TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548m
miRNA Sequence: CAAAGGUAUUUGUGGUUUUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521200 970 ------
NM_000037chr832443 2411 808 --1426 --
NM_000038chr551815 1763 1638 1354 161 12022 12005 --
NM_000051chr1173539 3238 2320 2295 2241 751 81 42952 1307 58 37 52331 1353 1269 726 691 --
NM_000052chrX83079 2877 2347 904 757 527 73 66 --43202 2943 1373 158 --
NM_000055chr3--1144 1364 --
NM_000059chr135881 802 248 205 42 --1187 --
NM_000067chr84557 524 270 72 ------
NM_000081chr121638 676 --11296 11856
NM_000084chrX56079 5295 4271 2443 2044 21339 661 15920 11965
NM_000088chr171263 --1179 --
NM_000090chr23928 698 358 1706 ----
NM_000092chr254513 3629 3575 736 507 ----23825 1186
NM_000108chr761708 1678 1567 1543 1452 119 11857 --11599
NM_000109chrX52632 2292 2206 2156 751 ------
NM_000110chr12293 57 11163 --1450
NM_000112chr535365 4267 1760 15321 55477 5178 5067 1517 684 14906
NM_000115chr1362566 2357 2025 1830 818 464 1410 11987 1727
NM_000125chr673637 3374 3360 1566 916 387 219 13836 23248 3206 --
NM_000127chr81302 ------
NM_000138chr1562442 2377 1957 1623 223 101 --12359 --
NM_000161chr144719 614 203 188 --41850 1537 758 752 11688
NM_000163chr572282 2196 2092 1958 890 434 90 --1134 --
NM_000167chrX81509 1427 1416 1321 713 692 674 360 --1249 11684
NM_000168chr783105 2872 2608 2561 2033 1100 779 550 --43298 2704 1317 1226 1862
NM_000176chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_000194chrX3542 143 116 ------
NM_000214chr2041457 1414 1314 1137 --1433 --
NM_000217chr12144960 4840 4583 4290 3338 2060 1981 1919 1752 1140 1080 432 357 103 14505 35371 3346 1271 11659
NM_000222chr421740 1679 ----11580
NM_000232chr452532 2171 925 47 35 1649 1418 1672
NM_000237chr81388 173 ----
NM_000248chr32586 490 11070 1819 --
NM_000252chrX21493 144 1236 21389 1272 --
NM_000254chr142935 1847 1081 66 --122 --
NM_000255chr64441 135 125 107 --1324 --
NM_000259chr15156233 6037 5843 5437 5260 5225 4958 4940 4921 4903 4671 2076 1513 1315 154 --15459 1202
NM_000264chr9----32989 2418 744 --
NM_000266chrX2630 373 1717 ----
NM_000267chr1792460 2373 2351 2275 690 501 486 372 199 23434 281 42294 781 213 187 --
NM_000276chrX52231 1858 1750 612 421 1590 11709 1183
NM_000284chrX51703 465 300 227 27 --21843 714 --
NM_000297chr451556 649 507 476 313 --21962 1836 11622
NM_000304chr1721060 202 ------
NM_000314chr1053007 2588 2431 586 67 12639 1225 22915 2714
NM_000321chr1341314 452 343 109 --11106 --
NM_000325chr41199 --1644 --
NM_000329chr13896 808 797 ------
NM_000332chr6216880 6101 5225 5041 5022 5004 4754 4726 4617 2786 2588 2492 2132 2105 1962 1844 1392 1045 983 286 98 32011 1515 639 14841 11114
NM_000333chr34979 867 390 41 --2725 90 --
NM_000337chr5155273 5220 4791 4518 4468 2645 1714 1471 1452 1409 696 603 474 407 43 12289 11705 --
NM_000338chr154936 807 330 68 1852 ----
NM_000346chr1781937 1811 1703 1504 1494 1301 735 293 --21962 1361 --
NM_000362chr2273614 3419 3072 1373 1289 1276 776 ------
NM_000368chr994482 4425 4311 3583 3124 3059 900 347 281 1875 11418 --
NM_000378chr111952 ----1198
NM_000391chr1161662 1341 452 438 271 206 --11494 --
NM_000393chr251966 1677 1641 712 263 --21408 737 --
NM_000399chr103912 864 749 --21203 1040 --
NM_000408chr293180 2907 2471 2148 2119 1000 813 543 178 33423 3008 2777 43119 2440 1357 109 --
NM_000411chr2133110 1174 644 22332 350 21265 1214 --
NM_000430chr1763429 3422 3250 2555 1443 1085 12613 ----
NM_000436chr541429 1398 446 304 21560 1033 ----
NM_000437chr162045 1804 799 720 409 155 ------
NM_000439chr542044 512 219 124 --12009 --
NM_000441chr752019 783 695 494 483 --22204 1986 --
NM_000442chr1731303 1236 341 ------
NM_000447chr1197 ----1431
NM_000448chr1173113 2220 2136 1052 533 480 432 1559 23236 817 --
NM_000449chr161311 570 533 453 301 174 ------
NM_000461chr363847 3539 3462 3041 1477 454 33855 815 431 33419 1468 913 --
NM_000462chr1561759 1644 1429 1223 369 335 11730 1466 --
NM_000474chr7--2457 191 1664 --
NM_000480chr1161560 1519 1265 464 419 30 --21660 354 --
NM_000484chr213881 369 125 1718 ----
NM_000486chr1293219 2826 2737 2484 2312 1000 805 365 246 ----13117
NM_000489chrX53264 2447 775 639 48 --42406 569 444 140 11016
NM_000493chr61848 1970 ----
NM_000503chr861804 1755 1447 636 549 494 --2437 147 --
NM_000508chr42918 869 1899 --1201
NM_000509chr41189 --128 --
NM_000523chr251167 741 401 372 60 ----11066
NM_000533chrX41966 1785 1339 582 11954 21244 89 --
NM_000538chr1361812 1349 574 297 176 38 21696 1312 1213 --
NM_000544chr6_cox_hap173121 2940 2490 2178 1198 1185 478 --33302 2472 1206 13345
NM_000545chr12--11292 ----
NM_000555chrX166707 6515 5921 5898 5711 5520 5346 5292 4905 4821 3158 2369 1325 915 859 277 25854 2206 15652 35886 5641 2417
NM_000575chr23887 863 405 ----1414
NM_000582chr44504 424 418 357 --1397 --
NM_000585chr41215 ------
NM_000596chr7----1117 --
NM_000598chr731419 197 40 1440 11505 --
NM_000599chr274596 3925 3884 3357 3086 1408 1050 14364 ----
NM_000602chr711310 1184 1122 11505
NM_000610chr1192927 2920 2653 2535 699 632 332 262 111 12818 22174 1112 --
NM_000611chr11147004 6801 6548 5154 1785 1766 1652 1459 1195 1090 1073 730 645 373 --21001 704 --
NM_000615chr1162946 2918 2788 2246 473 420 --22547 786 1152
NM_000618chr12156525 6356 6223 6162 6111 6047 4676 4425 2228 2208 1904 1566 1063 282 228 1510 56595 5856 5811 5661 4979 --
NM_000618chr12156525 6356 6223 6162 6111 6047 4676 4425 2228 2208 1904 1566 1063 282 228 1510 56595 5856 5811 5661 4979 --
NM_000627chr21600 1884 1889 --
NM_000633chr1885127 4908 4772 3965 3889 3435 1491 781 24198 3943 --35070 5036 3701
NM_000663chr1622139 931 32829 2780 2486 ----
NM_000668chr431043 319 271 1330 ----
NM_000675chr222256 124 143 2794 48 --
NM_000676chr17----1356 --
NM_000684chr1011162 1304 11105 --
NM_000685chr33865 762 143 --198 --
NM_000685chr33865 762 143 --198 --
NM_000693chr1531426 1270 724 --21641 663 11250
NM_000719chr1295244 4915 4614 4417 2376 1889 858 844 725 --11748 --
NM_000720chr31124 ------
NM_000721chr11318 --11672 --
NM_000724chr1031697 1298 495 --1177 --
NM_000726chr221328 586 --11049 --
NM_000788chr461406 1137 978 523 161 58 31475 1455 1042 --11362
NM_000793chr1474933 4708 3555 3508 3218 1714 399 13811 1975 --
NM_000809chr4239076 8452 8371 7463 6609 6259 6233 6018 5607 3557 3518 3463 2999 2927 2832 2642 2622 2584 2195 2062 1705 576 430 26511 778 39321 6871 6571 47474 6147 2739 2305
NM_000810chr151148 1571 2496 101 --
NM_000811chr52276 214 ------
NM_000813chr595373 5364 4599 4447 4394 4309 2053 1720 115 11934 ----
NM_000814chr1583825 2638 1642 1471 1395 1115 466 361 --12692 11196
NM_000816chr51186 1493 ----
NM_000824chr45931 822 802 692 83 ------
NM_000826chr472436 1656 337 260 250 193 183 --22415 1024 --
NM_000827chr572466 2351 2139 1891 1847 974 626 --12146 --
NM_000828chrX3221 172 134 ----1618
NM_000829chr1152275 706 556 364 26 ------
NM_000836chr191243 ------
NM_000838chr662514 1978 1811 1754 1013 156 62212 2057 1873 1783 1736 291 22754 1967 --
NM_000842chr112480 188 --1252 --
NM_000844chr361124 1113 991 734 398 180 ------
NM_000855chr111358 --1335 --
NM_000859chr531660 1588 1573 --21719 1531 --
NM_000860chr4101687 1675 1525 1487 1299 1262 1209 474 406 63 21307 682 1278 --
NM_000868chrX32500 1797 144 12379 ----
NM_000872chr1021036 123 --21414 570 --
NM_000875chr15116544 6022 5948 5939 5734 5535 4829 2675 1296 1223 516 21215 241 54358 2824 1734 1456 509 1504
NM_000876chr631255 1229 231 1943 --1100
NM_000883chr7154 ------
NM_000883chr7154 ------
NM_000891chr1783224 2828 2697 2366 931 786 373 32 --11417 --
NM_000899chr1294393 3824 3248 2821 1634 1450 809 702 28 1122 34319 3796 3663 --
NM_000901chr492575 1976 1953 1920 1794 1771 760 639 29 22071 792 31731 962 867 12512
NM_000912chr853539 3497 3490 776 595 1119 ----
NM_000917chr106995 840 779 385 279 160 ------
NM_000921chr121181 ------
NM_000922chr1141034 719 387 278 ----1983
NM_000935chr331018 900 149 ------
NM_000944chr42694 360 12045 3760 722 232 --
NM_000945chr261878 1800 786 587 290 31 12059 --1454
NM_000949chr52876 853 --1212 --
NM_000950chrX83156 2973 2588 2520 2312 2215 1375 515 --33203 1213 888 --
NM_000958chr54996 850 393 148 ----1873
NM_000965chr341200 849 193 38 --11271 --
NM_000990chr1173783 3705 2832 2504 1486 1356 438 23446 1220 140 --
NM_001001132chr2141463 306 179 133 --1968 --
NM_001001323chr1283149 2845 2784 2356 2122 2103 1128 902 --22886 757 --
NM_001001330chr104496 353 327 128 --11137 --
NM_001001389chr1192927 2920 2653 2535 699 632 332 262 111 12818 22174 1112 --
NM_001001390chr1192927 2920 2653 2535 699 632 332 262 111 12818 22174 1112 --
NM_001001391chr1192927 2920 2653 2535 699 632 332 262 111 12818 22174 1112 --
NM_001001392chr11102973 2966 2699 2581 745 678 378 308 157 64 12864 22220 1158 --
NM_001001395chr1232807 2164 880 --31096 844 52 12405
NM_001001396chr1143966 3878 3741 3687 3315 3108 2908 2770 2710 1581 1554 1313 1069 365 12733 11747 --
NM_001001419chr5145235 4772 4681 4300 4282 3934 3783 3705 3688 1020 883 841 745 282 21700 856 63662 3352 1902 1071 943 654 1420
NM_001001420chr5145235 4772 4681 4300 4282 3934 3783 3705 3688 1020 883 841 745 282 21700 856 63662 3352 1902 1071 943 654 1420
NM_001001433chr2083175 3133 3076 2825 1976 481 223 130 ------
NM_001001436chr162869 609 2802 566 ----
NM_001001481chr831038 486 86 --13147 11027
NM_001001484chr1072417 2392 2084 1641 831 493 144 --2861 617 --
NM_001001521chr2186 1269 ----
NM_001001549chr742615 1145 966 395 22744 2300 1377 --
NM_001001550chr742615 1145 966 395 22744 2300 1377 --
NM_001001555chr742615 1145 966 395 22744 2300 1377 --
NM_001001664chr2134083 4027 3674 3647 3089 2620 2588 935 860 508 270 249 219 1847 33175 2773 1141 --
NM_001001668chr1963906 3491 3353 3179 977 167 34268 4055 985 12717 --
NM_001001701chr452235 1484 1444 870 632 --21848 1493 --
NM_001001877chrY--142 ----
NM_001001890chr21163741 3695 3652 3603 3568 3207 3110 3100 2977 2836 1465 1174 775 664 651 390 --13363 --
NM_001001928chr22148340 7936 7756 7418 7166 7145 7100 6996 6981 6209 5749 2395 423 25 23190 1740 46323 5146 1234 160 --
NM_001001933chr11434 1169 ----
NM_001001971chr1041364 967 880 508 11265 ----
NM_001001974chr1052256 2247 2207 1871 1765 --1866 12357
NM_001001994chrX1451 ------
NM_001001995chrX3762 254 175 --11656 11391
NM_001001996chrX1451 ------
NM_001002233chr861696 669 626 459 181 74 --1603 1228
NM_001002243chr21312 ------
NM_001002244chr17--1117 ----
NM_001002245chr17--1152 ----
NM_001002246chr17--1152 ----
NM_001002247chr17--1152 ----
NM_001002248chr17--1152 ----
NM_001002249chr17--1152 ----
NM_001002255chr6------1329
NM_001002257chr283323 3145 2346 1272 1143 1092 1037 59 --22220 826 --
NM_001002265chr101719 2776 600 2675 76 --
NM_001002266chr101719 2776 600 2675 76 --
NM_001002296chr861403 1324 427 410 269 228 --11107 --
NM_001002811chr171615 1562 1504 1487 1396 1304 179 ------
NM_001002812chr171615 1562 1504 1487 1396 1304 179 ------
NM_001002812chr171615 1562 1504 1487 1396 1304 179 ------
NM_001002814chr8103868 3693 3639 3266 904 669 626 459 181 74 --33942 919 603 1228
NM_001002838chrX71879 1673 1538 1408 584 356 118 --21855 522 --
NM_001002843chr152968 336 21168 370 1429 --
NM_001002857chr152308 293 ------
NM_001002858chr152308 293 ------
NM_001002860chr1494474 4390 3835 3814 3728 3376 2949 1609 263 --33618 399 384 11230
NM_001002906chrY1457 ------
NM_001002909chr1762116 1838 1385 629 508 430 --31649 1431 498 --
NM_001002919chr22387 46 ----177
NM_001003407chr1074211 3777 1663 1119 797 491 259 ------
NM_001003408chr1074211 3777 1663 1119 797 491 259 ------
NM_001003652chr18238636 8630 8013 7739 7516 7206 6932 6896 6841 6708 6601 5677 5647 3307 3253 3215 2234 1866 1782 1640 1144 724 598 37419 7082 417 47302 6673 1830 554 --
NM_001003674chr1896793 6346 5956 5290 4919 2645 1047 828 590 1466 46866 5628 5321 2691 36981 6244 2636
NM_001003675chr1896793 6346 5956 5290 4919 2645 1047 828 590 1466 46866 5628 5321 2691 36981 6244 2636
NM_001003681chr2261975 1527 481 409 280 175 1752 ----
NM_001003688chr431233 1132 1083 1255 --11169
NM_001003712chr1283763 3360 3040 2890 1550 536 158 143 11021 73643 3469 3021 2934 2665 1401 152 12792
NM_001003792chr34766 436 143 31 --1350 --
NM_001003793chr34766 436 143 31 --1350 --
NM_001003800chr9103610 3510 3397 3132 2722 2693 2438 1241 1160 1137 23573 2284 11172 --
NM_001003895chrY1304 --154 --
NM_001003940chr1553796 3493 1361 1171 210 11111 23851 849 --
NM_001003942chr1553796 3493 1361 1171 210 11111 23851 849 --
NM_001003943chr1553800 3497 1365 1175 214 11115 23855 853 --
NM_001003945chr951873 1226 663 318 248 --1681 --
NM_001004023chr11218 ------
NM_001004065chr993636 3304 2951 2929 2907 2598 1577 944 220 ------
NM_001004125chr961116 950 863 345 127 112 2970 910 --21092 782
NM_001004196chr331091 972 146 11059 2503 496 --
NM_001004303chr15765 686 675 526 317 --1203 --
NM_001004303chr15765 686 675 526 317 --1203 --
NM_001004304chr1222110 595 13157 13196 1772
NM_001004308chrX41480 550 460 24 3421 409 72 --11066
NM_001004317chr643308 2738 860 646 --34428 3515 490 --
NM_001004329chr1221511 422 --11125 --
NM_001004342chr1105949 5018 4331 2043 1611 1233 790 629 600 274 24826 4024 46052 5796 4192 503 --
NM_001004346chr43987 938 781 168 ----
NM_001004354chr921030 56 --1991 --
NM_001004360chr251672 1408 1263 395 349 --12008 3694 621 434
NM_001004419chr1244157 552 542 464 24525 103 24614 637 1713
NM_001005158chr32495 29 ------
NM_001005159chr32495 29 ------
NM_001005242chr1241620 529 178 94 ------
NM_001005266chr151183 ----1732
NM_001005267chr151183 ----1732
NM_001005268chr151183 ----1732
NM_001005269chr151183 ----1732
NM_001005271chr1751164 928 418 271 194 1409 ----
NM_001005273chr1751164 928 418 271 194 1409 ----
NM_001005335chr19--1229 ----
NM_001005366chr124749 649 618 256 172 1901 --
NM_001005375chrY21878 236 --21306 701 --
NM_001005386chr262430 2358 1785 667 503 62 12392 --1351
NM_001005404chr1784429 4285 3958 3210 2797 1073 750 146 --24121 3141 --
NM_001005463chr10102186 1721 1694 1684 1044 902 769 658 225 97 ----11994
NM_001005473chr5136523 6493 5606 5322 5034 4941 4583 4515 4088 4080 2597 2198 362 14822 56670 5423 5415 4905 2325 11281
NM_001005474chr361421 1234 1057 507 261 82 --11470 11198
NM_001005476chr21626 ------
NM_001005502chr1274804 4096 3430 3223 2042 1227 572 --24758 4733 --
NM_001005527chr321236 397 ------
NM_001005739chr22672 334 --2860 735 --
NM_001005743chr142202 24 --21268 973 --
NM_001005744chr142202 24 --21268 973 --
NM_001005745chr142202 24 --21268 973 --
NM_001005746chr221328 586 --11049 --
NM_001005747chr221328 586 --11049 --
NM_001005753chr262303 2106 2042 2025 904 219 --21841 306 --
NM_001005781chr21485 --2521 246 --
NM_001005782chr22934 254 --2970 695 --
NM_001005845chr851811 1562 761 471 76 11260 1439 --
NM_001005849chr172473 406 ------
NM_001005861chr36953 721 344 264 153 127 3700 403 199 ----
NM_001005862chr17----1488 --
NM_001006600chr522147 1506 21719 1621 1443 12099
NM_001006605chr141164 1020 806 325 144 21175 992 --
NM_001006605chr141164 1020 806 325 144 21175 992 --
NM_001006610chr164872 800 787 244 ------
NM_001006623chr27843 505 473 431 301 242 137 1870 22465 1034 --
NM_001006657chr272731 2647 2585 2070 1238 936 258 --12656 --
NM_001006684chrX----2436 69 188
NM_001006945chr11470 --2217 202 --
NM_001006946chr251382 1334 1292 655 231 ------
NM_001007023chr1474933 4708 3555 3508 3218 1714 399 13811 1975 --
NM_001007024chr17104214 3948 3911 3709 3385 3111 1744 1512 1476 731 --13135 --
NM_001007025chr17104214 3948 3911 3709 3385 3111 1744 1512 1476 731 --13135 --
NM_001007097chr994987 3966 3864 3293 1955 1774 1720 1266 527 14790 ----
NM_001007102chr681330 1193 596 399 388 328 254 213 1668 2654 244 --
NM_001007237chr142427 2150 1860 530 --11933 --
NM_001007245chr72645 106 ------
NM_001007246chr2161725 1680 1581 1530 1292 1191 11589 ----
NM_001007267chr21769 1634 --1229
NM_001007277chr111886 ------
NM_001007466chr6114965 4497 3919 3445 3320 1303 1132 1105 425 134 55 --55026 4028 3950 1071 286 --
NM_001007553chr151111 411 379 361 334 --21163 498 --
NM_001007559chr1852044 773 718 399 153 --1356 11794
NM_001007794chr11685 1120 --1520
NM_001008222chrX31396 557 22 ------
NM_001008239chr1893502 3198 2388 1310 1190 1015 798 563 297 23078 277 --23084 2371
NM_001008392chr333089 945 464 --1405 --
NM_001008408chr7176289 6225 5825 5762 5389 4697 4640 4404 4372 2106 2030 2011 1965 1454 1161 531 415 24925 4764 22560 1272 --
NM_001008491chr242058 1370 738 497 --21950 1411 2633 187
NM_001008492chr242058 1370 738 497 --21950 1411 2633 187
NM_001008495chr861837 1601 1544 1484 617 358 ------
NM_001008540chr2142 ------
NM_001008541chr1031478 944 605 ----11866
NM_001008541chr1031478 944 605 ----11866
NM_001008564chr1372068 1742 1578 881 834 414 169 ------
NM_001008567chr91254 148 ----
NM_001008660chr1141594 1545 1536 487 11187 21081 437 11106
NM_001008707chr143294 190 136 --1330 --
NM_001008726chr143625 502 289 21084 571 ----
NM_001008738chr562596 2461 2406 773 734 189 --32107 1797 1104 1630
NM_001008744chr1451420 1323 1134 359 118 1208 --1159
NM_001008783chr61906 --1276 --
NM_001008860chr151112 --2758 150 --
NM_001008892chr151112 --2758 150 --
NM_001008894chr151112 --2758 150 --
NM_001008895chr1331434 1079 145 --31305 1056 182 --
NM_001008897chr64536 172 136 52 ------
NM_001008925chr433425 2400 574 12301 11229 --
NM_001009554chr483970 3927 3170 1778 793 519 292 277 44657 4323 3617 1035 24283 3802 --
NM_001009554chr483970 3927 3170 1778 793 519 292 277 44657 4323 3617 1035 24283 3802 --
NM_001009555chr43689 650 368 21369 589 11649 21700 1656
NM_001009814chr13192 ------
NM_001009880chr2283884 3742 3721 3557 3228 1313 1293 647 --24609 4047 --
NM_001009881chr12645 498 ------
NM_001009882chr12645 498 ------
NM_001009894chr1221450 1261 --11548 1590
NM_001009899chr3196390 6112 5826 5543 5404 5383 5198 5047 4608 4505 4403 4267 4256 4041 4017 2590 1831 980 129 35727 4195 546 54993 4838 1761 216 190 24786 1505
NM_001009909chr1153695 3514 2869 1148 102 23086 1274 ----
NM_001009955chr11196 --1157 --
NM_001009955chr11196 --1157 --
NM_001009959chr231704 967 81 --42530 496 390 221 2658 445
NM_001009960chr74706 529 377 293 --1813 --
NM_001009993chr263981 3212 3019 1765 505 486 --14336 --
NM_001010000chr1873214 3091 2435 1402 638 419 201 --32815 2490 813 1672
NM_001010844chr6----254 34 --
NM_001010846chr194541 3542 3320 3174 1796 1769 1612 1328 890 34492 3513 1410 11672 --
NM_001010853chr642966 2568 1042 341 13022 23061 894 --
NM_001010862chrX73332 2472 2036 586 267 185 165 --22260 258 --
NM_001010888chrX134100 4011 3872 3702 3678 3610 3263 1829 1794 1251 1025 867 813 24392 1699 14236 13837
NM_001010891chr5136237 5795 5781 5402 4994 4985 4246 2500 2456 2341 2284 574 271 --36689 4316 294 --
NM_001010895chr941475 627 121 97 1536 21548 83 1137
NM_001010927chr61545 ----145
NM_001010942chr1241163 1063 339 322 ------
NM_001010984chr182073 2058 1962 1713 747 644 289 214 22329 593 12015 --
NM_001010986chrX42475 880 833 560 1158 22495 350 --
NM_001010989chr164548 513 463 420 ------
NM_001010990chr164548 513 463 420 ------
NM_001011513chr4114015 3996 3348 3327 3160 2632 2533 1612 838 393 339 --2984 206 23028 449
NM_001011515chr44953 386 113 94 --4420 124 52 40 11040
NM_001011516chr44953 386 113 94 --4420 124 52 40 11040
NM_001011537chr332215 341 22 22009 1589 42306 2056 1992 456 --
NM_001011546chr202340 117 1320 --1799
NM_001011663chr104737 388 295 270 ------
NM_001011666chr795994 5207 4817 2094 1663 624 488 420 275 11255 56052 5587 4752 2068 499 11507
NM_001011708chr252902 2515 792 563 113 1786 1947 --
NM_001011713chr1441621 1197 652 47 --1632 --
NM_001011885chr1551709 1655 1263 722 362 ------
NM_001012393chr1195143 4135 4106 3909 3684 3656 1967 1802 266 11340 11069 --
NM_001012398chr162828 801 1424 ----
NM_001012410chr32355 33 169 ----
NM_001012418chr654202 3754 3653 808 90 --34293 448 286 11381
NM_001012420chr1562888 2696 873 569 503 211 --12033 --
NM_001012423chr1562888 2696 873 569 503 211 --12033 --
NM_001012426chr632622 1032 1002 ------
NM_001012427chr632622 1032 1002 ------
NM_001012478chr191647 ------
NM_001012514chr241140 971 950 95 ------
NM_001012516chr241140 971 950 95 ------
NM_001012751chr1071945 1866 1582 1575 665 410 159 11745 11527 --
NM_001012754chr1362049 1951 1854 1663 766 578 1828 1493 --
NM_001012761chr582732 2696 2554 2313 1765 874 781 398 12628 22129 604 --
NM_001012968chrX61819 1120 338 197 177 143 12601 42196 2095 888 186 12435
NM_001012977chrX1893 1448 1453 --
NM_001013031chr1063545 3218 2978 2221 1175 106 --41101 1082 1057 804 --
NM_001013398chr731419 197 40 1440 11505 --
NM_001013406chr721208 385 --21513 84 11493
NM_001013415chr431418 1103 240 11539 ----
NM_001013438chr34747 368 327 105 --1928 --
NM_001013439chr33593 214 173 --1774 --
NM_001013699chr123120 68 49 ------
NM_001013843chr153595 212 112 2749 186 ----
NM_001014283chr1321943 1468 --12041 11860
NM_001014286chr131273 --173 --
NM_001014380chr13155836 5731 5310 5272 4765 4312 2175 1972 1948 1886 1778 1539 934 766 588 85069 4241 2228 1711 1192 1090 493 399 55822 5372 4892 4378 1912 24622 1037
NM_001014434chr13672 637 89 --1819 1766
NM_001014443chr11251 ------
NM_001014796chr11178 ------
NM_001014796chr11178 ------
NM_001014797chr10188044 8036 7912 7767 7510 3281 3183 3148 3021 2445 2116 1520 1328 1113 434 286 271 195 13040 ----
NM_001015048chr1463202 3045 711 665 187 21 1808 12317 --
NM_001015049chr1463202 3045 711 665 187 21 1808 12317 --
NM_001015877chrX52666 2550 2508 2193 100 --32012 1020 928 12615
NM_001015880chr1071603 1351 1302 1160 601 545 108 --147 11550
NM_001015887chr361833 1725 1684 1371 1156 534 --31759 1507 1254 --
NM_001017368chr1762480 2312 2015 1963 909 28 --2584 469 12305
NM_001017369chr471056 713 414 351 167 159 143 1135 ----
NM_001017371chr221345 146 --2211 82 --
NM_001017395chr352485 2309 1022 577 396 23651 717 33280 2658 2636 --
NM_001017396chr262108 1885 1437 1374 871 827 ------
NM_001017405chr42828 244 ------
NM_001017415chr12713 518 180 2617 90 --
NM_001017416chr12713 518 180 2617 90 --
NM_001017424chr14597 479 451 359 11689 31611 1226 247 11783
NM_001017425chr14597 479 451 359 11689 31611 1226 247 11783
NM_001017434chr12476 254 --1152 --
NM_001017440chr7138145 7165 6270 5272 5061 3239 2646 2144 1472 1347 1069 1028 731 18062 61914 1639 1435 1276 1059 618 --
NM_001017523chr1261430 1318 1304 720 490 303 11379 ----
NM_001017923chr1451663 1449 323 257 248 --11109 1612
NM_001017926chr841665 1461 1349 77 ------
NM_001017962chr106995 840 779 385 279 160 ------
NM_001017963chr144938 356 170 123 ------
NM_001017992chr521103 1041 31473 1381 968 21423 443 --
