NM_000627chr2172 2601 271 1607 1357
NM_000633chr1894960 4935 4326 3698 3454 1792 959 717 230 11806 35068 5034 811 15128
NM_000641chr1951612 1577 489 340 166 11549 ----
NM_000676chr173409 216 196 --1355 --
NM_000681chr1031189 492 284 ------
NM_000683chr41508 ------
NM_000684chr1031178 506 495 --11005 --
NM_000685chr34860 324 310 97 1866 ----
NM_000685chr34860 324 310 97 1866 ----
NM_000686chrX71501 622 491 315 218 64 43 11176 --1613
NM_000693chr1531847 1674 1269 11514 21248 343 --
NM_000717chr17----1114 --
NM_000719chr1294687 4535 2578 2030 1763 1602 1577 1014 782 36246 1980 1466 21695 1613 --
NM_000724chr101529 2677 644 31720 176 121 --
NM_000726chr221263 289 --1208 --
NM_000756chr82477 104 --1484 --
NM_000758chr55311 267 232 215 207 --1222 --
NM_000759chr17267 44 ------
NM_000767chr1961496 1346 1328 1026 1000 394 ------
NM_000773chr101152 --1117 --
NM_000780chr841204 1193 1174 288 31222 514 311 31125 1050 834 11139
NM_000783chr103195 107 80 2481 208 ----
NM_000788chr471433 1406 1360 1253 1054 569 42 21012 511 1923 --
NM_000792chr12979 699 1958 ----
NM_000793chr14145055 4515 4468 4056 4023 3218 1589 974 937 929 876 587 154 76 55135 4709 3447 1852 1519 31543 1002 318 --
NM_000801chr202956 257 11116 --1403
NM_000806chr5101656 1617 1601 1543 1494 1365 596 503 348 122 31289 615 83 1391 1694
NM_000809chr4369283 9205 9076 9036 8934 8915 8731 8645 8452 8120 7791 7775 7472 6959 6870 6844 6455 6288 6018 5965 5773 5741 3169 2926 2871 2832 2566 2523 2061 1939 1925 1178 1042 938 605 310 48974 3519 3148 203 128371 8100 7825 7799 7755 6921 6495 5953 5658 3463 903 297 49213 7819 2944 1320
NM_000810chr15136 ----1380
NM_000812chr42335 33 ------
NM_000813chr5145544 5449 5234 4899 4618 4144 3544 1977 1751 1542 1531 1379 1305 1287 14008 54749 3987 2016 1656 1255 --
NM_000814chr1583662 3295 2691 1517 1216 1115 1037 1010 33633 2712 2666 21502 1092 11643
NM_000816chr55639 566 548 267 185 ------
NM_000818chr10--1512 ----
NM_000820chr131249 ------
NM_000824chr44950 756 707 647 1939 --1960
NM_000826chr4102564 2441 2413 1949 1687 1675 1625 1617 823 569 --42552 2106 685 559 --
NM_000827chr582545 2484 2418 2339 2274 2128 1977 820 1339 ----
NM_000838chr642376 2128 2004 384 12201 12793 11996
NM_000839chr33495 464 377 ------
NM_000840chr71134 ------
NM_000844chr35990 814 788 350 49 3760 181 163 21113 837 --
NM_000845chr71331 ------
NM_000855chr112347 97 ----1253
NM_000857chr44369 319 190 180 ----1425
NM_000859chr551560 1397 1379 533 512 1208 11718 --
NM_000861chr331975 1945 1722 --41761 1026 834 778 --
NM_000866chr341664 1173 646 411 11225 1232 1141
NM_000868chrX92543 2510 2250 924 508 388 247 218 185 2639 145 1944 --
NM_000872chr1061296 982 568 375 317 260 --11155 --
NM_000875chr15137036 6991 6618 6284 4713 4540 2636 2462 2380 1829 1665 1419 1279 26312 6023 35883 1767 1371 --
NM_000876chr631377 956 83 1327 --1361
NM_000877chr263080 2837 2241 2132 1983 788 22420 840 42879 1899 1190 979 --
NM_000879chr51131 --1233 --
NM_000880chr84897 321 300 90 --2870 787 --
NM_000882chr34386 371 323 142 1315 1423 --
NM_000885chr272065 1902 1768 1596 739 670 427 ------
NM_000891chr17113597 3332 3224 3150 3104 3071 2838 2497 902 418 318 43688 1458 939 33 53667 3036 2490 1056 735 13366
NM_000899chr12134317 4011 3879 3823 3770 3679 2984 2820 1745 1579 1376 1271 28 1248 --34394 3576 2919
NM_000901chr452399 1847 1771 840 823 22576 994 1296 --
NM_000902chr3103252 3145 2074 2068 974 755 713 635 448 235 22170 579 11103 --
NM_000908chr52768 668 2731 720 1743 --
NM_000909chr471335 1251 1072 283 239 147 137 1422 167 11234
NM_000910chr461513 1501 1303 1244 275 264 --31427 1395 593 --
NM_000917chr104623 609 268 160 ------
NM_000919chr53605 575 469 ------
NM_000921chr12----1152 --
NM_000922chr115821 393 360 317 294 --1278 --
NM_000926chr11349255 9040 9026 8970 8900 8754 8333 7868 7010 6839 6362 6171 6104 3766 3699 3548 3315 3191 3122 2851 2676 2449 2294 2243 2180 2030 1837 1446 1418 1352 513 465 415 163 68735 6192 5990 3680 1499 1212 109325 9015 8794 8596 5852 2918 2718 2261 1996 214 36750 1522 1392
NM_000933chr2041550 1358 1101 80 1671 ----
NM_000935chr3111107 1010 909 887 810 481 309 238 171 96 34 --2339 251 --
NM_000937chr17--2395 311 ----
NM_000944chr472312 2247 2209 832 776 638 243 12177 1191 --
NM_000945chr2112098 786 632 537 521 452 390 330 279 106 36 --11852 11841
NM_000949chr55958 951 919 906 211 1877 ----
NM_000950chrX163661 3594 3561 3544 3373 3194 3180 2822 2756 2587 1356 1212 1189 1176 458 138 33533 2719 97 53120 3111 3017 2341 986 12521
NM_000956chr1441065 1021 346 223 1355 --1951
NM_000958chr561329 1195 1066 996 870 476 --1842 --
NM_000959chr1193986 3081 3009 2979 2927 2686 2622 2471 1559 1548 1536 1429 1319 703 606 451 434 370 62 21279 886 32967 2567 279 --
NM_000962chr952897 2764 2043 923 364 ------
NM_000963chr1122505 2330 2088 1966 1702 516 481 432 421 310 146 68 --22157 831 1698
NM_000964chr17--1523 ----
NM_000983chr131301 467 338 --11615 --
NM_000990chr1183943 3864 3667 2682 1486 603 117 39 13925 23757 2710 --
NM_001000chrX130 ------
NM_001001132chr2171396 986 967 490 399 340 319 ----1355
NM_001001323chr1293122 2635 2514 2469 2459 1187 836 476 430 13135 52854 2082 1197 961 756 --
NM_001001330chr1061282 1273 1136 835 314 128 1811 21237 496 --
NM_001001349chr1711349 ------
NM_001001389chr11132961 2920 2785 2616 2482 2158 2146 1848 682 632 516 441 195 --12173 --
NM_001001390chr11132961 2920 2785 2616 2482 2158 2146 1848 682 632 516 441 195 --12173 --
NM_001001391chr11132961 2920 2785 2616 2482 2158 2146 1848 682 632 516 441 195 --12173 --
NM_001001392chr11133007 2966 2831 2662 2528 2204 2192 1894 728 678 562 487 241 --12219 --
NM_001001395chr12122299 2212 2187 1855 1844 1804 1095 810 635 415 310 279 31960 881 443 22339 422 --
NM_001001396chr174273 4126 2925 2738 1344 1076 1046 1315 12710 --
NM_001001419chr5235176 5141 5134 5119 5007 4916 4471 4271 3687 3609 3517 2059 1891 1844 1666 1020 920 847 823 796 417 147 112 65236 4933 4841 3345 746 283 43801 3661 998 276 --
NM_001001420chr5235176 5141 5134 5119 5007 4916 4471 4271 3687 3609 3517 2059 1891 1844 1666 1020 920 847 823 796 417 147 112 65236 4933 4841 3345 746 283 43801 3661 998 276 --
NM_001001433chr2073090 3001 2901 2488 2470 1986 355 --2494 277 --
NM_001001436chr166869 832 788 770 570 349 --1609 1598
NM_001001438chr211381 ------
NM_001001481chr8123397 3362 3114 2797 2726 2677 2542 785 598 512 269 263 31395 1172 487 21025 199 12219
NM_001001483chr112427 403 --1300 --
NM_001001484chr1052242 948 898 637 430 1212 2986 551 12025
NM_001001522chr11----1387 --
NM_001001549chr792817 2757 2304 2147 2056 1135 915 612 376 --22452 669 --
NM_001001550chr792817 2757 2304 2147 2056 1135 915 612 376 --22452 669 --
NM_001001555chr792817 2757 2304 2147 2056 1135 915 612 376 --22452 669 --
NM_001001556chr1551575 1479 1199 224 163 --1133 --
NM_001001557chr842011 1857 1821 776 --11963 --
NM_001001567chr211179 ------
NM_001001568chr211179 ------
NM_001001571chr211179 ------
NM_001001572chr211179 ------
NM_001001573chr211179 ------
NM_001001574chr211179 ------
NM_001001575chr211179 ------
NM_001001576chr211179 ------
NM_001001577chr211179 ------
NM_001001579chr211179 ------
NM_001001580chr211179 ------
NM_001001581chr211179 ------
NM_001001582chr211179 ------
NM_001001584chr211179 ------
NM_001001585chr211179 ------
NM_001001664chr2173832 3467 3446 3436 3258 3068 2804 2765 2588 1506 1309 1135 1056 893 553 369 102 23675 3638 24100 885 23085 250
NM_001001668chr19103864 3519 3398 3352 2716 1217 1164 1154 199 38 22813 1390 31677 1267 977 13907
NM_001001669chr552541 2426 2281 2206 851 ------
NM_001001890chr21144016 3652 3641 3270 3254 2746 1615 1475 826 766 600 548 487 333 13662 --13343
NM_001001928chr22148366 7952 7418 6500 6322 5960 5450 5145 1441 1248 610 550 494 176 36626 1775 300 36039 5849 2910 17194
NM_001001933chr12473 410 --1434 --
NM_001001938chr994127 3760 3368 3333 3116 1546 487 374 353 13088 43609 2832 1338 1314 --
NM_001001971chr1051125 1055 988 270 55 11032 1880 21256 290
NM_001001974chr10122263 2247 2146 2039 1962 1559 865 788 560 512 403 342 32191 1524 703 31786 1567 285 --
NM_001001995chrX61867 1857 1837 1655 1430 1258 11873 41783 1717 599 254 --
NM_001002026chr382412 887 872 851 730 512 427 90 ------
NM_001002243chr23742 162 31 ------
NM_001002255chr61348 ------
NM_001002257chr273548 3136 2214 1131 885 748 100 11426 3825 133 40 --
NM_001002258chr251974 805 452 356 165 ----12007
NM_001002295chr102929 792 --1818 11169
NM_001002759chr103633 422 57 1530 ----
NM_001002838chrX41879 1853 248 47 1119 2132 98 1280
NM_001002843chr1571297 1206 1180 1148 518 427 325 --1822 --
NM_001002860chr14164644 4534 4473 4315 3934 3835 3814 3717 3657 1694 1616 1609 472 445 375 313 --54055 3690 3597 1369 383 --
NM_001002906chrY1153 --2457 423 --
NM_001002909chr1772022 1810 1395 866 835 327 168 --31523 889 745 --
NM_001003652chr18238623 8599 8420 7738 7704 6665 6638 6600 6192 6090 6001 3087 2181 1925 1752 1687 1588 1394 1070 1009 977 463 165 76465 6441 6160 3254 3142 2776 1062 87255 6983 6106 3006 2976 2748 1640 1568 28514 2100
NM_001003665chr15959 789 164 147 128 ------
NM_001003674chr18146865 6681 6641 5412 5190 5126 4946 4511 2107 1587 883 720 606 470 46702 5446 5369 1053 46979 5320 1269 279 --
NM_001003675chr18146865 6681 6641 5412 5190 5126 4946 4511 2107 1587 883 720 606 470 46702 5446 5369 1053 46979 5320 1269 279 --
NM_001003678chr11194 ------
NM_001003679chr172132 1947 1860 1676 1443 474 462 11811 21875 1845 11894
NM_001003681chr2272153 2123 2050 1895 1481 364 175 ------
NM_001003688chr461233 1166 1116 1038 107 50 ----1462
NM_001003690chr6----1412 --
NM_001003698chr661455 1356 793 351 268 56 ------
NM_001003699chr661455 1356 793 351 268 56 ------
NM_001003712chr12143570 3496 3468 3458 2915 2890 2663 1525 1247 798 679 653 606 407 2969 907 32804 2782 1221 12641
NM_001003760chr6133638 3144 2882 2857 2635 2608 2597 2539 2224 1201 699 402 91 13071 33341 2798 1329 --
NM_001003792chr33943 436 209 21173 480 1349 1295
NM_001003793chr33943 436 209 21173 480 1349 1295
NM_001003800chr963494 3391 2966 1170 827 699 13537 ----
NM_001003810chr46720 655 581 225 196 48 --1616 --
NM_001003937chr261736 1553 1538 1328 498 93 --11488 --
NM_001004023chr1----140 --
NM_001004051chrX2226 61 --1100 --
NM_001004065chr9113979 3931 3809 1589 1149 989 824 805 573 524 421 ----21578 619
NM_001004106chr511023 ------
NM_001004127chr13--1105 167 130
NM_001004196chr341223 1164 1098 1080 1840 1936 --
NM_001004303chr12764 718 2676 527 ----
NM_001004303chr12764 718 2676 527 ----
NM_001004304chr1253246 3237 2888 2234 595 --23115 2261 --
NM_001004317chr6124164 4034 3977 3539 3386 3347 1436 1287 740 511 371 325 21247 838 23514 1006 --
NM_001004329chr1251456 1416 1062 602 498 ----1132
NM_001004346chr451101 842 240 179 111 1421 2938 299 175
NM_001004356chr451520 1510 1302 1145 980 ------
NM_001004358chr451520 1510 1302 1145 980 ------
NM_001004360chr221263 472 21838 509 21686 772 11903
NM_001004419chr1244613 3943 3413 3301 24113 1740 24515 3295 --
NM_001004431chr17----1237 --
NM_001005242chr1251427 1410 1304 529 56 11088 --11192
NM_001005266chr152103 24 ------
NM_001005267chr152103 24 ------
NM_001005268chr152103 24 ------
NM_001005269chr152103 24 ------
NM_001005353chr121211 1035 --21278 329 --
NM_001005353chr121211 1035 --21278 329 --
NM_001005367chr19--1347 ----
NM_001005375chrY21608 507 1696 ----
NM_001005377chr19--1282 ----
NM_001005386chr272477 2283 908 666 617 291 243 --137 --
NM_001005404chr1784489 4313 4115 3762 3216 3175 3154 191 --33425 3140 1747 24055 3263
NM_001005463chr10112617 2583 2366 2105 1991 1767 1044 976 933 420 284 11732 2462 235 --
NM_001005473chr5206107 5870 5307 5296 5222 5113 4904 4733 4457 4430 2579 2485 2279 2267 2232 1869 1556 1496 1131 189 24207 1627 45559 5380 5322 2597 16524
NM_001005474chr381484 1335 1308 580 558 532 202 124 ------
NM_001005505chr311723 --21858 1810 11554
NM_001005526chr21128 ------
NM_001005527chr341320 460 336 118 1535 --11237
NM_001005739chr25859 778 691 601 594 --2734 351 1335
NM_001005743chr1441308 1267 831 238 21337 932 1525 --
NM_001005744chr1441308 1267 831 238 21337 932 1525 --
NM_001005745chr1441308 1267 831 238 21337 932 1525 --
NM_001005746chr221263 289 --1208 --
NM_001005747chr221263 289 --1208 --
NM_001005751chr105424 194 167 144 136 --1533 --
NM_001005782chr24781 760 693 46 1787 ----
NM_001005861chr38832 782 658 633 366 359 329 259 --2183 73 1139
NM_001006115chr362706 2478 2122 1971 106 91 ----12533
NM_001006600chr5122114 2097 1913 1656 1522 872 566 442 402 292 82 53 22148 928 21588 73 --
NM_001006610chr162675 180 ----2891 661
NM_001006612chrX4400 159 84 48 ------
NM_001006613chrX4400 159 84 48 ------
NM_001006614chrX4400 159 84 48 ------
NM_001006617chr931395 1352 232 --11404 --
NM_001006618chr9--1246 ----
NM_001006619chr931395 1352 232 --11404 --
NM_001006620chr931395 1352 232 --11404 --
NM_001006621chr931395 1352 232 --11404 --
NM_001006623chr292497 2446 2249 816 697 538 247 159 137 ------
NM_001006636chr24895 882 803 72 ------
NM_001006639chrX1539 1128 ----
NM_001006640chrX1539 1128 ----
NM_001006641chr931170 1113 639 ------
NM_001006642chr931170 1113 639 ------
NM_001006643chr931170 1113 639 ------
NM_001006657chr283212 3151 2655 2531 2509 2236 510 472 32346 961 586 ----
NM_001006944chr111153 ------
NM_001006945chr14750 670 282 49 2607 255 1243 --
NM_001007023chr14145055 4515 4468 4056 4023 3218 1589 974 937 929 876 587 154 76 55135 4709 3447 1852 1519 31543 1002 318 --
NM_001007024chr1794347 4306 3579 3434 2976 1632 1617 385 247 --24214 2954 --
NM_001007025chr1794347 4306 3579 3434 2976 1632 1617 385 247 --24214 2954 --
NM_001007088chrX----2476 78 --
NM_001007097chr9125077 5036 4017 3922 3630 3302 1485 1302 907 340 319 262 ----31666 1152 476
NM_001007098chr13879 818 378 2808 153 ----
NM_001007099chr15690 589 341 194 21 --2864 606 --
NM_001007100chr15690 589 341 194 21 --2864 606 --
NM_001007102chr671647 1440 1352 1329 1309 653 613 21369 38 31193 498 388 --
NM_001007156chr1541972 658 624 618 1333 11745 --
NM_001007189chr51158 150 ----
NM_001007214chr151742 1546 547 309 177 ------
NM_001007226chr1731091 521 298 ------
NM_001007227chr1731091 521 298 ------
NM_001007228chr1731091 521 298 ------
NM_001007229chr1731091 521 298 ------
NM_001007230chr1731091 521 298 ------
NM_001007237chr152389 2376 983 839 530 22365 2151 11860 --
NM_001007245chr75645 515 430 39 25 ------
NM_001007246chr2131437 667 362 ------
NM_001007257chr121123 998 11246 ----
NM_001007267chr24892 665 301 249 ------
NM_001007277chr113957 801 373 ------
NM_001007464chr61103 ------
NM_001007466chr6135160 5122 5041 4965 4731 4497 3966 3935 3261 1924 1893 1735 1070 --44556 3273 1946 1222 13321
NM_001007468chr22--1247 ----
NM_001007559chr1862043 2007 1791 1371 773 521 --2416 355 --
NM_001007565chr3--170 ----
NM_001007792chr11197 ------
NM_001007794chr12733 651 ------
NM_001008222chrX11311 ------
NM_001008226chr1551819 1745 1227 1204 620 31755 1673 249 1112 21729 181
NM_001008239chr1883356 3177 3132 3082 3018 2723 1002 364 43840 3336 550 263 33775 3455 539 1317
NM_001008388chr42353 102 --2811 300 --
NM_001008392chr373293 3228 3150 2749 2636 452 231 52401 2383 749 419 175 12454 --
NM_001008401chr1921509 1436 ------
NM_001008405chr731859 702 460 1496 2389 345 --
NM_001008407chr721820 1405 ------
NM_001008408chr7136040 5948 5514 5276 5081 4812 4442 4415 2479 1454 1197 1066 394 44955 4887 4791 1966 24871 4713 14373
NM_001008491chr272008 1845 1503 638 510 303 184 12024 11949 --
NM_001008492chr272008 1845 1503 638 510 303 184 12024 11949 --
NM_001008495chr872039 1930 1909 1813 654 556 426 --11601 --
NM_001008539chr8135396 5155 5140 4620 3893 3873 3863 2038 1350 926 821 277 131 25360 1787 35379 3489 1301 11565
NM_001008541chr1051763 1639 545 169 129 11589 --11479
NM_001008541chr1051763 1639 545 169 129 11589 --11479
NM_001008564chr13102280 2115 2109 1960 1951 1715 1513 817 504 60 --1117 11408
NM_001008660chr1131470 1293 1170 ------
NM_001008707chr1441773 1472 626 388 11847 ----
NM_001008708chr23438 140 77 1113 ----
NM_001008723chr102538 336 1384 ----
NM_001008738chr5102944 2836 2661 2105 1974 1070 974 935 821 582 32462 774 497 1646 --
NM_001008777chr173606 496 63 --1515 --
NM_001008779chr2--2277 242 ----
NM_001008783chr64696 649 602 275 3688 663 43 1898 --
NM_001008860chr152756 149 1240 1769 1306
NM_001008892chr152756 149 1240 1769 1306
NM_001008894chr152756 149 1240 1769 1306
NM_001008895chr1331434 1369 932 11080 21165 1055 11087
NM_001008925chr493281 3246 2986 2891 2872 2332 2313 1142 1077 23333 498 32727 1228 481 1633
NM_001009185chr51581 --1156 1181
NM_001009552chr82554 544 1423 ----
NM_001009554chr4144741 4530 4449 4157 4089 3608 3349 3208 3185 1440 1408 644 450 364 13575 44259 4099 3970 3138 14754
NM_001009554chr4144741 4530 4449 4157 4089 3608 3349 3208 3185 1440 1408 644 450 364 13575 44259 4099 3970 3138 14754
NM_001009555chr451461 1409 1095 351 83 1369 ----
NM_001009567chr103692 653 26 --1177 1225
NM_001009571chr791687 1594 1194 1184 546 492 373 113 56 --11125 --
NM_001009814chr132240 92 ------
NM_001009894chr1241702 1396 343 57 --31593 1375 588 --
NM_001009899chr3186381 6206 6190 5572 4947 4675 4133 3996 2501 1760 1502 1119 1067 1022 990 255 223 214 36523 4237 981 36063 2462 2149 21218 1048
NM_001009909chr11133955 3701 3669 2807 1552 1422 1404 1336 739 624 534 514 314 23632 3262 63192 2554 1530 893 662 217 12992
NM_001009923chr203855 575 193 ------
NM_001009958chr7--1247 ----
NM_001009959chr272294 2052 1841 1003 443 316 72 12027 2977 664 --
NM_001009960chr782834 2827 2379 860 812 806 285 25 32238 997 964 11025 12577
NM_001009993chr294334 3672 2823 1794 1779 1088 920 880 703 54469 3444 1825 945 391 --13821
NM_001009994chr6----1122 --
NM_001010000chr1893397 3183 2641 2331 989 868 520 480 398 1924 32947 741 670 --
NM_001010844chr65251 196 178 45 26 --153 --
NM_001010853chr6183176 3126 3115 2839 2829 2600 2523 2342 1091 1042 1034 892 842 682 492 370 192 77 --13199 --
NM_001010854chr142703 575 --1256 1583
NM_001010861chr1112791 2661 2401 1077 1011 637 586 471 430 391 377 41026 992 969 527 ----
NM_001010862chrX93299 2990 2855 2708 2400 2108 1097 586 69 12249 1257 --
NM_001010867chr166709 5323 4883 2451 2154 1933 36006 2465 1551 --16744
NM_001010888chrX144531 4302 4011 3820 3794 3399 3385 3318 1175 1163 990 838 586 417 14345 --2945 868
NM_001010891chr5136931 5255 4627 4332 4315 4193 2328 2284 1007 924 545 515 141 65796 5066 5041 2457 1153 470 65916 4840 4325 4277 1430 1077 16825
NM_001010895chr971920 1759 1593 727 685 579 135 1447 --2512 32
NM_001010922chr1144223 3609 3573 3476 3170 3103 2967 1538 1400 1271 659 363 245 140 32706 864 796 13731 12978
NM_001010923chr641617 1564 1502 1367 21230 1104 21530 380 --
NM_001010927chr64559 448 405 43 3416 391 160 ----
NM_001010932chr72333 276 1384 ----
NM_001010942chr1241163 1071 903 455 1386 1339 1323
NM_001010984chr192585 2294 995 581 538 485 475 264 203 11893 42405 2073 2014 197 12304
NM_001010986chrX82449 930 627 598 446 349 210 51 1873 11647 11997
NM_001011513chr4154052 3299 3230 3061 3026 2951 2881 2764 1307 1022 832 442 205 161 84 1218 13047 --
NM_001011515chr451056 785 419 303 51 --4946 725 386 123 1852
NM_001011516chr451056 785 419 303 51 --4946 725 386 123 1852
NM_001011537chr372304 1562 1502 879 308 128 122 22294 1803 42118 1692 1603 925 --
NM_001011553chr73966 195 137 1880 1684 --
NM_001011663chr104844 686 408 123 11104 1953 1970
NM_001011666chr7276401 5488 5430 5031 4827 4669 4652 4502 4280 4172 4084 4066 2551 2431 2112 2081 2067 1988 1837 1652 1505 1499 1139 811 674 229 162 32283 1908 1512 15465 45754 5394 4818 2255
NM_001011668chr851158 1022 1008 73 48 ------
NM_001011671chr851158 1022 1008 73 48 ------
NM_001011708chr262732 956 946 279 211 130 32932 2903 2856 12072 12052
NM_001011713chr14111648 1547 1486 1302 1157 1046 1029 596 455 147 78 11111 11464 11622
NM_001011720chr851019 488 409 380 91 1148 235 25 11062
NM_001011724chr13--1204 ----
NM_001011725chr13--1204 ----
NM_001011885chr1581648 1455 1253 704 607 568 350 301 ----1196
NM_001012267chr9181 ------
NM_001012393chr1185040 5028 4460 4080 2030 1345 458 156 23377 738 --14960
NM_001012398chr162891 265 --1849 1781
NM_001012418chr6104226 4201 4068 3940 3909 3658 3286 3255 3205 285 ----14184
NM_001012420chr1542241 2230 2161 2039 --2503 211 1904
NM_001012421chr95900 892 856 587 311 2706 685 ----
NM_001012423chr1542241 2230 2161 2039 --2503 211 1904
NM_001012425chr11135 ------
NM_001012478chr192602 406 1643 ----
NM_001012614chr41494 1768 1721 --
NM_001012751chr1091582 774 541 522 504 487 294 231 223 1727 1104 --
NM_001012754chr1382042 1991 1354 1318 810 621 91 22 21947 1850 1154 1204
NM_001012755chrX135088 4907 4651 4443 4184 3863 3622 3564 1876 1794 1356 522 412 --44972 4728 4070 826 13583
NM_001012756chr1952643 2509 763 647 217 13008 33030 1294 597 --
NM_001012761chr5122576 2356 2313 2258 2194 2037 663 603 550 293 276 30 ----12697
NM_001012968chrX132414 2094 1813 1778 1710 833 712 673 606 394 185 176 52 12786 52775 1880 1731 1098 457 --
NM_001012984chr16----1144 --
NM_001012985chr1--1197 ----
NM_001013031chr10113545 3336 3293 3280 3230 3144 3026 2988 1174 534 322 32657 360 212 ----
NM_001013398chr741437 1409 102 45 21576 1552 11073 --
NM_001013399chr62282 134 ------
NM_001013406chr7101656 1511 1412 1345 1182 1140 590 449 385 83 ------
NM_001013415chr441583 1439 1028 306 ----11162
NM_001013439chr32573 270 --1173 --
NM_001013442chr41360 --1128 --
NM_001013620chr12378479 8425 8300 8265 8198 7925 7757 7572 7193 7186 6650 6533 6264 5827 5791 5703 5636 5629 5487 5311 5123 3319 3287 3243 2999 2707 2334 2189 2178 2155 2145 1757 1381 1297 465 429 323 27140 3305 78333 5597 5432 3330 2579 1391 1187 48513 8258 7052 145
NM_001013659chr19105408 5235 4558 4230 3928 1974 944 580 423 216 22060 407 41840 1816 1379 793 --
NM_001013690chr1251923 1613 782 418 173 12515 1148 1769
NM_001013699chr122226 104 1527 149 --
NM_001013717chr561410 1347 930 523 462 432 11443 ----
NM_001013838chr16--133 ----
NM_001014286chr132296 72 1100 ----
NM_001014434chr13818 710 115 172 2764 205 --
NM_001014443chr1183 ------
NM_001014797chr10188231 7374 7308 6226 5901 5600 5265 3182 3044 1575 994 980 827 732 685 385 308 154 46768 5009 1114 616 3802 753 411 13067
NM_001014812chr153411 382 168 --1349 --
NM_001014839chr11723 ------
NM_001014841chr11723 ------
NM_001014972chr22245 61 ------
NM_001015048chr14113202 3063 3019 2896 2876 2769 2618 1989 723 146 95 12745 11274 --
NM_001015049chr14113202 3063 3019 2896 2876 2769 2618 1989 723 146 95 12745 11274 --
NM_001015053chr1741569 1535 1304 51 --11260 --
NM_001015877chrX133046 2892 2826 2746 2666 2277 2218 1019 984 927 921 627 298 1943 33021 2613 1134 22423 964
NM_001015880chr1051704 1668 1571 260 55 21716 1303 31617 348 71 1505
NM_001015882chr93408 391 48 166 ----
NM_001015885chr201333 ------
NM_001015887chr381725 1699 1349 1324 1253 726 604 282 21685 385 31758 1506 744 --
NM_001017368chr1752805 2444 2180 1826 376 22824 460 11833 --
NM_001017369chr43424 407 210 2943 168 ----
NM_001017371chr261399 1163 1152 209 151 35 1526 21183 1010 1553
NM_001017395chr3123172 3057 2949 2657 1308 1068 945 893 777 684 663 171 12220 ----
NM_001017396chr251694 1511 1425 852 359 11828 11821 --
NM_001017415chr12770 306 --1792 --
NM_001017416chr12770 306 --1792 --
NM_001017420chr811362 11460 11429 21389 1125
NM_001017424chr161780 1722 1610 1516 1509 191 --11225 --
NM_001017425chr161780 1722 1610 1516 1509 191 --11225 --
NM_001017434chr18775 620 585 288 277 213 197 125 1753 3533 516 220 --
NM_001017440chr7168172 7824 7269 7068 6991 6615 6270 5175 2780 2312 1512 1456 1433 1154 1081 819 1217 37555 2144 1275 --
NM_001017923chr1481192 610 264 210 197 126 78 68 21370 386 21108 323 1227
NM_001017926chr851791 1355 1332 1236 708 ------
