TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548u
miRNA Sequence: CAAAGACUGCAAUUACUUUUGCG

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51863 ----11238
NM_000037chr822400 390 ------
NM_000038chr541578 421 176 130 ------
NM_000045chr61114 ------
NM_000051chr1193571 2378 1030 1024 904 893 832 179 121 12425 13415 --
NM_000052chrX83393 3314 2367 2177 1220 1029 652 485 --12527 --
NM_000081chr131697 239 69 --1604 --
NM_000084chrX55407 5198 5093 1898 1433 11880 ----
NM_000088chr17--11358 11285 1174
NM_000092chr263933 3493 3326 3212 1689 1297 ------
NM_000093chr942429 1531 576 567 1485 22508 838 --
NM_000096chr31952 ------
NM_000109chrX42588 2300 2118 666 1121 ----
NM_000112chr5125291 5257 4962 4743 4465 3834 1698 1127 884 869 759 502 --34416 4205 517 21772 542
NM_000125chr623778 3536 23711 806 13147 --
NM_000129chr6149 ----1202
NM_000141chr1011205 ------
NM_000142chr411362 ----11308
NM_000151chr1751911 1782 1692 423 340 ----1670
NM_000161chr1451458 1450 577 386 69 1626 --11831
NM_000163chr51698 1311 ----
NM_000165chr631714 1581 432 --11353 --
NM_000168chr762849 2537 681 488 212 80 ------
NM_000176chr533767 3297 995 --13722 --
NM_000192chr1251333 1323 1315 360 342 ------
NM_000202chrX53900 3113 2971 2787 2610 13220 1219 1185
NM_000208chr1972912 1161 994 504 495 469 277 1327 --14511
NM_000210chr232299 708 322 22228 1880 12337 --
NM_000214chr206711 380 349 336 292 121 ------
NM_000216chrX84046 3383 2847 2625 1190 944 470 312 23129 1509 ----
NM_000217chr1285299 4011 3645 3250 1949 1486 1294 764 --24320 2120 --
NM_000222chr431977 1845 129 1610 ----
NM_000240chrX31733 1522 1456 1318 ----
NM_000242chr1062630 2204 2192 1056 957 32 ------
NM_000245chr72528 49 ------
NM_000248chr373082 2209 1980 1142 1081 1005 708 22761 2234 1736 1527
NM_000251chr2157 ------
NM_000253chr41769 1957 ----
NM_000259chr1595994 5853 5587 4989 2481 1688 1594 1380 730 --12255 24566 1440
NM_000267chr1792918 2911 2904 2892 2631 2468 1112 826 811 ------
NM_000276chrX31898 910 226 ------
NM_000280chr1141011 905 404 347 ------
NM_000297chr421851 288 --32009 1597 110 --
NM_000304chr1721067 331 ------
NM_000310chr131233 368 258 ------
NM_000314chr1062328 2080 1223 1128 1002 297 ------
NM_000321chr1331817 1611 1438 1386 --11583
NM_000325chr41546 ------
NM_000327chr11----1269 --
NM_000328chrX1150 --1374 2304 96
NM_000332chr6146614 6405 6125 5747 5273 4385 2484 2472 2033 1793 1740 1708 1495 991 14773 15988 21955 1576
NM_000333chr361112 1043 914 790 304 293 --1287 --
NM_000337chr595827 4825 4814 4153 2325 2257 2125 1732 628 11212 ----
NM_000346chr1761737 1391 680 125 107 99 11869 11278 --
NM_000368chr934550 2969 163 1490 23034 1522 --
NM_000390chrX83418 3348 2701 2681 2298 1081 592 317 11025 ----
NM_000393chr242007 1565 195 137 ------
NM_000397chrX22397 721 12374 --1418
NM_000399chr101356 ------
NM_000408chr233333 1371 252 33187 2940 914 11125 --
NM_000430chr1781508 1191 1030 982 885 876 703 347 --13001 --
NM_000441chr772330 2255 2162 1963 1439 774 514 --1382 --
NM_000447chr1165 ------
NM_000448chr11112865 2758 2690 2661 2521 2368 2355 2313 869 369 29 ------
NM_000459chr92853 847 ------
NM_000462chr1561715 1558 1299 585 537 302 ------
NM_000489chrX103459 2888 2878 2298 2238 1347 1233 1161 628 134 12524 ----
NM_000492chr721075 182 --1129 --
NM_000495chrX21121 777 2849 421 ----
NM_000503chr851770 1555 1203 664 134 --11710 --
NM_000509chr41147 ------
NM_000522chr71890 ------
NM_000523chr22357 131 2252 237 ----
NM_000527chr1932455 528 265 ------
NM_000534chr2--1135 ----
NM_000555chrX87247 6697 6157 5892 5136 4761 1388 338 36741 4788 1337 21396 1175 1107
NM_000565chr121548 503 ------
NM_000582chr41364 ------
NM_000587chr541131 1100 978 281 ------
NM_000589chr5----122 --
NM_000594chr61651 ------
NM_000598chr71154 ----11486
NM_000599chr264602 4282 4215 3243 3186 1011 13838 --11321
NM_000600chr7--1396 ----
NM_000610chr11122953 2861 2836 2664 2293 894 887 880 874 795 576 144 12451 ----
NM_000618chr1255672 5099 4409 4403 892 25156 170 12326 14437
NM_000618chr1255672 5099 4409 4403 892 25156 170 12326 14437
NM_000633chr18104997 4918 4486 4456 4310 4083 3857 1833 292 176 23719 1842 14821 --
NM_000635chr1921268 1234 11564 ----
NM_000663chr1642847 2811 2419 149 ------
NM_000675chr221815 ------
NM_000693chr155606 571 526 520 512 21594 542 ----
NM_000701chr12247 81 1230 ----
NM_000718chr9161 ------
NM_000719chr1296485 5449 4977 1990 1797 1076 955 765 351 ------
NM_000724chr1051233 651 490 43 21 --177 --
NM_000726chr231490 1366 1076 11179 11376 --
NM_000739chr7176 ------
NM_000756chr81322 ------
NM_000767chr1941394 1207 969 232 ------
NM_000783chr10------154
NM_000788chr461219 1078 960 505 187 114 ----1105
NM_000801chr2031093 948 742 --1294 --
NM_000806chr531782 1769 493 1463 ----
NM_000809chr4168921 7446 7409 6811 6208 5929 3400 3221 2153 1793 1720 1503 1277 1232 184 52 48148 6990 1648 65 28113 1289 29159 5717
NM_000811chr5--1533 ----
NM_000812chr43141 128 50 --1303 --
NM_000813chr5125458 5131 5125 5119 4954 4878 4498 3404 1983 1051 879 626 1922 14123 13634
NM_000814chr1534116 3025 694 13342 1314 172
NM_000817chr221180 387 ------
NM_000826chr422323 1894 12116 1414 11963
NM_000827chr532582 2561 471 ------
NM_000829chr1152172 1581 930 229 87 ------
NM_000836chr19--1984 ----
NM_000840chr7--132 1371 --