NM_001017995chr5124797 4129 3675 3290 3264 3170 2970 1904 659 425 260 230 24349 1897 34466 3792 1730 --
NM_001017999chr132272 2019 1949 --12051 --
NM_001017999chr132272 2019 1949 --12051 --
NM_001018000chr132272 2019 1949 --12051 --
NM_001018000chr132272 2019 1949 --12051 --
NM_001018001chr132272 2019 1949 --12051 --
NM_001018004chr15------192
NM_001018006chr15------192
NM_001018007chr15------192
NM_001018020chr15------192
NM_001018038chr94591 212 205 107 1124 1503 --
NM_001018041chr61366 --1246 --
NM_001018054chr12325 230 ------
NM_001018056chr92426 24 --3525 167 123 --
NM_001018064chr93792 425 67 21835 627 1442 --
NM_001018065chr9166007 5471 4991 4782 4725 4305 3937 3838 3817 3705 1476 1384 1184 790 570 442 --45586 4639 4570 168 24813 4475
NM_001018066chr9166007 5471 4991 4782 4725 4305 3937 3838 3817 3705 1476 1384 1184 790 570 442 --45586 4639 4570 168 24813 4475
NM_001018067chr185167 4623 4322 3921 3561 1836 1119 569 54974 3517 1553 1170 614 45149 1572 736 275 --
NM_001018068chr185167 4623 4322 3921 3561 1836 1119 569 54974 3517 1553 1170 614 45149 1572 736 275 --
NM_001018069chr185167 4623 4322 3921 3561 1836 1119 569 54974 3517 1553 1170 614 45149 1572 736 275 --
NM_001018072chr1261430 1318 1304 720 490 303 11379 ----
NM_001018074chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_001018075chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_001018076chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_001018077chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_001018088chr151133 ------
NM_001018100chr153809 630 22 ------
NM_001018111chr743343 3024 2450 429 22529 1500 12897 --
NM_001020658chr131559 1078 169 11676 1644 --
NM_001020658chr131559 1078 169 11676 1644 --
NM_001020825chr51411 11300 ----
NM_001023567chr1562366 2280 876 613 572 506 ----12085
NM_001023587chr31953 ----11144
NM_001024094chr552936 1194 1005 199 25 23825 1078 2498 354 --
NM_001024218chr142667 613 1329 1155 --
NM_001024226chr111039 --1989 --
NM_001024227chr111039 --1989 --
NM_001024228chr111039 --1989 --
NM_001024372chr812269 11701 12213 --
NM_001024380chr82320 179 --32480 2336 1616 12499
NM_001024381chr82320 179 --32480 2336 1616 12499
NM_001024593chr102847 803 --2824 598 --
NM_001024647chr12107394 4953 4754 3048 3003 2978 1952 1636 960 105 25039 1798 15636 --
NM_001024649chr572868 2676 2229 2019 1099 283 266 12428 21976 1044 --
NM_001024660chr351710 1242 1093 666 302 ------
NM_001024688chr862180 2068 1951 800 371 207 ------
NM_001024847chr392308 1840 1669 906 816 810 788 698 368 1781 21000 191 --
NM_001024916chr92107 84 ------
NM_001024934chr63611 529 136 --1197 --
NM_001024935chr63611 529 136 --1197 --
NM_001024936chr63611 529 136 --1197 --
NM_001024947chr561032 896 751 350 276 168 ------
NM_001024948chr173522 2922 2850 2669 2168 906 275 33408 2555 946 42974 755 729 224 --
NM_001024956chr11115507 5402 5264 5154 4647 3677 2333 2281 980 863 344 12349 44517 3914 1719 248 13551
NM_001025068chr341591 1462 1442 666 --21417 487 1267
NM_001025069chr341591 1462 1442 666 --21417 487 1267
NM_001025076chr10166003 5960 4179 4125 2470 2153 2117 2018 1841 1568 1474 1335 676 609 195 178 11433 24209 1658 11650
NM_001025077chr10157361 7318 5537 5483 5051 4824 2926 2832 2693 2034 1967 1553 1536 1378 200 22791 109 35567 3016 279 13008
NM_001025079chr363900 2792 2609 863 774 428 21442 1236 23914 303 33445 1228 679
NM_001025100chr1831397 573 464 --33989 3674 1129 23082 2744
NM_001025105chr521017 340 --11256 --
NM_001025107chr132380 1778 823 --31866 1806 249 --
NM_001025107chr132380 1778 823 --31866 1806 249 --
NM_001025108chr243879 1449 495 139 --34180 3336 3038 --
NM_001025201chr22583 541 --1739 --
NM_001025233chr1282228 2004 1896 1817 908 845 792 783 --1325 --
NM_001025252chr873160 2874 2042 1212 1108 350 165 13084 ----
NM_001025253chr873160 2874 2042 1212 1108 350 165 13084 ----
NM_001025266chr364918 4750 3685 3408 3192 221 --43706 3667 3291 53 --
NM_001025366chr631877 1445 570 --11347 --
NM_001025366chr631877 1445 570 --11347 --
NM_001025367chr631877 1445 570 --11347 --
NM_001025367chr631877 1445 570 --11347 --
NM_001025368chr631877 1445 570 --11347 --
NM_001025368chr631877 1445 570 --11347 --
NM_001025369chr631893 1461 586 --11363 --
NM_001025369chr631893 1461 586 --11363 --
NM_001025370chr631877 1445 570 --11347 --
NM_001025370chr631877 1445 570 --11347 --
NM_001025389chr1161560 1519 1265 464 419 30 --21660 354 --
NM_001025390chr1161560 1519 1265 464 419 30 --21660 354 --
NM_001025579chr172843 329 ------
NM_001025580chrX83943 3836 3777 3521 3477 3356 3047 2709 12905 63881 3858 1274 873 800 327 14302
NM_001025595chr441085 601 355 151 1424 21469 559 --
NM_001025603chr161311 570 533 453 301 174 ------
NM_001025616chr451902 1383 717 599 505 --11744 11610
NM_001025777chr271602 1396 1249 1030 1022 174 121 11501 11133 11191
NM_001029858chr6103119 2982 2291 966 831 658 588 441 426 408 12188 42150 2130 869 697 1998
NM_001029859chr1152294 963 767 190 156 --1696 --
NM_001029860chr81260 ------
NM_001029863chr6102764 2687 2624 2037 1134 887 786 726 697 306 22096 1306 22784 484 21095 105
NM_001029875chr562995 2781 2407 2218 665 592 --12379 22818 127
NM_001029882chr1----1240 --
NM_001029882chr1----1240 --
NM_001029884chr662579 2360 1077 395 148 129 1275 12647 --
NM_001029998chr441303 411 298 144 ------
NM_001030006chr171764 --1417 1910
NM_001030007chr16113459 3401 3154 2860 2678 2440 1281 1197 1183 583 222 23048 475 21006 530 --
NM_001030055chr14104302 3764 3649 3639 1584 1387 1359 1057 905 565 23853 573 11614 --
NM_001031623chr641739 1324 481 150 1686 1472 --
NM_001031677chr51423 ------
NM_001031679chr1253498 3454 1231 429 71 1639 13423 --
NM_001031690chr742825 2804 979 24 1739 1991 --
NM_001031695chr2255422 4893 4077 1641 460 25315 1230 55021 4346 3570 1048 151 1206
NM_001031710chr731034 995 334 --11040 --
NM_001031711chr511414 --11369 --
NM_001031723chr41503 --124 --
NM_001031732chr463704 3151 1283 1111 601 533 31298 1131 224 2794 785 --
NM_001031738chr2152 --1501 --
NM_001031801chr222350 170 ----1470
NM_001031804chr1674188 3334 3164 1105 906 553 407 --22735 1083 1529
NM_001031812chr551690 1564 810 335 128 1194 ----
NM_001032279chr111397 ------
NM_001032280chr621545 388 ------
NM_001032282chr881321 1314 1180 1074 485 470 351 319 --1325 1920
NM_001032283chr123664 243 225 ------
NM_001032284chr123664 243 225 ------
NM_001032288chr2071583 1501 1449 1209 1072 376 145 ------
NM_001032293chr174542 190 116 42 --1593 --
NM_001032296chr1362721 2466 2294 962 801 567 --22799 246 1574
NM_001032380chr104557 398 137 59 21979 727 1151 --
NM_001032393chrX3713 659 610 --2494 160 --
NM_001032394chr622717 596 --32746 2416 936 --
NM_001032395chr622584 463 --32613 2283 803 --
NM_001032730chr14688 579 134 37 --1616 --
NM_001033025chr121547 304 --21503 164 --
NM_001033044chr141259 596 446 422 11328 ----
NM_001033045chr2104401 3892 3402 2951 2875 2841 1780 1386 862 382 34045 1656 721 13693 --
NM_001033047chr462404 2243 2200 2080 372 242 31819 885 516 12518 --
NM_001033049chr2141583 774 352 94 2867 436 ----
NM_001033056chr141259 596 446 422 11328 ----
NM_001033057chr331918 833 326 2706 26 21582 225 --
NM_001033059chr631575 267 188 11644 11420 --
NM_001033085chr2------1122
NM_001033087chr2083262 3008 2817 2231 2193 1321 1015 236 12435 ----
NM_001033112chr5--1765 ----
NM_001033117chr3114922 4809 4550 4066 3910 3808 3587 3291 3042 1419 578 13869 13545 --
NM_001033503chr54474 455 408 91 --1364 --
NM_001033506chr11------1331
NM_001033507chr11420 1261 11287 1558
NM_001033518chr731775 678 610 --11005 --
NM_001033519chr731775 678 610 --11005 --
NM_001033520chr731775 678 610 --11005 --
NM_001033521chr202158 149 --1605 --
NM_001033522chr202158 149 --1605 --
NM_001033557chr211325 --1315 --
NM_001033564chr641780 770 696 233 197 --1129
NM_001033566chr172958 108 1604 --142
NM_001033568chr172958 108 1604 --142
NM_001033576chr1752539 2024 1912 788 684 12266 12290 12604
NM_001033723chr872606 2567 2302 550 481 471 265 21727 1106 1455 --
NM_001033756chr631811 1379 504 --11281 --
NM_001033756chr631811 1379 504 --11281 --
NM_001033910chr122115 503 1433 1113 --
NM_001033925chr1042042 1743 1616 331 1128 21917 176 --
NM_001034841chr1675219 5194 4817 3529 1250 1035 44 33628 3348 482 --13938
NM_001034845chr41262 ------
NM_001034850chr551555 1546 1064 504 113 11078 ----
NM_001034852chr141802 2275 135 ----
NM_001034954chr1062761 2594 2240 807 261 65 --12658 --
NM_001034955chr1062761 2594 2240 807 261 65 --12658 --
NM_001034956chr1062761 2594 2240 807 261 65 --12658 --
NM_001034957chr1062761 2594 2240 807 261 65 --12658 --
NM_001035chr13468 182 170 21217 521 ----
NM_001035003chr41481 177 ----
NM_001035004chr41481 177 ----
NM_001035260chr1041340 1264 344 220 --1323 --
NM_001035511chr172132 2117 1853 1846 1783 1729 1474 1770 31869 1443 652 --
NM_001035512chr182239 2224 1960 1953 1890 1836 1581 55 1877 31976 1550 759 --
NM_001035513chr182239 2224 1960 1953 1890 1836 1581 55 1877 31976 1550 759 --
NM_001037132chr782271 1986 1952 1879 1735 1705 839 371 --2681 200 --
NM_001037133chr782271 1986 1952 1879 1735 1705 839 371 --2681 200 --
NM_001037164chr771907 1667 737 363 348 218 155 11289 1692 1608
NM_001037165chr7118147 7288 6983 6682 2384 2055 1881 1659 1278 375 167 --28853 8764 --
NM_001037172chr341361 444 387 230 11238 ----
NM_001037174chr282046 1892 1776 1514 1500 1437 599 112 --11429 --
NM_001037277chr161554 1301 1103 452 76 49 21586 1205 --21750 1691
NM_001037278chr161554 1301 1103 452 76 49 21586 1205 --21750 1691
NM_001037331chr184747 354 157 115 ------
NM_001037334chr1862269 1778 1771 1656 896 431 --51576 599 324 285 188 --
NM_001037339chr14710 502 195 116 11867 31305 583 405 1704
NM_001037340chr14710 502 195 116 11867 31305 583 405 1704
NM_001037341chr14710 502 195 116 11867 31305 583 405 1704
NM_001037341chr14710 502 195 116 11867 31305 583 405 1704
NM_001037535chrX31387 1167 54 1590 21361 1026 1251
NM_001037536chrX31387 1167 54 1590 21361 1026 1251
NM_001037540chrX31387 1167 54 1590 21361 1026 1251
NM_001037582chr441319 1201 668 513 ------
NM_001037631chr22433 101 --1455 --
NM_001037954chr1153113 3033 1026 772 537 --1848 13160
NM_001038628chr32393 40 --11871 --
NM_001038702chr592782 2590 2405 2308 1066 961 614 297 218 22512 2189 22666 137 --
NM_001038707chr122239 818 12326 --22231 532
NM_001038707chr122239 818 12326 --22231 532
NM_001039091chrX51293 940 467 300 122 1259 ----
NM_001039348chr221059 56 ------
NM_001039349chr221059 56 ------
NM_001039395chr942460 1704 1577 86 --22333 2288 --
NM_001039535chr1831466 452 96 190 ----
NM_001039538chr242730 2587 2557 1402 --1298 --
NM_001039547chr3146843 6812 6646 5980 5810 5003 4982 3220 3132 3080 2051 1496 613 223 25819 3196 57790 6584 6473 2358 833 57163 6779 6575 6303 946
NM_001039570chr2254672 4111 4071 3367 664 23116 441 --14643
NM_001039571chr2254672 4111 4071 3367 664 23116 441 --14643
NM_001039577chr144307 3443 774 450 33630 1057 430 21710 278 --
NM_001039580chr4164445 3929 3559 3487 3360 3300 2033 2006 1767 1437 1153 638 601 578 289 143 41398 1142 1121 922 24237 1977 --
NM_001039585chr173473 2859 2686 1667 1441 1147 40 --23437 2945 1569
NM_001039590chrX73972 3510 3470 3351 1473 287 61 1533 33545 1514 598 --
NM_001039591chrX73972 3510 3470 3351 1473 287 61 1533 33545 1514 598 --
NM_001039618chr1184456 2382 2308 2058 1536 700 340 69 1993 65448 4878 4501 3800 2241 794 25673 1903
NM_001039690chr1631893 1708 253 --22380 2061 --
NM_001039693chr243931 3650 2791 984 1619 14107 13741
NM_001039711chr12327 243 1969 1108 --
NM_001039712chr12327 243 1969 1108 --
NM_001039762chr103795 571 146 --165 1727
NM_001039840chrX175796 5571 5330 4452 4172 3888 3850 3685 2058 1664 1543 1484 1057 953 320 168 55 45206 1726 988 841 12359 --
NM_001039888chr11537 --1549 --
NM_001039937chr13143927 3559 3333 3102 3042 2855 2715 2649 855 794 496 371 163 36 42620 1072 951 317 32908 1234 694 11600
NM_001039960chr1251726 1530 1399 1312 1066 11490 ----
NM_001040001chr661832 1646 1437 793 179 42 11451 11715 --
NM_001040020chr751422 1094 514 474 382 --31432 1082 429 --
NM_001040057chr7--1339 2537 285 1463
NM_001040058chr44504 424 418 357 --1397 --
NM_001040060chr44504 424 418 357 --1397 --
NM_001040100chr31796 1402 1139 1976
NM_001040101chr431058 223 89 ------
NM_001040110chr731549 1409 120 ------
NM_001040135chr72630 596 --1699 --
NM_001040142chr272402 2347 2065 1817 1617 1586 421 11667 12252 --
NM_001040143chr272402 2347 2065 1817 1617 1586 421 11667 12252 --
NM_001040144chr1631893 1708 253 --22380 2061 --
NM_001040146chr1631893 1708 253 --22380 2061 --
NM_001040152chr763683 3290 2058 1603 1436 1246 24037 3220 --13354
NM_001040153chr134897 884 807 364 --1275 --
NM_001040158chr5----1476 --
NM_001040159chr431209 979 74 11274 --11350
NM_001040167chr74942 892 348 320 --2898 375 --
NM_001040179chr62878 45 1698 1822 --
NM_001040181chr33328 205 189 --1959 --
NM_001040182chr33328 205 189 --1959 --
NM_001040183chr33328 205 189 --1959 --
NM_001040199chr33328 205 189 --1959 --
NM_001040200chr33328 205 189 --1959 --
NM_001040214chr641578 561 48 36 21938 815 ----
NM_001040284chr16135977 5868 5573 5415 5143 4778 4412 4173 4120 3943 1697 1347 1269 24387 1225 65201 5080 4689 2351 821 562 --
NM_001040402chr482713 2529 2326 1138 972 765 512 388 22633 2317 ----
NM_001040409chr26940 805 757 382 315 116 --1879 --
NM_001040429chr1343263 2294 1159 634 12957 23058 307 22896 2726
NM_001040440chr53674 646 606 --1449 --
NM_001040441chr194165 3954 1593 1414 814 346 329 275 255 --23330 292 --
NM_001040446chr5102630 2568 2506 2264 2042 1966 988 871 733 343 ----1962
NM_001040450chr15102681 2519 2467 2303 2186 1971 891 588 333 160 --21835 876 1558
NM_001040453chr15102681 2519 2467 2303 2186 1971 891 588 333 160 --21835 876 1558
NM_001040458chr541881 1754 1429 263 --21813 105 --
NM_001040665chr7154955 4853 4815 4808 4272 3996 3845 3409 3367 1914 1855 1509 950 855 266 11804 11823 13956
NM_001040666chr74657 555 517 510 ------
NM_001040697chr111615 ----1106
NM_001040708chr81301 --1164 1159
NM_001040709chr192437 1931 1609 815 799 536 365 254 70 ------
NM_001040712chr942461 2201 679 561 12754 23016 2363 --
NM_001040875chr862529 1786 1747 905 454 129 --12330 --
NM_001040876chr441720 674 592 188 11707 11296 --
NM_001042355chr16105211 4963 4830 4593 4180 3843 3351 1853 1603 419 21331 1296 11316 --
NM_001042383chr362838 2402 956 279 237 23 --1153 --
NM_001042388chr182899 199 ------
NM_001042399chr121353 --2487 88 --
NM_001042403chr123791 385 207 --3332 182 47 --
NM_001042404chr161894 1284 779 520 299 238 11364 11250 --
NM_001042406chr61273 --11187 1809
NM_001042412chr16105211 4963 4830 4593 4180 3843 3351 1853 1603 419 21331 1296 11316 --
NM_001042413chr983646 3625 3305 3199 2602 2532 1450 55 ------
NM_001042414chr13------262 54
NM_001042425chr621545 388 ------
NM_001042437chr24989 917 160 92 1120 ----
NM_001042453chrX2472 108 2314 205 31127 298 99 --
NM_001042454chr161351 ------
NM_001042459chr32311 103 1250 ----
NM_001042473chr103551 470 319 --11659 --
NM_001042479chrX--11835 31539 505 329 1368
NM_001042480chrX--11835 31539 505 329 1368
NM_001042481chr1442204 1867 1776 92 --32695 2687 978 --
NM_001042486chr2031090 239 84 ------
NM_001042492chr1792460 2373 2351 2275 690 501 486 372 199 23434 281 42294 781 213 187 --
NM_001042493chr621663 1369 21470 29 22042 1912 --
NM_001042506chrX1893 1448 1453 --
NM_001042510chr851486 544 371 305 31 ------
NM_001042511chr851486 544 371 305 31 ------
NM_001042533chr373055 2975 2849 2606 2202 1268 724 12745 21215 425 13291
NM_001042537chrX72220 1972 1964 1921 909 449 234 22308 2301 21830 468 --
NM_001042548chr22853 699 1633 ----
NM_001042555chr12104625 4017 2953 1314 888 844 689 559 345 31 24221 139 54432 3514 3373 1068 311 11159
NM_001042599chr2217599 7570 7540 7103 7076 6621 6344 5625 5412 5241 2655 2469 1569 1560 1304 1290 991 855 793 639 313 57295 5856 5452 2763 809 47823 7159 6142 5118 16292
NM_001042601chr372948 2074 1258 1230 913 621 289 33213 1148 581 1603 --
NM_001042603chr12115369 4842 4704 4656 4502 4267 4236 4109 3731 968 855 --31971 1150 646 --
NM_001042604chr364554 4032 3342 1726 1444 150 24650 1266 33294 1241 48 24688 3406
NM_001042646chr331615 628 614 11338 11754 --
NM_001042663chr111130 --11062 --
NM_001042664chr111130 --11062 --
NM_001042665chr111130 --11062 --
NM_001042669chr451902 1383 717 599 505 --11744 11610
NM_001042681chr182529 2445 1933 1889 560 466 102 63 ------
NM_001042682chr182529 2445 1933 1889 560 466 102 63 ------
NM_001042682chr182529 2445 1933 1889 560 466 102 63 ------
NM_001042683chr631620 700 442 --1300 21520 420
NM_001042749chrX41982 1879 1436 1409 1571 1634 --
NM_001042750chrX41982 1879 1436 1409 1571 1634 --
NM_001042751chrX41982 1879 1436 1409 1571 1634 --
NM_001042762chr771126 1071 907 354 336 251 229 --11027 --
NM_001042784chr4----182 --
NM_001043351chr151807 453 396 382 212 2100 82 2614 297 --
NM_001044305chr631498 1365 1052 ------
NM_001044385chr264011 3919 3160 3036 1510 294 --13355 23874 2515
NM_001044722chr551690 1564 810 335 128 1194 ----
NM_001044723chr551690 1564 810 335 128 1194 ----
NM_001046chr572487 2266 1150 403 336 290 106 32228 869 321 22293 665 --
NM_001068chr3273 38 ------
NM_001071775chr1331678 1523 215 11542 21484 120 11207
NM_001076chr43165 123 109 ------
NM_001076chr43165 123 109 ------
NM_001079874chr152066 1987 1969 1524 366 21550 550 ----
NM_001083620chr472434 1655 336 259 249 193 183 --22413 1023 --
NM_001083621chr174420 4288 4072 2921 1169 1059 963 11701 1730 --
NM_001095chr1251811 1627 1489 430 116 11547 ----
NM_001099678chr3166434 5869 5115 2421 2408 2252 2209 1320 1178 1061 1001 692 620 561 330 93 45683 4097 3961 1706 106252 5537 5191 5070 4275 2474 2397 1486 1071 288 26233 889
NM_001100108chr197869 7762 7097 6532 6349 6022 2274 1847 1415 --46835 6046 2946 1094 --
NM_001106chr3169579 9221 8832 7989 7868 6841 6712 6329 5909 3770 3215 3074 458 431 131 124 37417 6103 2542 89778 7292 7209 6060 2899 2799 2547 1006 --
NM_001109977chr45768 678 577 174 97 --1149 --
NM_001111chr132380 1778 823 --31866 1806 249 --
NM_001113490chrX113549 2924 2689 2653 2583 2301 2260 2232 1023 983 127 --33656 3128 1207 --
NM_001117chr1852310 2236 2077 1839 197 11649 22321 2067 --
NM_001119chr421410 334 11398 ----
NM_001121chr1051797 1722 1313 1301 1193 ----11212
NM_001122679chr521200 970 ------
NM_001123chr102835 287 1168 ----
NM_001126chr11805 1703 2999 792 2927 313
NM_001128chr16113459 3401 3154 2860 2678 2440 1281 1197 1183 583 222 23048 475 21006 530 --
NM_001144chr1651348 1333 1013 921 178 --21128 929 --
NM_001148chr442038 1920 1852 396 ------
NM_001153chr24820 374 282 275 --2888 839 --
NM_001155chr52695 137 ------
NM_001156chr103544 426 164 1446 1592 --
NM_001160chr1262795 2056 573 255 82 31 --12306 1185
NM_001167chrX136675 6356 5992 2526 2241 1810 1758 1369 1247 1112 1008 824 159 --34850 884 839 --
NM_001173chr14104302 3764 3649 3639 1584 1387 1359 1057 905 565 23853 573 11614 --
NM_001174chrX32328 2127 308 11444 ----
NM_001177chr1282419 1637 1567 1549 772 587 486 369 1465 1404 --
NM_001179chr41184 --121 --
NM_001186chr2173147 2929 2667 2249 2047 1088 406 1236 33103 2521 953 --
NM_001198chr632368 2347 885 --22144 1596 --
NM_001200chr2021003 332 ----1953
NM_001201chr473747 3523 3386 3237 3068 1081 423 --12483 23790 948
NM_001204chr2197576 7116 6454 5812 5704 4798 2275 2254 1950 1766 1601 1549 1321 1059 678 594 486 473 213 36572 5869 2532 97414 2130 2087 1611 1417 1374 1271 1132 616 26266 6006
NM_001206chr952444 2196 1030 720 559 43012 2252 798 749 62653 2584 2370 2137 777 493 --
NM_001219chr721812 101 11655 21671 863 --
NM_001222chr1041858 1502 1462 1305 12010 ----
NM_001235chr113691 637 574 ------
NM_001237chr411193 --2168 142 --
NM_001237chr411193 --2168 142 --
NM_001239chr51114 ------
NM_001241chr262404 1883 1549 834 715 674 --1133 21965 1714
NM_001241chr262404 1883 1549 834 715 674 --1133 21965 1714
NM_001254chr1721052 106 --1170 --
NM_001256chr1752676 2121 973 529 316 32391 885 771 32414 1958 1018 --
NM_001257chr1621182 543 --1286 --
NM_001259chr7225853 5753 5584 5497 5342 4961 4840 4707 4640 4631 4581 2540 2082 1905 1653 1539 1502 1401 1225 1096 1079 466 35050 2444 894 105782 5348 4589 4300 4181 2201 1710 1329 481 395 --
NM_001262chr1135 167 1248 --
NM_001268chr135748 413 282 238 30 --2971 720 --
NM_001270chr55981 937 730 72 32 11102 1221 --
NM_001271chr1532040 1274 161 13118 13250 --
NM_001277chr1121036 352 --1906 --
NM_001278chr105934 783 364 335 290 1358 11055 --
NM_001280chr191188 --1252 --
NM_001282chr171764 --1417 1910
NM_001284chr54524 502 451 102 ------
NM_001289chrX31138 599 260 ----1192
NM_001290chr44918 813 407 101 165 ----
NM_001300chr101342 ------
NM_001304chr1773711 3508 3188 2976 1458 879 239 22796 195 52785 2435 1387 778 463 --
NM_001310chr12102780 2669 2387 2287 1938 982 903 790 688 401 1470 11961 12118
NM_001315chr661694 1396 829 610 460 52 11916 ----
NM_001324chr202158 149 --1605 --
NM_001329chr10--21658 1468 ----
NM_001331chr1172434 2201 1952 1784 822 316 145 32846 1946 465 52720 2062 1764 1120 1080 141
NM_001332chr531384 609 239 --1477 --
NM_001333chr92231 59 ------
NM_001343chr571697 1577 1391 1098 576 318 131 11077 ----
NM_001351chr331769 1158 148 --21280 605 --
NM_001356chrX51641 1557 878 333 75 --22243 1772 1317
NM_001364chr1184798 4364 3434 2931 2896 1611 1357 446 --33096 1440 1214 --
NM_001385chr82434 278 --1393 --
NM_001386chr811599 11875 42341 1801 890 397 --
NM_001390chr1873243 3181 3089 2553 1151 415 225 --23332 2692 --
NM_001391chr1821205 201 --11008 --
NM_001392chr18147 ------
NM_001396chr2172112 1826 1751 974 956 890 830 --11116 --
NM_001400chr171322 1164 1137 929 864 506 499 11357 11009 --
NM_001401chr951459 1415 1343 1065 577 1304 21017 534 --
NM_001407chr331150 640 417 1215 21066 231 --
NM_001412chrX103142 2888 2693 1343 953 719 685 335 177 30 11318 12941 12833
NM_001415chrX31498 624 116 --1807 11712
NM_001416chr171131 ------
NM_001417chr1231867 1787 116 21979 173 2398 125 --
NM_001418chr11------1212
NM_001418chr11------1212
NM_001419chr19134600 4152 4027 3882 3832 3185 3162 1757 1101 1051 951 378 60 14339 34410 1237 1171 --
NM_001420chr19--13140 23169 2088 --
NM_001423chr1231293 632 208 --41916 1909 1589 1549 --
NM_001427chr761818 1759 1457 1375 324 282 --11909 --
NM_001429chr225711 310 230 85 56 ------
NM_001430chr242017 1569 767 157 ------
NM_001431chr62298 162 --21143 956 --
NM_001432chr4123823 3655 3429 3345 2714 2623 2541 1395 1355 1090 1007 718 23311 2672 12757 --
NM_001438chr193686 2380 2357 2322 1074 886 513 334 191 1543 13645 --
NM_001439chr121547 304 --21503 164 --
NM_001448chrX51709 1427 521 458 60 11357 ----
