TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548o-3p
miRNA Sequence: CCAAAACUGCAGUUACUUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000109chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_000168chr751323 476 464 369 71 13015 1682 22851 214
NM_000259chr15116247 5994 4978 4375 2276 2254 1688 1594 1438 1007 730 ----14991
NM_000332chr6127072 6808 6405 6367 5987 5747 4375 2466 2033 1953 1793 1574 12000 ----
NM_000901chr462207 2022 1587 1574 1552 315 --11604 --
NM_001001419chr5125161 3994 3960 2086 1785 1089 1009 870 579 515 473 383 14408 ----
NM_001001420chr5125161 3994 3960 2086 1785 1089 1009 870 579 515 473 383 14408 ----
NM_001003652chr18128690 8459 7563 6305 6247 6149 6072 2838 1657 1378 1326 657 --27430 6634 16547
NM_001004065chr964009 3937 3891 3047 2606 1533 12620 --11525
NM_001005473chr594632 4445 4305 4189 4057 4041 2419 2316 1182 --1473 --
NM_001007278chr13114331 4291 4055 3335 2076 2016 2002 1992 1317 946 24 ------
NM_001008239chr18113667 3468 3190 3153 2691 2675 1449 1337 1326 1097 345 ------
NM_001008408chr7125841 5510 5116 4947 4881 4750 4522 4231 2189 377 256 248 ------
NM_001008495chr8102264 2177 1868 1759 1727 1535 467 460 393 121 ------
NM_001008925chr463222 901 741 729 427 291 23503 401 ----
NM_001010891chr5106497 5960 4893 4473 2103 1444 1198 916 728 389 16186 26670 5925 --
NM_001011513chr454048 3906 1625 1107 504 --12529 198
NM_001011666chr7105861 5413 4304 2547 2518 2050 1891 1021 605 240 22414 2128 ----
NM_001014380chr13135169 4961 4783 4028 3983 3936 1958 1875 1795 1486 1320 341 106 14397 15466 --
NM_001018067chr1135290 5252 4531 3847 3245 1668 1473 1346 860 845 540 431 409 --1202 --
NM_001018068chr1135290 5252 4531 3847 3245 1668 1473 1346 860 845 540 431 409 --1202 --
NM_001018069chr1135290 5252 4531 3847 3245 1668 1473 1346 860 845 540 431 409 --1202 --
NM_001025076chr10115461 3910 3817 2026 1885 1721 1502 1175 646 548 521 --1967 25579 1426
NM_001025077chr10126819 5268 5175 4634 2860 2533 2004 1906 1879 1321 667 255 --12325 26937 2784
NM_001025079chr3104185 4172 3839 3435 3305 2816 2724 2638 238 164 ------
NM_001025580chrX73090 2995 1226 460 428 339 250 ----14282
NM_001031700chr442378 2224 703 52 2381 186 --1298
NM_001034841chr16115335 5154 4982 4016 3779 3576 3411 1961 1050 417 360 --14398 --
NM_001037165chr798330 7646 7524 7325 7308 6620 2742 1159 574 --28919 1402 --
NM_001039538chr273690 3211 2300 2257 1453 475 258 13352 ----
NM_001039618chr1185812 4917 3883 2358 1801 1611 801 395 ----14661
NM_001039693chr263683 1621 1208 1020 1013 697 11518 22775 943 --
NM_001040712chr993397 3247 3195 2730 1185 1001 841 646 505 ----1783
NM_001042355chr16125033 4667 4534 3452 1460 1343 1174 1065 742 546 441 222 1624 ----
NM_001042412chr16125033 4667 4534 3452 1460 1343 1174 1065 742 546 441 222 1624 ----
NM_001042555chr1274340 3234 3168 1642 851 775 41 1991 --1933
NM_001099678chr386180 6157 6096 5494 2391 1948 1565 246 --1259 --
NM_001106chr3179772 9703 9650 9157 8864 8637 8293 8161 6989 6731 3639 2673 2654 2265 2092 197 68 --18808 12712
NM_001167chrX106658 6511 4994 2323 2178 1388 1086 976 812 420 16619 16490 --
NM_001204chr2157635 7429 7183 6244 6223 6216 5684 5193 2647 2450 1977 1361 833 500 442 16796 1206 --