NM_001017928chr3--1210 ----
NM_001017962chr104623 609 268 160 ------
NM_001017969chr92449 414 1592 ----
NM_001017977chr11371 --2258 62 --
NM_001017992chr591556 1530 1365 1280 1249 1225 1067 359 65 21517 1042 11422 21145 622
NM_001017995chr534557 898 235 13171 21729 919 14798
NM_001017999chr131767 865 297 22347 1625 12050 --
NM_001017999chr131767 865 297 22347 1625 12050 --
NM_001018000chr131767 865 297 22347 1625 12050 --
NM_001018000chr131767 865 297 22347 1625 12050 --
NM_001018001chr131767 865 297 22347 1625 12050 --
NM_001018009chr351193 1187 1026 1011 981 --1480 11112
NM_001018037chr95570 534 408 397 268 --21459 523 1203
NM_001018053chr1101998 1968 1589 1431 1246 1215 695 452 384 152 --11852 --
NM_001018054chr151447 1416 1371 563 349 --1428 1512
NM_001018064chr951968 1898 1773 475 163 ------
NM_001018065chr9155585 4742 4638 4602 4569 4214 2000 1456 1383 1184 1171 947 860 715 415 44696 1560 1365 1032 34057 1419 1140 11774
NM_001018066chr9155585 4742 4638 4602 4569 4214 2000 1456 1383 1184 1171 947 860 715 415 44696 1560 1365 1032 34057 1419 1140 11774
NM_001018067chr1175392 5167 4780 4387 3366 3323 2146 1728 1571 1537 1119 917 745 730 635 443 64 35056 1084 530 34421 548 274 14323
NM_001018068chr1175392 5167 4780 4387 3366 3323 2146 1728 1571 1537 1119 917 745 730 635 443 64 35056 1084 530 34421 548 274 14323
NM_001018069chr1175392 5167 4780 4387 3366 3323 2146 1728 1571 1537 1119 917 745 730 635 443 64 35056 1084 530 34421 548 274 14323
NM_001018074chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_001018075chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_001018076chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_001018077chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_001018080chr1131214 1090 964 21296 1060 ----
NM_001018090chr15102630 2565 2456 2236 2223 2190 527 372 315 188 22805 941 22006 275 1254
NM_001018091chr15102740 2675 2566 2346 2333 2300 637 482 425 298 22915 1051 22116 385 1364
NM_001018100chr151809 1304 2856 637 --
NM_001018102chr15102630 2565 2456 2236 2223 2190 527 372 315 188 22805 941 22006 275 1254
NM_001018111chr7--13010 34000 3024 2960 --
NM_001020658chr181680 1631 1612 1546 1439 317 255 207 --1295 --
NM_001020658chr181680 1631 1612 1546 1439 317 255 207 --1295 --
NM_001020825chr571426 1304 1123 1044 961 872 343 ------
NM_001023567chr1572439 2379 2063 1620 1545 506 355 --11534 --
NM_001024094chr5123951 3829 3648 3569 3486 3397 2868 1530 1419 951 540 99 11343 31523 780 353 --
NM_001024380chr851615 577 546 369 105 ----11549
NM_001024381chr851615 577 546 369 105 ----11549
NM_001024647chr12187496 7408 7207 6812 6535 6170 5936 5635 3071 3060 1934 1259 1148 1029 576 503 451 77 2911 536 61824 1055 998 977 945 59 16733
NM_001024649chr582944 2916 2784 2687 2667 2287 2044 176 12658 22130 1099 12677
NM_001024666chrX1598 ------
NM_001024807chr191234 ------
NM_001024809chr17--1523 ----
NM_001024855chr32546 160 --21919 1894 --
NM_001024916chr9163 185 --1108
NM_001024947chr521104 1048 --1721 --
NM_001024948chr163501 3351 3092 2588 2442 1347 43099 2841 2260 231 32500 728 668 12821
NM_001024956chr11155840 5744 5019 4777 4765 4755 3847 3549 2307 2281 1549 1451 1285 787 209 14783 44985 4403 4315 3677 14941
NM_001025068chr381691 1261 1132 652 631 540 471 382 31805 667 546 2370 265 --
NM_001025069chr381691 1261 1132 652 631 540 471 382 31805 667 546 2370 265 --
NM_001025072chr352845 2192 2082 2060 883 1111 ----
NM_001025073chr352845 2192 2082 2060 883 1111 ----
NM_001025076chr10246166 6138 5934 5904 5470 5373 5206 5065 4929 3950 3879 3794 2469 2463 1919 1657 1648 1568 1385 1193 1104 635 339 159 11163 36201 1831 1790 1735
NM_001025077chr10307524 7496 7292 7262 6828 6731 6564 6423 6287 5308 5237 5152 4950 4798 3015 3006 2926 2743 2551 2462 1993 1697 1517 1078 863 752 645 306 200 129 32521 662 589 17559 22093 1045
NM_001025079chr3154067 3993 3970 3912 3260 3004 2916 1620 1538 1424 1411 1362 1225 676 251 23273 2610 --13322
NM_001025108chr262895 1586 1395 580 526 495 --13912 --
NM_001025233chr1272753 2461 2255 1902 772 407 55 --21985 700 --
NM_001025248chr1561255 928 814 369 258 142 2384 375 1402 --
NM_001025249chr1561255 928 814 369 258 142 2384 375 1402 --
NM_001025252chr8153200 3008 2702 2566 2431 2319 2214 2062 1156 1108 732 467 400 366 102 1312 2546 510 --
NM_001025253chr8153200 3008 2702 2566 2431 2319 2214 2062 1156 1108 732 467 400 366 102 1312 2546 510 --
NM_001025266chr3164794 4209 4062 3888 3705 3653 3434 3399 3290 3252 3079 1953 1755 1483 908 221 14808 33666 3192 91 14368
NM_001025356chr127734 655 523 512 373 333 138 12676 12887 --
NM_001025366chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025366chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025367chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025367chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025368chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025368chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025369chr671856 1741 1578 1473 1334 1248 288 1422 ----
NM_001025369chr671856 1741 1578 1473 1334 1248 288 1422 ----
NM_001025370chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025370chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_001025579chr1731172 1051 285 ------
NM_001025580chrX143943 3890 3880 3857 3783 3638 3528 3046 3022 2926 1180 1028 1004 284 33914 1064 207 11273 --
NM_001025595chr451568 1405 1046 466 42 21590 1546 11355 2399 152
NM_001025596chr113328 184 134 ------
NM_001025603chr131446 1311 1295 ------
NM_001025616chr4111555 1549 1526 1498 1479 1440 645 609 372 336 265 2401 279 2505 415 --
NM_001025780chr931218 1087 1057 1527 51588 393 341 310 218 11488
NM_001029839chr341291 613 585 515 1381 1487 1113
NM_001029840chr341291 613 585 515 1381 1487 1113
NM_001029851chr53227 208 125 ------
NM_001029852chr53227 208 125 ------
NM_001029853chr53227 208 125 ------
NM_001029854chr53227 208 125 ------
NM_001029858chr683338 2207 2055 1143 875 666 616 574 22460 2271 12163 33411 2472 442
NM_001029860chr81119 1261 166 --
NM_001029863chr673114 2783 2777 2578 1984 482 82 42765 2366 970 191 1786 --
NM_001029875chr592350 2042 1017 998 906 524 344 125 113 --11082 11059
NM_001029882chr11575 --1239 --
NM_001029882chr11575 --1239 --
NM_001029884chr662646 2511 2486 463 439 39 12580 2212 129 --
NM_001029955chr453457 2886 1232 651 498 ------
NM_001029999chr183203 69 28 1137 1151 --
NM_001030002chr171380 ------
NM_001030006chr1762614 1843 908 637 586 320 --1416 --
NM_001030007chr16103216 3172 3132 3084 2846 2703 2678 2521 1380 222 33556 3236 1198 13879 --
NM_001030055chr14184766 4668 4487 4473 3673 3550 3213 3067 1855 1507 1218 997 871 651 549 506 384 81 34746 4692 479 54658 3501 1320 1057 372 34445 823 814
NM_001030272chr111383 --1483 --
NM_001030273chr111383 --1483 --
NM_001031623chr671625 1347 1124 381 277 162 127 1587 11739 11180
NM_001031679chr1263448 3053 2976 2943 169 33 23390 644 2125 85 --
NM_001031684chr251172 1046 963 286 36 --11073 --
NM_001031689chr9----126 --
NM_001031695chr22155333 5050 4840 4630 4392 3941 3930 3793 2187 2181 1190 1047 696 185 66 24577 3947 23873 150 23336 2110
NM_001031700chr4162486 2256 2207 2159 1964 1895 1648 920 914 840 791 717 650 211 173 36 12193 4625 576 369 222 1874
NM_001031709chr104264 82 70 44 ------
NM_001031710chr74975 908 352 56 --21112 1034 1183
NM_001031715chr15--1180 ----
NM_001031716chr23713 344 222 1797 ----
NM_001031722chr61170 ------
NM_001031723chr43370 331 42 ----1193
NM_001031725chr1----2106 24 --
NM_001031732chr483162 2887 1316 885 539 312 87 51 32355 1158 1112 42320 1104 852 365 --
NM_001031748chr122411 250 ----1441
NM_001031804chr16194300 3635 3472 3402 3197 3084 2964 2921 2853 2755 1410 1394 1366 1180 1015 906 898 527 498 11417 43715 1423 1082 432 --
NM_001031812chr5142255 2128 1921 1828 1576 1563 1472 1463 768 747 729 457 231 135 11701 52141 1818 490 128 91 22075 811
NM_001032280chr671545 1437 1419 1361 1249 487 464 21730 1096 ----
NM_001032281chr2284 31 ------
NM_001032282chr841299 338 311 70 31315 947 320 1251 --
NM_001032283chr125948 763 371 258 40 ----1685
NM_001032284chr125948 763 371 258 40 ----1685
NM_001032288chr2051642 1092 1086 1072 1036 ------
NM_001032293chr172475 442 1150 ----
NM_001032296chr1372842 2294 1018 987 622 324 245 2375 233 ----
NM_001032363chr121855 175 11987 --2845 119
NM_001032363chr121855 175 11987 --2845 119
NM_001032380chr1061704 1474 1468 621 369 282 1399 2349 243 --
NM_001032393chrX1228 1257 --1660
NM_001032394chr6122857 2600 2203 2152 1972 1066 935 734 596 563 303 255 1703 32717 2704 2193 1796
NM_001032395chr6122724 2467 2070 2019 1839 933 802 601 463 430 170 122 1570 32584 2571 2060 1663
NM_001032730chr13703 265 133 1689 1272 --
NM_001032999chr2045245 4943 3506 1536 1688 --14207
NM_001033002chr17196 ------
NM_001033045chr283815 3377 2936 1534 1386 966 728 381 44402 3871 2920 1781 24231 1087 23403 2952
NM_001033047chr452517 1646 694 571 158 --12318 12012
NM_001033049chr2142142 859 352 276 1451 12166 --
NM_001033057chr342106 1649 588 210 --1224 11688
NM_001033059chr661767 1492 1431 599 333 89 1608 31738 1511 60 --
NM_001033081chr141839 1748 1233 50 ------
NM_001033082chr141839 1748 1233 50 ------
NM_001033087chr2043274 2921 2296 341 --32961 2306 547 12341
NM_001033112chr55893 805 730 720 139 --1880 --
NM_001033506chr111335 --170 --
NM_001033518chr742524 1100 1012 552 ------
NM_001033519chr742524 1100 1012 552 ------
NM_001033520chr742524 1100 1012 552 ------
NM_001033557chr281290 1255 336 314 299 279 123 28 21091 51 --11235
NM_001033561chr172929 208 1608 ----
NM_001033564chr64367 333 214 127 ------
NM_001033566chr173941 118 89 2143 109 2242 40 162
NM_001033568chr173941 118 89 2143 109 2242 40 162
NM_001033578chr892206 2144 1720 948 492 463 264 222 142 11871 12351 --
NM_001033602chr1362698 2217 993 829 516 361 11882 --1432
NM_001033677chr121414 ------
NM_001033723chr872793 2566 2536 1801 1731 856 449 21824 1020 22803 352 11122
NM_001033756chr681774 1659 1496 1391 1252 1166 732 206 1340 ----
NM_001033756chr681774 1659 1496 1391 1252 1166 732 206 1340 ----
NM_001033910chr14861 738 554 234 --1227 21717 379
NM_001033925chr1092062 1743 1459 1448 827 762 755 143 97 3694 347 103 2651 536 11952
NM_001034841chr16125532 5200 5021 3615 3600 2030 1947 1564 1390 795 755 569 45538 5257 3883 511 24560 3568 12015
NM_001034845chr471405 1215 1096 1083 892 554 548 ------
NM_001034850chr581682 1470 1383 1327 568 200 186 129 1114 11051 --
NM_001034954chr1063189 2989 2733 2624 2533 28 ------
NM_001034955chr1063189 2989 2733 2624 2533 28 ------
NM_001034956chr1063189 2989 2733 2624 2533 28 ------
NM_001034957chr1063189 2989 2733 2624 2533 28 ------
NM_001035chr12525 182 ------
NM_001035260chr1041264 424 344 289 21341 240 41559 1299 587 510 --
NM_001037131chr231108 995 941 ------
NM_001037132chr741573 680 593 553 11987 62003 1879 1530 371 199 104 --
NM_001037133chr741573 680 593 553 11987 62003 1879 1530 371 199 104 --
NM_001037164chr762022 1906 1351 691 625 507 ----11334
NM_001037165chr7148852 8742 8476 8443 7788 6821 6671 6531 5848 3332 3217 974 648 240 38871 8505 8094 18763 --
NM_001037172chr34960 902 472 102 1231 1981 --
NM_001037174chr2112266 2185 2177 1775 1711 1675 1481 444 351 181 89 --1599 1414
NM_001037317chr1112791 2661 2401 1077 1011 637 586 471 430 391 377 41026 992 969 527 ----
NM_001037332chr562525 2488 2444 2382 2285 247 --32513 1902 730 --
NM_001037333chr562525 2488 2444 2382 2285 247 --32513 1902 730 --
NM_001037334chr1882453 1856 1845 1778 1656 888 718 23 32186 916 260 11771 --
NM_001037494chr122222 209 ------
NM_001037495chr122222 209 ------
NM_001037535chrX71226 1181 1025 974 517 274 249 21388 455 --11561
NM_001037536chrX71226 1181 1025 974 517 274 249 21388 455 --11561
NM_001037540chrX71226 1181 1025 974 517 274 249 21388 455 --11561
NM_001037553chr2174937 4514 1261 991 898 306 99 --13287 --
NM_001037631chr24854 400 119 68 123 21154 1122 --
NM_001037637chr52271 71 156 1122 --
NM_001037872chr2--1194 3715 554 297 --
NM_001037954chr1163369 3228 2550 996 963 180 1383 13336 13034
NM_001038603chr52262 25 134 ----
NM_001038640chr152650 293 ------
NM_001038702chr552521 2404 1799 860 704 3983 600 263 32665 2646 362 1449
NM_001039029chr1222024 1984 ------
NM_001039199chr2084968 4939 4783 3403 3319 842 280 270 1175 13957 --
NM_001039348chr22918 420 21055 70 11074 11023
NM_001039349chr22918 420 21055 70 11074 11023
NM_001039350chr721218 608 11802 ----
NM_001039366chr22162 ----1483
NM_001039372chr74679 634 628 579 ------
NM_001039395chr992460 2400 2332 2326 2287 1853 1788 804 706 ------
NM_001039479chr1442259 2219 2127 436 --32434 805 594 --
NM_001039523chr24348 339 331 119 ------
NM_001039538chr2153428 3221 2467 2278 1229 1068 1058 979 839 826 814 791 491 241 34 23157 278 11402 --
NM_001039547chr3217923 7161 6681 6154 5026 4924 3200 3100 2998 2954 2787 2555 2477 2433 1566 1122 852 738 230 174 139 57915 3221 1592 1351 959 87119 6812 6023 3024 2515 2357 2051 585 22465 497
NM_001039569chr2113043 2752 2672 2538 2093 826 721 567 274 223 158 12171 1407 --
NM_001039570chr2244672 4666 4640 407 14550 14599 --
NM_001039571chr2244672 4666 4640 407 14550 14599 --
NM_001039577chr154498 3463 1754 1590 185 --33673 3476 450 11050
NM_001039580chr4174721 4676 4444 4410 4065 3923 3813 3359 3150 2043 2033 1976 1924 975 795 737 323 54798 4129 3930 639 602 54638 4620 4082 3201 143 33301 1768 100
NM_001039585chr1174243 3338 3266 3236 3184 2943 2879 2728 1686 1576 960 863 708 691 627 319 174 21536 1143 33224 2824 536 --
NM_001039590chrX143435 3280 2906 2730 2722 2703 2591 2496 2462 1513 1433 1077 810 82 33466 2915 1420 11406 13027
NM_001039591chrX143435 3280 2906 2730 2722 2703 2591 2496 2462 1513 1433 1077 810 82 33466 2915 1420 11406 13027
NM_001039614chr15180 ------
NM_001039618chr11175983 5714 5671 5648 4792 4456 3911 2220 1985 1966 1557 1508 1480 1195 997 752 331 31413 1136 341 105836 5447 4907 4877 4683 4068 3933 2308 2240 1676 15782
NM_001039661chr1141127 1108 1072 1006 --1847 --
NM_001039693chr243726 2618 1201 1092 14116 13739 --
NM_001039709chr2045245 4943 3506 1536 1688 --14207
NM_001039715chr12979 699 1958 ----
NM_001039716chr121043 763 11022 ----
NM_001039762chr1062362 1879 1554 1520 566 367 --21806 64 11710
NM_001039840chrX205577 5144 4969 4878 4680 4246 2430 2406 2358 2011 1982 1902 1786 1472 1282 1273 999 845 538 447 54453 2272 1631 1228 511 44662 3696 1450 462 23686 1919
NM_001039916chr1221004 987 ------
NM_001039917chr1221004 987 ------
NM_001039918chr1221004 987 ------
NM_001039919chr1221004 987 ------
NM_001039920chr1221004 987 ------
NM_001039937chr13143769 3686 3285 2886 1553 1333 970 610 481 470 436 371 301 183 33905 3555 525 22784 1598 1795
NM_001039938chr1351526 1377 1212 1206 1160 --11180 1159
NM_001040001chr692019 1952 1872 1785 1714 812 728 670 100 2409 175 11498 --
NM_001040020chr741605 1496 1480 973 21532 475 11431 3383 267 85
NM_001040031chr192237 74 ------
NM_001040033chr1--1696 ----
NM_001040057chr771040 934 579 406 264 196 80 21481 439 2461 284 11267
NM_001040092chr82387 165 1105 147 --
NM_001040100chr361118 1051 795 488 346 36 1201 1909 --
NM_001040101chr421339 139 ----190
NM_001040110chr731704 1689 280 ------
NM_001040135chr72816 780 ----1631
NM_001040142chr271802 1727 754 673 464 218 125 22403 1573 22065 389 1550
NM_001040143chr271802 1727 754 673 464 218 125 22403 1573 22065 389 1550
NM_001040152chr795091 4998 4739 4581 3817 3385 3352 1436 215 ------
NM_001040153chr135952 848 731 177 119 1386 3928 306 274 1808
NM_001040157chr462267 1825 1114 858 507 244 32479 2008 193 22054 170 22923 58
NM_001040159chr43935 184 43 11210 1116 1434
NM_001040167chr72792 348 1888 ----
NM_001040181chr32765 39 2190 128 161 --
NM_001040182chr32765 39 2190 128 161 --
NM_001040183chr32765 39 2190 128 161 --
NM_001040199chr32765 39 2190 128 161 --
NM_001040200chr32765 39 2190 128 161 --
NM_001040202chr492277 2267 2078 1893 1665 1575 433 375 149 21794 175 11722 32227 579 124
NM_001040214chr672409 2344 2244 1865 1735 956 556 32047 1579 753 ----
NM_001040272chr932371 1918 1773 --11909 --
NM_001040280chr63663 646 491 ------
NM_001040284chr16225726 5208 5053 4758 4297 4044 4034 3861 3803 2090 1982 1862 1467 1286 1259 1185 1170 1122 819 533 483 301 44413 4338 3744 786 55132 1506 1207 561 472 24544 1777
NM_001040402chr4103077 3008 2824 2794 2395 1220 1182 653 546 193 22095 1235 1831 1389
NM_001040409chr25911 878 817 738 279 --179 1758
NM_001040429chr1352441 2219 1127 537 236 32609 1092 114 33584 2390 2274 22191 1022
NM_001040432chr33407 117 52 --1142 --
NM_001040440chr52550 447 1556 2530 508 --
NM_001040441chr164894 4326 3529 1158 592 255 45429 4844 2118 276 64201 3346 1579 814 683 140 1347
NM_001040446chr5112717 2690 2683 2676 2506 2473 2376 2160 2133 584 159 --22297 343 12221
NM_001040450chr15102680 2556 2519 2482 2425 2238 2158 1959 940 677 --12221 --
NM_001040453chr15102680 2556 2519 2482 2425 2238 2158 1959 940 677 --12221 --
NM_001040633chr73833 680 278 ------
NM_001040653chr341984 862 493 324 1697 31778 312 228 22082 528
NM_001040665chr7194593 3755 3653 3596 3367 3268 3240 3217 3147 3115 3076 1194 1050 975 622 611 507 293 53 43619 1510 951 267 34828 4208 3409 13481
NM_001040708chr84429 362 301 157 --2937 461 --
NM_001040712chr9113518 3511 3215 3188 3168 2793 2708 2345 1224 835 414 23201 2921 --1913
NM_001040876chr4101861 1775 1688 1628 1524 747 603 573 370 125 1417 11437 --
NM_001041chr31134 --1356 --
NM_001042355chr16125260 5230 4962 4881 4040 3899 1366 1315 1267 895 581 158 24181 912 44063 1448 1417 291 1769
NM_001042357chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042358chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042360chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042361chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042363chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042364chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042365chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042383chr363323 3137 1171 905 274 254 12839 1152 --
NM_001042387chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042389chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042390chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042392chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042393chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042395chr10101573 1489 1470 1379 1318 1292 961 480 131 110 --11131 --
NM_001042396chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042397chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_001042403chr126852 631 385 344 191 181 --2246 46 --
NM_001042404chr191972 1945 1914 1908 1769 1547 1408 1384 144 --11675 --
NM_001042406chr64948 936 918 337 1963 --11099
NM_001042412chr16125260 5230 4962 4881 4040 3899 1366 1315 1267 895 581 158 24181 912 44063 1448 1417 291 1769
NM_001042413chr9123990 3711 3420 3340 2957 2642 2602 2554 1439 1429 1026 682 23252 650 ----
NM_001042422chr17--168 ----
NM_001042423chr17--168 ----
NM_001042424chr463260 2850 2232 2180 2119 300 --2864 812 --
NM_001042425chr671545 1437 1419 1361 1249 487 464 21730 1096 ----
NM_001042440chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042441chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042442chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042443chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042444chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042445chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042446chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001042453chrX101771 1481 1465 1394 1212 1099 257 188 147 75 --21604 174 --
NM_001042459chr33344 222 102 --136 1312
NM_001042473chr10122149 2106 1860 1763 1682 1658 1388 821 392 343 204 108 12028 1157 --
NM_001042481chr14102686 2653 2630 2313 2175 2139 2109 2009 1854 128 12165 1316 21868 820
NM_001042486chr2011192 --11037 --
NM_001042492chr17123472 3128 3087 2475 2191 2132 1405 1102 1038 760 582 212 --21032 877 1613
NM_001042493chr651598 1520 1353 572 550 2735 592 31911 432 215 21370 333
NM_001042510chr881872 1804 1651 1505 1368 609 304 79 21515 1487 11390 --
NM_001042511chr881872 1804 1651 1505 1368 609 304 79 21515 1487 11390 --
NM_001042517chr134746 677 371 80 3819 364 282 1158 --
NM_001042533chr393289 3124 1322 1258 1213 1042 832 754 494 32850 665 32 2695 226 --
NM_001042537chrX62470 2336 2316 2232 1872 234 22436 910 --11973
NM_001042543chr471522 1350 1338 431 340 207 149 11399 11387 --
NM_001042548chr21190 2775 700 ----
NM_001042552chr151010 953 545 204 137 --21018 375 --
NM_001042555chr12134481 4389 4365 3967 3736 3339 3187 1563 1157 1067 880 600 125 24730 1809 13148 23466 1556
NM_001042573chr1722050 332 ----12014
NM_001042599chr2267768 7485 7271 7215 7029 6620 6577 6473 6324 6302 6212 6141 5891 5714 5361 5301 5137 4991 2997 2973 2574 1787 1338 697 684 437 47665 5918 1539 794 67854 7570 7559 5952 991 835 32888 1570 769
NM_001042601chr383218 2696 2064 1172 1039 868 601 468 11259 12880 21285 304
NM_001042603chr12165398 5369 4202 4006 3872 3665 1970 1691 1404 1301 1240 1196 1149 479 271 226 23627 1316 35189 4766 880 --
NM_001042604chr3164747 4449 3998 3819 3404 3153 3040 1938 1927 1523 1513 1426 1207 1182 844 649 64623 4576 1727 1129 604 96 54413 1240 1214 1033 533 --
NM_001042618chr14------183
NM_001042635chr14146 --127 --
NM_001042646chr321907 757 21772 1365 11615 --
NM_001042669chr4111555 1549 1526 1498 1479 1440 645 609 372 336 265 2401 279 2505 415 --
NM_001042681chr152651 2631 2244 594 124 1473 ----
NM_001042682chr152651 2631 2244 594 124 1473 ----
NM_001042682chr152651 2631 2244 594 124 1473 ----
NM_001042683chr681767 1671 1426 715 626 298 237 157 --11353 21871 457
NM_001042749chrX71736 1418 777 689 496 127 121 31546 1394 597 42031 633 606 281 1236
NM_001042750chrX71736 1418 777 689 496 127 121 31546 1394 597 42031 633 606 281 1236
NM_001042751chrX71736 1418 777 689 496 127 121 31546 1394 597 42031 633 606 281 1236
NM_001042762chr75816 176 114 87 50 ------
NM_001043318chr14114125 4050 4039 3890 3735 3505 3162 2781 2581 1620 701 13032 13690 13857
NM_001043351chr182067 1990 1406 906 774 642 635 116 ----11570
NM_001044385chr233579 262 66 43690 3161 2999 1511 12513 --
NM_001044387chr1933410 2543 1446 --12797 --
NM_001044388chr1933410 2543 1446 --12797 --
NM_001044722chr5142255 2128 1921 1828 1576 1563 1472 1463 768 747 729 457 231 135 11701 52141 1818 490 128 91 22075 811
NM_001044723chr5142255 2128 1921 1828 1576 1563 1472 1463 768 747 729 457 231 135 11701 52141 1818 490 128 91 22075 811
NM_001046chr5133002 2771 2535 2487 2004 1842 1178 933 813 764 749 699 38 12800 32964 2928 2848 11142
NM_001048183chr183704 3544 2763 2597 1103 236 209 37 1652 23408 1031 13798
NM_001049chr1462224 2203 2017 1683 1654 306 12031 12293 --
NM_001071775chr1381876 1865 1705 1461 704 592 256 119 --21853 235 --
NM_001076chr41143 1166 ----
NM_001076chr41143 1166 ----
NM_001078chr11705 --1512 --
NM_001079874chr132133 759 664 31850 1653 372 22066 1987 --
NM_001083620chr4102562 2439 2411 1947 1686 1674 1624 1616 822 568 --42550 2104 684 558 --
NM_001089591chr1152 ------
NM_001096chr173791 332 233 191 1196 --
NM_001099678chr3136385 6251 6117 5833 5603 5586 5442 5055 4586 2055 1070 887 29 41588 1321 1179 196 56231 5536 5482 1985 1580 --
NM_001100108chr1178317 7613 7437 7255 6938 6437 5988 5746 3067 2660 2423 2325 1559 1288 983 601 102 33054 1607 1308 58212 5076 3106 1600 1200 18380
NM_001101662chr1--141 ----
NM_001105518chr13879 855 287 --1801 --
NM_001106chr3178526 8484 7084 7033 6804 6739 6004 5939 3146 3092 2546 2482 2443 2390 1374 528 179 58145 7837 7346 5910 120 48654 7855 1498 1005 11532
NM_001109977chr43843 768 117 2679 98 1263 --
NM_001113490chrX103423 3127 2965 2438 2232 1023 725 630 188 179 13683 21003 42 --