NM_000842chr111509 ------
NM_000859chr531351 319 138 ------
NM_000872chr1011020 ------
NM_000875chr15126906 6755 6491 5954 2600 2447 2194 1960 1676 1156 806 74 11203 ----
NM_000876chr6----1129 --
NM_000880chr8----175 --
NM_000891chr1773629 3613 3128 2425 651 435 260 43231 2456 344 241 ----
NM_000895chr121101 ------
NM_000899chr1253846 3785 3321 2934 1496 13957 ----
NM_000901chr472535 1959 1603 1587 562 315 167 182 22023 695 12209
NM_000903chr1661434 1196 1174 1038 308 96 ----182
NM_000917chr105939 762 709 315 68 --1911 --
NM_000922chr113714 442 433 1798 ----
NM_000933chr2021646 1585 11196 ----
NM_000934chr171691 ------
NM_000935chr34805 790 503 63 11174 ----
NM_000944chr45938 805 786 730 545 ------
NM_000945chr231938 1577 468 --22025 1384 --
NM_000950chrX143638 3618 3269 3166 3127 2653 2538 2440 2367 2270 2232 1005 231 148 22239 1208 ----
NM_000958chr551247 1205 1163 991 266 ----1904
NM_000959chr153819 3065 2886 666 194 ------
NM_000963chr132355 255 246 ----2349 213
NM_000964chr171940 1518 ----
NM_000965chr31135 --2864 92 --
NM_000975chr1137 ------
NM_000983chr121604 1581 11080 ----
NM_001001132chr2131156 953 329 ------
NM_001001323chr1282987 2602 2447 2285 2144 1267 386 347 22839 1938 11258 --
NM_001001330chr101869 1149 2527 505 --
NM_001001331chr372476 2302 2278 1687 826 389 368 12690 1475 --
NM_001001342chr1051402 1201 557 395 369 --129 --
NM_001001389chr11122953 2861 2836 2664 2293 894 887 880 874 795 576 144 12451 ----
NM_001001390chr11122953 2861 2836 2664 2293 894 887 880 874 795 576 144 12451 ----
NM_001001391chr11122953 2861 2836 2664 2293 894 887 880 874 795 576 144 12451 ----
NM_001001392chr11122999 2907 2882 2710 2339 940 933 926 920 841 622 190 12497 ----
NM_001001395chr1231871 334 251 12830 ----
NM_001001396chr164413 3410 3272 2832 852 756 13249 23288 2845 11170
NM_001001419chr585208 3994 1754 1089 1010 579 515 383 --11786 1872
NM_001001420chr585208 3994 1754 1089 1010 579 515 383 --11786 1872
NM_001001433chr2052598 2021 671 194 188 1427 ----
NM_001001481chr833381 3357 382 1567 42204 1235 1049 72 12894
NM_001001483chr112373 38 1120 ----
NM_001001484chr1051990 1552 1528 868 293 ------
NM_001001520chr192186 128 ------
NM_001001549chr722112 485 11763 22139 1813 --
NM_001001550chr722112 485 11763 22139 1813 --
NM_001001555chr722112 485 11763 22139 1813 --
NM_001001557chr811649 21340 495 22083 1656 --
NM_001001560chr221847 ------
NM_001001664chr223897 1218 14041 ----
NM_001001715chr13------2460 409
NM_001001852chr221938 ------
NM_001001872chr141601 ------
NM_001001890chr2143296 698 678 640 43428 3266 1019 544 ----
NM_001001924chr821322 389 --1716 11680
NM_001001925chr821322 389 --1716 11680
NM_001001928chr2288335 8204 5830 3173 1928 1404 1387 932 --11490 --
NM_001001931chr821322 389 --1716 11680
NM_001001937chr18137 ------
NM_001001938chr943797 1575 1066 634 23675 369 1115 --
NM_001001971chr10182 1130 ----
NM_001001974chr1051537 1510 1497 903 763 194 ----
NM_001001992chr21--1194 ----
NM_001002257chr273528 3498 1384 1215 1104 919 875 ----11360
NM_001002258chr252022 776 618 564 418 11280 --1427
NM_001002295chr104918 780 438 112 ------
NM_001002759chr103524 508 493 ------
NM_001002762chr1052846 2418 2221 1801 594 12720 ----
NM_001002838chrX41502 481 218 34 11546 ----
NM_001002843chr15----11285 1209
NM_001002860chr1483951 3358 3082 3056 1534 1484 213 179 --1129 11577
NM_001002901chr1--1115 1325 --
NM_001003396chr6129 ------
NM_001003397chr6129 ------
NM_001003652chr18168690 8490 7429 6633 6545 6072 3448 3431 2767 1581 1549 1048 675 665 658 474 36249 2886 1224 57564 6306 6150 1792 1327 13165
NM_001003674chr18105434 4964 4725 2746 2451 2173 1980 1571 647 132 14977 26840 4836 26153 5926
NM_001003675chr18105434 4964 4725 2746 2451 2173 1980 1571 647 132 14977 26840 4836 26153 5926
NM_001003681chr2232056 1653 780 11429 --12033
NM_001003688chr41435 ----1961
NM_001003712chr1263845 3091 1349 886 805 433 21236 79 2629 319 13508
NM_001003792chr33473 186 125 --21132 958 2982 166
NM_001003793chr33473 186 125 --21132 958 2982 166
NM_001003800chr932376 1218 432 13532 ----
NM_001003810chr42333 278 --1634 --
NM_001003940chr1553500 1534 1510 358 97 12475 ----
NM_001003942chr1553500 1534 1510 358 97 12475 ----
NM_001003943chr1553504 1538 1514 362 101 12479 ----
NM_001004051chrX2241 81 ------
NM_001004065chr943821 2735 1523 27 --23048 2607 14011
NM_001004106chr521014 66 ------
NM_001004127chr131688 ------
NM_001004304chr1253094 3087 1012 836 385 1505 12901 13171
NM_001004317chr663669 3534 3361 2918 434 412 64346 4252 4225 1021 553 318 ----
NM_001004329chr1221387 1101 21498 483 --11176
NM_001004342chr186080 6069 6020 5157 4123 1863 959 341 14265 14676 1528
NM_001004346chr42186 155 21197 1138 ----
NM_001004360chr231828 1767 250 1526 11925 --
NM_001004441chr541500 670 640 363 ------
NM_001005158chr3--1488 ----
NM_001005159chr3--1488 ----
NM_001005242chr1251629 1547 560 230 165 1542 1664 21419 1283
NM_001005266chr152300 37 ------
NM_001005267chr152300 37 ------
NM_001005268chr152300 37 ------
NM_001005269chr152300 37 ------
NM_001005335chr19171 ------
NM_001005375chrY61852 1740 1174 622 231 150 --21598 1202 21510 420
NM_001005386chr282344 2304 1990 1640 1606 777 603 129 ----1328
NM_001005404chr1764529 4349 4225 1151 1141 238 13542 23653 3301 13778
NM_001005463chr1032072 1027 991 ------