NM_001304chr1773761 3600 3073 2971 902 490 439 ----22630 163
NM_001419chr19124673 4619 4391 2987 1532 1220 1204 1064 977 391 385 137 ------
NM_001609chr1093656 3036 1321 1286 1161 987 813 458 162 ----12874
NM_001695chr873578 2862 1704 1628 1502 839 376 ----1797
NM_001777chr3104185 4172 3839 3435 3305 2816 2724 2638 238 164 ------
NM_001858chr685077 4024 3546 3135 1600 586 249 215 13622 1750 --
NM_002006chr4105518 4347 3711 3642 3617 1569 1308 1262 955 455 14717 ----
NM_002025chrX139192 9136 9047 7746 7674 6433 5749 3305 3143 2989 1111 1045 708 17222 ----
NM_002128chr1382381 2030 1739 1686 1626 649 418 311 ------
NM_002158chr283745 2749 2631 1259 765 140 133 80 12429 ----
NM_002210chr253022 2349 1346 953 248 ----13366
NM_002270chr5145574 5537 5273 5200 4928 4910 4582 4137 3777 2135 2108 513 489 475 ------
NM_002374chr273690 3211 2300 2257 1453 475 258 13352 ----
NM_002408chr143657 562 205 1552 1743 1790
NM_002481chr1117873 7556 6743 2852 2540 1832 1500 615 217 206 100 ----17903
NM_002515chr1451807 487 329 205 88 ----11979
NM_002581chr965505 4368 3991 3867 3475 1423 ----24041 3469
NM_002655chr863860 3442 3267 2030 1650 1306 --14158 14909
NM_002839chr993397 3247 3195 2730 1185 1001 841 646 505 ----1783
NM_002886chr394952 4700 4511 4467 3330 1923 1857 472 394 12008 13620 --
NM_003144chr682133 1771 1618 1548 819 810 410 198 22145 825 ----
NM_003371chr9102136 2119 1957 1896 1858 1839 1652 1641 1634 1621 11874 ----
NM_003392chr383585 3520 3309 2990 1578 1211 79 72 13972 ----
NM_003478chr1183034 2997 2191 2153 2062 688 637 218 1723 ----
NM_003590chr2123894 3673 3615 2886 2794 2749 1088 1055 683 601 374 255 ------
NM_003597chr291931 1621 1500 1492 467 375 337 216 207 1138 12171 --
NM_003722chr372591 2457 2415 1942 1053 773 458 --12005 --
NM_003759chr4104218 3770 3689 3377 3111 3014 2784 2638 1396 239 ----1939
NM_003895chr2111625 ----2430 204
NM_003913chr673596 3355 3026 1389 1315 857 177 13468 13723 --
NM_004006chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004007chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004009chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004010chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004011chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004012chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004013chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004014chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004015chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004016chrX102502 2399 2031 1865 1793 580 432 176 158 33 ------
NM_004017chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004018chrX102502 2399 2031 1865 1793 580 432 176 158 33 ------
NM_004020chrX102588 2485 2117 1951 1879 666 518 262 244 119 ------
NM_004021chrX102502 2399 2031 1865 1793 580 432 176 158 33 ------
NM_004022chrX102502 2399 2031 1865 1793 580 432 176 158 33 ------
NM_004023chrX102502 2399 2031 1865 1793 580 432 176 158 33 ------
NM_004124chr1412220 --11026 32501 2341 713
NM_004171chr11128192 6078 5997 5826 3472 3432 2600 2502 1334 1102 887 593 18913 ----
NM_004232chr18113811 3508 3379 3235 2999 2446 1264 1008 496 213 113 ------