NM_001116chr1692596 2577 2547 2021 437 399 372 75 55 --11958 --
NM_001117chr1872408 1749 827 639 632 424 394 --32320 197 141 --
NM_001121chr1021823 659 11941 31767 1710 413 1454
NM_001122631chr111478 ------
NM_001124chr111456 1570 1508 --
NM_001126chr141086 962 311 63 21048 1014 2753 407 --
NM_001128chr16103216 3172 3132 3084 2846 2703 2678 2521 1380 222 33556 3236 1198 13879 --
NM_001135chr151345 --1821 --
NM_001144chr1611127 11242 1178 --
NM_001146chr892367 2104 1988 1877 1834 893 818 574 305 21560 1520 21802 924 --
NM_001151chr41236 1193 ----
NM_001152chrX1202 ------
NM_001153chr25918 282 275 194 95 --2838 324 1183
NM_001159chr25709 601 586 182 133 ------
NM_001160chr1252679 1758 745 605 403 32037 484 342 ----
NM_001165chr111137 --1171 --
NM_001167chrX186746 6703 6636 6356 5778 5191 4528 2028 1757 1630 1483 1071 1054 911 883 838 550 536 42592 1847 1811 1264 21747 1573 26561 6436
NM_001172chr141152 ------
NM_001173chr14184766 4668 4487 4473 3673 3550 3213 3067 1855 1507 1218 997 871 651 549 506 384 81 34746 4692 479 54658 3501 1320 1057 372 34445 823 814
NM_001174chrX62162 2053 1884 1859 1543 635 22196 2128 31729 1670 1627 --
NM_001177chr1281761 1725 1645 959 323 227 132 72 32279 1550 588 ----
NM_001178chr111383 --1483 --
NM_001186chr2142952 2672 2069 952 52594 2413 2250 2095 2054 22466 500 33161 2970 419
NM_001197chr221113 ------
NM_001198chr6162347 2298 2187 1949 1814 1660 1595 1550 1509 457 344 283 275 260 236 23 11938 22143 727 12446
NM_001200chr2061078 894 304 169 157 105 ----2206 46
NM_001201chr4153897 3649 3379 3334 3244 1497 1374 1282 1195 858 670 653 308 49 27 13558 63788 3722 3278 3068 1304 876 23058 2520
NM_001202chr141243 1288 1229 --
NM_001204chr2247486 6884 6405 5948 5829 5821 5398 5308 4798 2611 2291 2164 2080 2021 1818 1632 1610 1569 1450 1336 678 238 174 33 55384 2567 902 135 87 107662 7344 7288 6976 5714 5419 1744 615 296 183 26766 2362
NM_001206chr9123126 3065 3036 2862 2652 2583 1161 802 775 760 463 315 22004 891 31049 838 269 --
NM_001207chr52271 71 156 1122 --
NM_001211chr154337 288 277 126 --1144 --
NM_001216chr91125 ------
NM_001219chr752227 465 269 261 41 ----11532
NM_001222chr1011994 ------
NM_001227chr1051333 1193 1185 1173 406 ------
NM_001233chr762286 2247 1685 915 682 43 1267 4931 625 414 170 --
NM_001241chr2122368 2358 2210 2180 1804 1776 1627 1568 497 442 218 132 2670 233 11963 --
NM_001241chr2122368 2358 2210 2180 1804 1776 1627 1568 497 442 218 132 2670 233 11963 --
NM_001249chr142386 321 ------
NM_001253chr61235 1127 ----
NM_001254chr1751052 904 341 306 185 174 ----
NM_001256chr1782960 2413 2121 1822 1801 949 371 179 32899 2296 2101 12550 2639 312
NM_001257chr1641398 285 164 137 ----11316
NM_001259chr7276356 5904 5746 5472 5347 5130 5117 5087 4724 4587 4377 4353 4223 4179 3888 2461 2127 2082 1735 1636 1401 1328 1213 1078 962 480 393 1768 45781 4299 4046 1430 35201 793 703
NM_001262chr1--136 1335 1243
NM_001270chr52219 180 --1173 1826
NM_001271chr1523248 3153 23052 2406 151 --
NM_001273chr122593 366 ------
NM_001282chr1762614 1843 908 637 586 320 --1416 --
NM_001284chr5--1525 --1581
NM_001286chr152836 2812 1143 493 360 --12067 --
NM_001289chrX41165 620 139 31 1174 1190 --
NM_001290chr42867 433 11051 3882 761 426 11062
NM_001298chr231312 491 307 --11083 11275
NM_001304chr17103557 3323 2756 2714 2687 2563 1014 461 349 314 23862 2780 23122 1342 --
NM_001310chr12172994 2955 2921 2884 2515 2484 2449 1948 1914 771 744 713 595 488 302 261 77 52657 2551 1939 327 175 11908 --
NM_001315chr652303 1686 1586 893 585 32221 1572 1397 32044 1579 368 --
NM_001326chr11--1323 ----
NM_001328chr41494 1768 1721 --
NM_001331chr1172760 2268 2193 521 469 45 38 12435 32827 2092 259 12684
NM_001332chr521233 1055 2274 157 ----
NM_001338chr214489 395 374 349 1970 31067 866 141 --
NM_001349chr23413 185 133 1126 ----
NM_001351chr321807 332 ----1600
NM_001356chrX82521 1936 1819 1796 1641 1569 525 339 --22318 1771 --
NM_001357chr12270 226 ------
NM_001364chr11104682 4656 4193 3908 3808 3095 1583 1471 1085 661 1353 2996 775 24799 3435
NM_001380chr102984 126 11084 11005 --
NM_001386chr842339 2133 1904 1729 11856 1808 --
NM_001387chr562707 1960 955 726 181 73 12344 ----
NM_001390chr1873331 3171 3165 3111 2691 2638 1437 --33623 3586 798 --
NM_001391chr1841188 1181 68 45 11206 ----
NM_001396chr2172409 2379 2138 1127 1115 1108 1072 12451 22665 901 --
NM_001400chr121007 989 21138 500 1236 1507
NM_001407chr361150 1074 1065 490 259 249 ------
NM_001412chrX153576 3452 3311 3087 2946 2900 2826 2378 1092 939 835 552 510 490 284 32455 1323 876 2793 139 43627 3552 2694 1111
NM_001415chrX71816 1546 1419 1244 1234 305 75 1802 --1792
NM_001418chr113760 732 110 ----1200
NM_001418chr113760 732 110 ----1200
NM_001419chr19134743 4645 4417 4357 4207 4093 3870 3743 3507 1170 1143 1017 989 31232 961 888 34882 4565 466 1308
NM_001420chr1953167 2178 2086 1024 600 --1703 --
NM_001422chr1121360 263 ----1473
NM_001423chr1261915 1822 1548 1425 541 207 11445 12030 --
NM_001427chr732003 1537 1494 --1196 --
NM_001429chr225899 795 412 336 39 --1203 --
NM_001430chr242003 766 445 189 ----11738
NM_001431chr66916 850 484 317 298 212 --11211 --
NM_001432chr4173881 3634 3623 2921 2756 2681 2663 1316 1248 1136 848 250 195 154 143 125 78 2944 117 43175 2502 861 220 13545
NM_001438chr193246 3196 2781 2674 2357 797 315 243 191 33558 3286 2367 13496 --
NM_001451chr1691378 1286 1183 1046 969 466 459 432 74 --1426 --
NM_001452chr61664 1648 3702 681 612 1602
NM_001453chr691384 1335 1300 1118 604 516 349 334 191 21356 413 11191 --
NM_001463chr22594 332 ------
NM_001482chr152953 154 3707 102 76 ----
NM_001483chr72762 719 --1892 1808
NM_001490chr973092 1492 1389 828 607 461 374 33441 3005 2534 ----
NM_001491chr641771 1733 1668 142 ----22621 610
NM_001495chr821118 797 --127 --
NM_001497chr962761 2676 1923 1859 866 826 22143 728 1167 --
NM_001498chr641183 980 330 200 1219 --11275
NM_001514chr11172 1402 ----
NM_001518chr75326 208 147 127 84 11104 ----
NM_001527chr6174559 4228 4164 4052 3829 3373 1610 1604 1595 1462 1449 1347 1292 1182 338 121 100 11409 1937 31432 1278 213
NM_001530chr142320 285 11031 3865 435 71 --
NM_001535chr21----1607 --
NM_001542chr152389 2376 983 839 530 22365 2151 11860 --
NM_001543chr534015 3713 1053 --21624 946 1939
NM_001546chr641380 1240 1045 360 --1425 1580
NM_001550chr75645 515 430 39 25 ------
NM_001557chr2--11259 11307 11218
NM_001558chr1121551 21 --1586 --
NM_001560chrX52092 2064 1044 877 322 12138 11630 --
NM_001570chr311507 11436 ----
NM_001584chr1131146 765 455 31137 312 156 --2414 322
NM_001587chrX22219 2168 --2217 181 --
NM_001604chr111738 ------
NM_001609chr1094397 4166 4074 3624 3495 1292 1068 703 233 54362 4190 1092 883 737 33527 2880 281 1118
NM_001616chr2143414 3406 3343 3164 2573 1384 1194 1162 924 894 881 713 378 82 32743 1271 570 23148 3127 12656
NM_001619chr11288 38 ------
NM_001621chr7102750 2480 2350 2286 1179 714 521 495 460 157 --32954 2650 371 2693 591
NM_001621chr7102750 2480 2350 2286 1179 714 521 495 460 157 --32954 2650 371 2693 591
NM_001634chr661767 1492 1431 599 333 89 1608 31738 1511 60 --
NM_001642chr1161195 1189 1137 1102 888 251 11155 --11350
NM_001650chr1884060 1333 1282 1128 953 896 392 148 22797 249 42974 2912 976 215 --
NM_001655chr1172107 2094 825 703 696 364 329 3661 528 336 ----
NM_001656chr5101539 1516 1462 1449 1355 813 790 502 256 153 2521 160 11788 22010 591
NM_001659chr1242150 2056 2013 499 --22536 2026 --
NM_001660chr33681 612 130 ------
NM_001661chr172556 286 ------
NM_001663chr1472717 2399 2347 2028 1047 530 442 --2990 392 1956
NM_001668chr1101804 1785 1618 1579 856 721 692 653 575 416 --11913 --
NM_001675chr22172 ------
NM_001677chr151000 931 908 820 189 3802 403 327 --1123
NM_001679chr32765 529 1644 ----
NM_001681chr121536 ------
NM_001682chr1292836 2349 2228 2183 2173 901 550 190 144 12849 52568 1796 911 675 470 --
NM_001684chr163990 3843 2642 1061 793 763 132 ----
NM_001689chr251974 805 452 356 165 ----12007
NM_001690chr3102486 2457 793 625 613 606 600 494 481 412 11780 161 --
NM_001693chr82954 456 --1372 21232 905
NM_001695chr8134274 3989 3922 3865 3808 3392 3187 2855 1559 1355 1312 1240 78 1856 ----
NM_001696chr22162 ----1483
NM_001701chr921566 153 --1436 --
NM_001702chr81547 ------
NM_001703chr1151 ------
NM_001704chr62579 504 2459 394 ----
NM_001707chr71840 --1918 1899
NM_001709chr11102769 2750 2651 2534 2504 2314 2295 1054 818 458 32761 515 309 22914 550 1932
NM_001714chr122493 417 1430 ----
NM_001718chr6--11136 1999 --
NM_001722chr81243 ------
NM_001726chr11111 ------
NM_001730chr1351523 1311 535 204 138 --1130 --
NM_001730chr1351523 1311 535 204 138 --1130 --
NM_001731chr124794 754 715 56 --1899 --
NM_001742chr7101828 1774 1768 1599 1564 1479 1450 731 380 173 --41837 1382 604 374 11675
NM_001743chr24580 506 453 398 1186 ----
NM_001746chr582944 2916 2784 2687 2667 2287 2044 176 12658 22130 1099 12677
NM_001748chr12407 284 11066 ----
NM_001750chr582009 1653 1544 1450 506 384 286 271 ----12059
NM_001752chr111413 ------
NM_001753chr771811 1755 1599 1551 1302 631 186 --31661 1642 615 11825
NM_001754chr21144016 3652 3641 3270 3254 2746 1615 1475 826 766 600 548 487 333 13662 --13343
NM_001755chr1692300 2255 2178 1655 1588 1564 499 450 437 41868 1477 1456 309 22162 1398 --
NM_001759chr12124813 4807 4716 4600 4498 3775 1525 1401 1258 649 278 130 45008 1803 1776 1580 ----
NM_001762chr73696 306 173 1242 1751 --
NM_001769chr121297 1156 ----
NM_001774chr192237 74 ------
NM_001777chr3154067 3993 3970 3912 3260 3004 2916 1620 1538 1424 1411 1362 1225 676 251 23273 2610 --13322
NM_001781chr127935 888 880 730 659 613 295 --1903 --
NM_001788chr73966 195 137 1880 1684 --
NM_001792chr184917 910 401 370 --1335 --
NM_001795chr1631577 1502 1375 ------
NM_001796chr162253 246 ------
NM_001797chr163570 260 78 2768 681 --1746
NM_001798chr124934 928 899 434 ------
NM_001801chr53478 112 96 131 1427 --
NM_001806chr1952932 2785 964 309 126 ------
NM_001812chr43230 217 73 ------
NM_001830chrX114035 3844 3471 2777 2650 974 915 833 767 491 21 13619 --13734
NM_001839chr12755 115 --1772 --
NM_001842chr9184 ------
NM_001845chr1321070 896 --2931 254 --
NM_001851chr6--2714 613 1634 --
NM_001854chr131474 1100 386 31302 1242 1078 ----
NM_001855chr91896 --1589 2606 574
NM_001858chr6174963 4445 4175 4104 4096 3975 3887 3867 3755 3653 3289 2030 1720 1698 1462 497 93 44949 4849 1734 220 25107 3905 23716 2009
NM_001859chr953215 2960 1563 1529 1079 22606 1324 24004 1052 --
NM_001865chr6199 ------
NM_001870chr31253 ------
NM_001873chr43184 107 91 124 ----
NM_001875chr261055 372 337 285 239 120 1725 11065 1358
NM_001884chr51516 ----1543
NM_001891chr42315 34 ------
NM_001894chr2231199 1141 49 11032 ----
NM_001896chr16--1427 ----
NM_001901chr64986 783 704 682 --21079 697 --
NM_001902chr11307 ------
NM_001914chr181407 1345 ----
NM_001918chr1149197 9110 8446 8194 7075 6439 3487 3468 2758 1607 972 765 643 138 47215 2263 1273 1026 69240 8382 6529 6139 964 714 36753 3555 2342
NM_001920chr122499 295 ------
NM_001924chr13430 406 355 1483 --1421
NM_001931chr1161303 1203 1048 281 106 60 31177 466 94 11193 --
NM_001935chr22829 737 ----1915
NM_001936chr721218 608 11802 ----
NM_001938chr141545 627 538 74 11754 41792 1746 1496 1307 11840
NM_001942chr1832048 1822 330 --11450 11854
NM_001945chr531417 568 153 --11424 --
NM_001946chr1231184 769 78 --2982 826 --
NM_001948chr1561255 928 814 369 258 142 2384 375 1402 --
NM_001949chr682781 2757 2374 2103 879 647 541 225 12454 22746 39 --
NM_001950chr162756 721 --1729 --
NM_001955chr661033 985 957 939 888 210 --31114 1072 731 --
NM_001957chr4112218 1842 1443 816 628 609 505 419 303 295 190 1746 22097 134 11910
NM_001963chr46714 610 590 579 261 155 ------
NM_001964chr531110 1086 977 11100 ----
NM_001966chr31477 --31377 1099 290 11265
NM_001967chr3189 ------
NM_001968chr42869 166 1843 --1359
NM_001969chr1482833 2448 1163 1142 1036 936 799 779 22785 358 21185 1018 --
NM_001977chr43411 227 195 41533 503 446 273 1112 --
NM_001980chr1262175 2061 1966 1824 1392 299 ----22264 346
NM_001981chr141815 1730 1720 912 32061 955 282 1543 --
NM_001987chr1273113 1528 1441 1328 1070 755 480 --2571 427 --
NM_001999chr571540 1383 507 492 399 356 220 11188 ----
NM_002006chr4155790 4808 4576 4392 4329 4033 3883 3861 3633 2079 1608 1579 1395 1048 610 45694 4788 4623 269 55599 5392 5278 1383 1004 152
NM_002009chr1562300 2168 840 734 613 93 22277 920 42502 1011 887 497 --
NM_002011chr51439 ------
NM_002014chr123659 271 110 ------
NM_002015chr13153362 3219 2817 2731 2696 2590 2541 2152 1012 939 832 691 677 322 33 11121 --12648
NM_002017chr112962 854 --31284 1177 47 --
NM_002024chrX102146 2095 1829 1429 1389 583 260 218 147 25 2663 477 31751 690 681 --
NM_002025chrX259146 8184 8119 8099 7905 7814 7461 7398 7036 6970 6575 6328 6145 3533 3190 3149 3028 2961 1287 1125 983 698 658 446 123 49071 8371 5727 264 48168 7501 7047 1330 28079 6614
NM_002035chr18123930 3810 3712 3541 3103 2925 2682 2659 1228 1166 755 364 33958 2947 535 63704 3599 2668 954 732 710 13868
NM_002040chr21173175 3158 3151 2978 2970 2701 2619 2417 2320 2295 2061 1958 707 560 374 170 138 3951 421 409 42805 2214 1968 1043 22133 184
NM_002041chr15290 27 ------
NM_002044chr1551575 1479 1199 224 163 --1133 --
NM_002048chr9101323 1265 1197 1139 1018 1001 970 439 412 118 11170 ----
NM_002051chr102929 792 --1818 11169
NM_002056chr27834 777 710 670 353 339 258 ----1862
NM_002061chr161871 272 249 201 154 121 --51536 451 351 316 261 --
NM_002063chrX41194 858 848 467 21270 811 1842 --
NM_002069chr751535 1168 518 318 47 2682 565 ----
NM_002072chr9--1267 ----
NM_002073chr2231106 1073 169 11577 ----
NM_002082chr51986 ------
NM_002086chr1742217 2178 2123 553 ------
NM_002090chr42436 176 1193 1445 1201
NM_002092chr494324 3920 3913 3446 3365 3210 1022 1000 889 33843 1031 448 21146 334 34032 3701 918
NM_002094chr164352 344 321 80 --1111 --
NM_002107chr1----2426 94 --
NM_002110chr202301 223 ------
NM_002126chr1772562 1490 1462 1259 618 556 545 11664 31120 1105 787 11626
NM_002128chr1351744 1654 526 436 195 22392 2239 22343 872 --
NM_002129chr4157 --1158 --
NM_002133chr222473 427 ------
NM_002135chr123524 484 475 ------
NM_002136chr12--1204 ----
NM_002137chr772289 2240 1590 1571 1521 957 601 22196 543 22224 1883 12355
NM_002138chr46720 655 581 225 196 48 --1616 --
NM_002140chr961031 944 780 769 349 289 ------
NM_002145chr172379 292 ------
NM_002146chr1751400 1274 1160 1064 170 11222 11091 --
NM_002147chr172222 134 ------
NM_002148chr23467 263 135 1449 ----
NM_002158chr2153789 3739 3550 3434 3331 3249 3116 2964 2349 1492 1210 749 479 430 420 23357 2785 33574 2947 2740 13016
NM_002161chr92384 101 ----1426
NM_002163chr1651253 510 480 245 117 --11143 --
NM_002182chr3112799 2744 2680 2290 2217 2005 1892 1088 1019 658 423 11942 22703 2027 --
NM_002189chr104706 666 624 618 154 1715 --
NM_002193chr231515 1451 1408 --21400 152 1219
NM_002194chr21127 ------
NM_002196chr2021058 1025 --11139 --
NM_002196chr2021058 1025 --11139 --
NM_002199chr42788 681 3653 92 66 --1808
NM_002201chr15----1109 --
NM_002202chr52718 21 ------
NM_002203chr5123788 3577 2628 1530 1516 1348 1165 653 545 439 389 312 33109 225 128 33874 3102 91 23852 457
NM_002207chr34680 311 255 67 ------
NM_002210chr2193265 3255 3099 3093 2286 2185 1441 1300 1234 1098 1003 991 974 825 785 570 465 432 147 1292 22457 593 1658
NM_002211chr1081170 1005 908 838 819 813 298 154 1806 --1761
NM_002214chr7165640 5453 5404 5334 5226 4991 4731 4638 4446 4133 4033 4027 3867 1336 612 565 25249 5161 35531 5390 4833 14356
NM_002222chr341339 1255 912 311 ------
NM_002223chr12113967 3011 2934 2833 2670 2565 2529 1063 853 597 515 13090 42952 2895 2726 441 --
NM_002226chr145938 729 223 141 99 ------
NM_002227chr151171 920 381 241 131 ------
NM_002229chr19--1423 ----
NM_002234chr124763 739 624 197 ------
NM_002239chr261140 1134 326 287 122 55 --198 --
NM_002240chr213550 110 89 ------
NM_002242chr241876 705 432 55 1736 ----
NM_002245chr12473 276 --1621 --
NM_002247chr1061952 1769 1605 826 397 123 --11500 11521
NM_002252chr21167 ------
NM_002253chr421301 524 21123 1040 11416 --
NM_002264chr3124962 4521 4296 4004 3579 1968 1953 1015 833 643 470 460 14876 23756 1048 13268
NM_002266chr17148 ------
NM_002267chr1342354 955 250 122 1798 2691 463 --
NM_002268chr361796 1762 1705 1466 1435 266 ------
NM_002270chr5205483 5379 5094 4539 4301 4266 3824 3812 2183 1873 1679 1661 1605 1484 1366 1226 1052 931 847 812 12229 35594 3741 2245 33705 3490 1919
NM_002271chr1362331 1872 1576 1494 513 241 --2791 739 --
NM_002285chr262895 1586 1395 580 526 495 --13912 --
NM_002293chr162791 2614 2451 2406 1731 576 32768 2545 2517 12432 --
NM_002296chr171555 1312 1102 1083 667 335 109 ------
NM_002298chr1331503 1037 269 ------
NM_002310chr5286521 6064 5881 5785 5637 5511 5235 5181 5014 4699 4673 4650 4495 4476 4404 4390 2264 1414 1399 1357 1127 829 774 740 725 585 371 157 34176 1968 1386 36621 5440 5119 16010
NM_002314chr73988 941 918 ------
NM_002317chr52264 91 ------
NM_002334chr1131908 1360 1291 12073 ----
NM_002335chr111180 ----177
NM_002336chr12174896 4814 4793 4595 4023 3994 3823 3401 3142 1725 1668 1055 845 584 257 175 154 14985 43576 1408 1138 184 --
NM_002345chr125653 531 502 480 135 ----3219 72 26
NM_002349chr271308 1161 1118 1030 525 506 374 21445 1415 1111 1307
NM_002350chr851238 1231 1010 934 449 11251 1788 --
NM_002351chrX31541 237 223 2361 26 --1271
NM_002356chr672822 2549 2274 1908 538 285 278 1132 2999 317 --
NM_002372chr51273 184 1656 --
NM_002374chr2153428 3221 2467 2278 1229 1068 1058 979 839 826 814 791 491 241 34 23157 278 11402 --
NM_002376chr14178 ------
NM_002381chr281049 1014 867 741 708 204 124 46 ------
NM_002382chr144832 449 141 106 11344 1201 --
NM_002384chr183983 748 696 1973 ----
NM_002387chr5145187 5088 4827 4740 4593 4488 3713 2075 1838 1630 1446 1171 277 79 13333 --25157 3152
NM_002389chr181822 1786 1739 699 580 310 265 29 2532 391 21627 440 21708 1546
NM_002392chr124474 166 144 30 ------
NM_002395chr65982 488 454 384 357 21120 115 --11236
NM_002397chr571915 1733 1604 701 618 429 144 11627 22158 880 1804
NM_002398chr241546 1368 1176 1126 --11345 --
NM_002399chr1561457 1388 956 444 437 176 1371 ----
NM_002401chr1751549 1523 805 401 383 ------
NM_002402chr731208 352 209 11011 11083 --
NM_002408chr143813 43 35 2338 98 ----
NM_002427chr1161214 1102 912 320 261 54 1861 11264 --
NM_002430chr2262520 2475 2037 473 462 417 --1669 --
NM_002438chr103692 653 26 --1177 1225
NM_002439chr52947 936 --1326 --
NM_002440chr12284 54 ----1101
NM_002442chr1251761 1650 1521 264 254 ------
NM_002448chr42763 728 ------
NM_002449chr53411 356 36 1326 21070 1014 11239
NM_002451chr992885 2525 1267 1244 1073 842 666 457 323 31294 1221 749 11306 11177
NM_002469chr121391 ----1442
NM_002473chr222964 363 ------
NM_002480chr1261116 1039 1033 494 454 336 11096 21366 369 --
NM_002481chr1157829 7811 6704 6515 6393 5022 2959 2634 1815 1805 1619 1310 1253 579 320 16730 36544 1669 708 --
NM_002482chr12667 54 ------
NM_002486chr9102306 2186 1614 643 531 262 180 155 79 61 --22537 1595 --
NM_002492chr32324 72 ------
NM_002499chr1562135 1804 865 766 659 561 1399 ----
NM_002500chr23913 439 201 1496 1391 --
NM_002505chr621488 594 ------
NM_002507chr1711740 ------
NM_002515chr1472030 1891 1855 1700 542 232 71 --2474 218 --
NM_002518chr241142 996 469 459 ------
NM_002519chr1151228 1008 597 413 198 --31538 1283 192 1965
NM_002520chr5--1311 ----
NM_002523chr7--11053 --11106
NM_002524chr12685 245 ------
NM_002525chr1--141 ----
NM_002526chr651620 1311 649 569 401 1632 21482 289 --
NM_002538chr51572 1131 --2533 214
NM_002541chr71991 ------
NM_002544chr17194 1311 ----
NM_002545chr1185040 5028 4460 4080 2030 1345 458 156 23377 738 --14960
NM_002546chr82814 617 --3600 554 234 --
NM_002556chr1131646 818 94 11975 32108 1761 1633 --
NM_002569chr15168 ------
NM_002577chr3154028 3970 3332 2973 2914 2814 2661 2651 2495 2489 1560 1088 456 355 297 22924 1334 --1580
NM_002581chr9175491 5465 5354 5068 5002 4989 4859 4481 4154 3929 3905 3726 3616 2258 2015 1470 844 --45639 5541 5524 1655 25663 4552
NM_002582chr163941 904 157 ------
NM_002583chr124633 598 153 117 --1511 134
NM_002585chr1----1328 --
NM_002589chr41135 ------
NM_002591chr205600 559 531 468 427 ------
NM_002592chr202237 219 ------
NM_002594chr2042264 1584 962 152 22380 349 12141 21654 630
NM_002595chr1281912 1613 1523 1440 1380 755 706 167 21434 781 11213 --
NM_002596chr111396 ------
NM_002605chr1511020 1966 ----
NM_002606chr211179 ------
NM_002608chr2221588 1060 --11567 --
NM_002610chr263134 3074 2700 2375 888 653 32774 189 91 3331 223 201 --
NM_002612chr781832 1665 1390 1356 832 690 484 220 --12128 1357
NM_002613chr16105342 5072 4404 4362 3793 3714 3413 3379 3347 3271 25350 1962 11302 15240
NM_002618chr2145 --1347 137
NM_002623chr205703 510 496 292 200 2696 163 1169 --
NM_002628chr31105 11048 ----
NM_002631chr1190 ------
NM_002635chr123469 444 78 ------
NM_002636chr61448 --1470 --
NM_002641chrX71768 1592 1398 1344 757 598 73 --31650 293 140 --
NM_002643chr2121 ------
NM_002645chr11103152 2685 1958 1120 635 553 322 146 117 110 --23079 2726 23041 2563
NM_002646chr152193 1805 1565 362 284 1805 ----
NM_002647chr18127 --2222 128 --
NM_002648chr631305 1292 482 1842 ----
NM_002649chr741386 1084 462 358 11209 31298 1219 298 --
NM_002655chr8135031 4849 4509 3875 3356 2037 1833 1697 885 586 311 206 105 73781 3689 3489 3380 1608 81 69 105090 4962 4561 3753 3574 3525 2006 1540 1245 727 11989
NM_002656chr6121 --2777 192 --
NM_002657chr2073781 3651 3338 3128 2762 250 244 --13318 --
NM_002658chr104873 864 858 601 --1885 --
NM_002667chr651315 1005 424 360 206 --21223 1060 --
NM_002670chr361632 1239 1177 1091 255 238 --11472 1637
NM_002687chr1441100 392 358 162 ----21122 305
NM_002699chr151515 1434 1343 1231 89 11421 --21535 1304
NM_002703chr471935 1750 1659 1601 1337 535 114 11847 21695 575 1300
NM_002706chr22573 538 --122 1518
NM_002709chr283626 3390 2300 870 504 429 380 48 32920 2598 688 1682 13268
NM_002714chr641084 897 758 317 --21106 188 --
NM_002716chr1193341 2520 2333 2241 1444 1379 996 988 718 1450 --1262
NM_002718chr352376 1885 974 724 84 138 11721 --
NM_002719chr1491813 1782 1679 1549 641 565 511 411 68 1698 32420 2102 787 --
NM_002721chr9----181 1514
NM_002725chr133261 1776 1749 ------
NM_002727chr101647 2618 192 --3466 174 49
NM_002731chr1102684 2437 1252 1159 1120 1039 979 389 365 323 32049 1223 864 52667 2327 2133 1243 986 22715 1941
NM_002734chr1781901 1832 1754 1729 1460 1421 141 47 167 42253 1919 672 284 --
NM_002736chr771883 1863 1768 1657 1381 742 732 11671 21948 570 --
NM_002737chr17156598 6382 6286 5954 5847 5434 4690 4354 2184 2043 1971 1599 1467 1427 815 --34981 694 321 --
NM_002738chr165923 793 431 304 253 ----1879
NM_002740chr382820 2748 2708 2643 2034 941 626 94 12470 ----
NM_002742chr145731 564 258 180 92 ------
NM_002745chr22154556 4452 3823 3790 3582 3571 3226 3074 1824 1689 1520 1161 787 292 248 23342 277 43272 3219 3199 166 11232
NM_002748chr154978 890 831 365 21188 939 1398 --
NM_002749chr17----1231 --
NM_002750chr102222 197 ------
NM_002753chr41337 ------
NM_002755chr154728 676 649 356 ------
NM_002758chr173496 480 394 1388 ----
NM_002760chrY145908 5459 5428 5100 4780 4755 4579 4429 4324 4291 1730 612 606 588 --15377 --
NM_002788chr14--128 ----
NM_002792chr201121 ------
NM_002800chr6129 ------
NM_002806chr142315 238 ------
NM_002819chr1921197 109 --11271 --
NM_002822chr1281496 1350 547 408 335 267 182 109 1524 1616 --
NM_002823chr25671 608 505 272 230 1249 ----
NM_002825chr71623 ------
NM_002827chr2051801 1781 712 399 191 ------
NM_002828chr182865 137 ------
NM_002833chr1511513 ------
NM_002835chr74753 699 578 190 --1126 --
NM_002836chr20----146 --
NM_002837chr12134574 4319 4295 4117 4005 2853 1455 1224 1208 580 253 214 187 --11475 --
