TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548n
miRNA Sequence: CAAAAGUAAUUGUGGAUUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001040284chr16205825 5282 4758 4543 4412 4337 4173 3743 1982 1930 1862 1776 1697 1506 1347 1259 1185 785 741 599 45504 4615 1912 1623 55133 1208 821 562 473 --
NM_001040402chr4102794 2094 1234 1138 1043 831 765 512 388 193 12124 43009 2825 1183 654 11222
NM_001040409chr25952 940 777 757 745 --3912 879 818 181
NM_001040424chr2131812 1029 488 --12129 11965
NM_001040429chr1382608 2390 2274 2219 2190 1091 1021 113 42871 2843 1386 123 23585 2442 --
NM_001040432chr32450 142 1162 ----
NM_001040440chr54555 530 508 492 --1449 --
NM_001040441chr1225428 4915 4843 4383 4326 4201 4165 3649 3529 3346 2117 1593 1579 1554 1158 814 683 346 329 275 255 140 1602 ----
NM_001040446chr592690 2630 2506 2364 2309 2220 988 516 343 12446 42684 2298 2134 160 --
NM_001040450chr1552681 2612 2556 2519 160 --12222 --
NM_001040453chr1552681 2612 2556 2519 160 --12222 --
NM_001040458chr551747 1731 1429 124 62 11608 21823 105 --
NM_001040624chr852319 2036 942 373 70 1249 2617 267 --
NM_001040625chr852319 2036 942 373 70 1249 2617 267 --
NM_001040626chr852319 2036 942 373 70 1249 2617 267 --
NM_001040627chr852319 2036 942 373 70 1249 2617 267 --
NM_001040628chr852319 2036 942 373 70 1249 2617 267 --
NM_001040629chr852319 2036 942 373 70 1249 2617 267 --
NM_001040630chr852319 2036 942 373 70 1249 2617 267 --
NM_001040633chr71680 --2834 279 --
NM_001040665chr7165029 4828 3996 3755 3618 3480 3409 3367 3268 1595 1509 950 446 383 266 194 54738 3472 3065 1804 357 44594 4209 3148 1051 155
NM_001040666chr72731 530 --1296 --
NM_001040697chr111615 1589 --1106
NM_001040708chr851072 937 461 301 124 2957 810 1363 1159
NM_001040712chr9143518 3200 3188 2920 2793 2345 2201 1055 912 835 720 624 561 414 127 33512 3169 2709 13217
NM_001040875chr8102645 2420 2282 2174 2096 1747 823 501 454 177 22383 1673 22551 105 11886
NM_001040876chr481904 1688 733 674 416 343 188 58 --11438 31526 605 575
NM_001041chr31134 2333 315 1357 --
NM_001042355chr16175347 5203 4963 4216 4180 4063 3843 3351 1853 1806 1448 1424 1417 911 768 661 396 45421 4849 1331 754 31316 292 159 25232 4883
NM_001042357chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042358chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042360chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042361chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042363chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042364chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042365chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042383chr353450 2838 1306 1171 237 --1153 --
NM_001042387chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042389chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042390chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042392chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042393chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042395chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042396chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042397chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042403chr126688 385 344 207 134 82 --3853 182 47 1248
NM_001042404chr151972 1675 1459 789 779 21998 1364 31946 1548 145 11910
NM_001042406chr641098 962 918 273 --2949 937 --
NM_001042412chr16175347 5203 4963 4216 4180 4063 3843 3351 1853 1806 1448 1424 1417 911 768 661 396 45421 4849 1331 754 31316 292 159 25232 4883
NM_001042413chr9103990 3711 3646 3420 3305 3251 2602 1450 682 649 24136 3293 33341 2643 1440 --
NM_001042422chr17167 ------
NM_001042423chr17167 ------
NM_001042424chr473287 3156 2850 2250 827 534 367 22214 849 53261 2181 865 813 301 --
NM_001042425chr661729 1545 1383 1249 1095 388 1528 21438 1420 --
NM_001042437chr25989 917 718 160 92 2283 120 ----
NM_001042440chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042441chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042442chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042443chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042444chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042445chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042446chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042453chrX71506 1481 403 375 188 174 147 1205 11605 21467 259
NM_001042459chr32311 103 --2345 37 --
NM_001042473chr1062106 2027 1860 821 779 157 11527 52150 1683 1659 344 109 31765 1390 394
NM_001042475chr61106 ------
NM_001042481chr1472630 2175 2164 1867 819 390 347 --32687 2314 317 11856
NM_001042486chr202239 159 --11193 11039
NM_001042492chr17103128 3026 2460 2373 2132 1102 612 501 431 199 2790 281 43134 878 761 213 11034
NM_001042493chr661673 1598 1369 734 591 332 --31912 573 216 21355 434
NM_001042506chrX2893 172 1448 41388 1336 579 469 --
NM_001042510chr891651 1514 1505 1486 1390 1368 869 305 240 1134 180 --
NM_001042511chr891651 1514 1505 1486 1390 1368 869 305 240 1134 180 --
NM_001042517chr133818 810 281 1359 3747 678 159 2373 82
NM_001042537chrX92435 1972 1921 1001 909 896 449 363 234 12301 32471 2317 2233 --
NM_001042543chr471522 1398 1201 994 431 340 149 21189 551 21388 1339 11352
NM_001042548chr25892 853 774 699 190 1633 ----
NM_001042552chr111334 --2376 205 21020 547
NM_001042555chr12174729 4423 4404 4244 3862 3736 3559 3465 1808 1563 1555 973 880 600 484 345 113 74532 4221 4062 3856 1774 337 282 34390 3149 1068 24367 1159
NM_001042573chr1732050 2013 1823 ------
NM_001042599chr2317768 7686 7664 7570 7540 7492 7485 7271 7029 6621 6577 6416 5971 5952 5917 5646 5241 5015 2887 2662 2469 2080 1569 1538 991 887 877 793 768 639 313 32763 1777 1188 66142 5892 5138 2974 836 698 47856 7561 7217 6304
NM_001042601chr3113253 3241 3175 2948 2304 1284 1258 1172 753 572 303 53266 3213 3124 2236 594 2603 469 32882 1041 870
NM_001042603chr12125369 5189 4766 4704 3731 3626 3572 1691 1623 1315 962 343 11121 74007 1971 1405 1302 1197 1150 881 13874
NM_001042604chr3264671 4622 4594 4575 4449 4413 4384 4105 3658 3342 3276 3153 3032 1726 1523 1513 1128 855 844 705 603 533 384 150 123 95 34650 3400 133 44748 3999 3041 1241 33406 1216 1035
NM_001042618chr14182 ------
NM_001042646chr341771 1615 1364 531 11338 1758 --
NM_001042669chr471902 1526 1498 505 400 336 278 --31556 646 373 31551 611 417
NM_001042681chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042682chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042682chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042683chr661870 732 715 679 488 456 --31354 300 238 11428
NM_001042749chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042750chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042751chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042762chr741126 287 229 176 1695 151 189
NM_001043318chr14103890 3856 3766 3622 3162 3031 2596 1246 701 573 11587 54126 4051 4040 2782 1621 13692
NM_001043351chr171569 1561 906 774 396 382 116 --42068 1407 643 636 --
NM_001044385chr2143684 3160 3122 3036 3020 2998 2974 2676 1510 579 405 262 103 49 14041 --22515 68
NM_001044387chr1984101 3462 3410 2789 2543 1391 616 157 21402 1331 11447 12799
NM_001044388chr1984101 3462 3410 2789 2543 1391 616 157 21402 1331 11447 12799
NM_001044722chr5132260 2074 1828 1700 1606 1564 1524 810 675 490 231 128 91 12250 22129 1577 42143 1820 1474 731
NM_001044723chr5132260 2074 1828 1700 1606 1564 1524 810 675 490 231 128 91 12250 22129 1577 42143 1820 1474 731
NM_001046chr5153002 2928 2799 2625 2610 2487 2463 2024 2004 1842 1150 1141 889 290 106 22228 869 32965 2849 1179 --
NM_001048183chr1113797 3544 3408 3387 3099 2597 1104 1031 651 645 37 13807 1210 --
NM_001049chr1452293 2224 2030 1912 306 12370 ----
NM_001068chr3391 73 25 --1288 --
NM_001071775chr1361678 1523 1413 644 235 215 21836 501 1120 11855
NM_001076chr42165 143 1195 ----
NM_001076chr42165 143 1195 ----
NM_001077628chr12592 234 ------
NM_001078chr11705 ----1514
NM_001079874chr182133 2066 1987 1849 1652 1524 759 366 1550 ----
NM_001083620chr4112586 2550 2523 2439 2104 2050 1674 982 844 568 259 1588 22413 685 42564 1688 1618 560
NM_001083621chr164344 4288 4072 3238 1765 1051 24734 1384 ----
NM_001099678chr3156117 5869 5482 5055 2421 2039 1985 1587 1320 1196 1178 846 620 330 195 86380 5683 4618 4569 4480 2363 1309 952 46252 5537 1581 1071 26233 889
NM_001100108chr1158379 8317 8212 7869 5090 3106 3067 3053 2602 2423 1954 1307 1288 601 467 13350 65989 5747 5077 2326 1201 984 11602
NM_001101662chr1140 ------
NM_001105518chr13897 750 605 --3880 856 802 1289
NM_001106chr3229221 8571 8428 8144 7920 7836 7345 7255 6841 5909 3215 3146 1717 1620 1548 1531 1498 1333 892 528 131 119 37417 6103 2412 98655 7856 7034 6740 2547 2444 2391 1006 180 26806 6006
NM_001109977chr44768 678 655 97 --2844 264 --
NM_001111chr142450 880 167 93 --11806 22670 1785
NM_001113490chrX143682 2438 2301 2260 2232 1078 1023 1003 725 630 566 341 179 127 --33424 3128 2966 144
NM_001115chr8179 ------
NM_001116chr1672596 2577 1958 1926 437 399 75 2365 333 1373 --
NM_001117chr1852524 2408 639 197 141 --32321 1750 395 1426
NM_001121chr1091940 1823 1722 1642 1202 618 508 453 389 21282 346 41768 1711 660 414 --
NM_001122631chr111478 ------
NM_001123chr105835 679 339 287 99 1268 ----
NM_001124chr112569 480 --1509 --
NM_001126chr131047 1013 962 --1754 2409 313
NM_001128chr16123555 3459 3401 3235 3132 3093 2846 2678 1353 1197 698 222 23048 475 33880 3217 1381 --
NM_001135chr15195 --2822 346 --
NM_001144chr1641379 1241 921 178 11303 11128 --
NM_001146chr891988 1897 1559 1531 1519 924 693 621 305 --11803 --
NM_001148chr462055 1920 1852 1383 396 311 ------
NM_001149chr1031009 955 139 11286 1421 --
NM_001151chr41192 ------
NM_001152chrX----1203 --
NM_001153chr29820 374 344 324 282 275 182 62 48 --1839 --
NM_001156chr102426 181 --1592 --
NM_001159chr21805 --1134 1711
NM_001160chr12142831 2788 2721 2036 1896 1725 738 605 483 341 164 82 40 31 11039 32680 1759 404 1747
NM_001167chrX266703 6560 6541 6461 6435 6391 6356 5771 5643 4601 2664 2591 2526 2456 2019 1846 1810 1758 1263 1054 911 864 572 330 203 175 22354 900 76747 5779 1748 1574 884 839 551 25193 2030
NM_001172chr141152 ------
NM_001173chr14244745 4691 4658 4444 4302 4026 3728 3501 3459 3391 3357 3246 3092 1320 1173 1150 1057 905 829 822 813 478 384 319 54260 2984 1685 1162 208 64488 4474 3068 1856 1219 373 23215 999
NM_001177chr1292278 1637 1549 772 587 514 486 380 227 --1324 --
NM_001179chr41184 --184 --
NM_001186chr21193160 3147 3093 2969 2952 2929 2771 2626 2593 2412 2249 2094 2074 2053 976 891 771 418 406 11274 42673 2467 953 501 --
NM_001198chr6112445 2347 2341 2187 2064 1937 1890 1780 885 275 23 12206 72299 2144 1815 1596 728 458 345 --
NM_001200chr2061003 332 304 205 157 45 --11079 --
NM_001201chr4163557 3523 3386 3379 3278 3231 3068 3057 2972 2519 1497 1304 1195 1101 1081 670 23180 215 2654 309 43790 3724 878 51
NM_001204chr2367662 7576 7486 7198 7107 7070 6837 6765 6454 5829 5812 5799 5658 5548 5419 5383 5237 4798 4726 2566 2361 2330 2044 2021 1744 1601 1569 1549 1346 1336 901 678 594 213 134 86 76175 6077 5869 2532 2503 993 956 97492 7345 7289 5715 1611 907 616 297 34 46978 2082 1452 185
NM_001206chr9133126 3065 2672 2643 2284 2003 1989 1098 1030 890 838 760 559 2798 749 73037 2653 2584 1162 777 316 270 11051
NM_001207chr5284 55 --2272 72 1124
NM_001211chr152337 144 --3290 278 127 --
NM_001219chr742117 1531 813 101 11904 32228 270 262 143
NM_001222chr1021895 1462 ------
NM_001233chr792247 2053 1768 931 915 873 839 625 266 22262 674 32287 415 171 --
NM_001235chr113691 673 574 ------
NM_001241chr2102404 2180 1776 1615 715 669 591 458 232 122 11755 31628 443 133 11965
NM_001241chr2102404 2180 1776 1615 715 669 591 458 232 122 11755 31628 443 133 11965
NM_001253chr62245 126 ------
NM_001254chr1741082 1052 909 73 --1342 1187
NM_001256chr17112898 2631 2295 2179 2121 2100 2011 1064 973 638 311 42625 2391 1129 885 52551 2414 2106 1823 372 --
NM_001257chr1671530 1398 1315 1265 1230 543 137 --1286 --
NM_001259chr7266356 5753 5584 5472 5324 5200 4961 4749 4046 2400 2292 2236 2082 1949 1735 1596 1430 1401 1213 1079 962 826 792 767 702 298 65050 4720 4682 4266 2444 1417 115905 5782 5348 5118 4589 4300 4181 2462 1329 481 395 --
NM_001260chr131282 ------
NM_001265chr132939 220 1200 1205 --
NM_001269chr12927 909 --11014 --
NM_001270chr55981 937 825 730 32 11102 1221 1175
NM_001271chr1543051 2405 1274 680 23288 3118 23250 52 --
NM_001273chr122593 366 ------
NM_001282chr173526 320 286 --2587 417 1910
NM_001284chr56580 537 524 451 220 102 ------
NM_001286chr142067 937 360 195 --12813 12838
NM_001288chr6--1187 ----
NM_001289chrX3402 173 139 1498 --2622 192
NM_001290chr491061 1050 974 918 882 761 426 407 101 1692 1434 --
NM_001298chr251274 1023 984 340 172 --21084 308 --
NM_001304chr1783861 3585 3188 2779 2714 1160 314 239 53727 3475 2796 1185 527 53558 3123 1343 463 350 13325
NM_001310chr12122994 2955 2656 2550 2484 2449 2287 1948 1938 903 326 174 --1303 41910 773 597 490
NM_001313chr4--2898 855 ----
NM_001315chr662220 2044 1586 1579 1571 1396 --22304 369 --
NM_001326chr111322 ------
NM_001328chr42767 721 ----1496
NM_001330chr163980 317 305 --1136 --
NM_001331chr11122827 2683 2434 2328 2268 2193 1952 1935 822 441 259 223 1465 32766 522 46 22094 41
NM_001332chr551384 1055 609 273 156 ------
NM_001338chr212969 152 1385 21068 867 2397 143
NM_001343chr551697 1684 1639 1577 1098 --21206 167 --
NM_001349chr21125 1225 2414 186 --
NM_001351chr351707 682 599 332 261 2483 469 ----
NM_001356chrX102521 2318 1641 1557 964 878 517 339 333 132 11956 21825 1772 --
NM_001357chr11270 --1227 --
NM_001363chrX2780 135 1687 --1641
NM_001364chr11144798 4364 4193 3754 3434 3363 1611 1357 1085 1040 1023 775 661 352 23788 81 53809 3096 1584 1472 997 --
NM_001365chr173643 618 576 --1778 --
NM_001378chr21195 ----1348
NM_001380chr1031083 906 795 2955 860 21006 127 --
NM_001386chr882133 2045 1963 1855 1709 808 791 753 11875 32341 1910 1730 --
NM_001390chr1893623 3586 3510 3111 2638 1400 1234 537 225 23400 3327 33332 2692 799 13167
NM_001391chr1851205 1188 1181 281 153 11095 146 --
NM_001396chr21112450 2311 2175 2143 2112 1997 1826 1072 974 890 137 --52666 1128 1116 1109 902 --
NM_001400chr1121378 1322 1164 1137 1060 1019 989 929 864 506 499 236 11357 11009 --
NM_001401chr921459 496 1304 21367 1017 2475 398
NM_001407chr341203 1150 1074 268 1215 31066 491 260 --
NM_001412chrX123626 3551 2900 2888 2693 2454 1343 1110 1092 875 719 552 21318 831 42947 794 285 140 1512
NM_001415chrX71816 1412 801 791 455 305 75 --31822 1547 1245 11421
NM_001416chr172131 107 1447 ----
NM_001417chr1251399 1198 680 233 153 11631 121 11388
NM_001418chr111199 ------
NM_001418chr111199 ------
NM_001419chr19164882 4600 4537 4357 4346 4222 4093 4004 3933 3743 1231 960 887 466 307 60 24339 1381 94744 4566 4418 4208 3871 3508 1171 1144 990 --
NM_001420chr1922431 703 23140 636 33169 2088 601 --
NM_001422chr1131360 472 263 ------
NM_001423chr1252030 1621 1444 1425 208 --21916 1549 --
NM_001427chr742085 1457 380 324 --21495 197 --
NM_001429chr228899 784 711 412 403 75 56 39 --2337 204 1797
NM_001430chr282003 1737 1569 767 679 640 445 246 ----1191
NM_001431chr671211 1131 916 850 298 212 55 ----1319
NM_001432chr4133655 3634 3623 3544 3429 3402 3345 2656 2541 2502 1355 943 116 43873 3311 3256 1168 103882 3176 2757 2664 1317 1249 1137 849 155 144 2863 222
NM_001438chr1143686 3557 3285 3196 2855 2674 2366 2357 2322 1074 1052 886 315 191 32244 1016 543 43497 3247 798 244 --
NM_001439chr121547 502 --51503 584 365 164 71 1579
NM_001440chr822785 759 --1438 --
NM_001448chrX61709 1551 1276 700 512 60 --185 11657
NM_001451chr1651378 1183 1062 969 74 2931 383 41287 467 460 433 1428
NM_001452chr64716 702 647 601 ----2683 614
NM_001453chr661470 1355 1191 412 349 191 --41385 1301 605 335 1518
NM_001463chr21332 --1595 --
NM_001465chr551923 1635 1518 1343 856 1823 11353 11649
NM_001482chr155970 706 367 101 75 --1155 1955
NM_001483chr73918 807 762 31047 706 396 2893 720 --
NM_001490chr9103440 3004 2559 2533 1250 828 756 499 399 374 33597 2383 1289 21391 608 11494
NM_001491chr652620 1095 609 544 74 2950 883 11734 --
NM_001495chr81797 --21119 28 --
NM_001497chr992676 2142 2083 1923 1859 909 727 352 167 192 22762 827 1868
NM_001498chr651274 980 408 365 218 1262 1201 --
NM_001518chr741103 326 287 48 --1148 1129
NM_001527chr6154785 4415 4220 3865 1431 1408 1348 1277 1234 937 300 212 133 121 100 33369 3361 3075 54053 1611 1596 1451 1283 11606
NM_001530chr1461091 1030 865 435 344 71 1396 1286 1322
NM_001533chr192254 64 1229 ----
NM_001535chr21------1609
NM_001542chr172427 2389 2364 2150 1860 983 530 --12377 1841
NM_001543chr554015 3714 1624 946 938 14599 11054 --
NM_001546chr641240 579 382 360 21454 294 21381 426 --
NM_001550chr74660 645 106 25 2456 439 140 1432
NM_001557chr221258 1217 11355 11308 --
NM_001558chr1131551 586 108 1487 122 --
NM_001560chrX72596 2479 2137 2064 1044 877 327 12182 11631 --
NM_001564chr41143 1103 ----
NM_001570chr351435 1202 978 485 468 1183 ----
NM_001584chr1181241 1146 1136 413 321 311 155 53 --1766 --
NM_001587chrX32257 421 217 ----1183
NM_001609chr10134361 4189 3683 3633 3624 3527 3017 2880 1091 882 736 433 117 2725 206 34398 1069 234 1283
NM_001616chr2123343 3127 2742 2655 2573 2310 1270 953 569 397 237 82 22224 2174 53415 3165 3149 895 379 11386
NM_001619chr1131046 88 38 150 ----
NM_001621chr7153008 2964 2954 2577 2523 2350 1970 1037 714 692 590 558 521 371 152 12273 22287 496 42652 2482 462 159
NM_001621chr7153008 2964 2954 2577 2523 2350 1970 1037 714 692 590 558 521 371 152 12273 22287 496 42652 2482 462 159
NM_001634chr651738 1511 607 89 60 21909 1644 ----
NM_001642chr1131349 1154 888 1432 11138 11191
NM_001650chr1883609 2912 2796 2546 1553 1333 1013 248 33910 1273 871 32975 1283 977 2898 217
NM_001655chr1162045 1412 871 660 527 519 21747 1647 22095 365 1331
NM_001656chr562009 1884 1315 590 520 154 22085 1776 41789 1463 1356 791 --
NM_001658chr161091 1003 410 235 163 41 --1989 --
NM_001659chr1232536 2056 1738 --22151 2027 --
NM_001660chr32700 130 --1682 --
NM_001661chr17--1309 2557 287 --
NM_001663chr1492256 2028 1924 1047 966 955 827 442 353 22066 1791 1393 22349 992
NM_001664chr361030 1009 741 718 334 311 ------
NM_001668chr131734 1687 692 1211 61914 1805 1786 1580 857 655 --
NM_001675chr22172 ------
NM_001677chr171000 820 801 402 368 326 122 1249 1932 --
NM_001679chr33701 643 578 2669 620 1530 1767
NM_001682chr12102848 2498 2265 2228 2173 1041 821 675 600 550 22251 813 62569 1797 912 471 191 145 --
NM_001683chr372699 1734 1725 1702 945 765 527 --1641 --
NM_001684chr1124165 2955 2642 2625 1541 1271 1252 1061 1030 481 82 31 1272 13844 1795
NM_001689chr252006 805 558 518 329 2712 279 ----
NM_001690chr372487 1808 1779 481 413 400 61 --42458 626 614 607 2795 602
NM_001695chr873922 3428 3296 3041 2709 855 720 1987 43866 2856 1356 1241 33991 1314 81
NM_001701chr941268 1034 472 241 11466 21567 437 --
NM_001702chr8----1548 --
NM_001703chr1151 ------
NM_001704chr64608 458 393 387 1488 ----
NM_001706chr32664 21 --1695 --
NM_001707chr71898 --1841 1920
NM_001709chr1172914 2760 2534 1005 931 514 308 12895 42652 1055 819 551 22297 460
NM_001714chr124574 493 429 422 ------
NM_001717chr1561377 1020 957 490 259 36 --1203 --
NM_001718chr631135 1100 999 11178 ----
NM_001722chr8----1244 --
NM_001726chr11111 1153 ----
NM_001730chr1341623 1585 1311 130 --11524 --
NM_001730chr1341623 1585 1311 130 --11524 --
NM_001731chr124914 899 794 51 1295 --1717
NM_001742chr771674 1382 1229 731 604 442 173 1436 31838 1600 1565 2382 376
NM_001743chr21185 --2507 454 --
NM_001745chr571200 1149 1073 461 230 133 113 1903 1745 1317
NM_001746chr5102868 2676 2657 2229 2130 2044 1099 703 422 266 42727 2618 2428 1107 42917 2785 2688 2288 --
NM_001748chr131151 1065 278 ----1286
NM_001750chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001752chr111527 2601 409 1414 --
NM_001753chr7121833 1824 1558 1551 1501 1466 1442 1399 1302 615 222 35 1204 21643 187 21663 1601
NM_001754chr21173741 3726 3695 3661 3652 3603 3579 3568 3401 3342 1475 807 664 651 600 495 390 43250 1517 1031 731 23271 3255 31617 550 489
NM_001755chr16122300 2035 1910 1867 1832 1588 1476 1455 1441 429 308 241 --52256 2163 1399 500 438 --
NM_001759chr12175007 4973 4883 4716 4525 3775 3273 2039 1802 1775 1651 1579 1467 1409 906 649 349 11788 --34815 4809 4602
NM_001762chr73696 241 72 --1752 1175
NM_001769chr123337 155 56 ------
NM_001777chr3124130 3993 3783 3739 3321 3291 3272 2792 2691 2609 1470 863 34156 1442 1236 33914 3261 2917 54069 1364 1228 679 253
NM_001788chr73879 684 658 --2967 138 --
NM_001789chr32494 462 1566 1468 --
NM_001791chr151362 1267 1255 887 265 11288 1238 --
NM_001792chr185917 903 894 382 335 21079 888 1911 1403
NM_001795chr1621502 1360 --11578 --
NM_001797chr165817 767 745 680 570 1644 179 --
NM_001801chr52427 30 1223 1479 --
NM_001802chr163894 624 118 --1995 --
NM_001804chr52863 806 ------
NM_001806chr1962785 2714 2358 2349 2126 126 12261 12933 1966
NM_001812chr4------1232
NM_001822chr22583 541 1710 2739 672 --
NM_001830chrX103844 3733 3618 3471 2777 915 767 491 119 21 23410 331 2975 834 14037
NM_001839chr1--3511 307 77 2773 756 1118
NM_001842chr92576 84 ------
NM_001843chr12--2219 198 ----
NM_001844chr122144 57 --1395 --
NM_001845chr1351070 931 897 254 230 11313 ----
NM_001851chr64713 634 612 593 ------
NM_001854chr151301 1241 1218 1077 386 --21475 1101 --
NM_001855chr95896 853 605 573 37 ----1591
NM_001858chr6195107 4948 4857 4848 4193 3975 3715 3532 3519 3508 3151 2008 1764 1733 1720 453 219 191 183 54430 3309 1926 517 238 74097 3906 3756 2031 1463 498 94 14965
NM_001859chr994004 2923 2605 1323 1308 1138 1079 818 319 1360 --31565 1531 1054
NM_001860chr921049 402 ----11216
NM_001870chr31253 ------
NM_001873chr42514 23 --1108 --
NM_001874chr12154980 4804 4555 4534 4270 4167 4075 4019 3439 3240 3223 3197 1839 1227 975 --14733 --
NM_001875chr271065 868 724 357 337 279 120 11099 2286 240 21057 374
NM_001880chr22240 106 1294 1209 --
NM_001882chr53439 174 167 ------
NM_001884chr51542 ------
NM_001885chr11125 ------
NM_001891chr4----135 1317
NM_001892chr571551 1241 1086 1017 361 327 256 11452 11256 --
NM_001894chr2251225 1141 1132 1031 49 --21201 1042 --
NM_001896chr162426 41 ------
NM_001901chr63986 697 64 1903 21080 683 --
NM_001902chr13398 341 307 ------
NM_001903chr52915 657 --2615 214 1182
NM_001904chr32246 145 21093 742 --153
NM_001918chr1249197 8471 8382 8194 7668 7214 7068 6910 6888 6752 6638 6139 3554 3468 2341 2262 1272 1093 1025 972 964 714 160 27 79018 8834 8238 7510 7337 6116 2277 49241 6530 6440 644 27077 1609
NM_001920chr122499 307 2483 24 ----
NM_001921chr441211 1195 1027 197 11113 ----
NM_001924chr14516 482 430 420 --1356 --
NM_001931chr1151203 1176 1048 465 93 2217 160 11194 1108
NM_001935chr241032 914 872 46 ----1739
NM_001938chr191884 1839 1792 1753 1746 1716 1496 1307 627 2740 229 ----
NM_001942chr1871853 1822 1598 1344 487 195 21 11707 21451 331 --
NM_001944chr1842301 1699 1618 965 --1291 --
NM_001946chr1251184 982 782 769 78 --1827 --
NM_001949chr6163274 2826 2781 2766 2757 2746 2453 2374 2319 2235 2176 2086 879 818 225 160 23153 812 140 --
NM_001950chr161639 --1730 1723
NM_001954chr62757 728 1780 ----
NM_001955chr651072 888 806 731 210 --21115 945 11035
NM_001957chr482097 1909 1417 745 730 609 434 134 2476 343 5751 629 506 420 304 --
NM_001962chr51120 ------
NM_001963chr43714 303 261 --2580 156 1612
NM_001964chr531099 1086 1056 --1978 --
NM_001966chr331377 1264 1099 ----1292
NM_001967chr31430 ------
NM_001968chr45869 842 668 358 180 ------
NM_001969chr14102833 2784 2448 1163 1036 886 878 799 779 357 33813 3745 2487 31186 1019 937 --
NM_001973chr13333 285 118 ------
NM_001977chr441532 502 445 272 1391 --1114
NM_001980chr1252263 2154 528 362 345 41537 859 778 674 11967 11394
NM_001981chr1102060 1730 1566 961 954 906 543 281 263 145 31933 658 496 21721 914 --
NM_001987chr1274340 3667 3113 1707 1462 1169 755 14302 41442 1329 1071 428 1573
NM_001993chr171119 1030 889 747 366 355 266 2233 58 --1950
NM_001994chr1--1181 ----
NM_001995chr421438 1176 1924 ----
NM_001999chr571540 1520 1383 1187 1078 356 314 --3508 493 221 1401
NM_002006chr4185693 5599 5416 4787 4622 4329 3789 3633 1824 1551 1331 1089 1032 1004 610 268 124 51 95198 5146 4380 3824 2335 2231 1365 875 287 85791 5393 5279 4577 4034 1580 1396 1384 --
NM_002009chr1552502 2276 919 497 284 1856 2888 94 22302 1013
NM_002011chr5----1440 --
NM_002014chr121271 --1111 --
NM_002015chr13143342 2731 2647 2590 2541 1120 832 781 750 691 629 463 322 178 --1678 --
NM_002017chr1161329 1177 854 164 145 47 --1963 11286
NM_002024chrX102096 1751 1389 804 681 662 476 466 260 141 --31430 691 148 21831 220
NM_002025chrX269146 9070 8370 8168 8078 7905 7501 7412 7293 7047 6965 6613 5992 5726 3028 1882 1458 1330 1177 1125 983 698 658 465 263 209 59320 6002 2981 1283 972 47815 7462 6146 1288 23192 2963
NM_002031chr62642 563 1333 1253 --
NM_002033chr11134137 4061 3820 3469 3373 3136 3032 2913 2688 2526 845 117 50 12827 1191 33959 3064 2698
NM_002035chr18153967 3957 3930 3901 3867 3704 3541 2946 1067 1011 732 710 534 365 73 23673 1092 63600 2926 2669 2660 1167 955 11230
NM_002037chr63434 396 316 ------
NM_002040chr21163151 3122 3036 2538 2437 2417 2295 2132 2085 950 707 420 408 183 170 126 13049 62806 2702 2215 1969 1044 375 23160 2063
NM_002041chr15----191 --
NM_002044chr1531199 620 133 --11576 --
NM_002048chr951197 1169 971 833 130 2987 479 11324 21267 1020
NM_002051chr1051168 836 818 792 66 ------
NM_002056chr25861 777 710 258 159 --1835 --
NM_002061chr141871 555 316 201 --3452 352 262 21538 274
NM_002063chrX31269 810 518 --21195 843 --
NM_002065chr14446 422 229 147 11165 11294 1661
NM_002069chr73681 673 564 21903 460 11169 1320