NM_001451chr161969 21339 931 21276 452 1428
NM_001452chr6------1683
NM_001460chr1113472 3267 3260 2560 2430 2384 1314 1157 1131 222 168 1745 32580 1358 394 11217
NM_001463chr21332 ------
NM_001466chr17--1114 ----
NM_001482chr154970 819 713 669 --1155 --
NM_001483chr72242 201 11047 1893 --
NM_001491chr682620 2562 2053 1800 841 402 299 74 ------
NM_001497chr982516 2212 2095 2083 1902 1694 581 422 --32808 2167 223 22769 1852
NM_001498chr61980 11168 ----
NM_001530chr1441061 403 364 270 ------
NM_001533chr19--1229 ----
NM_001542chr142427 2150 1860 530 --11933 --
NM_001543chr553714 3020 1624 659 564 --23749 1937 --
NM_001546chr61360 21454 294 ----
NM_001550chr72645 106 ------
NM_001554chr11214 ------
NM_001564chr41143 ------
NM_001587chrX52231 1858 1750 612 421 1590 11709 1183
NM_001609chr1084408 3727 3591 3017 1775 736 154 81 23313 206 ----
NM_001616chr293127 2916 2802 2627 2310 569 397 285 237 --53165 3149 2869 2579 995 --
NM_001621chr742495 804 714 371 --22287 629 1936
NM_001621chr742495 804 714 371 --22287 629 1936
NM_001634chr631575 267 188 11644 11420 --
NM_001635chr731090 393 75 ----1887
NM_001642chr1121349 888 ------
NM_001650chr1873677 3090 3014 2891 1553 1234 508 23910 1108 43334 2997 1339 262 --
NM_001655chr1122076 1879 11747 12095 2764 308
NM_001656chr541315 590 520 154 1553 1429 --
NM_001658chr111039 --1989 --
NM_001660chr32754 78 1277 ----
NM_001663chr1472424 1091 1047 966 827 588 372 ----1992
NM_001664chr351009 741 334 311 80 ------
NM_001668chr152264 1687 346 255 68 --2655 637 --
NM_001677chr14820 717 402 317 1996 ----
NM_001682chr1282863 2559 2498 2070 1836 1817 842 616 11051 22600 471 --
NM_001684chr1123683 3595 3458 3404 3032 2825 2625 1298 1271 1030 786 82 --11464 --
NM_001690chr352487 2375 1958 413 400 ----12568
NM_001693chr861186 1160 987 928 803 84 --1973 --
NM_001701chr921268 241 ------
NM_001704chr64608 393 387 98 3514 488 246 ----
NM_001714chr122429 359 ------
NM_001730chr13------21303 1128
NM_001730chr13------21303 1128
NM_001731chr123945 816 337 --1186 --
NM_001744chr5149 1435 1450 --
NM_001746chr572868 2676 2229 2019 1099 283 266 12428 21976 1044 --
NM_001748chr151065 931 923 887 278 ----1286
NM_001753chr771558 1551 1442 661 583 561 113 --31643 1432 234 21669 1601
NM_001754chr21163741 3695 3652 3603 3568 3207 3110 3100 2977 2836 1465 1174 775 664 651 390 --13363 --
NM_001755chr1672300 2237 2207 1867 1588 773 294 181 ----
NM_001759chr12104973 4734 4716 3815 3475 1597 1467 545 349 140 --25204 1531 --
NM_001777chr363900 2792 2609 863 774 428 21442 1236 23914 303 33445 1228 679
NM_001785chr12305 208 ------
NM_001792chr181457 --3812 256 246 --
NM_001797chr163798 570 557 --1184 --
NM_001801chr54492 427 53 30 ------
NM_001806chr1992795 2358 2349 2232 2126 2051 1806 1128 865 11103 1724 1966
NM_001822chr22583 541 --1739 --
NM_001825chr5------1118
NM_001827chr9295 27 --1250 --
NM_001830chrX93778 3618 3471 3129 2906 2777 1215 1097 491 2331 152 11575 --
NM_001839chr13583 132 81 --1182 1118
NM_001844chr122144 57 ------
NM_001845chr1371399 1235 897 516 331 230 124 ------
NM_001851chr64612 593 122 97 ------
NM_001854chr131241 1218 43 --31101 574 146 --
NM_001858chr6135013 4857 4371 4286 3519 3508 3346 3151 3142 1917 906 453 370 13581 53756 3500 2056 498 404 --
NM_001859chr963886 2923 1308 1092 1079 883 --1851 --
NM_001874chr1274804 4096 3430 3223 2042 1227 572 --24758 4733 --
NM_001875chr241047 357 130 120 11099 1286 11057
NM_001880chr2--1294 ----
NM_001892chr521017 340 --11256 --
NM_001894chr2241225 1141 1018 953 --11201 --
NM_001895chr2061197 1071 994 838 768 206 ------
NM_001896chr16141 ------
NM_001901chr621053 986 2921 903 1675 --
NM_001903chr53915 796 657 ------
NM_001904chr33828 303 145 11093 11008 153
NM_001914chr182394 344 --1329 --
NM_001918chr1108382 6410 3573 3127 1272 1093 1025 994 160 27 49018 6616 6116 81 28889 8483 19129
NM_001920chr123662 624 205 ------
NM_001935chr231025 325 196 193 1131 --
NM_001938chr141884 1802 1746 1378 ------
NM_001939chrX73402 2502 1473 605 322 81 59 --1262 --
NM_001945chr531424 347 303 ------
NM_001946chr122982 809 --1815 --
NM_001949chr652746 2453 879 424 90 1812 ----
NM_001968chr42358 155 ----1831
NM_001969chr1453157 2913 2685 779 357 --33496 2619 991 --
NM_001977chr43648 502 302 2441 150 1584 1282
NM_001981chr161566 1551 954 613 453 315 --41938 1576 914 864 --
NM_001982chr1221185 136 11272 1360 152
NM_001987chr1274070 3634 2666 1566 1407 1202 681 --14270 --
NM_001993chr141119 747 355 249 158 ----
NM_001999chr511520 ------
NM_002006chr4115492 5482 5236 4416 4267 4187 3789 3578 1500 975 252 24923 875 13551 --
NM_002009chr1532769 2714 2276 32583 2355 795 1825 --
NM_002013chr142237 199 ------
NM_002015chr1353240 2321 832 629 463 ------
NM_002017chr1141329 986 164 120 11170 ----
NM_002023chr121498 531 --1350 11644
NM_002024chrX72096 1585 835 662 561 466 198 11928 21430 551 --
NM_002025chrX208880 8036 7412 7227 7047 6757 5992 5726 3028 2543 2517 1975 1882 1786 1771 1177 1125 825 465 254 21560 1283 47425 3488 3402 3217 13192
NM_002028chr141132 --1862 --
NM_002035chr1883999 3957 3901 3117 1429 1067 1011 365 23673 3441 33570 2518 1604 --
NM_002039chr45687 370 326 287 129 ------
NM_002040chr2193036 3014 2596 2499 2295 1009 950 170 163 --21044 956 32851 2063 69
NM_002048chr941251 1064 971 130 1479 ----
NM_002056chr24866 777 100 56 ------
NM_002065chr141259 596 446 422 11328 ----
NM_002069chr73681 384 173 --31685 1169 635 --
NM_002072chr92888 688 1983 1232 --
NM_002074chr131668 346 139 ------
NM_002076chr12133264 2965 2840 2606 2572 2561 2507 2276 1092 1082 720 388 357 ------
NM_002077chr952135 1670 1515 608 42 1573 1689 --
NM_002080chr163760 246 33 ------
NM_002092chr4114064 3355 1794 1613 1290 1155 1023 937 488 380 59 24111 3838 1637 --
NM_002107chr1----1427 --
NM_002114chr62128 110 --1197 --
NM_002126chr17123260 3148 2966 2949 2737 1120 1087 1031 1018 956 556 81 24138 3612 13132 --
NM_002128chr1311744 22328 819 11597 --
NM_002130chr531597 1207 393 11129 11548 --
NM_002133chr221576 ------
NM_002134chr16196 ------
NM_002137chr762003 715 705 536 365 211 --42225 1884 958 246 11764
NM_002140chr931171 173 91 --1781 --
NM_002146chr174943 917 398 390 --21401 1162 --
NM_002158chr2153852 3709 3228 3084 3015 2964 2870 2610 2365 1223 1131 1082 874 728 479 --32790 1333 782 --
NM_002163chr161112 --1473 21234 482
NM_002166chr23579 126 68 1229 ----
NM_002167chr11466 --1417 --
NM_002182chr362737 2253 2204 482 418 337 --22283 2006 1361
NM_002193chr21218 11799 ----
NM_002196chr204903 713 697 36 2937 208 --11027
NM_002196chr204903 713 697 36 2937 208 --11027
NM_002202chr551074 925 855 769 418 ------
NM_002203chr534106 2856 2688 43571 3016 331 253 11517 --
NM_002207chr3159 2757 608 1682 --
NM_002210chr253151 2185 1273 1264 291 11049 43455 1301 993 466 --
NM_002211chr1071122 1005 895 859 788 760 252 --3941 910 243 11103
NM_002214chr7125531 5160 4355 4316 4057 2301 1922 1568 1139 1039 916 183 34490 3657 1623 44853 4834 4639 2026 1657
NM_002222chr311340 11116 2234 32 --
NM_002223chr1252455 646 598 441 30 12818 1901 --
NM_002242chr232009 1701 1563 --156 --
NM_002247chr1062356 947 925 905 841 643 21799 918 ----
NM_002250chr19131 --1538 --
NM_002264chr3115049 4996 4844 4568 4445 4296 3477 1576 1294 1099 134 33558 1762 400 53767 3074 1954 1049 472 --
NM_002267chr13123 12315 22094 1851 --
NM_002268chr351705 1619 1405 1398 518 11360 ----
NM_002269chr62402 60 ------
NM_002270chr5175346 5095 5007 4643 3954 3883 3645 3467 2183 2173 1932 1909 1850 1397 1197 570 222 14593 41662 1111 848 698 --
NM_002271chr1311818 ----12349
NM_002285chr243879 1449 495 139 --34180 3336 3038 --
NM_002293chr1112686 2667 2655 2485 1891 1687 781 716 704 234 66 ------
NM_002310chr5156354 5881 5568 5119 4294 4005 2254 1967 1934 1878 1350 1251 1021 715 266 --56445 5872 2265 1557 1391 25040 4358
NM_002312chr132201 97 3847 333 155 ----
NM_002313chr1074211 3777 1663 1119 797 491 259 ------
NM_002317chr51373 ------
NM_002336chr1275010 4050 3699 3364 1055 735 285 --24808 1336 1684
NM_002349chr231414 1235 1138 --51674 1162 512 375 112 --
NM_002351chrX51693 1541 270 164 25 ------
NM_002354chr2185 --2373 340 --
NM_002355chr1291416 1346 1283 1275 1235 1147 933 495 163 ------
NM_002356chr672364 1756 905 672 317 262 36 31930 1821 326 32640 1977 137 --
NM_002371chr24516 473 189 71 ------
NM_002374chr242730 2587 2557 1402 --1298 --
NM_002381chr22851 670 ----1994
NM_002382chr142932 449 ------
NM_002395chr681119 1057 454 430 195 114 74 48 --1385 --
NM_002397chr542235 2203 836 60 1377 --1147
NM_002399chr15--1918 1445 11359
NM_002408chr143317 293 147 ------
NM_002430chr2262439 1685 954 888 288 276 --12038 --
NM_002444chrX61878 1497 1433 670 462 286 --11954 --
NM_002449chr51944 --11071 11200
NM_002467chr81175 ------
NM_002478chr111441 --1453 --
NM_002480chr1221397 1284 --1370 11006
NM_002481chr1177851 7404 7267 5986 5459 5352 5292 2960 2836 2468 1619 1311 1253 913 831 320 75 56868 5502 4958 1719 575 37214 6444 2745 --
NM_002485chr862180 2068 1951 800 371 207 ------
NM_002486chr972490 2195 737 632 520 376 41 22154 1555 --2546 157
NM_002487chr151593 1113 1247 1143
NM_002499chr1562495 2412 2212 866 408 172 1348 32008 1764 1522 --
NM_002500chr21473 --3914 421 154 --
NM_002508chr152023 1790 802 300 140 --11254 --
NM_002515chr1431621 218 72 --11701 --
NM_002519chr1131229 1100 431 21329 1155 ----
NM_002522chr1773813 3762 3059 1321 1012 509 359 12574 11329 1529
NM_002524chr11915 ------
NM_002526chr621676 1499 1103 167 21484 22
NM_002527chr12135 1103 ----
NM_002536chrX1228 ------
NM_002545chr1195143 4135 4106 3909 3684 3656 1967 1802 266 11340 11069 --
NM_002547chrX52646 922 457 418 76 --13774 --
NM_002556chr1152123 2060 1620 813 181 1682 --11763
NM_002576chr1131183 924 96 ----1798
NM_002577chr394075 3865 3367 2945 2871 1333 890 297 52 1181 33964 2807 632 --
NM_002581chr9145662 5451 5396 4445 4127 2278 1655 1313 1196 967 930 821 603 426 --25088 845 1134
NM_002583chr122529 418 --3512 243 215 --
NM_002591chr20----1477 2584 25
NM_002597chr11333 ------
NM_002600chr14710 502 195 116 11867 31305 583 405 1704
NM_002601chr2----2358 66 --
NM_002605chr1541106 1072 921 411 1402 ----
NM_002613chr1675248 5065 4742 4724 4391 4363 876 --13348 13325
NM_002616chr171234 --1572 --
NM_002618chr2136 --147 1349
NM_002628chr331047 495 219 ------
NM_002629chr101749 --1796 1563
NM_002635chr12--171 ----
NM_002641chrX31838 1827 758 11491 21733 1345 --
NM_002645chr11113091 3040 2904 2832 2784 2330 1041 621 576 376 195 22575 387 22156 2002 12740
NM_002649chr791526 1442 1203 1129 1092 677 615 439 307 11156 1391 --
NM_002655chr8114403 4255 3994 3738 3319 1427 1231 1087 843 245 80 54597 3654 609 596 287 43682 1207 760 359 23209 313
NM_002656chr641112 1095 1041 1006 1424 ----
NM_002657chr2063615 3360 3076 2602 2595 2472 1508 23853 3129 1246
NM_002670chr351239 636 532 467 170 ----11049
NM_002687chr1451204 511 263 119 92 1320 2164 69 --
NM_002689chr111324 ------
NM_002699chr1------11472
NM_002703chr481958 1766 1659 1601 1238 724 659 245 1478 21936 576 --
NM_002706chr23608 148 32 1161 ----
NM_002707chr21377 ------
NM_002709chr273588 3532 3267 2996 1278 860 827 23026 116 --13342
NM_002710chr1241066 865 735 311 ------
NM_002713chr121078 1014 11051 --1752
NM_002715chr511160 --1270 --
NM_002716chr1163141 3047 2348 2285 2257 1414 23304 27 13281 1998
NM_002717chr8--1227 ----
NM_002718chr322566 1856 31660 747 532 31849 1722 752 --
NM_002719chr1461991 1755 748 724 430 337 1953 12378 --
NM_002726chr61507 --1157 1356
NM_002731chr163178 2958 2725 2174 986 930 ------
NM_002734chr1731810 1730 636 31591 1417 786 52254 2052 1746 699 673 --
NM_002736chr731752 562 430 11913 11949 --
NM_002737chr17116194 6085 5828 5363 2340 2016 1752 1638 910 321 193 --46351 5436 1468 695 --
NM_002740chr3112820 2437 2320 2178 1004 906 627 524 501 437 123 12303 32802 1773 273 --
NM_002745chr2264505 3598 1659 1352 532 487 13147 23825 3519 13221
NM_002747chr183665 164 100 21707 179 11818 --
NM_002748chr152938 316 --21214 24 --
NM_002750chr101197 ------
NM_002764chrX4671 661 329 276 --1855 --
NM_002765chrX51293 940 467 300 122 1259 ----
NM_002779chr101222 ------
NM_002786chr11180 ------
NM_002787chr74655 270 175 84 ----1450
NM_002794chr1136 ------
NM_002808chr3--1153 ----
NM_002810chr11117 ------
NM_002815chr17--1179 1100 --
NM_002822chr1261806 1229 554 433 335 128 1510 2677 111 --
NM_002823chr22491 248 ------
NM_002825chr72543 458 ------
NM_002827chr2031769 1156 712 --21479 192 --
NM_002828chr181983 --1765 --
NM_002835chr74652 213 150 118 182 --1272
NM_002837chr1284360 3546 3155 3055 1846 1224 1215 1200 13350 33593 2982 1366 --
NM_002839chr942461 2201 679 561 12754 23016 2363 --
NM_002841chr33467 65 54 --1105 --
NM_002843chr1162901 2356 1339 1312 243 98 --1524 --
NM_002844chr641269 348 295 163 21023 119 ----
NM_002845chr181436 ------
NM_002848chr1211222 --11017 --
NM_002851chr72715 695 --1169 --
NM_002857chr192732 2389 2029 1847 1647 775 510 449 365 1344 11945 --
NM_002858chr111035 1340 1353 --
NM_002868chr1292261 2231 2139 1843 1622 835 671 247 152 1924 22402 306 --
NM_002869chr1141695 1375 373 94 11533 11406 --
NM_002871chr13553 354 92 21889 66 21978 412 --
NM_002873chr52451 388 --1461 --
NM_002874chr962349 2177 1919 840 588 282 --22240 940 --
NM_002886chr384881 3244 1802 1646 1152 1049 930 535 54027 3266 1851 1453 1215 ----
NM_002890chr551030 903 293 264 102 1230 ----
NM_002892chr1431653 1176 612 --2243 122 --
NM_002893chrX1333 1326 1252 --
NM_002894chr181211 1161 ----
NM_002895chr202607 76 --3845 674 217 --
NM_002902chr152644 124 2463 451 162 --
NM_002906chr1172425 1629 1560 1517 922 636 64 1679 ----
NM_002907chr123414 379 154 --1334 1294
NM_002912chr62709 216 ------
NM_002922chr1189 ----1650
NM_002923chr1------1650
NM_002938chr431516 1335 361 --1645 --
NM_002940chr441720 674 592 188 11707 11296 --
NM_002941chr341137 1020 439 243 --11171 --
NM_002942chr331424 1099 1088 2420 405 ----
NM_002946chr12484 451 ------
NM_002948chr351169 420 213 195 173 ------
NM_002956chr1241423 1210 1163 317 --21258 350 1535
NM_002957chr943411 3386 1503 747 12553 11468 --
NM_002958chr36953 721 344 264 153 127 3700 403 199 ----
NM_002959chr144170 2964 326 190 11646 --13857
NM_002971chr33403 346 87 ------
NM_002973chr12--2531 511 ----
NM_002977chr2123272 2926 2622 2376 2190 1224 1201 713 507 421 314 305 1295 --1690
NM_002994chr441498 649 456 321 21588 464 31922 1851 682 1714
NM_002995chr12691 82 1824 --1131
NM_002997chr251382 1334 1292 655 231 ------
NM_002998chr871915 1795 1699 902 376 80 43 21360 271 21496 451 11816
NM_002999chr2061971 1326 1277 572 558 232 --21251 130 --
NM_003001chr182239 2224 1960 1953 1890 1836 1581 55 1877 31976 1550 759 --
NM_003010chr1762289 1884 1814 957 498 465 ----22147 631
NM_003011chr941517 1192 469 176 1646 ----
NM_003013chr43715 681 539 --1136 1768
NM_003016chr1781842 1713 1515 1470 1410 1292 690 136 11345 21965 780 --
NM_003017chr61222 1265 2568 374 11219
NM_003022chrX41177 1149 1005 941 21061 805 41257 1223 947 431 11311
NM_003027chr152114 29 ------
NM_003030chr351947 1743 1666 1578 707 ------
NM_003031chr164872 800 787 244 ------
NM_003034chr12137921 7779 7009 7002 6690 5928 5902 5405 2437 2214 1629 204 152 17489 33210 3162 2960 16531
NM_003035chr1--1216 1311 --
NM_003038chr272672 2504 2300 2113 1997 792 478 198 ----
NM_003042chr351957 1896 1567 227 82 ------
NM_003043chr334275 4103 509 34072 2892 759 11564 1363
NM_003045chr13104991 4915 4883 4363 4211 3767 3377 3128 1554 346 --14583 --
NM_003048chr242786 2454 2378 2190 --1204 22537 272
NM_003051chr131958 1511 284 --1661 --
NM_003069chrX2558 503 ------
NM_003071chr352102 1499 336 292 244 --1345 --
NM_003074chr341602 1519 576 171 --51841 1654 1530 406 398 --
NM_003079chr173919 321 171 --2717 34 --
NM_003081chr2021071 161 ------
NM_003095chr123324 310 278 ----1354
NM_003099chr1596040 5918 2615 2497 2144 2001 1871 1629 752 15784 21828 42 16522
NM_003106chr31353 1228 ----
NM_003107chr672620 2605 2455 2327 2106 2095 1674 21684 1647 12415 --
NM_003108chr2146889 6807 6625 6347 6039 5701 4960 4871 2046 1557 1265 1177 835 609 25078 4416 45722 5424 5002 783 16568
NM_003111chr221345 146 --2211 82 --
NM_003112chr783082 2866 2781 2376 990 646 368 51 31201 590 262 12633 --
NM_003113chr23814 757 204 ------
NM_003128chr232593 2040 1058 1469 21739 37 --
NM_003129chr8161 ------
NM_003130chr741093 247 135 71 --21209 361 --
NM_003131chr671946 1754 1586 1504 773 711 590 --161 --
NM_003133chr13352 150 84 1192 2201 49 --
NM_003137chr641855 1557 1531 642 1534 1272 12105
NM_003146chr113363 259 32 ------
NM_003150chr1732387 568 455 1166 1146 --
NM_003152chr1721215 92 ------
NM_003154chr42105 77 --1184 --
NM_003155chr832794 2029 917 21842 652 11926 1689
NM_003156chr1131321 1047 514 ----11243
NM_003161chr1773514 2306 1410 1246 1140 510 438 --33346 3250 1391 --
NM_003183chr23743 641 317 --1243 --
NM_003184chr831142 351 21 ----21110 861
NM_003185chr2061287 1200 887 461 49 25 ----11081
NM_003188chr6145 ------
NM_003189chr1103303 3296 3100 2977 2645 2145 1309 691 552 386 33036 1067 149 32575 2492 226 1393
NM_003194chr61417 ----178
NM_003198chr11274 --1255 --
NM_003199chr18165633 5294 5094 5000 4956 4129 3815 3736 3481 2127 1466 1095 743 709 304 67 23649 1625 ----
NM_003201chr101108 21004 662 2261 124 --
NM_003202chr521747 566 21877 1736 11900 --
NM_003206chr61439 --2425 313 --
NM_003211chr1231697 1435 687 1288 ----
NM_003217chr1242038 595 583 122 ----11856
NM_003220chr621545 388 ------
NM_003221chr673871 3769 3415 3185 2800 2743 426 13338 13000 --
NM_003222chr204929 458 314 116 1965 1405 --
NM_003234chr362451 2154 1823 955 456 376 --11560 22137 1676
NM_003236chr263565 3537 3277 2911 2615 137 ----13288
NM_003238chr11234 ------
NM_003242chr392308 1840 1669 906 816 810 788 698 368 1781 21000 191 --
NM_003246chr1511458 --31971 1329 305 --
NM_003247chr641671 1522 1433 167 --21678 426 --
NM_003253chr2151609 1573 1543 1391 221 ------
NM_003255chr1772438 2272 2136 2074 1968 388 296 12168 ----
NM_003257chr1521434 971 1997 31051 1011 84 --
NM_003262chr3105276 5057 4367 4158 4046 3813 3634 1994 879 272 21727 1006 12059 --
NM_003264chr4--143 1511 --
NM_003269chr621256 21 --21177 1006 --
NM_003270chrX3870 789 379 --1952 137
NM_003272chr12226 84 ----1247
NM_003274chr2152701 2047 1844 1188 567 --22661 405 --
NM_003281chr1105474 3633 3507 2019 1823 1690 1670 1504 1186 303 --25321 4646 --
NM_003286chr2051118 1105 856 835 126 ------
NM_003291chr131812 2697 314 ----
NM_003292chr12504 461 11873 22291 1602 --
NM_003298chr3105917 5728 5259 4681 4436 4402 2186 1941 1043 237 --45426 5161 2030 206 --
NM_003304chr311024 ----1616
NM_003305chr42348 280 1126 --1111
NM_003314chr5--190 ----
NM_003317chr141102 1262 ----
NM_003319chr24347 155 70 42 --1776 --
NM_003320chr1134465 3148 1735 --14121 24101 4080
NM_003336chrX51066 970 775 295 89 1825 --21008 991
NM_003337chr561448 1439 1131 324 158 24 --2305 173 --
NM_003338chr1031888 1287 780 2721 600 1479 11393
NM_003339chr541337 1039 649 642 11582 11491 --
NM_003340chr431108 867 108 ------
NM_003341chr33584 532 164 1199 ----
NM_003342chr1743133 849 538 531 11231 33106 3072 2566 12978
NM_003344chr711709 --11682 --
NM_003348chr1221146 686 ------
NM_003349chr2071583 1501 1449 1209 1072 376 145 ------
NM_003352chr22934 254 --2970 695 --
NM_003359chr42983 948 ------
NM_003368chr12713 518 180 2617 90 --
NM_003369chr1122399 274 22523 557 ----
NM_003370chr191623 1757 ----
NM_003372chrX146 --1321 --
NM_003375chr10----1413 --
NM_003376chr631877 1445 570 --11347 --
NM_003376chr631877 1445 570 --11347 --
NM_003379chr61437 1915 1755 --
NM_003380chr102312 63 --2227 88 --
NM_003383chr92426 24 --3525 167 123 --
NM_003384chr143293 146 50 1351 ----
NM_003387chr272938 2837 2647 2618 1143 1123 487 ------
NM_003390chr112240 87 1126 ----
NM_003392chr364343 3185 3141 1622 1333 235 23514 1191 24351 1702 13894
NM_003403chr143704 571 204 --1805 --
NM_003404chr2031255 765 350 --11631 --
NM_003405chr221616 ------
NM_003406chr881819 1558 1480 1430 1390 787 515 416 --1274 11724
NM_003409chr1831102 1038 157 11320 11248 --
NM_003410chrX102283 2263 2074 2017 825 649 315 306 275 142 32647 2406 670 32067 1115 606 1235
NM_003411chrY61641 1615 1580 663 612 137 21831 633 ----
NM_003412chr392838 2414 1248 1112 990 982 693 591 175 --22788 828 --
NM_003413chrX31785 590 451 1231 2577 241 --
NM_003430chr1931200 583 230 31030 400 250 ----
NM_003439chr752692 2634 2217 1242 414 13363 --2302 159
NM_003440chr123763 294 62 ------
NM_003442chr111159 --1846 --
NM_003452chr92650 237 --1662 1227
NM_003453chr131258 164 ----
NM_003457chr174542 190 116 42 --1593 --
NM_003458chr373365 3126 2906 2778 2601 381 252 --23778 2627 --
NM_003463chr653301 2995 2309 2243 256 --32171 1058 803 --
NM_003467chr2142 ------
NM_003468chr2104007 3828 3347 3026 3003 2930 1352 1108 221 89 --1302 --
NM_003469chr23442 174 26 ----1106
NM_003470chr1681667 1648 1604 1557 714 444 433 352 --21328 1177 --
NM_003471chr351880 911 515 302 211 22165 780 1655 --
NM_003472chr63519 141 134 --11335 21105 343
NM_003473chr102168 73 1755 1859 --
NM_003478chr1143017 2783 2521 125 1260 32866 2201 417 --
NM_003483chr1272847 2703 2387 2088 586 536 45 22488 275 32375 2062 1819 --
NM_003488chr171875 ------
NM_003489chr21113429 3191 2949 2831 2215 1261 728 523 355 111 30 13164 12273 2782 343
NM_003498chr16--12783 22437 898 --
NM_003506chr841328 1092 901 432 --51348 1273 948 390 331 --
NM_003507chr251987 1867 1736 1641 22 21631 1458 31881 1557 747 --
NM_003566chr1283303 2754 2637 2496 2295 1120 580 196 --2497 206 --
NM_003567chr12442 55 --131 --
NM_003569chr62543 119 --2570 271 --
NM_003574chr1885738 5572 5317 4283 4251 3690 1211 1148 12322 85052 3883 1842 1558 1489 1011 978 484 1140
NM_003575chr7----1467 --
NM_003576chr1362721 2466 2294 962 801 567 --22799 246 1574
NM_003579chr11156 ------
NM_003580chr82571 464 165 ----
NM_003582chr11218 ------
NM_003583chr1293950 3459 3062 2522 1253 1020 532 215 204 13283 22820 120 --
NM_003589chr1331434 1079 145 --31305 1056 182 --
NM_003590chr263653 3515 1238 928 595 454 2219 142 33700 2944 2627 --
NM_003597chr282295 2198 2181 1972 547 538 322 157 --1189 11449
NM_003601chr41158 ------
NM_003603chr461803 1490 1453 1422 526 94 1582 --12135
NM_003615chr3133788 3474 2498 1329 1317 1186 1159 1140 1001 954 822 401 342 1590 53955 2649 970 755 290 11341
NM_003617chr1104942 4188 3157 3133 1236 1110 995 668 237 81 31304 1254 1066 --14921
NM_003618chr231182 221 111 1511 1979 1304
NM_003620chr174412 354 121 79 ------
NM_003622chr1222138 647 2664 542 21993 814 --
NM_003626chr1121291 1020 194 31336 1130 253 --
NM_003628chr21626 ------
NM_003630chr63728 529 515 --2481 42 --