NM_001005473chr5114651 4594 4445 4305 4057 2420 2333 2316 675 472 262 14191 54633 4223 4042 1183 276 --
NM_001005474chr331303 1189 1025 --11392 --
NM_001005476chr21128 ------
NM_001005526chr2--1111 ----
NM_001005732chr21------1558
NM_001005733chr21------1515
NM_001005743chr1431128 1084 376 --1863 --
NM_001005744chr1431128 1084 376 --1863 --
NM_001005745chr1431128 1084 376 --1863 --
NM_001005746chr231490 1366 1076 11179 11376 --
NM_001005747chr231490 1366 1076 11179 11376 --
NM_001005753chr222315 2269 12332 ----
NM_001005781chr21544 ------
NM_001005782chr21993 --1401 --
NM_001005845chr861884 1860 1624 721 626 31 --11611 --
NM_001005849chr173558 433 115 1511 ----
NM_001005861chr35983 920 909 667 223 ----1306
NM_001005862chr171502 --1219 1483
NM_001006600chr572387 2137 1789 959 662 426 270 32021 626 227 --1764
NM_001006605chr121155 902 ------
NM_001006605chr121155 902 ------
NM_001006610chr1651008 1002 375 329 285 ------
NM_001006612chrX2452 185 ------
NM_001006613chrX2452 185 ------
NM_001006614chrX2452 185 ------
NM_001006618chr91198 ------
NM_001006626chr7176 ------
NM_001006627chr7176 ------
NM_001006628chr7176 ------
NM_001006629chr7176 ------
NM_001006630chr7176 ------
NM_001006631chr7176 ------
NM_001006632chr7176 ------
NM_001006636chr2--1360 ----
NM_001006656chr1961707 1452 1265 601 521 134 --1538 --
NM_001006657chr273013 2700 1056 1019 867 264 94 12091 11195 --
NM_001006946chr231389 1223 512 ------
NM_001007024chr1743038 2917 336 290 1212 34301 3266 2897 --
NM_001007025chr1743038 2917 336 290 1212 34301 3266 2897 --
NM_001007075chr41841 --11026 --
NM_001007099chr12703 150 --1808 --
NM_001007100chr12703 150 --1808 --
NM_001007102chr641602 1447 1319 1020 --11589 --
NM_001007156chr1511804 ------
NM_001007157chr7121 ------
NM_001007214chr14732 620 404 277 21625 1290 1714 --
NM_001007237chr182821 2708 2563 2088 585 524 475 180 1247 ----
NM_001007245chr7------181
NM_001007257chr141407 945 547 315 ------
NM_001007267chr23842 655 174 ------
NM_001007277chr112423 360 ------
NM_001007278chr13103816 3355 3335 2076 1992 946 938 595 389 24 25204 4057 14332 24909 2018
NM_001007466chr6154937 4705 4246 3256 1872 1752 1596 1587 1581 1575 1568 1555 1542 993 146 25131 3646 ----
NM_001007468chr221264 ----1301
NM_001007471chr9----168 --
NM_001007546chr221284 1238 11539 ----
NM_001007553chr141234 1197 891 134 ------
NM_001007559chr1891926 1643 1624 1610 1604 1596 1430 703 667 --1106 --
NM_001007595chr15--1292 1327 --
NM_001007794chr12722 695 ------
NM_001008225chr7--1518 ----
NM_001008239chr18173803 3734 3708 3190 3183 3154 2911 2691 2676 1449 1348 1342 1327 1317 1097 915 556 --1346 13669
NM_001008392chr352734 2535 1342 858 151 22561 2378 1472 --
NM_001008393chr452928 2881 2241 2070 148 22306 462 --12088
NM_001008401chr1921084 435 11218 ----
NM_001008405chr73375 127 81 --41799 1586 656 284 --
NM_001008408chr7115804 5777 4857 4523 4232 4054 1500 926 824 437 377 --35169 4948 249 --
NM_001008495chr872178 1728 1535 1444 461 393 253 22266 323 21869 436 1123
NM_001008540chr24484 444 437 357 --1137 198
NM_001008541chr1011583 --11795 --
NM_001008541chr1011583 --11795 --
NM_001008564chr1352228 2124 874 306 109 ------
NM_001008738chr542498 2371 2017 448 ----1393
NM_001008801chr1971761 1486 1468 799 548 279 194 52004 1897 1637 466 111 ----
NM_001008925chr443122 2433 741 567 --3902 730 428 13224
NM_001008938chr111365 --1457 --
NM_001009554chr463365 2984 2874 1868 439 419 24039 3442 ----
NM_001009554chr463365 2984 2874 1868 439 419 24039 3442 ----
NM_001009555chr451728 1419 1322 1275 73 ------
NM_001009880chr2264255 3680 3585 1244 1157 877 34798 4459 3139 ----
NM_001009881chr1--1197 --1239
NM_001009882chr1--1197 --1239
NM_001009894chr1231567 1352 574 --11221 --
NM_001009899chr3125861 4722 4585 4077 2520 2190 1544 1322 893 813 685 119 35257 4004 1638 11166 --
NM_001009955chr11376 ------
NM_001009955chr11376 ------
NM_001009959chr232657 2079 754 21816 1635 12236 --
NM_001009993chr284565 4313 4285 2895 1031 552 435 191 2847 837 ----
NM_001010000chr1833452 3337 2451 ----13265
NM_001010853chr682925 2319 2150 1235 980 816 507 83 12396 32991 2883 2236 --
NM_001010854chr142277 189 ------
NM_001010861chr142195 2111 747 191 1467 ----
NM_001010862chrX93243 3027 3009 2535 1001 826 396 152 60 ------
NM_001010867chr1126483 6271 6103 5468 5365 5144 5022 4349 2298 2007 1592 72 25456 2240 1925 --
NM_001010888chrX104500 4440 4412 4149 3885 1296 1127 822 719 377 ------
NM_001010891chr5256669 6549 6497 6284 6110 5960 5924 5458 5112 5106 5085 4473 2715 2670 2268 2103 1470 1444 1220 916 765 742 728 662 389 11200 --11412
NM_001010895chr92666 279 --144 --
NM_001010934chr71908 1153 ----
NM_001010986chrX12172 1891 12429 --
NM_001010989chr161575 1210 --1102
NM_001010990chr161575 1210 --1102
NM_001011513chr463906 2757 2528 1514 1107 96 ----1506
NM_001011537chr372316 2186 841 709 625 380 139 11843 ----
NM_001011551chrX1174 1349 ----
NM_001011553chr7196 ------
NM_001011657chrX41143 983 308 132 ------
NM_001011663chr102915 314 --1435 --
NM_001011666chr795861 4980 2519 2310 2050 1958 605 240 155 24130 862 25414 4305 --
NM_001011708chr211849 --22582 577 --
NM_001011713chr1441066 1001 443 412 --1615 1374
NM_001011885chr153554 496 122 ----11814
NM_001012393chr1194191 4054 3297 2072 2040 1286 528 135 100 14509 13362 --