NM_004437chr193136 2586 1302 1229 1026 917 903 589 268 11193 1261 1927
NM_004612chr9124457 4210 3948 3529 3182 1601 1558 1464 785 769 477 54 23765 1308 ----
NM_004726chrX84952 4387 4294 4121 3710 3598 1080 675 166 11412 --
NM_004745chr877040 6895 6360 4862 4361 2373 1747 14405 ----
NM_004760chr752390 2350 2281 1879 1709 ----11737
NM_004775chr1842300 2040 1946 1768 --1398 22243 565
NM_004904chr7105861 5413 4304 2547 2518 2050 1891 1021 605 240 22414 2128 ----
NM_004949chr1891989 1856 1780 1754 1347 852 780 773 311 ----12179
NM_004985chr12103398 3003 2960 2773 1619 1312 921 544 425 167 --1202 --
NM_004992chrX158288 8279 7944 7454 7428 7039 7015 5759 5424 5400 3056 2752 1967 1952 1846 11409 25413 3272 --
NM_004992chrX158288 8279 7944 7454 7428 7039 7015 5759 5424 5400 3056 2752 1967 1952 1846 11409 25413 3272 --
NM_004999chr683743 3211 3169 2875 1251 965 791 450 --44147 1746 1188 764 1753
NM_005065chr1475021 3997 3842 1399 1141 671 506 23364 785 ----
NM_005116chr20124447 4362 4323 4009 3386 3272 2805 1830 1506 1221 1107 898 ------
NM_005121chr1763517 3500 3150 1045 966 457 1140 12532 --
NM_005156chr9165085 5055 4968 4697 4326 4163 4138 4033 3318 2003 1413 1272 1217 1200 1157 986 --14646 --
NM_005188chr11117876 7830 7186 6091 5892 2533 2438 1831 1748 1221 1136 22552 867 22705 2080 --
NM_005197chr1495286 5143 4020 4009 3965 1548 1452 177 122 124 15752 --
NM_005207chr22133276 2883 2658 2507 1220 1177 1043 912 574 560 549 514 504 ------
NM_005359chr18124799 4269 2407 2271 2254 2008 1933 1921 1502 1109 849 616 14257 15336 --
NM_005578chr375108 4472 1879 1669 1657 428 359 11718 22023 1071 13792
NM_005596chr996308 6232 5201 4378 2330 2236 1568 1003 454 15458 23996 1860 --
NM_005665chr1124946 4754 4678 4633 3101 1842 1779 1484 1441 1037 944 821 1937 21714 952 --
NM_005798chr13114331 4291 4055 3335 2076 2016 2002 1992 1317 946 24 ------
NM_005901chr18128690 8459 7563 6305 6247 6149 6072 2838 1657 1378 1326 657 --27430 6634 16547
NM_005903chr5125161 3994 3960 2086 1785 1089 1009 870 579 515 473 383 14408 ----
NM_005935chr4105152 4918 4726 4067 3960 3653 3637 3495 1948 453 --2947 482 --
NM_006007chr9104428 3982 3811 3632 1517 1321 1181 886 790 108 --22839 1350 --
NM_006037chr2114787 4767 4755 4426 4075 3390 1729 1692 1500 892 715 1959 ----
NM_006203chr5115607 4932 3498 1863 1596 1539 1483 1267 1135 695 172 ------
NM_006252chr1116590 6463 5524 5200 4737 2995 2282 1255 1240 1223 530 16960 37380 6067 1861 --
NM_006393chr1044487 3867 3199 425 11359 --24467 947
NM_006457chr454048 3906 1625 1107 504 --12529 198
NM_006489chr1451807 487 329 205 88 ----11979
NM_006544chr14105502 4470 4225 4125 2361 1707 1596 486 439 167 --13708 25911 5214
NM_006561chr10115461 3910 3817 2026 1885 1721 1502 1175 646 548 521 --1967 25579 1426
NM_006599chr1676395 5621 1901 1689 1653 1511 516 --36793 1918 1358 --
NM_006620chr6114287 4115 3439 3099 3031 1531 1326 722 664 411 353 ------
NM_006628chr1584576 4563 4332 3160 1667 310 293 164 --21108 736 12843
NM_006654chr1274340 3234 3168 1642 851 775 41 1991 --1933
NM_006738chr1584525 3659 3123 823 798 617 404 297 13861 12822 13263
NM_006775chr642988 2904 2574 2135 ----22198 645