NM_002072chr941014 933 910 266 1983 ----
NM_002076chr1283264 2766 2606 1082 1013 720 555 357 --33023 2188 1215 --
NM_002077chr942135 498 107 42 1472 1745 --
NM_002082chr5--11000 ----
NM_002086chr1732123 1553 553 ------
NM_002090chr42200 192 1513 3446 437 177 --
NM_002092chr4174762 4317 4103 4031 3927 3920 3913 3700 3210 1146 1030 1023 917 739 447 380 227 34111 3838 558 23706 890 34326 3448 336
NM_002094chr163314 111 80 --2353 322 --
NM_002107chr11336 2392 203 2427 95 --
NM_002114chr63168 128 84 --125 --
NM_002126chr17134179 2942 1663 1625 1490 1202 1120 1087 1031 1018 787 556 545 --31463 1260 1106 --
NM_002128chr13122391 2238 2212 2002 1839 1744 954 872 596 496 455 195 22328 1769 22344 527 --
NM_002129chr42121 57 ----1160
NM_002130chr551597 1434 1285 393 369 21129 121 11548 --
NM_002133chr221576 1382 2474 428 --
NM_002135chr122509 484 ------
NM_002136chr122262 203 ------
NM_002137chr772354 2195 1571 542 536 377 266 12324 32225 1884 958 --
NM_002138chr44616 196 114 48 1789 1656 --
NM_002140chr92748 349 1478 2781 290 1946
NM_002145chr172379 292 ------
NM_002146chr1741221 1091 943 428 --21401 1162 1172
NM_002148chr22448 135 --1264 --
NM_002158chr2183852 3574 3377 3356 3015 2964 2784 2349 1522 1492 1210 749 502 479 472 354 221 127 2254 151 63435 3250 2948 2790 2741 421 23791 3552
NM_002163chr162245 117 --11259 21145 482
NM_002166chr23679 658 579 2687 229 188 --
NM_002167chr11466 1503 ----
NM_002182chr3142799 2752 2737 2703 2680 2465 2371 2204 1941 951 859 718 668 482 --42745 2028 2006 1020 1425
NM_002193chr21218 1525 21401 153 21517 1453
NM_002194chr2----1128 --
NM_002196chr2051139 1058 834 697 329 2937 208 --11027
NM_002196chr2051139 1058 834 697 329 2937 208 --11027
NM_002199chr47930 807 781 652 353 91 65 21035 964 2789 71 --
NM_002201chr151109 186 ----
NM_002202chr55944 925 855 769 718 --122 --
NM_002203chr5114106 3874 3851 3788 3328 2557 1530 1165 456 224 127 34173 3016 331 33103 1517 92 --
NM_002207chr3195 --1682 1313
NM_002210chr2112764 2692 2483 2457 2208 2185 974 657 593 508 291 42427 2332 874 669 53266 1442 1301 993 466 21236 572
NM_002211chr1071122 1005 895 838 805 760 154 2379 137 1910 1815
NM_002214chr7115531 5334 5248 5160 4355 4057 3520 1329 1153 1016 183 55239 5052 4490 4439 3998 55641 4834 4639 613 566 35392 4448 1338
NM_002222chr321340 311 11116 1913 --
NM_002223chr12103089 2934 2895 2455 1595 1443 1087 607 598 441 22818 1435 12953 12728
NM_002226chr144899 729 141 99 --1224 --
NM_002227chr12336 72 --21172 382 --
NM_002232chr111108 11240 ----
NM_002234chr122671 624 ----2765 199
NM_002235chr1261449 1426 1140 615 352 211 11730 ----
NM_002239chr2198 1811 ----
NM_002240chr212550 89 1118 ----
NM_002242chr262009 1563 1452 735 705 462 1537 156 --
NM_002245chr11621 175 1474 --
NM_002247chr1072356 1940 1520 1500 841 621 397 31799 918 161 21953 827 --
NM_002252chr2----1168 --
NM_002253chr451416 1192 1122 1039 524 11164 ----
NM_002264chr3164875 4296 3756 3579 3477 3267 3238 3159 3089 1968 1703 1496 1070 756 643 517 43678 3558 3449 1762 41954 1049 1016 472 14523
NM_002266chr17148 ------
NM_002267chr1361927 1806 955 797 711 463 22315 1705 32355 692 251 --
NM_002268chr331762 1705 1435 --11797 11468
NM_002270chr5235594 5544 5095 4833 4623 4035 3901 3812 3741 3704 3645 3630 3489 2228 2183 1918 1858 1811 1679 1595 1484 1226 451 35162 4707 1966 44302 1662 1606 848 22247 1054
NM_002271chr1352161 1642 1576 791 295 12106 32332 740 242 --
NM_002285chr283989 3926 3383 2885 1654 1559 1142 495 13214 32896 581 527 13914
NM_002293chr192767 2627 2544 2516 1731 876 704 667 86 12744 42615 2452 2433 2407 1578
NM_002296chr171619 1555 1313 1282 667 653 369 11241 41561 1084 336 111 --
NM_002298chr1341409 515 290 269 --21504 1038 --
NM_002310chr5216621 6156 6048 6009 5881 5659 5637 5493 5402 5235 5119 4921 4424 4404 4175 1967 1534 1385 1357 829 811 31101 735 541 45441 4674 2265 726 34652 4497 159
NM_002314chr7----3989 942 919 --
NM_002317chr53373 125 91 ------
NM_002332chr121733 ------
NM_002335chr11176 ------
NM_002336chr12175076 4984 4896 4793 4524 4159 4091 4050 3699 3576 1764 1212 1138 1055 788 714 184 14658 34815 1669 258 21727 1410
NM_002345chr125654 518 218 71 25 --2532 136 1482
NM_002349chr271444 1414 1308 1235 1138 1030 306 4521 473 384 319 61420 1162 526 512 375 112 --
NM_002350chr841250 1153 804 449 --11239 21012 790
NM_002351chrX81711 1541 476 360 270 223 164 25 21573 345 ----
NM_002355chr1271305 1283 495 424 254 181 118 --1131 --
NM_002356chr6102698 2549 1844 999 878 672 538 317 131 36 12445 3286 279 137 12276
NM_002358chr4--1102 1160 --
NM_002359chr1734306 3466 3281 --33506 3421 1284 --
NM_002360chr732302 2161 1901 --42634 2509 2497 2252 --
NM_002372chr52656 83 2544 40 ----
NM_002374chr2113428 3156 2625 2467 1402 1303 1219 1068 979 491 277 33376 1159 293 53222 2279 1230 1059 242 --
NM_002381chr23851 708 670 1314 11015 --
NM_002382chr1431343 449 277 2248 137 2202 107 1143
NM_002384chr181972 1993 1697 1985
NM_002387chr5205156 5088 5016 4827 4629 4350 3885 3841 3713 3476 3332 3226 3151 1988 1981 1971 1696 1630 1446 277 --24741 2076 11840
NM_002389chr1111979 1822 1771 1707 1545 763 580 531 440 390 310 --21628 700 131
NM_002395chr661235 1119 454 430 357 114 2284 59 2983 385 1490
NM_002397chr592062 1626 1604 1430 880 836 803 745 701 --22159 1734 1147
NM_002398chr231269 611 590 --31547 1346 1177 11128
NM_002399chr1531464 454 370 --3957 445 438 --
NM_002401chr1742074 805 401 383 ------
NM_002402chr741208 1010 321 209 --11084 --
NM_002408chr144703 337 317 97 --136 --
NM_002416chr442084 2036 791 47 ------
NM_002430chr2271685 669 473 462 417 335 276 --22521 2038 --
NM_002438chr102224 177 164 --1694
NM_002440chr12238 100 --155 --
NM_002442chr1251761 1659 1650 354 264 ----21523 256
NM_002444chrX31497 562 286 --11954 --
NM_002449chr541238 1014 411 325 2464 295 21071 357 --
NM_002451chr9113913 3237 2885 1293 1239 1220 1176 872 748 458 323 1838 31307 1268 1245 --
NM_002467chr83416 378 175 --1402 --
NM_002469chr121441 --1392 --
NM_002473chr2211153 --2965 364 --
NM_002480chr1281366 1095 545 470 462 421 258 144 21360 1341 2495 370 11035
NM_002481chr1177811 7404 6729 6568 6544 6515 5081 2960 2880 2836 2446 1815 1619 1311 1253 383 320 46868 6371 2407 575 46705 1670 709 580 17831
NM_002482chr12667 63 --155 --
NM_002486chr962186 2056 1614 643 376 84 --42538 1596 263 62 32308 533 157
NM_002487chr156642 593 578 258 236 229 1113 --1135
NM_002492chr32324 142 --173 --
NM_002499chr1562495 2445 866 766 648 398 1557 31810 660 562 12137
NM_002500chr24495 473 439 201 3522 464 348 2914 392 --
NM_002501chr1911245 ----12770
NM_002507chr1711740 ------
NM_002508chr162023 1897 1865 1790 790 140 11855 1598 --
NM_002515chr1451793 474 218 190 72 --11701 --
NM_002518chr221142 102 --2997 460 1471
NM_002519chr1161538 1313 1283 1264 1229 964 11155 --1194
NM_002520chr51310 ------
NM_002523chr731105 1052 780 --11111 --
NM_002524chr13915 445 404 1899 1246 --
NM_002525chr1140 ------
NM_002526chr651676 1664 1160 631 42 --41621 650 402 290 11484
NM_002527chr122257 35 ------
NM_002538chr56532 476 402 213 168 130 --1573 --
NM_002541chr71991 ------
NM_002544chr171310 ------
NM_002545chr1165028 4959 4080 3376 737 458 14758 15041 1158
NM_002546chr82578 234 --2815 601 2619 556
NM_002556chr1172170 2133 2108 1974 813 127 94 --21647 1634 11763
NM_002569chr1521476 49 --169 --
NM_002570chr1531148 1080 1059 11042 1378 1895
NM_002577chr3104075 4028 3886 3353 2923 1333 1063 579 423 297 2627 181 42652 2496 1561 457 43972 2975 2663 2491
NM_002581chr9135662 5639 5524 4859 4551 4219 4127 3726 2258 1655 1196 967 949 --85492 5355 4557 4155 3906 2016 1471 845 25543 3618
NM_002582chr162950 904 --1158 --
NM_002583chr122633 33 --1512 --
NM_002585chr11328 ------
NM_002586chr621189 639 ------
NM_002589chr4----1136 --
NM_002590chr131212 1186 ----
NM_002591chr202531 151 ----1561
NM_002592chr20--1247 1220 --
NM_002594chr20132379 2282 2141 2074 1675 1653 1584 884 759 629 348 318 152 --1963 --
NM_002595chr12101943 1614 1433 1372 1234 1213 780 439 270 190 --21524 707 --
NM_002600chr141687 1182 710 502 31867 1573 1300 21305 583 1704
NM_002605chr153965 921 411 ------
NM_002606chr21------1181
NM_002608chr22----21589 1568 --
NM_002610chr2162773 2685 2594 2454 2393 2308 2161 878 813 794 331 251 201 188 90 38 33070 679 572 13135 22377 225
NM_002612chr772113 1549 1390 1356 1349 832 356 11819 42129 1666 691 221 --
NM_002613chr16155349 5248 5239 5065 4724 4404 4391 4363 3994 3602 3379 3290 1961 1877 1302 1137 13348 15074
NM_002618chr22432 36 --147 1349
NM_002623chr205703 695 519 200 162 ----1171
NM_002628chr341047 944 105 92 1878 ----
NM_002631chr1190 ------
NM_002633chr12543 114 ------
NM_002635chr121444 171 ----
NM_002636chr62460 448 --1471 --
NM_002641chrX71662 1638 758 338 293 246 140 31518 1443 1312 41769 1651 1345 74 --
NM_002645chr11103040 2904 2685 2562 2479 2041 1120 660 322 205 22543 2470 21959 554 33081 2728 112
NM_002647chr181128 --1223 --
NM_002648chr61841 1816 11293 --
NM_002649chr781526 1393 1298 1219 1208 677 358 298 11156 ----
NM_002651chr12694 680 --1833 1688
NM_002655chr8194676 3780 3753 3688 3525 3488 3379 3319 1988 1607 1487 1245 1087 885 727 334 245 206 80 54597 3797 287 156 64 95091 4510 3876 3575 3385 3357 2007 1541 106 44964 4851 4563 313
NM_002656chr631112 1078 192 1951 122 1779
NM_002657chr2043869 3318 3285 798 --43782 3324 3129 251 1246
NM_002658chr102925 54 --1886 1875
NM_002667chr631223 1060 206 --21006 425 1362
NM_002670chr3101550 1472 1398 1239 1091 636 601 532 467 365 11191 21178 256 --
NM_002677chr872547 2496 1970 1019 993 653 29 --2980 103 13001
NM_002687chr1421121 304 1451 3393 359 164 --
NM_002699chr151534 1420 1343 1303 89 --21435 1232 11427
NM_002703chr471846 1808 1659 1601 659 299 138 21609 1257 31936 1696 576 --
NM_002706chr23608 517 471 --2574 23 1540
NM_002709chr2153563 3267 2996 2919 2844 2751 2597 2421 2403 1182 682 504 438 380 150 62858 1430 1171 732 455 270 --13628
NM_002710chr1241066 955 448 131 161 ----
NM_002713chr131078 1036 1023 2860 303 --1752
NM_002714chr631106 263 188 --11085 --
NM_002715chr51476 1417 1270 --
NM_002716chr1163141 2520 1414 916 449 261 13304 63342 2334 2242 1445 1380 989 1998
NM_002718chr352644 1885 1823 1080 37 1747 21722 85 --
NM_002719chr1462420 2102 1813 697 565 511 --21783 412 1789
NM_002720chr161223 ------
NM_002721chr92513 30 --182 --
NM_002725chr111776 ----13263
NM_002727chr107647 617 465 218 191 173 48 1103 ----
NM_002731chr1152714 2684 2667 2048 1940 1243 1222 1159 1012 986 930 863 503 389 323 --12134 12329
NM_002734chr1781919 1730 1681 1568 1482 545 352 66 21591 1417 32254 673 285 1143
NM_002736chr7111863 1768 1752 1670 1598 846 742 707 562 471 430 21913 1578 31949 733 571 11383
NM_002737chr17106286 6194 6047 5363 4690 2239 2043 1427 346 321 35737 4670 1582 106599 6383 5436 4982 2185 1972 1600 1468 816 695 14356
NM_002738chr1671149 923 878 793 431 304 253 169 ----
NM_002740chr392820 2643 2469 2384 1817 906 627 437 366 --22749 942 12036
NM_002742chr142180 92 --1732 --
NM_002745chr22144452 3582 3571 3341 3199 1689 1564 1528 1231 1076 678 292 276 166 43326 3147 660 160 23825 3273 23221 1522
NM_002748chr1561187 938 890 398 382 81 --2979 366 --
NM_002749chr17------1233
NM_002750chr102234 197 --1223 --
NM_002755chr154728 654 356 58 1159 ----
NM_002756chr173877 672 661 --2910 390 --
NM_002758chr171387 1492 1497 --
NM_002760chrY105652 5459 5428 5377 4780 4429 4324 4291 3695 1270 32285 1309 685 35101 1731 613 25910 608
NM_002765chrX41293 947 467 300 3863 259 68 ----
NM_002767chr172468 151 2419 193 1430 --
NM_002787chr73655 270 84 --1214 1450
NM_002788chr142100 27 ------
NM_002792chr20--130 1122 --
NM_002800chr6129 ------
NM_002809chr17--1354 ----
NM_002811chr163553 364 21 ------
NM_002812chr192427 362 ------
NM_002819chr1921271 1206 --1110 --
NM_002822chr1281853 1496 616 554 523 408 335 128 31290 510 51 2183 111 --
NM_002823chr23671 491 248 --3609 273 231 --
NM_002825chr73543 479 145 --1624 --
NM_002827chr2051410 712 475 414 233 11831 21802 192 --
NM_002828chr182983 621 --1866 --
NM_002833chr151274 --11514 --
NM_002835chr71190 --1127 1580
NM_002836chr20146 ------
NM_002837chr1274295 3210 3055 1602 1384 1224 187 23350 2961 54575 4301 1476 254 215 14007
NM_002838chr151013 930 338 201 136 11191 41089 769 344 56 1920
NM_002839chr9143518 3200 3188 2920 2793 2345 2201 1055 912 835 720 624 561 414 127 33512 3169 2709 13217
NM_002840chr13481 437 381 11535 ----
NM_002841chr33476 441 54 --2137 105 --
NM_002843chr11123435 3336 3263 2901 2356 1365 1339 731 386 337 299 243 11347 23398 572 21304 408
NM_002844chr641110 510 363 348 1119 1143 --
NM_002845chr184689 624 436 102 --1651 --
NM_002848chr1241222 362 106 86 --11017 1333
NM_002849chr123844 761 391 11053 ----
NM_002850chr1931173 786 487 1813 ----
NM_002851chr72695 551 1545 1255 --
NM_002858chr121356 1035 21322 340 ----
NM_002863chr14--154 ----
NM_002865chr8----1242 --
NM_002868chr1242324 908 338 152 --1381 --
NM_002869chr1161964 756 373 275 203 43 --1389 32130 2103 1915
NM_002874chr9142526 2477 2435 2231 1990 1831 840 710 695 618 453 341 282 242 --1810 --
NM_002881chr271422 1271 1260 1117 494 328 199 1426 ----
NM_002882chr22--1100 ----
NM_002886chr3135190 3955 3747 3601 3298 1727 1646 1322 1206 773 535 414 82 75165 3266 1851 1471 1453 1410 979 45223 5199 3355 823 11315
NM_002890chr54693 651 321 102 --3982 821 632 --
NM_002892chr1481653 1268 1176 1156 649 624 612 230 --3471 243 122 --
NM_002897chr25766 675 229 85 68 2728 271 1157 --
NM_002901chr113392 377 270 ------
NM_002902chr152653 88 --2564 62 --
NM_002906chr1182187 2116 2032 1629 1560 1460 730 248 22324 2170 31817 1742 906 --
NM_002907chr124379 154 124 103 --2313 61 --
NM_002912chr64786 709 677 633 --3609 74 35 --
NM_002922chr11473 ----1650
NM_002923chr11663 ----1650
NM_002924chr11197 --1129 1530
NM_002940chr481904 1688 733 674 416 343 188 58 --11438 31526 605 575
NM_002941chr341269 1137 620 266 --11171 11593
NM_002942chr321424 163 2420 405 ----
NM_002946chr14484 451 168 30 ------
NM_002955chr61351 11871 1269 11457
NM_002956chr1271423 1333 1268 934 476 400 136 1235 2350 104 --
NM_002957chr963411 3343 3333 2537 2519 366 13753 23498 1468 13213
NM_002958chr38658 264 247 233 183 153 138 73 1199 3634 367 360 1784
NM_002959chr1101489 1232 1207 1063 816 803 606 498 278 190 22926 1646 --1717
NM_002968chr1651109 962 349 246 205 ------
NM_002971chr331118 837 783 1921 ----
NM_002973chr12194 2531 511 ----
NM_002977chr2103238 2960 2786 2622 2376 1300 1201 929 537 507 1295 1176 --
NM_002979chr15900 864 690 319 194 --122 2608 591
NM_002982chr174338 288 76 42 --1368 --
NM_002993chr42226 132 11044 21049 712 --
NM_002994chr461958 1829 789 749 484 251 1464 21922 1631 21467 714
NM_002995chr13743 553 530 2824 761 --2131 125
NM_002998chr8122159 1915 1885 1795 1728 1699 1625 765 592 376 58 43 2561 271 21401 598 11816
NM_003001chr172224 1960 1749 1581 700 313 122 --1585 --
NM_003002chr115781 730 285 141 54 --1823 --
NM_003010chr1762350 957 900 781 543 498 --22226 721 --
NM_003011chr961562 1517 1475 1366 469 374 31160 646 233 ----
NM_003013chr43790 715 681 ----1265
NM_003016chr1742039 1537 1515 1292 11345 21589 607 --
NM_003017chr671411 1092 1005 888 573 256 222 31213 265 108 2904 374 --
NM_003022chrX21290 1177 21061 805 11223 21311 53
NM_003024chr21----1370 --
NM_003026chr931032 405 61 1964 1213 11099
NM_003027chr155406 356 143 114 29 ------
NM_003030chr341877 1505 782 519 --11855 --
NM_003031chr164890 851 675 660 1828 ----
NM_003034chr12268157 7921 7141 7009 6857 6690 5914 5720 5496 5432 5405 5344 5152 5120 5081 5039 2914 2651 2645 2430 2214 1789 1681 1629 204 152 32134 1081 792 47690 3210 473 39 46531 6079 5629 605
NM_003035chr13996 829 612 --2959 311 1736
NM_003036chr12926 289 1349 ----
NM_003043chr3144263 4210 4173 4103 4063 4032 3909 3800 1289 1173 302 281 210 102 24072 759 34281 4237 314 24054 363
NM_003046chr8155379 5359 5140 4415 4342 3873 2038 1786 1564 1350 1335 722 603 560 333 23452 1535 33490 1570 1302 25398 3865
NM_003048chr2132786 2598 2454 2253 2190 2178 2127 1932 1834 1726 959 805 490 1304 12764 12537
NM_003051chr181683 1651 1561 1527 1511 531 335 147 21258 253 21377 802 --
NM_003054chr102261 223 ------
NM_003060chr531333 1178 279 ------
NM_003068chr841059 728 708 380 ----1897
NM_003069chrX7576 558 503 297 287 278 186 --1663 --
NM_003070chr96855 770 618 572 537 251 ------
NM_003071chr391868 822 760 362 309 282 258 244 116 1808 3638 547 345 1172
NM_003072chr191368 ------
NM_003073chr221246 ------
NM_003074chr392215 2100 1602 1543 576 356 333 171 101 --1535 12030
NM_003079chr172126 93 11003 3717 650 34 --
NM_003087chr101235 ------
NM_003088chr7----21092 762 --
NM_003095chr123324 245 21 --1342 2354 256
NM_003099chr15146600 6335 5072 4753 2516 2497 2253 2234 2001 1563 914 379 213 185 16529 46392 2021 844 297 21577 1530
NM_003100chr52381 104 --1321 --
NM_003101chr171643 1615 558 549 489 419 206 11666 --21526 1048
NM_003105chr11141 ----1107
NM_003106chr371104 964 949 927 885 817 353 1228 1267 --
NM_003107chr692620 2455 2106 1728 1674 1653 1049 654 482 31988 1684 1647 11742 --
NM_003108chr2266807 6783 6479 6464 6347 6323 6229 6039 5666 5551 5239 4960 4915 4871 4553 2121 1467 1177 962 918 835 624 609 577 331 249 11376 117133 6662 5722 5424 5142 5002 4780 4740 975 783 542 56568 5864 5445 5109 2138
NM_003110chr1741093 1062 749 709 1965 1955 1994
NM_003111chr261183 1152 552 525 151 104 1430 41400 1164 1011 211 137
NM_003112chr7173257 2866 2781 2596 2376 2320 2281 2140 2079 1994 990 958 913 646 479 368 353 22042 1201 43022 2633 2476 1206 --
NM_003114chr86733 642 618 270 193 138 --2555 174 1782
NM_003115chr13425 407 118 2189 43 148 --
NM_003128chr272593 2466 1058 676 584 224 116 --11739 11100
NM_003131chr652307 1533 773 711 687 ----22082 758
NM_003133chr15753 400 150 126 84 --1201 --
NM_003137chr652018 1939 1557 772 520 32199 663 534 1796 --
NM_003144chr671931 1679 837 553 426 347 176 --32093 527 52 --
NM_003149chr311314 ------
NM_003150chr1752387 925 455 334 120 1166 --1205
NM_003155chr842744 2559 113 94 22682 1979 1851 12759
NM_003156chr1141260 1047 944 365 --11214 --
NM_003157chr31866 --2682 299 143
NM_003161chr1793101 2924 2702 2665 2306 1219 723 546 438 12858 83552 3346 2937 2695 2644 1191 1152 533 --
NM_003162chr221119 839 --21090 910 2800 755
NM_003168chr172840 671 --11062 --
NM_003171chr10155 ------
NM_003174chr103744 352 166 --2103 75 --
NM_003176chr12342 59 --1227 --
NM_003176chr12342 59 --1227 --
NM_003178chr351824 829 749 725 21 1779 31905 1837 488 11471
NM_003184chr841142 1001 950 696 11043 11024 11110
NM_003185chr20101282 1238 1206 1040 929 887 864 446 407 25 --31171 1005 413 11081
NM_003186chr11----1388 --
NM_003188chr65691 154 139 96 45 2757 713 ----
NM_003189chr193263 2145 1281 1203 1037 1022 808 670 170 22798 2487 32492 305 226 --
NM_003193chr1----1141 --
NM_003194chr6----1544 --
NM_003199chr18225545 5294 5094 5029 4404 4265 4195 4156 4129 4098 3904 3667 1922 1466 1334 1324 1227 778 743 709 688 104 14579 25270 4020 21952 1721
NM_003201chr105759 715 687 202 165 21004 655 2943 745 --
NM_003202chr541747 1355 1303 523 11877 21900 1843 --
NM_003203chr2142297 2264 2203 1949 1847 1806 1546 969 960 777 735 619 606 154 22231 1856 2805 788 1720
NM_003204chr1741732 1359 1329 1190 ----31752 1721 1561
NM_003206chr6----2425 402 --
NM_003211chr1281697 1507 1425 537 429 233 203 99 21752 288 31468 1337 1308 --
NM_003213chr121191 ------
NM_003216chr2223356 3004 11219 13089 --
NM_003217chr1281433 716 590 540 147 139 122 115 11880 11759 11856
NM_003220chr661729 1545 1383 1249 1095 388 1528 21438 1420 --
NM_003221chr6114122 3817 3635 3509 2892 1481 1464 1449 721 426 394 23493 1564 --1446
NM_003223chr164861 787 694 303 192 ----
NM_003242chr362308 1856 1840 1608 810 698 21945 249 21000 579 12436
NM_003244chr183462 399 76 --2302 86 --
NM_003246chr1561757 1739 1553 1471 1458 241 22006 1953 21989 1938 21855 1746
NM_003247chr631671 1417 788 11994 41843 1678 426 286 --
NM_003248chr52141 54 --128 --
NM_003253chr2181667 1599 1431 1391 1281 1249 707 499 1244 21510 699 11886
NM_003255chr1782632 2516 2429 2375 2079 1968 913 388 ------
NM_003257chr1591434 1138 971 564 442 411 265 256 242 21175 997 11287 --
NM_003262chr3255303 5035 4575 4367 4213 4173 4158 3675 1994 1973 1776 1675 1576 1383 1337 1300 1271 1141 997 920 760 522 322 304 272 11888 34583 582 457 13282
NM_003269chr641256 451 350 21 11159 11177 --
NM_003270chrX4991 843 789 405 --1362 --
NM_003272chr15585 261 226 176 84 2110 74 --1247
NM_003274chr2152927 2701 2360 2119 1013 --52751 2661 851 501 201 11057
NM_003286chr2031036 407 255 1964 1969 11127
NM_003288chr202600 458 --1582 --
NM_003290chr193288 214 143 --1231 --
NM_003291chr131819 2314 79 ----
NM_003292chr172250 1906 1577 1406 469 461 314 21873 83 ----
NM_003297chr121303 196 176 1130
NM_003298chr365776 5632 5605 1566 1521 77 44430 3882 2131 2025 35698 2030 1579 15454
NM_003299chr121167 ------
NM_003300chr141324 ----1500
NM_003304chr371456 1146 1024 511 475 273 203 21509 1376 31381 1367 498 2643 616
NM_003305chr4--195 ----
NM_003309chr641367 1301 114 98 1770 21805 1215 --
NM_003315chr171233 ------
NM_003319chr22254 42 ------
NM_003320chr11134465 4383 4066 3670 3438 3060 3008 1776 1740 1651 1425 1162 1101 --24407 3113 14456
NM_003330chr1261173 1154 1118 678 430 370 --11798 11589
NM_003336chrX61133 917 884 829 295 89 1304 --3991 364 283
NM_003337chr571724 1456 1448 1439 1216 593 535 1348 4330 305 236 173 11742
NM_003338chr1041856 1601 1287 748 31497 721 118 41939 479 425 308 --
NM_003339chr551393 1337 1151 276 86 --11624 1385
NM_003340chr451158 1108 962 554 478 1254 1123 1202
NM_003341chr32532 515 1199 ----
NM_003342chr17123309 2714 2699 2654 1324 1114 1051 1014 849 681 531 338 31231 1144 646 22476 2356 1569
NM_003344chr771758 1601 1572 1258 1157 598 89 1624 1421 11745
NM_003345chr16167 --2451 215 --
NM_003348chr1281680 1614 1373 1310 1110 1083 686 347 --2672 368 21458 258
NM_003349chr2021072 172 --11087 11094
NM_003350chr861056 952 854 823 362 202 1841 ----
NM_003352chr23870 786 179 --1695 148
NM_003358chr9----1134 --
NM_003359chr481165 1114 1075 1022 873 500 267 27 --31179 1134 432 2513 277
NM_003360chr41192 150 ----
NM_003367chr19--1124 ----
NM_003368chr12778 713 1173 1307 1794
NM_003369chr1162823 2719 2612 2068 859 193 12523 32662 293 207 --
NM_003372chrX3780 216 181 --3321 229 166 --
NM_003373chr1021939 1602 --21805 1436 1696
NM_003374chr5137 ------
NM_003376chr61405 --1273 11847
NM_003376chr61405 --1273 11847
NM_003379chr631092 746 412 1915 ----
NM_003383chr92577 426 --1167 --
NM_003384chr144293 146 81 50 1351 ----
NM_003385chr22931 811 ------
NM_003387chr2172837 2796 2735 2708 2647 2623 2514 2495 2414 1974 1959 1900 693 648 576 258 178 2734 559 1659 --
NM_003390chr113990 155 87 1126 ----
NM_003392chr3104232 4175 4100 3921 1174 864 815 539 225 128 54279 3998 3514 2879 1191 94351 4332 3908 3383 3147 3086 2899 99 92 23894 2861
NM_003400chr26843 796 659 338 261 183 1236 --1604
NM_003403chr142704 528 ------
NM_003404chr2061859 1255 765 350 261 117 --11474 11425
NM_003406chr841819 1390 787 416 1242 41866 1234 637 274 --
NM_003407chr19--1688 2670 572 --
NM_003409chr1851434 1421 1102 269 157 1319 21388 87 1149
NM_003410chrX83022 2197 1100 905 712 515 394 142 32842 2425 670 33074 2538 606 32115 1083 235
NM_003411chrY131750 1634 1615 1556 1539 1243 1236 686 471 458 354 137 55 31854 1494 633 --1659
NM_003412chr392992 2932 2904 2455 2414 2225 2207 693 591 13080 42788 828 649 205 --
NM_003413chrX81751 1648 1316 728 713 590 451 218 149 3518 483 241 11567
NM_003418chr33624 222 51 --1738 --
NM_003427chr61673 ------
NM_003430chr1961509 1462 1360 1200 583 567 11423 --51664 1623 1429 1175 1151
NM_003431chr13627 464 178 ------
NM_003432chr5------123
NM_003439chr773075 2692 2217 1406 1354 1226 414 --32594 2203 1363 --
NM_003442chr111159 4903 701 328 123 2846 832 --
NM_003452chr91862 ------
NM_003453chr133646 301 258 ------
NM_003454chr1651524 1353 1211 536 217 ----31452 1433 1414
NM_003457chr173542 190 149 ------
NM_003463chr6112995 2957 2302 2243 1315 1048 973 914 873 593 559 --53030 2817 2288 954 853 2787 382
NM_003467chr24171 115 61 42 ------
NM_003468chr2114007 3828 3404 3347 3306 3036 2992 1565 1467 307 204 14269 44319 1116 482 259 --
NM_003469chr22360 26 ------
NM_003471chr3122333 1904 1688 1563 1549 911 904 878 646 577 439 203 12165 2567 345 --
NM_003472chr641389 519 419 249 2949 197 2961 579 41105 588 343 237
NM_003473chr1041059 712 427 168 2954 755 ----
NM_003477chr111564 1246 ----
NM_003478chr11153350 3317 3298 3168 2913 2809 2783 2113 1174 1158 995 987 661 616 149 42746 2479 2085 260 43330 2866 2201 333 --
NM_003482chr1252564 2431 1975 1819 699 12306 ----
NM_003483chr12122847 2703 2552 2139 2088 2030 2003 1986 1976 661 586 536 52610 2488 2155 580 275 42628 1907 1819 1178 --
NM_003488chr172875 696 ------
NM_003489chr21203408 3202 3191 3144 3118 2801 2673 2533 2127 1261 1169 844 728 719 711 523 516 355 166 111 43347 3164 2113 395 22273 366 1556
NM_001040284chr16205825 5282 4758 4543 4412 4337 4173 3743 1982 1930 1862 1776 1697 1506 1347 1259 1185 785 741 599 45504 4615 1912 1623 55133 1208 821 562 473 --
NM_001040402chr4102794 2094 1234 1138 1043 831 765 512 388 193 12124 43009 2825 1183 654 11222
NM_001040409chr25952 940 777 757 745 --3912 879 818 181
NM_001040424chr2131812 1029 488 --12129 11965
NM_001040429chr1382608 2390 2274 2219 2190 1091 1021 113 42871 2843 1386 123 23585 2442 --
NM_001040432chr32450 142 1162 ----
NM_001040440chr54555 530 508 492 --1449 --
NM_001040441chr1225428 4915 4843 4383 4326 4201 4165 3649 3529 3346 2117 1593 1579 1554 1158 814 683 346 329 275 255 140 1602 ----
NM_001040446chr592690 2630 2506 2364 2309 2220 988 516 343 12446 42684 2298 2134 160 --
NM_001040450chr1552681 2612 2556 2519 160 --12222 --
NM_001040453chr1552681 2612 2556 2519 160 --12222 --
