TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548p
miRNA Sequence: UAGCAAAAACUGCAGUUACUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr541256 1204 1061 859 ----1974
NM_000024chr51455 1192 ----
NM_000038chr582031 1696 1650 742 630 519 423 99 --2133 65 1728
NM_000052chrX42532 1036 985 709 11340 53405 3396 3311 693 218 1617
NM_000074chrX----1336 --
NM_000081chr141542 1298 606 54 21548 1257 ----
NM_000084chrX95558 5115 5019 4273 2354 2330 2092 447 270 3796 762 567 26007 1925 --
NM_000088chr1721330 1028 --1976 --
NM_000089chr73768 729 678 ------
NM_000090chr21864 --2204 171 --
NM_000092chr2134553 4515 4062 3935 3214 2989 2816 1563 1456 1260 1037 192 126 13633 23490 1613 21693 1417
NM_000093chr92946 569 ------
NM_000097chr331073 1042 995 --1337 --
NM_000104chr262928 2697 2555 2000 596 88 --1764 --
NM_000108chr721622 49 --21485 193 --
NM_000109chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_000110chr12991 297 --1770 1971
NM_000111chr71252 --1237 --
NM_000112chr5135555 5184 4745 4471 3552 1695 1685 1085 871 837 520 491 87 14577 24197 689 --
NM_000117chrX2289 241 --2220 115 --
NM_000125chr6114220 4185 4173 4138 4048 3813 3769 1569 813 370 147 --1802 --
NM_000129chr62543 341 ----11454
NM_000138chr1542487 1884 372 354 --22558 1899 --
NM_000139chr111528 --22210 145 1838
NM_000141chr102451 319 1520 21339 583 --
NM_000142chr421323 277 ----11560
NM_000151chr17------11786
NM_000153chr1441668 1617 1507 1165 ----11230
NM_000158chr34700 580 568 450 --145 --
NM_000163chr542095 1676 1466 364 1812 21502 412 --
NM_000165chr631606 1583 1273 --1371 11072
NM_000168chr763325 3301 2367 951 552 68 --42777 1320 466 371 --
NM_000170chr92411 197 --1347 --
NM_000176chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_000189chr282241 1906 1890 1756 1505 740 214 137 1891 1104 --
NM_000192chr1231357 639 209 --21330 1320 --
NM_000194chrX2138 107 --1460 --
NM_000208chr1944611 3010 1154 271 --34044 3441 358 --
NM_000212chr1731605 801 609 21951 882 ----
NM_000214chr2021513 382 --1501 --
NM_000216chrX74016 3965 3699 3462 2962 2811 467 --2833 261 --
NM_000217chr1284842 4659 4533 3897 3647 1993 1296 1274 --11756 --
NM_000222chr441948 1936 1847 161 1624 ----
NM_000240chrX22256 1458 11717 12276 --
NM_000245chr791473 1423 809 693 677 668 521 440 89 12086 --11546
NM_000248chr362482 2310 1113 518 285 161 --1838 --
NM_000252chrX51473 1392 1352 1064 313 11126 21239 1082 --
NM_000253chr421105 121 1302 2761 349 --
NM_000259chr1565847 5817 5263 4980 4843 4384 1583 --15230
NM_000264chr992992 2732 2643 2312 2295 2254 2240 666 424 --53283 3141 3100 677 530 1160
NM_000267chr1753215 3138 2633 829 815 --73131 2921 2915 2908 2895 2135 823 21042 799
NM_000276chrX3411 291 228 12163 ----
NM_000278chr1022316 2269 --11555 --
NM_000280chr112857 658 ------
NM_000304chr172818 230 --61070 1064 348 335 328 323 --
NM_000314chr1082860 2752 2256 1225 1217 1080 349 229 33239 3227 2159 --1474
NM_000321chr1361723 1463 1228 376 355 122 --1616 11617
NM_000329chr11129 --2900 814 --
NM_000332chr6106809 6179 5277 5228 4769 4757 2690 2531 1484 987 --64382 4377 4372 4351 2481 2469 15387
NM_000333chr311114 --3301 296 290 --
NM_000337chr555281 2266 1734 1087 630 --44300 2596 2339 2328 --
NM_000340chr321488 1409 1951 2536 518 1233
NM_000345chr441020 986 889 235 2423 349 1317 --
NM_000346chr1791991 1864 1427 1385 1365 761 696 605 594 --61941 1902 1394 122 117 104 --
NM_000358chr51390 ------
NM_000361chr2072099 1670 1641 1504 708 399 234 2726 65 2633 386 --
NM_000362chr2223511 2402 --23377 1112 12497
NM_000368chr984882 4804 4456 3969 3327 746 449 424 ----24533 905
NM_000390chrX42670 615 511 351 --2516 331 --
NM_000393chr261655 1644 1549 1429 686 457 --32010 1568 419 --
NM_000397chrX32417 2099 482 ----1725
NM_000399chr1041092 1016 1006 109 ----1319
NM_000405chr54463 378 148 61 --1419 --
NM_000408chr293410 2750 2715 2257 705 372 265 254 171 23245 2579 21362 298 11279
NM_000421chr171242 ------
NM_000428chr1462654 2637 2345 2301 900 545 ----12480
NM_000430chr1743716 979 592 555 --33173 1514 1089 --
NM_000437chr122144 1426 ----1710
NM_000439chr562236 2204 1718 1626 84 60 --3965 959 247 --
NM_000441chr742164 2137 1989 531 1267 1759 12209
NM_000446chr711051 --31149 1144 862 11008
NM_000448chr1183124 2692 2316 1320 1263 947 410 31 --23092 3040 --
NM_000451chrX11435 --2790 743 --
NM_000452chr1342133 1442 1379 70 11978 11370 --
NM_000461chr354582 4443 3044 1574 916 11848 23466 77 --
NM_000462chr1541495 519 470 255 11609 1338 11396
NM_000474chr71654 ------
NM_000484chr211242 ------
NM_000489chrX103036 2741 2493 2409 2329 2263 2240 2170 1158 446 --22715 2301 --
NM_000492chr731100 260 34 1516 ----
NM_000495chrX2291 22 --1448 21064 782
NM_000503chr821870 1772 --11724 --
NM_000509chr4----1193 --
NM_000522chr71932 1922 11150 --
NM_000523chr231105 379 120 --31206 262 220 --
NM_000525chr1121463 192 ------
NM_000527chr1952457 2266 2243 874 108 ----12157
NM_000530chr13759 690 276 ------
NM_000533chrX11741 --31795 1585 205 11512
NM_000536chr111419 --189 --
NM_000553chr82596 401 ------
NM_000555chrX187559 6711 6661 6302 6117 5949 5708 5488 4763 2552 2063 1968 1950 1504 1027 897 535 326 --26043 114 --
NM_000560chr1------1683
NM_000565chr11707 --22109 1545 1678
NM_000582chr42465 401 --2385 361 --
NM_000598chr721048 47 11515 ----
NM_000599chr264605 4490 3766 1195 1147 1008 --24325 3906 --
NM_000601chr72279 126 --1169 --
NM_000610chr1182955 2852 2702 2538 2484 702 409 147 --5891 884 877 155 141 --
NM_000615chr11102949 1932 1105 990 918 714 539 219 193 147 --1967 --
NM_000618chr12106276 5904 5305 4984 4912 4075 2558 914 453 52 31962 1722 923 66033 5096 4874 4869 4406 4393 14602
NM_000618chr12106276 5904 5305 4984 4912 4075 2558 914 453 52 31962 1722 923 66033 5096 4874 4869 4406 4393 14602
NM_000619chr122207 127 1537 ----
NM_000627chr22810 618 1945 1303 --
NM_000633chr1875187 4999 4933 4010 3860 3438 2011 --44964 4939 4897 1838 15016
NM_000641chr1931579 1411 387 ------
NM_000684chr1031210 941 282 --1504 --
NM_000686chrX21562 1143 ----11000
NM_000701chr1----1244 --
NM_000702chr122199 1505 12161 21871 1657 --
NM_000719chr1272474 1932 1898 1882 1721 860 36 1987 51698 1512 1018 785 707 --
NM_000720chr31126 ------
NM_000721chr132103 295 229 ------
NM_000724chr1061722 1426 1317 674 185 123 --11236 --
NM_000726chr221266 512 --1245 --
NM_000747chr171678 ------
NM_000756chr8198 --1325 --
NM_000767chr1931315 971 389 --11099 --
NM_000785chr122658 61 ------
NM_000792chr11982 ------
NM_000793chr1455124 4769 3692 3433 1717 21389 780 14760 --
NM_000800chr51416 --11648 --
NM_000801chr2031020 766 166 --1260 --
NM_000806chr521633 598 11369 3534 501 496 --
NM_000807chr4153 1163 --159
NM_000809chr4139079 8586 8143 7666 6262 6204 2624 2521 2065 1506 1468 1234 941 38673 2178 24 58918 7758 2123 1644 628 --
NM_000811chr52529 278 ------
NM_000813chr585236 5116 4942 4620 4200 1138 1085 596 24244 1741 65128 5122 4313 1980 1659 1183 1696
NM_000814chr1563968 2663 1506 760 576 263 13084 24119 1051 13712
NM_000816chr52641 203 ------
NM_000817chr221072 157 ------
NM_000824chr41773 ------
NM_000826chr421677 601 --22420 882 --
NM_000827chr532487 2142 495 1216 22447 170 --
NM_000829chr1132344 932 741 192 ----
NM_000831chr136271 6143 6132 ------
NM_000838chr672757 2079 1970 1828 1751 932 336 ------
NM_000839chr31466 ------
NM_000840chr71374 ------
NM_000842chr111302 --1506 --
NM_000844chr33839 440 51 --1908 1810
NM_000859chr551678 1381 1353 692 432 --11564 11707
NM_000861chr331949 1724 1717 ------
NM_000865chr6----2161 151 --
NM_000868chrX32547 427 310 12219 1251 --
NM_000872chr1041483 1017 503 36 --1378 --
NM_000875chr15136908 6493 6251 5887 5667 4877 4598 2464 2114 1737 1679 1118 589 26817 6288 46534 5476 2355 1286 --
NM_000877chr233024 3003 2409 11011 ----
NM_000891chr17133617 3607 3227 3217 3010 2777 2440 2422 1075 914 846 738 443 2597 566 2422 250 --
NM_000899chr1253799 3374 1646 1637 60 11197 ----
NM_000901chr472402 2320 2274 1672 893 763 688 --2843 699 1448
NM_000909chr41243 --21333 151 --
NM_000910chr431763 1739 1398 1578 1488 --
NM_000912chr822195 1132 1291 21105 894 11286
NM_000921chr122672 141 --2493 185 --
NM_000922chr1131009 878 297 1860 1391 --
NM_000926chr11139327 9129 8832 8805 2924 1634 1437 1269 1180 683 453 315 35 27935 5890 67013 6176 3732 3194 202 51 12379
NM_000933chr2031518 1489 470 21172 269 183 --
NM_000934chr172693 682 ------
NM_000935chr331008 961 254 --2808 796 --
NM_000937chr171384 ------
NM_000938chr42162 115 ------
NM_000943chr55463 372 173 115 91 ------
NM_000944chr452057 2025 765 625 119 21840 596 1789 1504
NM_000945chr241814 1803 1579 601 21830 568 134 --
NM_000950chrX103441 3123 3093 2982 2234 2218 1312 1171 655 443 --22437 151 33035 491 189
NM_000956chr142320 312 ------
NM_000958chr521249 1165 --11234 --
NM_000961chr2034039 3517 3382 13152 1880 --
NM_000962chr982899 2782 2704 2673 2238 2046 1126 366 --12339 --
NM_000964chr17----2534 514 --
NM_000965chr321234 389 --1867 --
NM_000966chr1221085 135 --1858 --
NM_000983chr1125 ------
NM_000990chr1133866 3822 598 11028 13649 --
NM_001001132chr213500 407 267 1395 ----
NM_001001323chr1263010 2891 2823 2293 964 888 --31264 1132 763 11202
NM_001001331chr341723 1704 947 802 --1392 --
NM_001001342chr10----11206 --
NM_001001389chr1182955 2852 2702 2538 2484 702 409 147 --5891 884 877 155 141 --
NM_001001390chr1182955 2852 2702 2538 2484 702 409 147 --5891 884 877 155 141 --
NM_001001391chr1182955 2852 2702 2538 2484 702 409 147 --5891 884 877 155 141 --
NM_001001392chr1183001 2898 2748 2584 2530 748 455 193 --5937 930 923 201 187 --
NM_001001394chr21615 2536 494 ----
NM_001001395chr1251747 803 774 363 253 --52191 2185 808 237 58 --
NM_001001396chr1124430 4313 4129 3914 3875 3337 3290 1641 1537 1315 855 634 11004 24452 2787 --
NM_001001419chr5125205 5073 4642 3786 948 849 791 688 657 474 167 149 25223 4286 33520 2035 1013 --
NM_001001420chr5125205 5073 4642 3786 948 849 791 688 657 474 167 149 25223 4286 33520 2035 1013 --
NM_001001433chr2043178 3137 2985 713 --32865 2024 191 --
NM_001001436chr162835 222 ------
NM_001001481chr832778 1276 709 --31256 1251 974 21042 996
NM_001001483chr113454 376 35 --2425 41 1359
NM_001001484chr103988 660 640 --2865 653 11994
NM_001001549chr7142820 2760 2563 2307 2142 2114 1148 671 413 399 382 178 157 124 --12519 --
NM_001001550chr7142820 2760 2563 2307 2142 2114 1148 671 413 399 382 178 157 124 --12519 --
NM_001001555chr7142820 2760 2563 2307 2142 2114 1148 671 413 399 382 178 157 124 --12519 --
NM_001001556chr15194 11504 11202 --
NM_001001557chr821860 1819 --21672 265 --
NM_001001664chr284104 3887 2979 1601 1402 862 371 104 --33845 3328 891 --
NM_001001668chr1943784 3407 3348 3125 11370 1125 --
NM_001001702chr541649 1202 739 388 --1588 --
NM_001001740chr12257 125 ------
NM_001001740chr12257 125 ------
NM_001001790chr91401 ------
NM_001001852chr221940 ------
NM_001001875chr91456 --3425 282 89 --
NM_001001890chr2183697 3655 3583 3412 3403 3390 3315 1207 13617 83747 3424 3368 3258 865 695 690 685 --
NM_001001928chr2288337 6347 6276 6212 6042 1930 163 84 16649 35833 1511 929 26009 1239
NM_001001933chr14475 233 188 128 ----1416
NM_001001936chr10--164 ----
NM_001001937chr18139 ------
NM_001001938chr933362 2958 897 --23131 3041 --
NM_001001974chr1082266 1819 1569 1521 869 765 663 562 --11591 --
NM_001001994chrX----1428 195
NM_001001995chrX11759 --21699 1554 11744
NM_001001996chrX----1428 195
NM_001002006chr21113 --2814 809 --
NM_001002026chr31445 12214 12423 22478 1619
NM_001002033chr173603 298 93 ------
NM_001002233chr822174 2016 1827 11769 --
NM_001002243chr23755 245 121 --1724 1586
NM_001002244chr17191 ------
NM_001002245chr171126 ------
NM_001002246chr171126 ------
NM_001002247chr171126 ------
NM_001002248chr171126 ------
NM_001002249chr171126 ------
NM_001002255chr6----2351 133 --
NM_001002257chr253011 1302 147 135 81 22881 123 --23366 3226
NM_001002259chr12----2138 107 --
NM_001002269chr92490 341 --1377 --
NM_001002295chr102804 68 --2915 441 --
NM_001002762chr10----12449 11805
NM_001002838chrX21867 755 --1137 --
NM_001002860chr1473955 3420 3084 653 388 296 131 --43410 3361 176 120 --
NM_001002909chr1742020 1633 839 166 --21526 1495 --
NM_001003406chr2243056 2990 2099 369 ------
NM_001003652chr18198643 7538 7431 7143 6935 6341 5680 5538 2881 2871 2770 2237 2183 1833 1380 1147 755 651 466 15447 56636 2804 2291 672 662 17568
NM_001003674chr18116159 6086 5863 5577 5293 5138 4922 4727 4593 1445 136 37013 6541 2695 46349 5520 1983 473 --
NM_001003675chr18116159 6086 5863 5577 5293 5138 4922 4727 4593 1445 136 37013 6541 2695 46349 5520 1983 473 --
NM_001003678chr111108 ------
NM_001003679chr182180 2141 2134 1847 1538 1441 585 572 ------
NM_001003681chr2242119 1384 521 178 --22053 1900 --
NM_001003688chr441135 1096 1011 474 --2763 490 --
NM_001003698chr62403 353 ------
NM_001003699chr62403 353 ------
NM_001003712chr12113955 3847 3647 3078 2818 2808 2785 1271 1229 790 236 --32670 1199 802 23501 3474
NM_001003792chr32994 212 --1110 --
NM_001003793chr32994 212 --1110 --
NM_001003794chr3--13009 --1161
NM_001003800chr922441 823 --13222 22699 2611
NM_001003810chr43558 194 117 --1637 --
NM_001003845chr21473 1427 ----
NM_001003940chr1521363 112 --23698 102 --
NM_001003942chr1521363 112 --23698 102 --
NM_001003943chr1521367 116 --23702 106 --
NM_001004019chr3----2406 116 --
NM_001004051chrX----186 --
NM_001004065chr953818 3785 1535 1396 991 --22611 1153 12911
NM_001004128chr11482 ----1687
NM_001004196chr331016 499 229 ------
NM_001004303chr13720 690 568 ------
NM_001004303chr13720 690 568 ------
NM_001004304chr1232002 1247 367 --23091 388 13119
NM_001004308chrX11489 --1615 --
NM_001004317chr653827 3541 3389 1049 493 ----13313
NM_001004329chr1251458 1353 1249 1155 1095 ----11314
NM_001004342chr1135962 5710 5079 4363 4338 4195 3985 3767 2046 1547 1502 755 602 15026 ----
NM_001004346chr441027 900 253 43 ----1391
NM_001004356chr411148 ----11524
NM_001004358chr411148 ----11524
NM_001004360chr251830 1502 775 301 252 11255 11606 --
NM_001004419chr1234457 1629 50 11454 ----
NM_001004720chr21743 ------
NM_001004722chr21912 ------
NM_001005158chr31385 ------
NM_001005159chr31385 ------
NM_001005242chr1221623 388 1235 ----
NM_001005266chr15----157 --
NM_001005267chr15----157 --
NM_001005268chr15----157 --
NM_001005269chr15----157 --
NM_001005335chr19----168 175
NM_001005353chr121313 1280 ------
NM_001005353chr121313 1280 ------
NM_001005366chr122904 307 --3763 757 263 1278
NM_001005375chrY31743 1736 1215 ----11161
NM_001005386chr251987 1643 774 628 246 1157 1573 2902 168
NM_001005404chr1784384 4335 4227 3747 3719 3143 1752 189 11412 14352 --
NM_001005463chr1092368 2132 1962 912 904 876 467 286 140 ----1773
NM_001005473chr5116403 4792 4660 4596 4432 4329 2612 2235 474 438 259 --14588 24637 606
NM_001005474chr321394 535 --21338 1186 --
NM_001005502chr1264983 4735 2090 1970 817 329 24664 3177 14319 --
NM_001005526chr21131 --1107 --
NM_001005527chr331300 1013 405 11324 158 --
NM_001005612chrX--1170 ----
NM_001005739chr21189 151 1550 --
NM_001005743chr1421130 373 --21116 1097 --
NM_001005744chr1421130 373 --21116 1097 --
NM_001005745chr1421130 373 --21116 1097 --
NM_001005746chr221266 512 --1245 --
NM_001005747chr221266 512 --1245 --
NM_001005782chr22161 64 ------
NM_001005849chr171477 ------
NM_001005861chr331012 944 225 --1913 --
NM_001005862chr17----2499 494 --
NM_001005910chr31458 1432 2480 463 --
NM_001005911chr31458 1432 2480 463 --
NM_001006115chr322704 2009 --22582 996 --
NM_001006600chr542017 1659 1591 272 1746 12446 1483
NM_001006605chr11942 --11158 --
NM_001006605chr11942 --11158 --
NM_001006610chr168973 920 900 677 326 294 287 247 --1854 --
NM_001006623chr2102537 2510 2458 2385 2183 1628 914 689 499 154 --1305 --
NM_001006635chr2----1225 --
NM_001006636chr21968 ------
NM_001006641chr911125 ------
NM_001006642chr911125 ------
NM_001006643chr911125 ------
NM_001006656chr1941687 1249 1215 579 11396 ----
NM_001006657chr2102658 2601 2343 2324 1058 1016 917 707 134 96 --1252 13190
NM_001006684chrX1400 --3423 414 109 --
NM_001006946chr241435 538 514 475 --21443 1189 --
NM_001007023chr1455124 4769 3692 3433 1717 21389 780 14760 --
NM_001007024chr1743288 1747 1386 250 23196 1621 64357 4304 3745 3714 3401 1485 12921
NM_001007025chr1743288 1747 1386 250 23196 1621 64357 4304 3745 3714 3401 1485 12921
NM_001007075chr481118 921 837 808 713 438 426 393 11014 ----
NM_001007097chr944900 4443 4134 3628 --33926 1399 788 --
NM_001007098chr12734 63 --1895 --
NM_001007099chr12688 121 1750 2327 322 --
NM_001007100chr12688 121 1750 2327 322 --
NM_001007102chr651311 1273 622 488 338 --31620 1593 1058 --
NM_001007214chr13622 406 341 --2314 227 --
NM_001007226chr1731236 1093 426 --11120 --
NM_001007227chr1731236 1093 426 --11120 --
NM_001007228chr1731236 1093 426 --11120 --
NM_001007229chr1731236 1093 426 --11120 --
NM_001007230chr1731236 1093 426 --11120 --
NM_001007237chr162812 2391 2138 2092 1863 472 --1645 --
NM_001007246chr2141695 1311 482 281 2778 384 ----
NM_001007257chr151464 1401 1233 1001 389 --31191 949 535 11051
NM_001007267chr22790 170 --1845 --
NM_001007277chr112420 273 ------
NM_001007278chr1365015 4752 3192 2119 935 533 25254 5117 34632 1319 199 133
NM_001007466chr6115217 5043 4930 4714 4707 4531 4500 4064 4031 3493 710 11439 51584 1578 1572 1559 1546 --
NM_001007468chr22----1261 --
NM_001007559chr1862047 1787 1621 705 418 372 --31614 1607 1601 --
NM_001007793chr102253 39 ------
NM_001008222chrX----125 --
NM_001008225chr73594 586 62 --2573 84 --
NM_001008226chr1531776 1424 1202 11361 ----
NM_001008239chr1873316 3179 3070 3016 2390 1172 579 13124 93711 3506 3470 3459 1351 1345 1339 1330 1314 --
NM_001008392chr322886 229 --2862 148 --
NM_001008405chr7--11700 --2382 350
NM_001008407chr721850 1822 ------
NM_001008408chr7116259 5931 5842 5765 5416 5274 5118 4527 2563 2110 1550 --45512 4874 263 258 --
NM_001008491chr272038 1776 1538 741 500 227 173 11810 1545 --
NM_001008492chr272038 1776 1538 741 500 227 173 11810 1545 --
NM_001008495chr852031 1871 1858 559 424 --41489 474 469 464 1807
NM_001008529chr1731326 944 452 1303 ----
NM_001008540chr22139 117 --2382 177 --
NM_001008541chr1052266 2101 2018 1944 339 12210 12172 12107
NM_001008541chr1052266 2101 2018 1944 339 12210 12172 12107
NM_001008564chr1392141 2021 1954 1895 1805 1689 836 397 347 12189 1309 --
NM_001008660chr1131597 1498 1473 --11297 21541 1371
NM_001008701chr1922776 1927 --12003 --
NM_001008707chr1421666 763 --2193 85 --
NM_001008738chr552373 2270 977 785 450 1443 32744 2739 2341 --
NM_001008800chr12204 91 ------
NM_001008801chr1921630 281 12100 11765 --
NM_001008883chr12204 91 ------
NM_001008895chr1341200 972 934 338 --1957 --
NM_001008925chr463569 3433 3186 2602 495 292 ----12336
NM_001009185chr5----1628 --
NM_001009571chr751187 634 488 240 93 1501 2197 184 --
NM_001009881chr11605 ------
NM_001009882chr11605 ------
NM_001009894chr1231552 1315 1144 11706 --1336
NM_001009909chr1162906 2759 1186 1152 573 536 23682 36 33959 1138 220 11548
NM_001009959chr232364 2081 458 22565 645 12461 --
NM_001009960chr762830 2406 2374 2232 863 674 ------
NM_001009993chr252826 1671 1389 1318 210 --14282 --
NM_001009994chr61124 ------
NM_001010853chr6113245 3143 2911 2310 2258 1045 988 677 430 345 180 12627 21227 519 13042
NM_001010854chr141194 ----1260
NM_001010861chr1176 ----1475
NM_001010862chrX42523 978 168 102 --33297 526 112 11234
NM_001010867chr145327 4724 2149 927 --26562 5452 --
NM_001010888chrX114502 4342 4113 4004 3500 3470 3387 3359 3207 3057 581 --34585 4416 3509 --
NM_001010891chr5136671 6240 6102 5250 4894 4448 4359 4249 2265 1377 1113 666 290 14542 45927 5088 4282 2667 15462
NM_001010895chr922040 1965 11301 1411 --
NM_001010922chr194215 3318 2952 2923 1338 1273 654 443 352 23306 1576 44109 207 202 197 --
NM_001010923chr651369 1133 1125 1112 401 21498 1076 11534 --
NM_001010924chr101363 --3859 785 499 --
NM_001010927chr62457 111 1379 1388 --
NM_001010932chr72279 126 --1169 --
NM_001010942chr1231299 1214 906 181 ----
NM_001010971chr15955 875 760 708 227 ------
NM_001010986chrX41656 1649 601 355 --12516 1339
NM_001010989chr162551 133 ------
NM_001010990chr162551 133 ------
NM_001011513chr474033 3354 3330 2530 980 835 819 --44050 2513 1627 1617 --
NM_001011515chr42783 172 --1266 --
NM_001011516chr42783 172 --1266 --
NM_001011537chr342121 2052 1836 1729 ------
NM_001011546chr202824 343 1746 --1251
NM_001011553chr72660 66 --2971 147 --
NM_001011657chrX31079 951 137 11054 1311 --
NM_001011666chr796552 6430 6331 5095 4755 4506 4226 1665 1174 --26445 2549 --
NM_001011708chr262584 2532 2075 1184 209 138 --2853 743 --
NM_001011713chr1481580 1542 1466 1155 998 566 174 150 --1338 --
NM_001011718chr20----1810 --
NM_001011720chr821005 94 11474 21303 38 --
NM_001012393chr11115116 4120 3583 2069 1805 1592 1312 797 684 146 121 --54568 4110 138 132 97 --