NM_002838chr1121088 1030 1013 918 891 880 746 343 196 156 118 55 1202 1768 1137
NM_002839chr9113518 3511 3215 3188 3168 2793 2708 2345 1224 835 414 23201 2921 --1913
NM_002841chr32131 104 2477 442 ----
NM_002843chr11133397 3370 3352 3336 3153 3143 2541 2165 1339 1302 608 538 406 1338 1571 22357 387
NM_002844chr63510 235 142 --21110 348 --
NM_002845chr183459 429 97 1437 1650 --
NM_002849chr121152 1762 --1392
NM_002851chr72528 254 ----1552
NM_002852chr33570 445 230 ----1601
NM_002858chr131351 1043 52 ------
NM_002865chr81241 ------
NM_002869chr11142128 2101 1964 1913 1884 1845 1702 1392 1357 694 388 304 222 43 2757 374 --1204
NM_002874chr951011 809 695 560 97 31991 619 342 12526 --
NM_002886chr3165198 5190 5171 5119 3564 3546 3354 1727 1313 1206 822 773 753 414 266 82 23956 3602 15222 --
NM_002890chr55981 939 651 631 201 --3820 693 321 --
NM_002892chr143470 242 218 --31268 1176 121 1650
NM_002895chr206909 696 673 182 151 140 --1687 1208
NM_002901chr112736 399 1378 ----
NM_002902chr153591 178 61 189 1563 --
NM_002906chr1181888 1741 1629 905 654 647 390 182 11461 32116 1816 1560 --
NM_002907chr122301 60 --2312 124 2380 104
NM_002912chr66858 776 608 158 73 34 1634 1786 1710
NM_002922chr12648 559 1474 ----
NM_002923chr11663 --1648 --
NM_002924chr14540 528 197 128 ------
NM_002940chr4101861 1775 1688 1628 1524 747 603 573 370 125 1417 11437 --
NM_002941chr371591 1269 1170 1101 593 475 266 1621 --11138
NM_002942chr3----1163 --
NM_002946chr12451 168 ----131
NM_002955chr661455 1356 793 351 268 56 ------
NM_002956chr1281268 555 392 371 357 349 192 103 21424 477 1136 --
NM_002957chr963531 3497 3211 2811 2537 1466 13334 13343 13412
NM_002958chr38832 782 658 633 366 359 329 259 --2183 73 1139
NM_002959chr1104431 4422 3820 3437 3087 1489 1364 1232 816 410 --21207 715 --
NM_002968chr1661059 962 922 349 246 205 ------
NM_002970chrX3308 250 65 138 ----
NM_002971chr321118 783 1838 ----
NM_002973chr123535 171 94 ------
NM_002974chr18196 --1333 --
NM_002977chr2133435 3047 2778 2513 2397 2342 2119 1237 1201 1024 929 441 175 --21300 537 --
NM_002979chr15690 589 341 194 21 --2864 606 --
NM_002982chr17142 177 2367 338 --
NM_002993chr451079 1048 887 711 132 1227 ----
NM_002994chr4121958 1920 1812 1788 1685 1636 1630 1476 1465 712 600 356 2750 252 --2790 485
NM_002995chr15791 553 214 129 123 ----1744
NM_002996chr16--11986 ----
NM_002998chr862184 1833 1814 1698 1400 376 51916 1729 1626 766 593 12159 --
NM_003010chr1742225 931 720 498 2901 544 --22351 958
NM_003013chr42810 588 2791 682 1263 --
NM_003016chr1741947 1588 1254 606 ------
NM_003017chr651135 903 881 373 256 31006 574 223 1888 --
NM_003024chr212877 717 --1369 --
NM_003027chr15--2407 144 2356 29 --
NM_003030chr331844 1505 642 21878 520 21854 782 --
NM_003031chr162675 180 ----2891 661
NM_003034chr12187920 7689 6689 6528 6077 5641 5627 5039 5011 3208 2682 2651 1789 1354 603 472 152 38 67142 5721 5121 2215 1682 797 22914 1629 45915 5433 5345 205
NM_003035chr14996 734 309 55 --1958 1613
NM_003036chr11964 ------
NM_003043chr374280 4236 4210 3878 1173 313 88 1282 34052 361 210 24264 4064
NM_003046chr8135396 5155 5140 4620 3893 3873 3863 2038 1350 926 821 277 131 25360 1787 35379 3489 1301 11565
NM_003048chr242785 1740 349 114 22455 1727 42763 2535 2253 2190 --
NM_003051chr191943 1683 1665 1561 801 674 638 579 449 --21376 531 --
NM_003054chr101296 1224 1261 --
NM_003060chr511081 --11178 --
NM_003068chr851059 895 791 380 233 1709 ----
NM_003069chrX3716 576 186 --2662 297 3504 288 279
NM_003071chr3101638 788 637 546 486 362 282 244 170 39 --1344 31869 761 117
NM_003072chr191137 1369 ----
NM_003073chr22--1247 ----
NM_003074chr362215 2080 1908 534 367 356 --22028 1543 --
NM_003088chr721091 761 ------
NM_003095chr124352 341 97 34 --1254 1246
NM_003099chr15146600 5481 5072 5024 4987 2516 2253 2093 2020 1881 1575 1563 1523 843 34754 2002 214 56391 2497 914 296 185 26336 380
NM_003100chr5----2381 320 1105
NM_003105chr111105 ----142
NM_003106chr351021 949 904 419 266 1965 1885 1928
NM_003107chr652496 1741 1728 1660 482 ------
NM_003108chr2257132 6807 6783 6705 6661 6566 6347 6337 5862 5720 5443 5250 5141 5134 5107 5001 4779 4739 4553 4541 2136 1213 974 782 331 14916 45423 1467 962 541 --
NM_003111chr261399 1163 1152 209 151 35 1526 21183 1010 1553
NM_003112chr7113055 3021 2632 2475 1994 1205 877 867 646 367 353 --42866 2596 958 913 22282 2141
NM_003114chr86780 642 554 223 173 138 1271 1193 1734
NM_003115chr12118 47 1408 ----
NM_003128chr232870 2439 351 12467 21738 1098 --
NM_003131chr61766 1688 22080 756 --
NM_003133chr17927 914 814 741 400 200 32 2151 85 1753 --
NM_003137chr641997 1557 795 772 11940 ----
NM_003144chr652121 2092 553 526 371 --151 --
NM_003155chr852757 2604 2573 850 113 12745 ----
NM_003157chr35775 681 298 285 41 ----1867
NM_003161chr17143551 3344 3101 3084 2936 2665 2643 2528 1402 1236 1206 1190 723 396 12703 32694 1151 532 --
NM_003162chr251089 975 909 798 753 1840 11119 --
NM_003171chr10155 ------
NM_003174chr104622 352 166 102 --174 --
NM_003176chr12226 114 --2342 59 --
NM_003176chr12226 114 --2342 59 --
NM_003178chr362076 1904 1718 1469 829 487 31825 750 726 11836 --
NM_003184chr831082 1008 696 11002 31108 1023 950 --
NM_003185chr2081206 1170 1078 1040 1004 929 864 34 1408 --11283
NM_003186chr11----1387 --
NM_003188chr62154 128 ------
NM_003189chr183123 2802 2491 933 670 445 304 224 --21022 808 --
NM_003193chr11140 ------
NM_003194chr61394 --1543 --
NM_003199chr18155583 5294 5029 4666 4081 4019 4009 3667 1922 1719 1529 1520 1324 436 391 24157 4130 35269 5094 1950 --
NM_003201chr1081032 1012 942 759 744 202 160 115 ----1688
NM_003202chr5--11748 21899 1842 --
NM_003204chr1761750 1732 1719 1559 1359 1233 ------
NM_003206chr61424 --1401 --
NM_003211chr1271507 1467 1425 1336 1215 321 247 2538 100 11307 --
NM_003213chr121191 ------
NM_003217chr1251854 1758 590 139 121 --1540 --
NM_003220chr671545 1437 1419 1361 1249 487 464 21730 1096 ----
NM_003221chr683996 3986 3689 3509 2892 1621 1449 868 --33635 444 394 11465
NM_003222chr201453 1845 ----
NM_003234chr362229 877 724 376 254 179 --1672 --
NM_003243chr141220 997 879 321 --3973 803 473 --
NM_003244chr184462 320 301 97 177 185 --
NM_003246chr1572095 1988 1937 1853 1757 1429 241 11740 ----
NM_003247chr661927 1726 1677 1254 425 285 21418 789 11842 --
NM_003253chr2171923 1884 1855 1509 1458 698 39 31392 708 500 --11432
NM_003255chr1752429 2401 2375 2173 2079 1914 12632 --
NM_003257chr1521286 945 1412 1242 --
NM_003262chr3165181 4582 3795 3675 3280 1897 1675 1576 1300 1141 920 786 581 522 456 271 51995 1974 1338 998 761 14213 14159
NM_003270chrX4991 843 405 361 --1789 --
NM_003274chr21112750 2701 2660 2072 1935 1055 1013 850 755 500 200 ------
NM_003286chr2041125 968 255 203 ----1408
NM_003290chr1921213 230 --2288 143 --
NM_003292chr142266 2021 1980 1521 11407 ----
NM_003298chr385491 2029 1821 1578 1566 971 94 77 15633 25697 5452 --
NM_003300chr141498 ------
NM_003304chr391380 1366 1065 1023 609 550 511 497 132 2476 274 21456 641 --
NM_003305chr4271 54 ------
NM_003309chr671830 1804 1742 1181 494 182 98 --21301 1214 --
NM_003319chr2187 1255 ----
NM_003320chr1164454 4406 4383 4066 3670 294 21741 1163 23438 3112 11102
NM_003330chr1221797 1587 1679 11173 --
NM_003336chrX6982 884 362 337 281 235 3830 296 90 1989 1918
NM_003337chr571740 1324 593 329 303 235 171 21449 1217 --21725 536
NM_003338chr1091938 1846 1601 1470 659 478 424 307 245 --11856 --
NM_003339chr561623 1337 383 188 160 86 11152 ----
NM_003340chr431158 200 122 1555 1962 1479
NM_003341chr31532 1516 ----
NM_003342chr1773309 2355 1237 981 681 623 567 12700 42475 1324 1051 338 --
NM_003344chr741758 1743 420 73 11158 ----
NM_003348chr1241456 1310 686 256 21615 348 1671 --
NM_003349chr2051642 1092 1086 1072 1036 ------
NM_003350chr83862 854 143 --1952 1363
NM_003352chr24781 760 693 46 1787 ----
NM_003358chr91133 ------
NM_003359chr471228 1178 1133 978 431 275 47 --21165 511 11076
NM_003360chr4--1193 ----
NM_003368chr12770 306 --1792 --
NM_003369chr1152823 2555 292 206 193 --22661 859 --
NM_003372chrX4939 921 320 228 1217 1165 --
NM_003373chr1081804 1621 1602 1435 1395 1332 694 653 --11939 --
NM_003374chr5137 ------
NM_003375chr102412 57 1137 ----
NM_003376chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_003376chr671840 1725 1562 1457 1318 1232 272 1406 ----
NM_003379chr641092 453 445 378 --1746 --
NM_003384chr14181 ------
NM_003385chr2--1812 ----
NM_003387chr262681 2623 1798 658 610 392 42736 2515 2496 694 --32709 649 577
NM_003390chr115897 841 435 155 87 ----1991
NM_003392chr3164349 4331 3921 3902 3382 3146 3085 2898 1354 1307 1195 877 864 539 220 98 14233 33892 2859 91 14101
NM_003400chr23732 602 308 1844 ----
NM_003403chr141528 ------
NM_003406chr881865 1818 1807 1536 1233 636 272 136 1417 ----
NM_003407chr194669 635 571 256 ------
NM_003409chr1861387 1208 1011 538 442 147 1270 186 --
NM_003410chrX132986 2693 2588 2429 2136 1081 913 712 617 605 301 289 233 22198 906 63073 3022 2537 2113 1100 515 --
NM_003411chrY81694 1634 1236 686 657 579 471 291 21751 1244 --11540
NM_003412chr3103041 2786 2320 2138 926 877 827 648 591 204 32933 2208 694 --12993
NM_003413chrX81751 1648 1565 675 624 517 482 240 1729 11316 --
NM_003418chr33737 624 51 --1222 --
NM_003432chr51227 --121 --
NM_003436chr192875 713 ------
NM_003452chr91739 --1862 --
NM_003454chr1681463 1450 1431 935 613 536 407 385 11212 11412 --
NM_003457chr172475 442 1150 ----
NM_003463chr6112816 2287 1315 1156 1088 1080 953 925 785 371 195 22244 594 63029 2957 2302 873 852 380 22996 1049
NM_003468chr2154318 4236 4191 3404 1565 1341 1115 1027 969 772 481 401 307 258 204 11468 13036 24008 3307
NM_003469chr23360 347 26 ------
NM_003471chr382333 1904 1589 951 664 577 257 203 31550 905 647 3911 566 344 --
NM_003472chr681499 1389 984 960 586 578 249 235 --31103 419 341 --
NM_003473chr101393 21060 428 ----
NM_003474chr1082422 2416 2297 2223 2053 354 291 187 1301 11571 --
NM_003477chr112773 225 ------
NM_003478chr11133350 3329 2913 2865 2809 2200 2113 1149 987 889 365 332 24 33169 996 662 33298 616 149 11159
NM_003482chr1232714 2564 2431 --11819 --
NM_003483chr1272873 2846 2627 1964 1906 1177 536 22031 1987 21976 1818 --
NM_003488chr17----1696 --
NM_003489chr2193191 3118 2362 2272 1169 809 623 554 508 42534 729 720 356 12801 12674
NM_003498chr1672500 2436 2383 1950 965 897 867 ------
NM_003503chr121175 160 1111 3839 817 56 --
NM_003505chr771815 1714 1306 1298 1261 1209 298 11949 11856 --
NM_003506chr841194 455 402 353 2326 306 31165 887 226 21093 478
NM_003507chr271987 1770 1555 746 737 610 441 11737 11932 --
NM_003557chr131588 1513 1433 --11069 --
NM_003558chr93624 261 251 --1719 --
NM_003563chr1731091 521 298 ------
NM_003566chr12113454 3308 3222 2688 2345 950 914 300 205 171 60 22724 2638 22822 134 11116
NM_003569chr62482 127 186 3569 173 119 --
NM_003573chr191265 ------
NM_003574chr18195761 5738 5580 5130 4851 4795 4731 4509 4043 3977 3635 2290 2248 1479 1021 1010 977 794 728 34424 1425 337 21741 1211 21668 1647
NM_003576chr1372842 2294 1018 987 622 324 245 2375 233 ----
NM_003579chr1--1142 ----
NM_003582chr1----140 --
NM_003583chr1263439 3031 1572 1357 789 734 43396 2470 1381 1244 21334 204 1190
NM_003587chr6180 ------
NM_003589chr1331434 1369 932 11080 21165 1055 11087
NM_003590chr2103976 3623 3400 3080 2489 1232 1187 1136 1109 889 23059 718 41548 1496 973 928 13217
NM_003597chr251899 886 772 388 282 --21972 1792 --
NM_003603chr442107 1952 300 282 32153 795 527 --11839
NM_003607chr174293 3148 1571 1145 573 348 255 44197 4177 2954 958 11077 24342 516
NM_003610chr201333 ------
NM_003615chr3123992 3011 2877 2647 1287 1268 1208 1140 1068 1051 289 220 53669 3372 1043 955 413 73898 3847 3098 1339 767 342 278 32917 1216 848
NM_003618chr291133 1011 978 465 301 241 174 111 69 21273 994 --21214 378
NM_003620chr1741042 999 364 155 31048 959 860 ----
NM_003621chr111529 ------
NM_003622chr1292418 1852 1823 1720 1652 546 487 251 53 42614 2155 2139 280 32547 813 497 --
NM_003626chr11111370 1346 1335 1240 1129 1001 549 339 252 211 109 ----2189 134
NM_003629chr173444 2911 2270 988 723 579 422 13153 ----
NM_003630chr63728 72 41 1776 2602 172 1300
NM_003631chr103782 658 223 ----1975
NM_003633chr572559 2515 2309 1865 1638 1012 783 21772 1668 ----
NM_003637chr151477 1290 1233 1175 488 --11127 --
NM_003644chr1795580 5015 4399 2166 1894 1634 1345 506 326 --34813 4307 1969 16292
NM_003645chr153261 250 189 ------
NM_003655chr171522 --1627 1310
NM_003659chr211239 --194 --
NM_003663chr3143508 3389 3367 2579 2566 2343 1311 1303 988 904 615 578 430 308 43185 2884 2443 980 11221 --
NM_003664chr51194 1142 2439 179 1218
NM_003670chr361457 1185 1084 1069 421 25 --21417 1381 --
NM_003671chr973479 3465 3414 812 456 390 107 23069 571 23427 2497 --
NM_003672chr191902 1596 1335 779 359 307 283 272 259 41946 1797 1266 451 31935 407 226 11544
NM_003675chr103428 405 204 --1419 --
NM_003681chr2134292 529 168 --26227 107 --
NM_003682chr112816 277 ------
NM_003686chr1182 ------
NM_003688chrX----1278 --
NM_003692chr94379 204 94 75 1693 2997 266 --
NM_003701chr131699 --1432 --
NM_003702chr81772 --1189 --
NM_003714chr553089 2952 2728 2448 2336 1879 12433 1694
NM_003716chr36980 861 825 775 733 306 ------
NM_003719chr53227 208 125 ------
NM_003722chr382671 2554 2132 2013 1955 1859 1789 1780 --32541 1773 1754 22601 677
NM_003725chr124431 418 295 157 ----1338
NM_003743chr271950 1879 895 866 793 284 162 --2555 68 --
NM_003744chr1441308 1267 831 238 21337 932 1525 --
NM_003745chr162349 51 1373 1379 --
NM_003746chr122222 209 ------
NM_003749chr1382263 2054 1906 1837 1687 1572 860 735 --12177 11766
NM_003750chr105988 775 723 398 68 --1334 --
NM_003759chr4134310 4040 4004 3582 3572 3409 3093 2656 1712 1685 1282 862 214 64211 4097 3293 2735 691 625 34290 3655 810 24277 3438
NM_003760chr13750 287 47 --1248 --
NM_003762chr15443 311 268 240 231 11429 2926 576 1326
NM_003763chr2073090 3001 2901 2488 2470 1986 355 --2494 277 --
NM_003764chr63720 648 592 --2753 637 --
NM_003769chr12251 30 --1224 1335
NM_003774chr12223395 3204 3149 2905 2881 2738 2506 2493 2430 2405 2394 2373 2275 2058 1047 847 660 647 626 485 426 193 32649 2513 85 42483 2386 2171 1302 --
NM_003778chr32239 137 ------
NM_003779chr11358 --1483 --
NM_003787chr18101603 1383 1249 1223 1213 537 225 193 116 80 41239 1157 473 204 11480 11139
NM_003794chr31387 ----1173
NM_003796chr192424 114 --1590 1182
NM_003798chr91132 ------
NM_003799chr18154543 3900 3543 3306 3126 1557 1141 1123 974 958 881 750 226 80 73 1998 ----
NM_003800chr6102362 2309 2277 2233 1842 1543 657 648 386 165 1821 11998 --
NM_003809chr171486 ------
NM_003811chr194578 240 184 89 ------
NM_003816chr821292 589 11520 31002 466 52 --
NM_003818chr2031081 690 135 ------
NM_003821chr84516 152 60 44 ------
NM_003822chr13336 167 26 52627 2470 2453 2092 128 ----
NM_003825chr1571282 525 374 368 293 274 203 11488 ----
NM_003829chr931165 941 229 --1159 11193
NM_003831chr1851828 1563 617 380 122 21529 386 --1429
NM_003838chr181420 1394 1161 514 390 222 203 60 21353 1100 1454 --
NM_003858chr142586 522 1279 1643 --
NM_003861chr1472804 2716 2416 2097 1950 1852 406 32422 2082 2063 12585 --
NM_003862chr51106 --175 --
NM_003864chr4--1185 ----
NM_003872chr242786 1993 773 290 ----1339
NM_003873chr1072391 2153 1650 1031 944 870 466 11560 12266 --
NM_003884chr371637 1580 739 711 590 548 409 3700 416 200 21735 519 21867 1793
NM_003885chr1782671 2661 2552 2445 2172 2115 2065 1923 ------
NM_003887chr282246 2199 2161 1999 1658 1436 623 546 41708 1683 392 257 22343 1835 1770
NM_003895chr21112123 1999 1912 1637 1562 810 744 499 364 255 29 1444 1520 2536 263
NM_003899chr1332609 2012 1778 ------
NM_003902chr14745 642 295 186 1340 2311 278 --
NM_003909chr8102911 2895 2738 2547 1230 1114 488 295 160 82 32179 2147 830 22749 965 1701
NM_003913chr6123733 3667 3261 2663 1567 1075 907 777 657 148 124 92 33763 972 577 13229 23752 3273
NM_003916chrX61508 1488 1435 1103 594 569 --21139 1061 1240
NM_003921chr181393 1313 1130 717 618 246 203 164 21680 267 2259 129 --
NM_003922chr152392 175 --172 --
NM_003927chr1831075 199 159 --1409 2972 418
NM_003929chr12550 347 ------
NM_003930chr762220 1870 717 539 391 231 32238 296 133 145 12477
NM_003932chr2291826 1536 1359 765 690 566 349 257 120 11425 21722 294 1481
NM_003934chr981186 1173 1091 1059 898 874 204 129 --2926 915 --
NM_003939chr10114049 3712 3097 2693 1514 1092 877 535 377 349 25 13792 ----
NM_003941chr7111994 1599 921 856 700 679 455 361 348 132 55 22215 1837 3253 114 29 --
NM_003942chr111153 ------
NM_003948chr431787 1644 653 1539 --1331
NM_003953chr162866 2846 2197 1966 1127 261 1626 --12879
NM_003955chr1751629 1579 1573 1526 1398 ------
NM_003956chr102479 371 2508 111 2460 85 --
NM_003957chr11----1745 --
NM_003961chr16------1209
NM_003966chr5157793 7297 6527 5808 5538 4834 2752 2115 2089 2040 1973 1797 1029 436 255 66146 5983 5222 5175 2405 295 17785 --
NM_003971chr17155 1516 ----
NM_003972chr1031156 546 174 1347 ----
NM_003980chr631300 908 397 11132 1269 1225
NM_003983chr16114316 4288 4012 3825 3451 3285 3168 1658 1280 510 283 2872 386 24383 3835 --
NM_003994chr12134317 4011 3879 3823 3770 3679 2984 2820 1745 1579 1376 1271 28 1248 --34394 3576 2919
NM_003995chr91213 --1246 --
NM_003998chr45665 577 541 531 476 1673 --1631
NM_004006chrX32572 2343 2017 32657 2207 418 1183 --
NM_004007chrX32572 2343 2017 32657 2207 418 1183 --
NM_004009chrX32572 2343 2017 32657 2207 418 1183 --
NM_004010chrX32572 2343 2017 32657 2207 418 1183 --
NM_004011chrX32572 2343 2017 32657 2207 418 1183 --
NM_004012chrX32572 2343 2017 32657 2207 418 1183 --
NM_004013chrX32572 2343 2017 32657 2207 418 1183 --
NM_004014chrX32572 2343 2017 32657 2207 418 1183 --
NM_004015chrX32572 2343 2017 32657 2207 418 1183 --
NM_004016chrX42486 2257 1931 1018 32571 2121 332 197 --
NM_004017chrX32572 2343 2017 32657 2207 418 1183 --
NM_004018chrX42486 2257 1931 1018 32571 2121 332 197 --
NM_004020chrX32572 2343 2017 32657 2207 418 1183 --
NM_004021chrX42486 2257 1931 1018 32571 2121 332 197 --
NM_004022chrX42486 2257 1931 1018 32571 2121 332 197 --
NM_004023chrX42486 2257 1931 1018 32571 2121 332 197 --
NM_004028chr1884060 1333 1282 1128 953 896 392 148 22797 249 42974 2912 976 215 --
NM_004036chr22545 48 1699 1621 --
NM_004040chr251268 1238 1120 1019 515 --1258 --
NM_004050chr1422726 2682 12592 ----
NM_004056chr83953 874 776 2923 820 --1853
NM_004060chr53906 471 316 --11242 --
NM_004064chr1261239 954 526 469 381 355 --2905 862 --
NM_004067chr7121511 1470 1295 1196 1136 1060 1023 628 591 457 428 352 21324 435 21530 1176 --
NM_004071chr2175 ------
NM_004081chrY21608 507 1696 ----
NM_004086chr146796 697 668 627 553 188 ----182
NM_004087chr321967 1536 --11739 --
NM_004093chr1393067 3039 2426 2308 2074 2011 1137 1102 27 23183 3152 23280 3130 --
NM_004094chr1493001 2596 2486 2471 1155 1098 1058 841 418 32965 2788 496 1109 --
NM_004096chr1051389 1366 831 545 43 --22070 729 11935
NM_004097chr21318 ------
NM_004098chr1031257 1177 918 --21285 1212 --
NM_004099chr931921 792 229 11716 1366 --
NM_004100chr682163 2131 2065 1644 823 206 117 36 ------
NM_004105chr22918 420 21055 70 11074 11023
NM_004109chr1172332 2191 1623 589 530 180 43 42374 2276 485 122 31762 250 23 --
NM_004113chr341913 1896 1401 615 2458 352 ----
NM_004114chrX21223 1007 --1276 --
NM_004124chr14143541 3301 3144 3041 2981 2900 2879 2745 1395 1216 1207 1013 228 69 23294 776 22956 871 1945
NM_004133chr882601 2518 2348 1919 1831 664 235 135 2544 334 32488 2430 612 --
NM_004136chr1553285 2835 2662 785 715 --32555 2515 829 1270
NM_004139chr202332 265 ------
NM_004156chr82554 544 1423 ----
NM_004161chr251636 1511 1218 604 258 11063 21042 301 --
NM_004162chr351186 1146 944 932 434 31178 867 142 ----
NM_004163chr18148 1135 1431 --
NM_004170chr991501 1438 1421 1395 758 690 682 143 135 11151 1324 --
NM_004171chr11209629 9246 8148 7976 7857 7390 7094 6675 6138 3515 3322 3014 2971 2649 2116 1835 1473 913 891 104 1741 57830 7617 7081 6779 939 36060 3298 199
NM_004172chr552036 2023 1426 1363 1246 --11723 --
NM_004177chr1141815 660 406 364 11839 21534 706 --
NM_004180chr22160 68 ------
NM_004207chr17--168 ----
NM_004209chr1621141 1069 ------
NM_004215chr81469 185 ----
NM_004225chr831208 461 139 1576 11504 --
NM_004226chr21210 ------
NM_004227chr763071 2949 2846 2686 2290 595 11108 32884 2579 579 1867
NM_004229chrX82037 2030 1988 1980 1835 1775 903 507 1434 21368 691 --
NM_004232chr18103690 3319 2880 2818 2783 2674 2462 1420 1368 181 33273 690 511 43484 3219 2455 1060 --
NM_004233chr63663 646 491 ------
NM_004235chr96845 801 793 573 58 51 --1553 1893
NM_004241chr103734 713 289 --2557 22 --
NM_004242chr64345 300 76 63 --1161 --
NM_004244chr122533 426 1433 1372 --
NM_004253chr96955 909 862 735 722 324 --126 --
NM_004261chr13927 869 659 1907 1245 --
NM_004264chr1271121 1023 831 485 334 153 136 11256 ----
NM_004272chr571810 1413 1276 675 610 378 157 32016 1741 1295 32036 1750 481 --
NM_004274chr1452203 2165 783 701 418 12509 1904 --
NM_004276chr121414 ------
NM_004277chr681615 1536 1522 1443 1379 643 574 146 11155 ----
NM_004279chr762299 1820 1478 732 354 260 --2208 116 --
NM_004280chr63464 386 328 ------
NM_004282chr63561 520 244 162 --1183
NM_004285chr196440 5985 5436 5306 4675 3942 1553 805 39 35356 4859 2131 16081 --
NM_004290chr551354 1259 1020 290 82 --1142 --
NM_004291chr53293 106 43 ------
NM_004293chr9153800 3507 3122 3007 2874 2478 1545 1536 1255 1248 1187 1092 772 617 320 2783 246 52548 1339 662 420 364 1852
NM_004301chr32314 114 --3347 265 246 --
NM_004304chr24293 283 148 121 ----1160
NM_004311chr1062983 2931 2813 2767 2511 72 --22233 1971 --
NM_004319chr183016 2773 2156 2069 845 260 248 231 22406 657 186 --
NM_004326chr18401 289 267 233 219 129 84 63 1496 ----
NM_004329chr1021400 342 31010 487 220 1993 21465 1046
NM_004330chr153983 947 320 --3381 360 90 1235
NM_004331chr862503 2077 1820 895 880 793 12624 1824 2575 153
NM_004337chr882258 2228 2028 894 709 623 307 276 --1683 --
NM_004338chr18146865 6681 6641 5412 5190 5126 4946 4511 2107 1587 883 720 606 470 46702 5446 5369 1053 46979 5320 1269 279 --
NM_004342chr792317 2038 1941 1932 1616 761 552 158 118 --32219 1979 737 1835
NM_004346chr431537 1179 60 2460 115 --1599
NM_004349chr841262 1236 298 128 ----1346
NM_004354chr47738 297 256 233 162 155 31 3705 694 214 --1815
NM_004360chr1631948 1541 638 ------
NM_004365chr52334 56 1340 ----
NM_004370chr672127 2066 2036 1734 1573 760 576 1251 11585 12136
NM_004379chr271207 1182 1171 577 245 155 84 11274 ----
NM_004380chr1662592 2565 1964 1673 639 369 --2356 157 --
NM_004382chr1711048 ------
NM_004383chr151405 ------
NM_004384chr5142255 2128 1921 1828 1576 1563 1472 1463 768 747 729 457 231 135 11701 52141 1818 490 128 91 22075 811
NM_004388chr11292 --2423 90 --
NM_004392chr1352474 2461 2089 1771 959 11744 22340 581 12111
NM_004393chr371607 1599 637 616 558 216 210 ------
NM_004396chr171293 ------
NM_004397chr11144044 3696 3547 3383 3259 3238 2887 2829 1380 1328 1158 982 576 100 23965 3535 22850 1052 11731
NM_004398chr112491 460 --2415 170 --
NM_004404chr272008 1845 1503 638 510 303 184 12024 11949 --
NM_004407chr431007 873 657 --2860 118 --
NM_004411chr74749 724 274 215 1715 2172 114 --
NM_004414chr2141519 1452 1313 293 --41550 1397 1338 1270 --
NM_004415chr64775 620 546 117 1644 1753 --
NM_004423chr362670 2137 2005 1692 495 82 12606 ----
NM_004430chr852559 2467 2085 1984 1099 12774 52499 2436 2180 2097 2042 --
NM_004431chr15820 810 589 552 40 --1583 --
NM_004432chr9112413 2190 2140 1910 1898 1836 1808 1632 663 522 477 --41710 831 730 716 --
NM_004434chr1441773 1472 626 388 11847 ----
NM_004438chr2103196 3173 3003 2884 2720 2377 1158 709 382 235 12774 22939 2465 --