NM_001040458chr551747 1731 1429 124 62 11608 21823 105 --
NM_001040624chr852319 2036 942 373 70 1249 2617 267 --
NM_001040625chr852319 2036 942 373 70 1249 2617 267 --
NM_001040626chr852319 2036 942 373 70 1249 2617 267 --
NM_001040627chr852319 2036 942 373 70 1249 2617 267 --
NM_001040628chr852319 2036 942 373 70 1249 2617 267 --
NM_001040629chr852319 2036 942 373 70 1249 2617 267 --
NM_001040630chr852319 2036 942 373 70 1249 2617 267 --
NM_001040633chr71680 --2834 279 --
NM_001040665chr7165029 4828 3996 3755 3618 3480 3409 3367 3268 1595 1509 950 446 383 266 194 54738 3472 3065 1804 357 44594 4209 3148 1051 155
NM_001040666chr72731 530 --1296 --
NM_001040697chr111615 1589 --1106
NM_001040708chr851072 937 461 301 124 2957 810 1363 1159
NM_001040712chr9143518 3200 3188 2920 2793 2345 2201 1055 912 835 720 624 561 414 127 33512 3169 2709 13217
NM_001040875chr8102645 2420 2282 2174 2096 1747 823 501 454 177 22383 1673 22551 105 11886
NM_001040876chr481904 1688 733 674 416 343 188 58 --11438 31526 605 575
NM_001041chr31134 2333 315 1357 --
NM_001042355chr16175347 5203 4963 4216 4180 4063 3843 3351 1853 1806 1448 1424 1417 911 768 661 396 45421 4849 1331 754 31316 292 159 25232 4883
NM_001042357chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042358chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042360chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042361chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042363chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042364chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042365chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042383chr353450 2838 1306 1171 237 --1153 --
NM_001042387chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042389chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042390chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042392chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042393chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042395chr1061489 1292 1131 961 131 110 1438 1482 --
NM_001042396chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042397chr1061520 1323 1162 992 162 141 1469 1513 --
NM_001042403chr126688 385 344 207 134 82 --3853 182 47 1248
NM_001042404chr151972 1675 1459 789 779 21998 1364 31946 1548 145 11910
NM_001042406chr641098 962 918 273 --2949 937 --
NM_001042412chr16175347 5203 4963 4216 4180 4063 3843 3351 1853 1806 1448 1424 1417 911 768 661 396 45421 4849 1331 754 31316 292 159 25232 4883
NM_001042413chr9103990 3711 3646 3420 3305 3251 2602 1450 682 649 24136 3293 33341 2643 1440 --
NM_001042422chr17167 ------
NM_001042423chr17167 ------
NM_001042424chr473287 3156 2850 2250 827 534 367 22214 849 53261 2181 865 813 301 --
NM_001042425chr661729 1545 1383 1249 1095 388 1528 21438 1420 --
NM_001042437chr25989 917 718 160 92 2283 120 ----
NM_001042440chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042441chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042442chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042443chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042444chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042445chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042446chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001042453chrX71506 1481 403 375 188 174 147 1205 11605 21467 259
NM_001042459chr32311 103 --2345 37 --
NM_001042473chr1062106 2027 1860 821 779 157 11527 52150 1683 1659 344 109 31765 1390 394
NM_001042475chr61106 ------
NM_001042481chr1472630 2175 2164 1867 819 390 347 --32687 2314 317 11856
NM_001042486chr202239 159 --11193 11039
NM_001042492chr17103128 3026 2460 2373 2132 1102 612 501 431 199 2790 281 43134 878 761 213 11034
NM_001042493chr661673 1598 1369 734 591 332 --31912 573 216 21355 434
NM_001042506chrX2893 172 1448 41388 1336 579 469 --
NM_001042510chr891651 1514 1505 1486 1390 1368 869 305 240 1134 180 --
NM_001042511chr891651 1514 1505 1486 1390 1368 869 305 240 1134 180 --
NM_001042517chr133818 810 281 1359 3747 678 159 2373 82
NM_001042537chrX92435 1972 1921 1001 909 896 449 363 234 12301 32471 2317 2233 --
NM_001042543chr471522 1398 1201 994 431 340 149 21189 551 21388 1339 11352
NM_001042548chr25892 853 774 699 190 1633 ----
NM_001042552chr111334 --2376 205 21020 547
NM_001042555chr12174729 4423 4404 4244 3862 3736 3559 3465 1808 1563 1555 973 880 600 484 345 113 74532 4221 4062 3856 1774 337 282 34390 3149 1068 24367 1159
NM_001042573chr1732050 2013 1823 ------
NM_001042599chr2317768 7686 7664 7570 7540 7492 7485 7271 7029 6621 6577 6416 5971 5952 5917 5646 5241 5015 2887 2662 2469 2080 1569 1538 991 887 877 793 768 639 313 32763 1777 1188 66142 5892 5138 2974 836 698 47856 7561 7217 6304
NM_001042601chr3113253 3241 3175 2948 2304 1284 1258 1172 753 572 303 53266 3213 3124 2236 594 2603 469 32882 1041 870
NM_001042603chr12125369 5189 4766 4704 3731 3626 3572 1691 1623 1315 962 343 11121 74007 1971 1405 1302 1197 1150 881 13874
NM_001042604chr3264671 4622 4594 4575 4449 4413 4384 4105 3658 3342 3276 3153 3032 1726 1523 1513 1128 855 844 705 603 533 384 150 123 95 34650 3400 133 44748 3999 3041 1241 33406 1216 1035
NM_001042618chr14182 ------
NM_001042646chr341771 1615 1364 531 11338 1758 --
NM_001042669chr471902 1526 1498 505 400 336 278 --31556 646 373 31551 611 417
NM_001042681chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042682chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042682chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_001042683chr661870 732 715 679 488 456 --31354 300 238 11428
NM_001042749chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042750chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042751chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_001042762chr741126 287 229 176 1695 151 189
NM_001043318chr14103890 3856 3766 3622 3162 3031 2596 1246 701 573 11587 54126 4051 4040 2782 1621 13692
NM_001043351chr171569 1561 906 774 396 382 116 --42068 1407 643 636 --
NM_001044385chr2143684 3160 3122 3036 3020 2998 2974 2676 1510 579 405 262 103 49 14041 --22515 68
NM_001044387chr1984101 3462 3410 2789 2543 1391 616 157 21402 1331 11447 12799
NM_001044388chr1984101 3462 3410 2789 2543 1391 616 157 21402 1331 11447 12799
NM_001044722chr5132260 2074 1828 1700 1606 1564 1524 810 675 490 231 128 91 12250 22129 1577 42143 1820 1474 731
NM_001044723chr5132260 2074 1828 1700 1606 1564 1524 810 675 490 231 128 91 12250 22129 1577 42143 1820 1474 731
NM_001046chr5153002 2928 2799 2625 2610 2487 2463 2024 2004 1842 1150 1141 889 290 106 22228 869 32965 2849 1179 --
NM_001048183chr1113797 3544 3408 3387 3099 2597 1104 1031 651 645 37 13807 1210 --
NM_001049chr1452293 2224 2030 1912 306 12370 ----
NM_001068chr3391 73 25 --1288 --
NM_001071775chr1361678 1523 1413 644 235 215 21836 501 1120 11855
NM_001076chr42165 143 1195 ----
NM_001076chr42165 143 1195 ----
NM_001077628chr12592 234 ------
NM_001078chr11705 ----1514
NM_001079874chr182133 2066 1987 1849 1652 1524 759 366 1550 ----
NM_001083620chr4112586 2550 2523 2439 2104 2050 1674 982 844 568 259 1588 22413 685 42564 1688 1618 560
NM_001083621chr164344 4288 4072 3238 1765 1051 24734 1384 ----
NM_001099678chr3156117 5869 5482 5055 2421 2039 1985 1587 1320 1196 1178 846 620 330 195 86380 5683 4618 4569 4480 2363 1309 952 46252 5537 1581 1071 26233 889
NM_001100108chr1158379 8317 8212 7869 5090 3106 3067 3053 2602 2423 1954 1307 1288 601 467 13350 65989 5747 5077 2326 1201 984 11602
NM_001101662chr1140 ------
NM_001105518chr13897 750 605 --3880 856 802 1289
NM_001106chr3229221 8571 8428 8144 7920 7836 7345 7255 6841 5909 3215 3146 1717 1620 1548 1531 1498 1333 892 528 131 119 37417 6103 2412 98655 7856 7034 6740 2547 2444 2391 1006 180 26806 6006
NM_001109977chr44768 678 655 97 --2844 264 --
NM_001111chr142450 880 167 93 --11806 22670 1785
NM_001113490chrX143682 2438 2301 2260 2232 1078 1023 1003 725 630 566 341 179 127 --33424 3128 2966 144
NM_001115chr8179 ------
NM_001116chr1672596 2577 1958 1926 437 399 75 2365 333 1373 --
NM_001117chr1852524 2408 639 197 141 --32321 1750 395 1426
NM_001121chr1091940 1823 1722 1642 1202 618 508 453 389 21282 346 41768 1711 660 414 --
NM_001122631chr111478 ------
NM_001123chr105835 679 339 287 99 1268 ----
NM_001124chr112569 480 --1509 --
NM_001126chr131047 1013 962 --1754 2409 313
NM_001128chr16123555 3459 3401 3235 3132 3093 2846 2678 1353 1197 698 222 23048 475 33880 3217 1381 --
NM_001135chr15195 --2822 346 --
NM_001144chr1641379 1241 921 178 11303 11128 --
NM_001146chr891988 1897 1559 1531 1519 924 693 621 305 --11803 --
NM_001148chr462055 1920 1852 1383 396 311 ------
NM_001149chr1031009 955 139 11286 1421 --
NM_001151chr41192 ------
NM_001152chrX----1203 --
NM_001153chr29820 374 344 324 282 275 182 62 48 --1839 --
NM_001156chr102426 181 --1592 --
NM_001159chr21805 --1134 1711
NM_001160chr12142831 2788 2721 2036 1896 1725 738 605 483 341 164 82 40 31 11039 32680 1759 404 1747
NM_001167chrX266703 6560 6541 6461 6435 6391 6356 5771 5643 4601 2664 2591 2526 2456 2019 1846 1810 1758 1263 1054 911 864 572 330 203 175 22354 900 76747 5779 1748 1574 884 839 551 25193 2030
NM_001172chr141152 ------
NM_001173chr14244745 4691 4658 4444 4302 4026 3728 3501 3459 3391 3357 3246 3092 1320 1173 1150 1057 905 829 822 813 478 384 319 54260 2984 1685 1162 208 64488 4474 3068 1856 1219 373 23215 999
NM_001177chr1292278 1637 1549 772 587 514 486 380 227 --1324 --
NM_001179chr41184 --184 --
NM_001186chr21193160 3147 3093 2969 2952 2929 2771 2626 2593 2412 2249 2094 2074 2053 976 891 771 418 406 11274 42673 2467 953 501 --
NM_001198chr6112445 2347 2341 2187 2064 1937 1890 1780 885 275 23 12206 72299 2144 1815 1596 728 458 345 --
NM_001200chr2061003 332 304 205 157 45 --11079 --
NM_001201chr4163557 3523 3386 3379 3278 3231 3068 3057 2972 2519 1497 1304 1195 1101 1081 670 23180 215 2654 309 43790 3724 878 51
NM_001204chr2367662 7576 7486 7198 7107 7070 6837 6765 6454 5829 5812 5799 5658 5548 5419 5383 5237 4798 4726 2566 2361 2330 2044 2021 1744 1601 1569 1549 1346 1336 901 678 594 213 134 86 76175 6077 5869 2532 2503 993 956 97492 7345 7289 5715 1611 907 616 297 34 46978 2082 1452 185
NM_001206chr9133126 3065 2672 2643 2284 2003 1989 1098 1030 890 838 760 559 2798 749 73037 2653 2584 1162 777 316 270 11051
NM_001207chr5284 55 --2272 72 1124
NM_001211chr152337 144 --3290 278 127 --
NM_001219chr742117 1531 813 101 11904 32228 270 262 143
NM_001222chr1021895 1462 ------
NM_001233chr792247 2053 1768 931 915 873 839 625 266 22262 674 32287 415 171 --
NM_001235chr113691 673 574 ------
NM_001241chr2102404 2180 1776 1615 715 669 591 458 232 122 11755 31628 443 133 11965
NM_001241chr2102404 2180 1776 1615 715 669 591 458 232 122 11755 31628 443 133 11965
NM_001253chr62245 126 ------
NM_001254chr1741082 1052 909 73 --1342 1187
NM_001256chr17112898 2631 2295 2179 2121 2100 2011 1064 973 638 311 42625 2391 1129 885 52551 2414 2106 1823 372 --
NM_001257chr1671530 1398 1315 1265 1230 543 137 --1286 --
NM_001259chr7266356 5753 5584 5472 5324 5200 4961 4749 4046 2400 2292 2236 2082 1949 1735 1596 1430 1401 1213 1079 962 826 792 767 702 298 65050 4720 4682 4266 2444 1417 115905 5782 5348 5118 4589 4300 4181 2462 1329 481 395 --
NM_001260chr131282 ------
NM_001265chr132939 220 1200 1205 --
NM_001269chr12927 909 --11014 --
NM_001270chr55981 937 825 730 32 11102 1221 1175
NM_001271chr1543051 2405 1274 680 23288 3118 23250 52 --
NM_001273chr122593 366 ------
NM_001282chr173526 320 286 --2587 417 1910
NM_001284chr56580 537 524 451 220 102 ------
NM_001286chr142067 937 360 195 --12813 12838
NM_001288chr6--1187 ----
NM_001289chrX3402 173 139 1498 --2622 192
NM_001290chr491061 1050 974 918 882 761 426 407 101 1692 1434 --
NM_001298chr251274 1023 984 340 172 --21084 308 --
NM_001304chr1783861 3585 3188 2779 2714 1160 314 239 53727 3475 2796 1185 527 53558 3123 1343 463 350 13325
NM_001310chr12122994 2955 2656 2550 2484 2449 2287 1948 1938 903 326 174 --1303 41910 773 597 490
NM_001313chr4--2898 855 ----
NM_001315chr662220 2044 1586 1579 1571 1396 --22304 369 --
NM_001326chr111322 ------
NM_001328chr42767 721 ----1496
NM_001330chr163980 317 305 --1136 --
NM_001331chr11122827 2683 2434 2328 2268 2193 1952 1935 822 441 259 223 1465 32766 522 46 22094 41
NM_001332chr551384 1055 609 273 156 ------
NM_001338chr212969 152 1385 21068 867 2397 143
NM_001343chr551697 1684 1639 1577 1098 --21206 167 --
NM_001349chr21125 1225 2414 186 --
NM_001351chr351707 682 599 332 261 2483 469 ----
NM_001356chrX102521 2318 1641 1557 964 878 517 339 333 132 11956 21825 1772 --
NM_001357chr11270 --1227 --
NM_001363chrX2780 135 1687 --1641
NM_001364chr11144798 4364 4193 3754 3434 3363 1611 1357 1085 1040 1023 775 661 352 23788 81 53809 3096 1584 1472 997 --
NM_001365chr173643 618 576 --1778 --
NM_001378chr21195 ----1348
NM_001380chr1031083 906 795 2955 860 21006 127 --
NM_001386chr882133 2045 1963 1855 1709 808 791 753 11875 32341 1910 1730 --
NM_001390chr1893623 3586 3510 3111 2638 1400 1234 537 225 23400 3327 33332 2692 799 13167
NM_001391chr1851205 1188 1181 281 153 11095 146 --
NM_001396chr21112450 2311 2175 2143 2112 1997 1826 1072 974 890 137 --52666 1128 1116 1109 902 --
NM_001400chr1121378 1322 1164 1137 1060 1019 989 929 864 506 499 236 11357 11009 --
NM_001401chr921459 496 1304 21367 1017 2475 398
NM_001407chr341203 1150 1074 268 1215 31066 491 260 --
NM_001412chrX123626 3551 2900 2888 2693 2454 1343 1110 1092 875 719 552 21318 831 42947 794 285 140 1512
NM_001415chrX71816 1412 801 791 455 305 75 --31822 1547 1245 11421
NM_001416chr172131 107 1447 ----
NM_001417chr1251399 1198 680 233 153 11631 121 11388
NM_001418chr111199 ------
NM_001418chr111199 ------
NM_001419chr19164882 4600 4537 4357 4346 4222 4093 4004 3933 3743 1231 960 887 466 307 60 24339 1381 94744 4566 4418 4208 3871 3508 1171 1144 990 --
NM_001420chr1922431 703 23140 636 33169 2088 601 --
NM_001422chr1131360 472 263 ------
NM_001423chr1252030 1621 1444 1425 208 --21916 1549 --
NM_001427chr742085 1457 380 324 --21495 197 --
NM_001429chr228899 784 711 412 403 75 56 39 --2337 204 1797
NM_001430chr282003 1737 1569 767 679 640 445 246 ----1191
NM_001431chr671211 1131 916 850 298 212 55 ----1319
NM_001432chr4133655 3634 3623 3544 3429 3402 3345 2656 2541 2502 1355 943 116 43873 3311 3256 1168 103882 3176 2757 2664 1317 1249 1137 849 155 144 2863 222
NM_001438chr1143686 3557 3285 3196 2855 2674 2366 2357 2322 1074 1052 886 315 191 32244 1016 543 43497 3247 798 244 --
NM_001439chr121547 502 --51503 584 365 164 71 1579
NM_001440chr822785 759 --1438 --
NM_001448chrX61709 1551 1276 700 512 60 --185 11657
NM_001451chr1651378 1183 1062 969 74 2931 383 41287 467 460 433 1428
NM_001452chr64716 702 647 601 ----2683 614
NM_001453chr661470 1355 1191 412 349 191 --41385 1301 605 335 1518
NM_001463chr21332 --1595 --
NM_001465chr551923 1635 1518 1343 856 1823 11353 11649
NM_001482chr155970 706 367 101 75 --1155 1955
NM_001483chr73918 807 762 31047 706 396 2893 720 --
NM_001490chr9103440 3004 2559 2533 1250 828 756 499 399 374 33597 2383 1289 21391 608 11494
NM_001491chr652620 1095 609 544 74 2950 883 11734 --
NM_001495chr81797 --21119 28 --
NM_001497chr992676 2142 2083 1923 1859 909 727 352 167 192 22762 827 1868
NM_001498chr651274 980 408 365 218 1262 1201 --
NM_001518chr741103 326 287 48 --1148 1129
NM_001527chr6154785 4415 4220 3865 1431 1408 1348 1277 1234 937 300 212 133 121 100 33369 3361 3075 54053 1611 1596 1451 1283 11606
NM_001530chr1461091 1030 865 435 344 71 1396 1286 1322
NM_001533chr192254 64 1229 ----
NM_001535chr21------1609
NM_001542chr172427 2389 2364 2150 1860 983 530 --12377 1841
NM_001543chr554015 3714 1624 946 938 14599 11054 --
NM_001546chr641240 579 382 360 21454 294 21381 426 --
NM_001550chr74660 645 106 25 2456 439 140 1432
NM_001557chr221258 1217 11355 11308 --
NM_001558chr1131551 586 108 1487 122 --
NM_001560chrX72596 2479 2137 2064 1044 877 327 12182 11631 --
NM_001564chr41143 1103 ----
NM_001570chr351435 1202 978 485 468 1183 ----
NM_001584chr1181241 1146 1136 413 321 311 155 53 --1766 --
NM_001587chrX32257 421 217 ----1183
NM_001609chr10134361 4189 3683 3633 3624 3527 3017 2880 1091 882 736 433 117 2725 206 34398 1069 234 1283
NM_001616chr2123343 3127 2742 2655 2573 2310 1270 953 569 397 237 82 22224 2174 53415 3165 3149 895 379 11386
NM_001619chr1131046 88 38 150 ----
NM_001621chr7153008 2964 2954 2577 2523 2350 1970 1037 714 692 590 558 521 371 152 12273 22287 496 42652 2482 462 159
NM_001621chr7153008 2964 2954 2577 2523 2350 1970 1037 714 692 590 558 521 371 152 12273 22287 496 42652 2482 462 159
NM_001634chr651738 1511 607 89 60 21909 1644 ----
NM_001642chr1131349 1154 888 1432 11138 11191
NM_001650chr1883609 2912 2796 2546 1553 1333 1013 248 33910 1273 871 32975 1283 977 2898 217
NM_001655chr1162045 1412 871 660 527 519 21747 1647 22095 365 1331
NM_001656chr562009 1884 1315 590 520 154 22085 1776 41789 1463 1356 791 --
NM_001658chr161091 1003 410 235 163 41 --1989 --
NM_001659chr1232536 2056 1738 --22151 2027 --
NM_001660chr32700 130 --1682 --
NM_001661chr17--1309 2557 287 --
NM_001663chr1492256 2028 1924 1047 966 955 827 442 353 22066 1791 1393 22349 992
NM_001664chr361030 1009 741 718 334 311 ------
NM_001668chr131734 1687 692 1211 61914 1805 1786 1580 857 655 --
NM_001675chr22172 ------
NM_001677chr171000 820 801 402 368 326 122 1249 1932 --
NM_001679chr33701 643 578 2669 620 1530 1767
NM_001682chr12102848 2498 2265 2228 2173 1041 821 675 600 550 22251 813 62569 1797 912 471 191 145 --
NM_001683chr372699 1734 1725 1702 945 765 527 --1641 --
NM_001684chr1124165 2955 2642 2625 1541 1271 1252 1061 1030 481 82 31 1272 13844 1795
NM_001689chr252006 805 558 518 329 2712 279 ----
NM_001690chr372487 1808 1779 481 413 400 61 --42458 626 614 607 2795 602
NM_001695chr873922 3428 3296 3041 2709 855 720 1987 43866 2856 1356 1241 33991 1314 81
NM_001701chr941268 1034 472 241 11466 21567 437 --
NM_001702chr8----1548 --
NM_001703chr1151 ------
NM_001704chr64608 458 393 387 1488 ----
NM_001706chr32664 21 --1695 --
NM_001707chr71898 --1841 1920
NM_001709chr1172914 2760 2534 1005 931 514 308 12895 42652 1055 819 551 22297 460
NM_001714chr124574 493 429 422 ------
NM_001717chr1561377 1020 957 490 259 36 --1203 --
NM_001718chr631135 1100 999 11178 ----
NM_001722chr8----1244 --
NM_001726chr11111 1153 ----
NM_001730chr1341623 1585 1311 130 --11524 --
NM_001730chr1341623 1585 1311 130 --11524 --
NM_001731chr124914 899 794 51 1295 --1717
NM_001742chr771674 1382 1229 731 604 442 173 1436 31838 1600 1565 2382 376
NM_001743chr21185 --2507 454 --
NM_001745chr571200 1149 1073 461 230 133 113 1903 1745 1317
NM_001746chr5102868 2676 2657 2229 2130 2044 1099 703 422 266 42727 2618 2428 1107 42917 2785 2688 2288 --
NM_001748chr131151 1065 278 ----1286
NM_001750chr5122058 1954 1889 1483 1260 506 484 403 384 342 234 65 --11545 21655 1452
NM_001752chr111527 2601 409 1414 --
NM_001753chr7121833 1824 1558 1551 1501 1466 1442 1399 1302 615 222 35 1204 21643 187 21663 1601
NM_001754chr21173741 3726 3695 3661 3652 3603 3579 3568 3401 3342 1475 807 664 651 600 495 390 43250 1517 1031 731 23271 3255 31617 550 489
NM_001755chr16122300 2035 1910 1867 1832 1588 1476 1455 1441 429 308 241 --52256 2163 1399 500 438 --
NM_001759chr12175007 4973 4883 4716 4525 3775 3273 2039 1802 1775 1651 1579 1467 1409 906 649 349 11788 --34815 4809 4602
NM_001762chr73696 241 72 --1752 1175
NM_001769chr123337 155 56 ------
NM_001777chr3124130 3993 3783 3739 3321 3291 3272 2792 2691 2609 1470 863 34156 1442 1236 33914 3261 2917 54069 1364 1228 679 253
NM_001788chr73879 684 658 --2967 138 --
NM_001789chr32494 462 1566 1468 --
NM_001791chr151362 1267 1255 887 265 11288 1238 --
NM_001792chr185917 903 894 382 335 21079 888 1911 1403
NM_001795chr1621502 1360 --11578 --
NM_001797chr165817 767 745 680 570 1644 179 --
NM_001801chr52427 30 1223 1479 --
NM_001802chr163894 624 118 --1995 --
NM_001804chr52863 806 ------
NM_001806chr1962785 2714 2358 2349 2126 126 12261 12933 1966
NM_001812chr4------1232
NM_001822chr22583 541 1710 2739 672 --
NM_001830chrX103844 3733 3618 3471 2777 915 767 491 119 21 23410 331 2975 834 14037
NM_001839chr1--3511 307 77 2773 756 1118
NM_001842chr92576 84 ------
NM_001843chr12--2219 198 ----
NM_001844chr122144 57 --1395 --
NM_001845chr1351070 931 897 254 230 11313 ----
NM_001851chr64713 634 612 593 ------
NM_001854chr151301 1241 1218 1077 386 --21475 1101 --
NM_001855chr95896 853 605 573 37 ----1591
NM_001858chr6195107 4948 4857 4848 4193 3975 3715 3532 3519 3508 3151 2008 1764 1733 1720 453 219 191 183 54430 3309 1926 517 238 74097 3906 3756 2031 1463 498 94 14965
NM_001859chr994004 2923 2605 1323 1308 1138 1079 818 319 1360 --31565 1531 1054
NM_001860chr921049 402 ----11216
NM_001870chr31253 ------
NM_001873chr42514 23 --1108 --
NM_001874chr12154980 4804 4555 4534 4270 4167 4075 4019 3439 3240 3223 3197 1839 1227 975 --14733 --
NM_001875chr271065 868 724 357 337 279 120 11099 2286 240 21057 374
NM_001880chr22240 106 1294 1209 --
NM_001882chr53439 174 167 ------
NM_001884chr51542 ------
NM_001885chr11125 ------
NM_001891chr4----135 1317
NM_001892chr571551 1241 1086 1017 361 327 256 11452 11256 --
NM_001894chr2251225 1141 1132 1031 49 --21201 1042 --
NM_001896chr162426 41 ------
NM_001901chr63986 697 64 1903 21080 683 --
NM_001902chr13398 341 307 ------
NM_001903chr52915 657 --2615 214 1182
NM_001904chr32246 145 21093 742 --153
NM_001918chr1249197 8471 8382 8194 7668 7214 7068 6910 6888 6752 6638 6139 3554 3468 2341 2262 1272 1093 1025 972 964 714 160 27 79018 8834 8238 7510 7337 6116 2277 49241 6530 6440 644 27077 1609
NM_001920chr122499 307 2483 24 ----
NM_001921chr441211 1195 1027 197 11113 ----
NM_001924chr14516 482 430 420 --1356 --
NM_001931chr1151203 1176 1048 465 93 2217 160 11194 1108
NM_001935chr241032 914 872 46 ----1739
NM_001938chr191884 1839 1792 1753 1746 1716 1496 1307 627 2740 229 ----
NM_001942chr1871853 1822 1598 1344 487 195 21 11707 21451 331 --
NM_001944chr1842301 1699 1618 965 --1291 --
NM_001946chr1251184 982 782 769 78 --1827 --
NM_001949chr6163274 2826 2781 2766 2757 2746 2453 2374 2319 2235 2176 2086 879 818 225 160 23153 812 140 --
NM_001950chr161639 --1730 1723
NM_001954chr62757 728 1780 ----
NM_001955chr651072 888 806 731 210 --21115 945 11035
NM_001957chr482097 1909 1417 745 730 609 434 134 2476 343 5751 629 506 420 304 --
NM_001962chr51120 ------
NM_001963chr43714 303 261 --2580 156 1612
NM_001964chr531099 1086 1056 --1978 --
NM_001966chr331377 1264 1099 ----1292
NM_001967chr31430 ------
NM_001968chr45869 842 668 358 180 ------
NM_001969chr14102833 2784 2448 1163 1036 886 878 799 779 357 33813 3745 2487 31186 1019 937 --
NM_001973chr13333 285 118 ------
NM_001977chr441532 502 445 272 1391 --1114
NM_001980chr1252263 2154 528 362 345 41537 859 778 674 11967 11394
NM_001981chr1102060 1730 1566 961 954 906 543 281 263 145 31933 658 496 21721 914 --
NM_001987chr1274340 3667 3113 1707 1462 1169 755 14302 41442 1329 1071 428 1573
NM_001993chr171119 1030 889 747 366 355 266 2233 58 --1950
NM_001994chr1--1181 ----
NM_001995chr421438 1176 1924 ----
NM_001999chr571540 1520 1383 1187 1078 356 314 --3508 493 221 1401
NM_002006chr4185693 5599 5416 4787 4622 4329 3789 3633 1824 1551 1331 1089 1032 1004 610 268 124 51 95198 5146 4380 3824 2335 2231 1365 875 287 85791 5393 5279 4577 4034 1580 1396 1384 --
NM_002009chr1552502 2276 919 497 284 1856 2888 94 22302 1013
NM_002011chr5----1440 --
NM_002014chr121271 --1111 --
NM_002015chr13143342 2731 2647 2590 2541 1120 832 781 750 691 629 463 322 178 --1678 --
NM_002017chr1161329 1177 854 164 145 47 --1963 11286
NM_002024chrX102096 1751 1389 804 681 662 476 466 260 141 --31430 691 148 21831 220
NM_002025chrX269146 9070 8370 8168 8078 7905 7501 7412 7293 7047 6965 6613 5992 5726 3028 1882 1458 1330 1177 1125 983 698 658 465 263 209 59320 6002 2981 1283 972 47815 7462 6146 1288 23192 2963
NM_002031chr62642 563 1333 1253 --
NM_002033chr11134137 4061 3820 3469 3373 3136 3032 2913 2688 2526 845 117 50 12827 1191 33959 3064 2698
NM_002035chr18153967 3957 3930 3901 3867 3704 3541 2946 1067 1011 732 710 534 365 73 23673 1092 63600 2926 2669 2660 1167 955 11230
NM_002037chr63434 396 316 ------
NM_002040chr21163151 3122 3036 2538 2437 2417 2295 2132 2085 950 707 420 408 183 170 126 13049 62806 2702 2215 1969 1044 375 23160 2063
NM_002041chr15----191 --
NM_002044chr1531199 620 133 --11576 --
NM_002048chr951197 1169 971 833 130 2987 479 11324 21267 1020
NM_002051chr1051168 836 818 792 66 ------
NM_002056chr25861 777 710 258 159 --1835 --
NM_002061chr141871 555 316 201 --3452 352 262 21538 274
NM_002063chrX31269 810 518 --21195 843 --
NM_002065chr14446 422 229 147 11165 11294 1661
NM_002069chr73681 673 564 21903 460 11169 1320
NM_002072chr941014 933 910 266 1983 ----
NM_002076chr1283264 2766 2606 1082 1013 720 555 357 --33023 2188 1215 --
NM_002077chr942135 498 107 42 1472 1745 --
NM_002082chr5--11000 ----
NM_002086chr1732123 1553 553 ------
NM_002090chr42200 192 1513 3446 437 177 --
NM_002092chr4174762 4317 4103 4031 3927 3920 3913 3700 3210 1146 1030 1023 917 739 447 380 227 34111 3838 558 23706 890 34326 3448 336
NM_002094chr163314 111 80 --2353 322 --
NM_002107chr11336 2392 203 2427 95 --
NM_002114chr63168 128 84 --125 --
NM_002126chr17134179 2942 1663 1625 1490 1202 1120 1087 1031 1018 787 556 545 --31463 1260 1106 --
NM_002128chr13122391 2238 2212 2002 1839 1744 954 872 596 496 455 195 22328 1769 22344 527 --
NM_002129chr42121 57 ----1160
NM_002130chr551597 1434 1285 393 369 21129 121 11548 --
NM_002133chr221576 1382 2474 428 --
NM_002135chr122509 484 ------
NM_002136chr122262 203 ------
NM_002137chr772354 2195 1571 542 536 377 266 12324 32225 1884 958 --
NM_002138chr44616 196 114 48 1789 1656 --