NM_006777chrX72267 2186 1098 1076 456 423 222 11890 127 1174
NM_006885chr16123847 3616 3437 2967 2886 1493 1486 1467 806 604 566 424 ------
NM_006924chr17104052 3595 3408 3279 1671 1391 1273 1078 92 46 ------
NM_007006chr1671305 1168 944 862 673 98 89 23431 796 13483 --
NM_007195chr1863551 3174 3010 2682 2302 1178 --11487 1457
NM_007200chr1584525 3659 3123 823 798 617 404 297 13861 12822 13263
NM_007203chr964009 3937 3891 3047 2606 1533 12620 --11525
NM_007249chr13139477 8908 8173 7962 5930 3188 2805 2467 2177 2156 1637 687 671 ------
NM_012081chr573495 3229 3152 3042 2807 2740 281 11416 11018 --
NM_012164chr9167072 7006 6974 6477 4910 4697 2939 2687 2635 2508 1369 969 658 302 143 52 --17246 --
NM_012234chr383754 3597 3559 3259 2444 1001 338 324 --12458 1465
NM_012294chr783814 3520 2655 1054 405 389 293 102 12944 13486 --
NM_012382chr553869 3114 1662 1374 693 21617 609 --34531 4128 57
NM_012388chr1543081 2031 199 178 12959 --12525
NM_014155chr1177030 6059 5324 2829 2564 1650 1070 170 2296 277 17502
NM_014331chr4116782 6693 6117 5134 4968 2116 1320 985 712 382 368 13058 ----
NM_014423chr575185 5096 4986 2015 1883 1473 111 14978 --14615
NM_014574chr1441411 1186 587 309 11250 11402 11393
NM_014702chr653348 2415 2405 905 213 ----1434
NM_014752chr1151649 1397 763 592 120 --1259 1715
NM_014765chr132670 2121 2070 1463 12331 1330
NM_014803chr1062802 2747 2630 2390 1170 583 --12637 1200
NM_014830chr12123915 3379 3289 2685 2398 1462 1271 838 395 337 319 261 12771 13818 --
NM_014877chr17137673 7590 6758 6626 6211 5649 4865 2973 2237 1465 949 570 511 --47634 7221 5903 1948 --
NM_014939chr18256 41 ----3600 588 478
NM_014989chr6111789 1618 820 512 480 473 458 431 414 127 113 ------
NM_015032chr1341179 1064 859 813 21923 1801 --12352
NM_015097chr361690 1657 761 140 122 116 --1441 --
NM_015199chr383021 583 573 559 459 260 169 156 1804 --11034
NM_015208chr1883758 3715 3542 3260 624 492 477 359 --12913 --
NM_015247chr16125033 4667 4534 3452 1460 1343 1174 1065 742 546 441 222 1624 ----
NM_015313chr1174563 4371 4241 3339 1466 422 398 34519 3493 3210 ----
NM_015314chr782478 2365 2190 2168 2097 1039 753 697 --22305 450 --
NM_015349chr672943 2589 2314 509 494 470 299 --2921 464 --
NM_015365chrX73090 2995 1226 460 428 339 250 ----14282
NM_015436chr463041 720 560 548 246 110 23322 220 ----
NM_015458chr874279 3502 3257 1901 1281 860 754 1764 33684 1719 534 --
NM_015554chr1582949 2833 2387 2300 1978 1007 586 104 21940 704 1830 --
NM_015569chr174573 3188 952 888 637 312 123 --23957 1270 --
NM_015640chr1135290 5252 4531 3847 3245 1668 1473 1346 860 845 540 431 409 --1202 --
NM_015878chr852076 1704 1498 655 340 1647 1681 1620
NM_015886chr835605 3968 2055 14993 --13945
NM_015906chr194863 4827 4797 4702 3472 896 832 601 569 --13107 --
NM_016206chr3168680 8103 7383 7370 7358 5866 5643 5440 2088 1581 1560 735 599 283 141 73 28309 7404 --1709
NM_016260chr2157607 7297 7172 6820 6639 5801 5453 5168 4990 4957 2780 1062 874 784 383 ----1710
NM_016308chr11385 11971 21929 1894 11736
NM_016507chr1762817 2657 2650 996 449 443 23019 2783 1389 12460
NM_016530chr1593919 3225 3002 2523 1520 1258 1212 1109 865 13008 11100 --