NM_003633chr541866 1771 1700 325 1960 ----
NM_003642chr2------1122
NM_003660chr191270 ------
NM_003663chr392944 2739 2496 2194 979 904 772 651 488 23431 1370 21362 565 1254
NM_003664chr51179 --2440 69 --
NM_003670chr321165 422 ----21206 486
NM_003671chr952940 1067 909 636 457 23316 3057 21362 1029 --
NM_003672chr151921 1796 1316 116 108 --11516 1228
NM_003677chr122782 69 11612 ----
NM_003679chr172911 2769 2421 2398 2256 1076 410 11053 1319 --
NM_003681chr2195540 5279 4975 4574 1406 1239 529 517 80 --24904 2349 25890 472
NM_003688chrX------1239
NM_003692chr91692 --1380 --
NM_003701chr1321022 772 --41049 944 808 433 --
NM_003704chr4----1633 --
NM_003705chr23844 596 305 ------
NM_003713chr161705 1303 1253 698 314 102 ------
NM_003714chr531170 724 27 --1258 --
NM_003718chr74545 513 168 47 1360 --1453
NM_003722chr362672 2132 1839 1773 886 599 1298 12477 --
NM_003725chr12------1421
NM_003728chr42505 222 ------
NM_003743chr222166 1461 11910 ----
NM_003744chr142202 24 --21268 973 --
NM_003749chr1342301 2161 1765 878 --31688 933 736 1814
NM_003750chr10--1311 2749 335 --
NM_003758chr1521122 603 21264 29 1115 --
NM_003758chr1521122 603 21264 29 1115 --
NM_003759chr4104171 4089 3327 3036 2985 2656 883 762 690 477 34243 3901 224 14005 --
NM_003760chr12539 262 2710 329 ----
NM_003762chr131336 926 165 --1941 --
NM_003763chr2083175 3133 3076 2825 1976 481 223 130 ------
NM_003766chr173496 169 28 ------
NM_003772chr1161228 534 345 334 265 244 --1379 --
NM_003774chr12143335 3126 2862 2621 2586 2568 2520 1318 1026 999 661 601 384 204 11293 21310 1303 --
NM_003781chr32393 40 --11871 --
NM_003783chr121136 435 11212 ----
NM_003787chr18111631 1549 1451 1321 1263 1238 1138 615 547 537 203 --1597 --
NM_003794chr331052 849 437 ------
NM_003795chr63484 199 105 2536 72 ----
NM_003796chr193601 181 114 1529 --1244
NM_003799chr1864250 3562 1309 1212 1123 175 --22882 718 11560
NM_003800chr621946 243 21981 1911 11747 --
NM_003816chr841425 1176 375 85 --153 --
NM_003819chr11222 ------
NM_003838chr121099 319 --3455 302 31 --
NM_003842chr861715 889 398 294 254 167 --31822 702 44 1711
NM_003850chr132439 208 ------
NM_003858chr142278 94 ------
NM_003861chr1452849 2323 2139 1852 295 11805 22508 408 --
NM_003870chr1531300 538 218 --12097 --
NM_003872chr273037 2896 2718 1223 639 476 390 1485 1865 22634 633
NM_003873chr1042135 1739 1690 76 --21941 755 --
NM_003877chr122913 298 ----1189
NM_003884chr341557 1480 507 127 1629 --1411
NM_003885chr174884 856 168 112 12154 --12117
NM_003887chr252199 1720 903 790 547 2472 375 21512 1438 12345
NM_003895chr215643 535 290 262 112 21895 1407 2745 383 --
NM_003896chr24989 917 160 92 1120 ----
NM_003901chr1052438 1938 1700 1003 166 12626 11708 --
NM_003902chr16722 632 579 532 311 53 1319 1297 --
NM_003909chr8102962 2696 2685 1905 1190 1135 965 829 295 186 --42750 2285 689 84 --
NM_003913chr654211 3648 3272 1576 1368 13949 21104 778 --
NM_003921chr161723 1432 674 618 129 60 --2248 205 --
NM_003922chr15------174
NM_003927chr183971 743 417 --1146 --
NM_003930chr742220 2130 1849 1748 --31709 719 120 --
NM_003931chr63611 529 136 --1197 --
NM_003934chr931039 484 88 1823 ----
NM_003939chr10124056 3337 3300 2821 2780 2720 2693 2586 987 819 684 631 23634 266 31490 1231 245 --
NM_003941chr742341 1710 1668 55 --31624 362 124 --
NM_003943chr441128 1053 1009 294 2411 400 ----
NM_003945chr57498 468 340 154 126 93 57 --1187 --
NM_003947chr331194 1007 130 ------
NM_003948chr462430 2085 1705 1077 1052 920 --31735 635 230 --
NM_003953chr1112889 2063 1985 1952 1936 1855 774 625 383 334 262 1475 ----
NM_003957chr111756 ------
NM_003958chr683647 3356 2711 2704 1244 715 508 157 --13098 --
NM_003966chr5187026 6809 6767 6145 6068 5863 5570 5462 4873 2802 2701 2634 2259 1295 1226 976 886 746 47632 7260 6836 6704 47265 2657 1648 1204 --
NM_003968chr32501 45 ------
NM_003971chr171515 ------
NM_003972chr101346 188 --1311
NM_003980chr631068 1048 224 --1387 --
NM_003983chr1683732 3451 3285 3188 3169 1115 891 101 --14392 --
NM_003994chr1294393 3824 3248 2821 1634 1450 809 702 28 1122 34319 3796 3663 --
NM_003998chr42630 141 ----1679
NM_004006chrX52632 2292 2206 2156 751 ------
NM_004007chrX52632 2292 2206 2156 751 ------
NM_004009chrX52632 2292 2206 2156 751 ------
NM_004010chrX52632 2292 2206 2156 751 ------
NM_004011chrX52632 2292 2206 2156 751 ------
NM_004012chrX52632 2292 2206 2156 751 ------
NM_004013chrX52632 2292 2206 2156 751 ------
NM_004014chrX52632 2292 2206 2156 751 ------
NM_004015chrX52632 2292 2206 2156 751 ------
NM_004016chrX52546 2206 2120 2070 665 ------
NM_004017chrX52632 2292 2206 2156 751 ------
NM_004018chrX52546 2206 2120 2070 665 ------
NM_004020chrX52632 2292 2206 2156 751 ------
NM_004021chrX52546 2206 2120 2070 665 ------
NM_004022chrX52546 2206 2120 2070 665 ------
NM_004023chrX52546 2206 2120 2070 665 ------
NM_004028chr1873677 3090 3014 2891 1553 1234 508 23910 1108 43334 2997 1339 262 --
NM_004033chr52695 137 ------
NM_004034chr103544 426 164 1446 1592 --
NM_004035chr17114967 4948 4755 4266 4015 3410 3202 1542 1289 286 70 --24976 4911 --
NM_004039chr152308 293 ------
NM_004040chr2--1981 ----
NM_004050chr1411045 22722 2080 12597 --
NM_004056chr84874 819 776 85 ------
NM_004060chr541206 1179 1166 40 --11324 1474
NM_004067chr751530 1154 1141 563 506 2302 274 ----
NM_004075chr122531 152 --157 --
NM_004077chr1241230 1094 875 841 181 164 --
NM_004080chr74966 526 194 72 21209 488 11318 --
NM_004081chrY21878 236 --21306 701 --
NM_004090chr1763299 3017 1367 1216 784 696 --23063 2818 22513 2496
NM_004093chr1322817 2688 12040 12012 12428
NM_004094chr1462596 2542 2215 2048 747 369 1247 22089 666 22488 491
NM_004096chr1072014 1824 1607 1502 1427 1360 557 ------
NM_004098chr101490 ------
NM_004100chr652661 2117 1072 742 656 1960 --22193 2030
NM_004105chr221059 56 ------
NM_004112chr1761635 1428 551 458 451 193 --1284 --
NM_004113chr31351 ------
NM_004114chrX1276 ------
NM_004117chr642209 2124 2113 1483 21560 383 21621 354 --
NM_004124chr1473103 2721 2294 1324 1048 517 243 1833 52237 872 798 537 229 --
NM_004133chr872537 1962 1900 1664 1088 564 77 --52367 2290 1920 613 489 12520
NM_004134chr51609 1577 1598 --
NM_004136chr1582961 2905 2515 2377 2288 708 467 49 --21299 24 --
NM_004157chr32890 562 --1261 --
NM_004161chr241636 988 215 157 ------
NM_004162chr3----1933 --
NM_004169chr171141 ------
NM_004171chr11179649 9475 8450 8342 7830 7309 3310 3297 2514 2489 1823 1680 1372 1109 841 650 554 39524 6982 2894 46676 6362 3283 1725 --
NM_004172chr542023 383 366 59 ------
NM_004181chr42342 273 ------
NM_004187chrX21413 149 ------
NM_004193chr102530 188 ------
NM_004203chr16133 127 ----
NM_004205chr112556 517 ------
NM_004210chr1061915 569 388 363 311 108 ------
NM_004225chr83946 589 61 ----21210 457
NM_004226chr21110 ------
NM_004227chr752932 2291 946 866 579 --22580 547 --
NM_004229chrX82055 1825 1731 1628 1548 872 176 92 21606 599 11525 --
NM_004232chr1853720 661 594 510 89 11461 53485 3206 2463 756 581 --
NM_004235chr93754 714 553 --159 --
NM_004237chr52897 879 --1903 --
NM_004241chr10--1648 ----
NM_004242chr6--152 ----
NM_004244chr122432 29 ------
NM_004263chr231633 288 180 ------
NM_004267chr31497 ------
NM_004272chr52292 136 11245 1676 1549
NM_004274chr1452222 1298 1170 746 315 --12724 12975
NM_004279chr752372 2175 743 208 116 ----12386
NM_004288chr23928 854 329 1130 ----
NM_004293chr9123507 3144 3085 2395 2381 2355 1448 782 622 311 245 95 21303 1063 13458 --
NM_004301chr33354 84 25 ------
NM_004311chr1032357 732 282 --12234 --
NM_004316chr1241179 956 808 800 172 31097 1074 253 --
NM_004326chr11495 --1268 --
NM_004327chr2272387 2129 2081 2005 979 908 408 ------
NM_004329chr1021045 147 1971 3439 403 241 --
NM_004330chr154923 774 138 123 ----11176
NM_004331chr841788 1733 745 597 1992 --11650
NM_004338chr1896793 6346 5956 5290 4919 2645 1047 828 590 1466 46866 5628 5321 2691 36981 6244 2636
NM_004342chr752089 1698 465 443 252 12027 52220 1943 553 202 112 12142
NM_004344chrX2503 92 ------
NM_004349chr82921 155 --21224 226 --
NM_004354chr46704 333 283 256 213 121 1248 1298 --
NM_004359chr191529 ------
NM_004369chr24734 592 461 226 ------
NM_004370chr672163 2049 1948 1825 1585 819 643 --31724 1558 577 11627
NM_004371chr151487 1391 1289 958 177 --41507 1296 229 136 --
NM_004374chr81136 ------
NM_004380chr1652334 2217 1994 45 21 --1318 --
NM_004384chr551690 1564 810 335 128 1194 ----
NM_004386chr1972132 1944 1901 1849 1502 628 31 ------
NM_004388chr1----2424 91 --
NM_004392chr1342099 1844 1704 581 11033 11633 --
NM_004393chr321576 203 --42222 1626 1609 1467 1378
NM_004395chr5--1169 ----
NM_004397chr11133776 3697 3384 3221 3075 2925 1607 1417 1159 842 492 461 94 --21266 186 33611 3570 3462
NM_004404chr242058 1370 738 497 --21950 1411 2633 187
NM_004405chr23858 848 283 --1739 --
NM_004411chr73714 274 36 1658 1264 1210
NM_004414chr214621 582 542 52 --11174 --
NM_004415chr65693 643 592 176 29 1686 ----
NM_004423chr352605 2533 2229 2064 82 --11091 --
NM_004426chr1241283 776 250 208 2263 225 ----
NM_004430chr882534 2449 2065 1992 1848 996 163 27 --22098 873 --
NM_004432chr991767 841 730 692 611 595 327 274 253 --42415 1887 832 191 --
NM_004434chr143294 190 136 --1330 --
NM_004436chr13666 445 202 --1216 --
NM_004438chr252545 2239 839 739 77 --1237 --
NM_004440chr631971 482 299 1784 2736 522 --
NM_004441chr321282 1234 ------
NM_004446chr13170 63 40 ------
NM_004448chr17----1488 --
NM_004450chr141297 ------
NM_004454chr352236 1473 862 723 305 1695 --1380
NM_004457chr251591 1391 1093 343 216 ------
NM_004458chrX122570 2251 2201 2100 2080 1862 1796 1052 532 483 167 73 --31701 937 771 --
NM_004459chr1761543 764 692 498 382 208 --11797 --
NM_004464chr491399 1230 883 788 737 585 558 408 237 33846 2847 318 13017 1468
NM_004472chr52666 173 --1471 --
NM_004480chr141265 ------
NM_004481chr132659 2595 757 12125 ----
NM_004483chr162453 382 196 ----
NM_004491chr1954159 1738 1570 364 122 13932 ----
NM_004492chr153226 201 75 1173 ----
NM_004496chr142175 149 ------
NM_004499chr52362 351 --2435 425 --
NM_004500chr1451521 1281 1260 623 97 11752 11902 --
NM_004501chr184143 3227 3067 2675 937 899 277 82 21339 1276 --13950
NM_004504chr272733 2713 1163 1145 935 735 407 32535 388 34 11201 1663
NM_004506chr62476 134 --2282 80 1230
NM_004516chr1951149 420 339 315 35 --3451 379 190 --
NM_004520chr5----2555 250 --
NM_004521chr101327 1120 1343 --
NM_004523chr1021483 1183 --21228 1095 --
NM_004525chr241490 1090 90 40 1375 1211 --
NM_004529chr931145 561 388 21122 1060 11392 --
NM_004537chr1241352 979 224 46 ------
NM_004566chr1032120 2036 815 11949 22534 2057 1217
NM_004569chr141215 --2671 626 --
NM_004571chr2183369 3330 3236 3089 1310 578 105 27 ------
NM_004575chr421384 78 ------
NM_004576chr51175 ------
NM_004578chr12916 86 1114 --1739
NM_004583chr174773 722 223 181 ------
NM_004586chrX85301 4980 4146 3945 3729 1844 822 517 35445 4726 3670 35214 843 668 --
NM_004593chr32672 122 1115 1138 --
NM_004598chr5113348 3101 3032 2887 2721 2531 2498 2231 936 729 686 12491 22443 481 --
NM_004600chr141424 1172 248 131 1473 11262 1957
NM_004607chr52218 195 ------
NM_004612chr994431 4040 3610 3132 1170 994 760 619 516 1329 54621 4102 3496 3239 825 2957 244
NM_004619chr122115 503 1433 1113 --
NM_004622chr252106 807 716 298 157 1182 12184 --
NM_004631chr12325 230 ------
NM_004642chr123687 266 33 ------
NM_004645chr173187 117 67 ------
NM_004650chrX51856 1844 1579 1245 464 21916 1492 21902 1704 --
NM_004654chrY41037 506 438 290 11087 1559 --
NM_004660chrY21503 337 --11704 --
NM_004663chr1571525 1383 1113 1010 601 522 88 --1260 --
NM_004666chr61258 1347 ----
NM_004670chr1071603 1351 1302 1160 601 545 108 --147 11550
NM_004677chrY1457 ------
NM_004680chrY1304 --154 --
NM_004681chrY3676 199 179 --1274 --
NM_004686chr851638 674 564 306 115 --1538 --
NM_004687chr1741651 1555 1469 1455 1502 ----
NM_004689chr14----1352 --
NM_004696chr13835 792 550 --1763 --
NM_004703chr1762469 2197 1759 945 721 543 152 12258 --
NM_004709chrX41706 1188 1141 168 ------
NM_004717chr711375 ------
NM_004722chr7--1212 ----
NM_004726chrX105514 5280 4850 4371 3557 1444 776 396 139 50 1997 34395 3797 1692 1819
NM_004730chr542112 1805 355 93 ----21440 272
NM_004733chr33235 184 152 ------
NM_004734chr1353014 2583 2372 585 487 11255 1251 --
NM_004736chr172155 1470 779 557 520 272 28 11864 2539 81 --
NM_004738chr2042486 2338 2032 186 1239 1979 1123
NM_004742chr321833 1317 2700 172 1619 1668
NM_004744chr473879 3584 3350 1055 731 578 398 11265 ----
NM_004745chr866682 6165 6104 5975 5732 944 --36833 5678 1753 --
NM_004747chr1051596 1265 329 305 265 --1608 --
NM_004748chr15102707 1440 1151 867 733 630 328 309 234 200 1557 53263 2984 2854 614 467 11305
NM_004755chr144878 848 369 68 21141 38 1358 --
NM_004760chr72850 246 --22429 425 12010
NM_004764chr122469 202 --291 73 --
NM_004768chr121098 800 ----1964
NM_004772chr521043 387 11536 21091 329 --
NM_004774chr1743076 3033 2443 1232 1768 ----
NM_004775chr1862392 2171 1600 1515 958 584 2921 431 12113 1420
NM_004776chr2053258 2402 2391 2280 523 1830 32710 1120 641 --
NM_004779chr551077 538 289 136 70 --1911 --
NM_004781chr171546 1275 1197 443 387 359 51 --2488 147 1210
NM_004781chr171546 1275 1197 443 387 359 51 --2488 147 1210
NM_004786chr181194 ------
NM_004787chr41144 ------
NM_004788chr1152481 2110 1938 1891 1692 --22375 2050 32540 1980 536
NM_004789chr93440 338 311 ----151
NM_004798chr20113409 2478 2443 1108 925 817 687 428 301 202 42 --21470 598 13547
NM_004801chr251442 1157 1148 137 77 1482 --1973
NM_004805chr231002 902 318 --2908 362 --
NM_004808chr1042328 1040 632 358 23312 640 12071 --
NM_004815chr1114812 4671 4585 4366 4095 3851 3449 792 768 486 441 --1126 1213
NM_004834chr253195 3043 1323 597 304 11077 --12158
NM_004835chr33865 762 143 --198 --
NM_004835chr33865 762 143 --198 --
NM_004836chr22985 739 --2214 125 1612
NM_004837chr161554 1301 1103 452 76 49 21586 1205 --21750 1691
NM_004840chrX72358 2084 955 794 455 347 32 12433 1920 1866
NM_004841chr1--31138 1131 63 1289 --
NM_004842chr631612 568 373 1512 1134 11312
NM_004850chr22333 252 1421 ----
NM_004854chr23873 480 244 --11321 131
NM_004857chr1464043 3914 3371 1915 1804 1457 --1473 --
NM_004859chr1733037 2337 2056 1108 12221 --
NM_004862chr1671593 1362 495 455 393 355 306 1438 --11083
NM_004863chr1484591 3354 3337 3318 1406 549 436 58 1208 23921 2054 13725
NM_004865chr62288 41 --1413 --
NM_004866chr5114975 4650 4582 3663 3488 1949 1929 1268 1100 539 166 24766 357 54518 3744 3361 42 29 --
NM_004869chr1851516 1434 1410 1256 1125 1456 21587 155 --
NM_004871chr17104214 3948 3911 3709 3385 3111 1744 1512 1476 731 --13135 --
NM_004873chr1463202 3045 711 665 187 21 1808 12317 --
NM_004888chr94977 293 199 137 ------
NM_004893chr5----1476 --
NM_004896chr1041255 1179 259 135 --1238 --
NM_004898chr4102622 2027 1988 1127 1108 1076 759 729 647 508 1348 12292 --
NM_004902chr204834 720 344 130 --3535 224 67 --
NM_004904chr795994 5207 4817 2094 1663 624 488 420 275 11255 56052 5587 4752 2068 499 11507
NM_004905chr12603 183 1641 2909 764 --
NM_004906chr62660 226 --293 77 --
NM_004912chr721208 385 --21513 84 11493
NM_004915chr211608 --1565 --
NM_004922chr102899 86 11033 ----
NM_004926chr1461819 1567 1505 1376 673 375 --1297 --
NM_004929chr811120 --1988 11492
NM_004932chr521541 152 1168 1714 --
NM_004937chr1741969 1657 823 170 ------
NM_004938chr94338 300 232 226 ------
NM_004956chr794470 3907 2942 1673 1339 1329 1053 429 75 13549 1267 34351 4239 3811
NM_004958chr1150 ------
NM_004961chrX21097 340 11146 21524 399 --
NM_004966chr1021020 292 ------
NM_004969chr103555 512 416 ------
NM_004972chr931197 399 290 ----11168
NM_004973chr651597 1155 705 289 167 --11725 --
NM_004976chr1185121 5027 5013 4133 3815 3687 1763 385 1661 13263 1667
NM_004985chr1283835 3721 3108 2810 1375 1019 891 134 24441 3556 14192 23275 1227
NM_004987chr23370 326 304 ------
NM_004992chrX138546 8301 7237 6266 3195 3124 2104 2027 1986 1557 943 339 249 --11239 15198
NM_004992chrX138546 8301 7237 6266 3195 3124 2104 2027 1986 1557 943 339 249 --11239 15198
NM_004993chr1461059 566 457 437 306 34 1111 ----
NM_004996chr1631629 1498 1309 ------
NM_004999chr6104253 3097 3054 1268 957 921 471 330 291 34 24358 1614 31755 1492 351 --
NM_005006chr22295 247 --1356 --
NM_005010chr782271 1986 1952 1879 1735 1705 839 371 --2681 200 --
NM_005011chr731549 1409 120 ------
NM_005022chr171201 ------
NM_005026chr151885 765 547 511 404 --1126 --
NM_005032chrX2705 113 --2855 318 --
NM_005036chr22148340 7936 7756 7418 7166 7145 7100 6996 6981 6209 5749 2395 423 25 23190 1740 46323 5146 1234 160 --
NM_005037chr3------1173
NM_005044chrX114369 4208 3995 3667 2810 1826 1350 617 465 248 120 --14593 1628
NM_005045chr73884 743 680 ------
NM_005054chr241700 1612 1529 462 --21678 1164 --
NM_005056chr12115613 5086 4948 4900 4746 4511 4480 4353 3975 1212 1099 --32215 1394 890 --
NM_005063chr1073262 3111 2948 2940 2449 467 338 --13736 1173
NM_005065chr1494374 4093 4079 4008 1971 1831 1366 935 494 1368 105028 4284 4266 4182 2159 1599 1124 894 467 309 1160
NM_005066chr13694 261 60 1828 194 --
NM_005069chr2161730 1717 1360 1265 1256 296 --11103 --
NM_005077chr91136 --1337 --
NM_005079chr873160 2874 2042 1212 1108 350 165 13084 ----
NM_005080chr222864 335 ----1630
NM_005087chr33593 214 173 --1774 --
NM_005095chr141709 1453 501 391 12203 11919 --
NM_005102chr22853 699 1633 ----
NM_005105chr131908 1894 175 12157 21667 675 --
NM_005109chr352522 1818 973 511 314 ------
NM_005112chr42855 640 --11031 --
NM_005113chr143469 435 127 ------
NM_005116chr2063925 3475 3120 2799 469 141 13156 14352 --
NM_005119chr141215 1179 1091 907 ----1866
NM_005121chr1793356 3014 2889 2615 2562 1181 528 254 79 33512 3066 820 43797 2734 1407 1345 --
NM_005124chr6171 1826 1689 --
NM_005126chr372292 1838 1683 1659 1585 688 275 21889 102 22025 1907 12056
NM_005133chr111397 ------
NM_005134chr182899 199 ------
NM_005141chr41123 1355 ----
NM_005151chr1862269 1778 1771 1656 896 431 --51576 599 324 285 188 --
NM_005154chr151226 1603 130 --
NM_005156chr9164583 4552 4306 4238 4096 4072 3793 3464 2135 1749 1698 1375 1104 1057 646 508 24773 1730 25382 853 34245 640 371
NM_005159chr1562141 1411 570 329 85 25 11511 21588 1459 --
NM_005164chr1252047 1912 975 894 157 11987 --12565
NM_005168chr241671 623 582 141 --11752 --
NM_005171chr121131 11050 1380 11008
NM_005180chr1041215 424 236 55 ----11522
NM_005188chr11177688 7460 7268 6246 6078 6016 5809 5582 2901 2865 2775 2460 2306 1824 1769 961 477 1910 87858 7193 7123 6187 5351 2683 2238 2231 17888
NM_005189chr1782518 2391 2371 2166 1832 689 442 204 --22323 1848 --
NM_005194chr202582 544 1572 ----
NM_005197chr1496154 5160 4698 2450 2058 1680 1637 1308 983 12337 55384 4919 4656 2160 1187 --
NM_005201chr331179 800 296 --11153 1957
NM_005202chr132084 1967 58 ------
NM_005203chr10173 ------
NM_005204chr104996 855 844 745 1727 1947 --
NM_005207chr2282354 2319 2289 1171 1162 1150 1118 1037 11012 ----
NM_005210chr2122 ------
NM_005214chr22396 64 --1418 --
NM_005219chr531256 447 273 1572 21677 1367 --
NM_005221chr73251 239 217 ------
NM_005222chr73943 267 252 1847 2245 228 --
NM_005229chrX41244 396 351 313 ------
NM_005230chr123566 545 120 ------
NM_005231chr11----1164 --
NM_005233chr362496 2383 2208 680 492 140 --1968 --
NM_005235chr2217599 7570 7540 7103 7076 6621 6344 5625 5412 5241 2655 2469 1569 1560 1304 1290 991 855 793 639 313 57295 5856 5452 2763 809 47823 7159 6142 5118 16292
NM_005238chr1163214 2858 2824 2817 2326 119 --13232 --
NM_005241chr331312 856 93 --11350 --
NM_005243chr221127 ------
NM_005254chr1551183 1035 870 465 170 --41367 1344 1082 32 --
NM_005256chr111736 ----2814 613
NM_005257chr1811314 --31306 881 390 1121
NM_005259chr211005 ----11386
NM_005261chr84856 702 642 325 --1994 --
NM_005271chr1041205 1103 838 423 ----1246
NM_005274chr11132 ------
NM_005277chr471953 1789 1624 1465 343 225 201 175 5759 731 636 619 390 --
NM_005278chrX1451 ------
NM_005296chrX2852 801 ------
NM_005311chr742615 1145 966 395 22744 2300 1377 --
NM_005312chr932095 1025 924 12686 1808 --
NM_005316chr1121153 372 ------
NM_005324chr174683 123 68 49 --11646 --
NM_005328chr82771 244 --2711 566 --
NM_005339chr4124250 3940 3727 3536 3359 3254 1446 1162 564 402 281 212 13518 13864 --
NM_005348chr144938 356 170 123 ------
NM_005349chr44635 602 498 104 --1432 --
NM_005358chr1341849 1210 692 122 --11512 --
NM_005359chr18246521 5936 5324 5232 5214 5035 4977 4828 4104 4069 4015 2395 2246 1815 1718 1392 1364 1138 1117 1055 543 319 138 90 11648 96481 5354 5076 4181 1632 1615 1148 742 106 24874 4227
NM_005375chr671158 1131 1093 773 387 255 80 ------
NM_005376chr13346 287 195 1983 ----
NM_005378chr25708 691 682 597 96 --1739 --
NM_005382chr82383 116 ------
NM_005385chr32312 26 --12662 --
NM_005397chr743343 3024 2450 429 22529 1500 12897 --
NM_005398chr1031103 1041 85 1554 31409 972 249 --
NM_005399chr164215 3886 3112 1731 1400 397 24269 3643 11010 --
NM_005400chr262648 2359 2138 2105 1935 1882 12171 ----
NM_005402chr781742 1587 599 439 396 162 92 27 ------
NM_005406chr1811094 --2605 279 11516
NM_005407chr1421281 421 --1455 1989
NM_005409chr451097 868 272 136 110 2953 780 2958 831 --
NM_005413chr21340 ------
NM_005414chr3----2305 211 --
NM_005415chr21592 --1273 --
NM_005420chr43612 140 63 ------
NM_005433chr1842580 966 674 152 1822 ----
NM_005436chr10113661 3327 3204 3115 2602 1517 1240 972 653 474 201 12871 33933 2745 360 --
NM_005439chr123375 155 68 --1178 1516
NM_005443chr43418 151 26 --1203 --
NM_005445chr101211 --1295 --
NM_005455chr181610 1596 1468 1416 638 528 375 35 11568 2674 222 --
NM_005458chr911529 ------
NM_005460chr53584 208 88 --1526 --
NM_005465chr171630 813 792 345 337 288 146 11405 ----
NM_005466chr142492 85 ------
NM_005475chr1242826 2494 874 81 12777 12880 --
NM_005487chr2261975 1527 481 409 280 175 1752 ----
NM_005494chr71163 ------
NM_005497chr17115941 4201 4043 1842 1495 918 624 604 437 341 100 11982 35059 1936 318 21956 380
NM_005502chr942566 2108 551 309 --32396 1039 192 --
NM_005504chr12126249 5686 4366 2438 2174 1404 948 847 776 687 677 217 21820 473 11901 1432
NM_005509chr541394 710 615 153 --21215 295 11468
NM_005517chr12935 224 --1102 --
NM_005522chr751390 1253 523 353 297 --182 1544
NM_005524chr33323 118 99 ------
NM_005530chr1541398 365 192 128 ------
NM_005537chr131365 1883 2161 66 --
NM_005542chr711430 11671 21263 80 11948
NM_005544chr231049 163 116 ------
NM_005546chr531612 821 407 --42336 2137 2022 2000 --
NM_005561chr131796 ------
NM_005563chr12669 246 ------
NM_005573chr52456 269 146 ----
NM_005574chr11122 2573 134 ----