NM_004440chr641846 1701 1429 336 11669 51994 1660 1380 692 382 11837
NM_004447chr123967 781 173 2272 235 2225 54 21049 905
NM_004451chr112706 613 1696 ----
NM_004454chr352311 1824 1606 1596 734 1700 12236 11871
NM_004457chr271607 1391 616 556 468 235 58 1217 11628 --
NM_004458chrX92569 2563 2338 2289 1875 683 662 300 278 42257 2202 1064 168 12433 12523
NM_004459chr1751796 1783 1693 1323 453 160 ----
NM_004464chr4163887 3228 2871 2858 2723 2637 1556 1528 1516 992 466 359 307 275 260 105 42770 1622 476 244 3458 398 379 --
NM_004466chr132751 102 1639 ----
NM_004482chr24931 835 772 352 ------
NM_004484chrX288 78 ------
NM_004487chr361270 1110 924 423 265 193 ------
NM_004491chr1964306 3912 3905 3895 3442 3356 14096 13957 --
NM_004496chr1451160 862 403 392 123 21217 176 11284 --
NM_004498chr152103 93 ------
NM_004500chr1481901 1789 1414 827 694 595 496 234 1703 1773 12039
NM_004501chr194142 4118 3817 3182 1642 1284 1146 314 31 22873 1374 11417 13120
NM_004503chr123851 831 645 ------
NM_004504chr232792 2035 1096 22873 965 33088 1163 293 12785
NM_004505chr1761317 1293 562 526 170 64 1107 ----
NM_004514chr1732638 819 424 --13091 --
NM_004516chr1951271 1176 785 320 251 1340 ----
NM_004520chr53274 249 173 1714 ----
NM_004521chr103368 351 341 ------
NM_004523chr1041287 1268 567 28 ------
NM_004525chr241490 1454 408 257 31549 1432 91 41468 173 108 53 --
NM_004529chr961390 1366 1242 1127 471 161 ------
NM_004535chr2031396 1341 244 --11352 --
NM_004540chr214911 867 841 327 --1936 --
NM_004561chr111695 11837 1731 --
NM_004566chr1082336 2325 2313 2036 1783 1754 694 148 --32552 2299 2177 --
NM_004569chr143670 568 173 1216 1625 --
NM_004571chr2172750 2469 1302 693 680 608 572 ----12120
NM_004574chr17123 ------
NM_004575chr4101626 1558 1401 1247 1235 1214 598 492 462 410 --1552 --
NM_004578chr13869 766 366 --1236 --
NM_004580chr15101674 1607 1566 1546 1477 1426 1419 1176 218 182 --11146 --
NM_004582chr1--1170 199 --
NM_004583chr171732 ------
NM_004586chrX175272 5243 5029 4462 3990 2142 2103 1200 1018 899 841 649 497 336 322 149 21 34222 3701 1113 35113 3945 822 25302 3711
NM_004591chr23350 301 172 ------
NM_004592chr121180 ------
NM_004593chr35886 590 235 189 137 --160 --
NM_004595chrX2339 131 --1165 --
NM_004598chr573348 3296 2557 1168 630 479 225 --43240 2498 2442 2364 --
NM_004599chr221676 ------
NM_004600chr13965 955 280 11197 21503 980 1601
NM_004602chr2081459 1435 1174 934 597 557 477 65 ------
NM_004607chr5165 1189 --1196
NM_004612chr9184559 4280 4039 4012 3919 3834 3811 3723 3346 2967 1934 1919 1730 1112 1001 984 573 248 23853 995 23475 955 14363
NM_004615chrX2796 311 1777 2881 742 --
NM_004619chr14861 738 554 234 --1227 21717 379
NM_004622chr272335 2183 1759 703 612 362 115 2490 469 41981 909 475 370 --
NM_004626chr113507 471 138 1607 --1564
NM_004627chr211701 1685 ----
NM_004631chr151447 1416 1371 563 349 --1428 1512
NM_004642chr121724 ------
NM_004643chr143804 528 184 --1116 --
NM_004650chrX51900 1245 136 128 117 11921 21703 1579 --
NM_004651chrX1335 ------
NM_004654chrY51394 1260 1036 376 334 --21299 558 --
NM_004655chr172855 373 1422 21407 526 11245
NM_004657chr241527 1457 1204 1125 11306 --11171
NM_004660chrY62138 2015 1749 1726 1516 337 1245 31866 1703 709 --
NM_004663chr1571525 1369 1241 1230 259 109 68 21533 1477 ----
NM_004666chr641394 1346 1033 200 11059 ----
NM_004670chr1051704 1668 1571 260 55 21716 1303 31617 348 71 1505
NM_004673chr151205 473 329 267 43 1217 1383 1301
NM_004677chrY1153 --2457 423 --
NM_004681chrY2245 127 --1308 1200
NM_004685chr13152948 2760 2685 2250 2148 2090 1964 1208 1103 846 627 475 448 422 390 --32804 946 431 --
NM_004687chr1771629 1594 1480 1469 1418 718 591 11761 ----
NM_004689chr142351 342 ------
NM_004690chr66805 729 636 283 266 257 ----1128
NM_004696chr13835 792 302 ------
NM_004698chr11212 ------
NM_004703chr1782339 995 952 732 553 519 291 128 1394 21826 945 1468
NM_004705chr113844 38 31 --1345 --
NM_004709chrX21140 44 31707 1208 25 ----
NM_004711chr22----13416 --
NM_004713chr144769 758 709 24 ------
NM_004719chr1262677 2084 1978 1862 515 119 12443 52892 2124 1933 1790 1757 12420
NM_004721chr31278 1245 ----
NM_004723chr1----1729 --
NM_004725chr1061282 1200 1104 1007 495 473 11089 11366 --
NM_004726chrX185637 5506 5236 4812 4792 4394 3724 3614 2003 1781 1656 1610 817 767 395 381 250 186 45428 4311 1002 990 25454 407 35559 4372 3765
NM_004729chrX72116 1848 1556 1535 1485 597 67 --154 --
NM_004730chr572203 1943 1889 1738 1437 416 270 1305 --1356
NM_004733chr34610 544 464 162 2593 98 1173 --
NM_004734chr1392989 2801 2703 2685 2302 2154 1149 1054 216 --12895 --
NM_004736chr162116 1965 565 538 222 208 42156 1471 844 801 12028 --
NM_004738chr2062554 2210 1990 711 627 464 ------
NM_004741chr1051537 1454 614 234 52 ----1310
NM_004742chr361601 1580 1282 1264 1152 355 --11540 --
NM_004744chr4103944 3761 2805 2740 1331 931 701 507 398 53 52811 1529 859 732 579 13087 --
NM_004745chr8176934 6832 6165 5732 5677 5206 2792 2705 2391 1852 1752 1507 1099 857 818 351 198 36862 6655 6480 --26969 1829
NM_004747chr1021596 479 1221 11347 11224
NM_004748chr15174034 3948 3086 2975 2940 2896 2717 1668 1637 1450 1397 623 526 449 410 297 234 53924 2825 1126 987 76 23328 1303 --
NM_004755chr146986 878 835 822 480 364 2849 786 176 21118 1053
NM_004756chr1911516 ----11360
NM_004757chr43538 241 62 ------
NM_004759chr122008 1609 --1687 --
NM_004760chr7112372 2075 2049 1937 1857 1787 881 789 424 297 221 1545 22303 533 --
NM_004762chr1731871 450 147 --1771 --
NM_004772chr52613 565 31580 1571 130 11090 1455
NM_004774chr1722915 248 32592 811 578 33076 804 333 1600
NM_004775chr18132329 2304 2284 2230 2176 1997 1991 1939 1933 1905 1773 1708 892 --41898 1608 335 313 12133
NM_004779chr571294 1116 910 844 526 88 65 1169 ----
NM_004780chrX1539 1128 ----
NM_004781chr151202 676 487 448 337 ------
NM_004781chr151202 676 487 448 337 ------
NM_004787chr42122 43 ------
NM_004788chr1162681 1006 867 415 390 217 12482 22374 907 --
NM_004789chr93440 383 291 173 1338 --
NM_004791chr13133 ------
NM_004795chr132602 555 41861 1640 1494 632 21506 336 --
NM_004796chr1472431 2407 2379 2202 2020 1917 621 11640 1776 11589
NM_004797chr373739 3446 3158 2601 1069 929 250 13620 12973 13037
NM_004798chr2063601 3573 3441 3105 2602 2571 --12907 --
NM_004800chr131220 ------
NM_004801chr271309 1199 1101 977 971 631 77 ------
NM_004808chr103631 287 49 --12070 --
NM_004815chr1194876 4849 4744 4070 4055 3973 3817 1232 1198 1117 965 927 702 530 501 368 261 226 44 43941 1612 802 757 13207 --
NM_004824chr661479 1358 1274 1250 1072 556 1225 1919 1965
NM_004830chr66814 736 687 360 340 132 --1189 --
NM_004831chr19--1708 ----
NM_004834chr243172 2863 952 560 23185 2715 11175 --
NM_004835chr34860 324 310 97 1866 ----
NM_004835chr34860 324 310 97 1866 ----
NM_004836chr25852 792 609 196 124 --1336 --
NM_004841chr151146 1026 875 830 306 --1188 --
NM_004842chr681723 1484 1445 1347 1310 1143 638 616 31227 1106 374 31418 550 133 --
NM_004844chr351193 1187 1026 1011 981 --1480 11112
NM_004845chrX83993 3732 3713 2823 1195 796 693 314 23738 590 ----
NM_004849chr661604 1565 1148 653 191 175 ------
NM_004850chr251491 1291 1179 710 531 11222 1102 --
NM_004856chr151221 ------
NM_004857chr14124630 4578 4043 3919 3263 1787 1654 1470 1304 472 424 280 13461 23105 1887 24219 1805
NM_004859chr1751952 1911 693 203 32 --12056 11164
NM_004860chr171556 ------
NM_004865chr61318 ------
NM_004866chr5214853 4721 4704 4503 4040 3862 3802 3663 3341 3188 3173 3133 1694 1682 1635 1432 1069 468 304 188 111 31795 1782 167 64773 3743 1949 572 242 73 23827 3238
NM_004867chrX191 ----1123
NM_004869chr1851702 1209 292 153 22 21369 374 51376 558 380 337 54 21411 1312
NM_004871chr1794347 4306 3579 3434 2976 1632 1617 385 247 --24214 2954 --
NM_004873chr14113202 3063 3019 2896 2876 2769 2618 1989 723 146 95 12745 11274 --
NM_004874chr83439 427 134 ----1167
NM_004879chr114835 679 390 251 ------
NM_004884chr1521340 1217 ------
NM_004887chr551160 925 747 740 265 --1313 --
NM_004891chr21222 ------
NM_004896chr1041179 339 259 204 21256 155 41474 1214 502 425 --
NM_004897chr102616 56 --2788 593 --
NM_004898chr492735 2672 2073 2027 1962 1155 984 888 508 1924 41988 958 759 251 --
NM_004902chr202797 287 --1757 --
NM_004904chr7276401 5488 5430 5031 4827 4669 4652 4502 4280 4172 4084 4066 2551 2431 2112 2081 2067 1988 1837 1652 1505 1499 1139 811 674 229 162 32283 1908 1512 15465 45754 5394 4818 2255
NM_004905chr13908 894 302 --1649 --
NM_004906chr63269 226 191 --176 --
NM_004912chr7101656 1511 1412 1345 1182 1140 590 449 385 83 ------
NM_004921chr1132490 2398 2329 2238 2232 2056 2020 1923 1716 820 424 215 147 11706 2686 483 11975
NM_004922chr1011019 ------
NM_004926chr1411226 21449 1388 21202 281 --
NM_004927chr1131471 1103 441 ------
NM_004929chr881366 1180 1012 468 431 264 217 81 1400 1987 --
NM_004932chr561672 1629 1312 1126 197 65 1391 11748 --
NM_004938chr971192 1002 834 782 468 398 232 ------
NM_004946chr5--2424 403 ----
NM_004947chr31217 12496 1273 --
NM_004949chr1862090 2084 2023 1793 1452 831 41581 1402 684 586 31642 862 407 11464
NM_004953chr31310 ------
NM_004956chr7144544 4494 4488 4470 4282 4236 4022 3668 3438 3167 1511 1106 582 266 3588 364 101 23459 775 --
NM_004960chr16166 ------
NM_004964chr11539 --173 --
NM_004965chr213620 204 79 --2166 66 --
NM_004966chr106984 407 378 332 238 203 1693 ----
NM_004968chr72729 613 ------
NM_004969chr101442 --1193 1220
NM_004972chr931118 1027 57 1731 ----
NM_004973chr681724 1596 1527 1244 1147 478 177 69 --136 --
NM_004985chr12134320 4275 3853 3214 3183 2987 1769 1393 1225 1185 770 297 142 44267 2811 1457 148 34492 4191 598 11405
NM_004992chrX168411 8347 7495 7225 7114 6201 5584 5417 5404 5372 3306 2766 2737 2139 1850 943 18302 1117 --
NM_004992chrX168411 8347 7495 7225 7114 6201 5584 5417 5404 5372 3306 2766 2737 2139 1850 943 18302 1117 --
NM_004993chr1431197 590 457 1982 134 --
NM_004995chr14----11528 --
NM_004996chr1631654 1267 435 ----11781
NM_004999chr6102927 2906 1805 1407 1238 1114 654 526 193 46 21198 472 34467 2804 350 --
NM_005006chr24875 792 355 121 ------
NM_005010chr741573 680 593 553 11987 62003 1879 1530 371 199 104 --
NM_005011chr731704 1689 280 ------
NM_005013chr11------198
NM_005021chr61102 --1317 --
NM_005022chr17182 ------
NM_005023chr531479 1447 508 1434 11037 11367
NM_005025chr3167 ------
NM_005030chr161243 ------
NM_005032chrX31004 786 396 --3925 854 756 --
NM_005034chr84473 455 422 37 --1492 --
NM_005036chr22148366 7952 7418 6500 6322 5960 5450 5145 1441 1248 610 550 494 176 36626 1775 300 36039 5849 2910 17194
NM_005037chr31171 1133 ----
NM_005045chr72998 657 1681 1673 --
NM_005054chr281768 1700 1592 1582 1243 462 155 55 31762 1530 182 21788 1677 --
NM_005056chr12185642 5613 4446 4250 4116 3909 2214 1935 1648 1545 1484 1440 1393 723 515 470 253 28 23871 1560 35433 5010 1124 --
NM_005057chr141791 502 307 280 1766 11775 11243
NM_005065chr14155038 5027 4928 4669 3905 3454 3357 3339 2052 1830 1510 1230 706 568 164 31756 931 577 45216 3468 1444 893 --
NM_005066chr13576 214 128 ------
NM_005068chr621143 47 --11432 --
NM_005069chr2141599 1102 545 460 21246 1228 11705 --
NM_005076chr134168 3069 2724 22820 125 --1160
NM_005077chr93482 442 136 ------
NM_005078chr1521575 1314 --11871 --
NM_005079chr8153200 3008 2702 2566 2431 2319 2214 2062 1156 1108 732 467 400 366 102 1312 2546 510 --
NM_005086chr1231150 492 178 11704 31403 136 128 21337 661
NM_005087chr32573 270 --1173 --
NM_005093chr2045245 4943 3506 1536 1688 --14207
NM_005095chr172259 2088 1566 882 391 268 23 --1298 --
NM_005099chr141091 946 533 512 --11220 --
NM_005102chr21190 2775 700 ----
NM_005105chr172079 2022 1978 716 238 175 97 --22043 439 --
NM_005108chr321918 1441 ------
NM_005109chr332426 1693 832 12550 ----
NM_005113chr143435 412 395 1105 ----
NM_005114chr44672 662 489 120 --1167 --
NM_005116chr2064575 4522 4384 4378 3120 2798 34564 4506 3278 24312 2830 23497 3476
NM_005121chr17193687 3422 3316 3009 2879 2833 2667 2322 1405 1150 1092 1060 1028 996 934 612 598 482 172 1537 33796 3243 903 12563
NM_005123chr121115 ----1326
NM_005124chr64936 687 70 51 1648 1929 1232
NM_005125chr111155 ------
NM_005126chr362267 1688 1659 844 596 63 ----1859
NM_005128chr214693 649 488 93 143 ----
NM_005151chr1882453 1856 1845 1778 1656 888 718 23 32186 916 260 11771 --
NM_005153chr163666 587 252 ------
NM_005154chr156534 515 496 425 414 64 ------
NM_005156chr9145318 5009 4777 4517 4504 4463 4424 4365 3740 1441 1012 943 852 368 13460 35242 5115 3664 1134
NM_005157chr911965 11558 --11777
NM_005159chr1572084 1481 874 365 238 143 51 3550 473 152 1342 11966
NM_005160chr22176771 6474 6356 6233 5852 5472 5379 5271 2694 2585 2395 2208 1979 1495 1441 1424 530 15562 55338 4939 1362 1061 502 --
NM_005164chr1272563 2545 2337 1820 1700 975 966 1895 32604 662 590 32460 2444 2170
NM_005166chr191234 ------
NM_005168chr211613 --41751 1580 1558 1286 --
NM_005171chr1241166 984 855 504 21085 816 21035 22 --
NM_005174chr101104 ------
NM_005178chr191420 ------
NM_005180chr10131606 1547 1520 1489 1342 1335 1269 1190 679 540 509 417 111 31149 1058 628 11600 --
NM_005181chr83715 686 173 --1302 --
NM_005184chr191368 ------
NM_005188chr11118216 6831 6029 5943 5809 5150 3210 2853 2775 589 311 28071 196 88340 7984 5999 3038 2829 2585 1704 1208 --
NM_005190chr62282 134 ------
NM_005194chr20----2534 178 1155
NM_005197chr14135918 5822 5374 5210 4470 3902 1542 1481 1375 1072 623 198 147 15047 14655 --
NM_005203chr102369 50 1399 1139 --
NM_005204chr102991 872 --1946 --
NM_005207chr2283712 3687 3254 2855 1118 746 417 28 11151 23662 3379 --
NM_005214chr24817 363 82 31 --21117 1085 --
NM_005224chr193690 559 466 2630 451 ----
NM_005227chr11506 ------
NM_005229chrX4960 886 837 278 --11299 --
NM_005230chr123635 545 498 --1425 --
NM_005231chr113974 155 148 11293 2175 163 --
NM_005233chr3102284 2111 2016 1949 638 484 425 219 205 168 22497 2209 52619 2593 2180 807 393 --
NM_005235chr2267768 7485 7271 7215 7029 6620 6577 6473 6324 6302 6212 6141 5891 5714 5361 5301 5137 4991 2997 2973 2574 1787 1338 697 684 437 47665 5918 1539 794 67854 7570 7559 5952 991 835 32888 1570 769
NM_005238chr11103373 3303 3289 2957 2803 1179 949 599 98 91 33558 3485 577 33320 3231 2734 --
NM_005241chr351409 1311 1233 550 430 1857 21325 193 11113
NM_005242chr521411 1400 21470 1282 --1353
NM_005243chr223135 83 44 1128 ----
NM_005249chr144741 704 256 84 --1669 --
NM_005252chr142675 492 1689 1682 --
NM_005254chr1561351 1343 1081 1013 529 31 31257 1234 171 --1964
NM_005256chr114828 610 167 159 1359 2838 736 --
NM_005257chr1831410 125 63 1935 --11258
NM_005259chr271413 1384 1293 1093 1005 467 364 21391 1287 21178 1015 1331
NM_005261chr881050 951 939 902 855 718 275 83 --1749 --
NM_005264chr10--1241 1885 --
NM_005271chr1041205 774 360 239 1465 ----
NM_005273chr7--1316 1332 --
NM_005281chr12716 622 ------
NM_005284chr62431 361 --1454 --
NM_005295chr7----2268 223 196
NM_005296chrX31022 833 326 1414 2852 778 --
NM_005302chr73417 163 156 1360 173 --
NM_005308chr101375 --1414 --
NM_005310chr171380 ------
NM_005311chr792817 2757 2304 2147 2056 1135 915 612 376 --22452 669 --
NM_005313chr152334 270 11081 ----
NM_005316chr1171160 910 839 721 350 329 154 --11075 1293
NM_005318chr2241170 1113 222 45 --1229 --
NM_005324chr1731584 229 107 1528 21620 49 --
NM_005327chr41229 ------
NM_005328chr83629 489 146 1561 --2765 304
NM_005329chr1672313 2298 2140 1905 1715 1444 643 2860 569 ----
NM_005333chrX81233 1062 882 353 337 275 62 35 ----21243 430
NM_005334chrX21761 1580 ------
NM_005339chr4144008 3981 3863 3451 2850 2729 1426 1076 1006 903 833 458 452 66 2996 282 1353 1213
NM_005342chrX62638 1804 792 763 226 33 --1645 --
NM_005358chr13101685 1585 1557 1505 1321 629 579 492 176 97 1345 21180 284 --
NM_005359chr18146422 6257 5793 2547 2524 2446 1631 1038 921 856 621 451 421 83 32396 1525 101 126480 6004 5099 5075 4855 4631 4611 1269 1031 951 741 558 15423
NM_005370chr193879 339 219 1161 ----
NM_005375chr631150 327 105 21188 303 1416 --
NM_005378chr23842 632 96 1683 1639 1598
NM_005384chr91237 ------
NM_005385chr352753 2537 2157 553 420 2685 292 32661 748 192 12223
NM_005387chr113637 457 439 1465 ----
NM_005388chr961641 1278 600 426 277 64 --31694 1623 1167 --
NM_005389chr63814 568 167 1274 --1290
NM_005392chr941895 1761 1468 1207 11397 11174 --
NM_005397chr7--13010 34000 3024 2960 --
NM_005398chr1061424 1206 1139 1055 450 231 --21408 248 --
NM_005399chr1114301 4292 4257 4215 3793 3778 3273 1063 945 146 98 32814 1732 195 11699 --
NM_005400chr272255 1976 1912 1105 1020 1000 595 12835 1711 12952
NM_005401chr12246 183 1165 ----
NM_005402chr751733 1679 1557 1530 1413 3534 163 93 ----
NM_005406chr1861632 1568 1292 1055 996 146 1501 1259 1617
NM_005410chr5--2511 269 1186 --
NM_005412chr122569 86 ------
NM_005418chr113470 256 229 ------
NM_005430chr121971 ------
NM_005433chr1822447 1951 --32615 2490 525 --
NM_005436chr10133255 3225 3197 3182 3135 2805 1530 1481 1279 1239 874 581 87 --2535 370 21325 915
NM_005438chr113623 606 245 ------
NM_005439chr121520 ------
NM_005445chr10187 2278 236 ----
NM_005455chr171668 1379 673 612 506 374 231 21417 36 51494 1483 1142 738 159 --
NM_005460chr53584 525 385 ------
NM_005461chr2081993 1787 1654 1585 1483 1235 683 388 ------
NM_005465chr112053 11784 ----
NM_005466chr142469 123 186 ----
NM_005474chr1741569 1535 1304 51 --11260 --
NM_005475chr1222948 664 --13024 --
NM_005484chr14------183
NM_005487chr2272153 2123 2050 1895 1481 364 175 ------
NM_005491chrX22038 1347 ------
NM_005493chr62738 190 ------
NM_005497chr17155799 5622 5057 4868 4625 4187 1964 1954 1312 1082 676 437 316 268 27 --66097 3916 1486 979 740 378 14044
NM_005502chr9133252 3111 2557 2299 2065 1231 1153 1147 1037 1018 785 736 633 --42832 2724 2154 1289 12270
NM_005503chr151238 ------
NM_005504chr12126551 6518 5882 5046 4892 4748 2639 2021 1655 1205 863 296 15565 35340 2174 1541 11701
NM_005509chr581771 1759 1694 1626 1251 1149 728 116 1122 51466 1332 1166 294 101 21884 1811
NM_005513chr351386 1359 518 424 239 11306 11460 1230
NM_005519chr101157 --1515 --
NM_005520chr54651 492 281 231 --1486 --
NM_005521chr10--1274 ----
NM_005522chr771368 1348 1142 876 254 152 71 --31236 922 523 --
NM_005523chr751231 1219 1160 1092 482 11058 ----
NM_005526chr81278 ------
NM_005536chr871310 1193 1074 1029 963 89 34 31366 220 142 ----
NM_005537chr132860 323 2366 343 199 --
NM_005540chr141610 279 269 262 122 11054 11594
NM_005542chr751946 1448 1272 435 321 --11570 --
NM_005544chr24833 783 706 87 1164 ----
NM_005546chr572374 2357 1999 871 709 370 358 ------
NM_005561chr133828 822 231 --1206 --
NM_005563chr15669 634 314 231 78 ----1100
NM_005566chr111448 ----1110
NM_005570chr1861137 1026 797 791 411 21 ------
NM_005573chr5196 --189 --
NM_005574chr11--1698 ----
NM_005575chr54692 556 262 152 1772 --1837
NM_005578chr3154859 4830 4818 4772 4625 4363 4177 4165 3895 3430 1971 1862 1340 1084 392 54042 3557 1760 1491 494 44983 4531 1472 709 --
NM_005581chr191322 ------
NM_005584chr136787 751 673 581 524 138 ------
NM_005585chr152318 171 --1287 --
NM_005587chr153873 93 25 1977 --1814
NM_005593chr122551 421 --2498 191 --
NM_005595chr13945 939 859 ----1158
NM_005596chr9156416 6270 5914 5441 4279 2391 2378 1987 1879 1811 1760 1330 991 436 316 16082 64922 4774 1939 1751 1619 845 24266 409
NM_005598chr111205 ------
NM_005599chr131308 1270 580 21475 1396 11491 11065
NM_005602chr311117 --4924 888 377 301 --
NM_005603chr1821273 46 11392 22004 1335 --
NM_005604chr682537 2361 2290 2116 1944 630 417 108 21772 636 32476 2324 572 22556 1864
NM_005611chr1641326 1271 968 429 --1979 --
NM_005613chr152185 1507 1470 789 630 22025 94 ----
NM_005618chr63474 424 258 --3642 549 445 --
NM_005623chr175401 164 140 116 52 189 ----
NM_005626chr1----1441 --
NM_005627chr651015 860 682 675 647 ------
NM_005632chr16--11026 1980 --
NM_005637chr1862043 2007 1791 1371 773 521 --2416 355 --
NM_005639chr1251348 732 698 573 126 1380 11703 --
NM_005644chr13415 373 47 --1116 198
NM_005647chrX73485 3139 3125 2409 1001 696 532 22156 924 11022 --
NM_005655chr841299 338 311 70 31315 947 320 1251 --
NM_005665chr1123755 3144 3037 1606 1565 1201 1121 1050 987 840 834 670 --14526 33374 381 149
NM_005667chr2--1436 ----
NM_005668chr5163731 3592 3266 3245 3181 2916 2822 1755 1209 1004 976 832 623 567 470 47 24204 4188 51570 1537 1242 640 189 43955 3236 1424 1265
NM_005669chr551617 1472 876 233 158 2322 87 --1604
NM_005684chr1191 ------
NM_005688chr331353 935 333 1361 1168 --
NM_005707chr1541335 1303 1294 1195 --1137 --
NM_005711chr53926 782 245 3958 932 199 ----
NM_005715chr682731 2674 2525 2465 2423 2323 386 92 21865 1018 22077 1751 --
NM_005717chr171267 1059 846 473 419 345 123 ------
NM_005721chr28961 934 855 807 762 381 335 212 --4994 398 389 270 1143
NM_005722chr272477 2283 908 666 617 291 243 --137 --
NM_005725chr131652 1598 805 31721 1690 798 32390 764 639 22445 240
NM_005730chr1283623 3313 3025 2306 1297 1147 967 611 --23613 1235 11324
NM_005734chr113563 266 95 ------
NM_005737chr2102467 2387 2332 2260 2050 1892 1133 763 723 134 ----12424
NM_005738chr762022 1906 1351 691 625 507 ----11334
NM_005739chr1542421 1734 886 393 1111 1471 --
NM_005746chr782644 974 915 863 471 398 368 356 2888 345 1999 --
NM_005748chr12143378 3333 2898 2817 2647 2218 1252 1227 1042 752 639 613 494 272 12393 42911 2732 2202 1137 1832
NM_005749chr174680 655 566 543 1179 --1197
NM_005751chr73472 433 74 ------
NM_005752chr1631202 871 794 1800 11120 --
NM_005754chr591247 1174 1037 994 936 388 380 278 131 11094 1436 1222
NM_005759chr2124604 4462 4301 3993 3946 3550 3448 1861 1782 1547 990 968 --24528 3268 13439
NM_005765chrX3821 214 133 177 1668 196
NM_005776chr144748 613 590 136 3695 619 117 ----
NM_005778chr31417 ------
NM_005779chr583616 2797 2630 2549 2501 1263 818 721 --13206 --
NM_005780chr133997 792 681 --1724 --
NM_005783chr23514 431 231 1565 ----
NM_005785chr1221730 297 11524 ----
NM_005786chr183216 181 147 --2986 139 --
NM_005789chr1741925 1649 1354 1320 ------
NM_005795chr2122968 2907 2896 2852 2734 2238 2227 2080 1213 1173 1085 886 42270 1201 1179 945 12354 22554 1098
NM_005802chr94784 753 642 537 1660 1324 2737 124
NM_005806chr2151292 1264 1097 1087 889 1826 ----
NM_005807chr12655 205 --1595 --
NM_005808chr373293 3228 3150 2749 2636 452 231 52401 2383 749 419 175 12454 --
NM_005813chr262608 2571 2149 1995 923 255 22545 1050 32473 2400 52 --
NM_005819chr163002 2477 2462 2205 2167 594 --11262 11164
NM_005822chr64856 832 497 236 12294 21686 48 --
NM_005828chr17145057 4740 4544 4235 4016 4009 3763 1933 1802 1781 908 485 283 112 24561 1728 35073 4845 4828 --
NM_005832chr381282 1170 1118 1048 549 503 491 249 --2417 375 11084
NM_005839chr11385 --1789 1231
NM_005840chrX176894 6492 6245 5230 5022 3043 3013 3005 2949 2312 2179 2169 1399 886 653 560 554 77064 5686 4727 2825 2370 1198 1035 --12928
NM_005841chr461132 1043 1000 954 802 748 11067 --1966
NM_005842chr136659 623 584 494 292 173 2665 644 1142 --
NM_005843chr2101931 1814 1795 1768 1633 1481 569 400 319 254 21966 439 2498 233 --
NM_005853chr163573 530 63 ------
NM_005857chr181357 1204 1172 1080 1040 986 434 296 --11389 --
NM_005859chr541508 1063 978 573 --31559 999 512 1491
NM_005862chr32675 387 --1375 --
NM_005868chr792449 1916 1904 1682 1629 922 608 599 209 41893 1566 835 140 1300 --
NM_005870chr132904 30 ----1952
NM_005871chr104829 783 439 316 --2351 64 --
NM_005872chr11198 ------
NM_005876chr21713 ------
NM_005880chr1651270 1148 1090 1053 1023 ----21532 331
NM_005885chr541548 577 548 320 11585 11596 --
NM_005888chr123469 444 78 ------
NM_005898chr1161990 1954 1250 755 741 191 12265 42917 2535 2316 625 22458 284
NM_005899chr1781564 981 578 557 327 308 155 90 1253 --11205
NM_005900chr461233 1166 1116 1038 107 50 ----1462