NM_001012398chr161838 ------
NM_001012410chr3----1362 1346
NM_001012418chr674217 3954 1393 691 633 596 116 --14104 --
NM_001012420chr1522817 2056 1359 22313 2291 --
NM_001012423chr1522817 2056 1359 22313 2291 --
NM_001012456chr71104 --123 --
NM_001012514chr2--1982 ----
NM_001012516chr2--1982 ----
NM_001012614chr41531 ----1271
NM_001012751chr1031931 1216 701 --21651 635 --
NM_001012754chr1362097 2003 1969 1488 178 130 11770 ----
NM_001012755chrX74924 4697 4665 3914 3361 1817 1789 --13727 --
NM_001012756chr1972895 2767 2677 2550 2361 839 664 1681 ----
NM_001012761chr53816 741 24 12537 22613 1066 --
NM_001012968chrX62492 2444 1751 1719 995 654 --1508 --
NM_001012977chrX11113 11416 11366 --
NM_001013031chr1053461 3451 3177 1063 976 1139 23322 859 --
NM_001013398chr71154 ----11486
NM_001013399chr61416 1804 1150 --
NM_001013406chr71480 --21292 51 --
NM_001013415chr441615 1248 1208 518 --11290 --
NM_001013437chr182315 74 ------
NM_001013438chr33982 913 643 ----1250
NM_001013439chr32828 759 ----196
NM_001013620chr12158025 8012 7934 7237 7041 6918 6077 5438 2836 2830 2368 1657 1056 1029 394 18475 46807 6432 6397 130 --
NM_001013629chr1041816 1652 1385 203 12137 ----
NM_001013659chr1935368 1388 1054 21212 402 ----
NM_001013703chr15----1452 --
NM_001013843chr152921 194 ------
NM_001014286chr13180 ------
NM_001014380chr13115812 5465 5381 5169 4962 4784 2272 1876 1822 1795 1487 1660 24200 342 24030 1322
NM_001014431chr142905 145 2668 82 ----
NM_001014432chr142905 145 2668 82 ----
NM_001014434chr12691 248 --1270 126
NM_001014446chr4----129 --
NM_001014797chr1077387 5406 2873 2839 1108 768 496 --47153 6829 1497 1157 --
NM_001014809chr44874 862 88 73 ------
NM_001014811chr111104 ------
NM_001014831chr192800 166 ------
NM_001014832chr192800 166 ------
NM_001014834chr192800 166 ------
NM_001014835chr192800 166 ------
NM_001015048chr1463121 3012 751 618 516 325 22970 254 12931 12124
NM_001015049chr1463121 3012 751 618 516 325 22970 254 12931 12124
NM_001015508chr81221 --2576 208 1562
NM_001015877chrX82933 2727 2479 2446 2410 2338 2047 1068 1749 1900 --
NM_001015881chrX41287 1029 813 68 ------
NM_001015887chr341613 1535 1462 585 1402 ----
NM_001017371chr231243 1224 1136 --11021 --
NM_001017395chr3103183 3073 2342 1351 994 886 863 725 139 86 21250 922 22293 195 --
NM_001017415chr11812 1128 1294 --
NM_001017416chr11812 1128 1294 --
NM_001017523chr1231401 531 98 ------
NM_001017922chr111730 ------
NM_001017926chr831603 1284 1200 ------
NM_001017930chrX2976 116 1592 1280 --
NM_001017962chr105939 762 709 315 68 --1911 --
NM_001017969chr9----1581 126
NM_001017977chr11105 --1114 --
NM_001017999chr16527 363 357 351 316 257 --12167 1736
NM_001017999chr16527 363 357 351 316 257 --12167 1736
NM_001018000chr16527 363 357 351 316 257 --12167 1736
NM_001018000chr16527 363 357 351 316 257 --12167 1736
NM_001018001chr16527 363 357 351 316 257 --12167 1736
NM_001018004chr152680 454 152 ----
NM_001018006chr152680 454 152 ----
NM_001018007chr152680 454 152 ----
NM_001018020chr152680 454 152 ----
NM_001018037chr921257 1089 ------
NM_001018038chr92151 51 ----1454
NM_001018053chr151713 1688 1628 1564 518 11236 1603 --
NM_001018056chr9--1157 ----
NM_001018064chr921581 569 ------
NM_001018065chr935034 4656 1405 21931 308 15053 15351
NM_001018066chr935034 4656 1405 21931 308 15053 15351
NM_001018067chr1104532 3245 1473 1360 1346 861 845 540 367 201 23849 1639 --15254
NM_001018068chr1104532 3245 1473 1360 1346 861 845 540 367 201 23849 1639 --15254
NM_001018069chr1104532 3245 1473 1360 1346 861 845 540 367 201 23849 1639 --15254
NM_001018072chr1231401 531 98 ------
NM_001018074chr533767 3297 995 --13722 --
NM_001018075chr533767 3297 995 --13722 --
NM_001018076chr533767 3297 995 --13722 --
NM_001018077chr533767 3297 995 --13722 --
NM_001018090chr15122694 2522 2485 1948 1923 1766 750 684 667 634 359 149 ----11092
NM_001018091chr15132804 2632 2595 2058 2033 1876 860 794 777 744 469 259 51 ------
NM_001018100chr151769 ------
NM_001018102chr15122694 2522 2485 1948 1923 1766 750 684 667 634 359 149 ----11092
NM_001018111chr774033 3844 3661 3586 3204 1173 550 --23109 3063 --
NM_001018113chrX1128 ------
NM_001020658chr121286 425 1399 ----
NM_001020658chr121286 425 1399 ----
NM_001023567chr1532361 2209 1735 ------
NM_001024094chr533767 3297 995 --13722 --
NM_001024218chr142319 83 ------
NM_001024226chr111139 1389 1184 --
NM_001024227chr111139 1389 1184 --
NM_001024228chr111139 1389 1184 --
NM_001024401chr16--12862 ----
NM_001024457chr21555 31423 1404 995 ----
NM_001024463chr151308 ------
NM_001024649chr5--1290 22707 2457 2410 321
NM_001024660chr331427 1397 508 --1631 --
NM_001024688chr871823 1806 833 753 704 664 545 21598 513 --11544
NM_001024808chr1222025 1850 ------
NM_001024809chr171940 1518 ----
NM_001024847chr342457 2337 2244 1579 ------
NM_001024934chr6--1517 ----
NM_001024935chr6--1517 ----
NM_001024936chr6--1517 ----
NM_001024947chr521056 300 ------
NM_001024948chr173254 3175 3074 2435 2412 1246 268 11130 ----
NM_001025076chr10156182 5879 5577 4242 4037 2209 2027 1721 1424 1299 1254 1051 966 824 140 --45462 3911 3818 549 1523
NM_001025077chr10147540 7237 6935 5600 5395 2782 2657 2612 2409 2324 2182 1498 1395 548 --56820 5269 5176 1907 1322 34636 1881 669