NM_005575chr54836 713 262 164 1811 ----
NM_005576chr152241 194 ------
NM_005578chr3125133 4830 4669 4332 4172 3932 1444 1084 795 308 212 124 31297 1285 285 43431 1959 1620 947 11474
NM_005584chr13----1788 1584
NM_005585chr15----1319 --
NM_005587chr1541000 952 930 775 1633 2874 27 --
NM_005593chr124552 505 191 135 --1526 --
NM_005595chr12157 129 --1828 --
NM_005596chr9156037 5931 5046 4911 4812 4046 3964 2522 2434 1783 1489 675 429 354 87 56138 5876 4367 1596 629 16272 11678
NM_005602chr331153 184 174 --2925 378 --
NM_005603chr1832033 1772 1365 2187 128 ----
NM_005604chr642476 1711 734 223 12051 ----
NM_005607chr841036 366 145 116 ------
NM_005613chr151695 1450 880 844 574 --11622 --
NM_005629chrX2160 101 --188 --
NM_005637chr1852044 773 718 399 153 --1356 11794
NM_005638chrX51417 1359 678 127 75 --1161 --
NM_005644chr11374 ------
NM_005648chr8170 ------
NM_005655chr881321 1314 1180 1074 485 470 351 319 --1325 1920
NM_005657chr15--1132 ----
NM_005662chr82385 107 ------
NM_005665chr194407 4332 3987 3858 3645 1607 1268 797 476 63960 3621 3361 971 892 186 64925 4468 4382 3288 174 166 --
NM_005668chr594371 4203 3063 2822 1756 1294 1264 1121 666 --33024 2801 641 --
NM_005669chr562080 923 603 321 100 39 21711 375 --1160
NM_005676chrX1156 ------
NM_005688chr31951 1152 2112 97 --
NM_005715chr672763 2731 2616 2591 2077 1864 1790 --32574 1752 801 12326
NM_005717chr141059 870 846 115 1299 ----
NM_005721chr23910 398 51 1945 1390 --
NM_005722chr262430 2358 1785 667 503 62 12392 --1351
NM_005725chr152234 1778 1689 805 750 2862 741 --12253
NM_005730chr1283668 3531 2917 1443 680 642 492 420 --1469 160
NM_005735chr22858 784 158 ----
NM_005738chr771907 1667 737 363 348 218 155 11289 1692 1608
NM_005739chr1571734 864 602 471 393 223 110 --12302 --
NM_005746chr762568 2435 1761 692 433 260 21856 289 1493 --
NM_005748chr1263447 2977 2865 2642 2319 547 23007 280 12427 23204 2399
NM_005751chr71346 ------
NM_005754chr571093 946 802 487 278 78 70 2239 187 3980 814 132 --
NM_005756chrX11282 21556 1000 5390 326 305 215 61 --
NM_005759chr2124744 4414 4313 4301 3674 3589 3256 1734 968 324 185 123 --53680 3625 3615 3557 3141 24607 4291
NM_005765chrX2742 95 --2822 65 --
NM_005768chr124675 667 534 176 ------
NM_005776chr141116 ------
NM_005777chr32105 91 ------
NM_005779chr542957 2743 2635 1263 32344 943 92 13142 --
NM_005786chr1831000 971 830 21101 212 2424 247 --
NM_005789chr1772050 1925 1912 1798 1650 567 56 --1731 --
NM_005797chr1141751 1565 725 74 21804 1252 11450 --
NM_005801chr171629 ------
NM_005802chr92775 736 1207 ----
NM_005808chr333089 945 464 --1405 --
NM_005813chr242420 2302 630 224 1503 22474 584 1894
NM_005819chr153145 1223 358 279 126 12604 13239 12816
NM_005822chr631828 940 516 --1268 183
NM_005828chr1795073 4398 4276 4235 3964 3878 1802 720 634 ------
NM_005832chr361420 1225 1149 1102 563 250 --51292 1269 1171 550 493 --
NM_005840chrX187074 6889 6636 6047 5685 5152 4696 3013 2684 2369 2339 2078 1573 1501 1348 880 170 70 24646 234 66458 5070 4799 1400 561 384 17141
NM_005841chr441025 933 455 274 134 ----
NM_005843chr261365 617 536 254 206 84 11735 21932 1815 --
NM_005848chr15--165 ----
NM_005852chr1751164 928 418 271 194 1409 ----
NM_005853chr163604 512 27 --1574 --
NM_005857chr151252 1212 1080 434 84 --41454 1436 1041 227 --
NM_005859chr51361 ------
NM_005871chr103423 234 182 11083 2318 49 --
NM_005876chr2--1732 ----
NM_005882chr42828 244 ------
NM_005885chr541584 1187 658 382 1274 ----
NM_005888chr12--171 ----
NM_005891chr61144 ------
NM_005895chr1283231 1559 1448 1217 1066 1050 996 538 11370 42734 913 459 429 1118
NM_005896chr26801 725 278 203 181 152 --1132 --
NM_005898chr11102793 2697 2620 2435 2351 2126 1147 802 688 283 1346 63163 2536 2291 1265 1029 765 --
NM_005900chr431233 1132 1083 1255 --11169
NM_005901chr18238636 8630 8013 7739 7516 7206 6932 6896 6841 6708 6601 5677 5647 3307 3253 3215 2234 1866 1782 1640 1144 724 598 37419 7082 417 47302 6673 1830 554 --
NM_005902chr1594624 4523 4458 4434 3883 1484 1440 1233 110 24517 2881 11618 --
NM_005903chr5145235 4772 4681 4300 4282 3934 3783 3705 3688 1020 883 841 745 282 21700 856 63662 3352 1902 1071 943 654 1420
NM_005904chr18155 ------
NM_005907chr631308 345 49 11648 ----
NM_005909chr593657 3518 3165 2923 1406 1391 1289 942 70 --43728 2827 1659 1174 --
NM_005922chr63359 314 93 1405 1410 --
NM_005924chr731060 884 842 --11128 --
NM_005927chr541167 1077 466 338 2479 428 1187 --
NM_005930chr142266 86 1587 --1822
NM_005935chr4155209 5183 5104 4563 3556 3296 3284 2088 1534 1523 1426 1220 1196 440 27 25267 3742 34752 3919 3479 14007
NM_005941chr894136 4085 3614 3299 3134 1378 790 252 127 ----14117
NM_005944chr331091 972 146 11059 2503 496 --
NM_005955chr1145504 5470 4891 4370 4101 3981 3722 3653 1683 1576 883 756 261 123 35250 4718 4065 24861 1316 23603 1709
NM_005962chr1031478 944 605 ----11866
NM_005962chr1031478 944 605 ----11866
NM_005963chr17182 ------
NM_005966chr242054 1602 707 410 22025 1632 ----
NM_005977chr134807 796 416 282 1976 ----
NM_005982chr141218 --1152 --
NM_005986chr1361083 1033 949 729 349 252 ------
NM_005987chr1--1308 ----
NM_005994chr171898 ------
NM_005999chr11183 21280 250 4320 293 262 225 11233
NM_006007chr984521 3569 1698 1566 1370 872 665 363 --1336 11329
NM_006011chr15114182 3689 3664 3409 3349 3273 1196 1166 1139 358 276 13848 34155 4005 1049 --
NM_006015chr12283 197 21299 828 ----
NM_006016chr682206 2196 2144 2091 2054 1658 869 657 1110 22062 70 --
NM_006022chr131927 1761 1303 --
NM_006029chr141717 1540 148 --
NM_006036chr252390 2013 1818 1727 577 1100 22529 890 1541
NM_006037chr294893 4304 4219 3118 2974 1641 1428 739 149 23112 584 43885 3758 1682 677 14231
NM_006042chr172478 400 ------
NM_006043chr161694 ------
NM_006047chr2083492 3320 2847 2440 2211 1292 766 722 2950 852 11020 1520
NM_006048chr131189 1068 415 ------
NM_006054chr1171505 1294 1008 484 448 254 205 1273 ----
NM_006055chr272912 2803 2723 2614 2446 1160 605 12352 22899 142 1175
NM_006060chr794429 4206 4164 3529 3390 3345 2707 689 236 ----1834
NM_006067chr164310 130 83 33 --5932 881 802 354 333 --
NM_006079chr62178 92 ------
NM_006080chr722128 85 ----12907
NM_006090chr11685 1120 --1520
NM_006094chr841909 928 692 55 12378 ----
NM_006095chr4174453 4373 4150 4011 3933 3907 3854 3781 3666 3564 3073 2914 1768 1400 1277 707 259 --11464 11488
NM_006099chr1----2871 134 --
NM_006106chr11113258 3148 3019 2922 2812 2291 1361 1332 541 229 132 12797 23439 3352 12940
NM_006108chr1131792 793 421 --11662 11487
NM_006113chr152066 1987 1969 1524 366 21550 550 ----
NM_006122chr1522423 868 21822 970 12788 --
NM_006135chr161439 1092 562 377 225 186 --1963 --
NM_006136chr73918 539 233 11258 1461 --
NM_006141chr1652500 2409 1982 1027 829 32259 2063 622 ----
NM_006145chr193152 63 36 11079 ----
NM_006148chr1782951 2901 2825 2677 2669 2519 1991 873 --22647 715 --
NM_006154chr1572840 2009 865 788 742 535 468 1176 11107 1900
NM_006155chr242058 1370 738 497 --21950 1411 2633 187
NM_006158chr821670 471 11156 21402 561 --
NM_006161chr53567 234 24 ------
NM_006164chr2287 21 --1363 --
NM_006166chr1272429 1751 1639 970 823 468 173 --3894 344 100 1436
NM_006180chr93792 425 67 21835 627 1442 --
NM_006182chr11178 ------
NM_006186chr22964 280 --11202 --
NM_006194chr143378 179 111 ------
NM_006195chr931438 1021 35 11056 1960 --
NM_006197chr841879 1633 863 805 --1318 --
NM_006203chr574610 4540 3812 3469 1967 1684 887 --24353 24 2981 598
NM_006206chr482764 2707 2532 2478 2470 2097 483 403 12941 1552 --
NM_006216chr2272 40 --1433 --
NM_006224chr1752480 2418 1839 978 25 1317 22507 357 --
NM_006232chr3----1239 --
NM_006241chr362277 2234 2226 1523 594 204 --3860 322 251 --
NM_006246chr143977 500 109 --1983 --
NM_006247chr191116 ------
NM_006251chr573132 2869 2734 2673 2563 2386 451 1400 32686 2198 1101 --
NM_006252chr1207297 6898 6749 6425 6172 5919 5863 5682 5439 2904 2095 1945 1631 1466 1168 1057 737 682 653 66 21112 908 77396 7193 7151 6726 900 789 72 37013 1573 233
NM_006253chr1211234 ------
NM_006256chr172587 2421 2414 1923 1710 1035 317 1746 72729 2479 2266 1901 821 615 273 --
NM_006258chr1041530 349 243 27 --41360 982 592 115 --
NM_006259chr42727 717 --199 --
NM_006264chr42185 125 --1502 --
NM_006265chr861539 1214 1192 1144 327 171 --1122 --
NM_006267chr271694 1594 1537 1515 683 576 148 1531 11838 --
NM_006275chr2072447 1953 1754 1737 765 500 248 12455 --22421 750
NM_006278chr111372 ------
NM_006282chr2084526 4340 2968 1892 1336 801 725 115 1353 1742 --
NM_006283chr894666 4119 3869 3276 3039 1952 1126 400 65 21616 315 24428 941 1293
NM_006290chr641954 1790 1363 681 21722 1660 ----
NM_006292chr111193 ------
NM_006298chr672725 2086 1281 1162 1056 967 169 --12984 12691
NM_006306chrX55183 2331 847 702 521 22208 1364 ----
NM_006311chr172342 114 ------
NM_006313chr1211546 ----21275 608
NM_006315chr483904 3434 3059 2754 1598 1539 618 128 23751 407 --2795 475
NM_006319chr161748 ------
NM_006321chr33899 622 175 2715 228 42176 860 832 85 --
NM_006323chr42729 175 ------
NM_006328chr111178 --194 --
NM_006330chr841539 1046 173 61 11407 ----
NM_006333chr23543 465 147 ----1171
NM_006335chr11139 --11003 --
NM_006338chr1----2570 46 --
NM_006345chr451198 523 325 313 113 1896 ----
NM_006346chr131181 ------
NM_006352chr121374 253 ----11776
NM_006359chrX72220 1972 1964 1921 909 449 234 22308 2301 21830 468 --
NM_006364chr142479 357 11025 21313 895 11031
NM_006366chr641188 1156 822 370 2486 332 31045 399 201 --
NM_006367chr13998 385 138 11067 189 --
NM_006369chr12307 112 --195 1409
NM_006371chr394855 4215 4113 3814 3517 1545 457 219 177 22027 520 3613 210 169 --
NM_006375chrX31346 535 132 ------
NM_006378chr971416 1397 1337 1275 1005 573 459 ------
NM_006379chr742190 1491 616 259 --1744 22008 250
NM_006380chr17134277 4086 4011 3269 3205 3053 2729 1621 652 529 388 261 149 34173 2899 459 23375 29 24025 797
NM_006393chr1094234 4094 3818 3276 1615 1159 901 210 54 23381 2795 23968 3458 177
NM_006401chr91339 ------
NM_006413chr103219 181 77 ------
NM_006415chr941223 1154 984 107 --11173 --
NM_006416chr61696 --1704 --
NM_006420chr2033278 2784 907 22671 2224 12688 --
NM_006421chr8--1839 ----
NM_006430chr22409 199 ------
NM_006434chr1062761 2594 2240 807 261 65 --12658 --
NM_006439chr41575 197 ----
NM_006449chr241645 482 417 198 --1660 1812
NM_006451chr551039 910 838 759 682 1731 1322 1850
NM_006457chr4114015 3996 3348 3327 3160 2632 2533 1612 838 393 339 --2984 206 23028 449
NM_006459chr1061661 1440 1324 721 567 544 11684 11999 --
NM_006460chr174632 599 93 39 1505 ----
NM_006464chr2104534 1829 1602 1520 1447 1381 863 835 573 508 11791 21221 983 --
NM_006469chr131118 539 515 --3528 233 158 1211
NM_006472chr12297 70 --1914 --
NM_006482chr1293950 3459 3062 2522 1253 1020 532 215 204 13283 22820 120 --
NM_006489chr1431621 218 72 --11701 --
NM_006496chr171706 1620 1607 1582 1276 594 58 2428 164 41887 1686 1567 1255 --
NM_006504chr1092649 2156 2054 1813 1103 652 246 125 91 22937 296 12731 32567 2042 524
NM_006516chr131084 557 359 ----11210
NM_006517chrX61549 1510 777 277 257 212 ------
NM_006519chr62319 24 --1327 --
NM_006520chrX21728 1518 --1555 --
NM_006526chr2031708 1590 191 11657 ----
NM_006532chr1942058 1949 804 403 1348 21734 318 --
NM_006534chr2083351 2860 2669 1134 690 327 318 307 1982 42712 2567 2329 1017 --
NM_006536chr15954 828 720 681 376 1962 11022 --
NM_006538chr2104177 2773 2718 1667 845 739 557 470 378 355 11546 1164 33894 3229 677
NM_006539chr162538 192 1447 1103 --
NM_006540chr831436 1404 1357 11589 ----
NM_006544chr14105357 4935 4913 4485 4464 4028 752 537 450 97 55496 5373 5324 4878 3920 44250 3943 3831 159 25138 351
NM_006546chr1775683 5672 5560 4782 4210 2632 1101 1250 --1496
NM_006547chr762119 1957 1390 629 175 144 ----11985
NM_006557chr951389 1301 533 430 375 --41657 1565 300 259 --
NM_006558chr83518 322 139 --1362 --
NM_006561chr10166003 5960 4179 4125 2470 2153 2117 2018 1841 1568 1474 1335 676 609 195 178 11433 24209 1658 11650
NM_006565chr1611098 ------
NM_006572chr1793247 2927 2686 2614 1367 632 404 307 153 32719 2547 884 4963 741 141 31 --
NM_006574chr33352 296 285 ------
NM_006575chr142331 133 2516 425 1580 --
NM_006577chr221225 855 ----1107
NM_006587chr4299 24 11635 21439 1336 --
NM_006591chr1121717 205 11606 11649 --
NM_006593chr24660 615 230 173 1831 ----
NM_006595chr1161857 1803 810 672 323 157 --2207 188 --
NM_006599chr16138049 7841 6773 6470 5615 5448 2780 2530 1856 937 890 506 78 25781 5243 96148 5711 5119 5039 2450 2189 1582 868 371 --
NM_006601chr1231135 1023 119 ------
NM_006603chrX41982 1879 1436 1409 1571 1634 --
NM_006609chr2122929 2585 2563 2310 2217 2029 1897 1885 1874 556 192 72 1743 12291 --
NM_006614chr393476 2917 2847 2781 2729 1276 816 681 157 12870 43542 2787 2253 844 --
NM_006618chr141443 519 304 197 --11453 21171 1081
NM_006620chr6104844 3656 1515 1158 1001 891 882 733 635 253 1849 1227 14295
NM_006621chr151592 1491 797 331 305 172 ----
NM_006622chr51499 ------
NM_006624chr1081821 1373 1315 739 677 413 156 122 4618 314 299 113 --1800
NM_006625chr1--11205 21142 421 --
NM_006625chr1--11205 21142 421 --
NM_006625chr1--11205 21142 421 --
NM_006626chr9112700 2491 2302 2249 1996 1801 1650 615 469 211 99 --32134 1005 513 2755 603
NM_006628chr1584557 3945 1857 1816 1088 1071 1021 707 13030 53116 1002 651 400 70 13610
NM_006629chr1852539 2287 1851 1784 945 --1645 --
NM_006636chr26940 805 757 382 315 116 --1879 --
NM_006642chr11300 ------
NM_006644chr132482 188 1651 ----
NM_006646chr1363030 2361 2116 1061 993 101 23076 1951 ----
NM_006654chr12104625 4017 2953 1314 888 844 689 559 345 31 24221 139 54432 3514 3373 1068 311 11159
NM_006656chr112155 121 --31198 423 111 --
NM_006670chr6----1598 --
NM_006675chr12102950 2717 2384 2309 2262 949 622 589 508 494 ------
NM_006699chr182640 2501 2305 2088 1004 829 450 372 --22648 1865 11028
NM_006711chr164792 668 329 63 --1759 --
NM_006713chr53321 263 201 --1137 --
NM_006717chr983380 3239 2531 2365 2145 2062 1054 671 11078 1373 22239 784
NM_006718chr641112 1095 1041 1006 1424 ----
NM_006720chr1074211 3777 1663 1119 797 491 259 ------
NM_006721chr102835 287 1168 ----
NM_006722chr32586 490 11070 1819 --
NM_006724chr63359 314 93 1405 1410 --
NM_006726chr41162 --21224 979 --
NM_006729chrX185371 5358 5144 5024 4730 4597 4411 4372 3831 3799 3442 2145 2034 2014 1961 1189 777 764 --35271 5078 1588 14496
NM_006731chr9115740 5525 4803 4642 2026 1622 1552 1457 1433 1233 994 14660 24943 2142 25781 458
NM_006734chr641354 620 493 257 --31536 247 131 1222
NM_006738chr15104006 3739 3340 3270 3224 3150 3062 1744 1312 879 --44601 4234 1557 366 --
NM_006745chr471056 713 414 351 167 159 143 1135 ----
NM_006746chrX31387 1167 54 1590 21361 1026 1251
NM_006750chr16137207 7176 7042 5769 5399 5187 5012 3158 2948 2194 666 179 107 28099 6889 68089 5547 2926 2640 860 166 12402
NM_006754chr741211 1135 314 277 1365 21266 158 --
NM_006755chr111165 ------
NM_006756chr851198 1017 306 299 157 11493 ----
NM_006759chr2186 1269 ----
NM_006761chr171620 1103 ----
NM_006763chr142142 2132 1739 744 --31889 512 213 --
NM_006766chr8122670 2529 1705 1003 967 841 696 460 302 277 85 53 12344 42645 2577 2359 2309 1350
NM_006775chr6162981 2913 2793 2686 2584 2517 2499 2449 2053 1159 1100 999 573 403 289 86 23120 721 --1934
NM_006777chrX52614 2406 2176 1976 676 --12897 1896
NM_006783chr133507 282 140 ------
NM_006790chr51309 ------
NM_006800chrX2596 214 --1568 --
NM_006805chr521083 398 --21628 1514 --
NM_006806chr213331 318 152 ------
NM_006807chr172994 232 ------
NM_006808chr91178 ------
NM_006815chr1271142 1015 896 536 528 360 156 ------
NM_006822chr172297 274 ------
NM_006823chr831172 1038 178 11191 ----
NM_006826chr231082 448 42 --1839 --
NM_006827chr1463107 2480 2229 2082 903 646 22797 2789 43140 2866 1321 513 --
NM_006828chr63476 181 89 --1198 1214
NM_006837chr8121 ------
NM_006838chr1261868 1648 1597 1375 609 553 31633 199 30 21568 303 21913 117
NM_006851chr1252747 2118 1888 1009 933 32726 222 178 42705 2488 1952 838 12949
NM_006852chr1762861 2803 2762 2678 2135 1122 --32517 2472 2206 --
NM_006854chr742020 1599 1494 188 --1194 --
NM_006870chr202340 117 1320 --1799
NM_006875chrX1777 ------
NM_006884chr351947 1743 1666 1578 707 ------
NM_006885chr1693949 3862 3507 2981 2586 1261 1145 927 441 12836 11448 --
NM_006888chr1483542 1384 1339 712 350 244 144 54 21399 1142 12322 --
NM_006892chr2061425 1365 1265 1189 1029 971 ------
NM_006892chr2061425 1365 1265 1189 1029 971 ------
NM_006896chr72847 188 ------
NM_006908chr761463 1077 1018 322 126 43 1923 ----
NM_006910chr162414 383 ------
NM_006914chr92597 332 11379 1346 1618
NM_006915chrX62343 2239 1619 548 74 37 3850 799 113 32059 403 369 --
NM_006918chr11115507 5402 5264 5154 4647 3677 2333 2281 980 863 344 12349 44517 3914 1719 248 13551
NM_006920chr241525 1517 1493 414 --11542 --
NM_006922chr232475 1710 1678 22211 309 122 --
NM_006924chr1774240 4135 2793 1347 341 314 67 23678 2871 24229 3856 1975
NM_006937chr172473 406 ------
NM_006939chr1451150 1055 890 839 207 --2359 93 --
NM_006940chr124708 577 299 107 11475 1767 --
NM_006948chr2131664 840 818 22266 2065 21602 68 --
NM_006950chrX4736 581 151 70 ------
NM_006963chr104962 866 121 72 --21209 438 --
NM_006980chr71130 1161 1226 --
NM_006981chr952874 2826 2535 1112 291 1780 32498 2252 2151 --
NM_006988chr2151288 1100 479 434 93 11208 ----
NM_006991chr31993 --21007 860 --
NM_006996chr161736 1643 1317 1268 231 138 --11862 --
NM_007005chr941301 1224 566 555 21572 261 21258 1143 --
NM_007006chr1693439 3378 3277 2588 1186 1090 254 206 130 --1225 --
NM_007007chr1274843 4819 4720 4605 4201 3018 1227 --11407 1182
NM_007008chr21292 3582 128 35 1240 --
NM_007010chr174763 649 461 267 1331 21176 185 --
NM_007011chr15106671 6304 6245 2645 2413 2348 2076 2059 1541 781 14758 66821 5785 2673 1995 1254 1145 16762
NM_007013chr861001 891 791 740 364 173 ------
NM_007023chr241100 1077 868 48 1797 1979 --
NM_007034chr13871 716 673 --11004 1335
NM_007038chr2185407 5305 4921 4060 2336 905 719 638 25169 1026 22053 1443 --
NM_007039chr1462010 1754 857 656 364 79 12307 1508 --
NM_007040chr194810 702 272 217 1691 1447 --
NM_007042chr372523 2364 2290 1760 1653 284 148 --11667 --
NM_007043chr1271859 1709 1687 1328 1306 561 73 ----21671 356
NM_007054chr573996 3263 960 943 868 648 638 31133 157 63 43782 2642 933 784 1950
NM_007064chr351710 1242 1093 666 302 ------
NM_007067chr1751512 1256 1244 414 151 --21356 592 --
NM_007068chr223961 362 151 ------
NM_007073chr6104225 4175 3765 3492 3314 3201 3043 2853 227 70 12969 33749 2887 316 --
NM_007078chr1052923 2842 1888 1068 847 --13058 --
NM_007084chr1331099 356 340 21455 1043 ----
NM_007106chr1352322 1875 1719 1064 146 --32420 1793 283 12742
NM_007107chr332306 2282 1569 1115 11936 --
NM_007111chr132789 56 ------
NM_007115chr2150 --1333 --
NM_007124chr641779 1599 1264 601 ------
NM_007137chrX85254 4671 3626 3546 1834 879 709 442 45175 4212 3932 3842 13508 13611
NM_007144chr1731324 85 54 ------
NM_007145chr1921217 925 --11237 --
NM_007146chr1731156 863 713 21810 60 31863 1083 528 --
NM_007150chrX31394 575 174 --12116 11976
NM_007156chrX--139 ----
NM_007158chr151111 411 379 361 334 --21163 498 --
NM_007166chr1141594 1545 1536 487 11187 21081 437 11106
NM_007172chr2283219 2869 2830 2514 2402 2289 523 122 1156 22792 1050 21045 995
NM_007173chr1162428 2254 2063 689 616 133 1469 1233 --
NM_007174chr122366 274 --42333 2160 2124 673 11519
NM_007175chr863358 3137 2837 701 250 88 144 33562 3318 3034 13050
NM_007191chr123612 57 47 ------
NM_007195chr1883535 3459 2756 2636 2614 1136 914 816 23139 494 53529 3412 3156 233 204 --
NM_007200chr15104006 3739 3340 3270 3224 3150 3062 1744 1312 879 --44601 4234 1557 366 --
NM_007202chr172718 51 ------
NM_007203chr993636 3304 2951 2929 2907 2598 1577 944 220 ------
NM_007207chr14804 791 657 174 ------
NM_007212chr152242 464 409 149 33 11604 --180
NM_007214chr651309 529 358 202 163 1515 ----
NM_007218chr81973 ------
NM_007222chr841665 1461 1349 77 ------
NM_007225chr1711008 ------
NM_007235chr122422 358 --1513 --
NM_007236chr1572463 2439 2346 1998 1977 594 371 --1161 --
NM_007245chr161790 1910 1915 --
NM_007246chr42739 414 ----2374 138
NM_007249chr13169462 8602 8579 6877 6802 6378 5879 3475 3180 2555 1745 1537 1145 640 375 333 59330 8417 5870 5735 2120 47619 7405 6977 6625 --
NM_007257chr811178 22684 46 32790 1093 729 12046
NM_007270chr751553 1451 1380 1118 1089 ------
NM_007271chr631557 1268 1153 21865 1294 ----
NM_007276chr731093 941 182 ------
NM_007279chr191647 ------
NM_007280chr151416 ----1129
NM_007292chr17114967 4948 4755 4266 4015 3410 3202 1542 1289 286 70 --24976 4911 --
NM_007325chrX3221 172 134 ----1618
NM_007332chr871407 1400 1226 1171 519 417 153 11348 21425 203 --
NM_007345chr1872213 1867 1771 1522 1478 1449 563 22235 23 --12031
NM_007347chr1583168 3013 2652 2061 1985 1126 881 779 22189 183 1870 --
NM_007349chr73425 378 165 --1452 --
NM_007351chr41367 2463 30 162 --
NM_007358chr1----41681 433 190 88 11326
NM_007361chr141152 1178 ----
NM_007363chrX31089 960 815 ----1781
NM_007372chr173845 574 266 ------
NM_007373chr1041216 1151 365 322 ----11205
NM_007375chr142652 1948 1780 777 11012 12161 --
NM_009585chr33865 762 143 --198 --
NM_009585chr33865 762 143 --198 --
NM_012069chrX41988 1812 823 128 ------
NM_012081chr573274 2997 2971 2846 638 459 153 12663 33343 915 135 23394 3385
NM_012082chr84723 703 394 24 --1793 --
NM_012090chr151302 1230 1165 827 131 --1341 --
NM_012095chr1083419 2669 1389 1003 868 495 359 187 13546 1214 --
NM_012096chr362619 1448 1371 966 583 179 31286 506 303 23410 2398 12575
NM_012097chr282046 1892 1776 1514 1500 1437 599 112 --11429 --
NM_012102chr182529 2445 1933 1889 560 466 102 63 ------
NM_012104chr1193531 3337 2686 1422 1333 1218 381 296 138 11191 ----
NM_012104chr1193531 3337 2686 1422 1333 1218 381 296 138 11191 ----
NM_012108chr42166 31 ----168
NM_012115chr62566 101 ------
NM_012120chr652409 2131 924 402 234 2961 680 32047 886 425 22042 522
NM_012124chr113824 176 81 1793 ----
NM_012129chr752431 2338 2261 753 533 --42303 1691 1639 913 1385
NM_012137chr142590 2132 1170 552 --42859 1814 488 482 12022
NM_012141chr13143927 3559 3333 3102 3042 2855 2715 2649 855 794 496 371 163 36 42620 1072 951 317 32908 1234 694 11600
NM_012153chr1132511 2492 717 --191 --
NM_012157chr31619 1173 1980 --
NM_012158chr1331786 1208 114 21398 675 11750 11447
NM_012161chr44925 791 766 386 --2988 192 --
NM_012164chr9167472 6026 6019 5801 5729 5439 4597 2903 2453 2198 2192 2037 1219 607 393 281 12874 26434 2515 16334
NM_012174chr1252785 2218 813 760 410 --1538 12730