NM_002140chr92748 349 1478 2781 290 1946
NM_002145chr172379 292 ------
NM_002146chr1741221 1091 943 428 --21401 1162 1172
NM_002148chr22448 135 --1264 --
NM_002158chr2183852 3574 3377 3356 3015 2964 2784 2349 1522 1492 1210 749 502 479 472 354 221 127 2254 151 63435 3250 2948 2790 2741 421 23791 3552
NM_002163chr162245 117 --11259 21145 482
NM_002166chr23679 658 579 2687 229 188 --
NM_002167chr11466 1503 ----
NM_002182chr3142799 2752 2737 2703 2680 2465 2371 2204 1941 951 859 718 668 482 --42745 2028 2006 1020 1425
NM_002193chr21218 1525 21401 153 21517 1453
NM_002194chr2----1128 --
NM_002196chr2051139 1058 834 697 329 2937 208 --11027
NM_002196chr2051139 1058 834 697 329 2937 208 --11027
NM_002199chr47930 807 781 652 353 91 65 21035 964 2789 71 --
NM_002201chr151109 186 ----
NM_002202chr55944 925 855 769 718 --122 --
NM_002203chr5114106 3874 3851 3788 3328 2557 1530 1165 456 224 127 34173 3016 331 33103 1517 92 --
NM_002207chr3195 --1682 1313
NM_002210chr2112764 2692 2483 2457 2208 2185 974 657 593 508 291 42427 2332 874 669 53266 1442 1301 993 466 21236 572
NM_002211chr1071122 1005 895 838 805 760 154 2379 137 1910 1815
NM_002214chr7115531 5334 5248 5160 4355 4057 3520 1329 1153 1016 183 55239 5052 4490 4439 3998 55641 4834 4639 613 566 35392 4448 1338
NM_002222chr321340 311 11116 1913 --
NM_002223chr12103089 2934 2895 2455 1595 1443 1087 607 598 441 22818 1435 12953 12728
NM_002226chr144899 729 141 99 --1224 --
NM_002227chr12336 72 --21172 382 --
NM_002232chr111108 11240 ----
NM_002234chr122671 624 ----2765 199
NM_002235chr1261449 1426 1140 615 352 211 11730 ----
NM_002239chr2198 1811 ----
NM_002240chr212550 89 1118 ----
NM_002242chr262009 1563 1452 735 705 462 1537 156 --
NM_002245chr11621 175 1474 --
NM_002247chr1072356 1940 1520 1500 841 621 397 31799 918 161 21953 827 --
NM_002252chr2----1168 --
NM_002253chr451416 1192 1122 1039 524 11164 ----
NM_002264chr3164875 4296 3756 3579 3477 3267 3238 3159 3089 1968 1703 1496 1070 756 643 517 43678 3558 3449 1762 41954 1049 1016 472 14523
NM_002266chr17148 ------
NM_002267chr1361927 1806 955 797 711 463 22315 1705 32355 692 251 --
NM_002268chr331762 1705 1435 --11797 11468
NM_002270chr5235594 5544 5095 4833 4623 4035 3901 3812 3741 3704 3645 3630 3489 2228 2183 1918 1858 1811 1679 1595 1484 1226 451 35162 4707 1966 44302 1662 1606 848 22247 1054
NM_002271chr1352161 1642 1576 791 295 12106 32332 740 242 --
NM_002285chr283989 3926 3383 2885 1654 1559 1142 495 13214 32896 581 527 13914
NM_002293chr192767 2627 2544 2516 1731 876 704 667 86 12744 42615 2452 2433 2407 1578
NM_002296chr171619 1555 1313 1282 667 653 369 11241 41561 1084 336 111 --
NM_002298chr1341409 515 290 269 --21504 1038 --
NM_002310chr5216621 6156 6048 6009 5881 5659 5637 5493 5402 5235 5119 4921 4424 4404 4175 1967 1534 1385 1357 829 811 31101 735 541 45441 4674 2265 726 34652 4497 159
NM_002314chr7----3989 942 919 --
NM_002317chr53373 125 91 ------
NM_002332chr121733 ------
NM_002335chr11176 ------
NM_002336chr12175076 4984 4896 4793 4524 4159 4091 4050 3699 3576 1764 1212 1138 1055 788 714 184 14658 34815 1669 258 21727 1410
NM_002345chr125654 518 218 71 25 --2532 136 1482
NM_002349chr271444 1414 1308 1235 1138 1030 306 4521 473 384 319 61420 1162 526 512 375 112 --
NM_002350chr841250 1153 804 449 --11239 21012 790
NM_002351chrX81711 1541 476 360 270 223 164 25 21573 345 ----
NM_002355chr1271305 1283 495 424 254 181 118 --1131 --
NM_002356chr6102698 2549 1844 999 878 672 538 317 131 36 12445 3286 279 137 12276
NM_002358chr4--1102 1160 --
NM_002359chr1734306 3466 3281 --33506 3421 1284 --
NM_002360chr732302 2161 1901 --42634 2509 2497 2252 --
NM_002372chr52656 83 2544 40 ----
NM_002374chr2113428 3156 2625 2467 1402 1303 1219 1068 979 491 277 33376 1159 293 53222 2279 1230 1059 242 --
NM_002381chr23851 708 670 1314 11015 --
NM_002382chr1431343 449 277 2248 137 2202 107 1143
NM_002384chr181972 1993 1697 1985
NM_002387chr5205156 5088 5016 4827 4629 4350 3885 3841 3713 3476 3332 3226 3151 1988 1981 1971 1696 1630 1446 277 --24741 2076 11840
NM_002389chr1111979 1822 1771 1707 1545 763 580 531 440 390 310 --21628 700 131
NM_002395chr661235 1119 454 430 357 114 2284 59 2983 385 1490
NM_002397chr592062 1626 1604 1430 880 836 803 745 701 --22159 1734 1147
NM_002398chr231269 611 590 --31547 1346 1177 11128
NM_002399chr1531464 454 370 --3957 445 438 --
NM_002401chr1742074 805 401 383 ------
NM_002402chr741208 1010 321 209 --11084 --
NM_002408chr144703 337 317 97 --136 --
NM_002416chr442084 2036 791 47 ------
NM_002430chr2271685 669 473 462 417 335 276 --22521 2038 --
NM_002438chr102224 177 164 --1694
NM_002440chr12238 100 --155 --
NM_002442chr1251761 1659 1650 354 264 ----21523 256
NM_002444chrX31497 562 286 --11954 --
NM_002449chr541238 1014 411 325 2464 295 21071 357 --
NM_002451chr9113913 3237 2885 1293 1239 1220 1176 872 748 458 323 1838 31307 1268 1245 --
NM_002467chr83416 378 175 --1402 --
NM_002469chr121441 --1392 --
NM_002473chr2211153 --2965 364 --
NM_002480chr1281366 1095 545 470 462 421 258 144 21360 1341 2495 370 11035
NM_002481chr1177811 7404 6729 6568 6544 6515 5081 2960 2880 2836 2446 1815 1619 1311 1253 383 320 46868 6371 2407 575 46705 1670 709 580 17831
NM_002482chr12667 63 --155 --
NM_002486chr962186 2056 1614 643 376 84 --42538 1596 263 62 32308 533 157
NM_002487chr156642 593 578 258 236 229 1113 --1135
NM_002492chr32324 142 --173 --
NM_002499chr1562495 2445 866 766 648 398 1557 31810 660 562 12137
NM_002500chr24495 473 439 201 3522 464 348 2914 392 --
NM_002501chr1911245 ----12770
NM_002507chr1711740 ------
NM_002508chr162023 1897 1865 1790 790 140 11855 1598 --
NM_002515chr1451793 474 218 190 72 --11701 --
NM_002518chr221142 102 --2997 460 1471
NM_002519chr1161538 1313 1283 1264 1229 964 11155 --1194
NM_002520chr51310 ------
NM_002523chr731105 1052 780 --11111 --
NM_002524chr13915 445 404 1899 1246 --
NM_002525chr1140 ------
NM_002526chr651676 1664 1160 631 42 --41621 650 402 290 11484
NM_002527chr122257 35 ------
NM_002538chr56532 476 402 213 168 130 --1573 --
NM_002541chr71991 ------
NM_002544chr171310 ------
NM_002545chr1165028 4959 4080 3376 737 458 14758 15041 1158
NM_002546chr82578 234 --2815 601 2619 556
NM_002556chr1172170 2133 2108 1974 813 127 94 --21647 1634 11763
NM_002569chr1521476 49 --169 --
NM_002570chr1531148 1080 1059 11042 1378 1895
NM_002577chr3104075 4028 3886 3353 2923 1333 1063 579 423 297 2627 181 42652 2496 1561 457 43972 2975 2663 2491
NM_002581chr9135662 5639 5524 4859 4551 4219 4127 3726 2258 1655 1196 967 949 --85492 5355 4557 4155 3906 2016 1471 845 25543 3618
NM_002582chr162950 904 --1158 --
NM_002583chr122633 33 --1512 --
NM_002585chr11328 ------
NM_002586chr621189 639 ------
NM_002589chr4----1136 --
NM_002590chr131212 1186 ----
NM_002591chr202531 151 ----1561
NM_002592chr20--1247 1220 --
NM_002594chr20132379 2282 2141 2074 1675 1653 1584 884 759 629 348 318 152 --1963 --
NM_002595chr12101943 1614 1433 1372 1234 1213 780 439 270 190 --21524 707 --
NM_002600chr141687 1182 710 502 31867 1573 1300 21305 583 1704
NM_002605chr153965 921 411 ------
NM_002606chr21------1181
NM_002608chr22----21589 1568 --
NM_002610chr2162773 2685 2594 2454 2393 2308 2161 878 813 794 331 251 201 188 90 38 33070 679 572 13135 22377 225
NM_002612chr772113 1549 1390 1356 1349 832 356 11819 42129 1666 691 221 --
NM_002613chr16155349 5248 5239 5065 4724 4404 4391 4363 3994 3602 3379 3290 1961 1877 1302 1137 13348 15074
NM_002618chr22432 36 --147 1349
NM_002623chr205703 695 519 200 162 ----1171
NM_002628chr341047 944 105 92 1878 ----
NM_002631chr1190 ------
NM_002633chr12543 114 ------
NM_002635chr121444 171 ----
NM_002636chr62460 448 --1471 --
NM_002641chrX71662 1638 758 338 293 246 140 31518 1443 1312 41769 1651 1345 74 --
NM_002645chr11103040 2904 2685 2562 2479 2041 1120 660 322 205 22543 2470 21959 554 33081 2728 112
NM_002647chr181128 --1223 --
NM_002648chr61841 1816 11293 --
NM_002649chr781526 1393 1298 1219 1208 677 358 298 11156 ----
NM_002651chr12694 680 --1833 1688
NM_002655chr8194676 3780 3753 3688 3525 3488 3379 3319 1988 1607 1487 1245 1087 885 727 334 245 206 80 54597 3797 287 156 64 95091 4510 3876 3575 3385 3357 2007 1541 106 44964 4851 4563 313
NM_002656chr631112 1078 192 1951 122 1779
NM_002657chr2043869 3318 3285 798 --43782 3324 3129 251 1246
NM_002658chr102925 54 --1886 1875
NM_002667chr631223 1060 206 --21006 425 1362
NM_002670chr3101550 1472 1398 1239 1091 636 601 532 467 365 11191 21178 256 --
NM_002677chr872547 2496 1970 1019 993 653 29 --2980 103 13001
NM_002687chr1421121 304 1451 3393 359 164 --
NM_002699chr151534 1420 1343 1303 89 --21435 1232 11427
NM_002703chr471846 1808 1659 1601 659 299 138 21609 1257 31936 1696 576 --
NM_002706chr23608 517 471 --2574 23 1540
NM_002709chr2153563 3267 2996 2919 2844 2751 2597 2421 2403 1182 682 504 438 380 150 62858 1430 1171 732 455 270 --13628
NM_002710chr1241066 955 448 131 161 ----
NM_002713chr131078 1036 1023 2860 303 --1752
NM_002714chr631106 263 188 --11085 --
NM_002715chr51476 1417 1270 --
NM_002716chr1163141 2520 1414 916 449 261 13304 63342 2334 2242 1445 1380 989 1998
NM_002718chr352644 1885 1823 1080 37 1747 21722 85 --
NM_002719chr1462420 2102 1813 697 565 511 --21783 412 1789
NM_002720chr161223 ------
NM_002721chr92513 30 --182 --
NM_002725chr111776 ----13263
NM_002727chr107647 617 465 218 191 173 48 1103 ----
NM_002731chr1152714 2684 2667 2048 1940 1243 1222 1159 1012 986 930 863 503 389 323 --12134 12329
NM_002734chr1781919 1730 1681 1568 1482 545 352 66 21591 1417 32254 673 285 1143
NM_002736chr7111863 1768 1752 1670 1598 846 742 707 562 471 430 21913 1578 31949 733 571 11383
NM_002737chr17106286 6194 6047 5363 4690 2239 2043 1427 346 321 35737 4670 1582 106599 6383 5436 4982 2185 1972 1600 1468 816 695 14356
NM_002738chr1671149 923 878 793 431 304 253 169 ----
NM_002740chr392820 2643 2469 2384 1817 906 627 437 366 --22749 942 12036
NM_002742chr142180 92 --1732 --
NM_002745chr22144452 3582 3571 3341 3199 1689 1564 1528 1231 1076 678 292 276 166 43326 3147 660 160 23825 3273 23221 1522
NM_002748chr1561187 938 890 398 382 81 --2979 366 --
NM_002749chr17------1233
NM_002750chr102234 197 --1223 --
NM_002755chr154728 654 356 58 1159 ----
NM_002756chr173877 672 661 --2910 390 --
NM_002758chr171387 1492 1497 --
NM_002760chrY105652 5459 5428 5377 4780 4429 4324 4291 3695 1270 32285 1309 685 35101 1731 613 25910 608
NM_002765chrX41293 947 467 300 3863 259 68 ----
NM_002767chr172468 151 2419 193 1430 --
NM_002787chr73655 270 84 --1214 1450
NM_002788chr142100 27 ------
NM_002792chr20--130 1122 --
NM_002800chr6129 ------
NM_002809chr17--1354 ----
NM_002811chr163553 364 21 ------
NM_002812chr192427 362 ------
NM_002819chr1921271 1206 --1110 --
NM_002822chr1281853 1496 616 554 523 408 335 128 31290 510 51 2183 111 --
NM_002823chr23671 491 248 --3609 273 231 --
NM_002825chr73543 479 145 --1624 --
NM_002827chr2051410 712 475 414 233 11831 21802 192 --
NM_002828chr182983 621 --1866 --
NM_002833chr151274 --11514 --
NM_002835chr71190 --1127 1580
NM_002836chr20146 ------
NM_002837chr1274295 3210 3055 1602 1384 1224 187 23350 2961 54575 4301 1476 254 215 14007
NM_002838chr151013 930 338 201 136 11191 41089 769 344 56 1920
NM_002839chr9143518 3200 3188 2920 2793 2345 2201 1055 912 835 720 624 561 414 127 33512 3169 2709 13217
NM_002840chr13481 437 381 11535 ----
NM_002841chr33476 441 54 --2137 105 --
NM_002843chr11123435 3336 3263 2901 2356 1365 1339 731 386 337 299 243 11347 23398 572 21304 408
NM_002844chr641110 510 363 348 1119 1143 --
NM_002845chr184689 624 436 102 --1651 --
NM_002848chr1241222 362 106 86 --11017 1333
NM_002849chr123844 761 391 11053 ----
NM_002850chr1931173 786 487 1813 ----
NM_002851chr72695 551 1545 1255 --
NM_002858chr121356 1035 21322 340 ----
NM_002863chr14--154 ----
NM_002865chr8----1242 --
NM_002868chr1242324 908 338 152 --1381 --
NM_002869chr1161964 756 373 275 203 43 --1389 32130 2103 1915
NM_002874chr9142526 2477 2435 2231 1990 1831 840 710 695 618 453 341 282 242 --1810 --
NM_002881chr271422 1271 1260 1117 494 328 199 1426 ----
NM_002882chr22--1100 ----
NM_002886chr3135190 3955 3747 3601 3298 1727 1646 1322 1206 773 535 414 82 75165 3266 1851 1471 1453 1410 979 45223 5199 3355 823 11315
NM_002890chr54693 651 321 102 --3982 821 632 --
NM_002892chr1481653 1268 1176 1156 649 624 612 230 --3471 243 122 --
NM_002897chr25766 675 229 85 68 2728 271 1157 --
NM_002901chr113392 377 270 ------
NM_002902chr152653 88 --2564 62 --
NM_002906chr1182187 2116 2032 1629 1560 1460 730 248 22324 2170 31817 1742 906 --
NM_002907chr124379 154 124 103 --2313 61 --
NM_002912chr64786 709 677 633 --3609 74 35 --
NM_002922chr11473 ----1650
NM_002923chr11663 ----1650
NM_002924chr11197 --1129 1530
NM_002940chr481904 1688 733 674 416 343 188 58 --11438 31526 605 575
NM_002941chr341269 1137 620 266 --11171 11593
NM_002942chr321424 163 2420 405 ----
NM_002946chr14484 451 168 30 ------
NM_002955chr61351 11871 1269 11457
NM_002956chr1271423 1333 1268 934 476 400 136 1235 2350 104 --
NM_002957chr963411 3343 3333 2537 2519 366 13753 23498 1468 13213
NM_002958chr38658 264 247 233 183 153 138 73 1199 3634 367 360 1784
NM_002959chr1101489 1232 1207 1063 816 803 606 498 278 190 22926 1646 --1717
NM_002968chr1651109 962 349 246 205 ------
NM_002971chr331118 837 783 1921 ----
NM_002973chr12194 2531 511 ----
NM_002977chr2103238 2960 2786 2622 2376 1300 1201 929 537 507 1295 1176 --
NM_002979chr15900 864 690 319 194 --122 2608 591
NM_002982chr174338 288 76 42 --1368 --
NM_002993chr42226 132 11044 21049 712 --
NM_002994chr461958 1829 789 749 484 251 1464 21922 1631 21467 714
NM_002995chr13743 553 530 2824 761 --2131 125
NM_002998chr8122159 1915 1885 1795 1728 1699 1625 765 592 376 58 43 2561 271 21401 598 11816
NM_003001chr172224 1960 1749 1581 700 313 122 --1585 --
NM_003002chr115781 730 285 141 54 --1823 --
NM_003010chr1762350 957 900 781 543 498 --22226 721 --
NM_003011chr961562 1517 1475 1366 469 374 31160 646 233 ----
NM_003013chr43790 715 681 ----1265
NM_003016chr1742039 1537 1515 1292 11345 21589 607 --
NM_003017chr671411 1092 1005 888 573 256 222 31213 265 108 2904 374 --
NM_003022chrX21290 1177 21061 805 11223 21311 53
NM_003024chr21----1370 --
NM_003026chr931032 405 61 1964 1213 11099
NM_003027chr155406 356 143 114 29 ------
NM_003030chr341877 1505 782 519 --11855 --
NM_003031chr164890 851 675 660 1828 ----
NM_003034chr12268157 7921 7141 7009 6857 6690 5914 5720 5496 5432 5405 5344 5152 5120 5081 5039 2914 2651 2645 2430 2214 1789 1681 1629 204 152 32134 1081 792 47690 3210 473 39 46531 6079 5629 605
NM_003035chr13996 829 612 --2959 311 1736
NM_003036chr12926 289 1349 ----
NM_003043chr3144263 4210 4173 4103 4063 4032 3909 3800 1289 1173 302 281 210 102 24072 759 34281 4237 314 24054 363
NM_003046chr8155379 5359 5140 4415 4342 3873 2038 1786 1564 1350 1335 722 603 560 333 23452 1535 33490 1570 1302 25398 3865
NM_003048chr2132786 2598 2454 2253 2190 2178 2127 1932 1834 1726 959 805 490 1304 12764 12537
NM_003051chr181683 1651 1561 1527 1511 531 335 147 21258 253 21377 802 --
NM_003054chr102261 223 ------
NM_003060chr531333 1178 279 ------
NM_003068chr841059 728 708 380 ----1897
NM_003069chrX7576 558 503 297 287 278 186 --1663 --
NM_003070chr96855 770 618 572 537 251 ------
NM_003071chr391868 822 760 362 309 282 258 244 116 1808 3638 547 345 1172
NM_003072chr191368 ------
NM_003073chr221246 ------
NM_003074chr392215 2100 1602 1543 576 356 333 171 101 --1535 12030
NM_003079chr172126 93 11003 3717 650 34 --
NM_003087chr101235 ------
NM_003088chr7----21092 762 --
NM_003095chr123324 245 21 --1342 2354 256
NM_003099chr15146600 6335 5072 4753 2516 2497 2253 2234 2001 1563 914 379 213 185 16529 46392 2021 844 297 21577 1530
NM_003100chr52381 104 --1321 --
NM_003101chr171643 1615 558 549 489 419 206 11666 --21526 1048
NM_003105chr11141 ----1107
NM_003106chr371104 964 949 927 885 817 353 1228 1267 --
NM_003107chr692620 2455 2106 1728 1674 1653 1049 654 482 31988 1684 1647 11742 --
NM_003108chr2266807 6783 6479 6464 6347 6323 6229 6039 5666 5551 5239 4960 4915 4871 4553 2121 1467 1177 962 918 835 624 609 577 331 249 11376 117133 6662 5722 5424 5142 5002 4780 4740 975 783 542 56568 5864 5445 5109 2138
NM_003110chr1741093 1062 749 709 1965 1955 1994
NM_003111chr261183 1152 552 525 151 104 1430 41400 1164 1011 211 137
NM_003112chr7173257 2866 2781 2596 2376 2320 2281 2140 2079 1994 990 958 913 646 479 368 353 22042 1201 43022 2633 2476 1206 --
NM_003114chr86733 642 618 270 193 138 --2555 174 1782
NM_003115chr13425 407 118 2189 43 148 --
NM_003128chr272593 2466 1058 676 584 224 116 --11739 11100
NM_003131chr652307 1533 773 711 687 ----22082 758
NM_003133chr15753 400 150 126 84 --1201 --
NM_003137chr652018 1939 1557 772 520 32199 663 534 1796 --
NM_003144chr671931 1679 837 553 426 347 176 --32093 527 52 --
NM_003149chr311314 ------
NM_003150chr1752387 925 455 334 120 1166 --1205
NM_003155chr842744 2559 113 94 22682 1979 1851 12759
NM_003156chr1141260 1047 944 365 --11214 --
NM_003157chr31866 --2682 299 143
NM_003161chr1793101 2924 2702 2665 2306 1219 723 546 438 12858 83552 3346 2937 2695 2644 1191 1152 533 --
NM_003162chr221119 839 --21090 910 2800 755
NM_003168chr172840 671 --11062 --
NM_003171chr10155 ------
NM_003174chr103744 352 166 --2103 75 --
NM_003176chr12342 59 --1227 --
NM_003176chr12342 59 --1227 --
NM_003178chr351824 829 749 725 21 1779 31905 1837 488 11471
NM_003184chr841142 1001 950 696 11043 11024 11110
NM_003185chr20101282 1238 1206 1040 929 887 864 446 407 25 --31171 1005 413 11081
NM_003186chr11----1388 --
NM_003188chr65691 154 139 96 45 2757 713 ----
NM_003189chr193263 2145 1281 1203 1037 1022 808 670 170 22798 2487 32492 305 226 --
NM_003193chr1----1141 --
NM_003194chr6----1544 --
NM_003199chr18225545 5294 5094 5029 4404 4265 4195 4156 4129 4098 3904 3667 1922 1466 1334 1324 1227 778 743 709 688 104 14579 25270 4020 21952 1721
NM_003201chr105759 715 687 202 165 21004 655 2943 745 --
NM_003202chr541747 1355 1303 523 11877 21900 1843 --
NM_003203chr2142297 2264 2203 1949 1847 1806 1546 969 960 777 735 619 606 154 22231 1856 2805 788 1720
NM_003204chr1741732 1359 1329 1190 ----31752 1721 1561
NM_003206chr6----2425 402 --
NM_003211chr1281697 1507 1425 537 429 233 203 99 21752 288 31468 1337 1308 --
NM_003213chr121191 ------
NM_003216chr2223356 3004 11219 13089 --
NM_003217chr1281433 716 590 540 147 139 122 115 11880 11759 11856
NM_003220chr661729 1545 1383 1249 1095 388 1528 21438 1420 --
NM_003221chr6114122 3817 3635 3509 2892 1481 1464 1449 721 426 394 23493 1564 --1446
NM_003223chr164861 787 694 303 192 ----
NM_003242chr362308 1856 1840 1608 810 698 21945 249 21000 579 12436
NM_003244chr183462 399 76 --2302 86 --
NM_003246chr1561757 1739 1553 1471 1458 241 22006 1953 21989 1938 21855 1746
NM_003247chr631671 1417 788 11994 41843 1678 426 286 --
NM_003248chr52141 54 --128 --
NM_003253chr2181667 1599 1431 1391 1281 1249 707 499 1244 21510 699 11886
NM_003255chr1782632 2516 2429 2375 2079 1968 913 388 ------
NM_003257chr1591434 1138 971 564 442 411 265 256 242 21175 997 11287 --
NM_003262chr3255303 5035 4575 4367 4213 4173 4158 3675 1994 1973 1776 1675 1576 1383 1337 1300 1271 1141 997 920 760 522 322 304 272 11888 34583 582 457 13282
NM_003269chr641256 451 350 21 11159 11177 --
NM_003270chrX4991 843 789 405 --1362 --
NM_003272chr15585 261 226 176 84 2110 74 --1247
NM_003274chr2152927 2701 2360 2119 1013 --52751 2661 851 501 201 11057
NM_003286chr2031036 407 255 1964 1969 11127
NM_003288chr202600 458 --1582 --
NM_003290chr193288 214 143 --1231 --
NM_003291chr131819 2314 79 ----
NM_003292chr172250 1906 1577 1406 469 461 314 21873 83 ----
NM_003297chr121303 196 176 1130
NM_003298chr365776 5632 5605 1566 1521 77 44430 3882 2131 2025 35698 2030 1579 15454
NM_003299chr121167 ------
NM_003300chr141324 ----1500
NM_003304chr371456 1146 1024 511 475 273 203 21509 1376 31381 1367 498 2643 616
NM_003305chr4--195 ----
NM_003309chr641367 1301 114 98 1770 21805 1215 --
NM_003315chr171233 ------
NM_003319chr22254 42 ------
NM_003320chr11134465 4383 4066 3670 3438 3060 3008 1776 1740 1651 1425 1162 1101 --24407 3113 14456
NM_003330chr1261173 1154 1118 678 430 370 --11798 11589
NM_003336chrX61133 917 884 829 295 89 1304 --3991 364 283
NM_003337chr571724 1456 1448 1439 1216 593 535 1348 4330 305 236 173 11742
NM_003338chr1041856 1601 1287 748 31497 721 118 41939 479 425 308 --
NM_003339chr551393 1337 1151 276 86 --11624 1385
NM_003340chr451158 1108 962 554 478 1254 1123 1202
NM_003341chr32532 515 1199 ----
NM_003342chr17123309 2714 2699 2654 1324 1114 1051 1014 849 681 531 338 31231 1144 646 22476 2356 1569
NM_003344chr771758 1601 1572 1258 1157 598 89 1624 1421 11745
NM_003345chr16167 --2451 215 --
NM_003348chr1281680 1614 1373 1310 1110 1083 686 347 --2672 368 21458 258
NM_003349chr2021072 172 --11087 11094
NM_003350chr861056 952 854 823 362 202 1841 ----
NM_003352chr23870 786 179 --1695 148
NM_003358chr9----1134 --
NM_003359chr481165 1114 1075 1022 873 500 267 27 --31179 1134 432 2513 277
NM_003360chr41192 150 ----
NM_003367chr19--1124 ----
NM_003368chr12778 713 1173 1307 1794
NM_003369chr1162823 2719 2612 2068 859 193 12523 32662 293 207 --
NM_003372chrX3780 216 181 --3321 229 166 --
NM_003373chr1021939 1602 --21805 1436 1696
NM_003374chr5137 ------
NM_003376chr61405 --1273 11847
NM_003376chr61405 --1273 11847
NM_003379chr631092 746 412 1915 ----
NM_003383chr92577 426 --1167 --
NM_003384chr144293 146 81 50 1351 ----
NM_003385chr22931 811 ------
NM_003387chr2172837 2796 2735 2708 2647 2623 2514 2495 2414 1974 1959 1900 693 648 576 258 178 2734 559 1659 --
NM_003390chr113990 155 87 1126 ----
NM_003392chr3104232 4175 4100 3921 1174 864 815 539 225 128 54279 3998 3514 2879 1191 94351 4332 3908 3383 3147 3086 2899 99 92 23894 2861
NM_003400chr26843 796 659 338 261 183 1236 --1604
NM_003403chr142704 528 ------
NM_003404chr2061859 1255 765 350 261 117 --11474 11425
NM_003406chr841819 1390 787 416 1242 41866 1234 637 274 --
NM_003407chr19--1688 2670 572 --
NM_003409chr1851434 1421 1102 269 157 1319 21388 87 1149
NM_003410chrX83022 2197 1100 905 712 515 394 142 32842 2425 670 33074 2538 606 32115 1083 235
NM_003411chrY131750 1634 1615 1556 1539 1243 1236 686 471 458 354 137 55 31854 1494 633 --1659
NM_003412chr392992 2932 2904 2455 2414 2225 2207 693 591 13080 42788 828 649 205 --
NM_003413chrX81751 1648 1316 728 713 590 451 218 149 3518 483 241 11567
NM_003418chr33624 222 51 --1738 --
NM_003427chr61673 ------
NM_003430chr1961509 1462 1360 1200 583 567 11423 --51664 1623 1429 1175 1151
NM_003431chr13627 464 178 ------
NM_003432chr5------123
NM_003439chr773075 2692 2217 1406 1354 1226 414 --32594 2203 1363 --
NM_003442chr111159 4903 701 328 123 2846 832 --
NM_003452chr91862 ------
NM_003453chr133646 301 258 ------
NM_003454chr1651524 1353 1211 536 217 ----31452 1433 1414
NM_003457chr173542 190 149 ------
NM_003463chr6112995 2957 2302 2243 1315 1048 973 914 873 593 559 --53030 2817 2288 954 853 2787 382
NM_003467chr24171 115 61 42 ------
NM_003468chr2114007 3828 3404 3347 3306 3036 2992 1565 1467 307 204 14269 44319 1116 482 259 --
NM_003469chr22360 26 ------
NM_003471chr3122333 1904 1688 1563 1549 911 904 878 646 577 439 203 12165 2567 345 --
NM_003472chr641389 519 419 249 2949 197 2961 579 41105 588 343 237
NM_003473chr1041059 712 427 168 2954 755 ----
NM_003477chr111564 1246 ----
NM_003478chr11153350 3317 3298 3168 2913 2809 2783 2113 1174 1158 995 987 661 616 149 42746 2479 2085 260 43330 2866 2201 333 --
NM_003482chr1252564 2431 1975 1819 699 12306 ----
NM_003483chr12122847 2703 2552 2139 2088 2030 2003 1986 1976 661 586 536 52610 2488 2155 580 275 42628 1907 1819 1178 --
NM_003488chr172875 696 ------
NM_003489chr21203408 3202 3191 3144 3118 2801 2673 2533 2127 1261 1169 844 728 719 711 523 516 355 166 111 43347 3164 2113 395 22273 366 1556
NM_003496chr72857 131 3806 732 63 1664 --
NM_003498chr1652639 1950 965 867 257 1382 32501 2437 898 --
NM_003503chr141175 919 110 56 1260 2840 818 --
NM_003505chr751948 1298 1209 381 286 2757 257 --21858 1308
NM_003506chr861092 901 477 432 325 305 1496 51195 1166 888 331 227 1457
NM_003507chr272057 1995 1949 1932 1736 610 441 21983 1839 41771 1557 747 738 --
NM_003557chr131588 1069 299 11561 11434 --
NM_003558chr93719 540 261 ------
NM_003559chr1753904 3859 3251 1336 241 11311 23129 1074 --
NM_003563chr1731091 1059 424 31378 144 99 ----
NM_003566chr12153308 2822 2754 2723 2688 2637 2496 2345 2269 2215 1115 969 914 731 134 42792 2133 1151 48 53455 951 301 206 172 --
NM_003569chr65612 518 173 119 85 --2570 483 1129
NM_003573chr191265 ------
NM_003574chr18235738 5580 5130 5118 5104 4731 4615 4423 4251 4043 3851 3690 1741 1667 1646 1479 1424 1211 794 507 470 336 106 11325 64515 3978 3636 2291 1011 978 22250 730
NM_003576chr1382835 2358 2294 1996 1018 622 374 232 21969 452 1246 --
NM_003579chr12156 141 ------
NM_003580chr81464 265 52 1591 --
NM_003582chr11218 ----142
NM_003583chr12183459 3423 3414 3395 3088 2855 2469 2420 2388 1438 1380 1357 1334 1243 1020 215 204 189 43283 3250 3081 636 2790 735 --
NM_003587chr6----181 --
NM_003589chr1371434 1165 1086 1079 932 591 391 --21370 1056 --
NM_003590chr2133515 3481 3400 3216 3080 3058 2985 2489 1187 973 928 745 717 12939 23977 1497 21550 1234
NM_003592chr71413 ------
NM_003597chr252295 1972 1752 886 157 3365 314 34 11793 --
NM_003601chr42187 158 ------
NM_003603chr462152 1838 1453 794 680 526 ------
NM_003607chr1154341 4238 4196 4176 4125 4070 3242 3148 2953 2660 957 946 515 348 255 --11572 11079
NM_003610chr201333 ------
NM_003615chr3233847 3668 3660 3628 3474 3371 3098 3050 2916 2686 1298 1215 1140 1056 1042 1001 954 847 603 412 401 342 278 73829 3820 3545 3312 1264 590 364 63993 3899 2649 1288 768 290 11341