NM_001012398chr162926 852 ------
NM_001012418chr694224 3656 3401 3203 3168 2858 1551 1390 574 13065 24071 3918 --
NM_001012426chr653331 3098 3066 2713 696 --11036 --
NM_001012427chr653331 3098 3066 2713 696 --11036 --
NM_001012478chr191619 1606 2635 416 --
NM_001012732chr431227 1213 512 ------
NM_001012751chr1061947 1523 1378 724 703 449 11531 --1417
NM_001012754chr1361954 1925 1857 1766 1671 127 12019 1157 --
NM_001012756chr1983261 3120 3043 2638 2504 2286 409 355 --23005 2364 1367
NM_001012761chr582560 2196 2132 2040 1984 1679 743 34 22571 1020 21934 211 12262
NM_001012968chrX92778 2416 2245 1808 974 912 891 163 54 32550 2341 181 --12448
NM_001012977chrX31349 503 327 --11116 --
NM_001012980chrX1229 ------
NM_001012989chrX2631 584 --163 1687
NM_001013031chr1043024 2252 978 767 ----13236
NM_001013398chr721048 47 11515 ----
NM_001013399chr62346 137 ------
NM_001013406chr731736 1180 37 11123 ----
NM_001013415chr431292 558 520 --11445 --
NM_001013437chr18----171 --
NM_001013438chr331021 984 758 1694 ----
NM_001013439chr33867 830 604 1540 1273 --
NM_001013620chr12208458 8140 8027 7969 7507 6536 6496 5923 5435 3390 2693 2666 2582 2166 2147 1762 1393 432 396 292 --58482 8016 6616 2823 2356 16973
NM_001013629chr1011387 --12117 --
NM_001013635chr12----1429 --
NM_001013699chr12273 27 ------
NM_001013703chr15--1446 ----
NM_001013843chr155925 886 769 705 196 --1265 --
NM_001014286chr13----177 --
NM_001014380chr13165825 5588 5467 5220 4964 4674 4661 4372 3933 2141 1960 1914 1749 770 757 639 35840 5385 185 35734 672 36 --
NM_001014434chr12688 207 ------
NM_001014443chr12254 86 ------
NM_001014797chr1098226 7411 5267 3047 2134 1895 943 794 756 12240 35598 1475 1160 22637 2082
NM_001014812chr151171 ------
NM_001014972chr2135 ----166
NM_001015045chr462466 1986 1760 1638 505 209 12314 1876 --
NM_001015048chr14143054 2941 2742 2621 2450 2320 2222 1984 620 545 284 247 227 34 --2727 521 12880
NM_001015049chr14143054 2941 2742 2621 2450 2320 2222 1984 620 545 284 247 227 34 --2727 521 12880
NM_001015053chr1731571 1397 1063 --145 --
NM_001015508chr81649 --1218 --
NM_001015877chrX62631 1009 930 630 342 154 11933 43024 2936 2476 2471 12484
NM_001015881chrX41279 1175 335 65 --21038 1033 --
NM_001015882chr91766 ----1221
NM_001015887chr331413 1326 1256 --11511 --
NM_001017368chr1772833 2383 2300 2017 1990 733 507 1473 12565 12809
NM_001017369chr421120 1020 ------
NM_001017371chr231032 404 201 11311 11080 --
NM_001017395chr352696 2628 2344 1204 1025 --23202 2640 11312
NM_001017415chr13513 304 297 ------
NM_001017416chr13513 304 297 ------
NM_001017420chr81189 --31416 951 155 11434
NM_001017424chr141615 1372 422 251 11771 ----
NM_001017425chr141615 1372 422 251 11771 ----
NM_001017440chr777826 7066 6617 5251 2783 1458 1079 11085 26825 228 --
NM_001017920chr21119 ------
NM_001017922chr11122 --21713 1499 --
NM_001017923chr1421070 70 11647 ----
NM_001017926chr81706 11775 11606 --
NM_001017928chr31247 ------
NM_001017930chrX51332 1220 170 105 99 --1207 1120
NM_001017969chr92672 180 --2562 418 --
NM_001017977chr11366 ------
NM_001017999chr122169 348 --41705 360 354 331 --
NM_001017999chr122169 348 --41705 360 354 331 --
NM_001018000chr122169 348 --41705 360 354 331 --
NM_001018000chr122169 348 --41705 360 354 331 --
NM_001018001chr122169 348 --41705 360 354 331 --
NM_001018004chr15----348 43 38 --
NM_001018006chr15----348 43 38 --
NM_001018007chr15----348 43 38 --
NM_001018020chr15----348 43 38 --
NM_001018025chrX138 ------
NM_001018037chr981469 1326 1091 976 509 393 306 270 ------
NM_001018038chr92195 110 1187 ----
NM_001018053chr171971 1855 1718 682 350 337 248 --11695 --
NM_001018056chr92506 169 ------
NM_001018057chr112296 155 ------
NM_001018064chr942145 2136 1901 1698 1380 21936 1584 11820
NM_001018065chr996010 5056 4641 4059 3915 3895 3708 2247 1401 21965 1883 ----
NM_001018066chr996010 5056 4641 4059 3915 3895 3708 2247 1401 21965 1883 ----
NM_001018067chr174825 4676 3976 3937 277 203 58 --35385 5328 4834 --
NM_001018068chr174825 4676 3976 3937 277 203 58 --35385 5328 4834 --
NM_001018069chr174825 4676 3976 3937 277 203 58 --35385 5328 4834 --
NM_001018074chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_001018075chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_001018076chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_001018077chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_001018078chr91447 --182 --
NM_001018089chr1573541 2689 2631 1581 955 608 433 --53921 3908 3903 3347 2694 --
NM_001018090chr1592604 2488 2193 2033 1920 661 648 313 225 --32842 2283 640 1919
NM_001018091chr1592714 2598 2303 2143 2030 771 758 423 335 --32952 2393 750 11029
NM_001018100chr151251 1311 1859 1773
NM_001018102chr1592604 2488 2193 2033 1920 661 648 313 225 --32842 2283 640 1919
NM_001018108chr1552142 803 721 606 147 11843 1506 --
NM_001018111chr754035 3849 3767 720 627 --43201 3196 3112 980 11177
NM_001018676chr81477 ------
NM_001018677chr81477 ------
NM_001020658chr171635 1563 1448 1441 1418 1318 427 --1298 --
NM_001020658chr171635 1563 1448 1441 1418 1318 427 --1298 --
NM_001023567chr1562381 2363 2282 2198 1829 1536 1409 ----
NM_001024094chr573845 3571 3452 3299 1231 954 782 --2125 89 --
NM_001024226chr121121 998 --1187 --
NM_001024227chr121121 998 --1187 --
NM_001024228chr121121 998 --1187 --
NM_001024372chr852010 1801 915 892 270 ------
NM_001024380chr852027 632 580 226 128 ------
NM_001024381chr852027 632 580 226 128 ------
NM_001024455chrX72475 2218 2109 2036 1893 86 43 --11698 --
NM_001024647chr1276861 6815 6378 4756 1727 173 117 27721 5940 24662 1027 --
NM_001024649chr552870 2824 2635 2001 286 1656 1520 --
NM_001024660chr341494 1400 1374 368 --11366 --
NM_001024736chr1511514 ------
NM_001024808chr1221831 419 --11853 --
NM_001024809chr17----2534 514 --
NM_001024847chr31581 --22235 1562 --
NM_001024855chr31163 --11686 --
NM_001024934chr6----2587 93 --
NM_001024935chr6----2587 93 --
NM_001024936chr6----2587 93 --
NM_001024937chr17--1749 198 --
NM_001024947chr51170 ----1861
NM_001024948chr163436 3272 3251 1137 731 174 --32504 649 228 1959
NM_001024956chr1195829 5747 5404 4780 3680 1746 1425 1174 897 13839 15773 15148
NM_001025068chr321264 1136 --51689 650 635 480 386 --
NM_001025069chr321264 1136 --51689 650 635 480 386 --
NM_001025076chr10145867 4898 4480 3882 3792 2465 1571 1499 1302 1176 968 912 837 612 21281 1234 76170 5908 5465 3915 3800 1888 680 --
NM_001025077chr10217225 6256 5838 5240 5150 5021 4998 4860 4809 4708 2929 2857 2660 2534 2326 2270 2195 1970 1144 252 203 22639 2592 117528 7266 6823 5273 5158 4732 4614 2038 1350 1081 304 1649
NM_001025079chr353787 3743 2725 2580 1357 13361 43996 3605 2842 243 --
NM_001025105chr531553 1057 53 1970 1344 1332
NM_001025108chr252901 1352 1333 583 142 --23020 2698 11658
NM_001025201chr22147 68 1579 ----
NM_001025252chr883218 3203 2966 2825 2619 2570 2181 603 11257 13164 --
NM_001025253chr883218 3203 2966 2825 2619 2570 2181 603 11257 13164 --
NM_001025266chr384392 3883 3437 1951 1750 1200 206 47 ------
NM_001025366chr631898 1384 577 11729 11351 11467
NM_001025366chr631898 1384 577 11729 11351 11467
NM_001025367chr631898 1384 577 11729 11351 11467
NM_001025367chr631898 1384 577 11729 11351 11467
NM_001025368chr631898 1384 577 11729 11351 11467
NM_001025368chr631898 1384 577 11729 11351 11467
NM_001025369chr631914 1400 593 11745 11367 11483
NM_001025369chr631914 1400 593 11745 11367 11483
NM_001025370chr631898 1384 577 11729 11351 11467
NM_001025370chr631898 1384 577 11729 11351 11467
NM_001025579chr1721009 331 --1857 --
NM_001025580chrX83860 3838 3531 3050 2842 2612 548 228 31083 566 186 33786 341 282 13555
NM_001025595chr471685 1663 1333 1095 662 468 240 11450 11253 --
NM_001025596chr114466 362 197 55 ------
NM_001025616chr4----31180 643 432 --
NM_001025780chr931107 1082 313 1134 185 --
NM_001029839chr321486 615 --11510 --
NM_001029840chr321486 615 --11510 --
NM_001029858chr693144 2241 2210 2165 1362 576 451 352 50 ------
NM_001029863chr672959 2363 2080 1169 982 531 60 --13098 1145
NM_001029875chr562783 2737 2419 1105 1085 640 --1814 11150
NM_001029882chr1----138 --
NM_001029882chr1----138 --
NM_001029884chr652529 1991 867 543 102 --42515 1827 1810 42 --
NM_001029989chr155638 390 287 71 56 ------
NM_001029998chr421227 188 --21424 232 --
NM_001029999chr18131 1215 --11073
NM_001030001chr141438 ------
NM_001030006chr173584 419 322 --12492 --
NM_001030007chr16--1630 33673 3667 701 --
NM_001030055chr14164639 4596 4491 4378 4129 3699 3588 3094 3079 2882 1447 1322 1152 982 928 738 --13071 21238 400
NM_001031623chr651570 484 165 153 68 --1125 --
NM_001031679chr1263451 3056 2828 290 171 111 --23427 138 --
NM_001031681chr1722330 33 ------
NM_001031684chr231029 965 934 --2165 39 --
NM_001031695chr2265338 3795 3573 2069 1717 1706 14487 52185 2179 2090 792 217 --
NM_001031700chr462316 2205 2130 904 371 214 --32221 653 55 1836
NM_001031710chr72934 59 1245 ----
NM_001031712chr61162 ------
NM_001031716chr23376 337 146 1130 ----
NM_001031723chr41349 ------
NM_001031732chr493164 2568 1064 883 818 788 750 144 59 --3857 368 318 13409
NM_001031748chr12----1562 1466
NM_001031803chr171253 ------
NM_001031804chr1632841 1403 1160 11723 73566 3342 3337 2851 2846 1086 501 --
NM_001031812chr582243 2126 2099 1826 1733 492 214 143 --1678 --
NM_001032280chr611341 --11423 --
NM_001032282chr821201 815 1315 21307 328 11078
NM_001032283chr125939 925 841 309 246 1804 ----
NM_001032284chr125939 925 841 309 246 1804 ----
NM_001032288chr201175 --11090 --
NM_001032296chr1372793 2360 1909 1833 1020 868 624 --2249 27 --
NM_001032363chr151984 1850 795 249 170 --11709 --
NM_001032363chr151984 1850 795 249 170 --11709 --
NM_001032367chr15----1449 --
NM_001032380chr1031995 560 139 1155 41460 497 372 285 1251
NM_001032393chrX1204 1559 ----
NM_001032394chr662664 2592 2150 1787 938 272 --11132 1259
NM_001032395chr662531 2459 2017 1654 805 139 --1999 1126
NM_001032999chr2055349 3804 3792 1531 253 --31359 1352 724 15275
NM_001033002chr17198 ------
NM_001033025chr141549 1507 1483 598 ----1588
NM_001033044chr161789 1399 1254 1183 702 154 11272 --1722
NM_001033047chr432088 649 161 ------
NM_001033056chr161789 1399 1254 1183 702 154 11272 --1722
NM_001033057chr331403 1333 799 --1273 --
NM_001033059chr631809 1782 593 1603 71861 1856 1851 1846 1841 1835 1546 --
NM_001033081chr141866 1785 1762 1751 --1739 --
NM_001033082chr141866 1785 1762 1751 --1739 --
NM_001033087chr2073303 3220 2919 2441 2253 1312 575 23278 815 32294 1001 151 13178
NM_001033112chr5--1734 --1126
NM_001033506chr111337 ------
NM_001033507chr111805 11367 1118 --
NM_001033518chr742243 1954 1893 246 --3745 613 226 1556
NM_001033519chr742243 1954 1893 246 --3745 613 226 1556
NM_001033520chr742243 1954 1893 246 --3745 613 226 1556
NM_001033557chr231226 216 70 --1339 --
NM_001033561chr173767 751 641 --1781 --
NM_001033566chr171244 ------
NM_001033568chr171244 ------
NM_001033578chr832297 1983 914 1397 12236 2409 284
NM_001033602chr1332255 1879 770 --1827 12274
NM_001033659chr1721369 1174 --11306 --
NM_001033723chr831966 1857 1017 22306 900 3566 458 271 12797
NM_001033756chr631832 1318 511 11663 11285 11401
NM_001033756chr631832 1318 511 11663 11285 11401
NM_001033910chr152152 2117 2099 1971 591 ----1710
NM_001033925chr1031446 580 141 --21905 189 --
NM_001034837chr52597 241 ------
NM_001034838chr52597 241 ------
NM_001034841chr1643820 3493 1392 704 --95535 5338 5198 4400 4026 4020 3573 1542 1040 --
NM_001034845chr451403 1115 1070 1062 948 --31421 1087 1081 --
NM_001034850chr541474 1422 203 122 --11144 --
NM_001034852chr142400 375 --1160 --
NM_001034954chr1053245 3006 2826 2661 2499 --12094 --
NM_001034955chr1053245 3006 2826 2661 2499 --12094 --
NM_001034956chr1053245 3006 2826 2661 2499 --12094 --
NM_001034957chr1053245 3006 2826 2661 2499 --12094 --
NM_001035chr131260 173 95 --31063 1031 87 --
NM_001035003chr431429 1224 129 ----1346
NM_001035004chr431429 1224 129 ----1346
NM_001035254chr922503 1612 --12608 --
NM_001035260chr1041288 1146 604 512 1313 1422 --
NM_001037131chr231335 1145 1008 ------
NM_001037132chr722148 374 --21711 1533 --
NM_001037133chr722148 374 --21711 1533 --
NM_001037164chr741419 772 336 120 11407 41670 1445 1437 125 --
NM_001037165chr798940 7409 7149 6819 6534 5843 2280 582 238 --128921 8857 8334 7650 7332 7327 7319 7312 7294 6592 1404 1162 --
NM_001037172chr351371 1032 943 923 72 11216 ----
NM_001037174chr231895 179 30 --32136 712 447 --
NM_001037317chr1176 ----1475
NM_001037331chr182181 160 ------
NM_001037332chr522409 2291 12492 ----
NM_001037333chr522409 2291 12492 ----
NM_001037334chr183787 381 49 1892 ----
NM_001037339chr141445 1307 585 410 --21185 714 --
NM_001037340chr141445 1307 585 410 --21185 714 --
NM_001037341chr141445 1307 585 410 --21185 714 --
NM_001037341chr141445 1307 585 410 --21185 714 --
NM_001037535chrX41318 1183 1107 976 11249 196 11230
NM_001037536chrX41318 1183 1107 976 11249 196 11230
NM_001037540chrX41318 1183 1107 976 11249 196 11230
NM_001037553chr2135114 4451 3751 --14051 14477
NM_001037582chr461736 1444 1119 1099 1083 374 11191 41181 213 204 143 --
NM_001037637chr5----187 --
NM_001037872chr23299 228 128 --1642 --
NM_001037954chr1133068 863 681 --1775 --
NM_001038628chr341609 1582 1178 384 1726 --1231
NM_001038640chr151763 ------
NM_001038702chr5102671 2548 2311 2224 1107 1069 506 406 243 223 1337 22599 1946 --
NM_001039029chr1211994 ------
NM_001039091chrX31237 287 245 --155 --
NM_001039199chr2044950 4547 4188 1130 --3989 278 273 --
NM_001039350chr7--11665 2660 153 --
NM_001039395chr992435 2290 1996 1663 472 244 235 186 152 --42403 2336 462 90 --
NM_001039465chr142444 421 1519 ----
NM_001039479chr1452436 2074 919 599 141 22005 820 12104 --
NM_001039523chr23423 407 350 ------
NM_001039538chr253691 3670 1066 493 259 11250 1245 --
NM_001039547chr3167894 7873 7154 7032 6723 6557 6476 5170 2932 2782 2553 1944 1791 988 965 232 21987 841 31404 1398 870 16892
NM_001039570chr2244105 1264 571 410 --14063 14612
NM_001039571chr2244105 1264 571 410 --14063 14612
NM_001039573chr171444 1414 ----
NM_001039574chr12702 658 1289 1680 --
NM_001039577chr174496 3901 3478 1075 953 513 233 ------
NM_001039585chr173234 1684 1574 1449 977 710 453 1777 43441 3227 2883 44 22950 2828
NM_001039590chrX113782 3721 3634 3482 3473 3058 2642 1519 1476 200 155 1934 42707 1436 1409 987 1506
NM_001039591chrX113782 3721 3634 3482 3473 3058 2642 1519 1476 200 155 1934 42707 1436 1409 987 1506
NM_001039618chr1185813 5044 5037 4038 2051 2003 1977 1678 --74910 4882 4687 4131 1613 1001 755 11561
NM_001039693chr234110 2776 944 13779 22794 1205 170
NM_001039709chr2055349 3804 3792 1531 253 --31359 1352 724 15275
NM_001039711chr13834 387 74 ------
NM_001039712chr13834 387 74 ------
NM_001039715chr11982 ------
NM_001039716chr111046 ------
NM_001039775chr1----268 39 --
NM_001039802chr141153 464 267 99 --4417 412 299 245 --
NM_001039840chrX155799 5556 5055 4962 3698 2433 2408 1837 1452 508 495 197 173 137 87 --33893 2090 875 14826
NM_001039888chr11323 ------
NM_001039916chr1231062 1007 936 1294 1998 --
NM_001039917chr1231062 1007 936 1294 1998 --
NM_001039918chr1231062 1007 936 1294 1998 --
NM_001039919chr1231062 1007 936 1294 1998 --
NM_001039920chr1231062 1007 936 1294 1998 --
NM_001039935chr51378 --1339 1315
NM_001039937chr1383258 3105 2678 1578 1093 1085 421 186 1652 1719 1500
NM_001040001chr611598 11987 1260 --
NM_001040031chr19177 ------
NM_001040033chr1------1683
NM_001040057chr741398 1279 1186 939 1507 1951 1977
NM_001040058chr42465 401 --2385 361 --
NM_001040060chr42465 401 --2385 361 --
NM_001040092chr83358 339 61 ------
NM_001040110chr721578 1215 11685 1500 1114
NM_001040135chr72754 600 1613 1713 --
NM_001040142chr262243 1935 1800 1589 467 27 --12218 --
NM_001040143chr262243 1935 1800 1589 467 27 --12218 --
NM_001040151chr1164122 4009 3037 1305 1167 499 1522 41010 1001 994 985 --
NM_001040152chr744528 3456 1513 706 15105 13820 --
NM_001040153chr133618 248 105 2956 779 ----
NM_001040157chr452879 853 571 296 139 --11031 12018
NM_001040158chr51479 --1114 --
NM_001040159chr441298 1114 182 118 ----1940
NM_001040167chr71945 --21191 854 --
NM_001040202chr442380 1862 1724 202 --12281 12527
NM_001040214chr612320 12328 --12264
NM_001040260chr441141 1081 1033 283 ------
NM_001040261chr441141 1081 1033 283 ------
NM_001040272chr942375 2269 1765 1444 --1442 --
NM_001040284chr1695560 5284 5239 1261 928 823 792 685 475 25366 551 43623 2144 2134 1933 --
NM_001040402chr471260 1185 1024 796 346 275 46 1138 31011 890 770 --
NM_001040429chr1322444 698 13613 23469 1188 --
NM_001040441chr134328 3686 175 --32141 2135 1557 24919 4839
NM_001040450chr1542554 2314 2120 284 22296 1880 1114 --
NM_001040453chr1542554 2314 2120 284 22296 1880 1114 --
NM_001040458chr531816 1620 1369 --31734 193 51 --
NM_001040633chr731013 898 62 1873 21084 1024 --
NM_001040653chr352505 875 729 638 296 ------
NM_001040665chr764830 4275 4211 3757 3270 1204 11673 44071 1630 237 232 --
NM_001040666chr71532 ------
NM_001040708chr82327 147 1454 1228 --
NM_001040709chr121934 1835 --11702 --
NM_001040712chr953573 3388 2856 2203 722 23593 1196 53231 3198 1187 843 838 --
NM_001040876chr461906 1480 735 486 212 61 --1680 --
NM_001041chr31136 ------
NM_001042353chr201398 --1190 --
NM_001042355chr16113988 3854 3846 3294 1997 1450 1175 614 403 193 161 24176 496 23354 1067 25340 1360
NM_001042383chr352751 2632 1048 433 182 22943 230 ----
NM_001042403chr121690 ------
NM_001042404chr181916 1411 727 697 642 581 439 241 1423 --21976 1950
NM_001042406chr62988 921 --1255 --
NM_001042412chr16113988 3854 3846 3294 1997 1450 1175 614 403 193 161 24176 496 23354 1067 25340 1360
NM_001042413chr9113868 3713 3670 3422 3353 3090 2645 1117 776 730 617 --33889 3884 59 13310
NM_001042424chr443263 2485 2183 538 12946 --1869
NM_001042425chr611341 --11423 --
NM_001042453chrX61607 1574 1264 377 190 149 --1255 --
NM_001042459chr3139 1340 ----
NM_001042473chr1052109 1761 1626 1383 159 --2782 113 --
NM_001042475chr61122 --1127 --
NM_001042481chr1492691 2632 2384 2235 826 746 663 375 303 143 22215 1852 --
NM_001042492chr1753215 3138 2633 829 815 --73131 2921 2915 2908 2895 2135 823 21042 799
NM_001042493chr632006 1382 154 11498 31583 1577 769 2384 267
NM_001042506chrX2503 327 --11126 --
NM_001042510chr841725 1507 1392 1371 --11759 --
NM_001042511chr841725 1507 1392 1371 --11759 --
NM_001042517chr132680 228 ------
NM_001042537chrX2438 367 11639 22321 452 --
NM_001042550chr941783 1682 796 76 1776 31660 1419 688 --
NM_001042552chr12943 540 ------
NM_001042555chr12124617 4406 4306 4195 4155 3580 3235 3151 2956 1105 975 603 --21852 883 --
NM_001042599chr2157284 5954 5915 5894 5481 5243 5209 4886 2976 2119 1993 1324 1107 687 339 11308 46145 2966 663 658 17829
NM_001042603chr12134280 4127 4116 3514 3456 3398 3340 2145 1796 1666 1507 965 345 24538 2030 31408 1402 1313 --
NM_001042604chr3154750 4664 4420 4388 4001 3741 3711 1646 1198 863 846 617 581 536 207 --34509 3561 601 --
NM_001042632chr2032549 2210 499 ------
NM_001042633chr2032549 2210 499 ------
NM_001042635chr142164 31 --1141 --
NM_001042669chr4----31180 643 432 --
NM_001042681chr182633 2406 2333 2242 1936 1903 1830 883 12513 ----
NM_001042682chr182633 2406 2333 2242 1936 1903 1830 883 12513 ----
NM_001042682chr182633 2406 2333 2242 1936 1903 1830 883 12513 ----
NM_001042683chr661776 1715 576 529 241 125 ------
NM_001042728chr1221085 135 --1858 --
NM_001042749chrX51766 1289 779 717 522 --1161 --
NM_001042750chrX51766 1289 779 717 522 --1161 --
NM_001042751chrX51766 1289 779 717 522 --1161 --
NM_001043318chr1494043 3930 3921 3798 3738 2776 2560 1101 804 --24005 3185 13724
NM_001043351chr162249 2025 818 697 310 287 --1303 --
NM_001044305chr641514 1141 214 111 ------
NM_001044385chr254003 3061 2844 1231 163 --53687 2754 1168 553 52 --
NM_001044387chr1974159 2545 1602 807 779 159 120 ------
NM_001044388chr1974159 2545 1602 807 779 159 120 ------
NM_001044722chr582243 2126 2099 1826 1733 492 214 143 --1678 --
NM_001044723chr582243 2126 2099 1826 1733 492 214 143 --1678 --
NM_001046chr512167 22779 259 12027 21154 505
NM_001049chr1452206 2195 2074 419 209 --12269 --
NM_001066chr112197 --1345 --
NM_001068chr3275 53 ------
NM_001071775chr1341680 1308 646 612 --21417 1187 --
NM_001077628chr11596 ------
NM_001078chr14732 712 646 489 ------
NM_001079874chr142135 1990 1948 1754 21780 1602 1369 --
NM_001081472chr11116 --2402 45 --
NM_001083620chr421676 600 --22418 881 --
NM_001092chr1742456 396 336 156 ------
NM_001094chr172800 744 --2754 749 --
NM_001100108chr1108187 7321 7189 6991 6591 5181 2604 1854 1396 1290 13332 55080 2401 2394 818 470 --
NM_001105518chr1------1806
NM_001106chr3199782 9582 9252 8722 8096 7922 7212 6604 6034 3773 3103 3077 2681 2647 2377 2244 2094 1550 346 --79653 3246 2269 1623 1009 531 70 11502