NM_012193chr11125191 4751 4416 3899 3667 2025 1691 1562 1552 1204 589 390 --24687 599 21445 1133
NM_012197chr941109 361 54 45 21230 1205 1652 --
NM_012199chr1154560 4442 4338 4075 3995 3951 2919 1680 1518 1119 1053 814 779 402 122 --33681 1458 823 --
NM_012207chr103419 271 189 --1237 --
NM_012214chr2126352 5341 5233 5179 4857 4764 4738 2407 2387 2051 900 746 11224 85975 5894 5826 1968 1872 510 350 68 21238 652
NM_012215chr1051777 1496 1327 601 258 11555 ----
NM_012223chr24956 426 173 21 --11334 --
NM_012224chr431111 416 235 ------
NM_012234chr393399 3191 3147 3104 3026 2912 2653 2544 1377 32664 377 197 33130 2340 267 --
NM_012238chr10101784 1715 1703 1278 1216 543 481 428 235 201 ----21195 623
NM_012242chr103817 325 57 1248 ----
NM_012247chr102894 748 1267 3964 704 166 --
NM_012249chr2123172 3166 3085 2987 2875 2589 2421 1390 1284 1006 218 79 --12327 13070
NM_012250chr1151074 945 524 451 356 31041 990 507 185 2868 430
NM_012252chr7125344 5331 5312 5124 4782 4641 3953 1858 1817 1754 1140 956 --23554 457 22152 1611
NM_012255chr201106 1481 ----
NM_012259chr631414 1405 226 ----11358
NM_012261chr20170 ------
NM_012262chr1114283 4008 3757 3674 3178 1815 1677 1547 459 393 56 34212 2024 1423 14243 23691 882
NM_012281chr772434 2382 2217 1888 1519 873 798 ------
NM_012286chrX149 --1486 --
NM_012287chr394488 4247 4129 4115 4089 4014 1193 839 613 --44401 3608 3072 1540 24268 2961
NM_012288chr6175657 4978 4870 4322 4272 4245 3948 3666 1743 1302 1227 1008 861 372 327 304 215 11315 --14784
NM_012290chr241382 683 675 554 1595 129 --
NM_012297chr462013 1974 899 244 130 98 22513 2031 21690 412 22046 1029
NM_012300chr542442 2119 2100 1945 1726 ----
NM_012301chr712244 12177 1457 --
NM_012308chr1132491 2038 1781 --11996 --
NM_012309chr11164953 4853 4813 4735 4276 4250 4075 3616 3180 3104 1854 1804 1762 1674 577 441 --44791 4146 3306 1915 --
NM_012316chr1104398 3555 2230 1742 1638 1508 1082 436 331 202 --35289 1075 389 --
NM_012322chr7----1296 --
NM_012325chr2081640 1566 1557 1126 1057 510 400 192 ------
NM_012326chr2--1821 ----
NM_012327chr1871550 1315 1261 1049 984 630 552 11025 21579 1572 --
NM_012328chr741494 1261 947 484 21387 384 31161 548 53 --
NM_012329chr172672 389 1274 41193 1042 435 118 11293
NM_012330chr1031531 541 213 --165 2406 230
NM_012333chr14650 519 249 74 --11320 --
NM_012334chr5144701 4421 4403 3617 3296 2881 1317 1245 730 572 555 528 299 248 --33562 3388 356 --
NM_012343chr5--1463 ----
NM_012345chr1371848 1768 1753 1628 1413 1365 667 --21854 1831 11294
NM_012347chr682530 2440 2402 2261 1941 1169 561 29 --22835 1030 11203
NM_012382chr5144356 3675 3589 3306 3203 3028 3010 1772 1438 1384 932 830 521 354 --54260 2842 1282 992 919 --
NM_012388chr15103016 2845 2660 2503 2445 2308 673 487 428 85 --52952 598 418 381 144 --
NM_012392chr12563 40 --1669 --
NM_012399chr2251273 652 484 327 111 ------
NM_012414chr11766 1147 ----
NM_012416chr93397 244 181 ------
NM_012417chr173601 537 118 ------
NM_012420chr1051567 1499 439 345 149 11648 1508 --
NM_012426chr16----1314 --
NM_012428chr152381 132 1787 2863 695 --
NM_012430chr3125 --1765 1529
NM_012433chr2--2252 78 ----
NM_012434chr631689 215 67 21443 1406 2608 324 --
NM_012443chr101150 --1626 1119
NM_012444chr203461 362 326 ----1455
NM_012448chr1762156 1622 1602 1009 909 308 --12348 --
NM_012454chr61545 ----145
NM_012460chr14124 ------
NM_012463chr1231549 1288 110 11401 21280 495 --
NM_012464chr492796 2531 2273 1972 1932 1137 1114 514 443 --2765 139 12469
NM_012465chr1032941 2858 2447 12261 ----
NM_012471chrX61896 1646 466 288 181 137 --1198 --
NM_012475chr11251 ------
NM_012479chr732587 1940 410 12695 1644 --
NM_012482chr12691 126 ------
NM_012486chr1197 ----1431
NM_013229chr1262795 2056 573 255 82 31 --12306 1185
NM_013230chrY51499 1470 623 322 125 21621 1318 31392 1340 1171 --
NM_013231chr1464389 3656 1632 1452 1407 1189 --51705 1595 1117 862 180 --
NM_013233chr241339 1211 1131 428 ------
NM_013236chr222788 124 --2477 218 1870
NM_013237chr5170 ------
NM_013243chr1521153 135 ------
NM_013248chr201228 ------
NM_013255chr7208780 8708 8201 8077 7684 7247 7180 7100 6848 6410 6287 3100 2883 1811 1160 916 844 788 267 228 26617 5462 48686 7038 427 273 11627
NM_013261chr483669 3581 3375 3137 2968 2622 626 106 12519 --23386 2740
NM_013262chr621276 946 21379 571 31349 1265 331 1413
NM_013263chr16----140 --
NM_013269chr1244084 479 469 391 24452 30 24541 564 1640
NM_013272chr151256 ------
NM_013281chr2041320 1242 294 155 11418 --11110
NM_013283chr55366 303 117 95 59 ------
NM_013286chr373634 3220 1474 822 629 497 305 --13278 --
NM_013293chr71138 ------
NM_013300chr121237 ------
NM_013304chr161232 ------
NM_013309chr15102641 2632 1942 1927 1030 988 714 599 586 28 2840 672 21744 351 --
NM_013313chr2283171 2900 2849 2509 2195 299 287 90 12892 --1679
NM_013341chr252902 2515 792 563 113 1786 1947 --
NM_013346chrX130 ------
NM_013357chr8------1768
NM_013361chr191249 1182 2703 229 --
NM_013374chr363106 2797 2214 2006 655 303 12462 1661 --
NM_013386chr15604 475 228 150 61 1338 51737 1713 1517 1191 234 11500
NM_013392chr2----1439 --
NM_013396chr2161141 1028 542 287 103 59 --1299 11039
NM_013434chr2--187 ----
NM_013434chr2--187 ----
NM_013436chr24743 297 78 43 ------
NM_013437chr831422 1298 362 --11433 --
NM_013444chrX5927 767 207 91 34 162 --11087
NM_013446chr751441 1025 996 310 161 --21274 1189 --
NM_013447chr1942843 539 247 57 --13092 12369
NM_013448chr142742 620 ------
NM_013449chr1262907 2491 2458 1153 770 653 11826 ----
NM_013450chr221060 390 11278 1888 --
NM_013943chr162695 2513 1123 341 263 156 --23264 619 22756 732
NM_013956chr8--1126 ----
NM_013957chr8--1126 ----
NM_013958chr8--1293 ----
NM_013959chr8--1293 ----
NM_013961chr8--1293 ----
NM_013962chr8--1293 ----
NM_013964chr8--1126 ----
NM_013986chr221127 ------
NM_013989chr1474933 4708 3555 3508 3218 1714 399 13811 1975 --
NM_013995chrX82530 2450 1630 818 714 684 516 492 11967 22416 592 12582
NM_014016chr351260 673 454 446 170 11294 41327 1310 679 434 21358 107
NM_014021chr122646 1315 2375 308 22951 836 --
NM_014023chr1031843 1178 46 --2398 191 --
NM_014028chr663160 3042 2587 2424 798 317 21147 635 1594 22062 668
NM_014031chr51303 ------
NM_014034chr651549 1258 1229 1052 367 11246 ----
NM_014038chr7144 ------
NM_014043chr351146 603 535 312 159 1634 ----
NM_014048chr16105235 4682 4252 4023 3729 3232 1706 659 624 552 --35106 987 857 25072 287
NM_014057chr931574 1492 645 1374 21568 363 --
NM_014071chr20174 146 ----
NM_014079chr341066 264 256 248 1750 2950 164 --
NM_014089chr1372068 1742 1578 881 834 414 169 ------
NM_014106chr1552994 2755 2211 1194 254 11173 32230 1074 954 22789 2628
NM_014109chr871216 1099 1080 944 463 430 418 2344 98 1777 --
NM_014110chr121078 1014 11051 --1752
NM_014112chr854792 4038 4032 229 111 23550 1178 11835 13666
NM_014117chr1682438 2238 2198 2134 1953 1772 1671 762 12155 22180 1819 --
NM_014141chr794391 4338 4255 4210 2024 1527 1388 1179 180 --23489 3312 --
NM_014149chr72855 804 --1344 --
NM_014154chr331058 422 308 --11445 --
NM_014155chr11187568 7409 7388 7165 7009 6741 6317 6305 5903 5757 5715 5300 4998 2992 2947 2360 413 140 47440 7428 6293 5489 67363 6218 4987 4716 1850 800 25179 877
NM_014157chr1694051 3884 3702 3317 2908 1354 1166 790 541 ------
NM_014159chr34628 606 541 73 ------
NM_014171chr24758 652 49 42 1266 ----
NM_014176chr13144 120 65 ------
NM_014181chr272775 1092 750 615 598 449 279 22688 974 22586 1131 --
NM_014182chr122289 126 1102 2760 299 --
NM_014189chr421410 334 11398 ----
NM_014190chr431762 1181 686 21750 50 ----
NM_014216chr1421605 1318 ------
NM_014217chr14597 479 451 359 11689 31611 1226 247 11783
NM_014233chr1761886 1666 1389 715 492 66 ------
NM_014236chr11237 ------
NM_014240chr352677 2599 1353 1239 738 13627 34003 2615 144 --
NM_014243chr462059 1847 1777 763 587 318 11433 ----
NM_014245chr331123 356 176 1303 ----
NM_014246chr2252266 2219 2147 1600 707 ----1473
NM_014250chr2261975 1527 481 409 280 175 1752 ----
NM_014253chrX42485 2452 2356 1698 --2425 131 12407
NM_014258chr204652 480 255 25 ----1628
NM_014263chr1031123 524 482 --11366 2340 72
NM_014264chr43595 103 42 --1540 --
NM_014267chr112921 85 1163 --1807
NM_014268chr1821380 1120 ------
NM_014278chr44441 342 106 59 1385 ----
NM_014280chr14588 259 201 29 --1708 --
NM_014282chr93490 135 57 ----1372
NM_014283chr141306 553 412 32 11230 31267 371 134 --
NM_014286chr962557 2402 1226 544 446 381 11019 --1676
NM_014290chr91179 ------
NM_014294chr821485 213 11017 2400 58 --
NM_014296chr331533 1013 594 --21272 309 --
NM_014309chr2255412 4883 4067 1631 450 25305 1220 55011 4336 3560 1038 141 1196
NM_014313chr1174 ----1483
NM_014319chr1241769 1752 1492 1209 --1764 --
NM_014333chr1172538 2519 2259 1925 1896 1001 299 --1466 --
NM_014335chr1541282 1115 1099 971 1941 3433 304 61 --
NM_014342chr11--11493 31474 422 143 --
NM_014345chr61795 1778 --1706
NM_014350chr551032 995 738 378 302 --1405 --
NM_014363chr1351176 1139 1054 890 849 ----21282 1186
NM_014368chr942069 1889 1791 160 1386 12105 --
NM_014372chr161924 1885 1722 1578 531 56 12089 ----
NM_014382chr351631 1146 1126 330 96 --11362 --
NM_014388chr1135893 4117 4009 2226 1915 1772 1401 877 559 521 497 206 143 55754 4973 4710 869 767 34421 3828 1154 --
NM_014392chr431058 223 89 ------
NM_014393chr872239 1738 1682 866 725 503 333 ----22183 419
NM_014397chr951420 1319 904 399 45 1317 21433 442 --
NM_014399chr75990 832 673 267 114 ------
NM_014410chr181386 ------
NM_014415chr341559 1395 1354 349 --21565 275 --
NM_014423chr5115568 5317 5203 4382 4131 1807 1548 1422 1388 1150 427 34917 4451 3737 65179 4720 1980 1335 971 452 11436
NM_014429chr31644 --121 --
NM_014431chr103280 164 149 --11410 --
NM_014432chr651372 1229 619 597 424 21467 612 123 --
NM_014445chr331651 638 194 2936 537 21998 1547 --
NM_014447chr441084 601 355 151 1424 21468 559 --
NM_014452chr671193 1089 1013 820 379 308 237 --1482 --
NM_014454chr621024 736 ------
NM_014456chr1021880 513 --1254 --
NM_014458chr161413 1337 1231 1073 1040 304 ----1949
NM_014470chr122701 542 ------
NM_014494chr1672044 1868 1640 1500 518 503 282 ------
NM_014498chr32128 117 --2361 324 --
NM_014504chr762128 2011 1919 1511 1326 245 1624 1313 1540
NM_014506chr951698 1627 1523 132 117 1398 162 --
NM_014517chr371932 1626 719 681 638 307 134 --41358 1202 784 373 --
NM_014521chr241687 675 377 256 ------
NM_014547chr154666 325 195 21 ------
NM_014547chr154666 325 195 21 ------
NM_014552chr231466 1193 346 --1594 11328
NM_014554chr1242013 1921 1642 562 1788 21624 161 --
NM_014570chr2231007 642 269 --1113 --
NM_014572chr1361723 1245 1196 1173 693 169 --11787 --
NM_014574chr1461579 1371 1128 980 376 297 ------
NM_014577chr224854 739 717 284 ------
NM_014583chr31480 ------
NM_014584chr1421102 210 1641 ----
NM_014585chr241249 1208 1114 120 --11024 --
NM_014586chr2184427 4189 3812 3371 3290 1417 1202 350 11522 34299 684 471 --
NM_014587chr1621549 1517 --41376 1367 1358 210 11310
NM_014606chr431063 622 172 1118 ----
NM_014607chr271877 1790 1393 779 667 566 336 32141 1766 838 ----
NM_014613chr553056 2380 2176 2076 1965 2866 523 11016 --
NM_014614chr241257 1109 991 222 11178 ----
NM_014615chr1693387 3346 2787 2543 2530 1276 834 524 60 ------
NM_014616chr342246 828 427 107 ------
NM_014618chr9126 ------
NM_014633chr11142 ------
NM_014635chr251678 1590 1501 1406 426 --11127 --
NM_014636chr964372 4363 4346 1725 1349 698 23972 1293 13038 --
NM_014637chr83550 532 434 11214 11001 --
NM_014647chr1672235 2221 1675 1454 661 588 410 ------
NM_014665chr863640 1240 711 359 126 61 1928 22889 2298 --
NM_014667chr362436 1951 1776 1648 892 745 ------
NM_014670chr251627 1600 1214 554 250 --11200 --
NM_014671chr721447 243 11290 1506 11263
NM_014674chr3143979 3931 3779 3413 3367 3321 2921 2809 2739 1530 1116 938 824 285 21066 718 31293 1241 895 --
NM_014676chr131559 1078 169 11676 1644 --
NM_014677chr841289 1049 1007 890 21329 325 ----
NM_014679chr114965 936 464 232 ------
NM_014682chr842119 791 546 439 --31702 1434 342 --
NM_014683chr1792157 1790 1549 1390 1365 760 586 278 186 2728 474 151 --
NM_014685chr164548 513 463 420 ------
NM_014689chr21628 1520 ----
NM_014690chr742825 2804 979 24 1739 1991 --
NM_014700chr1611379 ------
NM_014701chr1533054 2247 960 33263 2146 507 23188 57 --
NM_014702chr672735 2577 2443 2175 2148 1005 159 22967 2356 32118 1042 469 --
NM_014705chr752032 1726 1563 1363 281 --1267 --
NM_014707chr762270 1969 1922 1796 1422 613 ----1658
NM_014709chr21637 ----126
NM_014711chr1642123 2032 1809 665 --22014 426 22079 307
NM_014713chr23518 426 365 ------
NM_014717chr191858 ----1774
NM_014720chr1021779 1284 21172 696 11401 11796
NM_014721chr6167189 7048 7024 5795 5535 5526 5356 5305 4559 2181 2058 888 879 871 661 41 12049 57385 7311 6327 6164 2306 --
NM_014727chr191259 ------
NM_014729chr84905 738 375 289 1854 ----
NM_014730chr1254370 3898 3791 2116 566 1597 34848 4337 3642 --
NM_014730chr1254370 3898 3791 2116 566 1597 34848 4337 3642 --
NM_014733chr53680 201 147 1746 1578 --
NM_014735chrX51802 1733 763 552 30 --42139 1818 381 36 --
NM_014739chr6114044 3771 3336 3278 3223 2661 1361 1090 929 690 153 33779 247 238 24008 1193 14092
NM_014741chr1172185 2116 1898 1872 805 520 353 ------
NM_014742chr2021724 634 --11774 --
NM_014743chr432708 928 835 23147 2741 2467 137 --
NM_014746chr284414 1545 1176 1075 658 594 99 91 12703 34260 768 552 --
NM_014747chr165672 5632 4869 4415 4127 2228 --23975 3830 --
NM_014751chr841868 1842 283 190 1143 ----
NM_014752chr1141930 749 303 280 --21821 640 11577
NM_014755chr2114120 3826 3804 3610 2872 1702 1103 474 405 197 165 23763 187 44269 4148 428 96 22932 692
NM_014757chr552267 2084 930 558 78 12356 21642 1539 12180
NM_014764chr1231136 150 44 --1457 --
NM_014766chr743187 1303 302 142 --12758 12497
NM_014774chr1133146 3110 2616 2606 2308 2149 2133 2044 862 432 373 124 115 22391 352 22529 309 --
NM_014776chr12102748 2575 2555 2534 2135 2095 2046 306 188 119 11002 23072 3027 12269
NM_014779chr361057 887 842 790 385 119 ------
NM_014781chr82288 91 11080 2908 145 --
NM_014783chr1521542 1309 --31109 538 261 --
NM_014795chr241343 1225 479 274 --1880 --
NM_014802chr123969 266 71 ------
NM_014803chr1062762 2442 1949 458 230 41 ----12384
NM_014810chr1113673 3167 3127 2597 1468 1381 885 379 249 174 51 --63304 2959 2685 2665 2541 180 --
NM_014812chr161894 1284 779 520 299 238 11364 11250 --
NM_014819chr572203 2124 1550 1525 906 537 143 --11920 --
NM_014820chr311675 11412 22050 1632 --
NM_014822chr4--1483 ----
NM_014827chr12224 183 ------
NM_014828chr142475 207 --11681 1673
NM_014829chr542283 659 362 106 22317 2096 1759 1825
NM_014830chr1283836 3347 1482 1124 1088 908 591 101 --13363 --
NM_014832chr1351875 1813 671 404 369 --11377 --
NM_014835chr2052238 2180 479 401 97 --12190 1588
NM_014836chr104557 398 137 59 21979 727 1151 --
NM_014838chr2232141 1141 156 ----12279
NM_014839chr172292 2235 1978 1818 840 549 132 --32378 754 726 --
NM_014840chr1263177 2944 952 850 630 386 23137 2688 ----
NM_014841chr63493 380 182 --21046 415 1895
NM_014848chr1582705 2378 2012 1929 1823 1755 1014 920 --1585 12279
NM_014850chr3114922 4809 4550 4066 3910 3808 3587 3291 3042 1419 578 13869 13545 --
NM_014857chr1186 ------
NM_014859chr1751046 562 522 233 221 --2390 239 11413
NM_014860chr2102086 1979 1639 1048 898 703 596 344 334 309 21996 876 3675 557 170 --
NM_014870chr174420 4288 4072 2921 1169 1059 963 11701 1730 --
NM_014873chr184809 4664 4538 4408 3597 3299 3228 731 23804 1898 --13350
NM_014877chr17117653 6801 6390 5003 4976 3005 2948 2621 2578 1420 978 32222 1389 563 87801 7619 6925 6638 5083 5040 1705 1643 26400 1350
NM_014880chr262773 2361 2086 2041 712 319 1501 3704 466 417 1535
NM_014885chr4----136 2168 75
NM_014888chr751422 1094 514 474 382 --31432 1082 429 --
NM_014890chr32311 103 1250 ----
NM_014892chr63202 132 90 --129 --
NM_014893chrY11500 1700 ----
NM_014897chr1753097 2886 2760 983 170 32348 1129 252 --12279
NM_014898chr1952402 2043 1795 175 165 ------
NM_014899chr5103177 3159 3040 2969 2757 2612 2195 1042 919 830 23075 2265 --12564
NM_014900chr241049 757 203 193 ------
NM_014902chr2031090 239 84 ------
NM_014903chr1262464 2109 826 781 633 411 --1951 11819
NM_014904chr10123910 3359 3332 3073 2868 2817 2706 1630 1455 496 304 175 11356 11087 1923
NM_014906chr1774122 4032 3746 3569 3153 655 496 --23063 2956 1995
NM_014912chr10133408 3138 2879 2699 2601 2426 2185 1157 777 655 601 258 242 23020 553 13099 --
NM_014913chr183539 365 260 ----11294
NM_014918chr1521441 254 --31584 400 175 11152
NM_014920chr652342 1408 1271 314 49 --1633 --
NM_014923chr1342040 1622 804 265 --1740 --
NM_014926chr33246 235 115 11021 ----
NM_014927chrX1102 ------
NM_014932chr341770 1606 1461 1374 --1227 --
NM_014934chr1393944 3791 2707 2679 2425 1094 1044 784 94 21253 539 23701 2508 --
NM_014936chr672341 2092 1848 1106 917 138 94 3964 418 338 42267 1159 1112 1091 2740 481
NM_014937chr1031285 1267 288 --11307 --
NM_014942chr642636 1790 1014 592 --42439 2299 829 109 --
NM_014943chr831278 1054 799 11074 2942 324 --
NM_014945chr551938 1758 1298 461 174 ------
NM_014946chr2102775 2599 2345 1240 999 954 640 528 212 106 22291 2235 53059 2764 1135 623 425 --
NM_014947chr142544 1972 842 539 --31220 127 40 --
NM_014949chr14983 885 318 107 ------
NM_014950chr142320 100 157 --11733
NM_014953chr13104206 3831 3319 3027 1261 1017 937 909 711 333 1471 24117 3990 1102
NM_014961chr471885 1748 1620 612 602 594 505 1140 21640 1399 1339
NM_014962chr2062694 2638 2270 1066 460 147 --22428 1036 --
NM_014969chr111041 --1447 11013
NM_014974chr1061784 1723 1240 660 230 28 --21757 672 --
NM_014978chr1051366 1313 495 39 30 11226 199 --
NM_014982chr14114511 4006 3911 3749 3684 2163 1831 1804 1438 517 413 25233 1911 64749 4588 4337 1623 997 647 14565
NM_014988chr432550 2373 644 --22010 585 --
NM_014989chr631595 1381 731 1835 42085 1995 760 40 --
NM_014990chr142907 433 1821 --1467
NM_014991chr472971 2626 2570 2128 964 859 444 33099 2284 1126 12513 --
NM_014994chr1512303 12297 ----
NM_014996chr33979 421 205 --1744 --
NM_014997chr742903 2737 1123 287 --22706 138 --
NM_014999chr1241562 1212 1070 562 21389 652 11146 --
NM_015000chr1272627 2612 2249 2199 2163 1177 971 22692 1015 22872 2084 --
NM_015001chr13915 379 187 --1353 --
NM_015002chr1262158 1803 1424 515 42 25 --1621 21965 816
NM_015008chr352485 2309 1022 577 396 23651 717 33280 2658 2636 --
NM_015009chr35765 639 311 296 197 1648 1248 --
NM_015025chr232424 1722 587 1764 --12161
NM_015026chr12144699 4538 4528 4427 4271 4132 4076 3110 3063 3010 1260 923 637 470 --24069 331 --
NM_015027chr1631780 349 225 --22013 1584 --
NM_015032chr13102763 2602 2435 2384 702 662 529 137 89 48 --1263 --
NM_015039chr183536 1519 1355 1037 791 435 181 42 --22796 974 11698
NM_015040chr243387 3379 3328 2280 1478 22673 585 --
NM_015042chr1584274 4258 3764 3563 3306 3173 2848 1078 13860 33530 1501 877 --
NM_015045chr1062280 2178 2064 1538 1422 267 --22126 662 11625
NM_015046chr952639 2469 2176 1832 1810 --22211 1789 --
NM_015049chr2112738 2653 2625 2019 1187 1154 992 955 626 573 23 12670 33286 2996 2235 1762
NM_015050chr631031 422 367 ------
NM_015051chr942957 925 567 28 23029 776 ----
NM_015052chr741027 1009 911 167 --1504 --
NM_015054chr121187 190 ----
NM_015056chr2152560 1790 930 192 80 ----164
NM_015059chr1563642 3584 2737 1476 983 907 44011 1202 1041 882 ----
NM_015060chr7------1221
NM_015061chr92732 627 1566 1592 --
NM_015068chr772535 1502 1193 910 455 288 98 12889 ----
NM_015069chr16----1426 --
NM_015071chr576548 6358 4999 4207 4147 1474 808 25898 5889 46185 5380 1665 1658 --
NM_015074chr164716 3537 523 420 348 139 34380 3041 3016 1443 --
NM_015076chr693095 3046 2740 1214 789 635 537 455 315 --34198 3124 348 --
NM_015079chr1531165 704 594 12577 22621 1306 11989
NM_015082chr572541 2043 1889 1822 684 341 210 --22302 1029 --
NM_015086chr1211311 ----1105
NM_015087chr1322050 2028 --1574 --
NM_015091chr14--2827 720 1546 --
NM_015092chr16104632 4607 4131 3814 3772 3723 3511 1271 1047 708 24258 722 44426 3206 1311 1054 11179
NM_015093chr621803 723 --21843 316 --
NM_015097chr341886 433 303 285 2669 186 1795 --
NM_015100chr141776 1676 538 260 2704 562 11782 --
NM_015101chr182885 2590 2554 2540 2444 2145 1858 464 ------
NM_015107chrX102473 2335 1879 1835 1563 1514 697 294 205 44 12222 1636 1736
NM_015115chr482713 2529 2326 1138 972 765 512 388 22633 2317 ----
NM_015116chr1361651 1518 1166 563 75 47 --21640 67 --
NM_015120chr2----170 1282
NM_015125chr191485 ------
NM_015129chrX4392 291 246 40 ------
NM_015132chr721773 1312 ----1800
NM_015135chr71130 --1184 --
NM_015137chr842137 625 297 184 22010 964 22484 235 1124
NM_015138chr1542134 488 402 56 --32410 1850 274 --
NM_015141chr3142712 2605 2506 2069 2033 1860 1803 1732 970 771 636 520 502 51 1467 138 --
NM_015143chr451432 1273 353 82 31 1260 --11330
NM_015144chr1683950 3736 3283 2798 1280 851 256 97 13516 2816 121 --
NM_015149chr11387 --22180 2024 --
NM_015155chr1021328 1321 --12740 --
NM_015156chr14102479 1321 1313 1080 854 769 731 723 398 156 22685 541 23784 1250 --
NM_015158chr93826 792 568 ------
NM_015161chr1671541 1432 1300 1025 623 349 242 11192 11508 --
NM_015163chr1431710 1679 396 --11668 --
NM_015170chr862115 1650 1637 834 803 613 12135 21843 897 22310 1581
NM_015176chr181553 1522 464 446 420 254 198 191 --1403 --
NM_015180chr141764 ------
NM_015185chrX82831 1936 1185 928 619 526 401 65 ------
NM_015187chr43954 268 40 --1643 --
NM_015191chr1142396 1012 912 69 --11045 --
NM_015192chr2062774 2484 2326 2244 1981 470 1293 22846 2000 22582 2472
NM_015196chr4--1110 ----
NM_015198chr75417 364 345 236 103 1374 ----
NM_015199chr333003 2873 2086 --32533 1899 979 --
NM_015200chr431981 252 128 1530 1559 11742
NM_015206chr1563809 3627 2720 1411 912 57 1516 1235 --
NM_015208chr1893481 3291 2825 2750 2735 1514 1343 1118 1083 21127 698 2963 72 195
NM_015209chr132272 2019 1949 --12051 --
NM_015210chr183724 460 28 ----1978
NM_015215chr14866 814 615 479 2524 220 12093 12436
NM_015216chr53625 338 25 2430 351 21534 480 --
NM_015225chr993018 2901 2438 2095 2006 1199 925 289 187 1457 2766 90 1326
NM_015229chr1711142 ------
NM_015231chr115978 951 907 385 22 1938 1867 --
NM_015235chr1041984 1873 777 221 11439 31587 1488 1460 --
NM_015236chr421255 141 21056 102 --1999
NM_015245chr652542 2023 1070 291 185 31909 349 309 12120 --
NM_015247chr16105211 4963 4830 4593 4180 3843 3351 1853 1603 419 21331 1296 11316 --
NM_015250chr971912 1812 1699 1434 740 350 118 21875 586 ----
NM_015252chr24984 732 132 121 191 ----
NM_015254chr892930 2905 2774 2232 1285 1053 1038 831 24 1683 1403 --
NM_015263chr151177 --1750 --
NM_015264chr2283884 3742 3721 3557 3228 1313 1293 647 --24609 4047 --