NM_003618chr271272 1213 1182 1124 993 377 111 2974 511 31134 979 242 2467 304
NM_003620chr17101060 1047 1024 958 859 412 354 121 79 52 ------
NM_003622chr1282613 2599 2243 2154 2138 1720 966 279 3975 664 542 52548 1853 814 498 54 22420 489
NM_003626chr1161370 549 408 371 188 133 21125 1072 41336 1130 1002 253 21348 1242
NM_003629chr183152 2911 2297 1324 1265 579 422 38 --12271 1990
NM_003630chr64775 728 529 299 --3603 173 42 --
NM_003631chr103974 765 223 --2784 659 --
NM_003632chr171603 1866 1816 --
NM_003633chr5102309 1866 1771 1667 1638 1012 940 806 783 203 2960 860 12560 --
NM_003645chr15----2251 190 --
NM_003646chr111599 ------
NM_003651chr122525 211 1588 1406 --
NM_003655chr172522 309 --1628 --
NM_003658chr112759 217 1845 1850 --
NM_003659chr261239 1102 991 984 94 36 ------
NM_003663chr3183349 3184 3154 2944 2883 2442 2433 2343 2194 988 979 920 904 873 772 615 430 76 33431 1370 815 33368 1222 309 --
NM_003664chr54217 194 179 141 --1440 --
NM_003670chr381381 1346 1185 1165 1123 422 297 25 --11070 11419
NM_003671chr9103465 3397 3068 2609 1244 940 909 570 457 390 23316 3057 23428 108 23481 2499
NM_003672chr1111945 1935 1902 1796 1543 1265 450 407 359 283 259 1549 11597 2274 228
NM_003675chr103485 204 192 ----1421
NM_003676chr13707 650 59 2790 155 ----
NM_003679chr163005 2911 2398 1076 528 410 21162 1053 1800 --
NM_003681chr21106227 5014 4574 4285 4106 2366 1916 529 517 168 14430 1108 14294
NM_003692chr93997 692 204 2710 106 3380 267 95 --
NM_003701chr1331063 728 51 --1433 --
NM_003702chr8--2781 722 1190 --
NM_003713chr141705 1556 698 102 21399 118 21764 1662 --
NM_003714chr562728 2448 878 857 724 693 --23090 2434 --
NM_003716chr32861 733 --1981 1740
NM_003718chr73513 487 47 2360 32 1432 1116
NM_003722chr3122687 2672 2641 2600 2132 1859 1780 1773 1754 676 442 366 1298 32542 1956 1790 12556
NM_003725chr124438 337 295 88 ----1421
NM_003741chr3--1294 ----
NM_003743chr252166 690 555 324 80 --51951 867 285 163 69 1795
NM_003744chr1451368 1336 931 525 238 11263 11268 --
NM_003745chr162372 51 --2380 350 --
NM_003746chr121209 ------
NM_003749chr1331837 1765 1530 22063 1675 32178 1688 736 --
NM_003758chr1531565 1150 451 ------
NM_003758chr1531565 1150 451 ------
NM_003759chr4174276 4210 4171 4096 3655 3437 3292 2826 2734 2656 1632 1100 913 883 762 690 624 54243 3901 1009 875 224 54291 4005 863 811 215 14042
NM_003760chr12517 248 1329 148 --
NM_003762chr131428 926 325 --2577 232 --
NM_003763chr2093175 3133 3076 3001 1991 711 565 494 395 --32471 356 278 --
NM_003764chr63637 610 592 1662 2721 649 1755
NM_003769chr124334 112 103 51 --2225 31 --
NM_003772chr1161228 1185 1121 418 334 244 11309 ----
NM_003774chr12143335 3126 2648 2586 2483 2324 2171 1318 1047 661 499 426 384 84 22995 2553 73396 2431 2395 2387 2374 1303 486 43151 2508 2407 2060
NM_003778chr32137 123 ------
NM_003779chr11483 ------
NM_003783chr14470 459 435 376 21212 957 1130 --
NM_003787chr18101603 1549 1451 1263 1238 1156 1138 547 472 203 2533 492 31481 1214 226 --
NM_003794chr351081 1052 892 363 172 ------
NM_003796chr195601 590 424 181 114 ------
NM_003798chr92161 132 154 ----
NM_003799chr18104493 4288 4250 4197 1212 1123 997 800 433 175 --33544 959 751 21560 228
NM_003800chr6142362 2304 2277 2233 1998 1897 1842 1578 820 657 648 616 124 66 11981 32310 1544 387 --
NM_003809chr17--1470 --1488
NM_003816chr871519 1449 1425 1165 1002 589 282 21394 1115 2467 53 --
NM_003818chr2031102 1081 253 --1136 --
NM_003819chr12246 222 ------
NM_003821chr8267 60 3586 235 205 1153 --
NM_003822chr173210 3162 2626 2469 2091 127 26 22448 1129 12463 --
NM_003825chr1571572 1487 1282 1165 1025 293 203 1541 2375 369 --
NM_003829chr951206 1192 941 186 159 181 ----
NM_003831chr1881743 1639 1528 700 673 574 428 385 51719 1590 1337 306 162 31829 1569 123 --
NM_003838chr171352 1257 1099 514 331 311 203 11461 41395 455 223 61 1392
NM_003858chr144550 522 482 278 --1644 --
NM_003861chr1462716 2421 2081 2062 1977 1852 32310 1805 659 21951 408 12587
NM_003862chr5----1107 177
NM_003864chr41184 ------
NM_003872chr292896 2786 1993 773 639 390 338 290 67 12967 ----
NM_003873chr1082391 2371 1823 1559 1031 870 205 124 22244 1796 22267 945 --
NM_003877chr123913 822 105 ----1189
NM_003884chr3151866 1792 1735 1637 1580 1480 1274 711 699 590 548 507 382 157 127 41707 1248 629 195 1520 1411
NM_003885chr1732414 613 168 144 22672 1924 32663 2174 2117
NM_003887chr2112246 2199 2161 1707 1682 1658 1505 769 547 391 256 1153 21836 1438 12345
NM_003895chr2171528 810 770 535 443 290 262 --31638 745 35 1522
NM_003896chr25989 917 718 160 92 2283 120 ----
NM_003901chr1072448 2438 1938 1097 1041 651 458 12626 12462 --
NM_003902chr14586 339 311 278 1319 1297 --
NM_003908chr205924 904 438 186 115 --2896 230 --
NM_003909chr8102178 2146 1190 965 829 743 700 528 295 160 33027 1051 680 42750 1231 489 84 12897
NM_003913chr6134165 3762 3751 3648 3403 3272 3255 2993 1576 1567 1129 971 576 21307 936 43230 1076 778 658 13263
NM_003914chr131179 ------
NM_003916chrX61488 1333 1139 1093 239 149 --11062 21510 571
NM_003919chr72193 93 --1174 --
NM_003921chr1101679 1571 1432 1393 1371 618 266 259 129 60 31557 145 24 41131 718 248 205 --
NM_003922chr152397 306 1286 1176 174
NM_003924chr441598 1307 1258 116 --11507 --
NM_003927chr189971 769 743 717 417 266 199 123 82 --1160 1411
NM_003929chr141499 1478 1280 515 --2551 348 --
NM_003930chr7112476 2449 2237 2220 1920 1870 539 295 231 132 45 22568 2413 1719 1393
NM_003931chr64611 494 136 95 ------
NM_003932chr2281537 1424 1359 1227 480 319 239 120 --31723 767 295 --
NM_003934chr94926 915 191 146 2823 510 41174 1092 899 205 21061 876
NM_003939chr1084056 4049 3791 3712 3271 2693 1514 377 1266 13098 --
NM_003941chr7102369 2214 1862 1836 1668 753 743 455 348 55 21731 917 4362 254 133 115 2702 31
NM_003942chr111171 ----1155
NM_003948chr472618 1726 1077 1010 920 538 330 --1654 11646
NM_003953chr182878 2197 1966 1952 962 774 625 262 1513 22867 2847 --
NM_003956chr104507 484 153 110 --3461 372 86 --
NM_003957chr1121095 756 ----1747
NM_003958chr6123829 3550 3356 2704 1398 1264 1244 1209 1066 912 778 405 21584 1544 33098 844 832 1894
NM_003961chr161208 ------
NM_003966chr5197044 6921 6809 6767 6227 6145 5982 5462 5221 5174 5090 2752 2404 2290 2089 1797 976 746 294 37260 6836 6329 47786 2041 1030 256 16529
NM_003968chr32565 45 180 1674 --
NM_003970chr83451 162 141 --1134 --
NM_003971chr173515 122 55 ------
NM_003980chr691131 1068 1041 576 380 335 236 224 170 11238 21301 270 --
NM_003983chr16114345 4316 4288 3732 3451 3285 3169 1115 871 723 385 --24384 3836 --
NM_003994chr12174393 4118 3824 3770 3679 3575 3365 3110 2918 2821 2683 1745 1376 1319 461 247 28 12968 14319 11273
NM_003995chr92246 213 ------
NM_003998chr43672 630 577 --2666 477 1679
NM_004001chr1--1441 1455 1480
NM_004006chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004007chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004009chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004010chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004011chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004012chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004013chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004014chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004015chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004016chrX122570 2120 2045 1931 1779 1744 880 759 674 665 473 331 22090 1662 22487 98 --
NM_004017chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004018chrX122570 2120 2045 1931 1779 1744 880 759 674 665 473 331 22090 1662 22487 98 --
NM_004020chrX122656 2206 2131 2017 1865 1830 966 845 760 751 559 417 22176 1748 22573 184 --
NM_004021chrX122570 2120 2045 1931 1779 1744 880 759 674 665 473 331 22090 1662 22487 98 --
NM_004022chrX122570 2120 2045 1931 1779 1744 880 759 674 665 473 331 22090 1662 22487 98 --
NM_004023chrX122570 2120 2045 1931 1779 1744 880 759 674 665 473 331 22090 1662 22487 98 --
NM_004028chr1883609 2912 2796 2546 1553 1333 1013 248 33910 1273 871 32975 1283 977 2898 217
NM_004034chr102426 181 --1592 --
NM_004036chr21698 --149 1623
NM_004040chr221019 515 1981 31269 1121 259 --
NM_004050chr1432591 2431 2395 22722 2379 22727 2597 12684
NM_004056chr86922 874 852 819 776 85 ------
NM_004060chr541242 1206 1179 847 ----1474
NM_004063chr82301 96 --172 1310
NM_004064chr1231272 1130 355 --2955 906 2864 528
NM_004067chr761530 1511 1323 1295 1176 628 11228 21024 592 2459 430
NM_004071chr23266 213 75 2105 59 ----
NM_004079chr172959 2433 1985 1967 1812 461 62 --22851 1947 21821 1150
NM_004080chr711058 2488 266 31318 1026 240 --
NM_004081chrY31878 1734 695 3581 567 358 --11610
NM_004085chrX1153 --2277 194 --
NM_004087chr361967 1739 569 519 317 209 ------
NM_004093chr1373182 3151 2858 2074 1113 1102 27 --33281 3131 2012 12428
NM_004094chr14102964 2787 2596 2517 2349 2215 1058 835 807 495 22914 211 1110 22488 843
NM_004096chr1072109 2070 1934 1824 1659 1427 545 ----31391 1368 731
NM_004097chr21318 ------
NM_004098chr1021285 490 --11213 --
NM_004099chr961970 1715 792 606 366 82 --11922 1231
NM_004100chr652282 1976 1072 553 29 155 1824 11646
NM_004105chr241054 1022 420 69 ----11076
NM_004109chr1182373 2275 1762 1672 1616 484 121 23 1176 21624 251 145
NM_004113chr33508 457 351 1736 1616 11403
NM_004117chr662209 1873 1516 763 755 453 21560 501 31707 1621 817 11535
NM_004124chr14163541 3293 3144 3103 3041 2956 2745 2721 2671 2348 2294 1433 944 775 626 243 2833 580 43302 1396 872 229 12902
NM_004128chr133445 135 114 ------
NM_004133chr892642 2537 2488 1910 1900 543 333 135 77 12318 41920 1832 613 236 42603 2520 2432 666
NM_004134chr52670 230 --1598 --
NM_004136chr15133010 2880 2835 2662 2555 2515 2198 1281 1183 966 829 785 269 ----13287
NM_004161chr271636 1218 1062 1042 301 258 157 11507 11512 --
NM_004162chr371186 1177 1146 866 802 384 141 1164 1933 --
NM_004163chr181134 ----2433 50
NM_004169chr172719 141 3830 778 757 ----
NM_004170chr961501 1150 690 434 324 135 2497 389 ----
NM_004171chr11279649 9439 9195 8664 8450 7976 7830 7336 7094 7081 6881 6779 6547 6138 6059 5844 3297 2514 2341 2108 1830 1823 1785 1473 891 740 198 27643 1430 58149 7391 6676 1836 914 47859 7619 2118 941
NM_004172chr542036 2023 366 311 21562 207 11427 11725
NM_004177chr1151838 1534 1210 706 635 --31816 407 365 --
NM_004180chr21131 2608 582 1161 --
NM_004187chrX71413 1336 1250 1116 579 523 149 11491 ----
NM_004199chr5199 ------
NM_004202chrY3595 57 49 ------
NM_004205chr112556 57 ------
NM_004207chr17167 ------
NM_004208chrX2131 71 ------
NM_004215chr8184 --1470 --
NM_004225chr841504 1492 589 575 --1140 21210 463
NM_004227chr792932 2884 2291 1107 1057 866 848 579 511 1538 12580 22848 597
NM_004229chrX81835 1825 1368 872 691 433 388 92 32020 1874 1606 11981 11777
NM_004232chr18143849 3720 3272 3219 2455 1420 1368 1175 863 689 651 594 510 181 32850 1360 325 53485 3320 2675 2463 1061 12820
NM_004235chr94892 845 793 553 1639 259 52 --
NM_004237chr51879 --2937 27 1828
NM_004241chr101557 1648 3735 714 290 124
NM_004242chr63308 92 76 152 2346 162 165
NM_004249chr41108 ------
NM_004252chr174573 501 463 133 ------
NM_004253chr93955 703 159 --2863 736 2326 28
NM_004261chr161019 906 819 670 245 195 11002 1928 --
NM_004264chr1251255 1236 1139 216 153 21245 799 21122 1024 3487 337 138
NM_004268chr1161177 936 385 375 177 153 11159 2972 287 --
NM_004272chr562015 1750 1740 1525 1294 776 11245 3676 482 379 12038
NM_004274chr1472508 1251 904 783 694 448 315 ----12205
NM_004277chr641379 1154 643 473 11685 31537 576 147 --
NM_004279chr752299 1850 260 208 116 21866 850 1733 1356
NM_004280chr61125 1186 ----
NM_004282chr64520 204 182 61 --1562 --
NM_004285chr1116236 5355 5306 5203 4858 4067 3942 2130 2123 1693 39 16403 46441 6082 5986 1554 14677
NM_004286chr2262765 2597 2379 2171 2163 248 --12301 --
NM_004287chr1762594 2468 2148 1946 1738 709 1739 ----
NM_004290chr551259 1198 1141 295 142 21287 182 --11022
NM_004291chr52106 43 --1294 --
NM_004293chr9143789 3507 3307 2478 2381 2355 1536 1092 851 782 662 617 364 245 13163 32549 1340 773 33009 1250 422
NM_004301chr34265 246 134 106 --2348 315 --
NM_004311chr1062931 2357 732 332 197 72 31057 1045 477 52814 2768 2512 2234 1972 12985
NM_004316chr1251179 956 839 808 79 --1729 --
NM_004319chr182763 2722 2405 2069 656 286 260 248 22968 79 23017 87 --
NM_004326chr14495 289 129 63 --4402 268 234 220 --
NM_004329chr1091464 1340 1238 1045 1009 993 486 342 219 1971 ----
NM_004330chr155923 459 234 138 123 --2948 382 2362 92
NM_004331chr892623 2388 1865 874 853 804 597 574 152 --4896 881 825 794 --
NM_004337chr861976 1741 1520 894 623 290 2136 50 22229 277 1685
NM_004338chr18207032 6793 6701 6346 5517 5445 5368 5341 5190 5126 4496 1443 1269 1052 1010 883 828 818 443 279 36748 1655 466 46866 6642 5321 4947 16981
NM_004341chr21233 ------
NM_004342chr771932 1616 834 800 617 465 252 12027 62220 1980 1943 738 553 119 12319
NM_004346chr471537 1463 1179 598 546 459 114 31546 496 346 ----
NM_004349chr841032 921 345 298 11057 --11238
NM_004354chr46814 704 693 256 213 155 2585 309 2298 234 --
NM_004360chr16101948 1853 1834 1770 1748 1637 779 629 408 213 22011 352 11542 --
NM_004365chr52339 294 1219 157 --
NM_004369chr24734 461 226 114 --1632 --
NM_004370chr672198 2135 2049 1739 1585 1552 250 --2761 577 12129
NM_004379chr261273 1234 1171 1106 705 84 11378 3578 246 156 --
NM_004383chr15----1406 --
NM_004384chr5132260 2074 1828 1700 1606 1564 1524 810 675 490 231 128 91 12250 22129 1577 42143 1820 1474 731
NM_004388chr1--2340 71 2424 91 --
NM_004392chr1382574 2252 2110 1971 1955 1743 581 568 21984 1033 12341 22463 1773
NM_004393chr371599 1576 558 535 266 232 203 --41609 638 617 217 1212
NM_004397chr11163964 3697 3654 3534 3384 3352 3344 3238 2850 1730 1607 1328 1159 667 576 100 --44045 3548 2830 1053 12889
NM_004398chr112415 170 --1461 --
NM_004402chr151678 1583 1564 1547 221 21640 1309 11606 1323
NM_004404chr242023 2008 1536 649 2372 151 11950 2512 187
NM_004407chr42966 750 --3874 861 119 --
NM_004414chr2141397 1338 1270 1226 --11551 11521
NM_004415chr65693 643 620 296 170 1686 --1755
NM_004426chr1251976 1768 682 534 208 11517 1214 --
NM_004430chr8102773 2499 2449 2320 2085 1992 1901 1879 1848 27 12657 52437 2181 2098 2043 1100 --
NM_004431chr13787 590 583 --1811 --
NM_004432chr9121942 1898 1710 1576 891 730 716 692 595 522 477 152 2766 493 42415 1911 1809 832 1665
NM_004434chr1441846 1299 294 190 11204 --11775
NM_004437chr193205 3013 2980 2639 2464 1251 649 233 200 33258 1099 868 ----
NM_004438chr283173 2939 2773 2218 709 448 382 77 1471 53197 3004 2721 2466 237 --
NM_004440chr671836 1701 1668 1380 707 382 299 1784 41995 1847 1661 693 --
NM_004442chr151124 1062 665 605 585 --1251 --
NM_004447chr1291048 983 904 781 271 234 206 93 54 --2968 226 1175
NM_004451chr112728 695 --1619 --
NM_004454chr372236 1955 1870 1596 806 734 723 1695 22312 1607 --
NM_004456chr72232 206 ------
NM_004457chr271591 1391 1371 406 343 253 216 1136 21629 622 --
NM_004458chrX112570 2522 2433 2251 2201 2100 1812 1796 1063 749 167 32530 2139 1749 1684 --
NM_004459chr1771783 1740 1323 795 419 382 59 11429 21797 454 --
NM_004462chr82654 99 1664 3612 86 49 --
NM_004464chr4214206 3861 3705 3670 3621 3343 2871 2769 2760 1621 1556 788 585 567 475 458 408 398 379 275 243 63448 3238 3215 2847 355 318 31529 360 308 23230 468
NM_004481chr142659 2595 2547 938 12565 ----
NM_004482chr24891 670 617 125 2722 710 2932 773 --
NM_004483chr16--196 --1491
NM_004484chrX----289 79 --
NM_004487chr351270 1110 924 423 193 ------
NM_004491chr1964159 4095 3957 3912 3442 3356 --13896 --
NM_004496chr1481284 1216 1160 946 862 235 175 135 11256 1404 1125
NM_004498chr15--158 ----
NM_004500chr1452038 1455 702 229 71 21752 1323 51902 774 695 596 497 1236
NM_004501chr1144143 3961 3817 3119 3067 2872 1642 1373 1146 718 314 277 146 82 43190 1276 945 172 --11419
NM_004503chr12--1615 --1853
NM_004504chr2122872 2784 2766 2755 2733 2669 1163 978 964 924 735 495 32535 388 34 33089 2793 294 --
NM_004505chr1751761 1267 515 170 106 --31318 563 527 --
NM_004506chr63254 95 59 --2141 80 --
NM_004514chr1722348 424 --22639 820 13093
NM_004516chr1971149 865 503 339 235 118 35 1414 51272 1177 786 321 252 --
NM_004520chr54743 713 589 274 1570 1250 --
NM_004521chr10--1120 3369 352 343 --
NM_004523chr1021183 449 --21269 568 130
NM_004525chr271548 1490 1468 1431 1027 90 40 1462 2109 54 1175
NM_004529chr941294 1088 561 76 11122 21392 162 11368
NM_004535chr2031396 1382 1352 11181 21342 245 --
NM_004537chr1271493 1294 1238 1217 1205 979 94 21325 1068 11259 --
NM_004540chr212936 605 ----1869
NM_004561chr1141836 1284 200 192 --2732 696 --
NM_004563chr141160 ------
NM_004566chr1082552 2336 2120 2036 1783 815 807 694 11949 32326 2300 1755 12179
NM_004569chr142644 215 --3671 626 569 --
NM_004571chr2183428 3236 2119 1310 1302 845 105 27 22145 218 --32752 610 574
NM_004575chr441662 1214 492 78 --31627 1559 411 1554
NM_004578chr1----3870 367 237 --
NM_004580chr1521426 627 --21608 1147 11568
NM_004582chr13292 169 99 ------
NM_004586chrX195301 5042 5034 4462 4221 4146 3945 3710 3700 3689 2166 2142 2103 1803 1200 1112 822 497 149 --25114 843 23992 324
NM_004593chr33886 873 189 3781 617 115 3236 138 61 --
NM_004595chrX2298 165 ----1133
NM_004598chr5123348 3101 3016 2721 2557 2498 2478 2364 1223 1073 936 281 --43241 2443 481 226 11170
NM_004599chr221685 --1677 --
NM_004600chr181503 1196 1172 1142 1102 600 280 248 1473 1966 2982 957
NM_004602chr2061360 1296 597 557 501 65 1930 21175 935 11437
NM_004607chr52195 188 1207 166 --
NM_004612chr9184841 4798 4547 4362 4339 4040 3852 3610 3475 2967 1934 1730 1085 1022 994 924 760 573 21594 1341 33724 1113 249 23348 957
NM_004615chrX2776 742 --1797 1883
NM_004616chr12153 ----1210
NM_004619chr162115 1716 861 738 554 378 ----1229
NM_004622chr2121911 1496 909 703 612 489 475 468 370 198 157 115 11667 22184 1982 --
NM_004626chr115619 606 563 523 138 --1472 --
NM_004627chr214684 585 508 114 ------
NM_004630chr1111139 1483 1438 --
NM_004631chr171447 1330 511 428 381 230 127 --1564 --
NM_004635chr33799 755 111 ----1749
NM_004642chr121724 1525 ----
NM_004643chr143834 528 184 --2805 117 --
NM_004645chr172107 67 1850 ----
NM_004651chrX1335 ------
NM_004654chrY71394 1299 1037 947 506 376 290 11087 2559 335 --
NM_004660chrY51866 1516 1503 337 244 11885 31755 1704 710 --
NM_004663chr15101557 1532 1525 1476 1241 601 564 187 119 88 --1260 --
NM_004670chr1081715 1617 1302 504 451 348 260 71 ----157
NM_004677chrY3560 457 423 ------
NM_004681chrY3308 199 127 ------
NM_004685chr13132804 2770 2760 2649 2536 2090 1964 1016 846 680 542 431 391 12719 32686 2251 1104 1948
NM_004686chr891818 1313 1298 1249 674 582 564 403 115 21685 525 1610 --
NM_004687chr1771809 1760 1651 1480 1469 718 663 --1592 --
NM_004689chr14----1352 1344
NM_004696chr15835 792 649 294 126 ----1304
NM_004698chr1----1213 --
NM_004703chr178945 864 721 553 519 467 393 291 12212 32340 1827 953 --
NM_004705chr112633 345 --1845 --
NM_004709chrX91706 1694 1207 1188 1141 342 254 44 24 ------
NM_004711chr2213416 ------
NM_004717chr731375 1366 305 1148 11381 --
NM_004718chr25688 441 218 106 78 ------
NM_004719chr1292892 2709 2442 2419 2197 2084 1790 417 298 12376 42678 2125 1758 120 21935 517
NM_004721chr31244 --1284 --
NM_004723chr11972 ----1731
NM_004725chr1061366 1200 1088 495 285 153 --21105 1008 --
NM_004726chrX165558 5427 4942 4812 4714 4371 4310 3764 3614 2170 1996 1001 989 767 747 396 21769 1470 65455 5237 4395 1782 1657 408 44794 3726 2005 819
NM_004727chr1531784 832 627 11747 --11455
NM_004729chrX52063 1848 1485 1346 54 12112 11536 12118
NM_004730chr581977 1879 1738 1731 416 355 323 304 ----31945 1440 272
NM_004731chr1251746 1682 602 396 132 --21885 1712 21532 550
NM_004733chr34592 464 235 97 --3611 545 174 --
NM_004734chr13123113 2989 2712 2703 2685 2154 1149 1042 683 478 355 161 --42896 2802 2303 1055 12692
NM_004736chr1102155 2125 1470 843 800 565 557 448 424 208 11814 32029 1966 539 --
NM_004741chr104418 336 309 52 11258 2615 235 --
NM_004742chr311152 --31581 1541 356 --
NM_004744chr4143726 3584 3350 3087 2810 1528 1497 1331 1055 931 858 731 578 398 21265 1023 33762 702 508 --
NM_004745chr8176968 6861 6810 6682 6654 6479 6165 6104 5732 5450 4316 1965 1828 1389 944 893 857 36505 4817 506 76833 5678 2392 1753 1100 819 199 1353
NM_004747chr1061596 1347 1223 1087 479 220 ------
NM_004748chr15233972 3923 3808 3488 3328 3086 2824 2717 2707 2682 1668 1397 1125 986 897 756 607 539 410 328 297 234 75 32782 196 26 22897 1638 22942 1305
NM_004755chr1491117 1085 1052 878 848 835 785 364 126 11141 1823 178
NM_004756chr1911359 ----11518
NM_004757chr44583 533 269 97 1177 1242 --
NM_004759chr141766 1692 1609 1600 11622 1688 --
NM_004760chr782486 2303 2097 1903 659 619 544 533 --32050 882 425 1223
NM_004762chr1741871 1622 1522 139 --3772 451 148 --
NM_004768chr131098 842 732 2930 170 ----
NM_004772chr581579 1570 1518 1153 565 454 129 74 11251 21091 614 --
NM_004774chr17103125 3092 3076 2839 2591 2143 1232 599 577 333 1355 --1806
NM_004775chr18102198 2176 2132 1898 1773 1608 1533 650 442 335 52122 1788 921 431 277 52330 2305 2285 2231 893 1315
NM_004776chr20113337 3312 3258 3222 2463 2409 2270 2028 508 62 24 --11120 --
NM_004779chr571077 844 823 538 526 168 136 --21117 911 --
NM_004781chr181275 1202 676 539 448 337 105 51 1643 1488 --
NM_004781chr181275 1202 676 539 448 337 105 51 1643 1488 --
NM_004787chr41144 ----1124
NM_004788chr1172681 2481 1938 1905 907 579 375 --22375 868 1392
NM_004789chr95440 357 338 291 72 ------
NM_004791chr132544 249 --134 --
NM_004792chr21156 ------
NM_004795chr13111939 1860 1639 1493 1432 1413 723 642 631 336 126 31737 1688 1548 11507 --
NM_004796chr1482213 2202 2044 1639 1599 1588 776 604 --22380 622 --
NM_004801chr251199 631 550 137 77 --1978 1973
NM_004804chr2112762 2405 2395 1874 535 497 380 327 262 233 158 ------
NM_004808chr1052256 1040 632 452 263 13312 22071 288 --
NM_004815chr1134812 4095 3973 3940 3817 3561 1611 1117 801 792 768 756 44 54836 1911 1887 1852 556 74071 4056 3208 531 502 369 262 24878 228
NM_004821chr52531 195 --1537 --
NM_004824chr64964 482 294 224 1943 21359 1251 21074 921
NM_004830chr61132 2802 785 3737 341 190 --
NM_004831chr191707 ------
NM_004834chr2103195 3184 2863 2725 2714 2249 1175 867 699 597 11077 1953 --
NM_004835chr33865 167 143 --3325 311 98 --
NM_004835chr33865 167 143 --3325 311 98 --
NM_004836chr25985 739 640 602 110 --2853 125 2612 338
NM_004837chr141292 1133 452 38 31704 1586 331 --11691
NM_004840chrX92472 2422 2084 2066 955 910 455 228 94 12433 31817 1716 920 1866
NM_004841chr151064 1042 875 760 471 11138 1189 1308
NM_004842chr661612 1226 1105 663 616 373 11480 61724 1485 1446 1419 551 134 11312
NM_004844chr321187 1111 --31027 982 481 --
NM_004845chrX143737 3713 3130 2823 2801 1247 1222 1195 874 796 694 631 589 314 13873 ----
NM_004849chr66681 654 644 472 191 175 21048 589 11605 --
NM_004850chr241221 1129 252 102 11287 21292 532 --
NM_004856chr151378 ------
NM_004857chr14164693 4583 4218 4080 4043 3487 3460 3371 1804 1787 1646 1470 1457 1021 330 280 11836 53920 3106 1888 473 425 23265 1656
NM_004859chr1782402 2337 2056 1911 1163 244 203 32 1570 21953 694 --
NM_004860chr17----1557 --
NM_004865chr61369 --1319 --
NM_004866chr5224975 4853 4773 4721 3826 3802 3663 3467 3237 3173 3133 3070 1949 1929 1890 1794 1781 1100 1059 1017 572 166 34766 3211 940 74504 3744 3342 1683 1433 469 243 34706 3864 75
NM_004867chrX2229 122 1575 ----
NM_004869chr1881702 1410 1376 1368 1311 380 373 337 21094 302 3559 155 55 --
NM_004871chr17104354 4214 3948 3709 3434 3142 3111 1617 1476 203 14264 53580 2977 2955 386 248 14308
NM_004873chr14123202 3038 2876 2769 2744 1982 1274 462 391 282 187 21 23099 556 53064 3020 2619 724 147 11991
NM_004874chr83427 409 166 ------
NM_004879chr115764 679 390 251 149 1203 ----
NM_004884chr1551387 1363 1256 431 289 --11341 11219
NM_004888chr95689 371 293 161 137 ------
NM_004891chr2------1224
NM_004896chr1091474 1255 1179 1036 425 339 259 204 154 1194 21215 503 --
NM_004897chr106924 827 788 754 626 179 2782 95 1594 --
NM_004898chr4122735 2027 1988 1962 1108 1076 958 923 817 759 729 508 1348 32673 889 252 --
NM_004904chr7176441 5753 5393 4817 4690 4179 4172 2574 2551 2282 2254 2112 1988 1907 1663 1652 624 126518 4337 4261 2617 2535 2528 2031 1926 1255 355 130 73 95489 5466 4503 4281 2068 1140 812 675 230 44654 4086 1507 1501
NM_004905chr14894 649 589 356 --1909 --
NM_004906chr61226 1694 177 1271
NM_004912chr731182 512 385 11377 41513 1141 591 84 11414
NM_004915chr213822 608 516 1745 ----
NM_004922chr10----11020 --
NM_004924chr1921030 778 --1259 11092
NM_004926chr1471819 1567 1448 1387 1376 1359 281 --11203 --
NM_004929chr841366 399 264 81 --2988 469 --
NM_004932chr561748 1672 1312 1288 390 152 2193 168 1198 --
NM_004937chr1731969 1657 673 12543 ----
NM_004938chr95771 428 351 338 232 --1783 11194
NM_004946chr53431 423 402 ------
NM_004947chr342575 2495 684 273 --1218 --
NM_004949chr18101968 1580 1463 1401 862 683 585 390 280 153 2399 254 42085 1643 1453 832 21795 409
NM_004953chr31310 ------
NM_004954chr111289 ------
NM_004956chr7144470 4022 3459 2852 2786 1673 1511 1339 775 582 363 134 100 37 34515 1271 1019 23669 267 34239 3440 107
NM_004958chr14917 110 50 43 ------
NM_004964chr13546 539 73 1408 ----
NM_004965chr213709 150 79 1118 2205 167 168
NM_004966chr1051020 984 692 211 203 --1333 --
NM_004969chr104442 416 228 219 --1194 --
NM_004972chr961008 797 730 464 304 290 ------
NM_004973chr671597 478 414 355 343 308 167 --21725 37 --
NM_004975chr204883 628 79 28 ------
NM_004976chr1175166 5153 5121 5098 3815 3687 1583 --12022 --
NM_004979chrX2205 39 --167 --
NM_004985chr12204320 4266 4200 3735 3721 3698 3678 3250 3231 2810 1456 1404 1375 1284 707 344 268 147 100 51 54441 3556 1703 789 130 64493 4276 4192 1186 599 298 11227