NM_001113490chrX43417 986 431 313 12510 43061 2609 2305 1041 --
NM_001115chr8130 ------
NM_001117chr1852526 2410 2313 2163 397 1467 ----
NM_001119chr411412 --11319 --
NM_001121chr1041205 735 678 583 ----11802
NM_001122679chr541256 1204 1061 859 ----1974
NM_001123chr101321 1763 ----
NM_001124chr113511 485 465 ------
NM_001128chr16--1630 33673 3667 701 --
NM_001135chr15198 ------
NM_001144chr1641417 1393 1174 923 --11398 --
NM_001146chr852283 1998 1990 1861 623 --12115 --
NM_001148chr431450 445 399 11600 22058 309 --
NM_001149chr1031317 939 459 --1487 --
NM_001151chr41183 ------
NM_001153chr21824 --1855 --
NM_001160chr1272833 2792 2684 740 608 481 465 --52629 2114 1902 583 435 --
NM_001165chr111126 --1202 --
NM_001167chrX86535 5773 5648 4996 1454 1140 886 417 21251 105 31751 914 850 --
NM_001173chr14164639 4596 4491 4378 4129 3699 3588 3094 3079 2882 1447 1322 1152 982 928 738 --13071 21238 400
NM_001191chr201407 ----11239
NM_001198chr662182 2166 1822 1652 887 460 12351 31960 731 26 --
NM_001200chr2031006 788 306 ------
NM_001201chr4133921 3193 3071 1499 1430 1193 854 665 610 311 245 186 87 12695 1106 --
NM_001204chr2157583 7109 6417 5831 5801 5718 5645 5550 1978 1465 1354 824 646 207 37 14710 87489 7431 7418 7188 6661 502 216 194 --
NM_001206chr983128 3081 3039 2286 1180 983 524 320 --43068 2646 295 289 --
NM_001207chr5----187 --
NM_001211chr151339 ------
NM_001219chr751506 670 600 394 264 --12125 --
NM_001220chr7--1151 ----
NM_001222chr1031934 1897 98 11967 11716 --
NM_001233chr752349 2307 917 627 384 151 1264 --
NM_001235chr111640 --3707 583 578 --
NM_001237chr44850 433 171 21 11189 21094 302 1218
NM_001237chr44850 433 171 21 11189 21094 302 1218
NM_001238chr192481 84 ------
NM_001241chr292147 1904 1855 1778 946 831 593 485 109 --1447 11632
NM_001241chr292147 1904 1855 1778 946 831 593 485 109 --1447 11632
NM_001256chr17132882 2496 2416 2380 2273 2213 2181 2040 1962 986 952 385 279 --32896 2207 2197 --
NM_001257chr1641486 1443 1057 999 --1546 --
NM_001259chr786195 5586 1207 951 546 484 232 212 26165 642 52337 1363 971 965 932 22240 1333
NM_001262chr13338 309 278 180 ----
NM_001270chr521023 446 --1228 --
NM_001271chr15----12299 --
NM_001273chr121368 ------
NM_001278chr104902 771 390 244 --1970 --
NM_001282chr173584 419 322 --12492 --
NM_001286chr132768 2523 2413 1356 12070 --
NM_001300chr101400 ------
NM_001304chr1763217 2813 2712 1346 357 316 --23126 2641 --
NM_001305chr72784 37 ------
NM_001310chr1272724 2391 1951 1916 1881 691 305 1727 ----
NM_001315chr652046 1697 1581 1509 371 --21664 1497 --
NM_001316chr201384 --1337 --
NM_001326chr114455 420 392 47 184 ----
NM_001329chr1031550 1123 1027 11187 11093 1444
NM_001330chr164983 320 139 133 ------
NM_001331chr1132723 319 289 12205 21968 1788 --
NM_001332chr561530 1143 1135 1100 1077 399 199 21388 72 1482
NM_001338chr2121237 898 --2769 155 --
NM_001351chr331716 1709 1184 --1351 11131
NM_001356chrX72499 2246 2157 1827 1546 619 278 1301 22171 1776 --
NM_001364chr11114460 3253 2899 1586 1243 1137 777 765 663 226 107 13956 73166 1362 1219 1083 862 350 91 --
NM_001380chr103797 737 307 ------
NM_001386chr842349 1907 1797 1733 11851 51966 1833 709 196 93 --
NM_001387chr552365 1194 701 212 184 --1630 --
NM_001389chr211584 --1483 --
NM_001390chr1863535 3512 3092 2648 1236 1122 --1229 --
NM_001391chr1831190 1183 104 --149 --
NM_001395chrX1951 --1700 --
NM_001396chr2182443 2145 1070 976 904 413 283 23 --62116 1125 454 444 439 236 --
NM_001400chr151336 1324 1032 866 262 --2992 932 --
NM_001401chr951542 1369 653 315 144 --1538 --
NM_001402chr651768 1714 183 158 69 11731 ----
NM_001407chr361214 1186 1153 1076 488 225 ----21112 1070
NM_001408chr141316 1167 1161 1148 --11649 --
NM_001412chrX113539 3403 2944 2890 2516 2370 1094 796 554 203 126 1109 51156 1149 1143 1136 1130 --
NM_001415chrX41814 1414 627 457 --41562 313 308 294 --
NM_001416chr172458 342 ------
NM_001417chr1231401 702 155 --21955 1282 --
NM_001418chr113624 298 160 ------
NM_001418chr113624 298 160 ------
NM_001419chr19114602 4569 4253 4237 4186 4155 3364 1173 1148 85 21 --81222 1217 1206 1201 1158 1141 987 974 --
NM_001427chr762087 1953 1460 453 254 210 --11944 --
NM_001429chr222893 59 ----1208
NM_001430chr23560 237 73 --2543 443 --
NM_001431chr611246 --41214 285 256 215 1961
NM_001432chr473788 3636 2830 2658 1242 891 765 1171 33405 3180 147 13349
NM_001438chr153499 3198 1056 954 281 1864 23093 1029 --
NM_001439chr141549 1507 1483 598 ----1588
NM_001440chr832787 496 461 ------
NM_001443chr2161 ------
NM_001448chrX41278 295 153 82 --11120 --
NM_001449chrX1523 --1803 --
NM_001451chr1651279 1272 1178 1036 521 ------
NM_001452chr61639 --1705 --
NM_001453chr631649 1528 688 --1668 --
NM_001457chr321482 1162 --21273 47 --
NM_001463chr25809 728 645 306 263 --1800 --
NM_001482chr153972 837 143 ------
NM_001483chr74940 896 764 434 ------
NM_001490chr962915 2561 1393 599 501 464 --21259 611 --
NM_001491chr632705 76 63 --12729 --
NM_001493chrX1569 --1577 --
NM_001494chr102654 91 ------
NM_001495chr83795 783 171 ------
NM_001497chr952764 2277 774 584 169 ------
NM_001498chr681327 1265 1097 1025 882 545 459 303 --1368 --
NM_001530chr142934 346 --11104 11144
NM_001533chr19----168 175
NM_001539chr9----1101 --
NM_001542chr162812 2391 2138 2092 1863 472 --1645 --
NM_001543chr574624 4465 3752 3745 3674 3248 868 --1949 --
NM_001546chr631024 980 228 --2986 385 --
NM_001556chr81947 --11170 --
NM_001557chr21220 ----21313 1207
NM_001558chr1121639 324 --11554 --
NM_001560chrX22673 2067 165 12286 --
NM_001570chr361324 980 511 489 432 299 1228 ----
NM_001584chr1141039 769 464 109 11150 1431 --
NM_001587chrX3411 291 228 12163 ----
NM_001604chr112857 658 ------
NM_001609chr1053626 3529 1322 852 435 2909 707 24401 3033 --
NM_001614chr173597 220 29 ------
NM_001614chr173597 220 29 ------
NM_001616chr252575 2383 667 442 138 13313 13083 --
NM_001619chr11390 59 40 ------
NM_001621chr722424 1911 --23011 155 12527
NM_001621chr722424 1911 --23011 155 12527
NM_001629chr131268 1213 1230 --
NM_001634chr631809 1782 593 1603 71861 1856 1851 1846 1841 1835 1546 --
NM_001635chr72677 228 ----179
NM_001650chr1863565 2894 1342 1097 890 109 184 21017 930 23552 1287
NM_001655chr1142126 1415 711 522 --12018 --
NM_001656chr54628 172 157 31 1260 11359 11671
NM_001658chr121121 998 --1187 --
NM_001660chr3----3735 704 133 1686
NM_001663chr1452260 1050 857 444 405 --31691 214 170 --
NM_001664chr33734 423 313 ------
NM_001668chr141923 1511 738 50 --41817 1783 1777 482 --
NM_001675chr22174 ------
NM_001677chr12799 420 ------
NM_001678chr1731171 644 419 ------
NM_001679chr32584 54 ------
NM_001681chr123717 259 21 ------
NM_001682chr1262724 2605 2537 2007 678 602 --41130 978 846 477 1916
NM_001683chr341723 1704 947 802 --1392 --
NM_001684chr1124147 4030 3846 3631 3592 3054 3007 1358 1254 1032 572 351 21531 721 14169 --
NM_001690chr382176 2030 1992 788 467 184 137 90 --22184 1877 --
NM_001693chr83465 454 65 11116 ----
NM_001695chr853511 2664 1001 836 99 23797 318 92879 2874 2869 2864 2859 1506 1361 1125 378 1628
NM_001701chr941579 1105 1002 106 ----11041
NM_001703chr11280 ------
NM_001704chr63610 436 417 ------
NM_001706chr34699 666 372 351 --1787 --
NM_001707chr72666 227 --1845 --
NM_001709chr1162258 2172 887 841 580 247 --62583 2578 1837 892 589 554 12538
NM_001714chr124512 424 191 42 1437 ----
NM_001718chr621105 170 1345 11149 --
NM_001722chr81246 --164 --
NM_001730chr1361526 1434 1313 1040 552 132 1539 31504 1374 1281 --
NM_001730chr1361526 1434 1313 1040 552 132 1539 31504 1374 1281 --
NM_001731chr121796 3807 677 241 154 --
NM_001735chr93398 346 291 --169 --
NM_001742chr721384 635 11437 11603 --
NM_001743chr24583 518 458 62 ------
NM_001745chr511151 --11076 --
NM_001746chr552870 2824 2635 2001 286 1656 1520 --
NM_001753chr721561 1503 1635 11305 --
NM_001754chr2183697 3655 3583 3412 3403 3390 3315 1207 13617 83747 3424 3368 3258 865 695 690 685 --
NM_001755chr1652285 2258 527 446 208 11648 2509 504 --
NM_001759chr1294293 3514 3317 1881 1692 1481 1050 651 548 11517 85005 3401 3357 2042 1667 1662 1334 72 --
NM_001762chr7174 --1239 --
NM_001769chr124341 103 96 89 1301 378 73 60 --
NM_001774chr19177 ------
NM_001777chr353787 3743 2725 2580 1357 13361 43996 3605 2842 243 --
NM_001788chr72660 66 --2971 147 --
NM_001790chr51373 ------
NM_001791chr141153 464 267 99 --4417 412 299 245 --
NM_001792chr184798 399 337 250 ----1386
NM_001796chr16189 ------
NM_001798chr1221024 1000 ------
NM_001802chr161121 --1627 --
NM_001806chr1942773 2351 525 211 --32896 2812 2361 --
NM_001822chr22147 68 1579 ----
NM_001826chr11155 --1342 --
NM_001827chr9----1253 --
NM_001829chr42140 49 --1865 --
NM_001830chrX73741 3592 3046 1578 836 815 494 23875 240 1449 --
NM_001833chr91111 ------
NM_001839chr12656 37 1504 ----
NM_001845chr1321323 400 ----156
NM_001854chr141292 1189 388 64 ------
NM_001858chr6124211 4195 3611 3543 3521 3423 2060 1933 1571 1465 751 343 12070 35000 4026 217 33549 3536 664
NM_001859chr924012 2972 --1323 --
NM_001874chr1264983 4735 2090 1970 817 329 24664 3177 14319 --
NM_001880chr21301 --1206 --
NM_001884chr52164 158 ------
NM_001892chr531553 1057 53 1970 1344 1332
NM_001893chr171375 ----1387
NM_001894chr2231195 142 29 --21045 1023 --
NM_001901chr621018 978 --1686 --
NM_001902chr12402 351 ------
NM_001903chr51217 2772 78 ----
NM_001904chr35832 671 278 248 236 ------
NM_001920chr122604 182 ------
NM_001921chr431227 1213 512 ------
NM_001933chr1431245 516 387 --2979 311 --
NM_001935chr21134 --149 --
NM_001936chr7--11665 2660 153 --
NM_001938chr131498 640 88 --21575 630 --
NM_001939chrX42814 2485 821 727 11484 ----
NM_001945chr52925 289 --1572 --
NM_001946chr124411 360 231 176 --1830 --
NM_001949chr673246 3166 3026 2805 2704 893 228 13180 52829 2790 2784 2377 2227 --
NM_001951chr82590 489 --1533 --
NM_001955chr611075 1863 ----
NM_001957chr472100 1977 1897 869 792 438 306 --22067 1702 --
NM_001962chr5----2426 123 --
NM_001964chr541119 1088 1058 779 ------
NM_001967chr3----1457 --
NM_001968chr43824 680 649 1698 2872 674 --
NM_001969chr1482688 2588 2446 1485 978 888 759 209 13161 --23616 2697
NM_001970chr17--1608 ----
NM_001977chr43587 167 29 ------
NM_001981chr172310 1784 916 908 545 518 265 1719 21724 1492 11943
NM_001982chr1231079 363 236 ------
NM_001987chr1243688 2962 2711 431 --54172 3403 331 325 319 --
NM_001992chr542262 900 504 162 --11383 --
NM_001998chr3----2406 116 --
NM_001999chr511185 --11483 1360
NM_002006chr4104870 4037 1570 1516 1443 1386 1188 1168 544 266 22255 63 45602 5521 3555 1554 --
NM_002009chr1532338 2287 163 11872 22718 2555 1949
NM_002010chr13----1168 --
NM_002014chr12171 --1274 --
NM_002015chr1373345 2242 1337 903 859 422 332 23244 836 2685 466 1695
NM_002017chr1121311 129 --1167 --
NM_002024chrX41753 1729 1400 1391 2291 72 3756 751 745 --
NM_002025chrX149149 8093 7903 6821 6714 6270 6252 5764 3368 2991 1161 467 258 114 --69195 9138 6968 3307 1790 986 35755 662 132
NM_002027chr81477 ------
NM_002028chr1421263 28 --11283 --
NM_002033chr1162915 2691 808 501 221 194 --21133 120 --
NM_002035chr1893969 2898 2762 2489 1122 957 397 333 314 13953 21612 935 13604
NM_002039chr42359 243 1619 --1629
NM_002040chr21113127 3038 3017 2808 2704 2553 2415 2323 1276 910 829 21013 840 12541 --
NM_002044chr15194 11504 11202 --
NM_002049chrX1121 ------
NM_002051chr102804 68 --2915 441 --
NM_002061chr121654 302 --11569 --
NM_002063chrX11283 --21198 846 --
NM_002065chr161789 1399 1254 1183 702 154 11272 --1722
NM_002068chr191667 ------
NM_002069chr71580 --1143 --
NM_002071chr181687 ------
NM_002072chr921017 798 --1915 --
NM_002074chr151671 421 388 260 249 ------
NM_002076chr1253153 2768 1034 627 257 ------
NM_002077chr91109 ------
NM_002080chr161842 ------
NM_002084chr5149 ------
NM_002086chr1742166 1985 555 485 ------
NM_002092chr4164964 4860 4319 4162 4144 4023 3915 3093 2032 1645 1616 887 633 389 292 270 1772 74841 4156 4150 1886 1880 527 230 --
NM_002106chr43321 112 104 ------
NM_002114chr63170 149 22 ------
NM_002126chr17113893 3263 3164 1452 1257 1123 1108 707 352 216 46 --1980 --
NM_002128chr1392522 2443 2386 2282 1688 874 598 140 113 --3958 524 420 11844
NM_002129chr42360 123 ----161
NM_002130chr561550 1300 1197 388 185 176 11458 ----
NM_002131chr62826 64 --1990 --
NM_002133chr222578 419 --2477 431 --
NM_002137chr742228 2169 1493 179 ------
NM_002138chr43558 194 117 --1637 --
NM_002140chr941161 988 456 176 --1752 --
NM_002145chr17------1105
NM_002146chr1731384 1100 529 --1946 --
NM_002148chr21116 --2138 128 --
NM_002154chr5160 ------
NM_002155chr11246 1257 --1279
NM_002156chr21453 ------
NM_002158chr2103748 3712 3244 3172 2754 1490 785 629 492 223 13594 43841 2633 510 410 12960
NM_002160chr9--1631 1228 1392
NM_002163chr1641261 1166 1123 408 1423 ----
NM_002165chr20------1393
NM_002167chr12486 411 ------
NM_002180chr11----1821 --
NM_002182chr332739 2360 2198 --3968 677 671 --
NM_002193chr211426 --11698 --
NM_002196chr201716 ------
NM_002196chr201716 ------
NM_002199chr43944 57 45 --150 --
NM_002202chr521021 720 --2948 861 --
NM_002210chr263163 3045 2766 749 422 352 23515 3427 1596 13270
NM_002211chr102872 774 --1822 --
NM_002214chr795218 4542 2055 1991 1356 1331 865 615 606 --35337 4194 666 --
NM_002222chr331136 527 313 ------
NM_002223chr1251422 1131 941 609 348 32548 2533 1411 12747 --
NM_002226chr143901 226 101 1308 ----
NM_002229chr191452 ------
NM_002239chr231070 901 250 ------
NM_002240chr213558 103 92 ------
NM_002242chr222013 707 1200 11566 --
NM_002245chr11476 --1624 --
NM_002247chr1042358 1955 1772 646 --1413 --
NM_002249chr11457 ------
NM_002254chr231918 1559 788 ------
NM_002264chr374655 4641 3577 3438 3240 776 128 11899 21501 759 14452
NM_002265chr171407 1432 4783 776 757 752 --
NM_002266chr17250 27 196 ----
NM_002267chr1362444 2425 1656 983 694 113 ------
NM_002268chr341799 1781 1764 1240 11659 ----
NM_002270chr595635 4304 4287 3957 3855 3601 1587 770 514 --74932 4142 3810 2147 2142 2137 1418 23514 2113
NM_002271chr1352274 2163 1775 914 72 --177 --
NM_002285chr252901 1352 1333 583 142 --23020 2698 11658
NM_002291chr72147 117 ------
NM_002293chr132404 1878 1045 --1846 12398
NM_002296chr181728 1716 1468 1284 657 629 443 357 --21558 88 --
NM_002298chr134503 377 292 232 --11507 --
NM_002310chr585622 5404 5354 2151 1712 1475 831 707 --36051 1454 570 14408
NM_002312chr13192 ----11050
NM_002314chr721020 991 ------
NM_002333chr1911252 --2420 314 --
NM_002335chr111196 ------
NM_002336chr1295078 4970 4323 1978 1545 900 541 260 204 --34527 1141 1028 23375 772
NM_002345chr121122 ------
NM_002350chr83921 837 501 ------
NM_002351chrX2328 166 ------
NM_002355chr1261419 1359 329 256 172 128 ----11353
NM_002356chr6112805 2702 2656 2512 1138 1084 1058 880 540 310 50 --22058 158 --
NM_002359chr1774308 3508 1631 1183 1093 253 199 1893 11287 --
NM_002360chr742636 2500 2347 2164 ------
NM_002374chr253691 3670 1066 493 259 11250 1245 --
NM_002375chr342250 1891 1433 770 ------
NM_002376chr143497 490 483 ------
NM_002380chr82387 258 ------
NM_002381chr231034 934 67 --1711 --
NM_002382chr1431197 1144 979 ------
NM_002387chr5114841 4632 4623 4411 4382 1833 1107 995 667 486 345 --24353 1725 24745 4300
NM_002389chr151874 1824 754 703 27 21933 1835 1475 --
NM_002395chr64985 605 521 457 11187 31219 360 183 2434 373
NM_002397chr53839 748 134 1884 1695 --
NM_002398chr231549 1275 1227 --11350 --
NM_002399chr151447 ----11265
NM_002401chr1752078 1637 876 700 37 --1404 --
NM_002408chr142730 705 --2745 660 --
NM_002409chr2243119 2373 2307 1090 ------
NM_002428chr162186 150 --2160 155 --
NM_002430chr22----4641 471 361 279 --
NM_002442chr1211648 11431 ----
NM_002444chrX51946 1929 1640 1548 300 --1565 --
NM_002448chr42539 136 1767 ----
NM_002449chr531282 404 163 ------
NM_002451chr953787 3292 3222 2500 660 --43249 1311 1242 746 --
NM_002460chr683409 3299 3046 2682 1389 1107 900 496 13845 13686 --
NM_002469chr122394 315 ------
NM_002473chr2231115 1044 460 ------
NM_002478chr112455 444 ------
NM_002480chr122372 194 1952 4201 180 157 147 --
NM_002481chr157653 5989 5279 1823 44 16357 37876 6448 5085 --
NM_002482chr13282 79 40 --1195 1663
NM_002486chr912540 21988 258 1877 --
NM_002489chr71322 ------
NM_002493chr92266 43 ------
NM_002499chr1532011 761 265 ------
NM_002500chr21452 --21245 442 --
NM_002501chr1922907 2634 --33995 2564 1316 --
NM_002509chr201651 --3669 663 658 --
NM_002514chr821162 883 --1334 --
NM_002515chr142727 221 --21646 207 --
NM_002516chr19----1314 --
NM_002518chr251222 1144 1002 994 104 --1487 11013
NM_002519chr1111317 --11286 --
NM_002520chr51200 124 ----
NM_002522chr17113655 3595 3140 3120 2817 2650 1325 607 498 147 66 23775 443 11336 --
NM_002524chr13953 801 22 ------
NM_002526chr611435 ------
NM_002531chr2031801 911 320 ------
NM_002536chrX21613 1531 --2286 211 --
NM_002540chr91696 --1621 --
NM_002545chr11115116 4120 3583 2069 1805 1592 1312 797 684 146 121 --54568 4110 138 132 97 --
NM_002547chrX63140 2582 1525 704 484 95 24223 1444 24052 3445 --
NM_002556chr1122120 1549 --41657 1651 1555 816 11639
NM_002563chr33834 261 180 ------
NM_002567chr122749 595 ------
NM_002568chr81321 ------
NM_002574chr11253 ------
NM_002577chr3114037 3933 2825 2656 1428 961 844 787 459 309 300 1693 54050 1609 1558 1352 1347 --
NM_002578chrX1346 ------
NM_002581chr995641 5564 5343 4240 4129 3819 3477 1123 836 --25527 3811 --
NM_002582chr164952 907 728 160 ------
NM_002583chr125635 467 452 253 141 ------
NM_002586chr621320 1023 ------
NM_002588chr511619 --1677 1632
NM_002591chr201251 1535 ----
NM_002592chr201222 ------
NM_002594chr2022285 1582 --1327 --
NM_002595chr1281920 1833 1374 1236 491 272 193 170 --21651 443 --
NM_002600chr141445 1307 585 410 --21185 714 --
NM_002607chr761261 1219 1212 420 188 125 1910 11294 --
NM_002610chr262917 2596 2229 2102 1178 40 2964 346 ----
NM_002613chr1665096 5067 4366 3397 1085 223 ------
NM_002618chr2--1101 1124 --
NM_002623chr203295 202 28 ------
NM_002627chr10151 ------
NM_002628chr341068 858 486 391 11155 ----
NM_002629chr103301 289 162 ------
NM_002636chr6------1452
NM_002641chrX31800 761 636 12002 41654 1468 1408 88 --
NM_002645chr1152325 2160 1956 324 100 ------
NM_002648chr621332 827 --1854 --
NM_002655chr8135275 5221 5094 4955 4678 4159 3368 3359 1741 729 336 208 108 23821 524 ----
NM_002657chr2033695 2570 866 13857 23321 3134 --
NM_002660chr20--11155 1849 --
NM_002662chr322073 1556 11664 22145 712 --
NM_002668chrX1143 ------
NM_002687chr1471264 1201 999 361 177 167 142 --1894 --
NM_002693chr153327 89 26 ------
NM_002697chr11217 ------
NM_002699chr121275 1215 11393 179 11416
NM_002706chr22509 25 ----186
NM_002707chr2167 ------
NM_002709chr283073 2974 2605 2425 2337 2303 1083 961 137 3685 400 394 --
NM_002710chr122229 153 --1206 --
NM_002713chr121080 826 11149 ----
NM_002714chr641108 1099 1037 965 ------
NM_002715chr5----21013 273 --
NM_002716chr1172650 2336 1475 986 776 602 593 13153 13144 --
NM_002718chr342687 2636 628 136 ------
NM_002719chr1452422 2381 1995 1924 509 --1476 --
NM_002720chr161255 ------
NM_002721chr94501 363 162 98 --1381 --
NM_002729chr102605 565 ----2318 55
NM_002731chr143084 2025 1060 483 --21065 326 --
NM_002732chr9--1485 141 --
NM_002734chr1732203 1813 225 ----22261 549
NM_002736chr761600 1379 849 744 597 573 --41954 1771 807 474 --
NM_002737chr1786463 5930 4847 4312 1908 1250 1225 956 26650 5393 56197 4302 4281 4275 901 26387 1200
NM_002738chr1621094 791 21004 987 1804 --
NM_002740chr362751 2671 2645 2516 944 368 --22426 279 --
NM_002745chr2244031 3275 3111 1254 --13314 --
NM_002747chr1821795 641 --11746 1536
NM_002748chr1531176 777 49 --11071 --
NM_002752chr51547 --1226 --
NM_002753chr4--1754 ----
NM_002756chr171875 --1670 --
NM_002763chr11215 --2483 169 --
NM_002765chrX31237 287 245 --155 --
NM_002767chr171432 ------
NM_002787chr72580 87 --172 1648
NM_002788chr141102 ------
NM_002796chr1183 ------
NM_002800chr6131 ------
NM_002806chr144327 317 256 241 ------
NM_002808chr3------1118
NM_002813chr1231468 1118 1040 --11281 --
NM_002814chrX3664 592 491 ------
NM_002815chr17----192 --
NM_002816chr171291 ------
NM_002819chr1911058 ----11275
NM_002822chr121226 11697 11321 --
NM_002823chr23586 495 264 --1674 --
NM_002824chr121472 ------
NM_002825chr72604 147 ------
NM_002826chr11786 ----1991
NM_002828chr182327 253 1235 ----
NM_002830chr21269 ------
NM_002833chr1521614 1533 --11149 1278
NM_002835chr71554 --1131 --
NM_002836chr20148 ----165
NM_002837chr1293596 3423 3212 2938 1478 1420 444 189 51 --14298 1749
NM_002838chr14789 352 169 58 1884 1341 --
NM_002839chr953573 3388 2856 2203 722 23593 1196 53231 3198 1187 843 838 --
NM_002840chr11483 11595 3662 445 440 --
NM_002843chr1152904 637 574 118 109 13365 11376 --
NM_002845chr181691 --1105 --
NM_002848chr1251142 1023 364 343 308 --11071 11077
NM_002849chr1211075 --1271 1831