NM_016613chr442378 2224 703 52 2381 186 --1298
NM_017447chr2173157 3102 3022 2988 2836 2785 1188 --13590 11687
NM_017629chr151901 1289 558 549 539 ------
NM_017637chr9139263 9253 9241 8329 7556 3556 3450 3052 2734 1818 1671 1565 1534 23318 488 1222 1348
NM_017644chr395122 3366 1379 1040 841 756 519 461 51 --14075 --
NM_017658chr1474541 3572 883 773 578 285 71 34389 3330 1005 33758 166 136 --
NM_017813chr895654 5436 5148 5055 4562 4405 4189 4174 664 --35717 1656 836 --
NM_017944chr1133119 1183 1028 22453 173 136 1979
NM_017958chr242728 2123 103 90 22470 278 --12859
NM_018017chr10122814 2756 2685 2604 2341 2290 808 672 603 524 483 115 ------
NM_018126chr471562 1360 1283 1259 1023 498 252 1529 --1183
NM_018155chr373251 2864 2623 2425 909 575 288 --31075 972 132 --
NM_018279chr1262836 2806 2615 2427 2315 332 --2554 317 11010
NM_018313chr392433 2262 2092 591 365 358 343 324 280 ------
NM_018362chr1193924 3798 2640 1482 655 589 447 353 50 ------
NM_018364chr1104096 3967 3501 3448 2947 2721 2692 979 84 61 ------
NM_018374chr794827 3970 3426 1596 1589 1556 1185 1171 974 --1680 --
NM_018403chr394141 3858 3720 3514 2703 1646 1507 934 488 1209 --1448
NM_018440chr8108727 8124 6882 6763 5419 2758 2463 1258 727 390 28438 2741 18432 --
NM_018566chr1104977 4640 3348 1927 1797 1383 1182 1040 925 60 13661 11479 --
NM_018638chr12125408 5304 5013 4518 4342 4196 3841 2264 2099 783 388 379 11327 ----
NM_018947chr763723 3699 1019 418 322 182 --43816 1947 1139 487 --
NM_020122chr2125560 4279 2061 1950 1766 1288 1221 1176 1069 780 400 380 ----14412
NM_020640chr361868 1680 921 876 510 319 21940 868 ----
NM_020651chr261695 1491 1427 317 85 58 ----1224
NM_020673chr20127751 7070 7056 5768 5418 5373 3027 2747 1771 1392 1010 84 --27365 301 --
NM_020718chr16126229 5800 5709 4552 4408 4112 2378 2214 1901 1665 1222 91 1341 11322 --
NM_020727chr21113846 3802 3770 3470 3447 3433 2910 1277 1250 326 319 ------
NM_020772chr17148394 7865 7840 7424 5510 5302 2593 2222 1619 1610 1204 509 285 267 27197 3391 --11586
NM_020774chr18136264 5957 5951 5327 4921 3790 2147 1853 1610 1484 1441 850 379 ------
NM_020782chr1274868 4297 3966 1524 985 406 42 14688 13923 14461
NM_020921chr144845 308 299 138 13204 23351 460 1290
NM_020948chr1103627 3558 3477 3253 3123 3104 2376 1432 1010 830 ------
NM_021033chr1393424 3313 3110 3053 2630 1357 1292 1195 190 11260 ----
NM_021148chr781674 1005 821 808 793 749 691 96 11762 --12022
NM_021163chr7113556 2978 2739 1013 760 751 713 684 587 451 237 13495 ----
NM_021238chr1252048 1678 1378 590 251 1607 1103 1361
NM_021255chr1473417 3359 1618 1466 941 300 288 1536 13845 11056
NM_021813chr6145788 5644 5632 5441 5023 2338 2228 1576 1563 1271 790 727 694 409 --1870 --
NM_021964chr3136563 5974 5876 5604 4120 2379 2217 2184 2120 1915 1881 802 375 1796 22517 1864 24211 1463
NM_022459chr13114697 4611 4240 2487 2222 1898 1879 1505 782 631 592 26043 4859 26031 5690 1554
NM_022491chr1283352 3248 2976 2621 1169 774 58 46 1418 13465 --
NM_023010chrX4647 594 588 576 1823 ----
NM_024422chr18101781 1648 1572 1546 752 683 644 572 565 103 ----11971
NM_024524chr3122879 2689 2625 2527 2486 2034 932 879 647 618 339 325 ------
NM_024624chr23597 244 227 --1389 21550 1446