NM_001025079chr384185 4172 3840 3305 2845 2832 2816 1248 13609 33436 2639 239 1166
NM_001025108chr283935 3227 3017 2695 1344 834 769 57 --31331 1266 946 14126
NM_001025233chr1242032 1792 835 278 ----1136
NM_001025266chr384815 4306 4297 3929 3493 3354 1016 199 ------
NM_001025366chr661798 1649 1382 1294 658 314 --11816 --
NM_001025366chr661798 1649 1382 1294 658 314 --11816 --
NM_001025367chr661798 1649 1382 1294 658 314 --11816 --
NM_001025367chr661798 1649 1382 1294 658 314 --11816 --
NM_001025368chr661798 1649 1382 1294 658 314 --11816 --
NM_001025368chr661798 1649 1382 1294 658 314 --11816 --
NM_001025369chr661814 1665 1398 1310 674 330 --11832 --
NM_001025369chr661814 1665 1398 1310 674 330 --11832 --
NM_001025370chr661798 1649 1382 1294 658 314 --11816 --
NM_001025370chr661798 1649 1382 1294 658 314 --11816 --
NM_001025580chrX124280 4055 3747 2995 1519 1385 1226 611 589 482 310 251 22783 455 --1430
NM_001025595chr421106 323 --11331 --
NM_001025616chr441325 640 568 290 --1234 --
NM_001025777chr221516 1274 11420 2302 65 147
NM_001029835chr71327 ------
NM_001029858chr622336 48 --22392 1063 --
NM_001029863chr642239 988 385 141 --12529 --
NM_001029875chr572417 1980 1088 716 550 315 94 1220 1934 1416
NM_001029882chr11277 ------
NM_001029882chr11277 ------
NM_001030006chr1732647 2432 170 ------
NM_001030007chr1673997 3921 3670 3611 2889 2465 1252 12930 ----
NM_001030055chr1494575 4376 4046 3976 3934 2885 1820 1455 790 --24126 2990 --
NM_001030272chr11159 1352 ----
NM_001030273chr11159 1352 ----
NM_001031623chr62428 122 11238 11215 --
NM_001031679chr1242309 1375 333 109 --52847 2825 2493 553 297 --
NM_001031684chr231383 1182 362 1206 ----
NM_001031685chr13788 782 666 1932 1898 --
NM_001031690chr722899 2193 12626 ----
NM_001031692chr7131 1300 ----
NM_001031695chr2294741 4555 4543 1598 1419 1256 1147 502 486 35449 3789 1721 1675 --
NM_001031700chr442106 703 424 296 159 ----
NM_001031710chr72932 83 11091 ----
NM_001031712chr61387 ------
NM_001031716chr22995 335 1150 --130
NM_001031732chr473228 1380 1276 1075 550 489 325 ----12377
NM_001031748chr12--1621 1557 1235
NM_001031801chr221162 ------
NM_001031803chr17------2309 233
NM_001031804chr1654063 3579 822 726 314 --21719 626 11492
NM_001031812chr541989 1971 370 212 11440 22370 2177 --
NM_001032221chr91198 1392 ----
NM_001032280chr621724 1681 21405 1151 1599 --
NM_001032282chr831257 1199 1024 --1505 --
NM_001032283chr123871 306 177 ------
NM_001032284chr123871 306 177 ------
NM_001032288chr2051410 1327 1111 533 57 ------
NM_001032293chr17--1247 ----
NM_001032296chr1352738 2613 1907 158 30 32328 293 253 --12050
NM_001032380chr1032005 1801 1243 11464 ----
NM_001032393chrX1202 ------
NM_001032394chr642844 1768 1129 131 1141 ----
NM_001032395chr622711 996 ------
NM_001032410chr21--1194 ----
NM_001032999chr2075236 3789 1660 1374 1355 1340 705 15182 ----
NM_001033044chr121268 116 --11699 11617
NM_001033045chr223936 1552 13460 13037 160
NM_001033056chr121268 116 --11699 11617
NM_001033057chr332121 619 485 --1453 --
NM_001033059chr651986 1838 1687 1543 522 --1544 --
NM_001033087chr2052728 2333 914 750 265 23076 2981 ----
NM_001033112chr53784 300 131 --1122 --
NM_001033503chr52463 115 ----1380
NM_001033507chr13667 214 115 11282 ----
NM_001033557chr231250 396 112 ----1250
NM_001033561chr172749 156 1680 ----
NM_001033566chr17--1736 ----
NM_001033568chr17--1736 ----
NM_001033576chr1792739 2679 2502 2251 1940 794 757 596 158 ------
NM_001033578chr872239 2233 1956 1597 917 341 296 ------
NM_001033602chr1382262 1820 824 809 768 697 450 310 ------
NM_001033659chr1721474 355 1375 ----
NM_001033756chr661732 1583 1316 1228 592 248 --11750 --
NM_001033756chr661732 1583 1316 1228 592 248 --11750 --
NM_001033925chr1041930 1846 1681 578 1363 1186 --
NM_001034841chr16105297 5155 4397 4232 4029 4023 4017 3412 1219 1181 31052 460 362 34983 3780 418 11963
NM_001034850chr541420 1147 1141 671 21106 274 1346 --
NM_001034915chr82352 345 --11533 --
NM_001034954chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_001034955chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_001034956chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_001034957chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_001035chr131060 1021 309 ------
NM_001035003chr441279 563 341 273 ------
NM_001035004chr441279 563 341 273 ------
NM_001035254chr942605 2439 2322 1569 22403 2275 ----
NM_001035260chr1031322 1286 210 1608 ----
NM_001035521chr21655 ------
NM_001037164chr751773 1448 1440 686 655 11942 22015 1476 --
NM_001037165chr788918 8860 7524 7315 7196 6001 1839 1401 --58331 7647 7309 2743 575 --
NM_001037172chr351374 1201 995 883 70 ------
NM_001037317chr142195 2111 747 191 1467 ----
NM_001037334chr1832251 2212 684 12168 21875 784 --
NM_001037339chr121250 538 1430 --11348
NM_001037340chr121250 538 1430 --11348
NM_001037341chr121250 538 1430 --11348
NM_001037341chr121250 538 1430 --11348
NM_001037535chrX41552 1470 611 93 1238 ----
NM_001037536chrX41552 1470 611 93 1238 ----
NM_001037540chrX41552 1470 611 93 1238 ----
NM_001037553chr2154473 3806 1493 934 177 34523 690 342 ----
NM_001037582chr441080 216 195 140 ------
NM_001037631chr21722 11110 ----
NM_001037637chr51266 ------
NM_001037872chr22637 239 ----194
NM_001037954chr1143470 2231 2152 715 ------
NM_001038493chr211495 ------