NM_002850chr19----1804 --
NM_002851chr73697 673 173 ------
NM_002852chr31573 ------
NM_002855chr1133513 2596 375 1598 12554 --
NM_002858chr131244 1222 1208 --11237 --
NM_002865chr8------1246
NM_002868chr12----52381 2376 2370 2305 543 --
NM_002869chr1121957 894 --12224 --
NM_002874chr952316 2234 807 455 244 --22244 718 --
NM_002882chr22182 ------
NM_002886chr365201 3892 3357 3190 1957 1249 13879 63751 1274 1264 940 934 776 13623
NM_002890chr53984 838 78 1697 2654 349 1825
NM_002892chr1451343 1303 473 257 33 11198 1246 --
NM_002897chr21107 ----1161
NM_002902chr152566 64 148 1439 --
NM_002906chr1142342 1563 887 735 --32119 1753 826 12036
NM_002912chr63745 737 252 --1930 1681
NM_002922chr11601 ------
NM_002924chr11131 ------
NM_002938chr421767 364 21950 1385 21857 135 1156
NM_002940chr461906 1480 735 486 212 61 --1680 --
NM_002941chr381642 1606 1321 1207 1025 521 326 319 ----11073
NM_002942chr33878 434 292 ------
NM_002945chr172866 359 --2852 802 --
NM_002946chr11580 --2176 171 --
NM_002955chr62403 353 ------
NM_002956chr122875 448 --1222 --
NM_002957chr963500 3249 3202 2522 1434 645 --1369 --
NM_002958chr331012 944 225 --1913 --
NM_002959chr163554 1776 1721 1511 1491 1149 44463 3480 1477 1368 31764 289 283 --
NM_002967chr192156 129 ------
NM_002968chr1651114 964 956 754 146 ------
NM_002971chr3190 1453 1300 11122
NM_002973chr12----197 --
NM_002977chr262788 2351 1357 1302 913 178 22231 844 1736 --
NM_002979chr12688 121 1750 2327 322 --
NM_002982chr172370 340 --194 --
NM_002993chr41701 ----1995
NM_002994chr461960 1713 1501 243 119 111 --21634 101 11874
NM_002996chr1631980 1753 1309 11869 ----
NM_002997chr241435 538 514 475 --21443 1189 --
NM_002998chr852161 1403 454 83 60 2805 380 31743 860 90 --
NM_003003chr171217 ------
NM_003010chr1732435 357 234 --11532 --
NM_003016chr1711591 --31970 1298 733 11276
NM_003017chr631413 571 254 --179 --
NM_003020chr15------1177
NM_003022chrX41260 1226 891 77 ----1869
NM_003026chr921133 1034 --1408 --
NM_003027chr152116 91 --1359 --
NM_003030chr331816 1632 256 --51736 1730 1724 1607 1588 --
NM_003031chr168973 920 900 677 326 294 287 247 --1854 --
NM_003034chr12138021 7868 7272 6859 6681 6524 5279 5041 3169 833 640 565 475 11999 26384 6366 143
NM_003036chr1----1943 1293
NM_003042chr332013 1772 454 ------
NM_003043chr364278 4212 4175 3802 212 112 --24234 191 --
NM_003048chr272766 2700 2553 2201 1126 237 207 --22601 2133 --
NM_003051chr131714 1285 707 --4338 237 232 150 --
NM_003060chr551276 1207 1180 855 102 --1839 --
NM_003068chr81236 11118 ----
NM_003070chr92768 701 --2647 623 --
NM_003071chr322044 1836 1248 ----
NM_003073chr22----1261 --
NM_003074chr342184 2155 578 174 --51750 1744 796 354 336 --
NM_003076chr1221593 1151 --1651 --
NM_003081chr2041186 1008 878 284 1990 1173 --
NM_003091chr20183 ------
NM_003092chr202117 51 ------
NM_003100chr51427 ------
NM_003101chr141613 1034 551 211 --1312 1493
NM_003106chr31269 --2843 820 --
NM_003107chr652461 2100 1744 349 339 --32444 485 475 --
NM_003108chr2207302 7272 7137 6855 6612 6605 6559 5572 5278 4873 4844 1539 1469 1426 1205 1183 977 842 351 265 --26482 5556 1613
NM_003110chr1711065 11043 ----
NM_003111chr231032 404 201 11311 11080 --
NM_003112chr793262 3232 3207 2199 2133 2121 2081 1989 915 1372 22380 2207 --
NM_003113chr23348 137 110 --1741 --
NM_003115chr12400 329 --1121 --
NM_003128chr262596 2433 2218 1060 870 281 --22391 686 --
NM_003131chr622309 2268 ------
NM_003133chr131000 384 129 ------
NM_003135chr51333 --191 --
NM_003137chr622165 153 --2800 788 --
NM_003144chr632141 2064 1681 12160 51623 821 816 556 471 --
NM_003149chr3----11436 11318
NM_003150chr1712342 11805 1306 1339
NM_003155chr852751 2561 2481 2163 834 --12414 --
NM_003156chr112524 487 ----11195
NM_003162chr251121 1092 181 146 131 1941 1102 --
NM_003173chrX1339 ------
NM_003174chr103847 734 168 ------
NM_003178chr352241 2178 2142 1839 831 1605 ----
NM_003179chrX21338 120 ----1997
NM_003182chr72442 369 ------
NM_003182chr72442 369 ------
NM_003184chr821011 196 --3784 736 731 --
NM_003185chr2051253 1208 866 415 53 ----1933
NM_003188chr61131 ----1644
NM_003189chr161359 1339 1283 968 950 229 13007 11040 --
NM_003193chr1----1145 --
NM_003194chr6166 ------
NM_003198chr1----1258 --
NM_003199chr18135272 5031 4959 4615 4268 3921 3754 3484 2220 1856 1699 699 106 35043 4125 819 124234 4228 4222 4216 4211 4200 3681 3670 2003 1319 691 465 23941 3909
NM_003202chr531913 1845 1364 --11358 --
NM_003203chr261923 972 962 738 621 57 1437 12207 --
NM_003206chr61316 ----1420
NM_003211chr1271414 1196 690 535 431 205 191 2467 75 ----
NM_003217chr1261528 1251 543 226 117 62 1798 21763 784 --
NM_003220chr611341 --11423 --
NM_003221chr653905 3512 3044 2803 579 ------
NM_003222chr202802 438 1108 ----
NM_003223chr163864 692 526 --4710 705 659 654 1791
NM_003234chr322291 1586 21734 720 1728 11670
NM_003236chr243386 2885 1142 140 11177 11126 --
NM_003238chr1--1177 ----
NM_003242chr31581 --22235 1562 --
NM_003246chr1521995 1530 --31935 1913 1908 --
NM_003247chr661909 1846 1682 1407 1374 297 11258 61663 1625 1415 1395 1386 1380 --
NM_003253chr212702 619 ----11603
NM_003255chr1752441 2077 1896 911 378 --12501 --
NM_003257chr1531388 258 126 1110 2974 245 --
NM_003262chr3105305 4577 4371 3311 3278 1335 1154 900 667 524 --25259 4407 --
NM_003270chrX--3450 401 237 11155 --
NM_003272chr12634 263 1117 ----
NM_003274chr2152362 2050 1133 1011 858 --12223 --
NM_003275chr91108 --21220 602 --
NM_003285chr14452 386 95 44 ------
NM_003286chr204977 798 390 235 --1247 11041
NM_003290chr192145 102 ----183
NM_003292chr12508 185 --11897 --
NM_003298chr386032 5949 5164 4225 3925 2106 2006 500 11641 22416 1576 --
NM_003300chr14----1473 --
NM_003304chr361458 1369 1354 506 338 206 ----3596 515 241
NM_003315chr17----1236 --
NM_003317chr141600 --1678 --
NM_003319chr23621 242 109 1192 ----
NM_003320chr1153441 2953 1428 1256 690 --24410 1654 --
NM_003326chr142675 2630 2234 378 --1647 11829
NM_003330chr1231596 1156 432 11177 --11802
NM_003336chrX11044 ------
NM_003337chr51291 1678 ----
NM_003338chr1031603 727 204 1401 21875 312 1654
NM_003339chr521149 605 ------
NM_003340chr451352 964 911 891 870 --1127 --
NM_003341chr31535 1671 1147 --
NM_003342chr1773186 3111 2656 692 565 545 533 21328 932 12253 --
NM_003344chr711512 --11713 --
NM_003345chr163518 209 69 ------
NM_003347chr2241836 1651 1481 221 --11488 --
NM_003348chr1251329 1189 1085 621 63 ----1677
NM_003349chr201175 --11090 --
NM_003350chr81856 ------
NM_003352chr22161 64 ------
NM_003359chr421292 270 --31182 1120 107 --
NM_003362chr122702 362 21017 1003 2964 403 --
NM_003368chr13513 304 297 ------
NM_003369chr1142432 2408 1122 204 --1191 --
NM_003372chrX3935 693 231 ------
NM_003373chr1021746 542 11925 11956 --
NM_003374chr53739 521 39 --1783 --
NM_003375chr101308 1160 --1392
NM_003376chr631898 1384 577 11729 11351 11467
NM_003376chr631898 1384 577 11729 11351 11467
NM_003379chr64992 982 922 176 --1735 1750
NM_003383chr92506 169 ------
NM_003385chr21992 1185 --1334
NM_003387chr221146 260 1332 --22877 2731
NM_003390chr1141056 875 778 282 ------
NM_003392chr374299 3644 3622 3144 2903 1419 227 --34335 1177 820 --
NM_003400chr22263 139 --3663 620 186 --
NM_003403chr142608 241 --1562 --
NM_003404chr2041894 1862 1477 294 ------
NM_003406chr821599 1373 --188 1641
NM_003407chr192672 586 ------
NM_003409chr1831107 578 89 1547 ----
NM_003410chrX83104 2395 2343 1014 828 652 570 195 --1162 --
NM_003411chrY2615 462 --21618 560 --
NM_003412chr372790 2365 2349 2287 777 654 353 --32930 2907 2799 --
NM_003413chrX61646 1446 802 597 580 485 11807 11978 --
NM_003418chr32776 740 1226 ----
NM_003420chr32210 71 --2332 322 --
NM_003423chr1942299 1877 705 418 --11972 --
NM_003427chr61641 --1646 --
NM_003436chr193878 716 334 1907 1819 --
NM_003439chr743148 2777 2219 2184 --42702 1357 1090 38 --
NM_003442chr111161 --3849 835 685 1674
NM_003452chr92898 714 --21001 668 --
NM_003453chr131109 --5650 510 505 492 487 --
NM_003454chr1611503 --11205 11388
NM_003458chr31385 --23807 927 --
NM_003462chr111767 1158 ----
NM_003463chr672304 2285 1317 1298 1206 1099 544 2877 56 1957 --
NM_003467chr22139 117 --2382 177 --
NM_003468chr2144326 4223 4199 3770 3349 1563 1465 1058 651 632 305 278 206 67 11544 34124 1113 55 --
NM_003470chr1621347 447 --21820 1182 --
NM_003471chr341845 1823 1691 644 1612 1602 --
NM_003472chr681502 1401 1306 1225 963 581 251 167 ------
NM_003478chr1142915 2811 219 151 33013 2992 2285 1421 --
NM_003482chr1262767 2684 2566 1920 1807 836 --42752 1931 1926 703 --
NM_003483chr1282813 2662 2630 2141 2005 1909 1821 315 12959 --1972
NM_003488chr172698 33 --1879 --
NM_003489chr2152803 2480 2275 714 576 --73418 3413 2302 2297 363 336 169 1527
NM_003498chr1621948 947 --1374 1261
NM_003505chr751909 1888 1207 577 288 ------
NM_003506chr871315 1192 962 932 360 97 69 --41122 996 904 892 --
NM_003507chr261951 1934 1870 1586 1318 444 --22003 1998 1742
NM_003558chr92700 211 --1722 --
NM_003563chr1731236 1093 426 --11120 --
NM_003566chr12102538 2347 2331 1033 1021 948 916 739 683 174 23034 2684 32605 619 419 12220
NM_003569chr61252 1123 2615 523 --
NM_003574chr18115804 5662 5575 5043 4733 4576 4253 1930 816 110 62 25625 488 34693 4041 1917 --
NM_003575chr721478 964 --11006 --
NM_003576chr1372793 2360 1909 1833 1020 868 624 --2249 27 --
NM_003581chr21743 ------
NM_003583chr1273416 3055 1280 737 705 218 94 --22824 161 13097
NM_003589chr1341200 972 934 338 --1957 --
NM_003590chr283502 3473 3402 3082 1562 931 598 375 --62751 1268 1258 750 686 257 13485
NM_003592chr7----1472 --
NM_003597chr272184 1494 1421 602 434 338 192 --42173 1502 915 213 --
NM_003603chr451883 1543 1533 1520 671 --22094 625 --
NM_003607chr154376 4281 4103 3185 1557 13864 54204 2979 1168 814 346 23494 3247
NM_003613chr152121 113 1510 ----
NM_003615chr383965 3648 3630 2952 1270 1003 345 252 --43663 3611 3606 1285 1405
NM_003617chr194930 3800 3528 3235 3197 1635 1084 150 98 23756 3059 13137 --
NM_003618chr2----2982 153 --
NM_003620chr1731045 783 181 ------
NM_003622chr1252194 1722 968 548 104 --12408 1354
NM_003626chr1131294 1031 373 ------
NM_003629chr192325 1342 1267 1112 854 670 466 116 99 --53459 582 420 272 267 12960
NM_003630chr62267 201 3585 251 89 ----
NM_003631chr102817 266 --2771 215 --
NM_003632chr171877 --1820 --
NM_003633chr562545 2311 786 764 755 582 22523 658 ----
NM_003644chr1754854 4340 4227 1188 305 16576 15584 16283
NM_003651chr12----2528 421 --
NM_003654chr111156 1749 ----
NM_003658chr111561 --4658 651 646 641 --
NM_003659chr24302 149 131 107 --1154 --
NM_003663chr3103419 3351 3157 2946 2610 1058 685 617 119 78 --33483 3374 2197 --
NM_003664chr5--1198 2481 192 --
NM_003670chr33481 72 28 ------
NM_003672chr12721 479 21408 433 21938 695 11906
NM_003676chr12709 61 1700 1648 --
NM_003685chr191834 --31001 81 57 1983
NM_003686chr11261 ------
NM_003688chrX--163 ----
NM_003692chr93725 269 176 --11000 --
NM_003701chr131222 --1950 --
NM_003702chr8----1669 --
NM_003705chr21225 --1789 --
NM_003710chr15----1449 --
NM_003713chr171707 1679 1664 520 317 104 29 --1485 --
NM_003716chr32983 934 --2864 736 --
NM_003722chr352135 1968 1854 1756 918 1984 32723 2419 2007 --
NM_003728chr41460 --1424 1509
NM_003735chr511619 --1677 1632
NM_003736chr511619 --1677 1632
NM_003743chr262189 2070 1953 557 287 160 --21869 190 --
NM_003744chr1421130 373 --21116 1097 --
NM_003745chr16------155
NM_003749chr1322149 1835 12111 3245 240 235 12183
NM_003750chr1021000 245 ------
NM_003754chr111142 ------
NM_003758chr151118 ----11154
NM_003758chr151118 ----11154
NM_003759chr493657 3592 3112 3016 866 468 208 190 174 --42787 827 352 196 --
NM_003763chr2043178 3137 2985 713 --32865 2024 191 --
NM_003764chr61713 ------
NM_003766chr171611 --252 47 --
NM_003772chr1141190 829 411 170 --1349 --
NM_003774chr12103398 3345 3218 3069 2589 2180 2096 725 578 235 1841 ----
NM_003778chr34713 700 132 43 ------
NM_003781chr341609 1582 1178 384 1726 --1231
NM_003787chr1821655 1551 1358 21709 230 --
NM_003791chr163610 584 447 1120 ----
NM_003794chr341083 920 894 321 ----1969
NM_003795chr61171 --2143 138 --
NM_003796chr194592 473 199 53 ------
NM_003797chr112211 37 ------
NM_003799chr1843951 1306 177 154 13624 34496 4242 2971 22790 421
NM_003800chr672360 2275 1899 1877 1661 618 68 --12307 12315
NM_003816chr841427 1307 337 21 ----11454
NM_003822chr11694 ----1970
NM_003825chr151575 --4372 356 291 158 1559
NM_003829chr931208 276 206 ------
NM_003831chr181404 11378 51754 1749 1578 1572 577 --
NM_003850chr132634 219 --1239 --
NM_003861chr1452455 1948 411 298 126 ----12732
NM_003862chr51109 ------
NM_003870chr1522129 334 1172 21586 758 --
NM_003872chr242715 1988 1931 861 12628 1293 --
NM_003873chr1072361 2343 2236 2057 1989 1872 981 --21945 760 --
NM_003884chr331783 1276 748 11633 ----
NM_003885chr1752674 2564 2210 584 70 --12372 --
NM_003887chr232046 1938 1660 --31561 1555 1442 11449
NM_003895chr2131770 1600 812 --1656 --
NM_003902chr13334 213 27 157 1100 --
NM_003913chr693597 1655 1318 1281 1116 996 698 321 178 --53725 3574 3259 3128 1372 1818
NM_003916chrX21173 480 ----1119
NM_003922chr151308 --1400 --
NM_003930chr752503 2419 2404 2133 233 --22491 722 --
NM_003931chr6----2587 93 --
NM_003932chr2231651 1540 664 ----11784
NM_003934chr93928 896 327 --2194 111 1209
NM_003936chr22345 187 --1979 --
NM_003938chr1921145 158 11092 ----
NM_003939chr1074058 4021 3334 822 640 359 248 --63070 1517 1313 1308 1300 1291 --
NM_003941chr72923 105 --52476 1672 1566 130 118 --
NM_003943chr421056 137 1126 ----
NM_003947chr32846 133 ------
NM_003953chr152869 814 776 763 257 ------
NM_003957chr1121014 823 ------
NM_003966chr5157789 7080 6939 6895 6881 6811 6229 5811 5756 4766 3111 2660 2190 1651 278 --36409 2686 2293 --
NM_003971chr172570 86 ------
NM_003972chr10----11267 --
NM_003980chr631445 593 419 11110 21071 938 --
NM_003983chr1694386 4318 4290 3172 3105 1661 1491 1170 894 --34487 4349 4168 --
NM_003987chr1022316 2269 --11555 --
NM_003988chr1022393 2346 --11632 --
NM_003989chr1022252 2205 --11491 --
NM_003990chr1022252 2205 --11491 --
NM_003993chr11307 ------
NM_003994chr1253799 3374 1646 1637 60 11197 ----
NM_003998chr4------1599
NM_004004chr1361384 1334 1110 455 410 326 ------
NM_004006chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004007chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004009chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004010chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004011chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004012chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004013chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004014chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004015chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004016chrX72400 2034 1795 1706 484 433 100 --22211 2197 1161
NM_004017chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004018chrX72400 2034 1795 1706 484 433 100 --22211 2197 1161
NM_004020chrX72486 2120 1881 1792 570 519 186 --22297 2283 1247
NM_004021chrX72400 2034 1795 1706 484 433 100 --22211 2197 1161
NM_004022chrX72400 2034 1795 1706 484 433 100 --22211 2197 1161
NM_004023chrX72400 2034 1795 1706 484 433 100 --22211 2197 1161
NM_004028chr1863565 2894 1342 1097 890 109 184 21017 930 23552 1287
NM_004036chr21136 1691 ----
NM_004040chr221052 847 --11017 --
NM_004046chr18139 ------
NM_004050chr1432729 2500 1936 ------
NM_004061chr52630 246 --2259 251 --
NM_004063chr81303 1133 11072 --
NM_004067chr761513 1451 1178 1063 250 89 --2521 223 --
NM_004071chr23251 216 77 ------
NM_004075chr122589 215 ------
NM_004077chr12----167 --
NM_004080chr7------1132
NM_004081chrY31743 1736 1215 ----11161
NM_004085chrX3531 185 156 ----1107
NM_004086chr141556 1193 ----
NM_004087chr311741 1630 11274 --
NM_004089chrX41279 1175 335 65 --21038 1033 --
NM_004093chr1373259 3144 2940 2922 2648 2606 2072 1659 1840 --
NM_004096chr1072017 1968 1891 1661 1505 853 342 --22112 773 --
NM_004097chr2----1290 --
NM_004098chr1041287 1222 1215 501 11234 1495 --
NM_004100chr631969 1916 827 --21791 565 --
NM_004109chr1131618 265 151 ------
NM_004113chr331899 513 452 --1443 --
NM_004114chrX51226 1120 881 418 329 ------
NM_004117chr642213 1876 1709 1460 199 21783 456 --
NM_004124chr1493224 3146 3105 3052 2518 1435 1027 246 107 2807 290 12569 13557
NM_004126chr72290 45 ------
NM_004130chr3----2610 248 --
NM_004133chr842700 1902 541 296 1163 11913 --
NM_004136chr1592912 2833 2389 2366 380 351 342 284 52 --22665 788 22567 1053
NM_004157chr33914 763 200 --1795 --
NM_004161chr231231 553 372 1451 31434 1283 304 --
NM_004162chr31401 --1805 --
NM_004169chr171172 --1550 --
NM_004171chr11149651 8509 8193 7549 7070 6709 6689 6336 6096 3859 3837 2503 2111 1763 26909 6366 69514 7388 5829 3475 1833 889 33100 2397 1105
NM_004175chr223418 214 95 --3171 166 156 --
NM_004185chr11581 --1678 --
NM_004187chrX1151 ----11122
NM_004193chr101359 ------
NM_004200chr1143273 3251 3124 628 ------
NM_004209chr1611094 ------
NM_004215chr81472 --1413 --
NM_004229chrX42117 1978 1478 179 --2364 359 12128
NM_004232chr1873624 2465 2447 1370 867 305 139 --193 --
NM_004235chr93847 831 795 ------
NM_004236chr152462 453 --1158 --
NM_004237chr51283 1152 4907 824 722 332 --
NM_004239chr141106 ------
NM_004240chr19----1258 --
NM_004241chr101232 --1560 1739
NM_004242chr62348 78 ------
NM_004261chr131026 781 223 --182 133
NM_004263chr231278 1147 338 ------
NM_004267chr31499 ------
NM_004272chr551635 596 484 418 350 --21564 452 --
NM_004274chr1432711 2282 2113 22892 2659 ----
NM_004279chr742301 352 175 155 --11887 --
NM_004280chr64453 178 160 107 1400 ----
NM_004282chr61158 184 ----
NM_004286chr2252843 2166 1990 961 251 ------
NM_004290chr5--11263 11134 --
NM_004291chr52296 278 ------
NM_004293chr943729 2551 775 678 --12385 --
NM_004299chrX----128 --
NM_004301chr33108 87 33 --1249 --
NM_004302chr1212806 --12907 --
NM_004304chr21275 --1104 --
NM_004311chr1082929 2816 2359 2083 1109 457 387 67 --11975 --
NM_004313chr171420 ------
NM_004319chr162229 2216 1072 1055 274 258 ------
NM_004326chr131132 1121 236 --31111 773 379 --
NM_004329chr101995 11194 ----
NM_004330chr1551092 815 286 279 140 11140 1462 --
NM_004331chr842691 806 601 297 ------
NM_004337chr821746 63 21985 1763 ----
NM_004338chr18116159 6086 5863 5577 5293 5138 4922 4727 4593 1445 136 37013 6541 2695 46349 5520 1983 473 --
NM_004342chr731935 634 75 --22070 380 --
NM_004343chr191571 --1141 --
NM_004346chr441521 1465 524 386 11533 1549 --
NM_004349chr81923 --190 --
NM_004354chr41730 2293 131 ----
NM_004359chr192506 87 ------
NM_004360chr162395 342 --11773 12036
NM_004364chr19----41059 1048 1043 935 --
NM_004370chr631554 606 581 11589 1658 21729 572
NM_004379chr22281 158 --11239 --
NM_004380chr163642 292 48 --3278 257 251 2964 164
NM_004384chr582243 2126 2099 1826 1733 492 214 143 --1678 --
NM_004386chr1911978 --12230 --
NM_004388chr11374 ----195
NM_004389chr2172 ----1756
NM_004392chr1382343 1958 1891 1671 899 634 318 114 12058 22516 1848 --
NM_004393chr361725 1463 733 373 240 220 1562 ----
NM_004396chr171195 ------
NM_004397chr1153196 3032 1705 1609 1240 23579 3543 44216 4049 1347 192 14308
NM_004404chr272038 1776 1538 741 500 227 173 11810 1545 --
NM_004407chr421014 760 ------
NM_004414chr212545 289 ------
NM_004415chr62778 271 1667 1623 --
NM_004417chr53560 494 177 --1448 1614
NM_004419chr102978 948 --151 --
NM_004420chr1122285 1548 ------
NM_004429chrX31428 381 114 --21366 1360 --
NM_004430chr892740 2603 2501 2451 2292 2238 1995 1102 269 --42088 1892 1887 1882 --
NM_004432chr942394 1812 893 524 ------
NM_004434chr1421666 763 --2193 85 --
NM_004436chr12591 90 --1208 --
NM_004437chr133411 1207 577 --11307 --
NM_004438chr223007 315 --23176 385 --
NM_004440chr661893 1607 711 597 452 286 1643 ----
NM_004441chr321236 471 ------
NM_004443chr31502 ------
NM_004444chr71856 --2578 565 --
NM_004447chr1251146 985 382 156 57 --1784 --
NM_004448chr17----2499 494 --
NM_004449chr2131458 1019 938 ------
NM_004450chr14177 1106 ----
NM_004454chr352309 2159 1899 808 411 --42132 765 737 75 --
NM_004457chr221394 502 127 11581 --
NM_004458chrX72635 2609 1627 1004 286 180 76 --22254 1061 --
NM_004459chr1792037 1953 1785 1664 1440 1325 804 258 165 --11743 --
NM_004460chr2167 --1229 --
NM_004464chr454146 3676 2873 1261 133 14301 3421 411 241 1402
NM_004472chr52578 550 --179 --
NM_004480chr142738 648 --3523 517 511 --
NM_004482chr21296 1391 --1861
NM_004483chr162478 461 --1417 --
NM_004484chrX------1101
NM_004487chr35927 296 278 268 252 ------
NM_004491chr1914143 14291 34269 4259 3000 --
NM_004496chr1421158 395 ------
NM_004499chr52483 43 ------
NM_004500chr1471677 1457 727 697 598 567 499 --1232 1209
NM_004503chr121741 ------
NM_004504chr273032 2795 1166 1109 1099 874 642 ----21207 590
NM_004505chr1711328 --1567 --