NM_005901chr18238623 8599 8420 7738 7704 6665 6638 6600 6192 6090 6001 3087 2181 1925 1752 1687 1588 1394 1070 1009 977 463 165 76465 6441 6160 3254 3142 2776 1062 87255 6983 6106 3006 2976 2748 1640 1568 28514 2100
NM_005902chr1564016 3734 3258 3192 3162 2941 21584 1485 43313 1617 1224 1007 --
NM_005903chr5235176 5141 5134 5119 5007 4916 4471 4271 3687 3609 3517 2059 1891 1844 1666 1020 920 847 823 796 417 147 112 65236 4933 4841 3345 746 283 43801 3661 998 276 --
NM_005904chr1861200 1133 1080 964 88 55 21378 1260 169 --
NM_005906chr631459 542 126 21335 154 11544 --
NM_005907chr671659 1559 1363 1349 1139 666 548 21597 377 1634 --
NM_005909chr5124271 4237 4227 3581 3094 2634 1703 1658 1551 1038 986 972 12640 23281 670 --
NM_005920chr153869 3763 2393 1381 575 --33789 3394 177 --
NM_005922chr6157 1505 ----
NM_005923chr63681 631 553 ------
NM_005924chr751135 1091 429 276 218 1923 ----
NM_005925chr181146 --1109 --
NM_005927chr551157 1117 963 895 333 --31097 837 186 --
NM_005930chr145927 739 699 361 133 1191 --1611
NM_005935chr4174808 4541 4511 4347 4235 4011 3995 3821 3717 3681 1716 1614 1426 937 494 302 39 25047 3571 34801 3814 1080 11098
NM_005937chr1733666 3335 1176 --21613 1579 --
NM_005941chr874184 3299 3129 3088 776 564 349 53615 3135 1253 974 454 33498 2848 1640 12605
NM_005944chr341223 1164 1098 1080 1840 1936 --
NM_005955chr1155555 5405 5352 4860 4531 4499 4412 4146 4070 3670 3437 2016 1876 900 135 25471 3597 13653 --
NM_005962chr1051763 1639 545 169 129 11589 --11479
NM_005962chr1051763 1639 545 169 129 11589 --11479
NM_005964chr1731513 1464 245 ------
NM_005966chr282251 2129 1990 1888 835 658 570 410 31603 934 387 12183 --
NM_005967chr122727 719 1745 ----
NM_005968chr19149 ------
NM_005977chr134373 255 138 127 ------
NM_005986chr1362204 2053 2007 990 829 669 ------
NM_005989chr711047 --21603 1508 21390 1073
NM_005994chr172691 589 ------
NM_005996chr1231532 1203 961 --21491 370 --
NM_005999chr171522 1392 1231 1059 319 279 123 1310 21081 1033 --
NM_006002chr13----186 --
NM_006007chr9123821 3586 3430 2815 1675 1414 1354 1327 1141 1130 1040 388 54169 3069 1567 1027 41 --24398 143
NM_006010chr3182 ------
NM_006011chr1563273 3238 1562 1373 1196 846 ------
NM_006015chr121205 1082 1292 ----
NM_006016chr672216 2061 1640 1514 1413 614 196 22202 234 1262 21490 797
NM_006029chr14147 ----1788
NM_006030chr311723 --21858 1810 11554
NM_006033chr1872200 1840 1806 1755 1612 591 405 --22242 1880 11972
NM_006036chr2122583 2454 2390 2250 2013 1953 1809 909 670 554 539 43 11776 52565 2546 2463 1946 355 --
NM_006037chr2104473 4229 3883 1767 1714 1702 1443 1427 1212 483 1897 34304 3643 1078 --
NM_006038chr202770 193 --1757 11475
NM_006041chr17199 185 ----
NM_006042chr173465 108 82 --2375 46 --
NM_006047chr2093361 2583 2571 2211 2187 2154 872 576 432 --32719 2653 2367 --
NM_006048chr121097 198 --21189 827 --
NM_006055chr282803 2413 2255 1143 507 458 173 79 12913 52428 1110 961 605 419 1855
NM_006060chr794113 3771 3666 3384 3189 1596 1587 194 176 13391 23529 3460 --
NM_006067chr1651018 905 809 800 62 11070 1332 --
NM_006070chr3--170 ----
NM_006079chr63824 794 691 1843 ----
NM_006080chr772035 1898 1161 1078 788 770 479 1635 22669 449 1881
NM_006089chrX61599 1266 716 611 571 314 31734 1546 1256 1497 21907 116
NM_006090chr12733 651 ------
NM_006094chr8102413 2407 2175 1703 1657 1541 740 691 641 312 ------
NM_006095chr4154262 4011 4002 3722 3666 3650 3286 2838 1386 1326 1292 972 723 668 388 24151 3874 54085 3564 3465 1594 1400 23074 1769
NM_006100chr32165 45 ------
NM_006106chr11143421 3399 3359 2829 2770 2579 1240 1067 1001 550 541 489 373 145 1602 --1133
NM_006108chr1182226 1999 1747 1700 1484 737 726 165 1665 ----
NM_006113chr132133 759 664 31850 1653 372 22066 1987 --
NM_006135chr141395 506 410 377 --195 --
NM_006136chr741278 1156 365 168 11221 21039 918 2909 305
NM_006139chr272365 2293 845 685 608 488 252 --32727 2521 734 --
NM_006141chr1672761 2488 2365 2211 1955 829 609 1860 ----
NM_006143chr121113 ------
NM_006153chr32506 136 ------
NM_006154chr15102308 2039 2008 1916 714 594 522 494 394 164 --11004 2798 469
NM_006155chr272008 1845 1503 638 510 303 184 12024 11949 --
NM_006157chr113389 343 331 ------
NM_006158chr851445 1421 1262 1215 439 --21777 560 --
NM_006159chr121642 --2536 421 --
NM_006160chr1721659 1365 1412 ----
NM_006162chr1841784 1137 674 469 ------
NM_006166chr12102525 1991 1881 1864 1608 746 525 343 322 136 11978 31892 1735 226 --
NM_006178chr1741636 1407 1143 292 --11348 --
NM_006180chr951968 1898 1773 475 163 ------
NM_006183chr122392 68 1538 ----
NM_006186chr251169 1156 1113 973 359 ------
NM_006190chr251070 982 938 689 100 1308 1835 --
NM_006194chr1441064 427 355 164 ------
NM_006195chr941444 1233 411 177 1262 --1286
NM_006197chr862226 2023 1762 694 587 114 11974 12253 --
NM_006198chr211243 ------
NM_006202chr191244 --11477 --
NM_006203chr5154973 4901 4889 4845 4352 4206 3652 3410 2220 1778 887 669 626 596 283 34279 4117 1285 55589 4438 3487 979 365 1826
NM_006204chr10--1230 ----
NM_006206chr4102946 2811 2593 2485 2478 2266 2255 2043 1156 445 --32719 2013 171 12787
NM_006209chr82387 165 1105 147 --
NM_006210chr191396 ------
NM_006212chr1164990 4888 4706 4667 4634 4495 4100 3874 3730 3310 1703 1583 1107 838 482 424 14789 1598 --
NM_006216chr23673 485 40 --193 --
NM_006224chr1742418 1781 921 424 ------
NM_006226chr241265 1259 1242 1180 --1130 --
NM_006237chr1311621 ----22011 502
NM_006241chr392226 1968 1613 945 814 543 444 343 250 2462 205 --1303
NM_006242chr2042010 1939 1563 1479 21858 632 --12141
NM_006243chr131087 422 378 --2358 48 --
NM_006251chr5153327 3294 3076 2949 2734 2548 2472 2462 2288 2197 2102 1014 668 377 65 1274 43312 2976 2728 2703 --
NM_006252chr1237343 7244 7145 7055 6810 6361 6015 5373 5301 5287 4619 2904 2260 2185 1920 1387 1244 1205 912 818 677 351 71 24674 432 37395 6225 1316 26472 6436
NM_006256chr172727 2603 2477 588 291 188 161 32755 1790 572 32169 1900 272 32415 2229 2125
NM_006258chr1031387 1280 286 11531 ----
NM_006264chr43492 380 173 2368 186 1501 --
NM_006267chr281720 1581 1454 1383 422 363 340 218 --11612 --
NM_006275chr20122531 2505 2447 1791 1742 1724 810 707 635 398 368 74 12513 1748 11755
NM_006278chr111578 ------
NM_006279chr11368 ------
NM_006281chr82420 68 --2777 77 --
NM_006281chr82420 68 --2777 77 --
NM_006282chr2064682 4578 3209 2881 1602 962 11893 ----
NM_006283chr883938 3654 3307 3299 818 621 598 319 1977 34962 3276 1209 24319 3870
NM_006287chr2172602 2593 2526 2478 1899 1882 1818 830 792 777 559 250 231 161 130 121 73 --42664 993 803 89 2898 42
NM_006290chr661851 1633 1616 1537 1519 1380 --11798 1701
NM_006291chr1432017 2002 1518 --11324 --
NM_006298chr652724 1274 991 528 478 13381 1609 1928
NM_006299chr61241 ------
NM_006300chr1952311 2300 934 617 232 21741 195 11619 --
NM_006305chr151200 ------
NM_006306chrX135847 4964 3987 3978 3746 1984 1948 1924 1581 1556 1413 701 66 --14036 15936
NM_006307chrX1323 1120 ----
NM_006310chr1711225 --11200 --
NM_006313chr1261591 1333 1218 453 357 155 21580 1540 ----
NM_006315chr473984 2874 2754 793 463 322 119 --23852 2809 --
NM_006317chr51238 --1618 --
NM_006320chr41753 1438 1955 --
NM_006322chr134853 837 609 313 1762 ----
NM_006325chr122871 204 --1732 1719
NM_006330chr881342 1335 1159 1046 613 594 450 332 11106 ----
NM_006333chr22499 216 1544 1147 1466
NM_006334chr92119 110 ------
NM_006343chr23392 371 174 ------
NM_006345chr45942 862 312 287 238 1951 --21199 138
NM_006346chr131397 1199 --2482 182
NM_006352chr162003 1919 1684 1622 1576 504 --3822 460 283 --
NM_006359chrX62470 2336 2316 2232 1872 234 22436 910 --11973
NM_006364chr1491255 1167 1140 999 894 874 512 488 202 1864 31312 446 107 11266
NM_006366chr671112 1090 1005 983 520 343 177 1101 ----
NM_006371chr3104466 4235 3516 1710 1102 1052 977 751 687 384 --11561 --
NM_006372chr62440 186 ----1122
NM_006375chrX41383 746 613 326 --21346 74 --
NM_006377chr92816 126 ------
NM_006379chr782006 1971 1947 743 668 352 220 26 32115 764 85 ----
NM_006380chr17134375 4078 4023 3658 3398 3308 3020 2995 1469 1420 1386 1344 133 33737 3381 778 33990 901 795 24087 1612
NM_006386chr2261760 961 785 513 323 313 1450 ----
NM_006390chr1251680 1485 1296 434 92 ----1190
NM_006391chr112239 230 ------
NM_006393chr1084059 3015 2870 1257 1251 913 429 290 34235 3618 99 43560 1734 901 75 24582 3540
NM_006401chr93473 427 339 --1402 --
NM_006403chr651830 1547 1282 259 88 ----2121 101
NM_006413chr104973 465 302 279 1220 ----
NM_006415chr951292 1208 1194 494 169 31241 985 304 11172 1815
NM_006416chr63702 643 616 ------
NM_006420chr2083278 3218 3205 2998 2816 2567 958 914 22170 591 13459 12505
NM_006421chr84824 449 378 127 ------
NM_006427chr142166 128 ------
NM_006430chr22409 175 ------
NM_006434chr1063189 2989 2733 2624 2533 28 ------
NM_006451chr54785 735 321 302 2810 708 2891 848 --
NM_006457chr4154052 3299 3230 3061 3026 2951 2881 2764 1307 1022 832 442 205 161 84 1218 13047 --
NM_006460chr1761825 622 607 371 209 169 --11593 1435
NM_006463chr22585 384 --2596 177 --
NM_006464chr294610 4575 3640 3608 1368 573 508 487 215 21448 699 44534 2914 1520 641 --
NM_006466chr20----2682 143 --
NM_006467chr572292 2212 2128 656 449 310 95 32053 761 72 31535 938 26 1768
NM_006469chr171403 1117 1087 508 468 441 208 2562 228 1157 --
NM_006471chr18----1258 --
NM_006475chr132561 519 --2578 149 --
NM_006482chr1263439 3031 1572 1357 789 734 43396 2470 1381 1244 21334 204 1190
NM_006489chr1472030 1891 1855 1700 542 232 71 --2474 218 --
NM_006496chr131946 542 264 11270 1147 --
NM_006497chr172771 677 --1232 --
NM_006502chr6----137 170
NM_006504chr1042941 2628 1157 223 --62819 2730 168 115 47 23 1609
NM_006506chr3142 ------
NM_006516chr151663 1275 1183 1113 261 ------
NM_006520chrX4554 479 472 275 11078 21438 299 1116
NM_006522chr21379 ------
NM_006526chr2092159 2113 1949 1930 1668 1560 389 323 263 12100 22009 281 11356
NM_006527chr45758 563 230 147 136 --1186 --
NM_006529chr481513 1341 1329 667 422 331 198 140 11390 11378 --
NM_006534chr2093409 3254 2711 2697 2680 2198 2089 1069 602 1135 32476 1230 882 12765
NM_006536chr12985 376 ------
NM_006538chr293892 3500 2868 793 717 666 569 480 238 ------
NM_006544chr14276049 5734 5702 4913 4834 4761 4703 4599 4409 4167 2286 2160 1971 1896 1884 1868 1832 1358 1344 1029 801 757 667 660 348 153 58 95763 4936 4432 4074 3934 973 814 630 480 73997 3985 3942 3830 1922 537 199 25650 2051
NM_006546chr1796544 6346 6048 5117 2283 1668 1186 534 475 26469 917 35683 2386 901 32211 1795 1743
NM_006547chr731943 1878 480 --1360 31979 630 176
NM_006548chr321392 1145 ----1475
NM_006555chr72230 126 11940 ----
NM_006557chr941674 1655 1564 298 --140 --
NM_006559chr12906 754 2190 81 1249 --
NM_006560chr113328 184 134 ------
NM_006561chr10246166 6138 5934 5904 5470 5373 5206 5065 4929 3950 3879 3794 2469 2463 1919 1657 1648 1568 1385 1193 1104 635 339 159 11163 36201 1831 1790 1735
NM_006565chr1651169 1117 434 428 392 11201 11190 --
NM_006570chr9162 1350 ----
NM_006571chr81115 ------
NM_006572chr17143336 3218 3189 2937 2166 1200 1050 750 571 465 359 307 284 139 12349 33202 2794 2242 21182 539
NM_006575chr1451353 1271 1048 464 310 3939 134 97 1153 --
NM_006577chr261314 1131 1070 820 452 40 --31238 1225 907 31090 1040 1028
NM_006587chr481677 1430 1304 1261 1042 460 373 173 11683 --11094
NM_006595chr1181947 1857 1822 1414 626 566 206 101 --42048 1331 263 253 --
NM_006599chr16218260 6942 6905 6846 5727 5489 5118 3246 2762 2557 2391 1993 1581 1537 1420 867 649 635 386 370 276 87633 6774 6653 6522 2531 1198 891 79 58222 8139 7606 6113 1967 46020 5006 2400 205
NM_006602chr206854 573 557 339 185 167 1563 ----
NM_006603chrX71736 1418 777 689 496 127 121 31546 1394 597 42031 633 606 281 1236
NM_006606chr2072709 2587 1973 1179 1090 213 22 22152 2104 12702 --
NM_006609chr252994 2382 2099 1985 185 72591 2564 1898 1886 1875 880 748 12029 --
NM_006612chr171481 ------
NM_006614chr3153621 3286 2523 2480 1344 1102 946 914 881 871 837 602 303 156 50 23228 1267 53649 3216 2943 2235 1162 23149 2356
NM_006618chr141386 1377 1179 205 1632 ----
NM_006621chr121694 76 --21659 57 --
NM_006624chr1071821 1783 1322 1303 847 710 574 1219 31750 1527 561 --
NM_006625chr141064 463 430 205 --21141 87 1773
NM_006625chr141064 463 430 205 --21141 87 1773
NM_006625chr141064 463 430 205 --21141 87 1773
NM_006626chr962257 2142 2132 999 631 83 1800 52096 1059 601 512 113 --
NM_006628chr15124661 4590 4463 4430 3607 3104 1803 1167 776 564 456 69 23429 1534 33974 3785 3115 --
NM_006633chr51707 --166 1566
NM_006636chr25911 878 817 738 279 --179 1758
NM_006642chr1145 ------
NM_006644chr132488 108 --291 43 --
NM_006646chr1392318 2307 2209 2029 1979 777 529 260 175 ------
NM_006648chr9----1167 --
NM_006653chr65434 414 379 132 101 ------
NM_006654chr12134481 4389 4365 3967 3736 3339 3187 1563 1157 1067 880 600 125 24730 1809 13148 23466 1556
NM_006660chr151236 ----1266
NM_006667chrX51181 1124 91 35 27 1779 ----
NM_006682chr772712 2474 2230 1935 1928 868 767 11013 22242 88 --
NM_006690chr201684 --11753 --
NM_006691chr1151213 1026 992 975 787 ------
NM_006693chr71175 ------
NM_006699chr192501 2476 2419 2342 1666 1026 871 430 233 ------
NM_006704chr135425 412 322 142 111 1131 1304 --
NM_006706chr53547 164 41 --1171 1687
NM_006708chr651319 1186 974 232 61 31302 461 195 ----
NM_006710chr261101 1016 936 863 783 76 ------
NM_006713chr54782 609 560 201 --1136 --
NM_006717chr952753 2726 2702 889 75 23276 549 11015 --
NM_006718chr6121 --2777 192 --
NM_006722chr3102932 2148 2135 1211 963 894 888 868 840 818 2830 187 32835 1111 1014 3750 146 123
NM_006724chr6157 1505 ----
NM_006726chr461017 978 460 426 252 141 --2228 115 --
NM_006727chr53535 516 70 --1523 --
NM_006729chrX135488 3926 2039 1830 1622 1418 1286 1180 1124 790 739 597 30 45437 4277 1308 765 35270 2118 2093 1778
NM_006731chr9175791 5714 5489 4803 4723 4587 4505 4188 3608 2259 1880 1848 1457 1395 704 693 456 32275 1234 837 43753 2141 893 732 25688 1263
NM_006732chr1932071 2050 1907 --11420 --
NM_006734chr681638 605 537 493 484 324 257 219 --2425 130 1305
NM_006735chr73306 92 85 --1341 --
NM_006745chr43424 407 210 2943 168 ----
NM_006746chrX71226 1181 1025 974 517 274 249 21388 455 --11561
NM_006750chr16167735 6765 6732 6596 6329 5768 5684 5494 5096 2857 2722 2121 1262 770 726 46 38124 5146 801 27777 6314 16632
NM_006751chr241075 233 157 138 ----2946 53
NM_006756chr851405 1107 574 479 272 --21281 223 11199
NM_006763chr181917 763 749 645 588 523 119 88 22143 1770 ----
NM_006764chr33473 102 49 ------
NM_006766chr882669 2528 2497 2238 995 966 600 302 32385 355 139 ----
NM_006769chr1----1726 --
NM_006775chr682785 2666 2171 1164 1120 852 798 681 33063 2914 726 3999 975 932 --
NM_006777chrX82896 2740 2553 2412 2313 2222 1050 494 --2975 948 12615
NM_006785chr1882107 2011 1854 834 807 539 466 338 11477 1272 --
NM_006790chr55458 353 327 131 51 ------
NM_006800chrX3638 541 214 1458 1596 --
NM_006805chr591674 1661 1643 1435 632 588 507 398 254 11377 --11757
NM_006806chr211126 2375 332 ----
NM_006811chr207872 776 635 360 351 339 158 --2665 105 --
NM_006813chr63820 246 206 1736 1162 1156
NM_006814chr2032115 967 790 --12191 --
NM_006815chr1251226 1121 1015 527 91 3877 555 361 1536 --
NM_006819chr111117 ------
NM_006822chr17--1275 1586 --
NM_006823chr81276 --1971 1897
NM_006826chr241138 1101 1082 837 ----11058
NM_006827chr1463195 3077 2658 1320 997 624 --33107 2971 1277 12956
NM_006832chr14144 21080 321 ----
NM_006838chr1251265 640 387 312 34 11926 3341 302 115 --
NM_006839chr2131 ------
NM_006842chr111160 1111 ----
NM_006851chr1282704 1989 1935 923 837 518 344 83 22119 91 12793 11010
NM_006852chr1782572 1823 897 607 408 132 124 118 22804 2136 12741 --
NM_006854chr772020 1413 1309 1254 755 443 79 1333 12058 --
NM_006868chr1853180 2792 1050 503 26 1854 13218 --
NM_006873chr2143264 3018 2627 2224 1385 1002 970 813 769 705 584 528 177 170 31011 961 914 43163 2926 1278 843 1682
NM_006874chr431264 1161 1060 1481 --11151
NM_006875chrX1284 ------
NM_006884chr331844 1505 642 21878 520 21854 782 --
NM_006885chr1684224 3862 3393 3382 1446 1314 1239 336 32582 1177 657 33746 3109 2622 11541
NM_006887chr21218 ------
NM_006888chr14103404 3125 2927 2760 2685 2612 2225 1415 555 234 23087 2650 22891 910 --
NM_006892chr2021287 1213 ------
NM_006892chr2021287 1213 ------
NM_006895chr22738 460 --31459 383 37 --
NM_006898chr22802 513 ------
NM_006901chr151429 1510 ----
NM_006908chr741099 1065 963 270 11078 --11166
NM_006914chr941543 1365 345 132 1333 ----
NM_006915chrX62515 2121 1884 1721 967 124 3977 398 302 32058 548 368 --
NM_006918chr11155840 5744 5019 4777 4765 4755 3847 3549 2307 2281 1549 1451 1285 787 209 14783 44985 4403 4315 3677 14941
NM_006920chr2112084 1774 1725 1606 1540 1525 1312 676 639 450 63 11450 11689 --
NM_006922chr271743 855 744 682 669 432 336 3929 819 609 42557 1593 763 360 --
NM_006924chr17104240 3855 3811 3157 2824 1628 1204 687 626 346 1187 2973 396 24060 3792
NM_006930chr571876 1624 1572 1271 638 453 96 21738 316 11530 180
NM_006931chr1242118 1639 1525 590 32012 1325 479 ----
NM_006939chr1471161 990 974 773 323 257 91 2840 85 1957 --
NM_006940chr1241442 1347 766 667 2578 108 11312 --
NM_006941chr2211041 ------
NM_006947chr421674 373 --31716 597 113 11806
NM_006948chr2162438 2317 1724 980 823 433 21670 633 51918 1601 1534 898 275 12098
NM_006951chr103724 241 81 1285 1798 --
NM_006952chr351081 966 396 276 183 ------
NM_006959chr192355 343 --1372 --
NM_006962chrX----2476 78 --
NM_006963chr101437 1896 11275 193
NM_006965chr183969 904 158 ------
NM_006980chr74823 587 225 130 ------
NM_006981chr9102879 2504 2497 2219 1961 1942 1922 454 374 216 1527 12251 --
NM_006982chr12262 21 ------
NM_006996chr1111895 1860 1785 1691 1563 1297 695 534 370 306 90 31249 596 560 --11913
NM_006999chr581764 1734 1725 1484 689 552 536 341 --22051 517 --
NM_007005chr951536 1199 1053 288 241 ----21302 1215
NM_007006chr16193570 3500 3270 3112 3047 2858 2832 2822 2731 2630 2622 2518 2306 2250 1255 1218 467 385 206 23546 263 43493 2225 892 224 --
NM_007007chr12164720 4201 4193 3844 3439 3349 3082 1736 1469 838 686 672 665 323 186 180 44270 4163 1751 1627 31817 1636 1043 --
NM_007008chr24802 677 613 132 ----1288
NM_007011chr15166890 6820 6755 4839 4439 4287 2043 1994 1454 1358 1325 1302 944 337 279 183 --36631 5338 1554 11542
NM_007013chr83853 790 740 2360 174 1813 --
NM_007017chr53710 667 654 1615 2865 846 --
NM_007018chr95396 372 338 294 136 ------
NM_007023chr21978 1990 2839 776 --
NM_007033chr132042 644 590 ----1626
NM_007034chr131055 722 288 2872 208 2235 27 2999 661
NM_007036chr54834 780 157 35 1742 1789 --
NM_007038chr21256091 6039 5723 5639 5441 5361 5232 5183 4963 4949 4673 4207 4066 3826 2114 2108 2052 1853 1786 1770 1667 905 734 453 100 21418 1107 76015 5563 4849 2315 1277 893 583 24050 535
NM_007039chr14102025 1535 898 766 589 536 517 409 289 264 31867 397 309 22094 79 --
NM_007040chr194981 771 446 223 ------
NM_007045chr62532 173 --2431 137 --
NM_007050chr20107252 5971 3133 2875 1610 1336 1007 880 700 306 22497 1547 27972 1215 11661
NM_007054chr583734 3217 2814 1142 1102 999 967 334 43913 3725 981 869 53901 1560 943 834 801 --
NM_007068chr2221035 146 ------
NM_007073chr6144066 4033 3235 3192 3147 3141 3088 2949 2745 2564 1600 922 742 327 54176 3738 3044 2854 97 44190 3121 874 251 --
NM_007074chr161106 ------
NM_007078chr1063057 1906 1068 445 322 244 --13019 --
NM_007080chr41319 --142 1351
NM_007084chr1341253 1120 975 288 --11354 --
NM_007106chr13142648 2419 2163 2035 2022 1995 1894 1800 1719 912 596 429 383 208 12672 22137 1903 --
NM_007107chr311557 12283 ----
NM_007114chr3113065 3038 2836 2619 2484 1008 225 198 186 175 159 31085 803 275 53240 2569 2453 894 879 23286 2627
NM_007115chr2199 --1332 --
NM_007118chr5--1242 ----
NM_007124chr632007 1289 1236 41780 1643 1495 798 31550 747 180 --
NM_007125chrY41461 1280 984 192 41130 901 463 328 --11170
NM_007129chr134932 879 763 725 ------
NM_007145chr1951359 1246 1235 1227 512 11425 ----
NM_007146chr1762895 2768 2384 862 651 41 1888 ----
NM_007157chrX172933 2886 2867 2812 2791 2489 2438 2252 1075 886 717 633 520 436 258 77 37 --11168 --
NM_007159chr351678 1628 1448 701 483 2334 142 1473 21429 1415
NM_007166chr1131470 1293 1170 ------
NM_007170chr13628 621 270 --1872 --
NM_007172chr2283253 3212 2459 2342 2289 1049 523 315 23220 513 12139 22369 2164
NM_007173chr1182194 1631 809 689 644 475 363 279 32161 1802 50 2533 232 --
NM_007174chr1272159 2123 2066 2028 1740 1545 626 1367 ----
NM_007175chr883561 3358 3214 3176 3093 552 48 31 22589 540 ----
NM_007176chr1451310 1152 1141 677 334 ------
NM_007187chr1351030 966 354 328 165 --2146 28 --
NM_007190chr104923 914 329 24 --1989 --
NM_007191chr122217 148 1714 2489 284 --
NM_007192chr14179 1916 11136 --
NM_007195chr18143535 3382 3106 3095 3080 2880 2874 2868 2800 2792 1339 528 232 47 23664 3363 63193 2782 2411 2322 1136 270 12430
NM_007197chr125983 661 380 179 53 11018 11000 --
NM_007198chr851658 1581 1521 1456 1432 ------
NM_007203chr9113979 3931 3809 1589 1149 989 824 805 573 524 421 ----21578 619
NM_007204chr13589 558 493 1506 ----
NM_007207chr12968 146 --2911 791 --
NM_007212chr192106 1942 1512 1403 773 537 435 203 78 --1862 --
NM_007214chr631006 519 38 11310 11181 --
NM_007217chr32364 27 --1155 --
NM_007218chr81659 --1973 --
NM_007222chr851791 1355 1332 1236 708 ------
NM_007224chr12----1649 --
NM_007231chrX52009 1792 380 310 196 12411 42045 540 341 266 --
NM_007236chr1572483 2137 877 654 482 398 205 12347 ----
NM_007245chr162914 796 ------
NM_007246chr49813 775 763 667 657 322 276 165 26 ------
NM_007249chr13149272 8539 8242 7939 7617 6921 6788 5766 3775 3761 3373 2692 1320 1072 18763 38009 6730 1613 27859 1758
NM_007269chr13543 226 194 ----199
NM_007276chr72182 29 21094 1020 ----
NM_007279chr192602 406 1643 ----
NM_007282chr32177 103 ------
NM_007287chr3103252 3145 2074 2068 974 755 713 635 448 235 22170 579 11103 --
NM_007288chr3103252 3145 2074 2068 974 755 713 635 448 235 22170 579 11103 --
NM_007289chr3103252 3145 2074 2068 974 755 713 635 448 235 22170 579 11103 --
NM_007294chr1731131 1084 918 ----1125
NM_007295chr1731131 1084 918 ----1125
NM_007296chr1731131 1084 918 ----1125
NM_007297chr1731131 1084 918 ----1125
NM_007298chr1731131 1084 918 ----1125
NM_007299chr1731131 1084 918 ----1125
NM_007300chr1731131 1084 918 ----1125
NM_007302chr1731131 1084 918 ----1125
NM_007303chr1731131 1084 918 ----1125
NM_007304chr1731131 1084 918 ----1125
NM_007305chr1731131 1084 918 ----1125
NM_007308chr41619 ----1580
NM_007313chr911965 11558 --11777
NM_007322chr192602 37 ----1580
NM_007327chr91242 ------
NM_007331chr442530 2287 1946 236 12013 ----
NM_007345chr18112354 2323 2152 2035 2029 1890 1759 1638 1586 1539 917 11778 11602 22242 1801
NM_007347chr1592533 2193 1112 897 697 586 424 293 88 53169 2963 2908 1082 665 43020 2402 2069 471 32992 2159 799
NM_007353chr742689 2506 2160 280 ------
NM_007358chr182042 1988 1946 1882 1858 1432 1324 1303 22001 1482 11700 --
NM_007361chr141190 ------
NM_007363chrX11024 ------
NM_007372chr171741 --1331 --
NM_007373chr1071708 1590 1460 1353 1345 1203 447 --2377 322 --
NM_007375chr162729 2218 2159 1827 1072 142 12697 31837 883 628 1302
NM_009585chr34860 324 310 97 1866 ----
NM_009585chr34860 324 310 97 1866 ----
NM_012064chr1241097 1050 112 103 ------
NM_012072chr20104507 4354 4033 3853 3657 3627 3540 1325 784 166 14128 ----
NM_012074chr1441026 366 272 122 --178 --
NM_012081chr5143605 3392 3371 3048 2628 1183 1128 1079 914 475 428 269 153 134 --1406 12998
NM_012082chr83664 657 241 1207 --1724
NM_012084chrX2226 218 1454 ----
NM_012089chr161525 1150 428 245 230 119 1376 11105 31566 1300 266
NM_012090chr171274 977 236 174 161 136 66 1336 11197 --
NM_012092chr241599 773 630 477 1496 21439 597 --