NM_015265chr242503 2390 1999 311 --52616 2308 2255 2021 1971 --
NM_015267chr1261916 1861 1723 539 204 43 ------
NM_015269chr12645 498 ------
NM_015271chr483843 3575 3359 1197 1044 727 616 520 34038 460 187 1759 --
NM_015272chr161242 --2854 161 1391
NM_015275chr1251325 863 346 180 55 ------
NM_015277chr1861679 1145 588 537 75 54 --2368 189 --
NM_015278chr673146 2943 2549 1368 1220 1095 596 --12467 12583
NM_015282chr262954 2322 2034 556 398 61 2999 830 12612 1488
NM_015284chr162153 2083 2072 1719 1350 363 22135 695 1480 --
NM_015285chr1842083 1917 1845 801 12321 ----
NM_015288chr573356 3227 2716 2595 2458 1434 1149 --1929 --
NM_015291chr193471 3390 2381 2373 1141 1085 208 141 38 13239 42608 1402 1310 814 --
NM_015294chr1721150 36 1417 11128 --
NM_015296chr1321103 501 ------
NM_015299chr1441568 1433 1393 232 13983 ----
NM_015305chr1461366 1359 514 393 383 369 --21974 1888 --
NM_015308chr113766 154 22 ----1224
NM_015310chr8137777 7702 6811 6740 3224 3083 3047 2885 2206 1843 343 222 60 32464 1831 436 67676 7424 7372 6121 3140 707 12394
NM_015313chr11114679 4637 4493 3970 3469 3455 3402 3113 1569 430 392 11781 13814 23723 1680
NM_015314chr752444 1958 1817 982 796 11902 12487 --
NM_015315chr541031 919 744 125 ----13291
NM_015316chr1421018 200 ------
NM_015317chr282526 2273 2236 2227 1906 789 472 316 --32608 2069 2039 --
NM_015322chr15--154 ----
NM_015328chr7112681 2613 2606 2459 2337 2259 2070 1919 1912 503 50 13072 21204 926 --
NM_015329chr1952834 2102 1810 1069 529 ------
NM_015331chr1----1581 --
NM_015335chr1282661 2628 2385 1821 1781 1733 930 454 ----12652
NM_015336chr1242364 1790 1638 265 1153 --12400
NM_015338chr2081867 1585 1578 1566 596 427 413 121 --11462 --
NM_015339chr203842 787 92 11002 1284 1920
NM_015344chr872172 1992 1894 1454 864 398 327 21711 138 ----
NM_015345chr662776 2688 2317 911 246 171 12447 2833 676 --
NM_015347chr12112538 2490 2272 2224 2130 1904 690 678 530 403 70 21045 231 22794 2782 --
NM_015349chr642873 2006 560 125 --22405 427 --
NM_015353chr1782802 2715 2556 1129 979 682 354 297 1260 32440 1728 212 --
NM_015355chr1731805 356 223 1195 ----
NM_015358chr2121307 170 1118 31098 862 416 --
NM_015359chr862781 2459 2195 1857 300 285 12138 ----
NM_015361chr23944 699 53 2263 27 ----
NM_015365chrX83943 3836 3777 3521 3477 3356 3047 2709 12905 63881 3858 1274 873 800 327 14302
NM_015367chr2231586 1532 554 ------
NM_015381chr2221316 461 --11760 --
NM_015382chr143702 550 226 --1109 --
NM_015385chr1062761 2594 2240 807 261 65 --12658 --
NM_015387chr261424 1339 1309 744 733 399 --41580 1500 155 136 --
NM_015393chr443613 2586 1141 347 --12639 13606
NM_015397chr941929 1719 665 589 --1222 --
NM_015409chr1262780 2694 844 452 259 43 32609 1771 583 11825 --
NM_015429chr321057 447 --21073 351 2370 317
NM_015435chr831338 1240 1022 ------
NM_015436chr443244 2219 1273 393 12120 11048 --
NM_015443chr1731466 568 137 ------
NM_015446chr131301 1268 534 --31570 1508 1337 --
NM_015449chr11568 --1512 --
NM_015453chr351589 1534 1367 836 536 --11406 --
NM_015455chr554063 1139 861 655 394 2855 449 13992 --
NM_015458chr875078 4312 1758 1616 1502 1457 1011 54691 3889 1313 409 81 24708 1476 --
NM_015460chr351603 470 329 208 58 31970 1857 1383 12056 --
NM_015461chr181166 ------
NM_015463chr22822 34 --1266 151
NM_015464chr73920 875 735 ------
NM_015469chr91190 190 ----
NM_015474chr202231 203 2438 145 ----
NM_015475chr23867 378 301 ----1257
NM_015477chr1551001 934 716 216 193 --2965 93 --
NM_015484chr14797 301 239 113 1783 ----
NM_015497chr1531153 1112 126 1763 1457 1830
NM_015508chr341494 1281 1028 113 ------
NM_015509chr1271375 1352 1221 1147 1120 335 121 ------
NM_015520chr322616 1024 1724 22280 923 --
NM_015525chr61329 ----1857
NM_015530chr21896 1890 1791 --
NM_015541chr341075 958 946 375 1271 1248 11344
NM_015550chr793135 3105 2272 2219 1146 1058 661 341 50 --23485 462 --
NM_015553chr643440 3231 1978 1414 24932 4821 44034 1114 537 515 1901
NM_015554chr1572525 2441 1988 1894 821 483 251 11155 1936 --
NM_015555chr641739 1324 481 150 1686 1472 --
NM_015564chr583586 3320 3068 2574 2543 1184 1014 416 1289 13578 --
NM_015565chr2121626 653 --21585 1519 1105
NM_015568chr2074166 4141 3647 3201 3012 2998 1632 --11253 13710
NM_015569chr1124703 4595 4567 4469 3811 3790 2998 1888 557 259 202 173 31679 1545 1114 23551 844 13598
NM_015570chr761728 1393 657 460 251 195 --1230 11320
NM_015571chr672100 2035 1018 936 541 523 29 22455 488 1762 --
NM_015575chr253634 1387 946 362 60 21097 896 33026 1261 1061 --
NM_015576chr352954 2464 2257 333 176 1612 12605 12200
NM_015577chr551719 1713 1599 1284 560 --21534 421 --
NM_015578chr1952033 1971 1593 1285 593 --21470 177 --
NM_015602chr121821 221 ------
NM_015607chr1----1166 --
NM_015610chr731775 678 610 --11005 --
NM_015630chr241052 843 377 181 ------
NM_015634chr103444 202 46 ----191
NM_015635chr972102 2011 1897 1845 1449 1377 862 1138 --1741
NM_015640chr185167 4623 4322 3921 3561 1836 1119 569 54974 3517 1553 1170 614 45149 1572 736 275 --
NM_015641chr73940 879 457 1179 1228 --
NM_015642chr32326 112 ------
NM_015646chr1241163 1063 339 322 ------
NM_015657chr24675 305 292 87 ------
NM_015670chr17--1356 ----
NM_015676chr14------1146
NM_015678chr1361547 1115 681 428 307 162 --1465 --
NM_015687chr62431 377 ------
NM_015691chrX32968 984 684 12346 52351 1848 672 428 359 --
NM_015695chr621765 1450 ------
NM_015723chr72677 639 --1480 --
NM_015726chr141248 1211 447 107 ----11320
NM_015833chr2141583 774 352 94 2867 436 ----
NM_015840chr132380 1778 823 --31866 1806 249 --
NM_015841chr132380 1778 823 --31866 1806 249 --
NM_015852chr743302 3145 2893 1351 33294 1417 919 32766 2622 2452 12825
NM_015869chr3------1173
NM_015874chr44635 602 498 104 --1432 --
NM_015878chr872221 1820 1775 1735 1682 899 888 11970 ----
NM_015879chr18138590 8454 7986 7967 7159 6787 6177 6076 2949 2499 2407 1725 778 35935 5264 2587 ----
NM_015885chr113821 727 617 --1358 --
NM_015886chr885092 5063 5038 4253 2172 1983 1738 670 24794 4142 23727 1886 --
NM_015888chr192884 2366 2066 1318 1098 1070 997 538 397 13029 41062 827 805 72 --
NM_015902chr85914 902 685 633 116 --4929 889 328 278 1670
NM_015906chr194092 3047 3031 1877 1853 1132 998 694 495 44181 1354 422 82 43905 3774 1605 1504 --
NM_015907chr43260 143 85 ------
NM_015927chr161351 ------
NM_015960chr102364 112 ------
NM_015975chrX51227 374 275 268 92 --21334 336 --
NM_015986chr1731462 1382 557 2533 512 1911 --
NM_015994chr142455 233 --2699 152 --
NM_015995chr15115377 5331 4332 4158 1728 1628 1184 1085 951 594 54 ----14601
NM_015999chr13685 472 268 1524 ----
NM_016002chr11794 --1741 1644
NM_016003chr731775 678 610 --11005 --
NM_016009chr194793 4734 4588 4252 4078 3762 948 135 82 --34463 1452 260 11463
NM_016018chr842417 2068 1831 904 32354 1077 511 11752 --
NM_016021chr693008 2633 2530 2317 1978 1126 624 591 297 1972 12942 12305
NM_016023chr841797 1661 849 104 1885 21993 408 --
NM_016025chr1652029 1405 1359 1234 494 ------
NM_016028chr114982 460 441 217 183 2897 24 --
NM_016032chrX31396 557 22 ------
NM_016037chr1----21092 770 --
NM_016040chr151952 1769 620 485 367 22248 464 ----
NM_016061chr261637 1143 629 397 141 24 ------
NM_016072chr1252218 1735 971 956 548 1645 32445 1826 518 --
NM_016073chr153998 331 187 2802 788 ----
NM_016075chr1333179 2641 1979 12378 12005 1508
NM_016076chr163173 3165 2067 1291 373 285 13039 21000 929 13237
NM_016079chr262303 2106 2042 2025 904 219 --21841 306 --
NM_016081chr4102182 2082 1685 1489 858 810 767 716 251 183 12134 21734 301 1537
NM_016083chr6123763 3739 3580 3520 3094 2785 2618 1411 833 770 558 269 31315 1165 511 23667 330 --
NM_016090chr113913 416 184 1798 2771 315 --
NM_016096chr851486 544 371 305 31 ------
NM_016097chr1831090 84 58 --1839 --
NM_016099chr861403 1324 427 410 269 228 --11107 --
NM_016101chr1641290 1085 977 207 11195 ----
NM_016103chr54474 455 408 91 --1364 --
NM_016107chr51427 --11366 --
NM_016120chrX4490 309 295 77 1340 ----
NM_016121chr11260 11106 1125 1397
NM_016122chr121353 --2487 88 --
NM_016129chr42377 34 ------
NM_016131chr21514 11475 22141 1593 --
NM_016132chr1583102 2838 2797 2265 2252 1302 1263 1246 1112 1969 12202
NM_016133chr221654 1546 21622 211 1482 --
NM_016141chr32747 704 1269 161 --
NM_016147chr1161192 1139 1080 1039 942 150 ------
NM_016152chr341200 849 193 38 --11271 --
NM_016156chr1152247 1606 512 502 218 22064 1898 ----
NM_016162chr122858 840 ------
NM_016166chr15184 --1187 --
NM_016200chr73281 167 35 1254 1272 --
NM_016205chr451254 1036 1010 396 115 ------
NM_016206chr3258947 8844 8656 8532 8466 8416 8235 7893 7631 7075 6770 6357 6194 6109 5633 5528 3306 3100 2071 1975 1912 1682 256 223 149 38862 7702 3084 13551 36875 5495 1654
NM_016213chr152201 179 ------
NM_016217chr6123562 3196 2969 2844 2632 1198 1121 853 402 253 117 47 --42487 2326 1397 60 12495
NM_016221chr542359 2224 1924 689 22333 808 12076 1564
NM_016224chr651703 1690 523 414 70 12227 11746 --
NM_016226chr122478 387 196 1375 --
NM_016227chr141306 553 412 32 11230 31267 371 134 --
NM_016231chr171661 21231 172 11527 --
NM_016234chr103951 802 353 --187 1238
NM_016248chr13113993 3968 3348 3018 2957 1440 1150 906 735 484 200 22951 2914 33935 3683 177 --
NM_016252chr24637 288 183 154 ------
NM_016255chr662682 2127 969 414 277 257 ----12644
NM_016257chr173294 3060 2860 1149 967 479 160 --11036 --
NM_016260chr2197475 7331 7139 6509 6476 6160 5862 5388 4995 2994 2939 2863 2550 2479 2101 1788 1319 851 78 46610 5132 759 619 22704 100 36441 1364 750
NM_016262chr65576 460 194 54 24 ------
NM_016263chr1932599 1351 80 ------
NM_016271chr1882063 1738 1636 1552 1478 342 264 25 147 2906 270 --
NM_016275chr382728 2707 2586 1999 1813 675 466 310 32538 893 713 12019 --
NM_016277chr621013 430 11463 11540 --
NM_016282chr971714 1580 1507 1329 656 589 301 1249 --31383 528 120
NM_016287chr142045 1909 1629 513 --21490 311 --
NM_016289chr241975 706 354 213 --1694 --
NM_016299chr10----186 --
NM_016301chr122414 191 ------
NM_016302chr32305 181 1171 ----
NM_016304chr153725 593 122 1190 1681 --
NM_016308chr162090 1531 435 304 287 90 --11785 --
NM_016315chr271736 1633 1486 382 369 279 71 11152 --21177 212
NM_016322chr9123206 3134 3061 2925 2836 1052 939 576 377 369 235 34 --2608 63 11115
NM_016329chr32495 29 ------
NM_016331chr32341 120 ----2177 107
NM_016333chr162515 459 ------
NM_016338chr521034 390 --21119 304 --
NM_016340chr51255 --21187 955 --
NM_016351chr7--150 1585 --
NM_016356chr672700 2448 1971 1167 956 546 454 --1515 2785 194
NM_016374chr161379 1223 1149 1042 154 53 --11270 --
NM_016374chr161379 1223 1149 1042 154 53 --11270 --
NM_016376chr17113450 3392 3155 2736 2718 1279 1183 947 799 577 464 22897 784 --14262
NM_016377chr631612 568 373 1512 1134 11312
NM_016395chr155558 493 163 124 63 ------
NM_016396chr15102496 2259 2243 1917 897 833 733 480 410 400 32775 1954 356 2948 125 32006 1935 657
NM_016403chr114755 288 147 57 --1130 --
NM_016422chr11102974 2771 2690 2480 2429 2385 2367 2264 897 349 11951 13186 --
NM_016424chr1772025 1938 1790 1493 1403 531 467 1768 21775 790 --
NM_016436chr2082516 1959 984 924 876 608 554 378 11822 21095 1071 --
NM_016441chr252257 1657 929 672 183 11679 11998 --
NM_016447chr72231 201 ------
NM_016448chr181904 1898 1364 1231 1199 490 277 144 1605 1123 11808
NM_016451chr11169 --1118 --
NM_016467chr221295 1157 --31365 1021 534 --
NM_016470chr201133 ------
NM_016475chr1431173 1120 119 ------
NM_016476chr17--1152 ----
NM_016480chr5--1765 ----
NM_016485chr641729 655 379 64 21635 406 11533 --
NM_016486chr12338 173 --1422 --
NM_016505chr13656 508 56 ------
NM_016507chr1773129 2159 2080 1279 1166 592 237 169 2925 621 --
NM_016513chr652342 1408 1271 314 49 --1633 --
NM_016516chr22672 334 --2860 735 --
NM_016519chr42182 24 --168 --
NM_016520chr91315 1782 ----
NM_016521chrX156 1228 1237 --
NM_016522chr1161528 1479 1283 587 205 164 --21429 1189 --
NM_016529chr1351277 1009 865 234 69 --1196 --
NM_016530chr1584106 2890 2649 1651 477 353 311 291 23314 2970 53767 1353 1323 1178 279 --
NM_016531chr484155 3625 3593 3461 3398 3355 986 224 24164 3302 --11268
NM_016542chrX2472 108 2314 205 31127 298 99 --
NM_016544chr263629 3477 2757 1068 715 360 --13365 23056 1566
NM_016545chr11218 ------
NM_016547chr11732 ------
NM_016559chr331490 986 614 1526 ----
NM_016570chr12250 29 ------
NM_016584chr12----1279 --
NM_016587chr731093 941 182 ------
NM_016599chr451445 1044 548 300 185 11558 ----
NM_016603chr542135 1830 541 353 22240 229 21561 415 --
NM_016604chr53856 325 249 --11205 11249
NM_016605chr542203 2127 793 701 ------
NM_016607chrX21644 1334 11310 31323 1315 1283 --
NM_016613chr482781 2731 2522 2486 2447 2202 1895 1703 22008 1794 --22642 842
NM_016618chr2185 ------
NM_016621chr1164333 3902 3190 1251 1228 1044 ------
NM_016622chr231795 1412 603 --41883 687 58 44 --
NM_016623chr83529 477 407 1563 1497 --
NM_016625chr3178 ------
NM_016631chr214671 390 348 220 ------
NM_016641chr1641655 1516 1496 1170 ----11347
NM_016644chr51549 ------
NM_016649chr203482 115 36 --193 --
NM_016651chr144913 737 334 96 ----1174
NM_016654chr1551183 1035 870 465 170 --41367 1344 1082 32 --
NM_016818chr211608 --1565 --
NM_016824chr1051797 1722 1313 1301 1193 ----11212
NM_016827chr32610 30 ------
NM_016831chr162103 1877 1821 656 145 59 177 42379 1506 949 426 1280
NM_016929chr6114318 4034 3566 3244 2847 1842 1502 334 228 103 90 24459 966 24517 156 14207
NM_016936chr162821 614 ----1754
NM_016940chr21362 41 25 1440 ----
NM_016946chr193423 2797 2706 2597 2337 378 365 93 38 --12787 --
NM_016950chr431209 979 74 11274 --11350
NM_016952chr1173180 3155 1289 821 437 182 149 12950 21483 1380 --
NM_016953chr285128 4919 4571 4428 4267 1306 851 227 24825 4082 46131 5535 3838 438 11724
NM_016954chrX2494 147 --1574 1488
NM_017410chr1241286 922 849 463 1969 11277 --
NM_017415chr584463 3549 3192 2909 1591 1565 574 250 13596 12968 1943
NM_017420chr1473609 3438 3212 3085 1004 194 46 --53111 1182 988 914 808 1408
NM_017423chr462194 1902 1777 452 233 208 --1873 2635 273
NM_017426chr43646 229 196 --1701 --
NM_017437chr1452448 1610 620 59 35 1826 1188 1467
NM_017440chr124562 487 420 106 1178 ----
NM_017447chr21184255 4233 4113 4029 3723 3345 3058 2963 2671 1767 1679 1499 1400 893 665 577 443 140 13498 23434 1584 --
NM_017455chr152381 132 1787 2863 695 --
NM_017489chr841354 1241 1156 94 11203 ----
NM_017491chr42855 640 --11031 --
NM_017516chr1141107 810 245 217 ------
NM_017519chr63296 278 108 11324 ----
NM_017522chr12325 230 ------
NM_017526chr1----1597 1115
NM_017545chr202193 170 1535 ----
NM_017546chr23875 153 113 ------
NM_017548chr342049 1756 824 296 11846 ----
NM_017549chr731121 1091 345 --11339 11136
NM_017553chr1521220 1103 1162 ----
NM_017554chr331709 447 182 --22218 840 --
NM_017563chr3116376 6211 5154 4911 4894 4273 2177 1190 581 387 173 25225 421 26200 1221 --
NM_017569chr131310 --2110 53 --
NM_017576chr9--122 ----
NM_017580chr1051608 729 565 441 243 --1954 --
NM_017582chr1--21537 479 2425 54 --
NM_017590chr2232689 2610 577 11928 ----
NM_017594chr972908 2218 1226 1031 650 494 416 23211 1220 11191 --
NM_017599chr1291913 1874 1472 1425 1368 772 668 322 184 1623 21703 1316 11630
NM_017610chr1552121 1900 1766 1331 426 1405 1718 --
NM_017613chr212339 29 1112 ----
NM_017617chr921587 93 1234 1189 1166
NM_017628chr4134600 3505 3281 3273 3264 1592 1432 1406 775 711 621 518 383 33848 3799 759 44828 4648 4501 1383 14549
NM_017629chr151468 677 566 475 145 --1216 1514
NM_017632chr42314 58 ------
NM_017633chr633537 2777 832 --1162 --
NM_017634chr82173 57 11517 2588 245 11422
NM_017635chr1161471 1333 619 536 445 36 --1192 --
NM_017637chr9219320 9228 8992 8894 8848 8412 8217 8200 7594 7578 6753 6707 5957 5804 3413 3092 2439 1662 822 586 241 25781 2004 47964 5927 3122 2260 15738
NM_017640chr63822 638 75 1770 1153 1278
NM_017641chr121969 1245 ----
NM_017643chr1782920 2826 2530 2506 2279 2061 399 301 ----21905 651
NM_017644chr3154738 4539 4513 4486 4358 3473 3432 3387 1903 720 471 232 197 172 152 24202 1259 64861 3592 3224 302 247 131 24032 1167
NM_017650chr7105464 3673 2260 2141 1985 1516 1478 1198 701 208 --35282 3887 2068 11050
NM_017657chr21312 ------
NM_017658chr14124349 4297 3941 3165 3129 1365 1346 1251 1155 894 562 257 14209 24525 677 2518 149
NM_017660chr1973312 2328 2321 2283 1144 473 233 ----1268
NM_017661chr152968 336 21168 370 1429 --
NM_017666chrX72235 2028 1625 874 315 276 203 --31753 246 183 --
NM_017667chr72361 195 1171 ----
NM_017672chr153415 244 63 11354 ----
NM_017676chr571855 1842 374 296 221 92 58 ------
NM_017686chr151083 985 697 272 106 1961 --1283
NM_017693chr13--21628 349 11666 --
NM_017694chr242067 2034 1767 443 11631 21937 702 1597
NM_017709chr1104168 3751 3422 3402 3015 2948 1571 1034 699 252 --32873 1692 852 --
NM_017712chr1966230 6103 6020 5145 1246 708 13945 26242 4984 --
NM_017714chr202632 175 1314 3957 854 88 --
NM_017719chr331903 1596 184 --21867 123 --
NM_017724chr34714 553 123 61 ------
NM_017737chr152231 1631 1559 1378 877 12117 11683 --
NM_017738chr931164 382 40 ------
NM_017742chr1871963 1892 1862 1805 750 507 342 1322 ----
NM_017745chrX--2552 181 1222 --
NM_017746chr9181 1102 ----
NM_017752chrX102108 2033 1890 1813 1486 1386 591 467 181 91 1345 21613 268 --
NM_017753chr92665 418 1361 ----
NM_017754chr6114716 4316 4050 3965 3460 1644 1539 1310 716 656 266 44771 4296 3843 993 24581 571 11249
NM_017760chr71271 1305 ----
NM_017762chr1562464 2407 1540 699 447 44 --1653 11934
NM_017768chr12659 616 ------
NM_017769chr1492944 2777 2686 2659 2621 2553 1045 788 73 12363 1504 12845
NM_017770chr662909 2785 2227 859 827 263 ------
NM_017774chr62384 345 1307 --1374
NM_017779chr152734 2472 2167 570 503 12227 42574 2069 728 219 --
NM_017780chr83764 166 36 --1738 --
NM_017787chr1022831 2327 --32315 1134 701 --
NM_017789chr22692 264 --153 --
NM_017798chr202932 114 --2168 120 --
NM_017811chr952759 2137 1984 1159 745 21026 176 22292 1968 --
NM_017812chr72288 279 1728 ----
NM_017813chr8175814 5627 5202 4941 4903 4128 3954 3925 3884 3657 1630 1530 1493 1103 952 345 113 --55722 5662 5240 1157 943 15179
NM_017819chr31216 ------
NM_017822chr124548 266 102 24 ------
NM_017824chr1052660 2218 1749 624 241 22004 1790 --1216
NM_017831chr1884372 4267 3997 1471 1158 1051 918 369 13696 24260 1083 --
NM_017848chrX114186 3945 3880 3588 3387 2966 2924 1646 1266 655 142 34322 1183 47 24482 52 14024
NM_017849chr253227 2865 2000 823 730 --1304 1148
NM_017856chrX--11835 31539 505 329 1368
NM_017864chr8--124 ----
NM_017869chr16----1589 --
NM_017890chr81534 11508 11694 --
NM_017893chr101123 ------
NM_017896chr2082687 2603 2586 2511 2339 770 158 137 --33488 3428 119 --
NM_017905chr13--1547 2533 476 --
NM_017911chr2241513 1480 1352 407 ------
NM_017913chr91435 177 ----
NM_017919chr9145334 5085 4866 4366 3920 1729 1400 1394 1097 819 532 432 78 51 22272 1543 31805 1558 1170 11533
NM_017922chr142501 421 1415 1209 --
NM_017925chr981916 1820 1806 1529 1278 1242 256 161 --11492 --
NM_017938chrX62027 1946 1856 1442 872 315 --1409 --
NM_017943chr1411026 ------
NM_017944chr1132724 2076 1070 --12385 --
NM_017952chr264479 4232 4000 3832 1555 854 1950 1371 23895 1504
NM_017955chr143855 408 400 1489 --1324
NM_017969chr21172 ------
NM_017974chr231244 918 252 11030 11315 1965
NM_017982chr121108 57 ------
NM_017987chr1051902 1501 687 263 124 22050 406 32095 646 447 --
NM_017988chr125916 813 726 297 281 167 ----
NM_017994chr751156 1032 548 425 98 --1517 --
NM_017998chr921121 411 ----11390
NM_018018chr1231932 1684 74 11619 21576 1492 --
NM_018027chr1032201 221 173 ----13277
NM_018028chr1961312 1016 877 383 168 146 ------
NM_018045chr163022 2964 2734 2515 2371 71 ------
NM_018061chr121411 532 11346 21445 151 1583
NM_018070chr11196 --1157 --
NM_018078chr41247 --1935 1906
NM_018080chr151133 ------
NM_018084chr2112962 2792 2612 2295 2281 2225 1318 1263 751 678 258 3142 130 75 32810 1034 566 11063
NM_018085chr197614 7177 7041 6952 6036 4951 950 528 241 35972 2662 900 25371 2039 15205
NM_018086chr261786 1682 1512 1496 774 719 1139 ----
NM_018092chr1641157 1097 1090 1073 11616 1616 --
NM_018097chr151162 --1195 --
NM_018105chr81847 21258 961 21171 505 11213
NM_018107chr142719 282 1392 1709 1385
NM_018110chr1621106 1056 11410 11037 --
NM_018115chr43805 746 694 1684 1713 --
NM_018117chr103696 508 249 --1284 --
NM_018121chr1062642 1180 969 787 217 53 1529 32633 2490 328 --
NM_018131chr101808 1861 2147 113 --
NM_018133chr351982 1435 602 483 428 ------
NM_018139chr14--123 ----
NM_018155chr3123375 3348 3268 3037 2514 2481 1231 902 859 547 396 173 33442 2185 868 32957 1222 768 22560 225
NM_018157chr12270 45 --11230 11057
NM_018159chrX2256 228 --21696 1518 --
NM_018164chr12------172
NM_018169chr121466 --1535 --
NM_018177chr42727 710 --1305 154
NM_018181chr1841529 1273 221 133 1495 31304 581 418 --
NM_018182chr1772022 1682 1513 822 724 296 189 ------
NM_018184chr312086 32189 1923 469 2778 112 --
NM_018191chr1361743 1607 552 525 468 230 ------
NM_018195chr1151934 1906 1625 1487 549 --21830 1457 --
NM_018196chrX41043 885 858 255 ------
NM_018199chr1421066 1044 1252 1846 --
NM_018200chr1542630 422 356 300 ----12368
NM_018207chr121511 312 ------
NM_018211chr161458 1408 627 444 405 65 1849 --11390
NM_018214chr65835 517 430 269 157 --1421 11089
NM_018227chr453138 2706 1281 1099 767 --32787 2200 1975 12559
NM_018230chr14573 478 395 124 ------
NM_018243chr463862 3781 3364 3165 837 645 --13142 13019
NM_018246chr8102561 2222 2024 2005 814 372 261 110 61 26 12793 1161 --
NM_018247chr693165 2909 1104 1018 758 596 514 426 116 1321 ----
NM_018254chr132357 1798 32 ----11862
NM_018257chr20112531 2502 2217 2099 2028 2016 1920 776 727 670 444 --32321 1607 1027 21854 738
NM_018263chr272432 2051 1924 1836 548 507 310 --12246 --
NM_018264chr72977 105 ------
NM_018266chr331017 688 176 --1312 1349
NM_018270chr20----1756 --
NM_018279chr1273010 2936 2308 1072 914 742 681 --1617 12356
NM_018287chr1051059 890 391 355 115 1957 ----
NM_018290chr451032 948 941 415 295 1156 ----
NM_018293chr352883 2766 2558 2404 704 --12071 11998
NM_018299chr831038 486 86 --13147 11027
NM_018302chr44903 654 412 307 11981 --1671
NM_018307chr172958 108 1604 --142
NM_018312chr1141977 1599 1484 876 1133 1851 12111
NM_018313chr352248 1708 1067 721 521 22424 154 22639 286 11622
NM_018314chr112767 27 1521 --2496 258
NM_018315chr431418 1103 240 11539 ----
NM_018319chr1451420 1323 1134 359 118 1208 --1159
NM_018321chr5135 --1152 170
NM_018323chr481351 1258 1236 735 606 544 465 375 1324 11540 11508
NM_018325chr931493 1116 561 1452 41647 1136 387 260 --
NM_018327chr2041802 1757 1672 1261 1748 --11205
NM_018330chr1021279 350 1428 31626 1514 513 --