NM_004506chr63493 98 85 --2138 103 --
NM_004514chr1742240 1141 831 590 --3824 562 556 --
NM_004516chr1961117 1070 1032 403 318 254 --1868 --
NM_004520chr55612 592 160 145 116 --1222 --
NM_004521chr102355 346 ------
NM_004523chr10----21187 1166 --
NM_004524chr171225 ------
NM_004525chr221457 42 21365 296 1945 --
NM_004529chr9----31299 1091 80 --
NM_004535chr2031398 1116 500 11164 31497 1432 248 11356
NM_004537chr1241236 193 114 107 --1128 --
NM_004540chr21------2209 173
NM_004566chr1052554 2195 1786 809 696 --1349 --
NM_004571chr2143430 2165 768 107 1548 1848 --
NM_004575chr431272 1217 352 --11446 --
NM_004577chr72534 72 ------
NM_004578chr11833 --1920 --
NM_004580chr1531428 286 164 ------
NM_004583chr171734 ------
NM_004586chrX95437 5036 4464 3698 1994 928 702 461 451 1361 25218 4046 11807
NM_004591chr22393 170 --1380 --
NM_004593chr33899 226 192 ------
NM_004595chrX----4365 313 307 301 --
NM_004598chr573182 3124 2909 2555 822 170 30 --32815 1166 213 --
NM_004600chr121265 1026 --1278 1253
NM_004602chr201197 ----21366 939
NM_004606chrX173 ------
NM_004612chr963715 3217 926 788 575 117 24639 1238 24844 771 --
NM_004615chrX1209 --1745 --
NM_004619chr152152 2117 2099 1971 591 ----1710
NM_004622chr282465 1924 1881 1582 912 835 625 526 --2654 204 --
NM_004627chr216654 636 601 536 520 135 --2122 80 --
NM_004630chr112998 440 --1971 --
NM_004635chr3----1114 --
NM_004637chr321098 531 --1350 --
NM_004642chr121171 --2483 226 --
NM_004643chr141540 --5798 711 703 687 531 --
NM_004654chrY31222 990 203 --31397 1378 339 --
NM_004655chr1721284 1026 --31298 899 887 --
NM_004660chrY41757 580 530 276 21446 299 32105 1708 1519 12094
NM_004663chr1551386 976 566 379 90 --21239 553 --
NM_004667chr151459 ------
NM_004671chr18------1315
NM_004674chr81203 --3499 61 55 --
NM_004685chr13102688 2651 2539 2255 2103 1196 848 728 682 433 --52763 2217 577 551 546 --
NM_004687chr1731689 1590 1393 ------
NM_004689chr141357 --1306 --
NM_004694chr17----5197 177 172 167 162 1544
NM_004703chr171391 12525 21960 522 --
NM_004708chr19176 ------
NM_004709chrX71406 1379 1342 1313 1190 1144 461 ------
NM_004718chr26490 451 221 149 108 26 ----1620
NM_004719chr12102689 2672 2516 2485 2199 2066 1835 724 658 649 --1145 --
NM_004721chr3194 --1287 --
NM_004723chr11698 --31044 687 676 --
NM_004725chr1051474 1369 1260 391 204 --31011 400 289 --
NM_004726chrX115325 4953 4406 4065 3972 3537 2023 1998 1686 917 411 15586 45240 1837 1698 1082 14390
NM_004730chr551979 1931 1815 1755 407 --11736 --
NM_004733chr33613 501 181 ------
NM_004734chr1333172 2688 312 ------
NM_004736chr152150 1970 1424 792 427 1608 31926 1921 1916 11979
NM_004737chr221108 ------
NM_004738chr2022359 630 ------
NM_004739chr112595 564 ------
NM_004741chr102638 179 --1339 --
NM_004742chr341597 1583 240 208 1424 41655 1647 131 39 --
NM_004745chr876117 5691 4709 2374 1551 1115 990 --1202 1341
NM_004747chr1031403 1098 482 ------
NM_004748chr1583811 3765 3729 3551 2874 1269 1059 247 22849 920 64258 3389 2715 2710 2685 759 --
NM_004757chr42228 99 --1536 --
NM_004759chr142152 1694 870 112 --11603 --
NM_004760chr741999 884 579 441 1401 12392 --
NM_004762chr1751895 1880 1873 1624 1524 --11974 1143
NM_004765chr16168 ------
NM_004768chr131100 870 79 ------
NM_004770chr81195 ------
NM_004772chr531592 1520 1155 ------
NM_004774chr1763067 2039 618 462 311 219 --11070 --
NM_004775chr1872332 2282 2079 846 587 399 337 --42302 2289 2228 2201 1707
NM_004776chr2053314 3224 2992 2326 22 --22128 2104 --
NM_004779chr541323 524 373 192 --1139 --
NM_004781chr171200 1081 678 491 198 150 110 --1542 --
NM_004781chr171200 1081 678 491 198 150 110 --1542 --
NM_004788chr1152733 2235 2221 2160 1009 --22360 873 1640
NM_004789chr9--1436 ----
NM_004796chr1461843 1703 1527 779 760 246 12241 31602 1578 615 12050
NM_004799chr1------197
NM_004800chr13168 ------
NM_004804chr2--12800 ----
NM_004808chr1042506 2259 676 265 33291 362 43 --11294
NM_004820chr81102 ------
NM_004821chr53719 545 506 --1633 --
NM_004822chr1733054 3023 1157 --11436 --
NM_004824chr631361 1253 378 --1297 --
NM_004834chr273356 3248 1178 960 804 601 506 13265 2870 652 13150
NM_004836chr24605 217 114 95 1225 --1191
NM_004840chrX62068 1819 913 678 196 78 --197 --
NM_004841chr1----21067 764 --
NM_004849chr661607 1355 1102 637 614 475 --169 --
NM_004850chr2----21422 1416 --
NM_004857chr1453421 3324 3244 1649 475 ------
NM_004859chr1732339 1955 974 --42326 863 644 132 --
NM_004863chr1485098 5064 3852 3624 1441 265 232 158 1195 25270 1960 --
NM_004865chr61371 ------
NM_004867chrX1472 --1461 --
NM_004869chr18157 11129 --11615
NM_004871chr1743288 1747 1386 250 23196 1621 64357 4304 3745 3714 3401 1485 12921
NM_004873chr14143054 2941 2742 2621 2450 2320 2222 1984 620 545 284 247 227 34 --2727 521 12880
NM_004874chr81411 --1489 1495
NM_004879chr114392 370 298 151 ------
NM_004884chr1521734 413 --1434 11261
NM_004888chr91165 ------
NM_004893chr51479 --1114 --
NM_004895chr13527 486 361 --2498 376 --
NM_004896chr1041203 1061 519 427 1228 1337 --
NM_004898chr472738 2730 1965 1118 781 600 411 --2751 700 1962
NM_004902chr202723 701 ------
NM_004904chr796552 6430 6331 5095 4755 4506 4226 1665 1174 --26445 2549 --
NM_004905chr11305 1936 --1653
NM_004906chr64251 140 97 79 --2182 124 --
NM_004912chr731736 1180 37 11123 ----
NM_004915chr213843 611 518 ------
NM_004921chr142499 2493 2460 828 ----1274
NM_004926chr1441822 1362 1300 283 --21219 1132 11211
NM_004930chr11659 --3652 642 252 --
NM_004937chr1722695 398 ------
NM_004946chr51418 ------
NM_004947chr352389 2077 715 523 432 --12135 --
NM_004949chr1831986 1878 834 1469 12088 --
NM_004952chr11772 ------
NM_004956chr794444 3856 3436 1332 572 565 528 78 31 23963 3724 41639 1509 1498 585 --
NM_004957chr91447 --182 --
NM_004958chr12919 45 1102 ----
NM_004960chr163105 68 37 ------
NM_004964chr11548 ------
NM_004965chr213645 191 81 1514 ----
NM_004966chr102390 99 --1987 --
NM_004968chr71637 ------
NM_004973chr671488 1397 1117 476 318 173 41 --31718 546 143 --
NM_004976chr1135164 3465 1919 11007 13611 --
NM_004978chr131365 1321 497 --21343 514 --
NM_004985chr12104495 4327 4308 4278 4194 3595 3309 546 81 53 --11189 12776
NM_004992chrX88352 8282 7054 6968 6199 5761 3298 1182 --97456 7431 5520 5415 5402 5397 1854 1848 1243 17148
NM_004992chrX88352 8282 7054 6968 6199 5761 3298 1182 --97456 7431 5520 5415 5402 5397 1854 1848 1243 17148
NM_004993chr142358 310 ------
NM_004995chr1411502 --21515 1510 --
NM_004996chr1631717 1663 510 ------
NM_004999chr663806 3057 1747 861 652 149 1663 21190 766 14150
NM_005010chr722148 374 --21711 1533 --
NM_005011chr721578 1215 11685 1500 1114
NM_005017chr31255 ------
NM_005020chr72550 456 ------
NM_005022chr17----1204 --
NM_005023chr53510 431 188 --31110 1098 1092 --
NM_005026chr1----2570 130 --
NM_005027chr1911197 ------
NM_005032chrX3793 758 321 11020 1394 --
NM_005036chr2288337 6347 6276 6212 6042 1930 163 84 16649 35833 1511 929 26009 1239
NM_005045chr73792 640 188 ------
NM_005048chr22838 248 --1736 --
NM_005054chr261682 1407 1387 675 646 117 ------
NM_005056chr12124524 4371 4360 3758 3700 3642 3584 2040 1910 1751 1209 589 14782 31652 1646 1557 --
NM_005057chr1----41874 609 453 317 1428
NM_005063chr1043868 2371 366 305 13255 --23115 485
NM_005065chr14135406 4361 3998 3907 3894 3360 1603 949 915 781 773 675 207 24251 572 ----
NM_005066chr12541 32 --3755 45 37 --
NM_005067chr3----4968 815 400 123 --
NM_005069chr2131708 1376 624 --31222 1116 549 --
NM_005076chr11142 14124 ----
NM_005077chr92437 415 --1446 --
NM_005078chr1531577 339 322 --11435 --
NM_005079chr883218 3203 2966 2825 2619 2570 2181 603 11257 13164 --
NM_005080chr223867 790 337 ------
NM_005087chr33867 830 604 1540 1273 --
NM_005088chrX1807 ----1741
NM_005093chr2055349 3804 3792 1531 253 --31359 1352 724 15275
NM_005095chr11580 --22178 271 11609
NM_005096chrX31269 1118 1097 ------
NM_005099chr131347 1086 941 ------
NM_005104chr64780 617 557 84 --1749 --
NM_005105chr142135 2081 712 442 11949 2679 154 --
NM_005109chr342375 2141 1716 773 1515 42386 1829 592 568 --
NM_005116chr2064326 4011 2802 1831 1218 1108 --34365 4237 3275 --
NM_005119chr121296 262 11219 2343 317 --
NM_005120chrX1172 ------
NM_005121chr1763431 3318 2669 2623 905 617 33179 2599 986 12534 --
NM_005124chr62755 730 --3885 748 678 --
NM_005126chr362177 2028 2021 1880 1690 47 ------
NM_005141chr4148 --123 --
NM_005149chr141416 1273 1245 906 1266 --11288
NM_005151chr183787 381 49 1892 ----
NM_005154chr151469 ------
NM_005156chr9115321 4722 4647 4450 4329 4240 1967 1679 990 160 88 21614 1450 11139 --
NM_005157chr9----11907 11754
NM_005159chr15102225 2144 1888 1565 872 496 236 201 127 108 ------
NM_005160chr22136613 5980 5606 5287 4379 4346 4304 1527 1395 1383 1144 452 408 25661 218 12108 --
NM_005168chr211713 --11674 1347
NM_005171chr1241182 986 363 25 ------
NM_005178chr192423 407 ------
NM_005180chr104656 393 118 109 1333 11340 --
NM_005184chr192344 219 --11540 --
NM_005188chr11148218 7187 5579 3212 3041 2778 2706 2659 2234 2081 1897 1707 1030 740 --78360 7622 6003 5356 2548 2089 314 --
NM_005190chr62346 137 ------
NM_005194chr202484 181 --3467 462 457 --
NM_005197chr1456088 5387 4496 1479 174 --105759 5754 4017 1545 1524 1518 1511 1505 1499 150 25289 4702
NM_005203chr101141 1373 1171 --
NM_005204chr106993 949 766 747 697 295 ------
NM_005207chr22103714 3280 3229 1178 1165 1121 1044 741 380 31 --6581 576 567 562 557 501 --
NM_005219chr541791 1369 404 268 --11800 11681
NM_005224chr191443 --2611 543 --
NM_005226chr922238 973 22632 2431 --11612
NM_005229chrX21221 480 --1485 --
NM_005230chr12----2538 229 --
NM_005231chr112977 281 1204 21260 167 --
NM_005233chr342378 1951 356 210 1703 1428 --
NM_005235chr2157284 5954 5915 5894 5481 5243 5209 4886 2976 2119 1993 1324 1107 687 339 11308 46145 2966 663 658 17829
NM_005238chr1183091 2913 2827 1201 951 663 588 408 12563 43513 3474 2861 2195 --
NM_005239chr2172019 1498 1306 727 617 369 362 --32058 1353 738 --
NM_005240chr11633 --1651 --
NM_005241chr341260 1235 1023 394 --41271 976 963 196 --
NM_005242chr541249 1191 1131 1081 --11319 --
NM_005244chr20----1568 --
NM_005245chr4------1516
NM_005249chr141121 ------
NM_005254chr1551353 1038 1016 532 291 ------
NM_005256chr11------1832
NM_005257chr1851300 1151 331 324 66 1893 11430 --
NM_005259chr221438 976 --1356 11455
NM_005271chr103797 490 241 ------
NM_005276chr1221167 497 1545 11716 --
NM_005276chr1221167 497 1545 11716 --
NM_005277chr461865 1266 506 346 302 150 1623 11597 --
NM_005278chrX----1428 195
NM_005281chr111017 ------
NM_005284chr62490 434 --1457 --
NM_005295chr71225 1200 ----
NM_005296chrX1123 --1160 --
NM_005302chr72349 34 ------
NM_005308chr102369 337 ------
NM_005311chr7142820 2760 2563 2307 2142 2114 1148 671 413 399 382 178 157 124 --12519 --
NM_005312chr911811 --1273 --
NM_005313chr1541011 984 939 284 --1480 --
NM_005316chr112760 27 --11078 --
NM_005318chr223897 346 98 11041 41257 871 290 232 1238
NM_005328chr84546 520 277 233 --1775 --
NM_005329chr1622267 2142 11854 ----
NM_005334chrX51753 1676 1564 706 280 ------
NM_005339chr484252 4011 3649 1691 1424 1241 568 319 --53731 3192 3007 2853 332 --
NM_005342chrX52349 1849 798 681 285 12275 11032 --
NM_005349chr41259 --1509 --
NM_005358chr1341846 558 414 127 --2180 95 --
NM_005359chr18186483 5357 4980 4796 2273 2248 1817 1767 1634 1437 1358 1112 1034 851 624 562 423 133 22450 707 24801 93 --
NM_005369chrX1427 --1499 --
NM_005375chr6----2940 109 1867
NM_005376chr131145 908 290 --1227 --
NM_005378chr22774 710 ------
NM_005381chr21346 --5400 332 326 321 302 --
NM_005382chr8----1386 --
NM_005384chr9165 --1241 --
NM_005385chr352664 2605 2054 1060 343 ------
NM_005387chr111232 ------
NM_005389chr61738 2572 155 ----
NM_005392chr951905 1519 1491 1429 1356 ------
NM_005397chr754035 3849 3767 720 627 --43201 3196 3112 980 11177
NM_005398chr1031214 1197 452 189 ----
NM_005399chr1114261 3928 3888 3776 3092 1770 1454 745 658 149 96 23813 1226 31675 1312 814 --
NM_005400chr242938 2385 1023 568 11939 21968 1213 --
NM_005402chr731826 1731 715 ------
NM_005406chr1821066 471 --1445 --
NM_005407chr1421309 90 ----11479
NM_005410chr52531 266 ------
NM_005412chr12--1553 ----
NM_005415chr23596 276 157 ------
NM_005417chr2011877 ------
NM_005418chr111200 --1475 --
NM_005433chr1832641 1105 532 --1969 --
NM_005436chr1053936 3452 1514 1406 1235 13098 33436 1214 302 13054
NM_005437chr1041473 1458 1120 493 ----1442
NM_005440chr17----1570 --
NM_005442chr33512 126 38 --3455 409 64 --
NM_005445chr101214 ------
NM_005455chr151538 1193 401 378 339 11859 1679 11299
NM_005458chr932467 1560 962 1662 ----
NM_005460chr51529 1409 ----
NM_005461chr2031431 685 391 --11996 --
NM_005465chr111316 --1194 --
NM_005471chr541305 1241 1148 1042 --1275 --
NM_005474chr1731571 1397 1063 --145 --
NM_005475chr121667 ----13273
NM_005487chr2242119 1384 521 178 --22053 1900 --
NM_005493chr63620 553 117 --1594 --
NM_005494chr73612 244 207 ------
NM_005497chr17166151 4872 4863 4725 4673 3769 3760 1962 1797 1389 1343 1310 1107 440 346 295 1987 36074 4711 1568 --
NM_005499chr193612 571 75 ----1145
NM_005502chr963213 3114 3057 3047 2560 553 --1324 --
NM_005503chr153240 216 165 ------
NM_005506chr442147 1098 693 300 --21163 268 --
NM_005509chr571628 1497 1447 1204 717 677 346 --21335 278 --
NM_005517chr151442 1286 1086 1080 338 11396 194 --
NM_005519chr10----1162 --
NM_005520chr51497 1555 ----
NM_005522chr73947 924 508 11178 ----
NM_005530chr1541452 972 245 93 1274 ----
NM_005534chr21----2511 103 --
NM_005536chr841350 288 202 180 --1476 --
NM_005537chr133942 843 69 --1165 --
NM_005539chr102983 886 ----1910
NM_005542chr7101930 1784 1501 1433 1415 1297 1274 1267 1229 364 --21517 1446 --
NM_005544chr23778 709 157 ------
NM_005561chr131926 ----2210 189
NM_005562chr121221 1169 ------
NM_005563chr12798 637 --1706 --
NM_005566chr111450 ------
NM_005573chr56518 473 458 274 192 164 ------
NM_005575chr5169 --2644 26 --
NM_005576chr15----1214 --
NM_005578chr3114870 4555 1881 1860 1799 1407 1024 429 346 238 215 --11073 1541
NM_005584chr132810 790 --1629 --
NM_005595chr1----2943 863 --
NM_005596chr9126275 6047 5933 5021 4924 4381 2394 2011 1990 1861 1621 1402 1358 45168 4282 1945 1570 24752 3999
NM_005599chr151564 1493 1460 1083 975 --11102 --
NM_005602chr34859 327 142 62 --2304 272 --
NM_005603chr1831870 1367 1337 --12007 --
NM_005604chr632479 1912 770 --32455 628 623 --
NM_005607chr82984 697 --2195 190 --
NM_005610chr11774 --2647 575 --
NM_005611chr163466 431 382 ----1841
NM_005613chr152139 1883 1509 741 576 ------
NM_005614chr731024 954 284 --11102 --
NM_005618chr62554 476 ----1614
NM_005626chr1142 --1360 --
NM_005631chr711089 --1678 --
NM_005632chr16----11114 --
NM_005634chrX3675 162 92 --1144 --
NM_005637chr1862047 1787 1621 705 418 372 --31614 1607 1601 --
NM_005638chrX--1257 2291 239 2572 421
NM_005639chr1231773 1676 594 ------
NM_005644chr11413 --1343 --
NM_005647chrX53431 3245 3128 2302 549 --33160 3057 428 --
NM_005650chr222448 378 --21176 1096 --
NM_005655chr821201 815 1315 21307 328 11078
NM_005656chr2121513 1193 --41130 589 476 59 --
NM_005664chr152431 239 ------
NM_005665chr194278 3748 3142 1856 1845 1715 665 423 79 13066 54225 1445 1204 1039 954 44869 3149 1652 1625
NM_005667chr2176 ------
NM_005668chr581539 1328 1315 1297 978 827 680 529 --22920 1825 11213
NM_005676chrX1192 --1159 --
NM_005682chr1611341 ------
NM_005686chr121303 356 --11574 11505
NM_005688chr351362 1305 1126 426 416 --1217 1449
NM_005704chr1----1945 1955
NM_005708chr13----1152 --
NM_005711chr521030 951 ------
NM_005715chr662425 982 898 170 156 54 ------
NM_005717chr131249 1198 1062 --51287 1282 1272 333 323 --
NM_005721chr23912 272 68 ------
NM_005722chr251987 1643 774 628 246 1157 1573 2902 168
NM_005725chr12262 113 --1768 11531
NM_005730chr1263562 2979 2508 2453 823 260 --13429 --
NM_005731chr21127 ------
NM_005734chr111165 1734 2669 255 --
NM_005735chr21860 --1787 --
NM_005736chr1011149 --1501 --
NM_005737chr252454 2339 2099 2061 256 --32903 2448 751 --
NM_005738chr741419 772 336 120 11407 41670 1445 1437 125 --
NM_005740chr221117 ------
NM_005744chr15------1138
NM_005746chr772646 2149 2035 1778 496 371 103 ------
NM_005749chr171635 ----1593
NM_005751chr76474 436 377 77 69 50 ------
NM_005752chr1631162 297 176 --21123 797 1154
NM_005754chr541109 859 208 137 1940 --21178 928
NM_005759chr264530 4487 4426 4316 3548 1124 11029 11785 13351
NM_005765chrX2586 135 --1124 153
NM_005766chr132515 428 ------
NM_005768chr121709 ------
NM_005776chr14----2344 159 --
NM_005778chr31380 ------
NM_005779chr563661 2954 2921 2709 2551 1050 12747 32883 2875 527 --
NM_005782chr172196 102 ------
NM_005786chr183250 141 96 ------
NM_005788chr112588 229 ------
NM_005789chr1711551 165 ----
NM_005795chr2123008 2647 2468 2341 2092 1216 899 811 626 521 497 31 --22231 1945 --
NM_005796chr161351 ------
NM_005797chr1131753 1205 280 --1602 1611
NM_005798chr1365015 4752 3192 2119 935 533 25254 5117 34632 1319 199 133
NM_005806chr2131267 1100 1038 ------
NM_005808chr322886 229 --2862 148 --
NM_005813chr262423 2305 2235 2201 349 250 12144 155 --
NM_005819chr143501 1365 614 301 --1336 --
NM_005826chr13595 562 483 --1109 --
NM_005828chr1784769 1805 1725 1642 1596 360 286 38 23685 489 ----
NM_005832chr341296 1173 1152 200 --11073 130
NM_005839chr15987 792 758 706 99 --7912 895 693 688 679 364 334 --
NM_005840chrX127454 6892 6247 5392 5376 5177 3074 2544 2182 2172 2042 1596 27693 739 22082 121 --
NM_005841chr42958 265 --6765 279 79 73 67 61 --
NM_005842chr134687 496 146 123 --1278 --
NM_005843chr251549 1484 540 246 192 --1620 --
NM_005845chr1341313 1131 420 262 11588 21354 331 --
NM_005851chr11------1399
NM_005857chr121174 989 --11278 --
NM_005859chr51363 --11235 21150 532
NM_005862chr361050 880 800 424 143 108 ------
NM_005863chr104998 554 357 41 1390 2911 63 --
NM_005866chr91899 ------
NM_005871chr1061069 947 786 321 236 218 186 1681 1921
NM_005875chr31401 --2296 42 --
NM_005877chr224524 370 109 37 ------
NM_005880chr1641572 656 306 55 --2560 548 --
NM_005885chr541365 1258 579 49 --11117 --
NM_005896chr23535 111 103 ------
NM_005898chr1162906 2757 2538 1268 804 88 12018 22439 872 --
NM_005900chr441135 1096 1011 474 --2763 490 --
NM_005901chr18198643 7538 7431 7143 6935 6341 5680 5538 2881 2871 2770 2237 2183 1833 1380 1147 755 651 466 15447 56636 2804 2291 672 662 17568
NM_005902chr1563252 1532 1505 1494 1443 585 --11112 --
NM_005903chr5125205 5073 4642 3786 948 849 791 688 657 474 167 149 25223 4286 33520 2035 1013 --
NM_005904chr1831375 414 58 --2169 121 --
NM_005906chr691547 1461 1248 1110 532 503 452 393 355 --21147 423 11681
NM_005907chr641317 668 393 128 --2638 222 1282
NM_005909chr553666 3579 3054 573 39 13498 22637 171 22953 2748
NM_005910chr1723789 146 23482 3354 ----
NM_005911chr22963 157 --1204 --
NM_005920chr163872 3753 3338 2835 1384 539 --23847 1347 --
NM_005922chr61380 --1416 --
NM_005923chr63587 555 120 ------
NM_005924chr72427 274 --31138 433 280 --
NM_005927chr531160 1084 84 1114 21121 1100 --
NM_005930chr142722 135 --189 --
NM_005933chr1152509 2428 2282 1914 970 12569 ----
NM_005935chr4114971 4566 4514 4013 3816 3515 2128 497 455 78 42 --105213 4806 3957 3670 3665 3660 3655 3650 3643 949 --
NM_005937chr1754180 3850 3313 1616 694 --11529 --
NM_005938chrX1378 ------
NM_005941chr843279 2783 590 31 --1451 34144 4093 2852
NM_005944chr331016 499 229 ------
NM_005955chr1105449 5433 4920 4895 3628 2011 1573 1063 833 454 --65146 3675 1880 1874 931 264 --
NM_005962chr1052266 2101 2018 1944 339 12210 12172 12107
NM_005962chr1052266 2101 2018 1944 339 12210 12172 12107
NM_005963chr17169 ------
NM_005964chr1711482 ------
NM_005966chr232358 2131 1729 --41901 1692 588 401 12241
NM_005967chr122479 465 ----1723
NM_005968chr192200 74 ------
NM_005977chr133800 284 266 --163 --
NM_005985chr203772 754 286 ------
NM_005986chr138992 631 584 485 351 301 255 94 2517 443 22567 1948 --
NM_005989chr731637 583 488 --11606 --
NM_005990chr552739 2432 2312 761 552 --1360 --
NM_005996chr1241493 1034 522 108 11343 11156 11330
NM_005998chr12204 91 ------
NM_005999chr121488 296 --41109 1037 979 238 11116
NM_006007chr974144 3985 3816 1185 875 756 32 33277 3173 163 64527 3800 3639 3634 3629 1352 12842
NM_006010chr3172 ------
NM_006011chr1524328 1340 21516 115 ----
NM_006015chr1----31108 1103 1098 --
NM_006016chr682219 2167 2013 1932 1614 1517 703 495 11592 21724 1411 --
NM_006036chr262567 2441 2433 1976 1948 1572 1344 1144 --
NM_006037chr2124788 4757 4442 3716 3566 3494 3472 1717 1536 1524 1302 704 --84736 4430 4087 4082 4077 4072 1706 894 --
NM_006047chr2062614 2581 2390 724 579 430 32215 1024 436 33518 621 307 --
NM_006060chr753753 3230 3184 2712 174 11730 43208 3203 145 138 13158
NM_006063chr2140 ------
NM_006067chr163907 831 745 ------
NM_006079chr63797 276 204 --2694 194 --
NM_006080chr722879 451 --22218 743 12674