NM_001038702chr511922 --21904 250 --
NM_001038707chr121602 807 21682 351 12206 --
NM_001038707chr121602 807 21682 351 12206 --
NM_001039091chrX2243 52 1213 1183 --
NM_001039199chr2084662 3968 1775 1007 986 678 465 90 --13042 --
NM_001039348chr22849 230 2954 188 --1412
NM_001039349chr22849 230 2954 188 --1412
NM_001039372chr73674 623 176 ------
NM_001039459chr721023 988 --21109 1000 --
NM_001039538chr243644 3211 2257 1352 --33358 1454 476 12302
NM_001039547chr3127038 6189 5998 5943 5870 2935 1805 1401 976 866 815 599 1874 --36597 5129 1830
NM_001039577chr144193 4009 3892 951 1517 ----
NM_001039580chr434193 3249 3083 2415 223 ----
NM_001039585chr154076 3322 3143 923 451 12618 ----
NM_001039590chrX93734 3566 3235 3182 2939 2849 2810 1499 1492 --33719 3632 3422 --
NM_001039591chrX93734 3566 3235 3182 2939 2849 2810 1499 1492 --33719 3632 3422 --
NM_001039618chr11145845 5686 5636 5041 4917 4706 4693 4659 4627 2156 1648 1474 1340 801 11803 12359 --
NM_001039693chr294050 3656 2774 1638 1469 1424 1021 1014 942 --23684 698 11623
NM_001039709chr2075236 3789 1660 1374 1355 1340 705 15182 ----
NM_001039762chr1042010 1900 918 772 21913 35 ----
NM_001039802chr16480 474 467 420 281 97 ------
NM_001039840chrX45094 4291 1170 177 15560 15338 --
NM_001039916chr1211066 11203 ----
NM_001039917chr1211066 11203 ----
NM_001039918chr1211066 11203 ----
NM_001039919chr1211066 11203 ----
NM_001039920chr1211066 11203 ----
NM_001040001chr621918 391 11522 1256 --
NM_001040031chr191271 ------
NM_001040057chr721192 108 ------
NM_001040058chr41364 ------
NM_001040060chr41364 ------
NM_001040092chr83154 59 27 --1436 --
NM_001040101chr4----11225 --
NM_001040102chr1012220 --21718 636 --
NM_001040103chr1012220 --21718 636 --
NM_001040110chr741858 1506 1361 110 --1497 --
NM_001040135chr7----1707 1540
NM_001040142chr232240 2221 1532 2638 112 21922 1899 --
NM_001040143chr232240 2221 1532 2638 112 21922 1899 --
NM_001040147chr182589 238 --2702 620 --
NM_001040152chr733776 3452 416 --14006 --
NM_001040153chr131692 --2321 246 --
NM_001040157chr452488 2102 1076 1034 320 12900 1103 12397
NM_001040158chr52158 111 1178 ----
NM_001040159chr42405 250 1565 1274 1193
NM_001040167chr741100 882 850 809 1949 ----
NM_001040202chr462519 2322 1975 813 584 91 22285 1936 ----
NM_001040214chr622064 835 --11534 --
NM_001040260chr4----11024 --
NM_001040261chr4----11024 --
NM_001040284chr1694664 4362 4355 2140 1936 1241 688 458 127 25564 2152 45322 2311 2128 943 25392 4311
NM_001040402chr421242 44 22874 2744 ----
NM_001040409chr21687 ------
NM_001040429chr1353123 2512 1451 1191 1185 23133 2318 ----
NM_001040441chr134835 2144 2138 34375 3582 1476 1493 --
NM_001040450chr1542123 1782 607 121 ----1747
NM_001040453chr1542123 1782 607 121 ----1747
NM_001040455chr1121236 1045 11254 ----
NM_001040624chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040625chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040626chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040627chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040628chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040629chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040630chr862755 2361 2335 1858 911 656 21736 844 ----
NM_001040633chr741034 1016 896 269 ------
NM_001040665chr741957 1449 1061 147 34263 3950 3198 24093 1424 --
NM_001040668chr191118 ------
NM_001040708chr84967 374 325 176 1402 --1205
NM_001040712chr953234 2730 846 781 647 13359 21002 506 --
NM_001040876chr431238 683 267 1586 1496 --
NM_001042355chr1685082 4871 4256 3452 1190 743 223 106 --1547 14012
NM_001042388chr182989 23 1726 --1810
NM_001042403chr122877 199 --1402 --
NM_001042412chr1685082 4871 4256 3452 1190 743 223 106 --1547 14012
NM_001042413chr9104108 3879 3668 2708 2698 1463 1059 774 615 238 13045 12570 --
NM_001042414chr13----1118 --
NM_001042425chr621724 1681 21405 1151 1599 --
NM_001042453chrX31262 1218 347 --1502 11344
NM_001042473chr1022022 1902 31604 857 742 --1633
NM_001042481chr14--12402 ----
NM_001042486chr2041180 458 317 74 ------
NM_001042492chr1792918 2911 2904 2892 2631 2468 1112 826 811 ------
NM_001042494chr1573871 3828 3590 3289 2950 1330 719 --22389 235 --
NM_001042495chr1573871 3828 3590 3289 2950 1330 719 --22389 235 --
NM_001042496chr1573871 3828 3590 3289 2950 1330 719 --22389 235 --
NM_001042497chr1573871 3828 3590 3289 2950 1330 719 --22389 235 --
NM_001042510chr831710 1703 878 --11754 11641
NM_001042511chr831710 1703 878 --11754 11641
NM_001042517chr132904 105 ------
NM_001042533chr352522 2268 1143 637 401 23131 2398 13300 --
NM_001042537chrX3673 264 189 ----1944
NM_001042548chr23794 653 210 1319 ----
NM_001042550chr95691 685 252 236 35 --21414 498 --
NM_001042555chr1274340 4303 3797 3442 1642 1380 931 32960 1783 1754 2852 776 143
NM_001042599chr286161 5992 3094 2962 2372 647 103 77 17316 --14986
NM_001042601chr34883 835 314 144 32941 532 246 32893 2799 103 --
NM_001042603chr12105145 4619 4119 4021 3707 3554 2137 1733 750 733 21687 1145 ----
NM_001042604chr3104392 4375 3963 3739 3328 3075 2952 1349 1339 598 43625 3565 1650 553 44134 3486 3119 1196 --
NM_001042632chr2032305 2208 2049 --1193 --
NM_001042633chr2032305 2208 2049 --1193 --
NM_001042669chr441325 640 568 290 --1234 --
NM_001042681chr142362 2098 1035 296 --11854 --
NM_001042682chr142362 2098 1035 296 --11854 --