NM_004987chr23370 304 134 ------
NM_004992chrX88301 7237 7125 5394 5372 2737 943 249 15478 58348 6202 5405 1851 118 27497 5419
NM_004992chrX88301 7237 7125 5394 5372 2737 943 249 15478 58348 6202 5405 1851 118 27497 5419
NM_004993chr147981 590 566 457 343 295 34 1111 1987 --
NM_004995chr14------11530
NM_004996chr1621780 1326 --11660 --
NM_004999chr6114467 4433 4238 3097 1657 1197 859 493 471 330 137 14188 62805 1239 655 527 351 194 --
NM_005006chr23838 792 785 11029 1356 --
NM_005010chr7122271 2028 2003 1986 1900 1879 1758 1735 1530 1514 371 104 --2681 200 --
NM_005011chr731409 163 48 --21705 1690 --
NM_005013chr11197 ------
NM_005016chr124359 328 256 149 ------
NM_005021chr63413 179 68 1133 2318 103 --
NM_005022chr171201 --183 --
NM_005023chr551366 1037 508 485 433 11025 ----
NM_005027chr19--1425 ----
NM_005028chr1032220 1585 786 --12086 22081 2060
NM_005032chrX41004 756 396 113 --2926 855 --
NM_005036chr22178121 7952 7418 7193 7166 7100 6996 6981 6039 5849 5389 2910 1774 1508 423 378 299 56621 6575 5323 3190 1654 68367 6636 6323 5146 1442 551 11250
NM_005037chr31132 ----1173
NM_005044chrX104014 3983 3299 2948 2843 2810 1826 1485 465 120 21766 484 43620 1711 1113 489 14463
NM_005045chr73789 680 673 --121 --
NM_005054chr261761 1700 1529 644 462 181 11237 21789 1678 --
NM_005056chr12125613 5433 5010 4948 3975 3870 3816 1935 1867 1559 1206 587 11365 84251 2215 1649 1546 1441 1394 1125 29 14118
NM_005057chr131242 765 450 --11792 11777
NM_005063chr1053758 3111 2906 1451 481 --33556 3501 3126 --
NM_005065chr14185339 5216 4389 4117 4093 3905 3454 2052 1997 1971 1831 1755 1517 1510 930 576 244 164 45163 4212 2015 1578 55039 5028 3469 1445 894 --
NM_005066chr13731 294 190 1828 2577 215 --
NM_005069chr2161730 1681 1360 1256 1245 1227 --41706 1600 1103 546 --
NM_005076chr163798 3069 2819 2724 159 124 ------
NM_005077chr91136 --1443 --
NM_005078chr1521575 566 21564 1551 --11873
NM_005079chr8113160 3153 3008 2964 2042 1108 981 546 510 467 311 13084 33201 2567 733 1104
NM_005080chr224941 910 335 201 1616 --1630
NM_005086chr1251703 1403 1336 660 492 --1179 2138 130
NM_005087chr32270 173 ------
NM_005088chrX2643 164 1892 --1752
NM_005093chr2075271 5245 4522 4206 1529 1253 687 ----11538
NM_005095chr1112124 1605 1470 1453 889 882 578 501 391 268 23 12203 12089 1300
NM_005099chr131084 939 512 1326 21221 534 21093 948
NM_005102chr25892 853 774 699 190 1633 ----
NM_005105chr142079 1978 175 151 1432 1440 12045
NM_005109chr342549 2522 1700 832 12572 ----
NM_005113chr144506 435 127 104 1121 1396 --
NM_005114chr42536 282 1459 1168 1491
NM_005116chr20124563 4505 4312 3925 3496 3475 3277 3120 2830 2799 1073 141 13156 --24577 4380
NM_005119chr151215 1204 885 314 216 --1896 --
NM_005121chr17153422 3356 3316 3243 3028 2889 2667 2562 2379 1327 1181 1092 1036 903 536 23410 2872 73797 3688 2323 1407 1151 613 173 1600
NM_005123chr121325 ------
NM_005124chr66869 743 647 231 71 51 --1689 1931
NM_005125chr111155 ------
NM_005126chr392292 2019 1974 1918 1688 1659 1569 858 275 ------
NM_005133chr112397 109 ------
NM_005141chr42123 46 1355 ----
NM_005146chr11----164 --
NM_005151chr18122185 2127 2089 1778 1771 1656 915 770 559 448 312 259 1231 --1720
NM_005154chr155635 565 534 515 226 --1497 --
NM_005156chr9195242 5115 5023 4777 4463 4238 3783 3459 2135 1698 1675 1644 1229 1176 930 646 260 151 133 11730 54518 3665 1442 944 853 33742 3476 371
NM_005157chr931776 1557 364 --21966 1563 --
NM_005159chr1591965 874 570 549 472 342 329 238 151 12039 ----
NM_005160chr22206771 6262 5852 5561 5503 5446 5379 5338 4939 4832 4769 4745 4719 2427 2419 2208 1495 1441 1061 502 35280 2131 280 35473 2586 1426 26235 1364
NM_005164chr1292498 2459 2443 2308 2169 1856 975 894 157 11987 42605 2338 981 967 42565 1702 664 592
NM_005166chr19----1235 --
NM_005168chr261682 1671 1613 1580 1558 328 2698 385 21752 1287 --
NM_005171chr1261084 984 815 326 109 96 11133 123 21037 857
NM_005178chr19----1421 --
NM_005180chr10101547 1489 1342 1148 1097 1057 654 627 236 111 --21336 418 41602 1522 1271 1192
NM_005181chr85733 630 252 173 102 --1687 2717 304
NM_005187chr1641447 680 666 444 ------
NM_005188chr11188309 8270 8216 8070 7984 5943 5809 3210 2853 2829 2775 2585 2545 2306 2162 1208 311 195 47152 7108 3336 1070 36000 3039 1705 28342 591
NM_005190chr62313 266 21088 787 1135 --
NM_005194chr203582 534 154 1572 1179 --
NM_005197chr14186154 5918 5906 5891 5718 5374 5046 4698 4491 4337 3784 1542 1481 1375 1308 257 147 92 44448 2337 1421 724 24656 4471 21074 200
NM_005203chr103398 139 73 ----157
NM_005204chr103991 745 695 --1947 --
NM_005207chr2293712 3662 3379 1233 1150 1118 739 487 28 13677 33688 3255 418 1748
NM_005214chr231085 817 64 1827 --21119 84
NM_005215chr181629 ------
NM_005224chr197629 570 559 540 466 450 441 ------
NM_005227chr1------1508
NM_005229chrX2851 351 --31300 961 279 1839
NM_005230chr122545 120 --2499 426 --
NM_005231chr1131406 1375 1292 --3975 176 164 1150
NM_005233chr3122496 2208 2111 2016 1999 1949 1930 782 643 621 425 168 21856 572 42620 2181 220 206 32595 809 395
NM_005235chr2317768 7686 7664 7570 7540 7492 7485 7271 7029 6621 6577 6416 5971 5952 5917 5646 5241 5015 2887 2662 2469 2080 1569 1538 991 887 877 793 768 639 313 32763 1777 1188 66142 5892 5138 2974 836 698 47856 7561 7217 6304
NM_005238chr11163557 3484 3303 3289 3214 2911 2858 2803 2192 1198 1179 1162 949 576 113 98 1309 73374 3321 3232 2958 2735 600 92 --
NM_005239chr2142055 1496 1388 594 11912 1724 2349 218
NM_005241chr381325 1312 1233 1112 944 856 450 193 --11410 1432
NM_005242chr571503 1469 1281 1200 1020 352 249 11455 ----
NM_005243chr221127 --2136 45 --
NM_005245chr43626 312 93 ------
NM_005249chr142669 256 1700 2705 85 --
NM_005252chr141492 --1694 1684
NM_005254chr1581351 1256 1233 1183 1035 963 506 170 1524 51344 1239 1082 1014 32 --
NM_005256chr114838 828 736 358 ----2613 161
NM_005257chr1851257 1080 934 309 125 1903 164 --
NM_005259chr241548 1286 1005 330 --11179 21386 1017
NM_005261chr86902 856 342 325 275 170 2823 796 1719 1751
NM_005264chr104911 885 240 134 ------
NM_005271chr1071205 1159 838 774 464 295 239 --1361 --
NM_005273chr73332 315 296 1323 ----
NM_005277chr471953 1835 1822 1789 1641 1358 381 21797 311 2636 390 --
NM_005278chrX2482 451 ------
NM_005279chr26312 249 206 145 61 35 1781 1333 --
NM_005281chr1----2717 623 --
NM_005284chr61454 --1432 1363
NM_005295chr72223 95 --1269 --
NM_005296chrX4852 443 413 48 1374 2779 419 --
NM_005302chr72359 163 --174 --
NM_005308chr101414 ------
NM_005310chr17----1381 --
NM_005311chr752757 2452 2147 669 395 12300 32818 2305 377 --
NM_005313chr1551080 477 334 279 270 ------
NM_005316chr1191153 1075 910 839 820 434 372 350 292 1862 1330 --
NM_005318chr225868 850 229 167 45 ----11172
NM_005324chr17112153 2021 1699 1620 1584 1372 833 527 412 68 49 1552 ----
NM_005327chr42291 229 ------
NM_005328chr87771 764 560 489 303 244 146 --1566 --
NM_005329chr1672150 2140 1905 1715 950 859 568 --22314 1445 22305 645
NM_005333chrX91242 1000 956 917 429 353 161 121 62 1316 31063 338 36 --
NM_005339chr4204304 4267 4250 4008 3940 3536 3359 3189 2905 2893 2850 1482 1426 995 920 772 353 281 219 212 44288 3120 1335 719 43982 3864 2856 904 168
NM_005342chrX22347 1878 2852 239 32639 793 646 --
NM_005347chr951412 594 497 396 52 --1155 --
NM_005358chr1381685 1484 1180 629 579 492 344 122 1528 41586 285 177 98 11507
NM_005359chr18256422 6004 5936 5752 5700 5619 5422 5378 5099 4977 4631 4611 2573 2395 2246 1815 1364 1346 1138 1055 951 421 175 100 90 64264 4098 2025 1648 1520 1338 106481 5076 4856 1632 1270 1032 857 742 622 559 --
NM_005369chrX4645 588 579 425 1175 1258 --
NM_005370chr192339 160 1875 2880 220 --
NM_005375chr691187 1131 848 798 773 387 302 268 80 1192 2328 106 1418
NM_005376chr121121 346 31108 983 970 1906 --
NM_005378chr27708 691 682 639 597 96 50 ------
NM_005384chr9----1238 --
NM_005385chr362498 2222 765 748 684 291 12381 22662 2538 1194
NM_005387chr112637 464 1221 ----
NM_005388chr971694 1504 1441 1080 469 217 87 11291 21168 65 11625
NM_005389chr67814 568 521 289 273 167 115 ------
NM_005392chr931761 1461 1396 --21208 1175 --
NM_005397chr774000 3765 3120 3024 3009 2834 146 23674 1500 12961 --
NM_005398chr1051139 1041 1029 450 119 --21409 249 1233
NM_005399chr1174215 3886 3826 3793 2813 1768 1731 1699 1424 1400 1052 988 945 811 331 194 98 33643 2999 973 44293 4258 3779 147 13275
NM_005400chr2112965 2951 2929 2834 2796 2255 2192 1000 711 608 595 12592 31977 1106 1021 --
NM_005401chr12205 164 --2248 184 --
NM_005402chr791733 1506 1361 713 587 533 439 162 92 --11414 --
NM_005406chr184996 616 500 146 11523 21293 260 11634
NM_005407chr1441272 1001 196 134 ------
NM_005409chr441071 311 136 110 2953 780 2958 831 --
NM_005410chr53510 268 222 2557 63 1187 --
NM_005412chr121569 --187 --
NM_005420chr46612 307 140 129 72 63 --1681 --
NM_005424chr11111 ------
NM_005433chr18112580 2502 2490 2258 2222 1951 966 764 674 525 152 22049 1783 --22617 2449
NM_005436chr10184145 3483 3432 3182 3115 3050 2805 1625 1512 1324 1240 1211 914 581 568 535 299 201 31390 1259 332 1371 13137
NM_005442chr35559 510 232 158 35 1197 ----
NM_005443chr42573 435 ------
NM_005445chr103277 235 211 ------
NM_005455chr1101668 1596 1483 1416 1294 738 612 399 375 35 21880 1568 31143 674 232 21496 161
NM_005458chr952219 1991 1942 1529 936 22446 1833 ----
NM_005461chr2041993 1701 683 388 --31586 1484 1236 11656
NM_005465chr141783 1552 618 400 ------
NM_005475chr1213024 33216 2777 2008 1665 12950
NM_005484chr14182 ------
NM_005487chr2242050 1481 364 175 22147 110 11896 1182
NM_005493chr62190 88 1787 ----
NM_005494chr75614 421 200 163 71 --1247 --
NM_005497chr17156097 4861 4108 4043 3916 1842 1792 1620 1312 979 740 676 662 437 341 --75059 4869 1965 1487 1083 318 28 21956 380
NM_005499chr191569 ------
NM_005502chr9102832 2724 2412 2299 2269 1018 979 633 551 309 12453 53112 2558 2155 1290 1039 11149
NM_005503chr152238 155 ------
NM_005504chr12166551 6332 5686 5564 5362 5187 4691 4550 2174 2021 1700 1655 1622 1541 863 368 75915 4254 2272 1914 1820 1450 473 35341 5047 4749 --
NM_005506chr432643 1883 862 32756 2630 679 1691 12154
NM_005509chr581883 1810 1626 1332 747 710 121 101 1737 31695 729 295 21468 1168
NM_005513chr391386 1359 1305 1288 532 518 417 239 229 21480 153 11461 1426
NM_005517chr131444 1126 901 --2102 62 --
NM_005519chr10----1158 1517
NM_005520chr51603 --2493 282 1488
NM_005521chr101273 1281 ----
NM_005522chr741236 922 876 523 --11349 1256
NM_005526chr81278 1287 ----
NM_005530chr1591444 1398 1360 1242 1150 934 383 365 192 1116 ----
NM_005536chr841365 449 219 141 11091 2964 35 --
NM_005537chr134378 365 342 335 1883 --1101
NM_005539chr1021190 556 1565 11105 11003
NM_005540chr161593 1054 433 279 255 21 11318 2270 263 11612
NM_005542chr751940 1780 1570 1448 1272 21246 451 --11948
NM_005544chr21163 --1784 --
NM_005561chr133847 796 206 ----2830 824
NM_005563chr14702 669 634 99 --2232 79 --
NM_005566chr113448 366 109 ------
NM_005573chr55499 469 456 269 261 1114 --191
NM_005574chr111697 1573 ----
NM_005575chr57836 771 683 641 262 255 67 1633 2557 153 --
NM_005578chr3225155 4867 4830 4818 4772 4669 4332 4177 4041 3662 3591 3556 1759 1490 1084 804 533 493 328 308 236 150 44415 1909 1297 285 74984 4532 4364 3896 3431 1863 710 21474 394
NM_005581chr19------1324
NM_005584chr13----1788 1584
NM_005585chr151287 --1319 --
NM_005587chr153976 930 813 --2874 27 --
NM_005593chr124608 552 498 191 ------
NM_005595chr13686 157 139 --3946 940 860 --
NM_005596chr9266093 6081 6037 5931 5554 5177 5164 4922 4812 4774 4279 4265 4046 4008 2522 2434 2038 1760 1751 1660 1619 1330 991 845 408 149 65876 5157 4664 4085 2085 1605 46272 5442 1988 1940 11881
NM_005599chr181491 1474 1395 1308 1270 1064 963 430 ------
NM_005602chr341153 1067 301 223 21135 944 3925 889 378 --
NM_005603chr18102004 1772 1733 1570 1556 1391 1365 1335 1255 739 1187 147 --
NM_005604chr682555 2476 2450 2324 1863 1711 630 572 22337 1767 12291 1110
NM_005607chr851036 838 732 186 116 2797 277 ----
NM_005611chr164463 429 256 77 1275 21327 980 --
NM_005613chr182039 2024 1507 1450 880 574 169 93 11705 ----
NM_005618chr61474 --4643 550 446 425 --
NM_005625chr861052 959 872 760 444 375 1815 1981 1277
NM_005626chr11357 1104 1442 --
NM_005627chr63963 392 159 1205 --1684
NM_005632chr1611025 ----1982
NM_005637chr1882044 1785 1371 773 685 416 399 368 --1356 11794
NM_005639chr122379 90 --11704 --
NM_005644chr13374 97 83 --2416 117 --
NM_005647chrX93485 3315 3125 3054 2155 952 923 532 418 --33140 1002 697 11024
NM_005650chr2211098 21197 1106 --1360
NM_005655chr851314 1074 946 351 319 1235 2325 252 --
NM_005665chr1144880 4526 4332 3373 1978 1621 1607 1299 1201 1121 662 380 148 64 23960 971 23145 841 2836 672
NM_005667chr21435 ------
NM_005668chr5194203 4187 3954 3235 3199 2822 2810 1756 1570 1537 1423 1264 1209 1166 1004 976 824 666 189 21653 961 43246 2917 1243 641 2834 625
NM_005669chr571954 1617 603 321 233 112 86 11711 11473 1160
NM_005685chr7--1113 ----
NM_005688chr351353 951 414 360 168 1152 1936 --
NM_005697chr151179 ------
NM_005707chr1531294 1257 137 11331 21336 1196 --
NM_005711chr53957 931 198 1375 2783 246 --
NM_005715chr692731 2674 2496 2423 2077 1864 1782 1017 629 --11752 12326
NM_005717chr121059 846 1299 21268 124 1347
NM_005718chr31246 ------
NM_005721chr281029 994 961 910 855 398 270 142 1945 1390 --
NM_005722chr272509 2358 667 291 243 164 37 42392 2263 613 389 1618 --
NM_005725chr192444 1720 1689 1629 805 797 750 639 239 3862 741 77 1765 12392
NM_005734chr113760 666 153 --2267 96 --
NM_005737chr272423 2337 2260 2018 1785 948 723 1144 32051 1134 764 --
NM_005738chr761907 1667 1333 737 536 507 11680 21352 692 --
NM_005739chr1591870 1844 1734 886 602 471 393 223 110 ------
NM_005742chr24271 242 163 55 ------
NM_005746chr782693 2644 1904 887 433 344 213 133 42552 1856 444 289 31000 916 369 --
NM_005748chr12143378 3105 2911 2732 2647 2392 2218 1252 1161 1042 831 752 347 272 33007 2156 280 32203 640 614 32900 2399 1139
NM_005749chr179680 589 566 261 196 178 149 78 54 --1549 --
NM_005751chr72472 346 --2434 75 --
NM_005752chr1651120 1092 988 794 449 187 1877 --
NM_005754chr581174 1132 1093 436 388 299 278 221 21236 239 1132 11039
NM_005759chr2164752 4744 4547 4528 4462 4301 3513 3438 3268 1796 1782 1734 990 968 527 123 33847 506 242 23994 1862 34607 3552 1789
NM_005765chrX4742 133 95 76 1728 2822 669 --
NM_005766chr133492 380 35 --1513 --
NM_005776chr145694 618 341 156 116 --1137 --
NM_005779chr563616 3035 2952 2549 1263 818 12344 22502 722 13208
NM_005780chr133997 724 681 ------
NM_005783chr23600 564 514 --1232 --
NM_005786chr1851055 1000 986 216 139 11101 1182 --
NM_005789chr1721925 1650 11377 11321 --
NM_005795chr2142896 2714 2553 2447 2269 1200 1178 1097 1054 944 886 490 292 100 32505 989 445 22853 2228 32736 2356 2240
NM_005797chr1191780 1751 1266 725 599 278 236 85 74 1522 41769 1545 1379 1365 1528
NM_005802chr96784 753 736 659 134 123 1207 1643 1326
NM_005806chr2141087 968 889 825 --21265 1098 --
NM_005808chr383089 2400 2382 748 684 437 418 174 1938 22750 232 33230 3152 2456
NM_005813chr2112624 2571 2544 2420 2302 1995 1977 1049 224 213 52 22393 503 42474 2401 924 256 --
NM_005819chr1123498 3451 3424 3298 3177 2835 2205 1223 1163 608 564 126 --1595 33004 2464 1264
NM_005822chr662293 2164 1876 1686 497 236 21984 1951 149 1858
NM_005826chr1----1169 1243
NM_005828chr17135073 5057 4845 4560 4544 4235 3964 1802 1727 1663 507 112 36 14251 34829 3764 1934 --
NM_005832chr361478 1420 1083 563 250 26 --71171 1049 550 504 493 418 376 --
NM_005835chr6235 24 1196 1471 --
NM_005836chr8--148 2470 194 1392
NM_005839chr13921 904 230 1288 2790 386 --
NM_005840chrX237203 7063 6963 6245 5997 5768 5685 5230 5010 4726 3070 3013 2927 2824 2369 2339 2312 2169 2078 1348 1197 1034 29 36661 5953 763 56895 3006 2180 1400 561 1556
NM_005841chr471066 1025 965 762 263 148 94 134 1955 11002
NM_005842chr136664 643 593 584 494 38 --1143 --
NM_005843chr291965 1768 1365 617 536 438 254 233 84 11856 31932 1815 499 --
NM_005853chr162413 27 --2574 64 --
NM_005857chr151357 1172 1080 434 84 2982 557 21041 987 11391
NM_005859chr531146 490 361 --11000 31561 1510 514
NM_005862chr33722 387 90 2813 299 --2677 377
NM_005868chr7132300 1905 1892 1683 1629 1565 922 834 599 533 300 209 139 32032 961 707 ----
NM_005870chr1331385 951 904 --131 --
NM_005871chr106917 439 431 351 234 182 21083 1045 3784 318 65 --
NM_005872chr11353 160 --1200
NM_005875chr32291 98 ------
NM_005880chr1631531 1053 330 3317 296 130 --11272
NM_005882chr42828 244 --1897 --
NM_005885chr5101584 1559 1478 1113 1081 621 577 382 320 73 ----11598
NM_005888chr121444 171 ----
NM_005896chr25639 533 278 203 64 1215 ----
NM_005898chr11112917 2793 2457 2351 2264 2247 970 802 688 479 283 1346 22536 626 22318 193
NM_005899chr1761204 578 349 297 252 155 --1328 2310 92
NM_005900chr481233 1116 1092 1083 1008 797 777 461 2789 255 --11169
NM_005901chr18378630 8623 8513 8240 8084 7952 7739 7447 7255 6983 6601 6553 6464 6440 6159 6106 5908 5407 3253 3141 2976 2879 2845 2796 2775 2632 2288 2181 2099 1782 1732 1640 1061 977 753 598 546 68590 7548 7419 7122 5901 362 56639 3007 2749 1569 464 28422 6003
NM_005902chr15114624 4507 4162 4064 3966 3883 3734 1583 1484 1100 1007 24517 2881 43259 3193 3163 1618 23315 1226
NM_005903chr5265235 5134 4932 4916 4884 4840 4658 4471 4117 4083 4043 3801 3759 3688 3517 3344 3214 1891 1844 1657 1020 847 745 686 300 147 34396 3981 856 75177 3662 2060 999 824 797 113 2420 278
NM_005904chr1851377 1259 1200 69 55 11505 21134 89 --
NM_005906chr651459 1334 1133 542 153 21695 1451 11545 --
NM_005907chr681659 1603 1596 1559 666 435 376 345 --1635 --
NM_005909chr5114008 3657 3371 3281 2634 1406 1391 1367 1311 670 571 23856 3723 33582 1659 987 14229
NM_005911chr241171 970 281 155 11161 21429 1049 --
NM_005920chr133789 2866 2393 --21382 178 13396
NM_005922chr61504 ------
NM_005923chr61553 2277 195 ----
NM_005924chr731135 922 218 --31092 430 277 --
NM_005925chr181146 --1110 --
NM_005927chr531097 171 82 1479 31158 1118 187 1839
NM_005930chr145739 610 190 133 86 1587 1700 --
NM_005933chr1152476 2067 1912 1073 755 11112 12531 --
NM_005935chr4205046 4808 4701 4529 4511 4011 3995 3849 3821 3814 3717 3570 1523 1426 1381 1196 1097 466 440 421 23742 3361 54802 4236 1081 303 40 1939
NM_005937chr1743666 3335 1500 502 --21614 1580 11178
NM_005941chr8174184 3964 3614 3498 3299 3134 2937 2848 2604 1252 1229 973 776 710 564 453 349 21688 1162 11641 --
NM_005944chr361098 972 936 839 784 146 --11081 --
NM_005955chr1125504 5470 5143 4879 4746 4101 3653 3596 3437 900 261 135 25250 4065 45406 4861 3671 1877 12018
NM_005962chr1032312 1588 1478 2892 244 1546 --
NM_005962chr1032312 1588 1478 2892 244 1546 --
NM_005964chr1731480 1038 245 ------
NM_005966chr292251 2230 2129 1888 1650 1602 933 410 386 21632 604 --12185
NM_005967chr123744 727 719 ------
NM_005968chr191195 --150 --
NM_005977chr135807 416 405 282 255 --2139 128 --
NM_005986chr1382007 990 937 669 616 349 252 92 22606 2476 --22055 831
NM_005989chr761603 1389 1072 1047 230 27 --11509 --
NM_005999chr141106 402 309 235 2346 98 41523 1034 975 320 21233 1083
NM_006002chr13186 ------
NM_006007chr9144521 4397 4168 3430 3068 1585 1566 1354 1026 913 859 142 86 40 --21676 389 23823 1329
NM_006010chr31226 --183 --
NM_006011chr1533273 1196 846 --13239 --
NM_006015chr131182 291 283 --11083 --
NM_006016chr6112201 2154 2106 1720 1514 1489 1408 887 796 421 233 --32062 1414 263 --
NM_006022chr132927 673 1761 ----
NM_006024chr75926 588 215 138 98 ----1635
NM_006029chr141787 --148 --
NM_006030chr341858 1810 1723 1553 ------
NM_006033chr18102090 2032 1971 1880 1840 1755 1546 1460 604 405 12351 22243 592 --
NM_006036chr2122565 2516 2493 2463 2454 2390 2013 1974 1946 1775 1727 114 1100 22547 555 31955 541 357
NM_006037chr2144473 4304 4219 3805 3470 1767 1672 1594 1546 1534 1443 1428 896 702 --63885 3644 1715 1703 1079 484 14231
NM_006038chr2031531 1474 193 --1758 1772
NM_006039chr1711063 ------
NM_006041chr17184 ----1101
NM_006042chr172465 400 --3376 109 47 --
NM_006047chr20183361 2945 2847 2780 2759 2737 2719 2653 2583 2571 2388 2367 2211 2154 1103 722 576 432 23142 852 ----
NM_006048chr151189 1068 827 463 345 ------
NM_006054chr1131523 1309 118 ------
NM_006060chr753529 3345 3182 2707 817 1190 33461 3190 177 23386 196
NM_006067chr1641069 1018 905 343 --2802 333 164
NM_006070chr33332 114 69 ------
NM_006079chr66842 810 772 712 178 92 1687 1795 --
NM_006080chr782035 880 788 770 634 449 182 85 21028 956 22670 1899 --
NM_006089chrX111906 1733 1599 1545 1255 757 674 571 497 441 115 --11267 11262
NM_006090chr11685 1120 2734 652 --
NM_006094chr882407 1751 1657 1541 954 928 692 55 1153 1642 1742
NM_006095chr4234262 4163 4150 4011 3933 3873 3854 3666 3564 3517 3073 2914 1768 1594 1564 1400 1326 1292 1252 1005 854 798 205 --33466 3287 1387 14087
NM_006100chr3--161 146 --
NM_006106chr11143148 2922 2829 2812 2579 2213 1240 1001 601 550 541 229 145 132 21260 1015 23422 3360 12772
NM_006107chr17154 1410 ----
NM_006108chr1192111 1792 1700 1614 935 793 664 565 108 --52227 2000 1748 738 727 11487
NM_006110chr16197 ------
NM_006113chr182133 2066 1987 1849 1652 1524 759 366 1550 ----
NM_006135chr151372 562 506 377 95 ------
NM_006136chr781220 1210 1039 1000 918 908 358 304 21305 1258 1169 --
NM_006139chr272820 2727 2294 2229 734 685 131 22306 2202 12522 --
NM_006141chr16102761 2500 2488 2211 1982 879 859 829 609 72 12063 32366 1956 865 --
NM_006143chr121113 ------
NM_006153chr31668 1556 --1138
NM_006154chr15102924 2840 2039 2009 797 788 654 559 522 468 32697 998 176 12309 21006 166
NM_006155chr242023 2008 1536 649 2372 151 11950 2512 187
NM_006157chr112389 343 --1332 --
NM_006158chr841777 1670 1421 525 11148 2561 440 --
NM_006161chr53656 567 24 --1608 --
NM_006162chr181108 --11785 1471
NM_006164chr22398 87 --1363 --
NM_006166chr1281977 1892 1857 1735 807 693 563 322 21673 727 51882 1609 526 344 227 --
NM_006183chr124563 537 392 135 ------
NM_006186chr261240 1113 1078 1013 973 280 --11157 --
NM_006187chr1222404 747 22950 926 12525 --
NM_006190chr24995 332 307 156 --2836 101 --
NM_006191chr122386 222 ------
NM_006195chr941444 1438 285 261 11056 ----
NM_006197chr852226 1973 1762 805 241 --22254 115 --
NM_006198chr211243 ------
NM_006202chr1931477 1240 469 1270 1245 --
NM_006203chr5155589 4973 4438 4278 4233 4116 3976 3487 2003 1284 887 825 581 365 283 44555 3555 1438 1230 44902 4353 4299 670 2981 598
NM_006204chr102229 213 ------
NM_006206chr4112786 2764 2532 2478 2266 2255 2097 2013 510 483 171 1894 32720 2594 1157 12487
NM_006209chr81104 ----149
NM_006212chr1134788 4706 4667 4495 4100 4089 1618 1583 1180 986 598 482 436 24697 3582 44991 3875 1108 425 24890 840
NM_006216chr24673 666 485 40 --194 --
NM_006223chrX--1100 ----
NM_006226chr21130 11156 --11261
NM_006232chr3--1222 1239 --
NM_006237chr1362010 1958 1621 694 501 53 ------
NM_006241chr3142418 2234 2226 1620 1613 945 614 594 461 392 343 302 294 204 11507 31969 815 251 1545
NM_006242chr2052140 1857 1471 631 340 21526 734 --11565
NM_006243chr121087 113 --3379 359 49 --
NM_006246chr1411340 --1983 11268
NM_006251chr593312 3167 2961 2869 2605 2462 660 273 264 22667 1192 52977 2704 2198 2103 1015 42951 2730 2290 670
NM_006252chr1277579 7297 7269 6471 6435 6361 6225 6088 6044 5863 5682 5287 5252 4841 4673 4619 2904 2797 2744 2346 2260 1316 1244 912 737 431 351 66757 1789 1164 649 260 62 67396 7344 7151 6016 819 72 21389 1207
NM_006256chr1152754 2421 2414 2228 2169 2124 2098 2018 1923 1789 1035 675 571 537 317 1746 42729 2479 1901 273 1293
NM_006259chr48906 831 784 727 691 648 276 74 1969 1224 --
NM_006264chr42367 185 --1502 1175
NM_006265chr861539 1214 1192 1144 138 99 1323 ----
NM_006267chr281694 1612 1594 1515 747 683 148 88 1633 11582 --
NM_006273chr173432 332 92 ------
NM_006275chr20112512 2505 2447 1938 1754 1742 765 635 442 248 231 12455 21792 708 2750 370
NM_006279chr1------1370
NM_006281chr82436 420 11064 --2779 79
NM_006281chr82436 420 11064 --2779 79
NM_006282chr2054578 4526 3202 2881 1892 2353 234 21603 963 13211
NM_006283chr8134666 4318 4119 3869 3654 3276 1343 976 818 621 408 380 319 11148 14963 23940 1211
NM_006287chr2112602 2526 2137 1899 1883 993 897 639 250 231 41 --42665 804 162 74 22480 91
NM_006290chr651954 1798 1519 1380 700 ------
NM_006291chr1411518 21461 548 32018 2003 1325 --
NM_006296chr23168 129 32 ------
NM_006298chr673380 2725 1290 991 927 630 542 ----1611
NM_006299chr6----1242 --
NM_006300chr1982337 2243 1783 1740 1582 617 333 194 --22312 1620 --
NM_006305chr15------1202
NM_006306chrX65935 5847 4036 3987 847 702 --21985 1414 --
NM_006307chrX2323 119 1344 ----
NM_006310chr1741289 1200 509 382 ------
NM_006313chr1271591 1579 1539 1333 688 357 304 11207 11219 --
NM_006315chr4103871 3852 3844 2874 2801 2754 1473 1240 322 128 22766 407 12810 1795
NM_006317chr5----2619 239 --
NM_006320chr42437 252 --1956 1755
NM_006321chr352154 2114 894 499 175 1228 1860 --
NM_006322chr131761 2631 604 1838 --
NM_006330chr871530 1361 1105 1099 1046 594 300 1609 11160 1452
NM_006333chr25543 499 465 448 147 ------
NM_006334chr93222 110 83 1100 ----
NM_006345chr441198 950 313 137 2896 377 ----
NM_006346chr134481 198 181 98 1357 1187 --
NM_006352chr132003 433 283 22067 1833 41920 1623 1577 823 2506 462
NM_006353chr651013 919 881 533 99 --160 --
NM_006359chrX92435 1972 1921 1001 909 896 449 363 234 12301 32471 2317 2233 --
NM_006360chr11121 ------
NM_006363chr201597 1249 3558 233 84 1576
NM_006364chr1491265 1255 999 874 863 479 426 202 58 11025 41313 895 447 108 1514
NM_006366chr641291 1178 983 100 2394 332 ----
NM_006371chr354235 3517 1710 1561 917 --2752 688 1386
NM_006372chr62194 121 ----2442 188
NM_006375chrX31346 613 564 11787 1327 31385 748 76
NM_006378chr951416 1275 522 494 150 --21409 479 --