NM_012093chr121237 815 ------
NM_012095chr1093403 2331 2227 1341 824 789 614 601 206 12863 12350 1755
NM_012096chr3123672 3507 3499 3314 3279 3092 2737 998 923 844 582 111 13272 33409 2365 378 21372 477
NM_012097chr2112266 2185 2177 1775 1711 1675 1481 444 351 181 89 --1599 1414
NM_012099chr194861 398 314 184 1992 ----
NM_012102chr152651 2631 2244 594 124 1473 ----
NM_012108chr4166 --146 --
NM_012113chr11395 --1381 --
NM_012115chr64583 390 223 128 ------
NM_012118chr4139 ------
NM_012120chr6172937 2873 2833 2745 2551 2362 2193 2131 1965 1201 1025 913 884 520 424 353 317 2898 778 62715 2040 1104 580 514 170 22692 690
NM_012128chr12323 79 --1155 --
NM_012129chr762538 2511 2466 1689 533 364 32432 701 587 22097 1946 1446
NM_012141chr13143769 3686 3285 2886 1553 1333 970 610 481 470 436 371 301 183 33905 3555 525 22784 1598 1795
NM_012153chr1162301 608 177 102 90 77 12197 --1718
NM_012155chr19144 ------
NM_012156chr2073153 3120 2883 2140 932 878 619 ------
NM_012158chr1371816 1776 1749 1506 1445 1208 91 --21853 1786 11173
NM_012161chr43925 461 415 21080 767 2791 191 1266
NM_012164chr9197496 7205 7141 7104 6748 5392 5330 5197 5106 5053 4969 4945 2722 2514 2209 2144 943 898 236 47360 7000 2904 2199 47429 7026 6064 2380 --
NM_012176chr5168 --1252 --
NM_012177chr62567 558 --2539 172 1233
NM_012180chr41601 2636 156 ----
NM_012186chr11732 ------
NM_012188chr511088 ------
NM_012193chr1195340 4983 4258 4099 3721 1660 1149 789 761 14351 23562 22 1924
NM_012199chr1124548 4503 4338 4036 3901 3278 1261 1185 1119 915 703 334 --13680 2528 403
NM_012204chr941027 858 404 282 --1827 --
NM_012207chr102992 818 2297 84 2236 189 --
NM_012214chr2196298 6267 5824 5381 5336 5074 5044 4537 4511 3884 2547 1967 1871 1235 854 649 534 348 254 65750 4830 4765 4482 747 367 76209 5974 1080 680 555 509 480 26260 5720
NM_012215chr1061846 1765 1319 600 541 312 11207 ----
NM_012218chr191177 2432 390 22339 356 1398
NM_012219chr323096 778 2463 448 ----
NM_012223chr261243 1225 363 227 134 21 11024 --1870
NM_012224chr451175 848 842 432 192 11202 --2236 184
NM_012233chr231190 1080 937 2951 925 1443 --
NM_012234chr383371 3129 3046 2820 2338 1354 1031 266 33716 2654 2516 23436 717 --
NM_012238chr10101604 1531 1306 694 635 621 503 421 178 117 11362 --21576 1279
NM_012242chr105817 525 514 282 256 ------
NM_012247chr1071051 962 943 873 656 375 308 --1703 --
NM_012248chr161209 ------
NM_012249chr273068 2787 2594 2488 609 585 422 23371 3086 12875 22710 219
NM_012250chr112906 879 --2932 866 --
NM_012252chr7155282 5248 4856 4556 3930 3772 3608 3445 1187 1079 947 828 681 95 85 35313 4622 3891 45362 3884 2150 726 --
NM_012257chr75916 748 224 167 32 1335 1797 --
NM_012259chr651405 1365 1135 934 925 --11356 --
NM_012262chr1205038 4951 4940 4742 4693 4687 4681 4283 4204 3757 3337 3178 1768 897 879 691 551 510 458 200 24217 912 35278 4512 3407 24654 975
NM_012266chr921124 431 11163 ----
NM_012272chr121465 ------
NM_012281chr7102466 2445 2085 1963 1703 1694 1535 797 449 265 --1917 --
NM_012287chr3214525 4400 4299 4266 4137 3975 3957 3798 3607 3531 3352 3071 2908 1819 1230 1052 1044 1029 897 583 144 74223 3543 3182 1481 675 614 83 24290 1408 34369 3193 3049
NM_012288chr6115645 5149 4782 4737 4678 4327 3748 1959 889 361 341 --35760 5604 5301 13680
NM_012290chr241719 1414 423 335 --11347 1676
NM_012294chr7114073 4050 3607 3172 1356 780 708 644 395 355 74 --33904 1529 1262 --
NM_012296chr1113836 ------
NM_012297chr462415 2044 2013 1988 1789 863 --32096 1974 1893 --
NM_012300chr562222 1780 949 708 586 369 --1573 --
NM_012301chr762142 2041 1882 1834 694 82 11977 11744 --
NM_012302chr131173 1107 823 21125 251 ----
NM_012307chr188917 899 853 835 756 736 695 414 ------
NM_012308chr1122048 2038 ------
NM_012309chr1174455 4111 4075 3313 3305 1155 399 --11907 33997 3105 1727
NM_012311chr104619 580 492 215 ------
NM_012316chr1175469 5445 5439 4267 3580 3483 3435 2019 1913 1604 1279 1165 939 845 444 346 340 --1257 11128
NM_012318chr431373 1277 71 --1103 --
NM_012323chr2221583 1180 ----11146
NM_012325chr2041270 1242 1233 421 21641 1419 11126 --
NM_012327chr1851260 1127 1110 527 435 11316 --11617
NM_012328chr781426 1160 1040 908 529 247 136 83 ------
NM_012329chr1791420 1240 1192 1186 1174 1098 515 434 389 ----21595 281
NM_012330chr101228 11515 31497 586 429 --
NM_012334chr583561 3440 3387 3280 1650 1451 1251 788 33581 3250 731 13156 21155 697
NM_012338chr751209 1200 1165 1049 776 --11261 1142
NM_012341chr102389 130 2438 403 1200 --
NM_012342chr102198 143 --1360 --
NM_012343chr52878 704 1252 1226 --
NM_012345chr1381885 1692 1651 1553 1442 1365 1291 616 21629 260 --21849 444
NM_012347chr692313 2287 1201 1168 580 550 387 280 207 1164 22941 2886 --
NM_012382chr5114267 4259 3947 3805 3306 1762 1188 918 698 417 198 54104 3762 1695 1536 845 44378 830 471 177 --
NM_012383chr93405 380 41 --1350 1329
NM_012388chr15143164 3016 2915 2890 2700 2608 2368 2218 2035 898 428 233 186 40 22575 364 12503 12309
NM_012395chr773346 3238 3208 3051 2475 1248 844 21134 1071 23299 348 13137
NM_012405chr193597 3147 3015 2820 2649 2533 628 580 525 --1541 --
NM_012416chr931211 797 320 ------
NM_012417chr174489 458 422 90 --134 --
NM_012419chr61547 ------
NM_012420chr1052312 1606 474 285 107 178 1795 21722 150
NM_012425chr1072772 2711 841 553 401 138 113 22643 407 32740 1842 1777 --
NM_012428chr157963 882 679 262 238 210 185 --1862 --
NM_012430chr34759 749 527 108 --1535 --
NM_012431chr7123252 3223 3065 2676 1289 1242 616 388 278 269 261 41 3623 485 299 1441 23190 936
NM_012434chr641622 1175 109 39 1216 21513 1468 11578
NM_012443chr10176 --1130 1151
NM_012446chr52486 450 1473 ----
NM_012448chr1751849 1650 521 495 308 12532 22347 966 12399
NM_012454chr64559 448 405 43 3416 391 160 ----
NM_012463chr1281823 1529 1288 1136 669 493 328 261 --41279 1145 399 167 31506 1232 1174
NM_012464chr4122901 2773 2559 1932 962 633 557 513 409 245 205 192 12933 22012 58 --
NM_012465chr10103371 3364 3315 2812 2794 2531 2159 286 149 106 33008 2859 2539 1772 --
NM_012470chr71473 ------
NM_012471chrX61896 724 679 314 295 181 ------
NM_012475chr1183 ------
NM_012479chr7112645 2621 2594 2153 2119 2049 2015 900 642 409 54 --12458 --
NM_012482chr13143 133 53 --1613 --
NM_012484chr53517 169 69 184 ----
NM_013227chr151345 --1821 --
NM_013229chr1252679 1758 745 605 403 32037 484 342 ----
NM_013230chrY21721 1554 11696 51411 1391 1339 1170 1144 --
NM_013231chr14144078 3913 3525 3207 2834 2779 2746 1746 1452 1268 964 910 697 224 24418 3657 31594 1163 861 --
NM_013233chr241288 560 550 485 1203 11131 1429
NM_013238chr1371908 1643 1574 727 379 222 167 11652 11292 11691
NM_013242chr163326 127 88 ------
NM_013246chr113959 918 883 ------
NM_013248chr202235 191 ------
NM_013249chr114359 340 203 185 ------
NM_013250chr113457 389 266 11026 ----
NM_013254chr121676 1497 ----
NM_013255chr7278867 8780 7384 7100 7037 6891 6455 6326 5769 5546 5496 3222 3044 2742 2686 2672 2052 1980 1969 1730 1509 1031 986 976 937 695 392 28583 268 41532 1125 257 228 37181 2482 713
NM_013257chr892206 2144 1720 948 492 463 264 222 142 11871 12351 --
NM_013261chr4123050 3033 3027 2809 2733 2671 2411 1286 1256 1104 264 88 53582 3190 2565 1111 107 21444 1350 --
NM_013262chr641399 1348 925 411 --11264 --
NM_013269chr1244540 3870 3340 3228 24040 1667 24442 3222 --
NM_013281chr2071517 1446 1108 294 259 237 145 ----1230
NM_013282chr1951306 1211 1091 156 150 ----11172
NM_013283chr55793 700 644 608 267 2867 96 1340 --
NM_013286chr3103803 3796 3634 3478 2762 1077 822 268 260 111 153 23400 1210 --
NM_013296chr13421 160 58 --1108 --
NM_013302chr16124684 4323 4172 3480 3002 1852 1722 1690 652 602 216 133 23824 1867 24579 1014 --
NM_013309chr1552535 2513 444 333 280 12274 2714 350 1587
NM_013314chr101265 --3259 244 87 --
NM_013322chr771705 1653 1302 1193 1140 1059 155 21475 172 41443 1166 510 472 1534
NM_013341chr262732 956 946 279 211 130 32932 2903 2856 12072 12052
NM_013352chr66909 746 682 651 291 267 --2807 130 1620
NM_013354chr871188 1123 1009 314 227 45 22 11156 2973 280 --
NM_013357chr84766 582 349 133 --1734 --
NM_013367chr41112 ------
NM_013372chr1583188 3014 2945 2516 1090 941 752 232 1250 32501 2477 1200 12445
NM_013374chr372659 2292 2193 887 780 427 336 32277 1038 700 43087 3005 2955 303 1656
NM_013380chr191819 1761 1856 --
NM_013381chr1262440 2234 2108 1498 385 146 22150 1618 52371 2292 2052 1798 166 11769
NM_013386chr1131820 1790 1771 1570 1515 1498 1468 1371 1226 727 586 520 377 11161 1400 1229
NM_013390chr951806 564 387 299 270 ------
NM_013396chr2131172 387 287 1113 2611 259 21574 1142
NM_013410chr121211 1035 --21278 329 --
NM_013417chr92384 101 ----1426
NM_013423chrX51124 1015 846 821 505 21158 1090 ----
NM_013427chrX51124 1015 846 821 505 21158 1090 ----
NM_013436chr23278 173 131 174 ----
NM_013437chr861431 1297 1028 1013 958 58 2368 188 21186 387 11084
NM_013441chr11430 ------
NM_013444chrX51085 971 198 91 39 ------
NM_013447chr1962897 2729 2684 2367 806 270 32745 2519 653 ----
NM_013448chr142535 25 --1294 --
NM_013449chr1262253 2103 1985 1907 1877 1853 --12541 11915
NM_013450chr291241 1177 1029 931 796 402 390 375 23 1497 ----
NM_013943chr1113253 3198 2964 2475 2236 618 599 459 440 431 95 2834 187 33323 3140 2125 12348
NM_013956chr8--143 ----
NM_013957chr8--143 ----
NM_013960chr8--2760 719 ----
NM_013964chr8--143 ----
NM_013986chr223135 83 44 1128 ----
NM_013989chr14145055 4515 4468 4056 4023 3218 1589 974 937 929 876 587 154 76 55135 4709 3447 1852 1519 31543 1002 318 --
NM_013995chrX122589 2244 1883 1606 918 817 706 509 492 404 211 86 42349 911 775 257 42530 2340 1925 580 --
NM_014000chr1081804 1621 1602 1435 1395 1332 694 653 --11939 --
NM_014005chr532838 2415 2035 31056 376 235 31034 597 74 21195 1080
NM_014007chr951081 787 405 386 127 1924 ----
NM_014016chr361610 1356 1279 1210 1070 375 11179 1433 2674 332
NM_014021chr1103029 2960 2529 2380 2341 2311 889 759 420 198 11372 32950 2374 913 --
NM_014023chr1082879 2856 2682 629 269 190 183 116 --12624 --
NM_014026chr11--196 ----
NM_014028chr6103134 2906 2706 2423 2060 1236 1125 732 660 413 63197 799 704 649 275 226 32475 857 193 12651
NM_014031chr53302 234 114 --2359 31 --
NM_014033chr1251908 1453 943 609 306 22312 911 42282 2240 2107 1978 --
NM_014034chr661549 1453 1326 1012 253 179 2358 211 21174 949 --
NM_014038chr71309 ------
NM_014039chr1151361 1310 502 397 219 11094 11295 --
NM_014043chr361632 1128 1034 471 90 22 ------
NM_014044chr2----1201 --
NM_014048chr16145204 4932 4776 4598 3608 3389 2009 1943 1629 886 875 856 601 455 24635 625 ----
NM_014055chr121457 --1490 --
NM_014057chr971574 1503 1492 1459 1285 568 215 2641 522 11567 1129
NM_014059chr133303 290 252 --1360 --
NM_014079chr331061 844 177 --11035 --
NM_014089chr13102280 2115 2109 1960 1951 1715 1513 817 504 60 --1117 11408
NM_014106chr1592755 2617 2541 1002 885 743 566 420 45 31958 1184 431 32015 1029 254 32995 2212 1880
NM_014109chr851148 1019 874 274 149 --1776 --
NM_014112chr8174882 4324 2041 1949 1912 1877 1833 1549 1486 1379 1307 1184 1007 845 778 318 96 15391 21784 676 13784
NM_014117chr1662260 2198 2179 1935 761 391 12421 32657 1772 351 --
NM_014141chr7155099 5021 4933 4774 4391 3488 3311 1924 1463 1447 1334 984 379 294 189 22025 990 1245 11121
NM_014145chr203855 575 193 ------
NM_014153chr161524 --1586 --
NM_014155chr11267273 6698 6605 6536 6278 6264 6018 6001 5895 5742 5177 4915 4757 4694 2381 2360 2334 1895 1604 1424 999 798 780 682 439 413 57112 6318 6258 5636 2993 67155 5047 4986 2060 1849 714 47576 6692 6561 1154
NM_014160chr351414 1175 1151 1066 217 31372 1326 297 1379 --
NM_014171chr24652 244 196 42 --1541 --
NM_014181chr272585 1891 1156 820 777 738 298 22609 673 12841 1403
NM_014184chr12142 131 --1107 --
NM_014191chr124418 348 321 221 ------
NM_014208chr41296 --1242 --
NM_014211chr541659 1592 1538 122 21385 69 ----
NM_014212chr12271 64 149 ----
NM_014217chr161780 1722 1610 1516 1509 191 --11225 --
NM_014220chr33523 118 59 ------
NM_014223chr14694 490 284 228 --1184 --
NM_014225chr191402 1389 ----
NM_014240chr384082 3436 1347 1111 567 326 201 190 --1738 --
NM_014241chr104374 363 318 25 ------
NM_014243chr472050 1847 1350 1334 771 161 73 1510 21411 1374 --
NM_014246chr2252007 1874 1761 602 480 --1471 --
NM_014249chr151524 ------
NM_014250chr2272153 2123 2050 1895 1481 364 175 ------
NM_014253chrX42328 2237 1703 629 32304 2201 156 --12249
NM_014258chr203718 695 479 --2626 218 126
NM_014263chr1061421 1365 1211 1194 70 23 11444 3413 212 126 --
NM_014264chr44562 454 443 259 ------
NM_014265chr84761 731 695 564 ------
NM_014267chr114921 791 289 139 2893 314 1332 --
NM_014268chr1871380 1310 1304 1251 1238 502 433 ------
NM_014271chrX--1336 ----
NM_014278chr41389 ----1343
NM_014284chr11723 ------
NM_014294chr871485 1186 1121 1076 906 260 45 2986 539 21051 387 2245 190
NM_014296chr371271 1208 1135 1038 545 405 33 --21614 1216 11534
NM_014300chr151310 ------
NM_014305chr132696 675 --2561 530 --
NM_014309chr22165323 5040 4830 4620 4382 3931 3920 3783 2183 2177 2171 1180 1037 686 175 56 24567 3937 23863 140 23326 2100
NM_014315chr141149 ------
NM_014319chr1251791 1505 762 560 293 31847 1650 1210 299 83 --
NM_014322chr131112 890 309 2978 203 1292 --
NM_014325chr1282142 1515 553 462 454 399 391 285 ------
NM_014331chr4237669 7398 6637 6583 6311 5743 5572 5247 5154 5139 4890 4878 3025 2946 2913 2816 2810 2594 2584 2408 2223 1004 124 47296 6769 6291 480 86921 6302 6285 5881 5381 4935 3039 2751 47822 7807 540 139
NM_014332chrX4417 348 337 79 ------
NM_014333chr1192657 2519 2469 1874 647 490 475 465 260 11890 ----
NM_014335chr1571393 1115 1069 571 481 311 280 --11099 --
NM_014344chr112891 782 1823 ----
NM_014345chr671050 782 704 337 326 270 244 --2996 764 --
NM_014350chr591131 1055 1032 1025 403 378 368 342 102 ------
NM_014352chr1121406 1232 ----2957 286
NM_014363chr1381184 1063 1045 993 468 360 194 64 11055 21280 800 11140
NM_014372chr171820 1577 1345 787 580 349 198 11470 11806 1166
NM_014376chr562525 2488 2444 2382 2285 247 --32513 1902 730 --
NM_014382chr351766 1705 1126 469 355 2676 665 1345 --
NM_014388chr1165307 4096 3833 3827 1701 1644 1631 1401 1239 1191 1152 956 888 783 608 423 --36091 2089 276 1878
NM_014392chr421339 139 ----190
NM_014393chr852181 2069 1755 527 180 12247 --1548
NM_014394chr1081188 1145 1090 858 849 799 468 126 1306 1363 --
NM_014395chr491994 1986 1385 1362 1224 705 572 558 418 --1475 --
NM_014399chr73905 823 189 --1138 --
NM_014409chr131149 1142 1118 ------
NM_014415chr361452 1101 1053 634 245 227 41396 587 551 350 --2577 519
NM_014421chr482074 2043 2028 1931 1765 1550 845 587 11415 41955 1580 807 673 --
NM_014423chr5175529 5500 5443 5316 5232 5084 5027 5019 1861 1635 1595 1082 989 862 537 388 182 23588 311 35597 3841 210 11389
NM_014426chr201566 1622 1126 --
NM_014431chr1051623 1432 1355 1301 1257 ------
NM_014432chr681303 1240 1184 461 390 358 348 320 21135 598 1543 1620
NM_014445chr372044 1946 1713 1663 1575 590 129 2804 611 22134 1954 --
NM_014447chr451567 1404 1045 466 42 21589 1545 11354 2399 152
NM_014452chr631058 481 320 21014 921 1294 --
NM_014454chr661077 1049 1023 306 232 142 --1940 --
NM_014455chr1--1378 ----
NM_014456chr1041242 739 582 438 ------
NM_014458chr13304 195 147 --21392 1216 --
NM_014497chr22245 61 ------
NM_014500chrX1221 --1264 --
NM_014503chr12----1469 --
NM_014504chr751801 1500 1417 766 754 12097 ----
NM_014506chr941613 1069 1046 1029 11185 ----
NM_014515chr1221025 767 ------
NM_014516chr192252 235 ------
NM_014517chr361932 1838 1830 1790 1638 1556 --11201 --
NM_014520chr172424 56 ------
NM_014521chr221450 630 11578 11736 11831
NM_014522chrX5671 657 649 521 21 ------
NM_014547chr151195 ----2667 173
NM_014547chr151195 ----2667 173
NM_014552chr231506 1473 1184 21533 1159 ----
NM_014554chr1272051 1701 1544 1443 599 253 186 ------
NM_014570chr224955 856 146 112 1253 2997 843 --
NM_014572chr1391465 1447 1418 1305 1195 562 511 340 273 21681 356 31723 1497 236 --
NM_014574chr1471348 1272 1173 1035 608 497 191 21081 503 --21580 547
NM_014575chr3141 1163 --1447
NM_014584chr1481673 1655 1609 1152 659 542 531 117 21187 597 11102 2519 211
NM_014585chr251113 944 429 410 58 --21277 938 11061
NM_014587chr1661586 1375 1366 1356 623 599 ------
NM_014588chr202625 493 1145 ----
NM_014601chr1931365 1230 293 11407 ----
NM_014606chr451522 1416 627 577 89 21232 993 ----
NM_014607chr272145 1969 1926 1643 543 336 306 21363 87 193 --
NM_014608chr153155 116 82 --1180 --
NM_014612chr961543 1332 1295 1251 627 405 ------
NM_014613chr552720 2688 2622 2473 365 33057 2243 2177 2580 133 --
NM_014614chr221100 395 --11345 --
NM_014615chr1693550 3422 3089 2830 2543 964 524 414 68 2835 53 22530 76 --
NM_014616chr3143500 3368 3214 3195 2857 2394 2160 1191 1114 867 856 459 441 357 12597 1743 2839 312
NM_014620chr121297 ------
NM_014628chr6----1412 --
NM_014629chr821364 1118 21371 905 1473 --
NM_014630chr15134035 3619 3604 3557 3544 3130 2992 2674 2624 1016 881 790 397 13142 13979 --
NM_014633chr112438 180 --2578 432 --
NM_014635chr271746 1678 1564 1554 1206 426 119 31740 1502 146 ----
NM_014636chr994372 4300 4266 2911 2796 1685 1588 1297 323 1592 11725 14347
NM_014637chr871408 1170 1141 1132 1043 510 172 --21429 372 11055
NM_014647chr1642221 2007 661 536 ----1262
NM_014648chr341435 1342 912 517 1454 ----
NM_014655chr161623 1494 520 487 454 448 11984 22077 620 --
NM_014660chr751034 845 295 272 257 --1773 --
NM_014666chr52950 862 1868 31214 493 355 --
NM_014667chr392446 1847 940 914 884 455 369 165 67 1804 11747 --
NM_014669chr161125 ------
NM_014670chr251652 1600 1594 1159 266 21188 137 ----
NM_014671chr741479 597 563 199 31417 1201 244 11261 21469 553
NM_014674chr3113840 3758 3711 3299 2585 2573 1312 980 947 837 311 12810 33863 3698 424 23884 396
NM_014675chr11453 ------
NM_014676chr181680 1631 1612 1546 1439 317 255 207 --1295 --
NM_014677chr831281 903 91 --2890 331 --
NM_014682chr8122286 2125 2119 2020 1897 1872 1560 1539 397 371 226 138 ----21982 1961
NM_014683chr1762124 1653 1452 1365 438 170 --21990 1807 32186 1791 670
NM_014686chr1942523 1993 611 576 1462 --1528
NM_014689chr23628 481 216 1596 1113 --
NM_014691chr153418 299 123 171 1155 --
NM_014699chr162352 338 ------
NM_014701chr15103133 2925 2746 2321 977 880 718 289 228 64 33375 3055 2840 22428 126 --
NM_014702chr6122977 2848 2669 2532 1175 1096 1073 1041 986 963 834 769 43432 2597 2444 943 32774 2148 459 12347
NM_014705chr7121835 1769 1665 1599 1584 1450 619 579 564 509 374 367 21846 426 --11564
NM_014707chr782019 1589 1454 1448 662 656 305 57 1614 21851 1762 1856
NM_014708chr12164 ------
NM_014711chr16122083 2069 2032 2026 1988 1436 1400 1372 834 305 155 33 21724 245 42077 2013 802 782 --
NM_014718chr12----1682 --
NM_014720chr1041453 1400 1318 1283 --1503 11740
NM_014721chr6217367 7309 7171 6899 6473 6274 6181 5871 5754 5472 5453 2498 2038 1833 1439 1343 1049 919 705 467 420 92519 2432 1984 1976 1891 1631 1504 1193 604 87024 6725 6326 4799 2305 1969 1953 728 --
NM_014723chr2032009 1985 1023 ------
NM_014729chr881850 797 724 703 593 181 169 64 22037 810 2583 542 --
NM_014730chr1295286 4612 3511 1900 1699 1278 548 255 77 24628 1667 23937 1020 --
NM_014730chr1295286 4612 3511 1900 1699 1278 548 255 77 24628 1667 23937 1020 --
NM_014733chr592241 2010 1898 1826 1425 792 693 386 169 --2771 201 --
NM_014735chrX61693 1624 1562 1503 1496 581 --32138 1941 267 --
NM_014738chr17----1684 --
NM_014739chr693231 2791 1653 1340 937 643 551 280 221 42583 1266 1018 428 13906 12642
NM_014741chr1152184 2116 1805 805 797 ----1825
NM_014743chr453024 2947 835 562 289 1155 ----
NM_014746chr294392 3919 3413 3286 1545 1492 1321 870 496 14093 --14328
NM_014749chr14------1126
NM_014751chr821770 375 32059 1835 455 --11512
NM_014752chr1151673 1427 557 460 241 3784 304 232 31687 1663 1575 --
NM_014753chr102270 242 --1299 --
NM_014755chr2134268 3797 3087 2767 1641 1449 1211 1077 689 630 352 343 145 43093 1703 822 550 33340 2651 556 --
NM_014757chr572393 2360 2178 2102 1555 1522 78 --22171 45 --
NM_014758chr1162344 2328 1978 1855 1837 1682 --12456 --
NM_014764chr1231293 1075 308 21127 72 ----
NM_014765chr182348 1930 1027 882 190 169 137 94 52523 2010 1043 623 161 --144
NM_014766chr7103473 3413 3187 2988 2787 2652 2617 2605 2513 2495 13551 ----
NM_014772chr1863598 3125 2730 2497 725 707 13113 12329 --
NM_014774chr1113242 3165 3146 2557 2077 1986 1288 1275 449 357 159 --32258 2044 115 --
NM_014779chr36990 887 821 790 756 460 --1100 --
NM_014781chr851194 936 411 144 121 --11225 --
NM_014786chr111335 ------
NM_014787chr192798 2332 2281 2254 2223 2160 1881 481 44 --12175 12647
NM_014790chr5--1118 ----
NM_014793chr151608 --1579 --
NM_014795chr271254 997 878 870 478 400 30 11178 --21064 275
NM_014802chr1241151 1134 1039 56 --11124 --
NM_014803chr10112727 2673 2546 2374 1797 954 814 765 573 510 168 --32820 972 458 --
NM_014810chr143066 607 212 110 11013 --13674
NM_014811chr9----1227 --
NM_014812chr191972 1945 1914 1908 1769 1547 1408 1384 144 --11675 --
NM_014819chr5102286 2244 1926 1918 1810 1750 1563 873 793 92 12217 1440 --
NM_014824chr1141976 1699 807 170 21854 1819 21828 1380 --
NM_014826chr174293 3148 1571 1145 573 348 255 44197 4177 2954 958 11077 24342 516
NM_014827chr151690 1615 1588 595 384 1184 11201 --
NM_014828chr1462542 2242 2205 1982 460 207 --1200 --
NM_014829chr592367 2283 1748 823 659 361 295 190 140 11563 1415 1251
NM_014830chr1293786 3306 3031 2752 2377 1507 1498 1328 1088 --13826 --
NM_014832chr1392046 1422 1415 1404 844 615 442 422 282 21814 672 21983 256 --
NM_014835chr2062189 1841 623 596 586 554 12174 ----
NM_014836chr1061704 1474 1468 621 369 282 1399 2349 243 --
NM_014838chr2232333 2141 612 32403 409 393 1997 --
NM_014839chr182495 2172 2010 1968 753 724 667 572 52336 931 830 550 310 2863 699 --
NM_014840chr1253429 3377 3152 1254 348 1235 11061 23274 2651
NM_014841chr651215 555 281 113 21 1900 ----
NM_014847chr11202 ------
NM_014848chr1552654 2012 1014 643 584 12626 3776 499 469 --
NM_014859chr1751261 1252 1189 1164 959 ------
NM_014860chr251888 794 633 556 169 --3720 703 334 11980
NM_014862chr1524066 3238 1242 ----
NM_014864chr174320 3869 3677 3542 1613 452 145 13104 23645 1350 --
NM_014872chr942002 705 537 530 1757 1627 1486
NM_014873chr1214877 4567 4554 4423 3839 3832 3454 3348 3299 3086 1798 1508 1375 1357 1196 920 662 330 242 132 92 44606 4510 4179 69 34538 4340 3152 2204 153
NM_014876chr2242249 2195 743 294 ------
NM_014877chr17297653 7596 7355 7274 7190 6887 6679 6503 6390 6229 6077 5665 4830 2994 2525 2442 2259 2253 2213 1967 1355 1348 1326 1234 701 692 451 181 134 47763 6310 4972 830 56822 5082 3060 1030 647 12592
NM_014887chr132846 670 2310 186 1761 --
NM_014888chr741605 1496 1480 973 21532 475 11431 3383 267 85
NM_014890chr33344 222 102 --136 1312
NM_014892chr61212 ----1434
NM_014893chrY42249 1469 715 587 1244 21669 370 --
NM_014897chr1793001 2765 2636 2202 2194 2157 862 841 315 31170 575 558 33097 2441 2026 --
NM_014899chr582803 2707 2681 2600 2314 555 305 279 43109 3041 2066 270 11042 11996
NM_014900chr251194 1184 954 430 361 21050 225 ----
NM_014901chr542256 2201 1527 842 ------
NM_014902chr2011192 --11037 --
NM_014903chr1272464 2374 2341 1817 1605 65 35 --32423 2241 1634 --
NM_014904chr10183852 3650 3298 3020 2928 2755 2720 2690 2616 2610 2531 2496 1583 1567 1483 1346 1265 399 32773 1560 1221 --22625 454
NM_014906chr17123753 2954 2664 2534 1646 1237 1214 1204 1190 993 721 673 1833 31563 1222 913 14070
NM_014910chr191190 --2806 199 --
NM_014912chr10213508 3392 3373 3324 3317 3250 3234 3206 3167 3117 3035 2804 2683 2619 2601 2318 2308 1156 607 568 401 11192 33215 2229 2167 --
NM_014913chr1891509 1399 1371 1307 1253 570 377 341 268 ------
NM_014914chr231108 995 941 ------
NM_014915chr1051448 1098 522 303 95 41393 1229 1125 135 11298 1272