NM_001042682chr142362 2098 1035 296 --11854 --
NM_001042683chr641174 398 358 75 11834 --1751
NM_001042749chrX1158 1475 1216 11471
NM_001042750chrX1158 1475 1216 11471
NM_001042751chrX1158 1475 1216 11471
NM_001042762chr73685 171 41 ----1247
NM_001043351chr152325 1730 816 596 150 1258 12245 --
NM_001044305chr61279 ------
NM_001044722chr541989 1971 370 212 11440 22370 2177 --
NM_001044723chr541989 1971 370 212 11440 22370 2177 --
NM_001046chr521079 250 21042 415 12316 --
NM_001048183chr153769 2947 2603 1527 167 13597 42900 2584 685 247 --
NM_001050chr17--21090 353 1933 --
NM_001068chr31118 ------
NM_001080418chr11157 ------
NM_001083620chr422321 1892 12114 1413 11961
NM_001099678chr396157 6097 4331 2351 2126 2111 1566 258 246 --36181 5699 1847 --
NM_001100108chr1138223 7922 3181 2908 2747 2404 2397 2389 2379 1977 1666 1017 814 ------
NM_001106chr3209772 8978 8864 8807 8293 7638 7269 6989 6784 6731 6163 3249 2710 2674 2337 2107 1701 1236 564 329 17216 59704 9158 8638 2266 2061 1199
NM_001109977chr42249 234 1776 ----
NM_001113490chrX31390 535 114 --22876 2606 --
NM_001115chr8121 ------
NM_001117chr1842394 2186 2152 159 1341 ----
NM_001121chr1031176 519 220 ------
NM_001122679chr51863 ----11238
NM_001126chr13394 357 250 --2324 136 --
NM_001128chr1673997 3921 3670 3611 2889 2465 1252 12930 ----
NM_001128144chr2--1135 ----
NM_001144chr1621107 131 11421 --11260
NM_001146chr821572 704 12288 22030 1825 11616
NM_001148chr431691 703 317 ------
NM_001149chr101484 ----134
NM_001153chr2--1263 ----
NM_001159chr22613 512 ----1718
NM_001160chr1292110 1087 1045 897 600 586 548 462 196 22118 1961 ----
NM_001167chrX86659 6489 5694 5510 2323 2178 1879 1046 2710 474 31436 1087 977 11390
NM_001173chr1494575 4376 4046 3976 3934 2885 1820 1455 790 --24126 2990 --
NM_001174chrX21962 1833 --12144 --
NM_001178chr11159 1352 ----
NM_001186chr2182750 2374 2352 1203 990 533 101 47 --12437 --
NM_001187chr211506 ------
NM_001191chr204942 366 343 159 ----11207
NM_001201chr462453 1246 1190 501 465 70 21529 278 33372 3359 826 13822
NM_001204chr2117635 6668 6223 5684 5298 5193 2647 2028 1512 205 197 11726 37184 2451 1362 1444
NM_001206chr983079 3031 2763 2040 298 292 286 278 2598 165 ----
NM_001207chr51266 ------
NM_001233chr742154 344 261 155 1396 ----
NM_001237chr431089 946 913 ----165
NM_001237chr431089 946 913 ----165
NM_001238chr193529 189 167 ------
NM_001253chr62253 112 ------
NM_001254chr1761090 930 372 354 177 59 --11010 --
NM_001256chr1762779 2499 2378 2210 1872 261 1389 22945 1996 180
NM_001257chr1631440 1041 131 ------
NM_001262chr1--1313 ----
NM_001263chr41111 ------
NM_001269chr12974 902 ------
NM_001270chr52885 22 1313 ----
NM_001278chr106745 449 388 297 177 67 11226 11201 --
NM_001280chr193687 274 211 ------
NM_001282chr1732647 2432 170 ------
NM_001289chrX2182 71 11523 ----
NM_001304chr1773819 3251 2971 2628 1079 440 161 --33687 3601 491 13763
NM_001310chr1262927 2649 2618 2473 1879 410 12035 ----
NM_001313chr44874 862 88 73 ------
NM_001319chr19----11030 --
NM_001326chr111317 1424 1307 --
NM_001328chr41531 ----1271
NM_001329chr1031161 1025 93 --1245 --
NM_001331chr112852 296 --12111 12130
NM_001332chr531110 1103 75 --1635 --
NM_001338chr2141235 986 807 253 ------
NM_001351chr341831 1713 524 143 1320 51858 1572 1483 1171 1144 --
NM_001356chrX42300 2186 1785 997 1853 --1660
NM_001357chr1170 ------
NM_001363chrX1518 --1715 --
NM_001364chr1164458 1241 763 346 105 88 --21080 542 --
NM_001365chr171514 ------
NM_001379chr19--168 1216 1279
NM_001386chr862020 2011 1829 655 429 96 12256 1471 --
NM_001396chr2182614 2441 817 398 323 287 279 54 42094 2021 486 38 --12368
NM_001400chr121286 920 ------
NM_001401chr911051 ------
NM_001406chr1731730 1529 1134 ------
NM_001408chr121661 1314 11540 1259 --
NM_001412chrX82908 2857 2769 1152 1146 1139 1133 147 --13414 11202
NM_001415chrX61790 1559 1460 695 316 289 --1672 --
NM_001417chr1251951 1771 1659 1291 541 ----1407
NM_001418chr113622 590 156 --1548 --
NM_001418chr113622 590 156 --1548 --
NM_001419chr1994673 4391 2987 1574 1225 1154 1064 385 111 34241 1166 139 --34621 1534 393
NM_001424chr162731 88 1677 1186 --
NM_001427chr761940 1791 1474 1464 1381 243 --1207 --
NM_001430chr251860 1545 657 532 71 --1710 --
NM_001431chr63992 494 72 ------
NM_001432chr442998 2790 1023 394 33690 3554 139 13269 23445 3370
NM_001438chr163339 3039 2998 2862 850 841 ------
NM_001440chr832772 1090 459 1314 ----
NM_001448chrX51518 1291 330 306 168 --21154 1117 1116
NM_001452chr6--1574 ----
NM_001461chr1127 1612 1434 --
NM_001463chr22797 227 ------
NM_001482chr151785 2625 317 ----
NM_001494chr10----1293 --
NM_001495chr82296 114 --1169 --
NM_001497chr942180 1839 701 541 ------
NM_001498chr641103 1023 880 301 ----1898
NM_001511chr44623 587 170 143 ------
NM_001514chr1----1395 --
NM_001518chr721019 937 --1422 --
NM_001521chr21655 ------
NM_001530chr1411067 --1218 --
NM_001533chr19171 ------
NM_001540chr7193 ------
NM_001541chr111166 ------
NM_001542chr182821 2708 2563 2088 585 524 475 180 1247 ----
NM_001543chr554432 3636 3613 3574 952 23547 1074 --13598
NM_001546chr63989 983 272 ----1935
NM_001550chr7------181
NM_001587chrX31898 910 226 ------
NM_001604chr1141011 905 404 347 ------
NM_001609chr1052872 1797 1286 987 481 2442 251 ----