NM_006094chr882409 2000 1737 956 473 172 57 43 12443 5865 858 853 848 843 --
NM_006095chr4134496 4456 4367 4240 4005 3567 3417 3289 3129 3081 1007 898 730 3751 682 220 13911 21330 1256
NM_006100chr32553 48 ------
NM_006106chr1152910 780 689 396 314 12974 73444 3364 736 727 715 705 148 1243
NM_006108chr1152213 2133 1794 110 66 --32004 1617 568 2955 939
NM_006113chr142135 1990 1948 1754 21780 1602 1369 --
NM_006133chr1112374 ------
NM_006134chr2131635 1568 1361 11349 21338 111 133
NM_006135chr121339 174 --31478 1375 1307 199
NM_006136chr7----1178 --
NM_006139chr212773 --12566 --
NM_006141chr1632369 1985 240 1201 32491 883 839 12207
NM_006143chr122133 115 ------
NM_006145chr192877 835 --2786 348 --
NM_006152chr12--1240 ----
NM_006153chr32250 236 ------
NM_006154chr1562753 2327 1803 1040 524 316 ----22313 658
NM_006155chr272038 1776 1538 741 500 227 173 11810 1545 --
NM_006157chr111345 --3392 99 90 --
NM_006158chr831448 1405 194 --1444 --
NM_006159chr121602 1114 ----
NM_006161chr53658 610 242 ------
NM_006162chr1821140 665 1454 11790 --
NM_006166chr1262657 1994 973 502 346 247 12383 1230 --
NM_006178chr1731569 1409 1381 ------
NM_006180chr942145 2136 1901 1698 1380 21936 1584 11820
NM_006183chr121566 ------
NM_006186chr21307 --21116 976 --
NM_006190chr21382 --1432 --
NM_006191chr1211014 --1762 --
NM_006192chr202387 75 1887 ----
NM_006194chr1451054 937 841 535 404 ------
NM_006195chr941275 986 964 81 --11442 --
NM_006197chr812228 2669 428 ----
NM_006201chrX----1481 --
NM_006202chr1951578 1497 1479 630 589 --11538 --
NM_006203chr5115474 5419 4971 4094 967 867 799 584 559 354 115 11323 44356 3500 1137 897 25426 4757
NM_006206chr422596 2422 --22915 2258 1547
NM_006207chr81306 ------
NM_006209chr83358 339 61 ------
NM_006211chr8------1237
NM_006212chr175396 5049 4708 4669 3691 1437 438 --33561 1622 1242 15131
NM_006216chr23675 668 96 144 1529 --
NM_006223chrX1430 --139 --
NM_006224chr1752511 539 395 360 28 --1427 --
NM_006226chr221343 924 11197 ----
NM_006237chr1342269 1960 1908 173 11665 ----
NM_006238chr63401 360 207 ----12016
NM_006241chr341949 1889 923 253 133 42409 700 690 672 --
NM_006243chr131089 1028 41 ----1975
NM_006246chr1431062 509 112 11180 ----
NM_006251chr5132979 2832 2769 2707 2415 2405 2106 1343 1278 1270 1017 503 27 --32610 414 194 1971
NM_006252chr1117399 5608 5260 2907 2721 2262 1012 821 805 739 354 11383 57382 2350 1319 1242 1229 16070
NM_006255chr1431138 1113 791 ------
NM_006256chr172482 2301 2101 1037 895 139 70 --2681 104 12173
NM_006259chr42833 221 ----1280
NM_006264chr4--1537 ----
NM_006265chr821194 101 --11480 11466
NM_006268chr111745 --1862 --
NM_006273chr172434 330 ------
NM_006275chr2062507 2495 1856 637 358 250 1484 3924 734 349 --
NM_006277chr22678 246 ------
NM_006279chr11330 ------
NM_006281chr821150 94 1810 1423 --
NM_006281chr821150 94 1810 1423 --
NM_006282chr20104749 4580 4529 3417 3204 1905 1817 1055 965 728 176 23028 1606 14486
NM_006283chr8104133 4123 3792 1924 1917 1730 1202 384 300 152 1908 33043 1957 735 --
NM_006290chr641917 1800 1540 1366 ------
NM_006292chr112229 196 ------
NM_006306chrX83989 3981 3628 1783 1667 1658 1572 1550 --14039 11816
NM_006307chrX1247 --1326 --
NM_006309chr32104 63 ------
NM_006310chr1741291 1202 1085 384 ------
NM_006313chr1241662 1537 1213 270 --1360 --
NM_006315chr4114504 4265 3965 3895 3873 2812 2737 1205 1007 934 130 24332 1623 1872 12878
NM_006317chr51241 ------
NM_006320chr41190 1370 ----
NM_006321chr362179 1640 1377 1368 892 835 12075 1179 --
NM_006323chr41641 197 ----
NM_006324chr16155 ------
NM_006325chr122844 614 1296 1855 --
NM_006328chr112633 181 ------
NM_006330chr851163 671 346 114 96 --11103 --
NM_006352chr1122041 1952 1897 1625 1548 1492 1480 833 826 623 301 129 --31580 363 356 --
NM_006359chrX2438 367 11639 22321 452 --
NM_006360chr11123 ------
NM_006363chr201236 --1600 --
NM_006364chr145967 915 843 523 111 11259 4899 810 429 205 --
NM_006366chr621253 985 ----11241
NM_006371chr373520 1733 1563 919 749 404 379 14317 25287 662 --
NM_006374chr2141 --2532 47 --
NM_006377chr911231 1969 ----
NM_006378chr9162 --1492 --
NM_006380chr1783992 3812 3665 3378 3240 3056 1257 291 1697 33615 1347 269 --
NM_006386chr2272467 1681 699 508 425 357 226 --32293 1505 376 --
NM_006389chr1131360 1234 1209 ------
NM_006390chr1231682 633 322 --11294 11777
NM_006393chr1074488 4399 4160 3829 3563 2886 293 --32874 1249 427 14545
NM_006401chr92405 63 ------
NM_006403chr651131 285 262 91 72 --1378 --
NM_006413chr101336 --2316 306 --
NM_006415chr931280 1210 843 11033 31285 1197 316 --
NM_006416chr61698 ------
NM_006420chr2072919 2833 2786 657 554 486 329 22865 2552 22823 2580 23048 563
NM_006421chr82484 184 --121 --
NM_006427chr141130 ------
NM_006434chr1053245 3006 2826 2661 2499 --12094 --
NM_006451chr521052 737 --1142 1287
NM_006457chr474033 3354 3330 2530 980 835 819 --44050 2513 1627 1617 --
NM_006459chr1031632 1476 724 1617 11593 --
NM_006460chr1721596 1278 --1282 --
NM_006464chr284545 4485 3151 3078 986 979 113 80 11719 14671 --
NM_006466chr20131 1744 ----
NM_006472chr151297 1202 368 223 46 --1824 --
NM_006482chr1273416 3055 1280 737 705 218 94 --22824 161 13097
NM_006489chr142727 221 --21646 207 --
NM_006496chr171711 1689 1461 1402 1251 509 149 --21418 62 --
NM_006504chr1052963 2479 1816 755 49 11888 12736 1119
NM_006517chrX31553 407 75 --12024 --
NM_006519chr6297 34 ----1331
NM_006520chrX61580 1521 1440 1300 1068 301 ------
NM_006526chr2082215 1965 1650 879 556 317 265 193 --22065 1637 --
NM_006527chr43761 188 139 ------
NM_006529chr431249 386 239 ----21658 1325
NM_006530chr122432 346 ------
NM_006532chr1962031 1951 1806 1768 834 381 --21757 1739 --
NM_006534chr2093412 2542 2379 1248 1136 1023 968 793 309 11306 23108 2728 --
NM_006536chr14755 635 286 117 ------
NM_006537chr154608 509 210 125 --1169 --
NM_006538chr2114096 3172 2730 1601 1156 742 720 380 277 236 206 --23209 42 --
NM_006540chr851386 1294 1212 399 84 --11180 --
NM_006544chr14135712 5082 4467 3999 3987 2362 2307 1620 1027 759 504 375 118 1427 43710 1887 1835 202 35809 5507 4656
NM_006546chr1766584 6036 5181 4785 1726 537 --46659 5563 1719 1678 12405
NM_006547chr752050 1730 1701 1409 281 --11506 --
NM_006548chr341636 1361 1155 1147 ------
NM_006549chr122147 135 --11048 --
NM_006554chr2----1225 --
NM_006557chr941393 536 433 302 11560 ----
NM_006558chr82449 142 ----1195
NM_006559chr12908 259 --11143 --
NM_006560chr114466 362 197 55 ------
NM_006561chr10145867 4898 4480 3882 3792 2465 1571 1499 1302 1176 968 912 837 612 21281 1234 76170 5908 5465 3915 3800 1888 680 --
NM_006565chr1621165 452 --2432 426 --
NM_006571chr82117 32 ----1245
NM_006572chr1773141 2929 2736 467 199 58 35 11037 41021 967 569 63 --
NM_006574chr31291 1100 ----
NM_006575chr1441142 450 214 94 1398 1573 11154
NM_006577chr231149 857 23 1408 21242 313 --
NM_006587chr461433 1332 1132 251 146 26 --1405 11600
NM_006593chr23636 220 178 ------
NM_006595chr1172068 1998 1806 1305 344 288 209 11367 31951 1335 496 --
NM_006599chr16168148 8089 8018 7608 6794 6115 5633 3125 3063 2379 2284 2085 2072 1969 1727 1707 12161 48225 1686 1656 374 25626 1997
NM_006601chr121143 ------
NM_006602chr202576 157 --1859 --
NM_006603chrX51766 1289 779 717 522 --1161 --
NM_006606chr2092793 2704 2514 2399 2313 1968 730 624 24 12134 11050 --
NM_006609chr243001 2588 2032 152 1615 52955 2242 897 892 561 --
NM_006614chr373467 3080 2698 2534 684 570 411 33398 3053 2239 21089 201 --
NM_006618chr13996 261 200 --31478 1446 491 --
NM_006620chr674355 3757 3643 3391 3374 724 508 1257 21534 666 14087
NM_006621chr121979 669 ------
NM_006624chr1082091 1932 1529 839 244 138 102 91 --2455 60 1161
NM_006625chr13461 424 398 --1744 --
NM_006625chr13461 424 398 --1744 --
NM_006625chr13461 424 398 --1744 --
NM_006626chr9102366 2327 2080 1930 1877 1665 1001 697 115 102 11949 22348 2146 --
NM_006628chr15114007 3603 1628 1213 1182 1005 850 737 720 709 410 1941 64588 4583 4578 4573 4565 655 14596
NM_006633chr52731 57 --170 1164
NM_006640chr1721874 1638 ----11845
NM_006644chr132119 46 --1486 --
NM_006646chr1362244 2036 1982 687 660 104 --43094 2919 1895 448 --
NM_006651chr41992 --1578 --
NM_006654chr12124617 4406 4306 4195 4155 3580 3235 3151 2956 1105 975 603 --21852 883 --
NM_006656chr1131202 1050 152 ------
NM_006658chr7194 --1360 --
NM_006660chr15----146 --
NM_006667chrX3842 37 30 ------
NM_006681chr41162 --165 --
NM_006691chr113869 837 289 --11030 --
NM_006699chr142532 824 762 393 --2858 39 12424
NM_006700chr122626 139 ------
NM_006706chr52790 533 ------
NM_006710chr251018 924 876 210 164 ------
NM_006711chr162795 56 --1708 --
NM_006713chr51707 --172 --
NM_006716chr731330 264 101 ------
NM_006717chr962756 2734 2641 2265 844 180 --22715 141 --
NM_006721chr101321 1763 ----
NM_006722chr362482 2310 1113 518 285 161 --1838 --
NM_006724chr61380 --1416 --
NM_006726chr43154 144 96 1891 21230 809 --
NM_006727chr52526 135 ------
NM_006731chr955397 4946 4563 4374 1918 25598 1781 --15494
NM_006732chr1942073 2066 1911 186 ------
NM_006734chr62496 260 1117 255 49 1135
NM_006735chr73345 309 60 1366 ----
NM_006738chr1594567 3199 1638 1606 1449 1414 1315 1283 618 13220 23429 1289 --
NM_006745chr421120 1020 ------
NM_006746chrX41318 1183 1107 976 11249 196 11230
NM_006750chr1665550 5334 2116 1512 1319 87 --55420 5325 5307 2717 743 1775
NM_006751chr241077 797 744 714 187 ----
NM_006754chr741271 424 131 79 --21140 1124 --
NM_006756chr871407 1296 1010 993 576 126 49 --41538 1431 1332 1105 11112
NM_006761chr17----2765 692 --
NM_006763chr121731 747 1753 --12138
NM_006766chr862532 2513 2500 2362 1725 699 --22066 184 --
NM_006769chr15740 687 564 494 45 ------
NM_006772chr621295 1250 --11634 --
NM_006775chr673035 2905 2669 2136 1104 863 89 ------
NM_006777chrX72742 2467 2225 2111 1886 1818 424 22527 1070 2137 29 --
NM_006788chr1852126 1688 1616 1341 328 21360 263 21784 1525 --
NM_006791chr152541 116 --2423 50 --
NM_006800chrX2599 508 ------
NM_006802chr11387 199 ----
NM_006803chr831386 352 303 --21584 1440 11550
NM_006805chr571218 1177 1133 591 401 227 112 ------
NM_006806chr211307 ------
NM_006807chr1731352 1316 245 ------
NM_006809chr201159 --2844 770 --
NM_006810chr3----154 --
NM_006811chr20178 --1238 --
NM_006813chr64707 273 248 164 ----1230
NM_006814chr2072543 2193 2001 1764 1716 793 712 --12630 --
NM_006815chr1241310 997 539 328 11195 4953 552 428 305 --
NM_006820chr154277 3947 2770 2746 108 --33288 100 94 12828
NM_006822chr171609 ----1538
NM_006823chr841324 496 240 71 --1974 --
NM_006826chr21329 ------
NM_006827chr14103382 3319 3072 2653 1280 1158 1110 842 400 221 --12975 --
NM_006832chr141713 165 ----
NM_006836chr12274 43 ------
NM_006838chr1221817 46 --21268 280 11848
NM_006842chr111123 ------
NM_006846chr51341 1109 ----
NM_006851chr1232796 921 348 12914 ----
NM_006852chr1742389 1972 1162 777 ----12745
NM_006854chr761583 1339 1287 1256 474 301 11305 1112 --
NM_006856chr1231142 799 731 --1398 --
NM_006857chr2268 61 ------
NM_006868chr1863043 2844 2414 2269 1986 1951 1417 --1265
NM_006870chr202824 343 1746 --1251
NM_006873chr253165 3106 1299 633 191 11291 42694 328 240 175 --
NM_006874chr41959 --21063 825 --
NM_006875chrX3779 751 81 ----1270
NM_006884chr331816 1632 256 --51736 1730 1724 1607 1588 --
NM_006885chr16114169 3801 3314 2626 1618 1502 1495 1419 948 930 525 --83852 2902 2896 2890 2860 2686 601 582 34063 2970 607
NM_006888chr1443240 2828 1341 417 1277 12709 13359
NM_006892chr2031320 1245 1215 ----11384
NM_006892chr2031320 1245 1215 ----11384
NM_006896chr71190 ------
NM_006897chr121423 1616 ----
NM_006908chr731491 1046 55 --1190 21468 131
NM_006910chr161352 ----157
NM_006912chr12276 227 ----11599
NM_006914chr921506 190 11183 ----
NM_006915chrX42215 1879 525 76 1425 42504 2499 2063 245 --
NM_006916chr241017 931 443 345 --1370 --
NM_006918chr1195829 5747 5404 4780 3680 1746 1425 1174 897 13839 15773 15148
NM_006920chr241925 692 679 453 21623 1561 21778 803 1420
NM_006922chr281862 1793 1712 1020 625 507 435 373 22398 1582 52054 2047 2041 1856 528 --
NM_006924chr17114255 4148 3597 2826 2790 1788 1672 1373 674 629 22 --64234 3966 1394 710 690 94 --
NM_006925chr142444 421 1519 ----
NM_006931chr1252155 1538 1492 612 160 1557 ----
NM_006937chr171477 ------
NM_006938chr184880 749 63 47 --2917 908 --
NM_006939chr141326 --21081 759 --
NM_006940chr1231698 408 333 11279 41295 445 440 401 --
NM_006948chr2182495 2487 2319 1654 1604 890 882 152 ----1828
NM_006951chr104782 773 766 103 ------
NM_006959chr191345 --1358 --
NM_006963chr1031277 479 308 --1466 1126
NM_006965chr1821125 906 1920 ----
NM_006979chr6----1543 --
NM_006981chr942703 2434 2254 593 ----11073
NM_006988chr2111225 ----1276
NM_006996chr161854 1832 1263 680 663 537 --21571 1561 --
NM_006997chr102410 402 ------
NM_006999chr512012 21290 337 1447 --
NM_007005chr921261 49 --51204 543 537 296 66 --
NM_007006chr16103272 3212 3110 2960 2464 2273 1046 431 229 109 --13116 --
NM_007007chr12154704 4492 4111 3825 3704 3331 3303 3103 1638 723 624 342 331 249 78 --34622 4090 1719 --
NM_007008chr23820 772 295 ------
NM_007010chr1741258 686 652 639 --21365 1231 11581
NM_007011chr15136038 5964 5824 5341 5174 4234 2483 2372 2351 1148 589 388 186 --46585 6580 6575 335 16885
NM_007013chr85895 794 786 727 357 ------
NM_007017chr52895 356 --1648 --
NM_007019chr202176 67 --1117 --
NM_007023chr22889 268 1947 ----
NM_007024chr31462 ------
NM_007033chr1----21701 677 --
NM_007034chr12269 247 --1746 --
NM_007036chr51872 2230 203 ----
NM_007038chr2196094 6041 5444 4675 2118 1851 1089 1053 1045 24304 4070 44655 1530 1360 1058 --
NM_007039chr1432083 1913 1891 ----2863 513
NM_007040chr191775 --21075 1060 --
NM_007043chr1232017 572 39 ------
NM_007045chr61534 1561 ----
NM_007050chr2066073 6024 5725 705 698 60 26847 1306 22430 310 --
NM_007052chrX2383 34 --1594 --
NM_007055chr104835 498 235 73 ----1526
NM_007064chr341494 1400 1374 368 --11366 --
NM_007078chr1053039 3021 2845 1224 850 --32961 2956 796 --
NM_007084chr1331332 1103 286 --3397 391 367 --
NM_007096chr91111 ------
NM_007106chr1342646 1997 1906 718 22575 2184 3974 304 213 --
NM_007107chr342398 2133 1880 148 11914 ----
NM_007111chr135859 630 312 285 241 1255 2657 303 --
NM_007114chr363242 2572 990 881 757 177 ------
NM_007123chr141104 415 260 122 ------
NM_007124chr62683 551 --1183 --
NM_007125chrY41039 472 222 68 11429 ----
NM_007129chr131766 1781 ----
NM_007137chrX104673 4405 4387 3961 3766 3511 3493 2204 1477 1172 15337 24595 3992 --
NM_007139chr731121 475 433 --11166 --
NM_007145chr1931231 929 534 ------
NM_007146chr1742766 2386 1958 1128 21922 1826 --1760
NM_007150chrX32086 133 69 --12121 --
NM_007159chr331680 1201 217 ------
NM_007166chr1131597 1498 1473 --11297 21541 1371
NM_007172chr2263210 2894 2558 2480 313 124 12587 22406 2061 12463
NM_007173chr1151909 1875 308 235 73 1520 31799 1789 444 --
NM_007174chr1252402 1892 1882 411 276 1248 ----
NM_007175chr893284 2741 2662 2580 2319 722 613 601 591 --13220 --
NM_007191chr121615 2439 51 ----
NM_007192chr1431189 1101 106 --11182 --
NM_007195chr1883084 3011 2820 2684 1334 1062 924 811 --22804 1175 --
NM_007197chr1221048 747 1346 3298 197 192 1665
NM_007200chr1594567 3199 1638 1606 1449 1414 1315 1283 618 13220 23429 1289 --
NM_007203chr953818 3785 1535 1396 991 --22611 1153 12911
NM_007207chr1194 ------
NM_007212chr161944 1774 1686 1555 864 780 --11709 --
NM_007214chr64931 891 477 365 1257 151 --
NM_007216chr1131167 262 134 180 ----
NM_007217chr32308 158 ------
NM_007218chr8136 1663 ----
NM_007222chr81706 11775 11606 --
NM_007225chr1711010 ------
NM_007231chrX52250 2137 1787 920 269 1577 ----
NM_007235chr122425 69 ------
NM_007241chr171240 --173 --
NM_007246chr41324 ------
NM_007249chr13139390 9132 8760 8110 7980 7942 7199 3415 2182 1616 1541 1157 648 19466 78175 8012 7773 1680 689 673 668 1323
NM_007256chr1141665 1616 201 164 11245 21481 1188 --
NM_007259chr12524 459 ------
NM_007270chr721476 1212 ----1297
NM_007275chr311180 ------
NM_007276chr751017 944 377 161 122 --1439 --
NM_007279chr191619 1606 2635 416 --
NM_007283chr3--13009 --1161
NM_007285chr162454 203 --1149 --
NM_007294chr1721333 1157 1922 11198 --
NM_007295chr1721333 1157 1922 11198 --
NM_007296chr1721333 1157 1922 11198 --
NM_007297chr1721333 1157 1922 11198 --
NM_007298chr1721333 1157 1922 11198 --
NM_007299chr1721333 1157 1922 11198 --
NM_007300chr1721333 1157 1922 11198 --
NM_007302chr1721333 1157 1922 11198 --
NM_007303chr1721333 1157 1922 11198 --
NM_007304chr1721333 1157 1922 11198 --
NM_007305chr1721333 1157 1922 11198 --
NM_007313chr9----11907 11754
NM_007324chr1------197
NM_007331chr472558 2488 2272 1949 854 676 468 --1729 --
NM_007345chr1852157 2073 1787 206 49 --21870 1462 11526
NM_007347chr1542655 2639 2536 2196 --33105 1988 486 1302
NM_007350chr1284189 3883 3699 3502 3242 3100 1014 868 14205 73920 3494 1179 1139 1094 584 578 --
NM_007351chr42454 65 1244 --1371
NM_007353chr753066 2501 2479 1937 283 ----11023
NM_007358chr141741 1261 393 328 --21252 1247 1399
NM_007361chr142154 135 ------
NM_007372chr171847 --2801 777 --
NM_007373chr1071830 1462 1335 610 526 251 202 --41813 677 512 356 --
NM_007375chr172752 2448 2285 2221 2165 976 114 --31026 474 469 1196
NM_012064chr1211084 --1157 --
NM_012072chr20104540 4379 4208 3492 2811 1788 1621 1167 773 407 --23632 1182 --
NM_012073chr541510 1004 553 198 --11574 11255
NM_012081chr533301 1497 156 3651 307 224 3918 887 879 --
NM_012084chrX2479 228 --1351 --
NM_012089chr141127 1107 299 240 ------
NM_012090chr181199 1167 990 975 815 517 452 148 ----1834
NM_012092chr211546 --1130 --
NM_012096chr3113765 3682 3518 3352 3087 2812 2652 1139 270 122 114 --2781 401 12280
NM_012097chr231895 179 30 --32136 712 447 --
NM_012102chr182633 2406 2333 2242 1936 1903 1830 883 12513 ----
NM_012104chr1133452 2679 478 22992 472 ----
NM_012104chr1133452 2679 478 22992 472 ----
NM_012110chr42270 119 ------
NM_012115chr64581 569 388 199 1132 1624 --
NM_012120chr622533 250 1787 52639 2367 1997 1928 173 12943
NM_012124chr113346 183 163 --290 85 --
NM_012129chr762469 1949 1643 831 540 95 12198 22308 200 11920
NM_012130chr212230 108 ------
NM_012141chr1383258 3105 2678 1578 1093 1085 421 186 1652 1719 1500
NM_012153chr1142586 1728 843 370 12515 1779 1181
NM_012157chr3----1624 --
NM_012158chr1381824 1753 1143 716 683 451 93 64 --11504 --
NM_012161chr41928 1934 11077 --
NM_012164chr9137247 7028 6975 6437 6385 6067 5700 2972 2146 1572 1370 901 144 17056 35667 4699 662 --
NM_012175chr113886 276 175 --1794 --
NM_012180chr43221 187 142 1569 1208 --
NM_012188chr521078 1053 ------
NM_012193chr1155434 5027 3914 1024 775 --65458 4467 4261 3907 1885 182 --
NM_012197chr951457 1357 1331 1276 520 --21606 49 --
NM_012198chr21614 --146 --
NM_012199chr184516 4285 2916 1698 1371 917 817 489 --11600 --
NM_012207chr1041100 930 180 78 ------
NM_012213chr162678 546 ------
NM_012214chr2126308 5872 5828 5705 4995 4642 2569 2539 2411 2054 483 171 34451 2255 41 15274 15413
NM_012215chr1051763 1345 715 624 545 --11709 11323
NM_012216chrX1103 ------
NM_012218chr1931113 359 259 2349 215 ----
NM_012223chr221228 989 --2431 62 --
NM_012233chr221193 790 --1940 --
NM_012234chr3103561 3524 3346 3194 2893 2459 2320 1203 1111 893 --3340 335 329 13413
NM_012238chr1031678 1592 690 --1320 --
NM_012242chr102306 159 ------
NM_012245chr143465 399 307 ------
NM_012247chr106981 968 945 875 707 640 --2898 30 --
NM_012248chr162674 212 ------
NM_012249chr273499 3403 3381 3056 2554 2511 390 12879 --22976 2728
NM_012250chr111421 1455 21240 527 1858
NM_012257chr731040 799 165 --1920 --
NM_012259chr631397 1368 1138 --31251 1181 187 --
NM_012262chr195258 4519 4367 4122 3792 1023 770 462 59 21652 514 14685 --
NM_012264chr2212035 ------
NM_012264chr2212035 ------
NM_012266chr931129 1119 908 1360 ----
NM_012272chr12----2447 440 --
NM_012281chr721823 751 --22365 788 --
NM_012286chrX6646 529 516 489 127 28 --153 --
NM_012287chr374004 3897 3355 1228 1046 560 313 24123 3661 23633 927 13517
NM_012289chr19157 --1468 --
NM_012290chr231215 80 38 21299 1039 21517 297 --
NM_012297chr432399 2344 937 11757 42408 1792 867 336 --
NM_012300chr542444 2052 1778 1760 --22044 952 12226
NM_012302chr11363 1220 ----
NM_012307chr182821 693 ----1761
NM_012308chr1132191 2041 816 --22051 1755 --
NM_012309chr1194649 4223 4149 3308 3183 3064 1806 689 327 11919 54548 3747 3229 1594 1129 --
NM_012316chr165437 5276 4290 886 574 211 --13672 14076
NM_012322chr74454 319 285 148 --132 --
NM_012323chr2211585 ------
NM_012325chr2061550 1372 1297 1268 1193 464 --11569 178
NM_012327chr1831568 1052 189 ----1461
NM_012328chr731287 371 237 --41467 1278 1191 912 --
NM_012329chr1761718 1490 1422 1243 563 495 ------
NM_012330chr1041388 538 487 117 1470 21783 432 1591
NM_012331chr82548 525 ------
NM_012333chr141495 1323 445 40 11178 11224 --
NM_012339chr102571 554 1654 ----