NM_018339chr9--11786 11774 11662
NM_018348chr1641184 1129 945 87 --1338 --
NM_018351chr12114701 4654 4279 4044 3583 1714 1265 1153 745 341 285 24392 3960 44684 4210 1703 508 --
NM_018361chr8103687 3610 3448 3352 2555 1620 1375 444 420 353 --1936 --
NM_018362chr1183560 1302 1138 808 529 333 245 182 1599 12888 43960 2979 949 319
NM_018364chr1123838 3730 3463 3053 1486 1417 1220 1192 342 230 187 33 --33418 3238 151 33400 3030 2986
NM_018367chr1162503 2100 1641 763 701 195 1774 21808 370 --
NM_018371chr82636 32 --1581 --
NM_018372chr11470 --2217 202 --
NM_018373chr14116388 6084 5310 4833 4650 4586 1884 1634 1031 579 252 46492 4314 2000 420 65877 2534 2510 1184 486 320 --
NM_018374chr7134856 4757 4168 4017 3436 2094 1693 1568 690 660 607 433 200 23200 420 33783 1179 1161 11507
NM_018375chr1421533 410 --21325 227 11294
NM_018383chr252013 1900 443 431 256 ------
NM_018386chr133274 136 98 --1388 --
NM_018387chr93495 127 70 --1136 --
NM_018388chrX41123 395 55 30 ------
NM_018398chr3----1326 --
NM_018409chr453263 3192 2266 1077 610 13086 22681 2580 --
NM_018416chr1282671 2493 1939 1777 1024 583 419 308 --32324 1911 386 --
NM_018424chr941442 1317 1266 706 --11706 --
NM_018425chr1062314 2077 2041 1035 556 462 2420 104 ----
NM_018429chr552819 2671 2555 1804 899 --12660 --
NM_018439chr1832366 1008 503 --52299 1671 798 408 318 --
NM_018440chr8258593 8045 7998 7890 7532 6985 6827 6444 5839 5807 3190 3100 3050 3005 2808 2783 2396 2328 2311 2115 1801 1675 1273 797 505 37102 5883 883 57546 7318 5467 2515 1224 12575
NM_018441chr23797 780 38 --2246 68 --
NM_018444chr852145 1680 925 386 334 ------
NM_018448chr1241184 826 436 114 --11137 --
NM_018451chr132891 40 ------
NM_018452chr6_random73834 3796 2441 2423 1147 1009 410 13351 21361 1200 --
NM_018456chr31101 ------
NM_018462chr33622 562 144 --2325 228 --
NM_018464chr103389 308 286 ------
NM_018469chr1751143 1132 494 414 399 ------
NM_018477chr144994 974 859 794 11041 ----
NM_018482chr842102 512 172 53 1448 42576 2204 829 705 --
NM_018489chr132387 2290 294 --22063 1957 --
NM_018490chr1171839 1786 1585 1404 517 410 73 --11530 --
NM_018557chr271715 1610 1483 1225 367 327 254 21542 1376 2113 54 11306
NM_018559chr13151 ------
NM_018566chr194566 3749 3359 2050 1552 1535 1256 1167 1161 11673 44308 1941 1730 888 --
NM_018569chr461359 379 325 253 198 84 ------
NM_018590chr102426 131 --11641 --
NM_018638chr12155289 4969 4943 4385 3818 2000 1961 1937 1713 1298 447 440 393 111 50 35547 3977 3499 15647 --
NM_018640chr1232807 2164 880 --31096 844 52 12405
NM_018650chr151927 1606 846 802 679 31691 475 454 22071 565 --
NM_018657chr35847 719 653 552 267 ------
NM_018660chr893123 3004 2908 2571 2539 2424 2373 767 740 32934 2758 933 1429 --
NM_018662chr174373 4221 4165 3058 616 545 366 --24263 1610 24197 4191
NM_018667chr1632673 2640 851 ------
NM_018682chr73634 270 100 1662 178 1200
NM_018685chr72963 833 41006 954 784 474 1150 --
NM_018691chr551256 1186 441 230 148 11011 11233 --
NM_018693chr2----199 --
NM_018695chr522147 1506 21719 1621 1443 12099
NM_018698chrX41993 304 202 137 11907 11450 11213
NM_018700chr54419 368 261 52 11345 21153 181 11278
NM_018703chr162414 383 ------
NM_018704chr11195 --1679 --
NM_018710chr821124 218 171 --21374 991
NM_018728chr1561557 1109 1068 985 120 25 --21191 1053 --
NM_018834chr54891 397 235 65 --1680 --
NM_018840chr202197 179 1498 ----
NM_018841chr1163604 3485 2961 2879 2686 2628 2559 2433 1455 1397 1191 1079 1024 296 273 74 22972 2911 22531 472 1559
NM_018846chr73995 642 334 ------
NM_018847chr941705 1439 317 66 11383 ----
NM_018890chr761463 1077 1018 322 126 43 1923 ----
NM_018898chr522266 878 1940 12201 12046
NM_018899chr522266 878 1940 12201 12046
NM_018900chr522266 878 1940 12201 12046
NM_018901chr522266 878 1940 12201 12046
NM_018902chr522266 878 1940 12201 12046
NM_018903chr522266 878 1940 12201 12046
NM_018904chr522266 878 1940 12201 12046
NM_018905chr522266 878 1940 12201 12046
NM_018906chr522266 878 1940 12201 12046
NM_018907chr522266 878 1940 12201 12046
NM_018908chr522266 878 1940 12201 12046
NM_018909chr522266 878 1940 12201 12046
NM_018910chr522266 878 1940 12201 12046
NM_018911chr522266 878 1940 12201 12046
NM_018931chr5--1665 132 1320
NM_018934chr5170 1148 158 --
NM_018940chr51838 1426 1371 --
NM_018945chr683647 3483 2267 1218 1036 980 520 479 1530 11419 --
NM_018951chr72890 169 ------
NM_018963chr2141465 1150 950 106 ----11544
NM_018970chr732018 1165 821 32806 2682 2469 33089 942 598 --
NM_018972chr862529 1786 1747 905 454 129 --12330 --
NM_018976chr1272756 2192 2183 2009 1064 770 152 1286 2621 593 1484
NM_018979chr1262272 2195 1874 1781 909 796 11607 22609 2420 --
NM_018992chr1621411 1098 --11622 11615
NM_018993chr2041370 1061 409 56 --21434 1378 --
NM_018999chr1084417 4354 4137 3943 3281 3254 1820 102 --34640 4196 3264 --
NM_019000chr551555 1546 1064 504 113 11078 ----
NM_019001chr364554 4032 3342 1726 1444 150 24650 1266 33294 1241 48 24688 3406
NM_019002chr21127 1106 ----
NM_019004chr71369 --11640 1963
NM_019005chr72380 336 --1359 --
NM_019006chr152584 99 ------
NM_019008chr2283580 2927 2791 2754 884 571 402 342 13034 22814 454 13517
NM_019016chr17189 --1237 --
NM_019018chr52619 112 1272 1657 --
NM_019022chr18103211 3123 2890 2864 2468 2205 2089 1087 475 235 186 1575 --
NM_019027chr462436 1013 735 375 247 235 11884 21790 1754 --
NM_019030chr51152 ------
NM_019035chr471636 629 590 510 453 439 210 11997 11948 --
NM_019036chr61273 --11187 1809
NM_019044chr284707 4693 3973 3852 3451 3247 742 562 1268 34716 3989 581 141
NM_019050chr482230 1616 1585 1560 914 797 766 271 1118 2861 500 --
NM_019053chr102859 833 2430 224 11017 --
NM_019058chr104594 535 279 55 --1824 --
NM_019063chr242024 1785 1481 549 --31709 627 416 1842
NM_019072chr543574 2896 881 854 23939 3890 14038 23648 551
NM_019083chr161581 1471 1419 1163 348 83 ------
NM_019084chr1032191 1820 765 11688 22118 1919 22073 793
NM_019087chr541299 1234 1227 241 11695 11553 --
NM_019091chr221033 229 --1152 1171
NM_019094chr12103403 2859 1153 1106 1100 1018 822 661 225 158 23423 3134 13030 --
NM_019098chr841863 1783 346 238 ------
NM_019114chr982156 2007 1947 1897 1862 1833 328 39 21798 155 12534 12130
NM_019116chr1683560 3456 3223 3172 2957 2595 404 162 --22810 1127 --
NM_019117chrX73128 3045 2244 1363 1199 904 676 --1985 --
NM_019555chr341814 1457 263 90 31699 1647 696 2144 100 --
NM_019556chrX81502 1377 1143 1134 1077 939 435 295 --163 --
NM_019590chr1031347 1177 517 --11285 --
NM_019593chr2073045 2833 2568 2301 2248 619 471 1368 32040 1229 89 --
NM_019597chrX3713 659 610 --2494 160 --
NM_019600chr151786 --1518 --
NM_019605chr11681 ----1688
NM_019610chr132173 2166 1882 1757 2575 113 --
NM_019843chr222355 93 ------
NM_019859chr1021067 154 --21445 601 --
NM_019860chr1021115 202 --21493 649 --
NM_019862chr1631629 1498 1309 ------
NM_019891chr131116 1088 53 11204 --2832 202
NM_019895chr33328 205 189 --1959 --
NM_019898chr1631629 1498 1309 ------
NM_019899chr1631629 1498 1309 ------
NM_019900chr1631629 1498 1309 ------
NM_019903chr1051797 1722 1313 1301 1193 ----11212
NM_020039chr1251811 1627 1489 430 116 11547 ----
NM_020066chr12218 125 --1796 1654
NM_020116chr421562 469 11130 11687 --
NM_020120chr271602 1396 1249 1030 1022 174 121 11501 11133 11191
NM_020122chr2135929 5898 5757 5295 2003 1094 1054 999 736 538 361 237 69 35076 2114 1312 35998 5200 787 --
NM_020123chr102529 115 --31322 1008 450 --
NM_020130chr841096 1030 399 98 --11252 --
NM_020133chr6156451 6372 6169 6063 5597 5558 5296 5078 4334 2558 2366 1943 1123 1050 184 --26251 5666 --
NM_020141chr182424 2265 2200 1766 797 709 613 345 --1523 --
NM_020144chr781987 1794 1754 1738 1642 1466 491 160 11336 ----
NM_020147chr153213 206 83 148 ----
NM_020148chr1832840 706 571 --1243 --
NM_020150chr103576 384 73 --21641 797 --
NM_020159chr451154 670 394 146 104 --11572 11679
NM_020168chr1511290 --1972 --
NM_020177chr5102928 2785 2502 1217 1208 886 868 525 414 329 11027 --11184
NM_020180chr182528 127 --11153 --
NM_020184chr242135 1739 849 281 1890 ----
NM_020193chr11--1948 41161 1031 957 195 --
NM_020198chr1721426 1308 11470 31513 1288 984 --
NM_020199chr541217 224 120 48 --1940 2298 177
NM_020204chr13672 637 89 --1819 1766
NM_020205chr152643 2292 2241 1204 1009 1131 11114 --
NM_020228chr114884 459 260 221 1171 1303 1986
NM_020231chr33676 206 91 --1263 --
NM_020239chr122239 818 12326 --22231 532
NM_020240chr592782 2590 2405 2308 1066 961 614 297 218 22512 2189 22666 137 --
NM_020243chr223806 665 612 ------
NM_020245chr6114871 4403 3825 3351 3226 2034 1209 1038 1011 331 40 --54932 3934 3856 977 192 --
NM_020307chr32373 300 ------
NM_020336chr20113548 3463 2928 2865 2716 2635 2559 2447 1171 384 284 --11152 --
NM_020337chr463126 2359 1175 245 170 134 12483 22789 1141 1470
NM_020338chr1053517 3377 2903 2716 65 ------
NM_020340chr662071 1980 1655 1520 862 147 --11765 1651
NM_020341chr2041848 551 483 401 --32071 560 352 11364
NM_020342chr252505 2106 1889 751 265 11955 12077 --
NM_020346chr1151615 1359 1224 1126 577 ------
NM_020357chr341510 1200 1141 651 11229 2271 86 --
NM_020369chr71113 ------
NM_020381chr611799 193 11390 --
NM_020382chr12--1221 2245 143 --
NM_020390chr3164855 4655 4465 4399 4380 3842 3222 3179 1900 1737 1707 1665 1600 1538 1368 549 24838 1849 24599 1084 --
NM_020403chr1341612 1493 1192 560 ------
NM_020405chr1734296 1458 75 2871 323 ----
NM_020420chrY21878 236 --21306 701 --
NM_020425chr621663 1369 21470 29 22042 1912 --
NM_020429chr782394 2233 754 712 673 465 259 165 11973 11984 --
NM_020432chr741783 721 363 169 ----32175 751 738
NM_020440chr193080 3068 3027 2766 2715 1239 1179 728 380 --12247 --
NM_020443chr1146650 6504 5931 5267 5130 4880 4239 2693 2518 2306 1492 1446 1281 55 12453 41465 1038 818 168 16077
NM_020444chr581532 1434 1411 1328 1174 1096 989 61 ------
NM_020445chr72630 596 --1699 --
NM_020449chrX2760 305 ----1260
NM_020453chr462006 1980 1333 742 491 251 --21616 1593 --
NM_020455chr622717 596 --32746 2416 936 --
NM_020465chr1611968 11686 ----
NM_020466chr694998 4304 4164 3147 1539 1406 1308 332 152 33346 3164 3116 --13489
NM_020473chrX31838 1827 758 11491 21733 1345 --
NM_020474chr1832040 1404 798 --1330 22009 1980
NM_020475chr832380 2348 745 --1363 --
NM_020476chr832380 2348 745 --1363 --
NM_020477chr832380 2348 745 --1363 --
NM_020478chr832443 2411 808 --1426 --
NM_020480chr832380 2348 745 --1363 --
NM_020525chr122367 176 ------
NM_020529chr141185 ----1468
NM_020532chr21292 3582 128 35 1240 --
NM_020546chr552887 1259 940 659 325 12722 1681 11239
NM_020631chr111130 --11062 --
NM_020638chr1261435 1397 793 548 221 167 1335 ----
NM_020640chr332069 2031 700 12224 ----
NM_020644chr112272 90 1239 --1761
NM_020647chr83866 790 415 21792 1469 11571 1836
NM_020651chr261354 1306 605 437 406 269 11338 11834 21448 421
NM_020654chr3------21455 1359
NM_020666chr52945 346 --2285 239 --
NM_020673chr20127595 7277 6533 5821 5453 5357 1720 1695 1098 677 551 348 27721 1082 27316 1318 17679
NM_020686chr1622139 931 32829 2780 2486 ----
NM_020689chr2031467 1255 250 ------
NM_020696chr3129 ------
NM_020697chr82260 206 --31312 1068 198 --
NM_020699chr194851 4695 4408 4158 3860 3814 2137 842 427 31716 1676 266 33332 1360 833 14702
NM_020708chr2031894 1001 829 12170 12494 22345 2125
NM_020711chr231704 967 81 --42530 496 390 221 2658 445
NM_020717chrX124309 3591 3156 2002 1900 1805 1691 860 715 453 392 298 --1613 --
NM_020718chr16106111 5391 4853 4601 2628 1978 1354 1052 882 701 16501 65563 5511 4141 1622 1150 98 --
NM_020727chr2153875 3143 1323 474 464 33689 2807 1370 ----
NM_020728chr752555 2457 2450 1059 119 33200 2718 371 1815 --
NM_020732chr63296 278 108 11324 ----
NM_020734chr1293220 2666 2603 2545 2521 2079 1299 927 176 1849 33204 881 304 --
NM_020738chr241481 1168 272 86 11536 21080 244 139
NM_020739chr15102707 1440 1151 867 733 630 328 309 234 200 1557 53263 2984 2854 614 467 11305
NM_020742chrX62734 2685 2470 2031 1909 1007 --11739 --
NM_020747chr53938 378 93 --2606 256 --
NM_020748chr1761764 1699 1552 740 203 192 1568 --1332
NM_020750chr631471 965 32 --1932 --
NM_020752chr1042308 2132 425 236 22477 738 32757 1158 478 --
NM_020760chr231540 253 52 11966 --1576
NM_020766chrX93532 3204 1575 1565 1303 1267 1168 936 535 1397 21477 820 --
NM_020768chr5103214 2907 2754 1080 994 702 479 264 219 147 --11191 --
NM_020772chr17268070 7892 7854 7794 7274 7250 6448 6055 5917 5723 5307 3479 2851 2250 1962 1779 1556 1167 1068 995 638 549 514 501 420 28 12493 78037 7701 6655 6641 5771 1698 1010 27593 5538
NM_020773chr432670 2447 608 32634 1722 162 22536 938 --
NM_020774chr1875527 4762 3928 2391 1979 1188 992 --96114 4546 4342 2416 2345 1566 975 774 244 15643
NM_020778chr15134837 4826 4539 4522 4458 4000 3610 1947 1866 1529 620 520 503 1412 24851 3807 --
NM_020779chr272731 2647 2585 2070 1238 936 258 --12656 --
NM_020783chr1832183 404 376 --2790 101 1900
NM_020791chr1731325 425 380 ----11006
NM_020792chr392666 2658 2631 2505 790 647 317 245 72 1376 --1947
NM_020794chr141438 584 556 527 --41395 1314 1246 1154 1383
NM_020796chr522267 2038 --22817 2371 --
NM_020800chr321308 1104 1100 2186 33 --
NM_020801chr53750 629 75 11861 32357 780 109 --
NM_020806chr142667 613 1329 1155 --
NM_020807chr1621780 89 11332 1383 --
NM_020808chr13746 438 262 --1859 --
NM_020809chr1162163 1759 1633 1414 502 174 12236 11887 --
NM_020810chr1443216 3073 1347 110 --12961 13634
NM_020819chr62802 171 --4232 221 213 110 1862
NM_020820chr2041559 1470 1259 376 ------
NM_020824chr101571 1529 1616 --
NM_020825chr1662924 2631 1528 1217 1108 361 12944 43688 2499 1015 942 --
NM_020834chr1441320 1286 450 92 --1505 21839 1607
NM_020839chr341378 1221 1119 1104 --1134 --
NM_020841chr1283763 3360 3040 2890 1550 536 158 143 11021 73643 3469 3021 2934 2665 1401 152 12792
NM_020843chr153413 354 135 ------
NM_020844chr8197639 7391 7278 7249 6517 6439 6217 5652 5011 4992 4798 2857 2581 2414 1632 492 470 361 274 17339 24913 1767 17658
NM_020850chr1692505 2490 2406 2248 1135 976 909 875 129 --13191 --
NM_020853chr1271826 1057 990 917 879 803 548 11105 1203 --
NM_020854chr1821225 449 --41534 995 500 79 --
NM_020856chr1951459 1180 408 397 335 21157 381 11270 11346
NM_020858chr1582387 2348 2330 648 539 498 273 74 --12263 --
NM_020861chr6148 1889 ----
NM_020868chr251672 1408 1263 395 349 --12008 3694 621 434
NM_020870chr482261 1790 1728 1690 1595 338 254 221 ------
NM_020871chrX72457 1747 1733 989 853 458 103 --21945 1893 22433 1023
NM_020872chr331620 235 182 --21759 1657 --
NM_020873chr32703 85 1732 --2719 566
NM_020890chr3----1198 --
NM_020899chr1741719 911 754 192 --1600 --
NM_020901chr11----1406 2430 279
NM_020909chr283730 2973 2881 2711 616 515 441 367 23578 2839 34029 2887 705 1234
NM_020918chr1032914 519 141 21144 315 11237 --
NM_020921chr1463675 2561 2428 2329 1294 684 --23651 2639 --
NM_020922chrX71879 1673 1538 1408 584 356 118 --21855 522 --
NM_020927chr1642250 1943 1653 412 --21735 530 --
NM_020935chr2114518 4118 3792 3536 3040 1731 1715 837 756 510 63 24670 4558 11227 --
NM_020940chr1052940 2194 816 445 97 ------
NM_020946chr931722 1147 650 --11129 --
NM_020948chr1153601 3539 3412 3379 3341 2436 2428 1264 1255 677 326 248 174 74 21 21468 774 22918 156 2495 266
NM_020971chr19170 ------
NM_020975chr1021642 615 1696 ----
NM_020977chr442038 1920 1852 396 ------
NM_020988chr1671296 1262 1129 1073 108 90 82 11116 1891 --
NM_021003chr143692 542 30 173 ----
NM_021005chr1521023 838 1188 1432 --
NM_021007chr272402 2347 2065 1817 1617 1586 421 11667 12252 --
NM_021013chr17178 ------
NM_021020chr893483 3329 2501 2288 1066 746 407 290 153 ------
NM_021032chr31351 ------
NM_021033chr1372971 2940 2769 2737 2678 2643 1158 1990 12811 22719 1166
NM_021038chr353271 2445 2324 2059 1315 ------
NM_021064chr631509 605 157 --11320 --
NM_021069chr461803 1490 1453 1422 526 94 1582 --12135
NM_021072chr52722 634 1686 21833 967 1300
NM_021079chr1743249 2769 1066 924 12589 22601 363 --
NM_021083chrX103437 3372 3310 3201 2699 2558 1188 986 843 262 ------
NM_021088chr262108 1885 1437 1374 871 827 ------
NM_021090chr22114861 4009 3830 3533 3492 2005 1870 1239 1067 755 215 24518 1018 23480 194 --
NM_021097chr252525 2500 2255 2135 219 --32507 2401 1225 --
NM_021101chr372456 2272 1990 1911 1012 751 191 --31547 950 509 --
NM_021110chr81734 --191 --
NM_021111chr941116 509 326 48 --11335 --
NM_021116chr7159073 9048 8924 8644 8246 7695 7463 7368 6218 5583 3439 3233 2352 2060 1488 --11945 17614
NM_021120chrX63133 2177 1258 1020 485 252 ----11044
NM_021132chr1031241 1129 390 ------
NM_021133chr171631 1529 1431 1159 1088 269 77 11659 ----
NM_021136chr141670 --2585 283 --
NM_021140chrX2440 31 2990 817 ----
NM_021148chr742057 726 238 176 128 1322 --
NM_021159chr431487 1322 1284 ------
NM_021167chr742842 2282 2247 984 32785 646 334 --21855 186
NM_021183chrX42569 895 514 486 --2833 387 --
NM_021190chr141070 547 477 306 11328 11229 11055
NM_021192chr2------1432
NM_021194chr1130 ------
NM_021205chr152819 2712 1166 663 551 22367 1816 1479 22234 159
NM_021213chr173974 296 257 11029 21007 867 --
NM_021219chr211243 ------
NM_021222chr131438 521 185 ------
NM_021224chr93417 390 375 ------
NM_021227chr4----1546 1452
NM_021229chr1221182 778 ------
NM_021238chr1231658 1574 818 12088 12055 --
NM_021249chr1441135 588 362 36 1541 21218 400 1338
NM_021252chr1041741 1333 812 50 21389 798 --1233
NM_021253chr631428 1399 378 --11392 --
NM_021255chr1483695 3635 3515 1408 1397 1226 691 637 --53018 2654 905 238 76 --
NM_021269chr1931884 1563 285 3351 101 34 11389 22081 670
NM_021572chr64977 415 354 315 --1793 --
NM_021574chr2272387 2129 2081 2005 979 908 408 ------
NM_021614chr52244 33 ------
NM_021622chr1052256 2247 2207 1871 1765 --1866 12357
NM_021627chr311122 ------
NM_021629chr395035 4716 4253 2025 1709 1470 889 842 82 23846 1076 33901 1447 1318 11059
NM_021637chrX21395 95 1199 ----
NM_021638chr494577 4515 4109 3477 3113 1770 1534 1152 289 24632 192 24121 596 --
NM_021639chr1----1899 --
NM_021643chr251815 1782 1329 750 294 ------
NM_021644chr103419 271 189 --1237 --
NM_021647chr483970 3927 3170 1778 793 519 292 277 44657 4323 3617 1035 24283 3802 --
NM_021648chr642530 552 490 411 12268 42715 684 297 117 --
NM_021722chr7--150 1544 --
NM_021723chr7--150 1585 --
NM_021809chr2042473 1893 653 297 21781 1680 ----
NM_021813chr675338 5253 3578 2079 1461 1093 187 12209 25704 5531 --
NM_021814chr681533 1362 1316 1061 652 417 337 270 ------
NM_021818chr1421082 336 --11171 11413
NM_021905chr661937 1866 1857 1833 1484 614 --1620 --
NM_021911chr595373 5364 4599 4447 4394 4309 2053 1720 115 11934 ----
NM_021912chr1583825 2638 1642 1471 1395 1115 466 361 --12692 11196
NM_021914chr14122193 2180 2131 1824 1528 866 618 513 452 379 344 222 --22048 649 1200
NM_021931chr2011066 21151 1002 ----
NM_021940chr631498 1365 1052 ------
NM_021947chr1721331 367 1160 11179 --
NM_021951chr94848 371 169 96 1792 --1344
NM_021954chr1353402 2958 1453 1391 41 53355 2875 1143 931 257 --1465
NM_021956chr611570 --11208 --
NM_021960chr142809 2143 585 559 42041 544 268 30 32700 2587 1793 --
NM_021961chr11147520 7424 6974 6652 6442 5826 4690 4671 4660 2637 2118 1426 576 142 46770 498 458 386 97149 5097 5007 4943 4930 4608 2440 2254 509 27197 662
NM_021964chr3195885 5066 4959 4570 2480 2357 2270 1849 1507 1422 1174 1087 1032 895 660 643 515 419 189 56134 5694 5502 671 206 45818 4588 1185 1060 --
NM_021967chr521020 188 ------
NM_021970chr4127 168 --187
NM_021976chr61677 ------
NM_021977chr663170 3161 2580 1184 1063 66 --33655 3569 1136 --
NM_021979chr141368 --2415 36 --
NM_021984chrX21097 340 11146 21524 399 --
NM_021987chrX21097 340 11146 21524 399 --
NM_021988chr2071583 1501 1449 1209 1072 376 145 ------
NM_021990chrX21097 340 11146 21524 399 --
NM_021998chrX31314 459 296 1390 11367 11210
NM_022037chr251024 653 320 279 209 --2749 219 --
NM_022041chr1692644 2619 2093 1955 1808 955 795 630 569 12674 12736 --
NM_022048chr15105700 5258 4922 4033 2373 2347 2017 1569 1411 1301 36110 3964 755 36190 5839 4328 1831
NM_022051chr11134 1709 ----
NM_022063chr1031588 346 295 11793 ----
NM_022085chr641602 1421 532 131 11435 ----
NM_022091chr642299 1733 957 825 ----1934
NM_022114chr164749 4028 3935 3502 1402 144 ------
NM_022116chr771126 1071 907 354 336 251 229 --11027 --
NM_022118chr132501 151 ----172
NM_022124chr102200 166 ------
NM_022129chr1021285 1146 ----179
NM_022130chr541199 916 278 89 --11452 --
NM_022132chr51134 --1127 --
NM_022133chr881743 1685 1670 1462 1439 1358 1161 663 1719 11847 11858
NM_022137chr141802 2275 135 ----
NM_022138chr671505 1489 1477 1410 1319 1272 108 ------
NM_022143chr751235 475 441 83 60 ------
NM_022162chr1631081 800 200 2763 155 2360 215 --
NM_022166chr16126186 6138 5609 4796 4598 2100 1853 1702 1654 1111 745 325 --35730 2261 184 26366 1674
NM_022170chr721762 378 11673 ----
NM_022173chr251024 653 320 279 209 --2749 219 --
NM_022340chr373681 3401 3070 1078 944 420 23 --1252 --
NM_022343chr921372 339 --2413 309 --
NM_022351chr853272 2772 2482 796 255 21320 358 21331 515 --
NM_022361chr61423 ------
NM_022373chr72899 712 ----1967
NM_022442chr2071583 1501 1449 1209 1072 376 145 ------
NM_022444chr751977 1545 1408 207 25 ------
NM_022456chr12107394 4953 4754 3048 3003 2978 1952 1636 960 105 25039 1798 15636 --
NM_022458chr773160 3022 2044 805 662 384 172 13057 --13149
NM_022459chr1395819 5221 4604 2367 2079 1801 1397 1069 894 56087 5611 5339 4158 2115 45659 5173 4005 314 15198
NM_022465chr1262647 2637 1121 503 225 200 12878 22444 280 --
NM_022469chr163190 2346 1199 1034 427 302 ------
NM_022473chr1564250 3472 3297 3046 1243 1092 23226 176 22881 626 44473 3598 820 749
NM_022474chr1472627 2251 1867 714 559 504 283 ----12153
NM_022476chr162828 801 1424 ----
NM_022483chr551570 1536 1251 1210 155 --11579 --
NM_022496chr121122 --184 --
NM_022497chr363820 2934 2775 2493 525 68 13188 11498 13583
NM_022576chr11333 ------
NM_022650chr551030 903 293 264 102 1230 ----
NM_022652chr122982 809 --1815 --
NM_022658chr1211340 1859 2469 168 --
NM_022716chr153136 2873 919 556 438 12061 ----
NM_022726chr641707 1664 400 316 --11582 --
NM_022735chr141778 1695 180 103 11659 21847 75 1714
NM_022739chr1741189 797 271 248 ----2919 833
NM_022748chr792851 2776 2757 2030 1859 1802 581 184 83 --12798 --
NM_022750chr74175 61 40 25 188 --1165
NM_022753chr172033 1718 742 720 630 357 142 --32229 775 481 1463
NM_022756chr161512 1467 1339 517 470 196 --21386 501 --
NM_022757chr31981 1646 2798 417 --
NM_022758chr643084 1045 652 333 1413 ----
NM_022763chr382844 2814 2387 1020 579 323 288 156 ----1974
NM_022776chr351316 1294 1152 263 192 ---