NM_006379chr792190 2114 2063 1971 1671 934 763 352 84 1419 1744 12008
NM_006380chr17204243 4086 4011 3990 3736 3611 3440 3380 3269 2995 2690 1621 1611 1420 1344 1254 777 652 388 133 22885 1130 23309 3021 44080 4025 903 797
NM_006386chr2252290 1760 961 449 124 --1324 1515
NM_006390chr12111680 1667 1485 1362 1296 675 640 576 413 394 189 21144 143 --194
NM_006391chr112324 230 --1240 --
NM_006393chr10124581 4541 4234 4157 3617 3539 3276 2884 1305 1242 901 98 33899 2795 1271 53561 2871 1735 430 291 21253 77
NM_006401chr91402 1335 2428 408 1475
NM_006403chr641129 372 120 100 31848 1774 1372 31548 260 89 11832
NM_006413chr1041147 1096 1007 219 --2466 303 1975
NM_006415chr991240 1208 1194 984 909 814 494 303 217 31115 973 883 31293 1173 175 --
NM_006420chr20123459 3365 3278 2784 2567 2504 2259 2169 958 914 590 250 53184 2652 2339 2224 581 12817 --
NM_006421chr831123 482 378 1839 ----
NM_006424chr441943 1671 1559 319 21773 183 ----
NM_006427chr141128 ------
NM_006434chr1023174 2989 32875 2833 793 13190 22535 30
NM_006451chr551039 838 809 759 707 1731 1322 2893 850
NM_006457chr493348 3047 2991 2764 2509 1052 978 878 217 23134 72 44053 2957 833 206 13028
NM_006459chr1062030 1747 1661 1590 1583 1324 ------
NM_006460chr1791825 1488 622 534 450 434 279 169 39 --21594 210 --
NM_006463chr2----2597 178 --
NM_006464chr2184542 4534 3787 3608 3177 3034 2914 1871 1829 1694 1520 1447 863 698 573 508 215 76 31791 948 803 44611 4576 642 488 --
NM_006466chr202860 682 --1144 --
NM_006467chr592292 2128 2073 2052 1535 767 760 283 71 --2939 450 128
NM_006469chr171403 1200 1118 561 539 227 120 --3469 233 158 1211
NM_006471chr182286 89 --1259 --
NM_006475chr132610 458 --3579 520 150 --
NM_006479chr124880 855 828 756 1923 ----
NM_006482chr12183459 3423 3414 3395 3088 2855 2469 2420 2388 1438 1380 1357 1334 1243 1020 215 204 189 43283 3250 3081 636 2790 735 --
NM_006489chr1451793 474 218 190 72 --11701 --
NM_006496chr161946 1706 1620 1269 594 147 2361 164 ----
NM_006497chr17----1233 --
NM_006502chr6169 1112 138 --
NM_006504chr10102941 2819 2649 2156 1088 608 441 253 115 47 --42731 1158 169 24 12630
NM_006506chr3142 ------
NM_006516chr121183 239 ----21277 263
NM_006517chrX3777 277 73 1876 12196 1195
NM_006520chrX91578 1438 1077 597 580 499 299 287 115 21672 437 1555 --
NM_006526chr20112099 2062 1930 1869 1560 1448 1398 1355 315 263 191 21657 789 32010 1669 282 --
NM_006527chr42186 147 --2759 137 --
NM_006529chr471612 1513 1389 1192 422 331 140 21180 542 31379 1330 668 11343
NM_006534chr20163409 2860 2764 2630 2476 2375 2089 1271 1169 1134 964 828 690 318 307 134 11045 42712 2199 1231 883 12682
NM_006536chr12387 376 1138 1986 --
NM_006537chr153215 111 97 1237 ----
NM_006538chr2113500 3276 2873 2773 1519 1293 998 793 739 378 355 44167 1663 1546 500 2718 239 33894 571 482
NM_006540chr871442 1436 1292 1177 1055 463 396 21589 1525 ----
NM_006544chr14366118 6065 5762 5755 5710 5702 5649 4935 4913 4485 4431 4073 3997 3985 3933 3845 2269 2116 2085 2050 1922 1896 1884 1832 1333 1315 972 813 757 667 629 561 537 500 479 199 45373 4878 2108 1849 96050 4762 4410 3943 3831 1359 1345 1030 205 25736 351
NM_006546chr17206544 6468 6346 5787 5729 5683 5560 5117 4834 2394 2210 2182 1794 1742 1716 1705 1668 916 534 487 21216 250 32387 1800 902 --
NM_006547chr7122137 1978 1885 1865 1848 1760 1495 769 629 360 175 144 2712 554 --21985 482
NM_006548chr371633 1385 1277 1145 561 532 474 1515 11393 --
NM_006549chr1262792 2258 2129 1123 861 580 1573 1277 --
NM_006554chr25302 290 222 143 33 --1102 --
NM_006555chr711939 1122 1231 --
NM_006557chr9--1394 41657 1565 300 41 --
NM_006558chr84518 356 139 67 ------
NM_006559chr15906 835 231 189 80 --1250 --
NM_006560chr11----1329 1186
NM_006561chr10195206 5065 4929 4179 2470 2463 2117 1831 1675 1568 1525 1474 1385 1335 1162 998 734 609 530 11433 116202 6167 6139 5905 5471 5374 3880 3795 1791 1658 340 11650
NM_006565chr1631200 1098 67 --31191 435 429 11119
NM_006570chr91349 ----164
NM_006572chr17153336 3218 3138 2937 2927 2348 2332 2242 2166 1222 1181 1167 538 465 307 22719 884 33203 1051 141 22796 573
NM_006574chr33352 296 285 ----1137
NM_006575chr1471271 1133 938 549 153 133 96 2516 425 11354 1312
NM_006577chr291225 1089 1039 1027 907 855 820 188 40 1248 31315 1239 1132 1454
NM_006582chr1------163
NM_006587chr461682 1093 188 160 99 24 21635 1203 51431 1262 1043 461 174 --
NM_006595chr1171989 1857 1803 810 672 626 263 21286 607 62049 1948 1415 1332 254 207 --
NM_006599chr16398222 8139 8087 7883 7632 7606 6942 6773 6652 6521 6113 6019 5950 5727 5448 5062 5005 4991 2780 2557 2530 2502 2399 2083 1993 1967 1950 1856 1673 1197 1077 1039 890 461 421 386 276 204 78 58002 7995 5781 5114 3047 86906 5119 2763 1582 1538 868 650 371 --
NM_006601chr124840 767 130 119 1922 ----
NM_006603chrX101879 1711 1545 1393 777 596 579 260 235 97 1571 2634 282 22033 608
NM_006606chr20123062 2709 2702 2301 2151 2103 1966 727 377 356 213 22 1957 --11975
NM_006609chr2142929 2831 2590 2563 2351 2029 1985 1897 1885 1874 879 747 178 72 1234 12383 --
NM_006614chr3153649 3227 3148 2917 2355 2235 1463 1344 1291 1266 1102 946 681 642 157 --33287 3217 1163 22945 839
NM_006618chr181475 1443 1377 631 519 197 188 144 1465 21387 206 --
NM_006620chr6114353 4083 2983 2950 1414 1273 1085 814 506 441 253 23664 849 33902 3009 833 --
NM_006621chr171694 1659 1592 1491 735 627 103 21994 72 158 --
NM_006622chr54499 452 438 400 ------
NM_006624chr1061828 1821 1527 427 218 122 2618 274 21751 562 --
NM_006625chr161064 772 463 430 396 87 11205 11142 --
NM_006625chr161064 772 463 430 396 87 11205 11142 --
NM_006625chr161064 772 463 430 396 87 11205 11142 --
NM_006626chr9132345 2324 2226 2096 2033 1979 1801 999 799 569 469 458 113 --52143 2134 1060 805 513 1603
NM_006628chr15103974 3601 3428 1533 1088 1071 932 848 718 707 11035 74591 4431 3786 3116 1804 1168 70 13610
NM_006629chr1862479 2287 1851 1058 945 852 1603 12259 1971
NM_006633chr53728 565 113 --167 --
NM_006636chr25952 940 777 757 745 --3912 879 818 181
NM_006644chr133488 482 91 1651 144 --
NM_006646chr1362916 2585 2242 2209 529 260 33076 3014 1951 22319 1980 12309
NM_006648chr92167 119 ------
NM_006653chr61101 --1380 1436
NM_006654chr12174729 4423 4404 4244 3862 3736 3559 3465 1808 1563 1555 973 880 600 484 345 113 74532 4221 4062 3856 1774 337 282 34390 3149 1068 24367 1159
NM_006658chr72467 92 1218 --21011 827
NM_006667chrX41181 1124 778 35 1367 128 --
NM_006670chr62633 255 --1598 --
NM_006675chr1272201 949 622 589 515 508 486 12195 ----
NM_006682chr752254 2242 1012 767 280 22324 1058 52713 2231 1936 1929 89 --
NM_006691chr11--11022 21027 976 1789
NM_006693chr7--2846 662 1176 --
NM_006699chr182501 2350 1763 1747 1666 450 233 81 12434 22420 872 11028
NM_006704chr135451 383 304 142 130 --2426 323 1414
NM_006710chr231101 1016 76 ------
NM_006711chr164792 710 329 63 --1695 1690
NM_006716chr761317 1282 1221 497 266 87 157 21265 22 --
NM_006717chr983275 2417 2145 1159 889 802 548 75 33357 3259 1078 --22728 1017
NM_006718chr631112 1078 192 1951 122 1779
NM_006721chr105835 679 339 287 99 1268 ----
NM_006722chr371111 829 749 186 145 122 111 31070 340 311 52836 2136 841 835 819 51218 1016 896 890 152
NM_006724chr61504 ------
NM_006726chr42252 162 --4979 427 142 116 1230
NM_006727chr51110 1357 1524 1537
NM_006729chrX225488 5436 5144 5137 4411 4372 4276 4121 4112 3946 3926 3799 3664 3533 2039 1878 1307 1254 777 764 739 597 --45271 2119 1831 791 12095
NM_006731chr9165842 5791 5687 4803 4505 4082 2274 1841 1552 1457 1262 1233 953 893 732 537 2973 832 55490 3754 2142 1881 1396 1458
NM_006732chr1912071 11940 21908 1421 --
NM_006734chr681412 515 493 324 304 281 257 44 1452 2538 131 2427 222
NM_006735chr7192 --3342 307 86 --
NM_006738chr1564591 4542 3426 3410 3150 1471 --31445 1292 1286 --
NM_006745chr491118 1018 975 957 942 414 301 167 159 --1425 --
NM_006746chrX81560 1387 1226 1181 974 517 454 74 1590 11026 1251
NM_006749chr841282 1044 1034 434 11243 ----
NM_006750chr16128123 7735 7067 6631 6459 5769 5145 2948 2114 1904 835 800 37743 6889 329 45097 2723 1263 771 47779 6316 2123 728
NM_006751chr271075 945 909 888 330 301 52 --1158 --
NM_006754chr74932 887 509 257 1240 21217 137 11227
NM_006756chr891457 1405 1281 1198 1129 1017 574 385 306 31493 1356 102 21108 224 --
NM_006759chr2186 2269 120 ----
NM_006763chr152142 1769 763 749 645 --3589 524 120 190
NM_006764chr3--1409 2474 103 151
NM_006766chr8132670 2529 2384 2352 2325 2210 1705 967 728 354 302 138 124 21680 405 22503 144 12240
NM_006772chr631631 1093 398 ------
NM_006773chr281622 1559 1427 620 350 259 76 50 11532 21551 442 1571
NM_006775chr6143062 2981 2913 2833 2609 2584 2499 2449 2171 1164 1060 999 725 188 22948 2235 52786 2667 1121 976 799 2934 683
NM_006777chrX72740 2687 2614 1181 1050 948 134 2769 148 22897 2223 1977
NM_006783chr134644 605 282 140 ----1598
NM_006785chr1841722 1476 834 272 --1467 1340
NM_006788chr1852132 2123 1614 1339 281 11566 21382 331 --
NM_006800chrX3596 457 214 --2639 542 --
NM_006801chr194563 542 526 92 ------
NM_006803chr861602 1522 1384 630 359 38 ------
NM_006805chr551756 1376 548 398 225 1496 1255 1509
NM_006806chr212374 331 ----1128
NM_006807chr1731171 994 154 1385 ----
NM_006811chr205872 665 635 234 105 2848 815 ----
NM_006813chr67735 721 354 246 162 155 37 ------
NM_006814chr2052487 2191 2115 1996 406 11850 1791 --
NM_006815chr1271015 876 554 536 528 425 360 187 21122 882 --
NM_006818chr12813 332 ------
NM_006820chr1103945 3697 2854 2761 2648 1552 1250 1183 932 518 34308 4259 1714 44250 3661 477 97 --
NM_006822chr172297 274 --1587 --
NM_006823chr851172 971 896 238 178 11191 ----
NM_006826chr231082 1057 448 --1839 --
NM_006827chr14113380 3206 3195 3107 2955 2658 2651 2480 2229 646 398 12797 43078 2972 1321 1278 --
NM_006832chr1421079 320 11099 ----
NM_006838chr1261925 1648 1265 553 341 34 21658 199 2388 303 1117
NM_006842chr111110 ------
NM_006851chr1272793 2118 1009 923 658 90 54 32726 291 222 32705 838 345 11991
NM_006852chr1762803 2762 2741 2414 2404 2135 22492 572 42573 898 608 133 1120
NM_006854chr792020 1581 1413 1274 1254 755 332 322 220 --21310 449 12060
NM_006857chr23194 66 27 1808 --1782
NM_006868chr1853218 2840 853 627 261 22718 610 23181 504 11052
NM_006873chr2103184 3163 2926 1010 960 913 843 813 681 301 21039 793 63265 1279 971 529 178 171 12629
NM_006874chr451150 1060 924 480 385 1106 ----
NM_006884chr341877 1505 782 519 --11855 --
NM_006885chr16154057 3862 3570 3109 2581 1540 1338 1261 1176 1037 945 848 687 656 597 22836 675 63747 3394 2623 1448 1315 1240 --
NM_006887chr22541 262 ----1220
NM_006888chr1483086 2826 2810 2800 2773 2649 1339 910 31399 1142 682 --12893
NM_006892chr2081315 1265 1254 1213 1090 427 292 244 21391 496 --11289
NM_006892chr2081315 1265 1254 1213 1090 427 292 244 21391 496 --11289
NM_006895chr261987 641 589 460 383 37 1474 21460 739 --
NM_006901chr153509 464 429 ------
NM_006908chr781417 1165 1099 1077 1065 160 144 126 --2964 271 --
NM_006910chr163414 383 297 1146 ----
NM_006913chr61372 ------
NM_006914chr931543 1025 332 11379 31366 346 133 --
NM_006915chrX102387 1877 976 967 914 563 548 397 301 74 52529 850 799 463 113 42059 1722 369 125 11886
NM_006916chr241256 1151 948 499 2250 190 31015 929 103 11108
NM_006918chr11185769 5402 5030 4985 4940 4782 4734 4671 4403 3847 3808 3677 2281 1560 980 893 863 837 45486 5124 4813 2349 24316 1452 13551
NM_006920chr292084 2078 1868 1689 1525 1517 1449 1302 676 1388 51775 1607 1542 1455 451 21314 65
NM_006922chr2112475 2003 1853 1710 1593 928 855 818 763 608 525 12211 21744 433 42559 684 362 338
NM_006924chr17174416 4240 4135 4059 4042 3811 3791 2824 1615 1581 903 707 687 626 396 186 75 12871 43856 1629 632 347 1975
NM_006930chr571839 1737 1530 1364 453 315 79 11474 21877 1573 11273
NM_006931chr1282011 1639 1525 1324 505 478 286 178 --1596 --
NM_006937chr172473 198 ------
NM_006938chr1841095 877 701 234 1198 3920 905 44 --
NM_006939chr1451161 943 839 335 84 41211 1036 415 140 3958 324 93 --
NM_006940chr1291357 1312 1292 754 667 577 495 299 107 21894 421 21443 767 --
NM_006941chr2211041 ------
NM_006948chr2172317 2097 1669 970 898 632 275 12266 41919 1602 1535 824 --
NM_006952chr3----1184 1278
NM_006959chr192355 343 ----1374
NM_006962chrX21247 78 ----1478
NM_006963chr1051275 1199 895 92 24 --1438 --
NM_006965chr181904 1874 1970 --
NM_006980chr72823 130 --1226 --
NM_006981chr982578 2535 2264 1069 615 526 374 291 32200 1050 780 22498 2252 42881 2506 1963 1944
NM_006982chr12----122 --
NM_006993chr101279 1262 ----
NM_006996chr181912 1563 1317 1248 595 559 231 70 --11862 21897 1299
NM_006999chr552008 689 571 536 341 12082 1518 12053
NM_007005chr951301 1214 1053 566 293 11572 11200 --
NM_007006chr16183545 3439 3378 3270 2870 2807 2622 2588 2498 2306 1218 1186 429 385 309 262 254 206 --43113 2226 893 225 23495 2824
NM_007007chr12234843 4720 4605 4269 4201 4162 3702 3565 3479 3329 3301 3082 3018 1817 1808 1750 1705 1636 1626 1213 1062 1043 247 24404 531 64194 3440 3350 1737 687 187 1182
NM_007008chr21287 ----1134
NM_007011chr15106736 6245 5338 4439 2076 1541 1325 699 354 337 46536 4758 2762 1340 66821 6632 1995 1555 945 184 1281
NM_007013chr85891 791 740 359 173 --1814 --
NM_007017chr54710 686 644 632 1610 2866 655 1848
NM_007018chr91136 --2397 373 --
NM_007019chr202174 43 ------
NM_007023chr261019 989 839 776 759 347 --1979 --
NM_007026chr171141 1199 --1607
NM_007033chr12644 625 --1591 --
NM_007034chr171044 998 871 673 660 207 27 1169 11004 1237
NM_007038chr21196039 6015 5723 5563 5407 5244 4858 4673 4049 3968 1869 1770 1555 1417 1106 905 893 583 534 45705 5169 4902 2208 116092 5442 4964 4950 4850 4208 2115 2053 1854 1278 735 42317 2110 1788 1669
NM_007039chr14132025 2010 898 857 626 609 589 419 396 376 308 289 79 22307 1862 32095 767 518 --
NM_007040chr194958 702 223 186 --2772 447 1983
NM_007043chr1241859 1687 1306 101 12162 31909 726 170 21926 356
NM_007045chr63532 431 58 --1138 --
NM_007050chr20167866 7591 7379 7252 6022 5917 3133 2946 2875 2496 2390 1660 1611 1546 1215 880 13000 47973 1008 701 307 --
NM_007054chr5133912 3901 3724 3120 2807 1560 999 980 967 960 943 868 648 21133 157 53735 2815 1143 1103 835 1803
NM_007068chr2231035 961 362 ------
NM_007073chr6134175 3737 3235 3121 3043 2853 2564 1600 733 570 251 96 70 2191 82 44191 923 875 328 34035 2747 744
NM_007074chr161106 ------
NM_007078chr1093019 2952 2923 2842 2444 2212 1068 818 322 12907 23058 1907 1447
NM_007080chr45350 116 65 55 24 --2320 43 --
NM_007084chr1361551 1354 1099 975 340 288 11043 11254 --
NM_007106chr13132671 2648 2601 2035 1995 1903 1719 1064 668 596 383 193 180 21736 1039 32420 2138 209 12024
NM_007107chr362396 2282 2150 1569 914 846 ----11559
NM_007111chr132283 56 --2654 260 --
NM_007114chr3163285 3240 3164 2988 2626 2569 2453 2320 1084 879 802 533 274 242 175 127 21051 983 42837 1009 226 199 1896
NM_007115chr2----2333 100 --
NM_007118chr52278 241 ------
NM_007123chr161270 899 809 244 120 49 2909 74 11107 11081
NM_007124chr691801 1779 1642 1550 1494 1289 797 447 180 21676 400 22008 748 --
NM_007125chrY61169 1129 900 520 462 327 1421 21281 985 --
NM_007129chr134994 834 397 149 1115 2764 726 --
NM_007144chr1751324 265 181 85 54 ------
NM_007145chr1931424 1129 925 --31237 1228 513 11248
NM_007146chr1772895 2384 1156 887 863 713 137 21810 60 12769 --
NM_007157chrX72489 2438 2252 1168 955 886 520 --22934 438 3719 260 39
NM_007158chr141244 1182 459 361 ------
NM_007159chr3111678 1648 1428 1414 1275 701 559 367 333 227 141 2495 240 21449 474 --
NM_007166chr1161594 1536 1438 1404 1170 487 1637 11294 --
NM_007172chr22133219 2459 2368 2289 2163 2139 2058 512 375 315 245 234 122 --23213 1050 22344 519
NM_007173chr1192160 1906 1850 1801 1631 1579 689 533 49 1323 2810 233 1646
NM_007174chr1282319 2146 2028 1740 1545 626 366 274 1498 22160 2124 --
NM_007175chr853358 2837 2588 552 539 12888 33562 3215 49 --
NM_007178chr121342 ------
NM_007185chr12817 788 ----11009
NM_007187chr132783 165 --3967 355 147 130
NM_007190chr1071160 1108 1082 989 914 397 25 ------
NM_007191chr125713 612 489 284 217 2467 447 ----
NM_007192chr1431136 968 915 --180 --
NM_007195chr18123663 3535 3362 3193 2792 2782 2429 1332 1136 1060 353 47 22389 494 93383 3096 3081 2881 2801 2412 2323 271 233 32876 2870 1341
NM_007197chr1251017 754 661 380 295 --21001 54 --
NM_007198chr831445 1432 1157 --31659 1523 1457 --
NM_007200chr1564591 4542 3426 3410 3150 1471 --31445 1292 1286 --
NM_007203chr983979 3931 2907 2566 1577 989 618 220 1906 23810 1150 2826 575
NM_007204chr14649 505 239 150 1193 ----
NM_007207chr15968 791 622 236 174 --1912 1148
NM_007212chr1102242 2120 1942 1490 916 862 537 409 304 33 21604 371 2774 204 180
NM_007214chr651309 886 850 358 47 1515 11007 21183 521
NM_007216chr113959 861 380 --2839 132 1435
NM_007217chr3----1156 --
NM_007222chr881504 1461 1440 1349 1332 1236 1135 265 21782 1340 21356 709 --
NM_007224chr12----1650 --
NM_007231chrX92468 2410 2135 1785 380 341 310 125 42 1289 32046 541 267 11794
NM_007235chr123422 135 67 --1513 --
NM_007236chr1552346 2137 1998 1641 639 21650 960 1483 --
NM_007241chr171238 --1133 --
NM_007245chr161796 1910 1915 --
NM_007246chr47921 821 775 739 322 276 190 --1166 1815
NM_007249chr13149128 9100 8762 8009 7858 7770 6877 3475 3456 2555 1973 1757 1707 1676 36465 3638 1822 59273 7940 7619 6731 1614 --
NM_007250chrX3448 367 72 ------
NM_007255chr52599 551 ------
NM_007257chr872759 2508 1824 1178 1034 524 56 12684 32701 2412 394 32806 2046 1833
NM_007269chr16242 226 194 168 115 98 ------
NM_007270chr741474 1451 1254 395 --1568 --
NM_007271chr641557 1444 1136 228 11865 31345 671 57 --
NM_007276chr751093 1019 432 281 182 ------
NM_007279chr193642 524 406 ------
NM_007281chr41184 ------
NM_007282chr32146 65 1970 1104 --
NM_007285chr161187 ------
NM_007287chr373145 2262 2169 1103 635 578 540 23194 750 1714 23254 450
NM_007288chr373145 2262 2169 1103 635 578 540 23194 750 1714 23254 450
NM_007289chr373145 2262 2169 1103 635 578 540 23194 750 1714 23254 450
NM_007294chr1741147 1131 234 124 ------
NM_007295chr1741147 1131 234 124 ------
NM_007296chr1741147 1131 234 124 ------
NM_007297chr1741147 1131 234 124 ------
NM_007298chr1741147 1131 234 124 ------
NM_007299chr1741147 1131 234 124 ------
NM_007300chr1741147 1131 234 124 ------
NM_007302chr1741147 1131 234 124 ------
NM_007303chr1741147 1131 234 124 ------
NM_007304chr1741147 1131 234 124 ------
NM_007305chr1741147 1131 234 124 ------
NM_007308chr41579 ----1586
NM_007313chr931776 1557 364 --21966 1563 --
NM_007327chr91242 ------
NM_007331chr462556 2500 2012 724 673 192 42376 1986 758 515 22531 1947 12290
NM_007332chr831226 519 172 21348 295 11079 --
NM_007345chr18112354 2241 1890 1867 1800 1777 1771 1586 1522 1478 1457 --32153 1603 918 32325 2031 1761
NM_007347chr15153168 2991 2962 2907 2393 2158 2061 1985 1081 798 779 697 664 471 298 --42968 2534 2194 587 33022 2404 2071
NM_007349chr72378 108 --1452 1389
NM_007353chr742499 1019 411 280 --12507 22691 287
NM_007358chr192000 1946 1869 1730 1700 1481 1303 299 218 2738 80 22043 1989 21860 1326
NM_007361chr142493 152 ----1192
NM_007362chr331278 1084 604 41468 1392 305 92 1392 --
NM_007372chr172845 798 2715 43 2742 332 --
NM_007373chr10111797 1540 1460 1151 447 433 377 365 353 322 161 --11591 21347 1205
NM_007375chr1122825 2802 2696 2393 1837 1827 777 628 410 301 152 50 21012 693 32161 884 143 --
NM_009585chr33865 167 143 --3325 311 98 --
NM_009585chr33865 167 143 --3325 311 98 --
NM_012064chr1211097 --1113 11052
NM_012069chrX51988 1802 823 752 180 --21996 1833 --
NM_012074chr142471 272 --31027 123 79 --
NM_012081chr5123694 3605 3123 2997 2940 2846 2640 1138 428 322 239 153 22857 2663 41080 915 407 135 13394
NM_012082chr84723 664 641 206 2696 331 1242 --
NM_012084chrX3453 226 218 ------
NM_012089chr191565 1525 1299 1105 375 265 245 230 202 11387 21151 120 1430
NM_012090chr171197 1165 977 827 497 335 161 1525 1137 --
NM_012093chr121250 1178 --11238 --
NM_012095chr1083403 3328 2862 1341 754 506 244 206 1632 22351 615 2826 791
NM_012096chr3153763 3736 3499 3271 3084 2365 1397 1371 1268 998 844 778 583 476 281 31286 506 303 33673 3410 379 23316 3094
NM_012097chr2112266 1776 1756 708 599 444 413 351 231 181 112 ------
NM_012099chr194991 854 314 185 11205 1399 1863
NM_012102chr182640 2631 2172 1868 657 525 472 63 1451 22245 595 --
NM_012108chr42507 46 ----168
NM_012115chr63583 566 546 ----2392 230
NM_012118chr4----140 --
NM_012120chr6132745 2691 2225 2131 1104 1025 996 897 777 689 580 234 170 2961 680 52938 2716 2363 886 425 42042 522 516 319
NM_012124chr112918 333 2582 44 ----
NM_012129chr7102431 2261 2097 1790 1578 700 586 533 445 189 21752 653 31947 1691 365 12540
NM_012137chr152793 2132 2090 1170 884 22899 2013 52425 2344 482 371 299 --
NM_012141chr13234026 3904 3569 3554 3392 3051 3042 2886 2855 2784 2722 2636 1553 1393 1372 794 524 496 470 436 380 371 301 33989 2571 220 33775 611 184 21600 1335
NM_012153chr1162196 1735 893 717 260 177 12048 191 --
NM_012155chr19144 ------
NM_012156chr2063281 3153 3120 932 619 304 --12884 --
NM_012157chr331017 897 882 1741 ----
NM_012158chr1361786 1501 1208 1172 221 91 21398 675 11750 21855 1447
NM_012161chr491106 1079 925 791 766 433 415 265 246 1739 1192 --
NM_012164chr9197359 7205 7193 7026 6999 6672 6383 6064 5953 5439 5392 5197 4597 2903 2740 2198 2192 2144 380 57394 6912 2374 1463 1443 47105 2515 2210 899 27431 2382
NM_012175chr115881 692 582 288 177 ------
NM_012176chr52252 233 1246 ----
NM_012177chr62455 232 --2568 540 1174
NM_012180chr44635 629 196 155 1689 --1603
NM_012183chr11428 1624 ----
NM_012186chr11770 ----1734
NM_012188chr511088 ------
NM_012193chr11174983 4416 4350 4258 3562 3543 1966 1715 1660 1204 1142 1022 923 773 668 390 22 24788 1467 11150 35342 4101 763
NM_012197chr941641 1617 1462 348 11230 1652 --
NM_012199chr1174548 4442 4338 4036 3995 3322 1816 1680 1636 1131 1119 954 915 579 527 455 402 --23681 3279 23903 1263
NM_012207chr1061025 818 419 296 189 83 1209 2993 237 --
NM_012214chr2276298 6259 6209 6180 5749 5719 5341 5233 5063 5044 4903 4829 4764 4481 2407 2291 1985 1941 1080 746 680 594 496 366 254 216 25 36279 1913 1863 115975 5826 5382 2548 1968 1872 556 535 510 481 350 35076 1238 652
NM_012215chr1091846 1750 1607 1319 1274 1206 723 601 312 21917 1785 21766 542 --
NM_012218chr1952339 824 431 397 389 --1357 --
NM_012219chr353216 2945 778 462 447 21243 438 ----
NM_012223chr261243 1023 987 869 227 21 2150 107 11226 --
NM_012233chr24950 937 924 443 --21191 943 11082
NM_012234chr363715 3472 3409 2653 2515 1254 32664 377 197 63437 3130 2340 1032 718 267 --
NM_012238chr10131784 1715 1575 1361 1319 1278 688 543 481 428 421 314 201 2346 158 11307 31606 623 505
NM_012242chr102817 304 1248 2283 257 --
NM_012243chr13801 659 337 ------
NM_012244chr1411747 --41715 1700 1676 108 --
NM_012247chr1071058 978 943 873 395 308 296 1813 2964 704 --
NM_012249chr2123370 3166 3085 2875 2709 2594 2488 2478 846 609 422 218 13021 --13070
NM_012250chr115932 879 524 419 356 41199 1041 990 350 --2908 868
NM_012252chr7195362 5312 5282 4782 4641 4621 4556 4473 4024 3953 3740 3608 3569 3539 3420 1079 956 726 85 35257 4665 1201 45249 4857 3446 96 23886 2152
NM_012257chr74942 797 334 167 --3917 749 225 --
NM_012259chr621405 226 11055 11136 21358 927
NM_012262chr1214940 4870 4844 4653 4512 4283 4204 4108 3757 3609 3407 3178 1996 1980 1677 1450 974 911 572 459 347 44212 3289 2024 196 34682 3338 201 35280 899 882
NM_012266chr941162 906 431 102 --11125 --
NM_012281chr782217 2197 2085 1519 873 798 783 376 11687 1918 --
NM_012284chr12--1319 ----
NM_012286chrX3611 49 26 ------
NM_012287chr3214368 4290 4247 4222 4164 4129 4089 3895 3798 3542 3192 3181 3048 1480 1044 674 613 452 337 82 72 1892 74401 4138 3608 3353 3072 1231 1030 24268 1410
NM_012288chr6175760 5724 5673 5657 5604 5432 5301 4737 4696 4678 4327 4272 3906 3679 381 361 271 21315 395 45646 1960 890 342 25151 4784
NM_012290chr221382 675 21208 595 11348 --
NM_012294chr7104058 4050 3904 3591 3352 3012 1262 708 395 74 11220 24074 1530 --
NM_012297chr492096 2013 1974 1943 1924 1893 1789 754 68 --22416 864 12046
NM_012300chr562442 2222 2040 1945 949 369 --21781 574 --
NM_012301chr741976 1882 891 82 22177 666 11745 12144
NM_012302chr151271 1124 823 361 250 1163 11174 --
NM_012304chr542417 1752 985 56 --2546 142 --
NM_012307chr184899 866 736 695 1256 3854 836 757 --
NM_012308chr1122048 2038 12221 ----
NM_012309chr11164455 4302 4250 4075 3996 3738 3222 3180 3127 3104 1907 1804 1726 1165 577 399 --13306 13315
NM_012311chr101620 --3581 493 216 --
NM_012316chr195469 5274 5261 4062 1127 939 582 563 257 --75446 4268 3484 1914 1605 1166 347 25441 342
NM_012322chr74283 146 126 64 --1296 --
NM_012323chr2221583 1145 ------
NM_012325chr2051640 1566 1418 1270 1126 1188 ----
NM_012327chr1871616 1489 1315 1261 1196 630 252 11592 11128 11112
NM_012328chr73947 369 83 --31161 909 248 --
NM_012329chr1791594 1420 1389 1240 672 561 389 309 280 3648 504 274 21193 435 21601 1188
NM_012330chr1031514 429 368 11247 21498 587 1230
NM_012334chr5124403 3580 3249 3156 1760 1464 1245 1154 788 730 696 555 23529 3289 33562 3388 1452 43442 3282 1652 1253
NM_012338chr771261 1209 1200 1144 949 141 56 2432 255 ----
NM_012339chr102567 552 ------
NM_012341chr106437 402 389 200 173 130 ------
NM_012342chr101360 ----1200
NM_012343chr551033 967 302 251 159 1463 2705 227 --
NM_012345chr13121885 1848 1692 1628 1450 1442 1365 629 443 259 243 188 1344 11854 21555 1294
NM_012347chr682886 2530 2440 2388 2261 1169 163 29 --1208 22943 1203
NM_012382chr5154356 4267 4103 3761 3306 1709 1694 1535 1384 1359 932 844 830 354 177 42764 774 759 744 54379 4260 919 699 472 11190
NM_012383chr94362 350 328 297 --142 --
NM_012388chr15153016 2700 2608 2574 2503 2445 2308 2035 816 524 428 404 363 317 233 --53165 2891 2369 2219 2041 --