NM_012342chr104457 443 362 196 ------
NM_012343chr521051 230 11116 ----
NM_012347chr662467 2316 1944 492 452 31 --11131 22933 2392
NM_012382chr584485 4345 4213 3937 3464 1639 1633 420 11286 44364 1543 1387 357 --
NM_012388chr1553007 2955 2936 2447 2024 1432 32045 2033 211 --
NM_012394chr1------1102
NM_012395chr793215 2893 2464 985 786 590 479 288 251 23350 2904 32608 1246 301 12178
NM_012397chr1861714 1687 1677 1583 1164 285 ------
NM_012399chr2251777 1718 1496 1430 767 ------
NM_012411chr11135 ------
NM_012414chr13715 709 118 1296 ----
NM_012416chr92799 285 ------
NM_012417chr172491 42 ------
NM_012419chr62583 219 ------
NM_012420chr1031879 1850 61 --31609 1571 514 --
NM_012426chr162362 316 --145 --
NM_012428chr153974 733 383 1254 1803 --
NM_012431chr753274 3047 1321 1111 993 33256 2983 2878 32566 760 620 --
NM_012434chr651553 1353 1198 1177 327 --11163 --
NM_012446chr53516 452 154 ------
NM_012448chr1721553 970 --11015 --
NM_012449chr7--173 126 --
NM_012454chr62457 111 1379 1388 --
NM_012463chr1281827 1436 1148 1138 672 664 298 169 ------
NM_012464chr452561 2534 2189 1076 906 --22420 271 --
NM_012475chr12254 86 ------
NM_012479chr742598 2387 1840 161 1653 22461 704 --
NM_012482chr1----2616 46 1147
NM_013227chr15198 ------
NM_013229chr1272833 2792 2684 740 608 481 465 --52629 2114 1902 583 435 --
NM_013230chrY----21693 1531 11397
NM_013231chr1494262 3937 3607 2782 1422 1192 343 222 211 34355 4236 1083 23993 3681 --
NM_013233chr221082 1044 1988 ----
NM_013238chr1321911 1392 --1225 1258
NM_013243chr1531057 582 211 --11473 --
NM_013245chr16----2458 284 --
NM_013253chr112296 155 ------
NM_013255chr798387 8187 2215 2103 1814 1721 1266 1180 974 16291 78870 7819 5647 5549 2170 2056 1901 25721 1537
NM_013257chr832297 1983 914 1397 12236 2409 284
NM_013261chr462963 2780 2749 2735 791 262 11499 --23268 1145
NM_013262chr661327 1307 928 476 432 399 --21093 1010 --
NM_013269chr1224384 1556 11381 ----
NM_013279chr1142071 1616 1450 345 ------
NM_013282chr1941279 1026 813 444 11114 31081 73 31 --
NM_013283chr5184 --2861 213 --
NM_013286chr343798 1427 1246 678 11255 ----
NM_013292chr16186 ------
NM_013293chr71140 --2582 276 --
NM_013302chr16124327 3302 1824 1730 1050 740 656 629 591 458 267 164 13865 23836 284 13646
NM_013309chr1542664 2180 2057 1719 ------
NM_013316chr7----2820 200 --
NM_013322chr721434 474 11197 ----
NM_013323chr172907 447 --1426 --
NM_013336chr311329 --2283 171 --
NM_013341chr262584 2532 2075 1184 209 138 --2853 743 --
NM_013351chr171718 ------
NM_013354chr871461 1447 1133 975 918 477 427 ------
NM_013368chr192120 85 ------
NM_013372chr153589 335 234 13388 11215 12642
NM_013374chr352731 1237 554 429 189 22716 2697 12739 1504
NM_013377chr123160 127 101 ------
NM_013380chr192584 310 ----1169
NM_013381chr1242010 932 175 61 --12281 --
NM_013386chr121823 305 ----11606
NM_013396chr2181550 1426 1209 1077 499 290 262 77 ------
NM_013410chr121313 1280 ------
NM_013411chr121962 1808 ------
NM_013433chr1942039 1846 726 576 21977 1592 ----
NM_013436chr22300 98 --138 --
NM_013437chr881301 1035 1016 479 390 344 243 60 21276 939 ----
NM_013438chr951686 670 426 303 278 --1465 --
NM_013444chrX3748 244 192 ------
NM_013446chr751428 1414 1068 1061 230 --21284 1048 --
NM_013448chr142567 247 1177 1187 --
NM_013449chr1232611 2512 1157 1284 22370 1851 --
NM_013450chr211159 ----1935
NM_013943chr192697 2585 2516 2014 1194 792 621 452 97 1780 31278 1273 1016 1590
NM_013989chr1455124 4769 3692 3433 1717 21389 780 14760 --
NM_013995chrX72604 2419 2343 1950 1943 1734 424 --2470 416 --
NM_013996chr72442 369 ------
NM_013996chr72442 369 ------
NM_013997chr72442 369 ------
NM_013997chr72442 369 ------
NM_013998chr72442 369 ------
NM_013998chr72442 369 ------
NM_014000chr1021746 542 11925 11956 --
NM_014007chr91423 --1389 --
NM_014011chr242468 957 825 229 1298 ----
NM_014016chr321474 378 ------
NM_014021chr1103203 2963 2799 2707 2388 2376 761 492 340 119 13291 33300 2452 2217 --
NM_014023chr1052453 462 401 193 88 12658 12877 --
NM_014033chr1262297 2158 1981 1864 605 119 11759 3447 442 162 --
NM_014034chr641368 595 217 105 ------
NM_014038chr7----3164 159 153 --
NM_014043chr34421 257 162 92 --21617 25 21636 1460
NM_014048chr1695302 5294 5238 5168 5115 4326 3391 1554 603 --24818 1974 --
NM_014051chr6168 ------
NM_014057chr931505 1308 496 ------
NM_014059chr131363 ------
NM_014071chr201438 ------
NM_014089chr1392141 2021 1954 1895 1805 1689 836 397 347 12189 1309 --
NM_014106chr15102898 2716 2275 2115 1955 1106 738 503 457 120 --12814 --
NM_014109chr841238 433 423 56 1209 31181 1023 327 --
NM_014110chr121080 826 11149 ----
NM_014112chr8124801 4035 3679 2200 1990 1686 1383 956 843 736 679 410 --45398 2068 2057 715 1140
NM_014117chr1631822 1673 454 12175 32004 1694 394 --
NM_014141chr765101 4558 4257 4001 899 296 11625 53829 3824 3814 987 438 --
NM_014142chr10128 ------
NM_014153chr16--1511 1627 --
NM_014154chr33211 175 108 ----21451 392
NM_014155chr11117271 7170 7158 6792 6539 4696 2261 2078 1428 716 278 --77544 7040 6517 5328 4732 2027 298 17369
NM_014157chr1674036 3310 3126 1321 1311 1063 854 --23397 1030 13870
NM_014160chr331416 1069 904 ------
NM_014170chr31327 ------
NM_014178chr143587 237 50 --2566 128 --
NM_014181chr212191 12705 5482 476 470 464 457 --
NM_014189chr411412 --11319 --
NM_014190chr411764 --21671 1147 --
NM_014191chr122981 402 ------
NM_014211chr511130 --1465 --
NM_014212chr121812 ------
NM_014213chr22194 45 ------
NM_014217chr141615 1372 422 251 11771 ----
NM_014223chr12674 44 --1189 --
NM_014225chr191363 ------
NM_014231chr123635 569 66 ------
NM_014233chr1742182 2066 863 69 --22169 1448 --
NM_014240chr394177 3570 3431 2647 1350 1114 974 780 588 ------
NM_014243chr432126 1779 1414 --3676 322 176 --
NM_014245chr35873 716 444 359 164 ------
NM_014246chr2232228 2195 2150 1539 11754 --
NM_014248chr221121 ----137
NM_014249chr15------1528
NM_014250chr2242119 1384 521 178 --22053 1900 --
NM_014253chrX42268 889 671 168 22415 1616 12240 --
NM_014263chr1011380 ----11215
NM_014264chr45647 491 462 446 219 --2606 47 --
NM_014267chr113755 188 137 --1298 --
NM_014271chrX1221 --1301 --
NM_014278chr42116 108 ------
NM_014279chr9----1730 --
NM_014280chr13291 163 107 1651 1124 --
NM_014283chr151072 1005 556 374 335 1444 21312 37 --
NM_014289chrX11113 ------
NM_014290chr9----1161 --
NM_014294chr821419 482 --1252 1116
NM_014296chr36999 548 521 425 255 217 1313 ----
NM_014305chr131506 --1699 --
NM_014309chr2265328 3785 3563 2059 1707 1696 14477 62181 2175 2169 2080 782 207 --
NM_014310chr2221397 690 11963 ----
NM_014313chr161475 1460 1018 237 77 45 ------
NM_014315chr141152 ------
NM_014317chr10273 58 ------
NM_014319chr1271508 766 389 296 242 87 64 21546 489 11383 --
NM_014325chr1262152 1932 1898 1806 555 440 1860 1791 1458
NM_014329chr16----1306 --
NM_014331chr4127797 7672 7635 5657 5555 5363 4969 2924 2488 1864 1321 370 --26288 2006 --
NM_014333chr1172748 2572 1771 701 625 212 143 11854 2469 309 --
NM_014335chr1571233 1218 483 334 314 120 85 1263 11072 --
NM_014342chr1141464 1444 944 368 --2221 149 1918
NM_014344chr11----1785 --
NM_014345chr61798 182 --21000 248
NM_014350chr521133 1125 ----11021
NM_014352chr1131411 1370 1227 ------
NM_014361chr113415 189 21 1351 127 --
NM_014363chr1321070 499 1295 1853 --
NM_014368chr922074 463 --11806 12096
NM_014372chr12304 59 ------
NM_014376chr522409 2291 12492 ----
NM_014382chr391764 1639 1282 1242 1190 595 548 534 218 --31703 1155 636 --
NM_014393chr851631 920 747 581 438 --21568 205 11602
NM_014395chr441930 1828 1356 612 --21952 300 21972 1389
NM_014397chr9----11174 --
NM_014415chr34363 230 147 63 ------
NM_014417chr192942 929 ------
NM_014423chr5105445 5288 5206 5182 5143 4998 4759 1884 1167 456 --1867 21340 1087
NM_014426chr201719 ------
NM_014432chr611243 --127 --
NM_014445chr341661 772 647 526 ----1354
NM_014447chr471684 1662 1332 1094 662 468 240 11449 11252 --
NM_014452chr631232 918 305 1771 183 --
NM_014454chr61984 --1235 --
NM_014455chr11434 ------
NM_014456chr1041744 343 295 257 --21821 185 --
NM_014458chr121218 307 --1228 --
NM_014470chr121734 ------
NM_014482chr21132 ------
NM_014494chr1632376 1672 128 --3903 765 719 --
NM_014495chr12226 215 ----1536
NM_014497chr2135 ----166
NM_014498chr33354 301 130 ------
NM_014500chrX1231 1242 ----
NM_014502chr111397 --1318 --
NM_014507chr22----1906 --
NM_014515chr124671 381 260 209 1662 ----
NM_014517chr361992 1935 1700 1636 683 310 21928 1535 21714 724 --
NM_014521chr221194 1156 1227 ----
NM_014522chrX1202 ------
NM_014547chr151740 ------
NM_014547chr151740 ------
NM_014552chr231491 1468 1264 ----11025
NM_014554chr1282301 2164 1719 1654 1645 189 169 51 ------
NM_014570chr222999 94 ----2832 108
NM_014572chr131576 --51445 1181 502 276 98 --
NM_014573chr1751446 1287 376 354 341 --31825 1357 346 --
NM_014574chr1441554 1403 193 34 --41415 1314 984 500 --
NM_014575chr32467 148 --144 --
NM_014577chr223820 590 303 --1743 --
NM_014583chr33514 385 120 ------
NM_014584chr1431676 562 120 --31330 1218 1137 --
NM_014585chr231200 415 60 11234 2897 96 --
NM_014587chr1621551 1380 ------
NM_014592chr52597 241 ------
NM_014602chr32288 88 ----1349
NM_014606chr411181 --41427 1414 241 235 --
NM_014607chr251964 851 782 748 339 1771 3571 541 324 1554
NM_014608chr151451 --1382 --
NM_014612chr961436 1093 980 532 413 92 ----11274
NM_014613chr532444 2338 535 --12531 --
NM_014614chr231192 1084 913 ------
NM_014615chr1663583 3424 1359 818 512 412 --42834 2630 916 890 --
NM_014616chr341361 865 831 746 --11367 --
NM_014618chr91142 ------
NM_014620chr121533 ------
NM_014629chr8--1497 ----
NM_014630chr1532672 733 210 --23359 3343 --
NM_014634chr2263555 2795 1023 866 743 691 12275 1679 11029
NM_014635chr261660 1375 1355 639 610 81 ------
NM_014636chr984366 2950 2754 2730 1665 1299 768 452 ----14270
NM_014637chr821432 442 163 2945 170 --
NM_014647chr1642259 2224 2173 413 1241 32238 1442 349 --
NM_014653chr1231691 1559 1406 --11766 --
NM_014660chr721075 278 1204 2270 166 --
NM_014662chr222439 102 --1135 --
NM_014663chr12983 392 --1968 11067
NM_014666chr53972 948 496 --21117 977 --
NM_014667chr362442 1959 917 601 379 161 32038 1868 767 21926 619 --
NM_014669chr161128 --1102 --
NM_014670chr2--31518 1011 376 5578 573 568 563 558 --
NM_014674chr3113935 3760 3343 2715 2693 2576 2499 1296 839 739 337 22867 530 23714 1001 11305
NM_014675chr11495 ------
NM_014676chr171635 1563 1448 1441 1418 1318 427 --1298 --
NM_014677chr831391 1291 1223 ------
NM_014682chr882255 2204 2156 2137 2089 818 559 272 42037 1973 1952 688 --11887
NM_014683chr1742154 630 452 388 11777 --1823
NM_014685chr162551 133 ------
NM_014686chr1962547 2258 1966 1918 1875 559 ------
NM_014689chr22167 142 --1117 --
NM_014699chr161354 ----1320
NM_014701chr15103101 2825 2659 1348 979 721 356 230 129 80 11269 13339 12155
NM_014702chr683429 2856 2818 2416 1286 836 461 262 22122 1110 ----
NM_014705chr791979 1939 1737 1453 1326 758 695 621 261 --41767 1331 583 547 --
NM_014706chr1251143 872 494 352 257 ------
NM_014707chr772231 1971 1811 1799 1514 664 388 --11570 --
NM_014709chr22645 78 --170 --
NM_014710chrX1195 ------
NM_014711chr1631812 1801 277 --32096 2020 805 --
NM_014713chr2----3175 116 44 2345 184
NM_014720chr1041638 1383 1287 467 --5730 152 147 142 133 --
NM_014721chr677153 7027 5523 5075 4713 2500 1883 --46832 2718 1831 719 26658 6331
NM_014723chr20----13216 --
NM_014729chr851532 741 729 705 462 11607 1260 --
NM_014730chr1254340 3754 2113 1664 1561 12124 1768 14231
NM_014730chr1254340 3754 2113 1664 1561 12124 1768 14231
NM_014732chr1675825 5721 5271 5017 2292 2091 2046 13979 23650 2105 --
NM_014733chr551970 1694 774 574 126 21805 42 1684 --
NM_014735chrX82070 1569 1532 1494 863 813 519 254 22054 2012 32021 1627 1501 --
NM_014736chr154663 312 96 81 ------
NM_014739chr644173 3215 1196 1119 11302 92725 2719 2713 2707 2701 2695 2679 134 67 1259
NM_014742chr2031313 326 222 --11616 --
NM_014743chr492679 2509 2442 2410 2172 2102 987 417 293 12571 32713 2359 1079 --
NM_014746chr284416 4276 4216 4070 3749 3281 3145 873 --32854 1110 772 --
NM_014751chr851991 1784 731 408 98 --12108 --
NM_014752chr116631 522 463 288 239 121 --1555 21669 262
NM_014755chr264271 4099 2770 643 559 442 --31080 998 143 --
NM_014757chr532100 2023 1524 --1564 22397 2088
NM_014764chr122944 306 --11104 --
NM_014765chr142650 2503 1921 876 1730 42333 1040 401 251 --
NM_014767chr10----1324 12600
NM_014774chr153149 2603 2261 2066 717 13091 22973 2119 --
NM_014776chr12102911 2537 2522 1926 848 795 414 206 195 146 --11937 --
NM_014779chr33951 782 774 --1935 --
NM_014781chr821151 390 --1212 --
NM_014782chrX2336 46 ------
NM_014783chr1571545 1525 1141 598 403 188 115 ------
NM_014786chr1111163 --21189 1168 --
NM_014787chr1----32180 849 823 --
NM_014791chr91231 ------
NM_014795chr24942 922 897 206 --21186 885 --
NM_014802chr12158 --21137 177 1763
NM_014803chr1052666 2638 2550 1801 975 12237 12005 12455
NM_014804chr173449 173 61 ------
NM_014807chr111643 ------
NM_014810chr153569 3059 2895 2600 985 13658 13018 1254
NM_014811chr93253 196 186 ------
NM_014812chr181916 1411 727 697 642 581 439 241 1423 --21976 1950
NM_014813chr15572 548 392 96 49 ------
NM_014819chr521528 824 12371 41924 1656 860 521 1465
NM_014820chr332057 1277 300 1131 31769 1485 1429 --
NM_014822chr41579 ------
NM_014824chr1131601 1313 794 11674 31811 421 189 --
NM_014826chr154376 4281 4103 3185 1557 13864 54204 2979 1168 814 346 23494 3247
NM_014827chr131564 354 196 --41607 1586 1223 1204 --
NM_014828chr1421684 182 --1915 --
NM_014829chr562370 2344 2116 2088 605 417 12287 32261 2222 513 --
NM_014830chr1273828 3819 2754 2564 2408 1543 98 --32794 2688 1511 13384
NM_014832chr1341737 1408 1373 373 11468 1205 --
NM_014835chr2032240 2011 1614 --1626 12195
NM_014836chr1031995 560 139 1155 41460 497 372 285 1251
NM_014838chr2252697 2492 2255 431 302 --22295 1159 --
NM_014839chr162216 2189 1867 644 422 260 22324 2300 1866 12499
NM_014840chr1262970 2322 2204 1188 232 85 2723 715 23415 3398 --
NM_014841chr631083 951 558 --1999 --
NM_014844chr1454150 4015 1682 1166 1068 --22538 315 --
NM_014847chr11493 --1477 --
NM_014848chr1532589 2380 472 --22709 657 --
NM_014858chr131001 786 778 ------
NM_014859chr1731331 1192 962 --2225 191 --
NM_014860chr291897 1653 851 811 802 671 172 59 24 31752 679 374 1602 1552
NM_014862chr1544227 3872 2988 1478 --12660 --
NM_014864chr184232 3648 3419 3087 1035 994 863 388 --11666 13326
NM_014868chr121610 --4850 69 46 40 --
NM_014871chr121619 1664 1599 --
NM_014872chr952000 1500 851 826 330 ------
NM_014873chr194739 4194 3897 3697 3444 1563 1370 718 686 13994 24006 1653 --
NM_014874chr141880 1818 1619 755 ------
NM_014876chr2222232 738 --52252 2209 2184 574 181 --
NM_014877chr17147222 6885 6270 6239 6072 5712 5663 4810 2997 1949 649 183 137 101 16394 37731 5905 455 11034
NM_014883chr462466 1986 1760 1638 505 209 12314 1876 --
NM_014885chr4139 ------
NM_014890chr3139 1340 ----
NM_014892chr65659 548 496 92 32 --1632 --
NM_014893chrY52212 1830 1671 866 101 12052 ----
NM_014897chr1752631 2092 1040 585 231 --32768 2444 839 --
NM_014898chr1922269 1966 --22407 93 --
NM_014899chr563162 3085 2060 1177 761 236 11153 12199 12434
NM_014900chr241111 1086 403 200 ------
NM_014901chr51765 --1793 --
NM_014903chr1272428 2310 2243 772 357 320 33 --1371 --
NM_014904chr1043948 3711 2962 862 1657 42933 2614 1553 904 12535
NM_014905chr222001 298 ------
NM_014906chr1764112 3916 3502 2934 2659 915 ----11243
NM_014912chr1043319 2943 2188 779 --52734 2145 692 629 349 13185
NM_014913chr182542 339 11525 ----
NM_014914chr231335 1145 1008 ------
NM_014917chr13827 749 698 168 1848 --
NM_014918chr1551597 1453 403 287 62 --61125 1062 584 579 570 411 --
NM_014920chr683262 2614 2398 1134 938 625 261 202 --1636 12701
NM_014921chr1922776 1927 --12003 --
NM_014923chr1351490 796 357 128 42 12237 1204 1214
NM_014924chr1472988 2689 2628 2031 1018 996 487 --52833 2756 2567 539 125 --
NM_014932chr321807 1773 12011 ----
NM_014936chr671081 988 911 897 437 315 141 1172 21759 157 12371
NM_014937chr102373 236 ----11289
NM_014938chr1212398 ------
NM_014939chr1811081 --2140 45 --
NM_014945chr5----12004 11983
NM_014946chr263053 2944 2917 2699 1169 376 --21139 195 --
NM_014947chr173027 2938 2611 2229 1082 733 259 --1326 13006
NM_014949chr13968 888 872 ------
NM_014950chr141193 ------
NM_014952chr1541962 1946 817 109 ------
NM_014953chr1354325 4111 3321 1294 322 32723 1412 96 ----
NM_014959chr1983509 3134 2571 2392 2229 826 552 489 11058 22331 1418 12598
NM_014961chr441888 1623 599 131 ----1509
NM_014962chr20102445 2430 1117 1039 1005 904 635 531 457 303 22171 1104 12699 --
NM_014964chr1712137 --1614 --
NM_014969chr11951 --1450 --
NM_014970chr11115 ------
NM_014974chr101239 11761 11802 31789 1229 330
NM_014977chr14----1505 --
NM_014978chr1041856 1554 1538 1271 --21669 103 --
NM_014982chr14105447 4643 4485 3942 3797 3465 1958 1806 387 240 13287 44343 1627 1502 1122 --
NM_014988chr442433 1777 518 203 --22554 353 --
NM_014989chr681611 1546 1441 1383 821 452 423 114 --4482 477 433 416 11599
NM_014990chr142890 855 --11167 --
NM_014991chr492998 2974 2791 2664 2636 2431 2151 1241 1084 --42856 2831 2407 1190 11197
NM_014992chr141650 ------
NM_014997chr742710 1998 729 198 22871 2245 12938 --
NM_014999chr1231417 1103 403 --51196 1159 239 229 218 --
NM_015000chr1212202 --23023 2111 33133 1935 216
NM_015001chr12381 131 --2982 315 --
NM_015002chr1252270 1427 918 884 28 ------
NM_015005chr1431760 1619 320 ------
NM_015008chr352696 2628 2344 1204 1025 --23202 2640 11312
NM_015009chr3185 --1768 --
NM_015015chr1922031 1296 --1525 --
NM_015017chr151253 1158 818 391 94 ------
NM_015018chr6191 ------
NM_015020chr1643778 3572 3000 2581 12548 2109 90 --
NM_015023chr111642 --31856 1804 125 --
NM_015025chr282681 2595 2574 2523 645 507 464 199 --2592 56 12613
NM_015026chr1284726 3994 2926 1061 771 612 388 50 1474 33320 1040 951 12970
NM_015027chr1642016 1808 428 208 --11348 --
NM_015032chr1392839 2803 2626 2316 2163 2033 1065 494 454 1378 --12211
NM_015035chr2096622 5961 5778 5711 4418 1853 1840 1058 812 --16314 --
NM_015039chr184246 3919 3313 3230 1556 1546 1264 504 22978 1179 24330 486 --
NM_015040chr283184 2963 2867 2728 2090 716 631 421 1314 33096 3090 2170 --
NM_015042chr1564342 3619 3526 3183 3176 1240 --23392 1207 --
NM_015045chr1032247 530 476 1171 51886 1881 1876 490 482 --
NM_015046chr952509 2492 2014 1819 91 12693 12448 12625
NM_015047chr131126 377 341 --1310 --
NM_015049chr253289 2575 2047 960 664 --12438 --
NM_015050chr6----2996 505 --
NM_015055chr1162796 2672 2250 1896 545 414 ----12897
NM_015056chr2182609 2584 2562 2419 2377 1941 93 36 12451 --1197
NM_015059chr1532805 2641 626 --2655 328 --
NM_015064chr1213228 --131 --
NM_015068chr723380 365 23957 1547 12672 --
NM_015071chr586411 6129 4770 4698 2217 2077 1369 1014 --2440 301 16037
NM_015073chr1912014 --11901 --
NM_015074chr1104820 4324 4166 3612 3569 1658 1551 576 423 361 --14902 --
NM_015076chr643888 2905 1648 1241 --23539 1179 --
NM_015082chr512147 --11046 --
NM_015086chr12184 --1175 --
NM_015087chr1382615 2501 1904 652 576 440 367 254 1593 22514 1082 156
NM_015090chr196241 6054 6042 5885 5605 5526 4167 1094 481 25355 4192 15029 --
NM_015091chr144750 679 539 305 ------
NM_015092chr1674545 4170 3997 3726 3554 3110 1314 13087 43875 3361 2939 950 --
NM_015093chr651819 1627 1367 452 95 ----1728
NM_015094chr2233354 889 311 --34458 4425 631 11160
NM_015097chr362221 1739 817 798 786 141 --41543 443 395 127 --
NM_015100chr131730 779 253 11551 42033 1587 402 358 --
NM_015107chrX82384 2058 1990 1983 1810 1683 1552 711 11898 12064 --
NM_015110chr932516 1737 1592 --11891 139
NM_015115chr471260 1185 1024 796 346 275 46 1138 31011 890 770 --
NM_015120chr22263 72 ------
NM_015124chr2242466 2055 831 109 --12391 --
NM_015129chrX21703 423 --21748 1740 --
NM_015132chr76578 445 428 384 222 33 1642 21350 699 --
NM_015134chr173548 541 84 --1640 --
NM_015137chr862264 2024 1921 1840 480 215 --42308 2039 788 403 12052
NM_015138chr151153 --42802 1053 1028 278 --
NM_015141chr342737 2157 2014 523 12037 ----
NM_015143chr411011 --1102 --
NM_015144chr1683865 3809 3481 2497 1411 1283 1093 442 13954 1447 --
NM_015153chr62752 259 ----1672
NM_015155chr1043311 2106 1330 750 --23247 1127 --
NM_015156chr1464015 3221 2739 2611 1561 167 33950 3693 928 31585 1432 461 11317
NM_015158chr92617 258 ------
NM_015161chr1681544 1510 1476 1273 627 352 291 104 ------
NM_015163chr1411670 --1282 --
NM_015172chr1----21272 421 --
NM_015176chr121760 291 --11202 1452
NM_015178chr822724 454 ------
NM_015180chr143788 742 307 ------
NM_015185chrX42656 879 811 322 12674 12928 1932
NM_015186chr92469 50 1337 ----
NM_015187chr41125 --1271 --
NM_015191chr1142497 2390 2001 1802 ------
NM_015192chr20102971 2950 2763 2465 2329 2002 1984 898 570 506 1536 1238 --