NM_014916chr71619 --2745 637 --
NM_014917chr13825 717 152 1974 ----
NM_014918chr1521582 47 --11570 1102
NM_014920chr6123756 3671 3427 2695 2368 1421 1414 632 544 501 461 241 33368 3170 216 43220 2390 357 49 12343
NM_014923chr13102339 1936 1906 1495 1486 729 632 464 72 40 --3739 668 312 --
NM_014924chr1452830 2687 2516 716 194 22037 566 32672 2564 806 --
NM_014926chr351070 385 372 270 28 ------
NM_014932chr351483 636 446 438 25 --31461 605 226 --
NM_014934chr13124019 3933 3725 3576 3179 2500 2465 1547 1170 854 493 303 2816 764 33959 2679 384 22693 794
NM_014936chr6152901 2603 2396 2367 2027 1111 917 908 894 730 474 393 313 297 138 21849 1762 2467 94 21947 584
NM_014937chr1021267 345 2483 71 ----
NM_014938chr1222152 2057 ------
NM_014939chr1861440 1244 1178 504 247 173 --2574 124 --
NM_014942chr6112437 2390 2100 2046 2032 1936 1014 934 878 708 699 --22380 564 --
NM_014946chr2153057 3027 2650 2430 2387 2183 954 858 835 769 629 563 486 424 123 22462 1094 12942 --
NM_014947chr1132863 2197 1219 914 854 831 698 668 458 323 265 169 126 11088 33025 2437 472 --
NM_014949chr111038 1370 1983 --
NM_014950chr1461730 1681 1119 1108 461 227 21691 1364 --1551
NM_014951chr1072653 2481 2364 2308 2106 1862 453 --12318 --
NM_014952chr1522058 1577 --31944 1868 1840 11933
NM_014953chr1384362 4007 2727 2643 348 332 180 100 1529 2921 594 13924
NM_014961chr452159 1761 872 650 543 21744 1557 ----
NM_014962chr2082852 2427 2413 941 707 390 272 65 22419 2271 12538 11067
NM_014964chr1762423 2056 2039 1615 632 590 --2676 611 1468
NM_014969chr141017 446 374 177 21065 1042 ----
NM_014977chr142524 518 ------
NM_014978chr1081853 1800 1704 1663 1647 1491 1464 45 ------
NM_014982chr14225274 4949 4511 4389 4006 3873 3820 3516 3395 3340 3329 1955 1887 1780 1556 1293 1254 1205 1131 1124 750 727 13879 65044 4587 4504 2097 350 210 1308
NM_014988chr452276 2265 2182 2096 762 --32009 1904 1871 --
NM_014989chr692084 2033 2002 1673 1534 758 237 67 39 --11729 --
NM_014990chr1421136 842 --1396 --
NM_014991chr4123274 3206 2917 2885 2833 2827 2789 1225 1184 1024 937 756 11219 22994 2717 --
NM_014996chr33961 742 104 2941 422 2866 687 --
NM_014997chr762705 2317 2228 2028 828 485 22738 1140 ----
NM_014999chr1221551 408 31199 123 92 21100 573 21563 1071
NM_015000chr12152943 2652 2500 2416 2407 2199 2163 2083 1072 1051 971 910 896 685 211 1830 22899 2871 22929 204
NM_015002chr1282221 2025 1803 1424 820 814 580 252 1719 12086 --
NM_015005chr1421293 317 11737 ----
NM_015008chr3123172 3057 2949 2657 1308 1068 945 893 777 684 663 171 12220 ----
NM_015009chr33862 770 246 1164 1311 --
NM_015012chr112377 364 --179 --
NM_015013chr1----1300 --
NM_015015chr1912027 ------
NM_015017chr151034 890 253 204 190 2397 97 ----
NM_015020chr1683825 3328 3031 3023 2997 2457 906 277 22778 2592 13834 --
NM_015024chr841323 1241 1018 528 --1580 --
NM_015025chr262647 2571 567 361 120 87 21064 154 12242 2551 338
NM_015026chr12154020 3967 3828 3073 1758 1745 1703 1336 1305 1143 688 576 495 353 329 63931 3879 3507 1652 1433 694 54699 4538 4132 3523 1620 23222 932
NM_015027chr1631736 1605 1325 --1687 --
NM_015032chr1372754 2547 2030 1785 1140 893 137 31071 745 663 --22436 170
NM_015035chr20106739 6697 5958 1930 1850 1828 1728 1242 746 627 11277 25211 1227 1712
NM_015039chr163678 3420 1623 1050 496 468 14249 24315 1696 --
NM_015040chr283328 3319 3301 2672 2599 2521 2414 781 13344 1693 12746
NM_015042chr1541315 498 233 220 --24329 1204 --
NM_015045chr10132280 2145 2124 2082 2028 1702 1440 661 654 571 484 478 267 22152 304 31623 871 617 11674
NM_015049chr2113026 2850 2624 1164 1101 939 815 760 705 662 605 12020 22234 1016 --
NM_015052chr731209 503 121 --11071 --
NM_015054chr124490 390 94 54 --1430 --
NM_015055chr1182828 2793 2669 2553 2536 2389 914 419 --32933 2610 1893 --
NM_015056chr2132389 2164 33 --32375 2293 1829 --
NM_015057chr131192 ------
NM_015059chr1573984 3032 2773 1560 1453 652 624 --22983 1123 --
NM_015061chr95762 721 693 591 215 --1823 --
NM_015069chr165605 488 425 233 204 --1521 --
NM_015070chr1351573 1405 512 158 92 11187 1486 --
NM_015071chr5156231 6154 6084 6000 5827 5790 5403 4335 2283 1732 1664 986 935 478 436 --36408 5455 5379 15513
NM_015072chr143631 429 96 ------
NM_015074chr1134818 3643 3629 3604 3454 3024 1868 1553 1483 937 851 784 347 --33413 1502 442 --
NM_015075chrX12268 --12028 --
NM_015076chr6124455 4434 4196 4086 3997 3724 3507 2910 1320 1112 1054 416 44523 1371 651 538 23886 3475 --
NM_015080chr112302 280 ------
NM_015087chr13112635 2378 2238 1647 756 573 467 364 320 226 98 1771 1251 --
NM_015091chr143676 536 122 1706 1255 --
NM_015092chr16154642 4632 4425 4403 4368 4011 3885 3631 3539 3205 3136 3057 3027 748 739 23512 1306 11177 13699
NM_015093chr651703 1351 1274 698 689 1661 11364 11197
NM_015094chr2241670 900 859 662 24690 1824 ----
NM_015097chr391584 778 743 472 433 397 357 284 146 21957 1696 32288 812 421 --
NM_015100chr131581 297 108 --1775 --
NM_015107chrX61689 1554 1514 734 542 120 --42429 2294 2231 2034 --
NM_015110chr9152513 2414 2384 2269 1777 1544 885 834 766 643 425 369 269 120 106 1777 32535 2074 1734 1798
NM_015115chr4103077 3008 2824 2794 2395 1220 1182 653 546 193 22095 1235 1831 1389
NM_015120chr2169 2116 40 1280 --
NM_015122chr191230 ------
NM_015129chrX101705 1587 1581 716 676 553 535 246 212 125 161 ----
NM_015130chr451248 1167 526 169 101 11272 1507 --
NM_015132chr731624 1599 1362 1683 31903 1312 220 --
NM_015137chr8152467 2456 2377 2226 1837 1722 1692 1663 1019 820 785 766 217 183 95 1926 22261 729 31757 626 492
NM_015138chr1572804 2001 1860 1849 1728 1033 706 ------
NM_015141chr382734 2366 2342 2274 2164 1803 502 459 12070 --2735 340
NM_015143chr461416 1328 1257 1205 324 284 11302 ----
NM_015144chr1673873 3050 3037 2803 2770 2553 1423 53277 2956 1429 951 116 43950 3847 3760 2925 --
NM_015149chr152147 2018 1528 505 117 --12130 --
NM_015153chr63750 643 606 1544 2713 222 1702
NM_015155chr1062853 1279 1185 1124 370 296 1210 12739 --
NM_015156chr1474012 3701 3307 3218 1475 398 132 --22608 716 23856 1502
NM_015158chr92792 607 --1844 --
NM_015163chr1441820 1667 1266 284 11680 21538 322 --
NM_015169chr82374 335 ------
NM_015170chr872351 2238 2216 2021 1868 1643 1606 --22308 1596 --
NM_015176chr141306 1216 402 198 11360 2581 496 --
NM_015178chr832722 2686 852 ------
NM_015185chrX103031 2840 2761 2273 2237 706 526 353 324 51 ------
NM_015186chr91447 2317 22 1466 --
NM_015191chr1182654 2055 1730 959 912 506 88 56 --1413 11063
NM_015192chr2093009 2774 2670 1999 956 929 896 508 364 --22903 1912 --
NM_015196chr4----1100 --
NM_015199chr3102873 2532 1950 1163 978 833 754 656 532 49 12795 ----
NM_015200chr472351 1702 1008 817 636 558 503 31663 1045 366 1701 --
NM_015202chr1621700 1275 ------
NM_015206chr1593581 3432 3047 2926 2529 1198 1109 812 368 13157 11422 --
NM_015208chr1893417 3408 2597 1513 1399 1248 1161 778 170 43228 2826 998 524 12628 22981 1344
NM_015209chr131767 865 297 22347 1625 12050 --
NM_015213chr114720 533 245 184 1161 ----
NM_015215chr183049 2108 1053 819 727 563 380 40 22503 2310 --23171 1085
NM_015216chr571564 1533 1085 549 516 355 32 ------
NM_015225chr9112640 2615 2414 2095 1199 1100 941 925 264 195 186 32431 875 605 32273 289 29 2631 169
NM_015226chr1653408 3388 714 478 443 --1599 --
NM_015230chr4121872 1703 1662 1502 1464 1382 1355 1171 714 193 129 32 --21669 386 --
NM_015231chr112964 229 --2951 267 1979
NM_015233chr1362698 2217 993 829 516 361 11882 --1432
NM_015236chr461478 1302 1095 1015 943 363 ----1590
NM_015238chr52273 260 --1472 --
NM_015239chr91189 ------
NM_015245chr682738 2708 2562 2555 2119 1926 877 530 ------
NM_015247chr16125260 5230 4962 4881 4040 3899 1366 1315 1267 895 581 158 24181 912 44063 1448 1417 291 1769
NM_015250chr951796 1693 1268 532 370 11839 1358 --
NM_015252chr24818 764 602 333 2133 122 1878 --
NM_015256chr51581 --1156 1181
NM_015262chr105424 194 167 144 136 --1533 --
NM_015265chr2112314 2287 1969 1814 1762 1712 622 604 431 120 52 ----11652
NM_015267chr1232057 1792 317 --11800 1340
NM_015270chr1252366 2357 1969 588 466 --31455 428 416 --
NM_015271chr4104224 4004 3705 3417 3050 3042 1380 696 520 411 33881 3576 3102 43874 3583 3276 2641 14234
NM_015272chr163829 687 339 --2389 160 --
NM_015275chr1281967 1830 1773 1436 742 637 415 180 31698 667 144 11499 11326
NM_015277chr1861500 1323 587 505 431 367 1538 --1297
NM_015278chr6113248 3234 3109 3044 1038 896 747 652 571 248 242 22550 1221 --12571
NM_015282chr262084 423 398 374 131 114 ------
NM_015285chr181152 22236 1846 1641 --
NM_015286chr1582433 2093 1839 662 596 376 212 115 21722 73 ----
NM_015288chr573636 3588 3568 2898 2877 2370 132 12938 21527 1384 --
NM_015291chr193351 3048 2607 1316 1161 1141 1042 226 65 33545 3510 2541 43382 3110 2209 564 --
NM_015294chr1741127 966 787 422 11059 --1763
NM_015296chr1321160 157 11104 31127 309 182 --
NM_015310chr8126316 6188 5791 5582 5450 2015 1798 1780 1254 1244 187 82 68112 7367 7231 5435 3048 2177 88294 8080 6986 6497 6120 5443 3139 140 15147
NM_015313chr11224678 4618 4526 4511 4493 4455 4406 4308 3752 3698 3653 3619 3391 3167 3084 3057 1678 1620 1502 974 852 309 --21811 1490 24558 2919
NM_015314chr772597 2220 2118 1966 1950 1746 216 21818 566 --32037 972 405
NM_015315chr543388 3341 3314 693 23429 728 33459 904 544 --
NM_015316chr1431187 1104 199 ------
NM_015317chr2101816 1799 1792 1000 881 830 695 538 451 170 22237 2064 42526 2038 1111 301 1517
NM_015319chr121458 ------
NM_015321chr1964891 1819 1620 1025 584 564 13322 ----
NM_015323chr691603 1170 1111 1079 568 489 382 285 259 11126 11336 21162 396
NM_015326chr132911 2513 2492 11144 12922 1464
NM_015330chr2211995 ------
NM_015335chr12112375 2363 2264 2155 2128 2066 1841 1812 1699 645 541 32250 2177 609 22650 966 --
NM_015336chr1282587 2527 2299 1979 911 851 617 288 22550 1791 52556 2470 2398 2198 2113 --
NM_015338chr2051460 1250 427 46 32 ------
NM_015339chr2021006 907 1275 ----
NM_015342chr54143 126 118 24 ------
NM_015344chr871932 1539 1514 1501 672 267 156 2647 117 1238 --
NM_015345chr642413 2255 956 79 --12243 --
NM_015347chr12102538 2499 2149 1853 1120 963 870 689 292 266 22997 404 32973 2781 2272 1701
NM_015349chr6132981 2930 2907 2702 2404 2005 1111 680 670 487 426 341 181 --1702 12755
NM_015352chr2053283 3255 1431 493 229 12740 13799 --
NM_015354chr91162 ------
NM_015355chr1781863 1720 1296 1248 356 254 243 141 21656 224 ----
NM_015358chr2171251 1138 1091 1061 368 248 28 --21036 271 1957
NM_015359chr842871 2638 1929 1915 22782 1983 ----
NM_015361chr23691 284 273 1815 ----
NM_015365chrX143943 3890 3880 3857 3783 3638 3528 3046 3022 2926 1180 1028 1004 284 33914 1064 207 11273 --
NM_015367chr2231676 1628 1554 1437 11027 11587
NM_015375chr184999 4119 4014 3994 3899 1189 1006 326 ------
NM_015381chr2241326 752 451 445 --22008 461 --
NM_015382chr142714 702 1227 1577 --
NM_015385chr1063189 2989 2733 2624 2533 28 ------
NM_015387chr292115 1994 1845 1800 1786 800 680 603 565 1745 1154 --
NM_015393chr493786 3107 3085 2647 2624 2605 1520 885 347 31158 996 966 13013 --
NM_015394chr1272329 2279 1859 977 526 408 41 21627 706 2503 98 --
NM_015396chr31428 1530 11230 --
NM_015397chr961814 1462 1421 535 269 184 ------
NM_015407chr31164 ------
NM_015409chr1252716 2622 2251 2047 345 11928 32694 2149 2016 --
NM_015412chr352845 2192 2082 2060 883 1111 ----
NM_015423chr1151588 1409 1079 387 71 11634 1530 --
NM_015429chr361113 1083 1067 870 368 84 1259 3728 350 315 --
NM_015431chr192752 1291 1281 1207 1195 782 621 514 163 ------
NM_015435chr871417 1400 1363 1108 1098 561 282 21387 211 --1394
NM_015436chr493100 3065 2805 2710 2691 2151 2132 961 896 23152 317 32546 1047 300 1452
NM_015443chr1741389 1365 145 137 --21445 1376 --
NM_015446chr191659 1568 1336 1181 1168 1123 474 399 260 2420 190 11507 21642 1143
NM_015455chr5104014 3729 3694 2694 2662 1574 1442 1342 655 350 13372 94142 2843 2633 2554 2522 1056 1012 845 282 44130 3777 395 194
NM_015457chr1121096 345 --1918 --
NM_015458chr8125340 5249 4880 4619 4288 3869 3225 1616 1605 1025 643 246 21381 670 24971 1475 --
NM_015460chr382079 1988 1982 1946 1449 1330 447 301 --1288 12018
NM_015461chr181531 ------
NM_015463chr24829 224 139 49 --1265 --
NM_015464chr71118 145 4920 895 754 111 2821 311
NM_015472chr31203 ----1477
NM_015472chr31203 ----1477
NM_015474chr203251 212 110 ----198
NM_015483chr751134 188 142 123 40 1367 ----
NM_015484chr18957 925 815 797 653 264 239 175 2857 277 --1683
NM_015485chr11294 ------
NM_015496chr81269 --1118 --
NM_015507chrX3447 369 163 1169 ----
NM_015509chr1251527 1352 1228 1220 1147 ------
NM_015514chr145558 504 476 146 139 --1485 --
NM_015520chr352804 2347 1924 1725 908 --1922 12386
NM_015530chr25915 790 645 399 36 1217 ----
NM_015532chr15102630 2565 2456 2236 2223 2190 527 372 315 188 22805 941 22006 275 1254
NM_015535chr283829 2591 1672 1521 1277 1123 909 560 1468 1204 12719
NM_015542chr1041119 1061 1041 924 --1856 --
NM_015548chr64921 871 854 814 1152 ----
NM_015550chr7133532 3498 3483 3295 3280 3257 3229 2922 2906 1434 1092 1001 82 23469 3454 52875 1146 587 532 147 11028
NM_015553chr6135184 4328 3863 3781 3772 3748 1859 1594 1511 1097 1030 968 558 25061 1972 44192 4033 3950 1113 24901 33
NM_015554chr15112876 2686 2665 2356 1817 1784 866 574 451 394 240 22398 805 2852 838 1931
NM_015555chr671625 1347 1124 381 277 162 127 1587 11739 11180
NM_015559chr184939 932 703 684 ------
NM_015560chr392919 2820 2768 2728 2630 2624 1134 736 211 32718 904 722 32867 1081 1043 11955
NM_015564chr592903 2768 2636 2339 1047 653 314 237 149 146 43577 3493 2543 876 1176
NM_015565chr21152302 2259 2250 2194 2035 1782 1584 1418 481 272 242 228 183 133 103 1494 --1436
NM_015567chr1321055 1044 1972 ----
NM_015569chr1124627 4595 4589 4545 3628 3300 902 843 393 301 290 57 13160 54703 4170 3562 3325 259 --
NM_015570chr751350 680 503 460 229 11557 21318 693 --
NM_015571chr6192631 2121 1948 1771 965 917 888 866 721 596 576 495 422 374 304 249 215 115 29 --31701 472 408 12679
NM_015575chr273472 3277 1480 1471 1459 375 348 13635 33532 1260 815 --
NM_015576chr372953 2751 2604 2464 2023 726 207 12488 ----
NM_015577chr551794 1737 1533 1284 1268 ------
NM_015578chr1982118 1529 1456 1431 299 276 221 176 12034 21349 1336 --
NM_015601chr1061023 958 883 712 392 288 2977 826 ----
NM_015602chr111821 21799 1657 ----
NM_015605chr10101604 1520 1501 1410 1349 1323 992 511 162 141 --11162 --
NM_015608chr102642 72 1140 ----
NM_015609chr152327 2291 995 837 486 12983 ----
NM_015610chr742524 1100 1012 552 ------
NM_015622chr71175 ----1247
NM_015626chr1731149 289 249 11056 21223 1030 --
NM_015630chr21354 --2252 156 2844 802
NM_015634chr101412 ------
NM_015635chr971677 1479 676 532 526 215 76 31846 1500 354 --1863
NM_015640chr1175392 5167 4780 4387 3366 3323 2146 1728 1571 1537 1119 917 745 730 635 443 64 35056 1084 530 34421 548 274 14323
NM_015646chr1241163 1071 903 455 1386 1339 1323
NM_015670chr173168 147 124 ------
NM_015675chr192551 63 --1614 --
NM_015676chr141286 ------
NM_015678chr1331578 1221 162 --31629 464 428 --
NM_015691chrX92940 2172 2037 1970 1847 426 357 88 46 2399 231 --1160
NM_015693chr41248 ------
NM_015695chr662148 2090 2030 1861 528 232 ----11880
NM_015702chr23305 91 44 ------
NM_015713chr8143629 3513 3274 2834 2769 2620 1376 1014 678 566 558 413 336 57 --53314 2761 2352 865 195 --
NM_015725chr192520 161 --1501 --
NM_015726chr1101845 1738 1682 1564 1552 1247 613 600 525 286 21212 114 --11432
NM_015833chr2142142 859 352 276 1451 12166 --
NM_015844chr183983 748 696 1973 ----
NM_015846chr183983 748 696 1973 ----
NM_015847chr183983 748 696 1973 ----
NM_015850chr862240 861 835 821 671 526 12061 21986 811 --
NM_015852chr763595 3442 3172 2822 1249 1210 23303 2773 73193 3134 2614 2521 2451 2422 2223 13635
NM_015866chr121123 998 11246 ----
NM_015869chr31171 1133 ----
NM_015879chr18208648 8558 8461 8156 7501 7401 7021 6961 6674 5347 5228 5214 3087 2768 1736 1509 1007 631 597 268 17087 17986 --
NM_015885chr114765 692 356 327 1773 2549 303 --
NM_015886chr8175539 5508 4716 4586 4238 4222 3732 3577 3516 3499 3480 2207 2196 850 324 200 180 15076 105578 5464 5063 4626 1925 1864 1738 1372 610 97 --
NM_015888chr1113400 3309 3299 3256 2834 2272 1276 1061 1046 861 362 23334 126 3826 804 64 32127 2078 300
NM_015891chr651489 666 470 58 52 --32065 1744 540 1416
NM_015895chr61161 ------
NM_015902chr82928 888 --2668 598 --
NM_015906chr1144625 4544 4119 3903 3686 3631 3030 3009 1503 758 618 606 356 337 43838 1854 1138 496 64063 3863 3140 1685 1563 1119 --
NM_015920chr152210 141 --1626 1497
NM_015938chr36930 763 723 381 285 260 1397 --1895
NM_015942chr8----166 --
NM_015946chr54734 669 638 262 1509 2558 146 --
NM_015949chr72875 730 ------
NM_015952chr61103 ------
NM_015956chr191224 ------
NM_015957chr112261 70 ------
NM_015962chr1441586 560 316 124 --21550 1181 --
NM_015967chr16988 416 314 304 298 278 --1914 --
NM_015975chrX3681 205 121 1375 11333 --
NM_015980chr541616 1585 1361 183 --1275 --
NM_015986chr1771272 1195 1153 955 344 297 204 21258 75 11328 1147
NM_015994chr145698 657 233 151 90 ------
NM_015995chr1585599 5461 5172 4599 4013 2140 1662 1034 --14198 --
NM_016002chr13740 220 63 1750 1230 --
NM_016003chr742524 1100 1012 552 ------
NM_016009chr1104839 4375 3902 3778 3745 1478 1460 573 259 164 24942 414 44755 4608 1451 485 13835
NM_016018chr8102827 2728 2681 2671 2510 2368 1993 1047 892 347 --22380 2028 21974 1832
NM_016021chr682940 2689 2475 906 812 623 234 94 22318 920 22118 297 11979
NM_016023chr881992 1816 1643 1477 849 829 762 587 31743 1662 563 42031 1834 1632 263 --
NM_016025chr1621521 286 21360 1235 1278 --
NM_016027chr84515 446 140 31 2374 74 --1124
NM_016028chr113982 204 36 2964 52 ----
NM_016032chrX11311 ------
NM_016037chr161186 1091 957 769 216 207 ------
NM_016040chr182408 2254 2198 2170 1789 817 619 188 22743 2131 32289 210 97 --
NM_016045chr2081578 1562 1392 1261 1183 668 530 60 21295 73 41634 539 468 91 --
NM_016048chr53949 937 234 --1839 --
NM_016061chr231403 1142 177 11189 11682 --
NM_016070chr172248 65 ------
NM_016072chr12142443 2416 2306 2287 2125 2095 1580 701 573 517 412 379 346 248 32361 2219 972 21786 1735 --
NM_016075chr13123116 2877 2658 2450 2203 2137 2038 1998 1945 541 371 37 13180 1899 --
NM_016076chr1112901 2440 2067 2034 1123 1101 909 646 430 381 144 22508 811 33235 999 89 1993
NM_016078chr1761120 1028 847 834 801 22 ------
NM_016081chr482228 2182 2124 1829 1790 1684 1542 1419 --1342 --
NM_016083chr6133849 3835 3666 3270 2964 2810 2790 2454 1410 725 662 608 477 --33763 420 89 23878 3283
NM_016087chr761534 1507 1356 1249 1080 560 21495 471 1159 21447 1367
NM_016090chr11--1393 2770 72 1299
NM_016096chr881872 1804 1651 1505 1368 609 304 79 21515 1487 11390 --
NM_016097chr18277 58 --1321 11069
NM_016098chr64504 403 129 111 ----1192
NM_016100chr202346 57 1147 --141
NM_016104chr61103 ------
NM_016107chr581387 1371 1365 427 403 372 285 245 1252 2925 866 2465 381
NM_016118chr72739 85 --2820 752 --
NM_016120chrX7886 842 791 771 126 89 64 ----1184
NM_016121chr11930 ------
NM_016125chr171475 1504 1458 1380
NM_016131chr252387 820 714 366 239 32010 783 135 199 --
NM_016132chr15113356 3126 2729 2672 2584 2377 2122 1131 1087 1031 86 22253 581 2968 534 --
NM_016133chr241432 489 457 218 11655 41587 1365 1341 374 --
NM_016138chr1641527 473 258 91 ----31299 1286 310
NM_016144chr53290 105 50 --2483 191 --
NM_016147chr1121139 449 ------
NM_016166chr151186 --1174 --
NM_016169chr1022997 2454 2532 506 ----
NM_016200chr73711 270 140 ----1282
NM_016203chr73833 680 278 ------
NM_016205chr431466 1387 589 --21372 1295 --
NM_016206chr3228760 8471 8416 7291 7155 6978 6673 6001 5905 5492 3409 3268 3198 2283 1941 776 577 539 458 443 399 261 78691 7562 6705 6405 6049 3182 978 78947 7554 6495 6228 5965 1975 1743 35634 1025 769
NM_016213chr15--1180 1154 --
NM_016217chr673305 3255 3105 2827 2670 2587 117 32868 48 31 32812 2632 1396 22970 1222
NM_016218chr57901 848 836 411 379 290 139 147 ----
NM_016224chr681923 1744 1358 737 414 246 234 36 1143 1466 1302
NM_016226chr121181 --2387 105 --
NM_016230chr62536 202 1190 ----
NM_016231chr1761393 1176 411 195 151 85 ----1213
NM_016248chr1393934 3838 3617 2988 2883 2814 2537 1231 518 52514 815 767 736 591 43348 2957 2786 176 23019 26
NM_016252chr24624 198 192 65 1319 ----
NM_016255chr6153367 3318 3236 3057 2837 2312 2291 1281 1033 969 862 633 349 276 151 11232 22259 257 1981
NM_016258chr11251 ------
NM_016260chr2266983 6743 6729 6686 6567 6139 5933 5862 5782 2911 2872 2543 2362 2000 1635 1518 1362 934 851 773 748 676 510 241 140 106 46949 6582 5389 1246 67475 6575 5099 5022 4910 288 27634 6086
NM_016261chr175828 822 743 663 65 --2692 53 --
NM_016262chr62590 437 --3631 115 24 --
NM_016269chr41856 1998 ----
NM_016271chr1852197 2072 548 311 285 32346 343 265 31450 905 618 12064
NM_016275chr3102586 2459 2241 2108 800 718 640 408 395 326 --2187 119 1467
NM_016277chr641392 650 486 150 11174 1430 11117
NM_016279chr53509 494 437 --2501 479 --
NM_016281chr1241174 1047 834 795 3848 471 349 ----
NM_016282chr991714 1606 1488 1414 1318 572 139 118 70 21330 657 2589 340 11170
NM_016284chr161925 ------
NM_016287chr181458 1296 638 359 254 174 102 48 --32084 1449 85 --
NM_016289chr22911 693 --1606 21681 707
NM_016300chr32181 34 ------
NM_016302chr33797 704 58 ----1182
NM_016303chrX4400 159 84 48 ------
NM_016306chr33384 92 49 ------
NM_016308chr1122009 1859 1848 1762 1701 1460 1352 1277 711 244 46 34 ----11398
NM_016312chr122406 106 --2429 415 1440
NM_016315chr271662 1622 1552 1410 1395 1161 658 41737 1634 178 72 2210 120 1113
NM_016316chr2--1194 3715 554 297 --
NM_016322chr972701 2626 2122 2071 1006 476 61 1705 ----
NM_016323chr4278 29 --1258 --
NM_016338chr551205 1034 845 326 212 ------
NM_016340chr52429 163 1338 21186 954 11283
NM_016351chr75592 584 566 560 439 ------
NM_016352chr721409 1285 --1487 --
NM_016355chr122420 358 1381 ----
NM_016356chr6112448 2331 2200 1896 1012 860 659 454 410 192 57 12322 22783 644 32809 2413 2296
NM_016357chr1231217 958 362 --21192 450 1793
NM_016374chr141268 423 363 184 31224 994 103 1389 --
NM_016374chr141268 423 363 184 31224 994 103 1389 --
NM_016376chr1784073 3826 3810 3171 1739 1183 1062 542 34300 4061 3393 21654 1495 --
NM_016377chr681723 1484 1445 1347 1310 1143 638 616 31227 1106 374 31418 550 133 --
NM_016395chr1551786 1343 1291 704 175 1321 21759 639 1559
NM_016396chr15153039 2953 2880 2795 2590 2334 1871 1004 994 655 633 610 457 360 115 22419 411 22405 699 --
NM_016404chr11142 --1143 --
NM_016410chr96607 597 542 240 142 61 --2645 177 --
NM_016422chr11103009 2742 2732 1277 871 829 602 438 121 45 23068 2488 32229 727 215 --
NM_016423chr142392 319 ------
NM_016424chr173467 443 217 1524 11774 1428
NM_016436chr2072683 2671 1094 1084 1015 532 66 1882 --1985
NM_016441chr2122257 2126 1818 1756 1725 866 847 687 681 402 274 247 12211 11991 --
NM_016442chr592310 2286 2201 2182 1784 1651 1539 770 742 1753 32277 2171 41 22298 1831
NM_016448chr141805 1626 1540 1512 1610 31231 1191 502 --
NM_016454chr151234 ------
NM_016463chr5----1153 --
NM_016468chr142175 74 ----1228
NM_016472chr1451495 1422 1413 1096 1047 11071 21378 1266 11078
NM_016475chr1471186 1173 1032 514 497 437 379 --1913 --
NM_016480chr55893 805 730 720 139 --1880 --
NM_016485chr662177 2087 1407 737 379 29 31718 766 651 ----
NM_016486chr11420 ----1499
NM_016499chr112564 515 2547 63 ----
NM_016507chr17123216 2797 2706 2325 2293 2238 2227 2096 1947 1251 924 577 --43148 2159 1139 620 --
NM_016512chr81254 ------
NM_016513chr6123756 3671 3427 2695 2368 1421 1414 632 544 501 461 241 33368 3170 216 43220 2390 357 49 12343
NM_016516chr25859 778 691 601 594 --2734 351 1335
NM_016518chr173884 721 259 ------
NM_016519chr43357 173 24 2534 501 ----
NM_016522chr1121196 215 21467 1401 21046 164 --