NM_024665chr3154500 4467 3934 3819 3811 3564 3293 2860 1832 1013 994 927 766 752 324 --3988 260 183 --
NM_024818chr351543 1491 1359 1004 274 11467 --11294
NM_024947chr3159208 9157 8216 8057 6414 6312 3826 2744 2528 2427 2029 1523 639 407 34 18067 --25927 685
NM_024989chr287348 6192 2843 1610 1431 1326 517 180 25147 5014 23024 146 --
NM_030621chr1463728 623 478 312 205 199 12986 ----
NM_030627chr5113896 3788 3719 3595 2629 1215 433 341 244 230 160 23320 634 ----
NM_030647chr7105834 5804 5726 5691 4420 2363 2130 1406 984 450 16239 15791 --
NM_030806chr187737 7703 5877 3666 2453 1915 1891 315 --26731 5855 12167
NM_031845chr273690 3211 2300 2257 1453 475 258 13352 ----
NM_031847chr273690 3211 2300 2257 1453 475 258 13352 ----
NM_032116chr13135169 4961 4783 4028 3983 3936 1958 1875 1795 1486 1320 341 106 14397 15466 --
NM_032228chr1172962 2616 2608 2369 2352 768 476 23259 820 1483 --
NM_032373chr10145449 5125 4878 4818 3863 3662 2166 2024 1949 1740 1459 1326 478 372 --11220 --
NM_032505chr371816 1788 1775 1052 639 625 102 --11859 --
NM_032864chr141387 351 192 107 --1161 1504
NM_033020chr194863 4827 4797 4702 3472 896 832 601 569 --13107 --
NM_033222chr961376 437 389 377 77 50 31325 1175 120 ----
NM_033224chr7108051 6986 5574 2873 2237 1834 1623 1469 811 662 12193 ----
NM_033285chr8114472 3999 3907 3896 3824 3379 2955 1791 1463 568 119 --24346 3886 --
NM_033360chr12103519 3124 3081 2894 1740 1433 1042 665 546 288 --22850 323 --
NM_033430chr4104120 3667 3256 1626 1582 968 838 609 345 312 --13580 --
NM_033437chr4104120 3667 3256 1626 1582 968 838 609 345 312 --13580 --
NM_033656chr21125283 4990 4727 4410 4398 4050 3677 2330 2198 1952 1157 611 --35972 5637 983 --
NM_052811chr13114331 4291 4055 3335 2076 2016 2002 1992 1317 946 24 ------
NM_052885chr12124637 4423 4415 3677 3577 3528 1864 1405 1280 873 784 452 ----2742 112
NM_052927chr572212 2161 1994 1943 1456 859 80 ----11571
NM_053016chr965165 2258 1747 1453 1327 1260 11927 17499 11545
NM_053043chr7125841 5510 5116 4947 4881 4750 4522 4231 2189 377 256 248 ------
NM_053056chr1192647 2443 2141 2100 2094 2056 1080 917 486 --12599 --
NM_080632chrX4647 594 588 576 1823 ----
NM_080867chr1484939 4546 4171 4129 1974 1008 873 220 ----13296
NM_080927chr3113110 2492 2312 2297 2263 2202 2087 2060 1323 1110 1024 --12081 --
NM_130391chr993397 3247 3195 2730 1185 1001 841 646 505 ----1783
NM_130392chr993397 3247 3195 2730 1185 1001 841 646 505 ----1783
NM_130393chr993397 3247 3195 2730 1185 1001 841 646 505 ----1783
NM_133493chr684581 4509 3643 3080 2925 1296 104 61 ------
NM_138444chr1384352 3923 3509 1946 1796 1280 1274 538 24375 1209 14171 1618
NM_138459chr663248 2706 2663 2458 2405 894 ----11423
NM_138713chr1676395 5621 1901 1689 1653 1511 516 --36793 1918 1358 --
NM_138714chr1676395 5621 1901 1689 1653 1511 516 --36793 1918 1358 --
NM_139281chr583404 2569 2277 2193 1184 1158 1035 1020 1335 11366 13233
NM_144571chr4125020 4928 4441 2587 2536 2162 2152 1584 1406 1371 677 655 26157 2713 ----
NM_144578chr14104751 4304 3941 3778 3554 1602 1528 1378 613 234 1817 ----
NM_144599chr1595491 5246 4864 4835 4585 4024 3936 2118 1475 --15349 --