NM_012394chr1122 --196 --
NM_012397chr1871652 1581 1279 1236 1162 555 365 21722 712 --131
NM_012399chr2261273 772 765 578 527 354 11331 31293 789 494 --
NM_012405chr152811 2649 2641 2533 541 1649 33598 3148 581 23017 2822
NM_012412chr74850 337 317 262 185 ----
NM_012414chr1163 1147 2838 712 --
NM_012417chr174537 489 90 34 ------
NM_012419chr61445 2480 151 ----
NM_012420chr1051721 1606 439 149 77 22149 1558 1286 1797
NM_012421chr12468 401 --1438 --
NM_012425chr1082719 2642 1688 841 606 401 366 282 32545 2158 1993 52773 2741 1843 554 114 11779
NM_012426chr16--1334 1314 --
NM_012428chr154795 381 314 210 1787 4883 863 680 239 --
NM_012430chr32749 108 --1536 1529
NM_012434chr661577 1513 1327 1175 275 215 21406 123 11469 21624 41
NM_012443chr102150 130 1863 ----
NM_012446chr52472 450 --1487 --
NM_012448chr1772531 2398 2358 2121 1602 645 308 --52348 1651 967 522 496 --
NM_012449chr7123 ------
NM_012454chr65564 455 415 390 159 ----145
NM_012463chr12111549 1529 1505 1497 1288 1231 1173 1136 660 399 167 --61824 1280 1146 670 495 262 --
NM_012464chr4132932 2901 2890 2559 2345 2012 1932 1114 1043 1022 514 409 268 22734 1898 2963 59 12775
NM_012465chr1093371 3007 2975 2941 2858 2794 2538 2531 37 11310 33365 773 107 13317
NM_012471chrX61931 1896 1605 295 181 159 11363 2725 301 --
NM_012475chr11251 --184 --
NM_012479chr782458 2365 2335 1838 900 770 410 159 1374 62646 2595 2050 2016 644 55 22623 2155
NM_012482chr14613 143 126 53 2626 182 ----
NM_012486chr13421 398 97 ----189
NM_013227chr15195 --2822 346 --
NM_013229chr12142831 2788 2721 2036 1896 1725 738 605 483 341 164 82 40 31 11039 32680 1759 404 1747
NM_013230chrY21721 1695 11318 41392 1340 1171 1145 11413
NM_013231chr14144417 3975 3656 3619 3569 3207 2834 2746 1528 1452 1407 1350 1163 315 12760 41595 911 862 225 --
NM_013233chr251131 428 268 202 172 --1551 --
NM_013243chr1561153 1001 529 268 247 87 --21044 503 --
NM_013248chr201228 --1236 --
NM_013249chr111340 --1204 --
NM_013254chr124604 496 469 166 ------
NM_013255chr7328867 8780 8718 8708 8582 8201 7416 7180 7100 6891 6862 6455 6326 5643 5546 2742 2672 2481 2166 2143 1989 1980 1509 1177 1160 1031 976 937 712 392 267 228 48568 7217 5462 329 67038 5497 2053 1533 1126 258 21971 988
NM_013257chr872294 2126 1981 1870 1512 405 142 1107 2949 464 32353 266 224
NM_013261chr4133737 3581 3263 3205 3189 2961 2747 2733 2564 2422 1350 1194 106 23115 3023 33034 1445 265 33029 2673 1106
NM_013262chr62925 253 2571 459 31400 1349 1265 1413
NM_013269chr1244159 4039 3733 1666 44452 4374 3239 3211 34541 4443 3229 13224
NM_013272chr153391 256 49 ------
NM_013277chr1251096 967 927 899 872 2227 115 --197
NM_013280chr112656 182 ------
NM_013281chr2091366 1259 1242 597 408 294 259 229 155 21418 1349 31518 1447 238 11110
NM_013282chr1981307 1289 1171 1120 1021 984 937 279 --21092 157 21213 152
NM_013283chr57866 350 340 303 196 95 59 1874 2645 609 --
NM_013286chr393796 3634 3400 2762 973 822 181 111 52 2493 324 43804 1211 269 261 --
NM_013293chr75576 267 257 138 31 ----1280
NM_013302chr16194684 4579 4311 3997 3823 3525 3481 1875 1866 1852 1690 1475 1029 1014 860 602 456 216 140 54463 1119 610 465 104 34324 1723 653 14174
NM_013309chr1592662 2632 2598 2273 714 641 586 444 395 1840 1351 --
NM_013314chr102244 87 ----2267 261
NM_013316chr74686 667 197 126 1924 ----
NM_013322chr791474 1443 1432 1193 1166 1059 533 472 171 11734 1511 21655 157
NM_013336chr33558 545 280 196 1174 --
NM_013341chr252931 2902 2855 2051 251 2786 54 32073 947 212 1132
NM_013352chr66909 807 746 619 130 89 --1292 1269
NM_013354chr851459 1155 1009 973 280 --21129 315 124
NM_013357chr81833 ----2768 736
NM_013367chr4----1113 --
NM_013372chr1563014 2444 1200 941 249 232 --22946 2478 12503
NM_013374chr3122797 2728 2276 1037 1013 844 699 687 655 530 427 303 12354 13006 33089 2957 2661
NM_013377chr123152 124 99 ----1495
NM_013381chr12132440 2371 2149 2108 1819 1768 1726 1617 1498 930 869 129 58 12096 42293 2053 167 147 11800
NM_013386chr1101371 1160 1153 727 604 400 228 150 107 61 21416 1176 21517 521 31572 1500 1470
NM_013390chr921806 270 --1300 1566
NM_013396chr2161573 1548 1141 287 112 103 --21173 260 2613 294
NM_013410chr121278 1035 --21212 330 --
NM_013423chrX41210 1168 1157 1089 2838 406 31125 847 506 --
NM_013427chrX41210 1168 1157 1089 2838 406 31125 847 506 --
NM_013433chr1931821 1352 1328 --11833 --
NM_013436chr25763 743 131 73 35 1627 ----
NM_013437chr8101411 1298 1083 1071 1013 969 552 367 187 58 2993 319 31433 1187 388 --
NM_013438chr941697 424 238 72 11817 3306 174 38 --
NM_013441chr11500 1262 1431 --
NM_013444chrX2369 91 1443 3972 199 40 11087
NM_013446chr751441 1412 1340 365 310 1129 11189 --
NM_013448chr143769 742 255 --1295 --
NM_013449chr1292491 2458 2103 1914 1844 1153 1128 264 122 22561 1826 22254 1986 22543 1855
NM_013450chr271154 931 924 796 496 390 383 21278 156 51242 1030 403 376 24 --
NM_013943chr1153323 3253 3198 2695 2583 2347 2125 1013 833 599 341 263 186 95 53 33087 909 614 42965 2237 619 441 23142 2477
NM_013956chr8142 1126 ----
NM_013957chr8142 1126 ----
NM_013960chr82759 718 1802 ----
NM_013964chr8142 1126 ----
NM_013986chr221127 --2136 45 --
NM_013989chr14145134 5055 4708 4515 4056 3829 3446 3322 3218 1940 1851 1518 1002 318 13885 31862 1544 975 --
NM_013993chr62757 728 1780 ----
NM_013994chr62757 728 1780 ----
NM_013995chrX162530 2348 2070 1925 1630 918 910 818 774 764 644 492 467 350 335 256 --22341 581 21885 213
NM_014000chr1021939 1602 --21805 1436 1696
NM_014005chr592415 2026 1226 1194 1079 1055 561 375 234 11202 31035 598 75 12037
NM_014011chr272466 2453 2059 752 696 682 94 --1384 12326
NM_014016chr351610 1178 673 454 331 --2434 376 11358
NM_014021chr1103029 2529 2374 2341 1371 994 983 913 729 582 5785 755 739 400 308 22961 2951 1200
NM_014023chr1072879 2624 2067 1843 116 86 63 12077 3630 191 184 12858
NM_014026chr11195 ------
NM_014028chr6163196 2906 2706 2650 2501 2424 1125 857 843 798 703 648 528 274 225 153 43368 635 564 133 32476 1237 661 32062 734 195
NM_014031chr55359 303 234 137 31 ------
NM_014033chr1272311 2282 2240 1978 943 931 910 --12108 2612 308
NM_014034chr691549 1258 1174 1039 949 357 253 210 191 21269 1246 --1181
NM_014035chr531399 998 393 21299 563 ----
NM_014039chr1151361 1310 1093 378 269 11021 31296 398 220 --
NM_014043chr361632 1614 1068 535 90 22 --11129 1473
NM_014044chr2----1202 --
NM_014048chr16145300 4932 4682 4634 4072 3820 3729 3389 3232 1388 624 610 601 552 14134 31944 1630 857 15206
NM_014055chr121490 1194 1458 --
NM_014057chr991574 1503 1492 1459 1388 640 532 521 128 11298 11568 --
NM_014059chr131252 --1361 1292
NM_014079chr341066 1035 844 58 ------
NM_014089chr1392280 2068 1893 1877 1802 1715 1672 1407 834 --31952 118 61 --
NM_014106chr15192994 2810 2755 2549 2211 2074 2015 1957 1879 1194 1183 1029 928 736 566 490 430 316 254 31173 393 76 12217 3887 745 47
NM_014109chr841178 1043 274 54 1344 31020 880 777 --
NM_014110chr131078 1036 1023 2860 303 --1752
NM_014112chr8175390 5378 5007 4792 4324 3808 3783 3535 2206 2198 2041 1984 1949 1912 1549 1007 229 64681 3603 3550 2021 1851 1178 51835 1487 1380 846 677 11786
NM_014117chr16132438 2420 2260 2238 2198 1991 1772 1690 1671 921 762 452 391 12155 32658 2180 352 --
NM_014141chr7195119 5099 5021 4933 4555 4391 4255 4139 3989 3807 3603 3446 2024 1527 1120 984 817 712 294 12081 44775 3489 3312 380 1247
NM_014153chr162586 247 --1525 --
NM_014154chr351340 1100 1058 385 209 21256 1232 21445 168 --
NM_014155chr11287575 7409 7273 7111 7009 6741 6691 6560 6501 6317 6257 5797 5742 5635 5300 4998 4694 2992 2973 2360 2112 2086 1153 832 714 413 351 140 77206 6341 6293 5489 5319 4711 1420 97156 6019 5896 4987 1850 1425 1000 800 440 55179 5049 4759 2062 1611
NM_014160chr371414 1371 1325 1152 565 537 296 11170 21067 380 1219
NM_014171chr24758 652 196 42 1266 1542 --
NM_014181chr292841 2608 1891 1092 777 672 598 449 402 32688 974 950 32586 821 739 --
NM_014184chr11107 --1132 1144
NM_014191chr12----1349 --
NM_014211chr551668 1578 1384 1340 68 ------
NM_014212chr124970 810 71 48 --165 160
NM_014217chr151722 1509 415 359 81 11552 21611 1226 11783
NM_014220chr31625 ----1120
NM_014223chr12207 42 --3695 491 185 --
NM_014225chr192402 388 ------
NM_014239chr142366 341 ------
NM_014240chr394082 3564 3429 1127 917 772 738 567 190 13627 31348 1112 202 13438
NM_014243chr481847 1777 1411 1374 1317 509 318 161 21608 1506 --11336
NM_014245chr33871 701 356 ----1880
NM_014246chr2252219 2147 1995 1749 904 11804 11762 21876 473
NM_014249chr151524 ------
NM_014250chr2242050 1481 364 175 22147 110 11896 1182
NM_014253chrX82452 2303 2248 2237 2200 1703 742 155 32338 790 199 ----
NM_014258chr203480 255 25 --1219 2697 628
NM_014263chr1051443 1211 524 212 126 --21366 414 172
NM_014264chr44595 489 70 42 --1460 1569
NM_014267chr117921 892 722 639 313 186 139 3661 163 100 1333 --
NM_014268chr1831380 433 391 --21311 1239 11306
NM_014271chrX3335 256 211 ------
NM_014278chr43389 342 106 ------
NM_014283chr151330 1007 476 412 32 21230 596 ----
NM_014289chrX41383 1128 1074 48 11369 ----
NM_014290chr92179 39 ------
NM_014294chr8131417 985 538 480 470 347 271 244 189 138 112 75 45 21481 1269 31052 388 261 --
NM_014296chr321533 1216 2579 28 21615 1272 --
NM_014300chr151310 ------
NM_014305chr133696 561 489 --2676 531 --
NM_014309chr2284869 4566 3936 3783 3325 2099 2077 226 45374 5312 4521 2023 85324 4621 3864 2178 2172 1038 176 141 --
NM_014313chr161628 1509 1472 520 423 235 ----1483
NM_014315chr14----1150 --
NM_014319chr1261846 1649 1279 1209 387 61 --41506 764 294 84 1101
NM_014322chr16977 404 331 309 202 50 1992 2891 293 11114
NM_014324chr531172 291 189 ------
NM_014325chr1272142 553 462 454 269 232 217 --1392 1287
NM_014331chr4307821 7806 7795 7295 6768 6363 6311 6302 6285 5881 5840 5572 5411 5139 4935 3039 2922 2817 2741 2584 2486 2281 1886 1862 1726 729 539 479 351 138 24822 60 87670 6922 5382 5155 4891 2914 2409 2224 42753 2596 1006 126
NM_014332chrX1337 ------
NM_014333chr1172538 2519 2243 1889 1088 490 382 32772 1785 229 42658 2470 1875 466 1477
NM_014335chr1561115 1099 1069 571 481 280 1941 ----
NM_014342chr114302 268 236 93 --2422 218 --
NM_014344chr114822 800 782 133 ------
NM_014345chr66996 337 326 270 254 244 1778 2783 765 21052 706
NM_014350chr581131 1032 1017 995 766 378 368 302 --21026 405 --
NM_014352chr1141225 1041 956 285 --11407 11234
NM_014363chr1371176 1139 1054 800 468 438 194 --1361 21282 1186
NM_014372chr171924 1885 1806 1578 1469 787 165 12089 31821 1346 350 1200
NM_014376chr562525 2513 2407 1902 1831 730 11012 22286 248 --
NM_014382chr381766 1705 1126 664 633 532 216 96 21650 1398 1346 2671 357
NM_014388chr1135893 5795 5714 4620 4096 2081 1772 1562 1401 877 724 497 347 55754 4973 1655 779 767 56092 3828 1192 1154 277 22091 1241
NM_014393chr882246 2239 1621 1564 807 725 547 249 11818 1181 12183
NM_014395chr461385 1354 705 572 504 475 2783 693 --11988
NM_014399chr7--2777 280 --1140
NM_014415chr371395 586 576 550 518 391 349 31265 1149 673 1228 11103
NM_014417chr192940 924 ------
NM_014423chr5175597 5443 5412 5317 4162 4056 3841 3587 2267 2114 1807 1635 1595 1388 999 317 310 45282 4655 3737 415 41394 1083 990 863 25502 212
NM_014426chr203621 203 126 ------
NM_014429chr33644 131 67 ------
NM_014431chr1021670 164 11693 11433 --
NM_014432chr671134 619 597 543 424 348 320 ------
NM_014445chr32803 610 1936 22135 1955 11665
NM_014447chr4101588 1544 1480 1354 601 466 398 355 151 135 1646 ----
NM_014452chr661013 920 379 320 294 80 --1482 --
NM_014454chr631096 1024 232 --31050 238 143 31079 942 308
NM_014455chr11377 ------
NM_014456chr102678 438 31300 483 156 1583 --
NM_014458chr141413 1216 1203 304 11141 21393 201 --
NM_014462chr8--1118 --1124
NM_014469chr111561 1147 2621 154 --
NM_014489chr112882 704 ------
NM_014494chr1662416 1640 858 760 387 363 11549 ----
NM_014497chr2--1177 162 --
NM_014498chr33261 128 117 ------
NM_014500chrX------1266
NM_014503chr12----1470 --
NM_014504chr752096 1961 1919 504 113 --21501 767 11803
NM_014505chr121370 1466 ----
NM_014506chr951478 1253 1184 1069 117 21579 398 ----
NM_014515chr1251025 767 701 690 240 1800 ----
NM_014516chr192235 220 ------
NM_014517chr391932 1790 1638 1626 1556 1319 767 719 681 2740 393 11202 --
NM_014521chr281830 1577 1450 1153 630 549 305 256 --11737 --
NM_014522chrX3671 521 21 ------
NM_014547chr156738 666 195 172 128 110 ------
NM_014547chr156738 666 195 172 128 110 ------
NM_014552chr241532 1466 1184 1158 --11474 11508
NM_014554chr1211501 1788 51702 1545 1444 254 187 1601
NM_014570chr222997 252 1140 2857 113 1845
NM_014572chr13121723 1680 1305 1196 1173 573 355 340 289 273 205 169 --51498 1448 563 512 237 --
NM_014573chr1731818 1344 176 ------
NM_014574chr1491579 1371 1080 1035 980 546 497 432 191 11443 21349 1273 --
NM_014575chr34446 169 162 41 ------
NM_014577chr227922 854 818 717 592 284 270 2637 91 --2867 861
NM_014584chr1491327 1198 1186 1102 659 596 518 424 210 2641 158 1118 --
NM_014585chr241277 1114 1060 58 --1411 3946 940 431
NM_014586chr21114485 4427 4339 4189 3295 3085 3075 1417 737 697 641 24033 1805 11753 --
NM_014587chr1611549 1619 51587 1376 1367 1358 624 1601
NM_014602chr32345 286 ------
NM_014606chr471522 1411 1231 1107 992 627 577 41096 1076 318 118 21417 90 --
NM_014607chr281790 1410 1362 609 543 336 93 86 --22146 1644 11971
NM_014608chr151379 171 4181 156 117 83 --
NM_014612chr911296 3457 373 171 ----
NM_014613chr583064 3056 2380 2242 2176 2014 1884 884 21215 523 2581 134 1367
NM_014614chr251190 1100 1081 395 222 11178 --11347
NM_014615chr16113422 3346 3089 2543 2530 887 834 647 586 524 52 31267 1080 865 32831 415 77 1966
NM_014616chr393478 3214 3195 2596 1114 838 468 311 231 13331 52161 868 744 442 358 --
NM_014618chr92400 26 ------
NM_014620chr12----1298 --
NM_014628chr61412 1345 ----
NM_014629chr81904 1456 1474 11366
NM_014630chr15113955 3619 3604 3141 3130 2950 2854 2674 2624 397 229 --13980 13559
NM_014633chr112101 42 --1579 1434
NM_014635chr271739 1678 1657 1501 608 426 145 ----122
NM_014636chr9114372 4346 4266 4253 2974 2728 1725 1588 591 400 323 33238 1313 1293 14301 --
NM_014637chr821408 1054 21214 1018 41430 1044 373 173 --
NM_014646chr1863236 2899 2526 1254 1142 1001 ----1798
NM_014647chr1682235 2221 1617 1438 661 644 536 261 31633 1424 273 12008 --
NM_014653chr1221987 1557 11590 11404 --
NM_014660chr71246 1717 3846 273 258 1775
NM_014666chr551278 867 379 355 215 138 31215 873 494 1952
NM_014667chr351920 1892 1776 1747 803 --31848 915 370 --
NM_014669chr16----1126 --
NM_014670chr261627 1272 1187 554 266 136 1589 --11596
NM_014671chr771479 1468 1416 1200 552 490 243 21290 162 2564 200 11263
NM_014674chr3173883 3863 3758 3711 3338 3299 2999 2942 2932 2809 2585 2573 2497 1312 837 395 382 54019 4006 3750 1575 1066 2425 401 13700
NM_014675chr1------1455
NM_014676chr151680 1559 1439 1140 295 --21632 208 --
NM_014677chr851320 1289 1049 998 890 ----1333
NM_014679chr113464 309 148 2527 405 1537 --
NM_014682chr882234 2119 1981 1960 557 397 226 138 2522 304 11540 1373
NM_014683chr1782185 1990 1790 1365 841 829 770 669 21386 728 11808 11454
NM_014686chr1951993 527 470 461 400 ------
NM_014689chr23628 595 176 --1114 --
NM_014699chr162352 338 ------
NM_014700chr1641565 1379 1370 1320 --11344 --
NM_014701chr1593374 3133 3054 2839 2531 2091 1344 977 228 53183 2146 507 165 137 22429 127 --
NM_014702chr6163431 3409 3099 2774 2596 2577 2443 2346 2175 2148 1351 1175 942 834 459 191 32424 2356 929 21042 987 12979
NM_014705chr791994 1845 1764 1751 1563 1363 619 425 281 --31770 1451 580 11601
NM_014707chr771969 1796 1762 855 613 385 305 --22020 1852 1658
NM_014709chr22637 508 ----2573 26
NM_014711chr16112123 1809 1723 1668 1436 802 782 385 244 155 33 12001 32014 1989 1373 42079 2071 2028 307
NM_014712chr16--1612 ----
NM_014713chr25426 365 149 130 40 ------
NM_014718chr12----1683 --
NM_014720chr1031739 1284 727 --21401 504 --
NM_014721chr6307024 6725 6309 6059 5968 5795 5535 5503 5347 4928 2518 2498 2431 2202 2181 2171 2058 1983 1932 1890 1845 1833 1827 1630 1503 1439 1343 1192 1066 603 36629 6138 763 97368 7311 6327 6182 4800 2306 1954 1050 468 21971 730
NM_014729chr892217 2036 1855 809 738 703 583 375 64 2854 555 2725 182 1544
NM_014730chr1295286 4627 4612 4155 3937 3511 1666 1636 1020 --178 --
NM_014730chr1295286 4627 4612 4155 3937 3511 1666 1636 1020 --178 --
NM_014733chr551846 680 386 201 107 --31899 793 772 --
NM_014735chrX52060 1624 1503 267 120 11350 32139 1694 1497 11943
NM_014738chr17----1685 --
NM_014739chr6164034 3892 3223 2791 2641 2582 1361 1265 1175 1131 1017 482 427 280 64 50 2247 238 23907 3232 1645
NM_014741chr1152185 2174 2116 824 805 ------
NM_014742chr2041724 1715 1636 311 --1233 11749
NM_014743chr472677 2352 2163 1253 835 188 154 23147 2204 2563 290 13026
NM_014746chr2154414 4392 4327 4092 3608 3413 3286 3279 3143 1545 1492 870 846 658 594 21480 1040 1497 11323
NM_014749chr142258 125 2778 346 ----
NM_014751chr892058 1880 1834 1659 1511 454 406 283 254 ------
NM_014752chr1181865 783 667 552 513 303 280 231 1774 41674 1664 461 242 41689 1577 1429 559
NM_014753chr102270 242 --1300 --
NM_014755chr2134097 3475 3092 1702 1589 1449 1077 821 630 549 440 197 145 53313 3241 1123 1063 187 64269 3341 2768 2652 557 353 1692
NM_014757chr592393 2360 2267 2102 2084 1757 1522 463 78 1456 12172 22180 47
NM_014758chr1172487 2344 1855 1802 1682 807 562 1978 12457 11980
NM_014764chr1261293 1126 1101 941 150 71 11264 --1310
NM_014765chr1122522 2028 2009 1042 858 622 382 204 190 160 137 43 1993 1170 --
NM_014766chr743550 3491 3187 2988 12581 22653 2606 12497
NM_014772chr1843598 3125 2730 725 13108 22498 708 12331
NM_014774chr173165 3146 2557 2077 2044 771 115 32391 781 352 22259 160 --
NM_014779chr38887 842 790 756 460 385 152 100 --1822 1992
NM_014781chr8136 1928 21226 145 --
NM_014787chr132646 1881 415 --32799 2176 482 12334
NM_014790chr51117 ------
NM_014795chr2111254 1225 1177 1162 1063 937 870 552 509 479 274 --31183 880 31 1402
NM_014802chr1241134 1061 969 56 1238 21152 1125 --
NM_014803chr10122843 2820 2442 2088 1973 954 918 852 599 510 458 242 --42674 2547 1798 973 --
NM_014810chr1103673 3387 3127 3056 1198 1012 1001 607 379 212 12840 ----
NM_014811chr93488 193 184 1151 1228 --
NM_014812chr151972 1675 1459 789 779 21998 1364 31946 1548 145 11910
NM_014819chr572216 1926 1653 873 537 518 502 1185 32245 1920 441 --
NM_014820chr351445 784 463 382 307 61570 1412 820 400 242 198 11274 --
NM_014822chr43566 530 454 2483 235 ----
NM_014824chr1161976 1853 1818 1449 1380 418 11484 21829 808 --
NM_014826chr1154341 4238 4196 4176 4125 4070 3242 3148 2953 2660 957 946 515 348 255 --11572 11079
NM_014827chr141201 652 342 183 1173 11589 --
NM_014828chr143475 460 207 1817 32543 2206 201 --
NM_014829chr5112297 2283 1562 836 659 601 415 362 250 116 93 32317 523 22 --1825
NM_014830chr1243836 3826 2752 1088 12761 23307 1508 --
NM_014832chr1391983 1813 1422 1371 749 671 615 294 256 12022 31405 845 443 --
NM_014835chr2052238 2180 2173 623 97 --32190 1842 555 1588
NM_014836chr1071704 1488 398 369 282 137 59 --21475 244 21470 351
NM_014838chr22112402 2141 2077 997 959 881 612 429 408 392 351 ----12335
NM_014839chr1142495 2335 1865 930 902 863 829 699 667 572 549 341 309 132 --2754 726 --
NM_014840chr1283395 3377 3273 3177 2944 2650 1061 234 23137 2688 23153 1255 13431
NM_014841chr64899 513 493 380 --31216 556 282 --
NM_014846chr82237 107 ------
NM_014847chr11202 ------
NM_014848chr1592698 2654 2625 2378 2012 1014 920 776 499 --2585 470 --
NM_014850chr3104922 4677 4550 4066 3770 3427 3227 1589 1077 578 12996 ----
NM_014853chr1711479 ------
NM_014860chr261979 720 703 633 453 334 11996 2557 170 --
NM_014867chr863336 3310 1406 929 702 169 23788 1028 42361 1490 1252 442 --
NM_014868chr122290 177 187 166 --
NM_014870chr164344 4288 4072 3238 1765 1051 24734 1384 ----
NM_014871chr121607 ------
NM_014872chr952382 756 485 328 317 --32003 628 531 1539
NM_014873chr1164909 4737 4605 4567 4538 4509 4178 3388 3299 3152 1551 1368 731 203 152 68 --64878 4341 1509 1197 921 663 64556 4425 3834 3350 1800 1377
NM_014876chr2242249 2180 1640 294 ----22197 745
NM_014877chr17317762 7653 7596 7473 7355 7263 6887 6822 6390 6309 6070 5052 4971 4830 3060 3005 2903 2829 2591 2530 1326 1234 1030 829 647 521 474 189 181 159 134 75500 1513 1389 793 563 237 216 76504 6230 6078 5666 5083 702 452 36681 1969 1350
NM_014878chr9135 ------
NM_014887chr135826 761 360 309 185 ------
NM_014888chr781605 1531 1480 1441 474 382 266 84 --11432 --
NM_014890chr32311 103 --2345 37 --
NM_014892chr63433 202 90 --1213 --
NM_014893chrY62094 1669 1469 768 715 243 52348 700 671 457 400 1371 --
NM_014897chr17123097 2893 2765 2441 2400 2054 1169 841 647 574 557 448 42348 1129 691 252 32637 2027 1175 33003 2196 322
NM_014899chr5103159 3108 3040 2969 2681 2314 2065 1995 1042 269 12265 1556 --
NM_014900chr251152 1049 261 224 185 1139 11195 --
NM_014902chr202239 159 --11193 11039
NM_014903chr1282464 2374 2241 755 633 354 212 65 --22424 1635 21819 37
NM_014904chr10143946 3359 3312 2772 2668 2624 2531 1567 1559 1472 1287 1220 453 341 24033 3294 53021 2929 2611 2497 1347 32757 2618 1267
NM_014906chr17114069 4032 3753 3560 3528 1563 1222 913 832 655 625 23432 736 52956 1647 1238 1191 722 22666 995
NM_014909chr141208 --23449 2727 12741
NM_014910chr193806 199 113 ------
NM_014912chr10223317 3250 3234 3180 3077 3035 2911 2699 2601 2473 2426 2229 2167 1191 1157 979 777 689 626 568 401 265 1115 83393 3374 3216 3118 2805 2684 2309 608 23326 3169
NM_014913chr1841509 1475 1071 49 --2571 342 --
NM_014916chr74795 745 637 586 ------
NM_014917chr13973 825 746 --1718 --
NM_014918chr1541295 254 101 59 11313 31584 1571 48 --
NM_014920chr6163367 3220 3169 3059 2390 2375 2342 767 681 571 357 314 241 215 198 49 --73757 3175 2696 1422 1415 633 545 13429
NM_014923chr1372297 2040 1495 668 312 126 40 11986 31907 1487 740 2731 74
NM_014924chr14112960 2830 2807 2687 2672 2564 2036 2029 806 716 565 13197 ----
NM_014926chr34929 739 372 246 11021 3386 271 29 --
NM_014932chr351890 1523 1510 1461 253 --2227 26 1607
NM_014934chr13103121 3112 2692 2679 2492 815 793 763 330 318 11005 74020 3960 3577 2501 494 385 304 --
NM_014936chr6152901 2396 2367 1946 1893 1848 1780 1761 1079 917 583 313 284 138 94 1964 21112 895 1469
NM_014937chr1041285 1267 482 70 133 ----
NM_014942chr6112636 2046 2032 1936 1014 934 846 708 699 564 549 --52439 2391 2381 2101 879 --
NM_014943chr831216 1054 999 21270 1074 2433 403 --
NM_014944chr151137 500 491 395 32 --1424 --
NM_014945chr521979 174 --22001 121 1161
NM_014946chr2142942 2461 2430 2387 1974 1093 1072 954 835 563 528 486 191 106 32291 2235 1054 43059 770 630 425 --
NM_014947chr1103025 2935 2863 1087 1079 508 458 323 306 256 --41220 915 699 127 32439 474 171
NM_014949chr15983 966 885 369 238 ------
NM_014950chr1461690 1681 1557 1363 1108 550 ----21733 1126
NM_014952chr1541959 1944 1932 827 --21869 1841 --
NM_014953chr13103923 3831 3319 2727 2643 1117 921 594 528 333 34185 752 138 --1102
NM_014961chr482123 1934 1743 1556 859 612 594 505 1140 1873 --
NM_014962chr2082694 2418 2270 1066 1046 941 887 272 32453 727 185 22539 2428 22854 392
NM_014964chr1742056 611 467 111 11505 1473 21617 678
NM_014969chr171136 1064 1041 1017 934 816 177 --1447 --
NM_014974chr1041225 326 306 28 ------
NM_014977chr14--1514 1525 1520
NM_014978chr1061552 1464 1417 1374 558 39 --41854 1664 1492 46 --
NM_014982chr14185436 4968 4511 4504 4288 4093 4006 3878 3557 3329 1804 1780 1351 1061 750 708 565 307 1421 95045 4588 3517 1956 1255 1132 1125 351 211 24391 2099
NM_014988chr452550 2493 2182 1904 1871 22821 1998 12010 --
NM_014989chr642002 1729 1595 1381 1835 42085 1674 760 40 12035
NM_014990chr1431136 396 368 1821 1843 --
NM_014991chr463285 2971 2789 2128 1218 1024 43099 2284 375 325 42995 2828 2718 1185 12919
NM_014992chr143736 677 101 --1772 --
NM_014996chr35979 961 940 866 421 21083 358 2744 688 1106
NM_014997chr762885 2737 2317 2087 1139 1105 1409 12706 --
NM_014999chr1271588 1562 1198 1070 400 122 91 11389 21101 574 1410
NM_015000chr12112928 2612 2500 2199 2163 2107 1072 1036 971 829 203 11015 62944 2872 2653 2084 911 212 22901 898
NM_015001chr14781 379 311 207 ------
NM_015002chr1262266 2158 1803 1424 773 718 --32087 821 581 1816
NM_015005chr1411736 --1318 11295
NM_015008chr373172 2219 1308 1189 833 577 472 33651 717 221 42658 1069 894 172 1665
NM_015009chr35862 765 311 226 163 --1248 --
NM_015012chr112364 79 ------
NM_015013chr11300 ------
NM_015015chr1911379 --12028 --
NM_015017chr191104 1034 1028 813 396 389 253 231 96 --1102 --
NM_015020chr16103853 3570 3497 2777 2591 2510 1034 900 882 779 --63835 3826 2998 2458 907 278 --
NM_015024chr821365 340 21149 410 21243 581 11325
NM_015025chr271063 587 550 446 361 337 153 22655 764 22572 556 22244 1658
NM_015026chr12204699 4550 4538 4437 4271 4132 4020 3930 3523 3506 3221 3073 3063 1750 1703 1651 1432 931 923 693 33874 3081 622 51621 1337 1306 1144 331 --
NM_015027chr1671803 1736 1605 1548 365 349 225 1708 --1689
NM_015032chr13112932 2754 2676 2435 2285 2161 1070 744 662 169 137 32789 2120 312 22031 1786 --
NM_015035chr2075958 1930 1276 850 780 711 627 1315 45212 1851 1729 747 11229
NM_015039chr174315 4248 4208 4195 3420 3266 1623 --2497 469 11698
NM_015040chr2113387 3343 3328 2865 2781 2745 2633 2599 861 714 117 --12673 2783 695
NM_015042chr1554274 1466 1315 1204 498 ----14331
NM_015045chr1082280 1817 1738 1673 871 538 303 267 2520 131 72126 1441 662 655 618 485 479 22147 1625
NM_015047chr141119 413 368 339 ----1884
NM_015049chr2132625 2470 2337 2039 2019 1209 1187 1101 992 955 691 662 605 --22851 2235 31018 762 707
NM_015051chr973278 1118 925 567 396 137 75 23029 776 33053 534 362 42491 1320 1205 97
NM_015052chr741085 1027 1009 434 2557 117 21072 504 --
NM_015055chr1172903 2892 2610 2536 2389 2248 1819 --