NM_015198chr71223 ----11086
NM_015199chr352792 2535 981 480 262 --31012 837 586 --
NM_015200chr472469 2426 2164 2129 2104 760 510 --11006 --
NM_015203chr1184 ------
NM_015206chr1563726 3323 3064 3012 552 89 ----13391
NM_015208chr1833763 2565 625 --12915 13435
NM_015209chr122169 348 --41705 360 354 331 --
NM_015213chr114792 542 182 174 ------
NM_015215chr153052 3037 2500 1135 811 --22253 567 --
NM_015216chr51116 1174 ----
NM_015221chr1031504 1271 38 ------
NM_015225chr982981 2777 2118 2078 1181 355 197 151 22905 2091 22376 533 --
NM_015231chr112232 92 ------
NM_015233chr1332255 1879 770 --1827 12274
NM_015236chr441481 1441 1032 599 ------
NM_015238chr52474 25 ------
NM_015239chr91422 ------
NM_015245chr642619 2122 1856 861 --12582 12734
NM_015247chr16113988 3854 3846 3294 1997 1450 1175 614 403 193 161 24176 496 23354 1067 25340 1360
NM_015250chr92743 373 --11524 --
NM_015251chr1652278 2115 2076 217 143 ----11825
NM_015252chr22908 211 --2781 101 --
NM_015254chr833159 171 126 ------
NM_015256chr5----1628 --
NM_015263chr151939 21191 436 ----
NM_015265chr262515 2202 626 172 123 83 12620 41012 143 96 90 176
NM_015267chr1232166 690 458 --1143 --
NM_015268chr32467 253 1744 ----
NM_015269chr11605 ------
NM_015270chr1231704 430 418 --11764 --
NM_015271chr4104122 4024 3667 3642 3363 2697 1324 643 359 288 --34002 3878 3672 --
NM_015272chr1671754 1527 1310 649 170 153 73 ------
NM_015275chr1242092 2009 218 57 12112 11374 --
NM_015277chr1871242 744 685 563 460 77 56 11663 1670 11302
NM_015278chr633042 749 478 11216 ----
NM_015282chr232961 1966 1889 23026 2772 32892 1872 579 13005
NM_015286chr1552419 2342 1851 1784 289 --21887 392 12466
NM_015288chr543669 3487 2661 1530 13514 ----
NM_015291chr1113476 3384 3159 2857 2610 2601 2337 1127 1110 1088 591 --13460 13202
NM_015294chr17----21131 52 11155
NM_015305chr1421671 344 ------
NM_015308chr114180 156 39 26 ------
NM_015310chr8147515 6123 5873 5794 3142 2419 2018 1937 1800 1553 1175 703 199 169 --58297 5757 5635 745 185 23102 145
NM_015313chr1174714 4504 4164 3452 3116 1505 1155 24295 871 23364 400 --
NM_015314chr762475 2306 1955 658 626 451 --11041 --
NM_015315chr513056 --82909 2904 2464 2458 2452 2446 887 882 --
NM_015317chr242186 1818 303 55 --62276 1802 998 884 838 833 --
NM_015319chr121461 ------
NM_015321chr1924894 1686 ------
NM_015323chr661669 1643 1571 364 295 183 --21611 1399 --
NM_015326chr12771 627 11082 11900 --
NM_015328chr742610 2456 1018 701 ------
NM_015329chr1921832 1817 --12935 12752
NM_015331chr11635 --1608 --
NM_015335chr1262460 2078 1052 634 616 332 12230 22435 598 1813
NM_015336chr1272678 2301 2201 2097 1974 1962 1846 --42474 714 587 275 12591
NM_015339chr201994 ------
NM_015342chr51121 ------
NM_015344chr861900 1646 1517 629 242 46 ----11505
NM_015347chr1252801 2735 2445 1906 600 12992 ----
NM_015349chr682944 2920 2863 2381 922 499 296 167 12668 5983 966 511 301 288 12985
NM_015350chr11512 ------
NM_015353chr1742807 2604 606 235 ------
NM_015355chr1772008 1970 1840 1565 1463 702 329 11612 41299 779 770 79 --
NM_015358chr2151128 1101 974 518 31 --176 --
NM_015359chr852805 2640 2399 2177 672 --11980 --
NM_015361chr23824 765 375 --1276 --
NM_015365chrX83860 3838 3531 3050 2842 2612 548 228 31083 566 186 33786 341 282 13555
NM_015375chr154729 4704 3796 1421 1346 --23375 1141 14588
NM_015378chr122837 1861 22503 376 --1292
NM_015381chr2212038 --11344 --
NM_015382chr141523 ------
NM_015384chr51122 ------
NM_015385chr1053245 3006 2826 2661 2499 --12094 --
NM_015387chr241997 441 119 103 ------
NM_015393chr483810 3557 3162 2932 2626 1277 1155 963 --2133 115 1336
NM_015396chr341233 430 287 121 --1211 --
NM_015397chr921932 1844 --2189 182 --
NM_015419chrX3437 286 220 --1879 --
NM_015428chr1941687 1249 1215 579 11396 ----
NM_015432chr161646 ------
NM_015435chr831420 594 246 1547 31437 1112 1106 --
NM_015436chr463388 3252 3005 2421 314 111 --11320 12155
NM_015443chr1731430 1367 1114 11470 4606 179 173 168 --
NM_015446chr12553 527 --1480 --
NM_015455chr594036 3388 1444 1227 1142 1059 955 647 493 --42698 1578 1257 93 22527 637
NM_015458chr8105080 4974 4682 3249 1828 1762 1623 1023 1014 470 1721 33686 3230 1813 11722
NM_015460chr321948 299 1305 21614 1452 --
NM_015475chr241028 872 850 801 1775 1436 2914 25
NM_015477chr1551017 967 788 691 288 ------
NM_015485chr12297 53 --145 --
NM_015496chr82264 213 ------
NM_015497chr1521109 776 --21127 822 --
NM_015514chr143622 556 489 --2599 144 --
NM_015516chr1131473 1290 1281 ------
NM_015523chr111238 --1258 --
NM_015525chr66966 946 463 363 87 45 --1334 --
NM_015530chr22913 627 ------
NM_015532chr1592604 2488 2193 2033 1920 661 648 313 225 --32842 2283 640 1919
NM_015534chr131034 893 389 --11011 --
NM_015535chr254089 3824 2648 414 187 --24210 3654 --
NM_015541chr331304 888 417 --11254 --
NM_015542chr1031121 1039 220 --6956 944 939 933 927 859 --
NM_015548chr62711 171 --2728 671 --
NM_015550chr783593 3288 3213 2948 1180 1171 839 466 --13535 13262
NM_015554chr15122859 2421 2395 2268 1820 831 799 781 557 548 539 107 11788 22879 2427 --
NM_015555chr651570 484 165 153 68 --1125 --
NM_015556chr141178 ------
NM_015560chr362869 2575 2138 1110 300 65 11138 22628 214 --
NM_015564chr532708 2571 768 13482 12845 --
NM_015565chr2152298 2262 2252 2117 363 --21389 658 --
NM_015567chr135490 450 308 271 29 --1374 --
NM_015569chr184570 3958 3758 2991 1923 1331 953 604 14488 34625 4575 639 1688
NM_015570chr731597 1491 165 --21733 234 --
NM_015571chr641780 1754 1703 425 12156 2940 906 2884 241
NM_015575chr273667 2593 2409 2316 2273 1390 1027 --83311 3305 2581 2439 949 843 378 178 --
NM_015576chr362931 2668 2541 2525 2128 336 --3364 301 32 --
NM_015577chr551846 1796 1687 1602 417 ------
NM_015578chr1961800 1570 1498 1473 1287 540 --3805 135 128 --
NM_015584chr1741352 1146 404 134 ------
NM_015589chr141142 ------
NM_015602chr121586 673 11132 1526 --
NM_015607chr11195 --2222 216 --
NM_015609chr122274 997 --1490 --
NM_015610chr742243 1954 1893 246 --3745 613 226 1556
NM_015626chr1721152 351 --31227 1033 287 --
NM_015630chr251106 372 356 255 158 ------
NM_015635chr931672 1491 97 ------
NM_015640chr174825 4676 3976 3937 277 203 58 --35385 5328 4834 --
NM_015642chr3----2129 123 --
NM_015646chr1231299 1214 906 181 ----
NM_015652chr103646 501 57 ------
NM_015670chr171477 ------
NM_015675chr19------1555
NM_015678chr131467 11417 ----
NM_015686chrX----22480 423 --
NM_015687chr64529 470 166 157 ------
NM_015691chrX52892 2886 2389 2040 117 --42016 2011 2006 415 --
NM_015695chr632028 1565 819 ------
NM_015711chr191767 ------
NM_015716chr17--1749 198 --
NM_015726chr141838 1569 615 459 --21556 111 1290
NM_015836chr161546 1539 1306 583 493 32 --11397 --
NM_015845chr182683 477 ------
NM_015850chr882238 2126 1760 1677 1630 524 372 225 --21989 825 1817
NM_015852chr733570 3147 2226 ----23434 2599
NM_015855chr111679 ------
NM_015866chr151464 1401 1233 1001 389 --31191 949 535 11051
NM_015874chr41259 --1509 --
NM_015878chr82554 514 --1683 12082
NM_015879chr18128535 8222 6729 2797 2754 2544 1920 1872 1420 1181 575 139 32772 1513 550 38646 2261 397 --
NM_015881chr112296 155 ------
NM_015885chr112802 551 --1831 1308
NM_015886chr874981 4418 3730 1250 162 99 79 24816 2200 12144 21349 838
NM_015888chr163312 808 624 389 154 66 --4975 919 411 404 --
NM_015891chr622084 123 --2625 176 --
NM_015898chr191300 ------
NM_015902chr85891 638 612 600 47 1204 1283 --
NM_015906chr174547 4248 3096 1551 1506 1019 813 --24679 1478 --
NM_015908chr7176 ------
NM_015912chr842523 1850 1827 207 1658 32510 2504 155 --
NM_015913chr12735 712 ------
NM_015920chr153628 113 33 ------
NM_015939chr205666 640 610 578 151 --129 --
NM_015960chr101115 ------
NM_015975chrX41836 1336 712 511 --11311 --
NM_015980chr551588 1575 1366 1084 624 1300 1192 --
NM_015981chr553171 3039 2224 1186 962 13030 23051 91 --
NM_015982chr17----1340 --
NM_015986chr1721331 138 --2915 569 --
NM_015990chr481118 921 837 808 713 438 426 393 11014 ----
NM_015995chr1535463 4994 62 1145 24162 954 --
NM_016002chr13802 744 187 ------
NM_016003chr742243 1954 1893 246 --3745 613 226 1556
NM_016009chr164786 4382 3917 1500 1097 459 --24045 3783 --
NM_016018chr812219 22256 1960 12302 --
NM_016019chr72868 742 ------
NM_016021chr642712 2262 2034 96 12054 ----
NM_016022chr12988 149 --1137 --
NM_016023chr872112 2038 1556 877 852 837 296 2748 204 22171 1348 11828
NM_016025chr1611862 --11595 --
NM_016027chr8124 --134 --
NM_016032chrX----125 --
NM_016037chr14952 731 408 249 11125 ----
NM_016040chr172480 2369 1871 623 371 279 212 12043 ----
NM_016041chr17173 ------
NM_016045chr2051492 1187 740 630 470 168 11423 21840 1266
NM_016048chr53906 274 127 ----1225
NM_016061chr261684 1662 1338 1271 1022 172 1431 ----
NM_016072chr127933 798 671 611 550 524 377 ------
NM_016076chr152505 2420 2056 487 91 --12037 23169 493
NM_016078chr1741063 991 230 107 126 1438 --
NM_016083chr643703 2966 480 422 22691 150 13098 --
NM_016084chr17------147
NM_016090chr1121032 319 1310 2904 75 --
NM_016096chr841725 1507 1392 1371 --11759 --
NM_016097chr1811093 --1954 --
NM_016100chr202361 349 ------
NM_016101chr16292 51 ------
NM_016107chr54507 484 288 48 1431 31369 1274 397 --
NM_016120chrX3845 795 483 1291 1161 --
NM_016125chr17----1412 --
NM_016129chr41380 ------
NM_016131chr2112233 2201 2096 1968 1596 789 685 617 504 368 141 11564 31524 551 103 12146
NM_016132chr1583359 3136 3129 3068 2902 1126 315 291 12639 73373 3365 3151 2716 1324 974 40 22843 168
NM_016133chr2123 ------
NM_016138chr1651766 1558 352 132 95 ----21126 113
NM_016141chr31227 --1767 --
NM_016144chr53789 615 52 --1486 --
NM_016147chr1111142 ----11150
NM_016151chr161115 --1332 --
NM_016152chr321234 389 --1867 --
NM_016166chr151189 ------
NM_016169chr1053209 3137 3101 3000 512 1441 --11095
NM_016185chr173603 298 93 ------
NM_016192chr2--1263 ----
NM_016203chr731013 898 62 1873 21084 1024 --
NM_016205chr41103 --21375 467 --
NM_016206chr3239010 8682 8469 8383 8237 7556 7199 6722 6366 6241 6117 5968 5930 5558 3370 3270 3102 2343 1839 1815 1038 402 202 --128105 7400 7395 7390 7385 7380 7372 7362 6459 1217 601 287 23413 252
NM_016213chr15140 ------
NM_016216chr34657 199 32 25 --2722 37 --
NM_016217chr653315 3303 2724 2490 120 13222 43565 3233 3072 2674 --
NM_016224chr61832 --21727 188 11490
NM_016227chr151072 1005 556 374 335 1444 21312 37 --
NM_016230chr63495 174 81 ------
NM_016231chr1721530 1477 --2664 318 --
NM_016234chr103748 363 79 --1136 --
NM_016247chr3--1429 ----
NM_016248chr1383937 2991 1419 1234 752 312 179 35 13678 83899 3836 3626 3620 3027 1461 1047 386 --
NM_016252chr21187 ------
NM_016255chr642904 2742 391 298 --11229 --
NM_016258chr11294 ----1565
NM_016260chr2137338 6985 6142 5931 2924 2807 2654 2252 919 863 243 161 142 47670 7156 2530 1891 46480 5756 5459 473 26823 5603
NM_016262chr63153 118 72 --1500 --
NM_016271chr1872127 2070 1994 1639 1542 908 274 ----21460 628
NM_016275chr352495 2089 584 411 31 --1822 12219
NM_016277chr651529 1310 1163 280 99 --31544 1150 1017 --
NM_016279chr52504 143 ------
NM_016282chr931717 1120 574 1617 1305 --
NM_016287chr151911 1890 1732 1291 70 1160 1706 --
NM_016289chr252180 874 771 357 43 32263 1554 683 22071 139 --
NM_016297chr233544 1036 98 23129 384 13353 --
NM_016302chr31653 --1800 --
NM_016306chr3271 24 --2376 84 --
NM_016307chr91286 ------
NM_016308chr1102093 2078 1930 1846 1765 1328 606 560 530 438 11944 11853 --
NM_016315chr221164 666 1699 11536 --
NM_016316chr23299 228 128 --1642 --
NM_016319chr122710 208 --1189 --
NM_016322chr962840 2001 1281 1029 1017 536 --33120 485 480 13074
NM_016329chr31385 ------
NM_016333chr161162 ------
NM_016338chr511037 ------
NM_016340chr521266 1109 --1467 --
NM_016351chr71173 --2575 570 --
NM_016352chr721287 236 1948 51407 1399 1393 1382 576 --
NM_016356chr641900 1891 989 953 22916 2872 12149 --
NM_016374chr121483 1300 --21433 1339 1367
NM_016374chr121483 1300 --21433 1339 1367
NM_016376chr1743496 1516 1498 1452 12662 ----
NM_016396chr1573004 2993 2511 1006 636 100 92 22442 2414 21874 702 --
NM_016404chr11----146 --
NM_016410chr9----1466 --
NM_016418chr2283547 2997 2856 2507 2445 1531 1107 293 ------
NM_016422chr1162814 2693 2667 2578 613 324 2276 196 --1126
NM_016423chr141322 ------
NM_016424chr1761531 1294 551 470 219 205 --2796 521 174
NM_016426chr221577 ------
NM_016436chr2052480 1884 1017 640 270 1848 22552 1962 1975
NM_016441chr272353 1904 1786 1609 1477 869 858 12016 52359 2136 2069 902 676 --
NM_016448chr141550 1333 1287 505 --11689 --
NM_016451chr11172 ----1283
NM_016454chr15----1238 --
NM_016463chr5----1158 --
NM_016475chr142401 141 11177 1146 1485
NM_016476chr171126 ------
NM_016480chr5--1734 --1126
NM_016485chr62875 689 32069 859 383 2451 107 --
NM_016488chr1271965 1871 1760 1573 1287 736 274 11395 ----
NM_016507chr1733150 2775 875 12540 42659 998 763 575 1505
NM_016512chr82257 80 ------
NM_016513chr683262 2614 2398 1134 938 625 261 202 --1636 12701
NM_016516chr21189 151 1550 --
NM_016518chr172887 712 ------
NM_016522chr11------11054
NM_016525chr91866 1939 ----
NM_016529chr1331041 495 46 1143 1237 --
NM_016530chr1593145 2999 2846 2573 2540 2528 1654 1355 355 22859 737 43968 3833 3004 1522 --
NM_016531chr434127 3674 1042 24081 2775 13077 1794
NM_016542chrX61607 1574 1264 377 190 149 --1255 --
NM_016545chr16901 867 833 808 622 220 --1275 --
NM_016547chr11705 ------
NM_016559chr361369 1303 579 561 430 321 --1595 --
NM_016569chr1241493 1034 522 108 11343 11156 11330
NM_016570chr12132 --1400 --
NM_016577chr342885 2743 1134 302 --24158 348 --
NM_016578chr11------1642
NM_016584chr121301 ------
NM_016587chr751017 944 377 161 122 --1439 --
NM_016588chr6--1936 1317 --
NM_016598chr311312 --11353 --
NM_016603chr561647 1428 597 259 118 92 --1357 1341
NM_016604chr5180 --21277 1037 --
NM_016605chr552658 2330 839 549 337 --12224 --
NM_016607chrX1207 --21652 1647 1245
NM_016614chr64809 495 74 25 ----1698
NM_016617chr1351796 1687 1636 696 404 --41931 1692 147 57 12105
NM_016620chr141351 1276 424 330 --2403 222 --
NM_016621chr1164520 4016 1464 1360 416 336 --54558 4543 4537 998 992 --
NM_016623chr81534 --1500 --
NM_016626chr1831725 1459 463 11582 11467 11604
NM_016628chr101235 ------
NM_016631chr214239 223 58 28 ------
NM_016651chr1461132 1008 985 379 247 86 11153 --1199
NM_016652chr2041239 1136 529 206 ----129
NM_016654chr1551353 1038 1016 532 291 ------
NM_016818chr213843 611 518 ------
NM_016823chr17----2371 21 --
NM_016824chr1041205 735 678 583 ----11802
NM_016831chr162344 2251 2083 1734 223 186 12097 52311 1654 953 775 360 --
NM_016834chr1723789 146 23482 3354 ----
NM_016835chr1723789 146 23482 3354 ----
NM_016836chr21107 ----1161
NM_016839chr21107 ----1161
NM_016841chr1723789 146 23482 3354 ----
NM_016932chr2132 ------
NM_016936chr1642141 1648 1627 1481 11613 ----
NM_016946chr183275 3100 2995 2684 2261 1390 1186 1030 ------
NM_016950chr441298 1114 182 118 ----1940
NM_016952chr1164008 3988 3198 3093 238 122 1891 53923 1338 1328 1313 444 --
NM_016953chr2146134 5887 5689 5639 4834 4493 3789 1717 1547 1293 1087 442 418 371 1392 45853 4751 1539 78 --
NM_016954chrX3649 497 473 1122 ----
NM_017416chrX----1146 --
NM_017420chr1453804 3011 2736 811 106 12326 33549 400 199 --
NM_017423chr421573 1535 1671 1238 11669
NM_017426chr42622 453 --3634 518 512 --
NM_017437chr1472369 2326 2304 2159 1770 348 161 1373 62017 1997 1990 1985 639 83 --
NM_017444chr841805 1307 757 464 ------
NM_017447chr2174298 4130 3591 3096 3024 1502 953 13819 84116 3438 3165 3160 2787 1558 1439 704 14441
NM_017450chr1721006 93 ------
NM_017451chr172999 441 ------
NM_017452chr201197 ----21366 939
NM_017453chr201197 ----21366 939
NM_017454chr201197 ----21366 939
NM_017455chr153974 733 383 1254 1803 --
NM_017456chr1751895 1880 1873 1624 1524 --11974 1143
NM_017489chr841129 532 317 217 --31159 97 59 --
NM_017510chr5--1665 ----
NM_017519chr631069 189 111 --1282 --
NM_017544chrX3707 403 21 ------
NM_017548chr332140 1454 346 --51929 830 808 802 797 --
NM_017551chr1042664 2610 2083 444 --1250 --
NM_017554chr321953 1716 --12089 12213
NM_017563chr386371 6203 6049 5490 5089 4127 3962 1846 1376 46407 5408 4678 2160 --
NM_017569chr13----2114 57 --
NM_017575chr17----11619 --
NM_017580chr1061674 1635 957 715 486 400 --32396 2342 1548 --
NM_017582chr121809 1546 1448 1581 --
NM_017590chr2232692 2645 704 ------
NM_017593chr44462 419 314 69 ------
NM_017599chr1261859 1852 1320 1312 676 576 1318 1448 --
NM_017610chr1531361 336 242 12117 2763 348 --
NM_017612chr123519 473 40 ------
NM_017617chr921216 1048 --11281 11594
NM_017628chr4115243 5108 4035 3629 3310 3284 1732 1125 1063 1043 60 --74852 4847 4836 1649 1636 1629 780 --
NM_017629chr141877 1721 1669 679 --11255 1318
NM_017632chr44306 115 93 60 ------
NM_017633chr6113937 3399 3322 3028 2979 2970 2806 1351 985 323 111 1799 33908 3452 2617 23603 555
NM_017634chr831829 1561 306 11961 11882 --
NM_017635chr1151376 1270 1060 509 490 2540 466 ----
NM_017637chr9309416 9364 9312 8458 8247 8167 8157 7570 6988 6755 6456 3780 3661 3434 3198 3124 3053 2708 2577 2511 2310 2031 1936 1892 1566 1383 1060 644 471 387 23114 2937 139272 9265 9255 9250 9066 3455 2427 2196 1820 1678 1673 1668 591 --
NM_017638chr13245 110 60 --386 81 76 --
NM_017640chr62222 180 ------
NM_017641chr1251145 1015 442 320 263 --1802 --
NM_017643chr1762637 2610 2460 1232 242 211 --42476 2471 2466 467 1102
NM_017644chr3165022 4559 4476 4441 4093 3979 3833 3475 3367 2006 1826 1339 842 829 474 369 --55224 5124 4811 4684 3227 1203
NM_017645chr942655 1932 1276 834 --32555 819 362 --
NM_017650chr7105285 5178 4520 2217 2051 1746 1374 1174 504 301 36027 1921 651 55983 4293 2061 1343 255 --
NM_017657chr23755 245 121 --1724 1586
NM_017658chr14104494 4414 4346 4236 1748 1384 1016 897 680 477 23371 1694 1138 --
NM_017666chrX62183 2153 1776 1729 1478 330 --21781 250 --
NM_017667chr71208 ------
NM_017672chr1541337 287 119 29 --11153 --
NM_017673chr1------1806
NM_017686chr131068 430 109 --1831 --
NM_017693chr1321487 543 1377 21656 1562 11609
NM_017694chr221576 255 11941 1706 1528
NM_017709chr163911 3332 3214 3154 2760 1471 --54149 1054 1048 896 521 --
NM_017714chr202857 254 --1863 --
NM_017719chr382113 2085 1835 1704 731 651 305 132 ----1976
NM_017724chr34838 559 104 63 --1191 --
NM_017730chr31267 --1592 --
NM_017734chr1----179 --
NM_017737chr132145 1981 1960 --1528 --
NM_017738chr941207 1161 1132 1021 ------
NM_017739chr1182 ------
NM_017742chr181509 --2397 83 --
NM_017745chrX2272 253 ------
NM_017752chrX41785 1774 1631 153 2227 173 ----
NM_017753chr961031 971 756 290 140 129 ------
NM_017754chr674586 3825 1920 1530 1456 1110 347 14444 --11543
NM_017757chr1831083 872 852 --21160 832 --
NM_017758chr1711199 --8371 149 114 107 100 82 76 62 --
NM_017762chr1551907 1577 625 566 270 --21942 192 --
NM_017768chr15618 379 261 206 73 --2784 275 --
NM_017769chr1442779 2263 2148 339 --12665 2454 182
NM_017770chr642885 2788 963 465 --1362 --
NM_017778chr841099 928 589 91 --1299 --
NM_017780chr81854 1760 ----
NM_017784chr341181 1172 781 43 --21083 79 --
NM_017786chr81561 --2620 105 --
NM_017789chr22837 55 ------
NM_017798chr205963 951 393 220 138 --1458 --
NM_017799chr1441695 1497 655 615 ------
NM_017801chr34797 731 432 420 186 12508 --
NM_017811chr953098 3068 2763 697 158 12152 43027 2556 1007 1001 --
NM_017813chr8135751 5718 5651 5622 5515 5191 4535 4043 3957 2111 1043 965 382 21393 989 24775 666 25657 2121
NM_017819chr31219 ------
NM_017822chr12----2776 652 --
NM_017824chr1052672 1066 549 353 190 --31762 1712 265 --
NM_017826chr132748 596 --1682 --
NM_017831chr18104196 4152 3428 3250 2948 1830 1280 1214 886 372 --11481 14001
NM_017836chr32124 25 --1586 --
NM_017845chr41250 ----1755
NM_017848chrX64040 3341 2969 1655 1619 529 --1457 --
NM_017849chr232446 2220 425 --13202 --
NM_017866chr851085 979 449 145 70 ------
NM_017880chr2----127 1316
NM_017890chr851708 1609 1199 760 178 --1386 11891
NM_017896chr2073363 2955 2428 773 541 443 263 --23328 692 --
NM_017902chr1094695 4671 4069 3536 2223 2075 1633 858 538 ------
NM_017907chr11----1491 --
NM_017913chr91141 --4185 180 175 101 138
NM_017918chr4--1103 ----
NM_017919chr994586 3953 3776 3593 1397 1120 824 162 54 2436 400 24350 155 14210
NM_017922chr146662 437 424 262 237 135 ------
NM_017925chr931848 1823 1565 ------
NM_017926chr144583 359 322 309 1248 ----
NM_017938chrX82183 2040 1992 1980 1965 1887 1717 42 1781 1502 21387 608
NM_017943chr141749 1960 ----
NM_017944chr1133062 2093 585 22986 1193 43124 3039 1187 574 --
NM_017954chr751187 634 488 240 93 1501 2197 184 --
NM_017964chr22264 156 ----1988
NM_017972chr144583 359 322 309 1248 ----
NM_017987chr1041875 1713 890 529 ------
NM_017994chr742742 2561 884 465 --81005 1000 588 581 573 567 562 531 --
NM_017998chr941263 1148 1123 998 11027 41183 1009 1004 250 --
NM_018000chr242105 1704 1476 103 ------
NM_018009chr122122 115 ------