NM_144664chr1182091 1954 1044 646 449 396 356 347 12287 ----
NM_144767chr1584525 3659 3123 823 798 617 404 297 13861 12822 13263
NM_145055chr18113667 3468 3190 3153 2691 2675 1449 1337 1326 1097 345 ------
NM_145259chr297059 6664 6339 6033 5564 5302 2437 2180 314 --11253 --
NM_145808chr742902 2011 679 172 11920 43126 2474 2415 701 --
NM_147150chr964009 3937 3891 3047 2606 1533 12620 --11525
NM_148174chr852076 1704 1498 655 340 1647 1681 1620
NM_152407chr5112879 2408 2311 2304 2297 2290 1316 1155 494 300 109 --22458 2278 --
NM_152624chr5117473 6847 6603 5181 2489 1305 1219 876 538 386 272 16221 ----
NM_152756chr584244 3317 3046 1169 1080 705 292 234 ----23992 1406
NM_153188chr5145574 5537 5273 5200 4928 4910 4582 4137 3777 2135 2108 513 489 475 ------
NM_153686chr452361 1986 1774 300 280 ----1681
NM_170606chr771845 1764 1443 1368 627 324 292 --11552 11198
NM_170710chr442947 1180 607 528 ----1774
NM_173214chr1676395 5621 1901 1689 1653 1511 516 --36793 1918 1358 --
NM_173468chr4115447 5329 4322 3973 1634 1470 1435 1402 1257 262 244 --44910 4615 1477 970 --
NM_173470chrX102337 2162 2133 1047 1015 982 525 475 392 304 1273 ----
NM_173536chr4155044 4973 4655 4629 3911 3670 3485 3398 1598 1523 1453 1268 1036 497 361 25098 1839 31180 1094 1078 11965
NM_173829chr5155951 5751 5684 5462 4164 3912 2029 1814 1771 1754 1739 984 624 498 420 ------
NM_177438chr1463728 623 478 312 205 199 12986 ----
NM_181265chr442947 1180 607 528 ----1774
NM_181358chr194197 3615 3427 2780 1577 1551 993 898 148 --21226 576 --
NM_181521chr16157162 6983 5976 5581 4703 4668 2758 2700 2646 2614 2278 2019 1282 1218 57 ----15970
NM_181705chr5105784 5738 5667 4506 3795 3610 3570 1011 587 352 ------
NM_181787chr893698 3505 3420 3397 1208 789 684 459 51 ------
NM_182485chr4103205 3149 2603 2536 2500 1129 943 718 364 296 ------
NM_182646chr4103205 3149 2603 2536 2500 1129 943 718 364 296 ------
NM_182898chr7105861 5413 4304 2547 2518 2050 1891 1021 605 240 22414 2128 ----
NM_182899chr7105861 5413 4304 2547 2518 2050 1891 1021 605 240 22414 2128 ----
NM_194247chr2134477 4189 3869 3514 3045 2906 1720 1468 1414 1101 877 750 406 ------
NM_194314chr1115525 4867 4843 4658 3799 3575 1518 1400 1391 765 665 25356 4679 11414 --
NM_198268chr194197 3615 3427 2780 1577 1551 993 898 148 --21226 576 --
NM_198269chr194197 3615 3427 2780 1577 1551 993 898 148 --21226 576 --
NM_198329chr351543 1491 1359 1004 274 11467 --11294
NM_198793chr3104181 4168 3835 3431 3301 2812 2720 2634 234 160 ------
NM_199421chr1484939 4546 4171 4129 1974 1008 873 220 ----13296
NM_203327chr20124447 4362 4323 4009 3386 3272 2805 1830 1506 1221 1107 898 ------
NM_203342chr193136 2586 1302 1229 1026 917 903 589 268 11193 1261 1927
NM_203343chr193136 2586 1302 1229 1026 917 903 589 268 11193 1261 1927
NM_203446chr2122435 1934 1190 --21014 485
NM_206853chr683850 3691 3088 3028 1005 995 987 933 ------
NM_206854chr6105111 4952 4349 4289 3539 3486 3448 3427 516 187 13735 ----
NM_206855chr6166076 5917 5314 5254 4504 4451 4413 4392 3945 1481 1152 864 725 436 272 60 14700 ----
NM_207361chr13106141 5781 5165 4088 2194 1742 726 647 487 436 ------
NM_213590chr13114331 4291 4055 3335 2076 2016 2002 1992 1317 946 24 ------