NM_001616chr253282 3086 3078 2365 801 1431 22759 1010 --
NM_001619chr11--11089 ----
NM_001620chr11--1532 ----
NM_001621chr772924 2845 2508 1170 836 378 29 11081 22828 437 --
NM_001621chr772924 2845 2508 1170 836 378 29 11081 22828 437 --
NM_001627chr321720 212 1391 --1959
NM_001634chr651986 1838 1687 1543 522 --1544 --
NM_001635chr73873 746 675 143 ----
NM_001642chr1131221 1210 262 --11093 --
NM_001650chr1853468 2791 1321 855 308 13483 ----
NM_001655chr1142015 1944 771 724 1715 31551 1356 75 --
NM_001656chr531857 1378 29 --1271 --
NM_001658chr111139 1389 1184 --
NM_001659chr1222294 689 --1655 --
NM_001660chr32661 300 1624 1768 --
NM_001663chr1432639 863 523 ------
NM_001664chr321059 668 ------
NM_001668chr151780 1672 735 643 366 22058 54 ----
NM_001681chr12--162 ----
NM_001682chr1292701 2316 2161 1999 1858 1133 981 100 61 12553 1972 --
NM_001683chr372476 2302 2278 1687 826 389 368 12690 1475 --
NM_001684chr164130 3127 2989 2549 569 473 12966 23005 2562 1887
NM_001689chr252022 776 618 564 418 11280 --1427
NM_001690chr342179 1874 160 148 11904 ----
NM_001695chr843579 2895 2882 795 33861 1497 1264 31705 1629 1503 --
NM_001702chr81389 ------
NM_001704chr61527 --1415 --
NM_001706chr32852 795 ------
NM_001709chr1142595 2586 592 568 12904 22198 2180 --
NM_001718chr631328 1011 312 ------
NM_001719chr20----2177 38 --
NM_001723chr63256 228 162 ------
NM_001726chr11139 ------
NM_001730chr1321371 1255 31285 502 312 31332 592 422 --
NM_001730chr1321371 1255 31285 502 312 31332 592 422 --
NM_001731chr121689 --1772 --
NM_001744chr51105 ------
NM_001746chr5--1290 22707 2457 2410 321
NM_001753chr741594 1516 670 146 ------
NM_001754chr2143296 698 678 640 43428 3266 1019 544 ----
NM_001755chr1631889 1605 827 1534 1274 --
NM_001759chr12115215 4768 3517 3465 3354 1940 1932 1912 1680 1349 69 25143 3498 1841 --
NM_001769chr122167 99 1346 ----
NM_001774chr191271 ------
NM_001777chr384185 4172 3840 3305 2845 2832 2816 1248 13609 33436 2639 239 1166
NM_001788chr7196 ------
NM_001791chr16480 474 467 420 281 97 ------
NM_001792chr1841047 795 276 23 ------
NM_001797chr161119 ------
NM_001799chr51186 ------
NM_001801chr53487 235 213 ------
NM_001806chr193822 713 209 --1568 --
NM_001826chr12345 339 ----1465
NM_001829chr43902 855 138 ------
NM_001830chrX63969 3144 3005 1265 988 446 23370 1570 11355 --
NM_001839chr1--141 ----
NM_001845chr132545 475 1913 ----
NM_001855chr92543 29 --1100 --
NM_001858chr6105077 4903 3954 3561 3135 869 749 586 487 249 24922 3971 11249 --
NM_001880chr2126 ------
NM_001881chr101343 --1403 --
NM_001882chr52406 388 1508 --146
NM_001884chr53161 58 26 ------
NM_001893chr171373 ------
NM_001896chr161334 ------
NM_001901chr621001 109 1690 1959 --
NM_001903chr51898 ------
NM_001904chr34916 684 233 24 ------
NM_001924chr11457 --146 --
NM_001935chr2--1283 ----
NM_001938chr171653 1504 1464 663 620 485 41 ------
NM_001949chr662793 2787 2292 2053 891 445 12266 ----
NM_001951chr8--1594 ----
NM_001964chr51430 ------
NM_001968chr43965 822 677 ------
NM_001969chr1442965 1481 697 508 13248 13219 13675
NM_001980chr121788 22016 1746 ----
NM_001981chr152308 2147 841 521 173 ------
NM_001982chr1211077 ------
NM_001987chr1283864 3533 3265 711 549 328 322 316 ------
NM_001992chr5--12213 ----
NM_001999chr541490 1474 1400 464 ------
NM_002006chr494347 3902 3617 2290 1748 1262 955 617 455 --23712 3596 --
NM_002009chr1582690 2558 2552 2540 2290 1996 1910 930 --21946 802 --
NM_002014chr12169 ------
NM_002015chr1393374 3300 1175 668 379 372 330 103 82 11108 12476 --
NM_002017chr112936 506 31036 1023 322 ----
NM_002024chrX52169 748 742 410 255 12193 21500 346 --
NM_002025chrX108867 6728 6433 6249 5658 3143 1045 734 708 372 39049 5768 118 37747 7609 5750 --
NM_002030chr1941209 1091 149 75 ------
NM_002031chr61687 --1610 --
NM_002039chr42643 356 ----1602
NM_002040chr2152116 1254 1024 989 770 22424 2042 22358 32 12571
NM_002051chr104918 780 438 112 ------
NM_002054chr21177 ------
NM_002056chr2--1806 1828 --
NM_002061chr131577 626 146 ------
NM_002065chr121268 116 --11699 11617
NM_002069chr74422 306 146 76 --11473 --
NM_002073chr22--11080 ----
NM_002076chr1293124 2960 2048 2020 1132 1124 625 253 83 11210 ----
NM_002077chr9--185 ----
NM_002082chr52977 29 ------
NM_002086chr1722164 262 ----1218
NM_002092chr4154700 4588 4553 4519 4159 4153 4147 3173 3091 1883 1819 1711 701 517 266 1621 14460 --
NM_002106chr4--1261 ----
NM_002107chr1--1464 1176 --
NM_002126chr1783812 3557 1608 1078 813 705 563 250 21130 282 --33983 1618 439
NM_002128chr1341739 1007 649 134 2170 117 62382 2031 1627 520 312 21 --
NM_002129chr43393 344 322 ------
NM_002130chr531722 1195 428 1297 --11079
NM_002131chr62986 213 ------
NM_002133chr222516 417 1494 ----
NM_002137chr761952 1809 827 435 388 293 11478 ----
NM_002138chr42333 278 --1634 --
NM_002140chr931037 885 759 --153 --
NM_002154chr5------1112
NM_002158chr253240 1374 765 134 80 2692 142 33746 2750 1260 --
NM_002163chr161406 1413 ----
NM_002165chr201387 ------
NM_002166chr21507 ------
NM_002188chr51691 ------
NM_002190chr62837 345 ----1533
NM_002193chr231719 1600 738 ------
NM_002196chr201929 ------
NM_002196chr201929 ------
NM_002203chr523926 503 1396 24054 3900 --
NM_002210chr253364 3160 2349 1346 419 1213 --2955 250
NM_002211chr1031108 1000 923 ------
NM_002214chr774667 3545 1989 1648 863 783 582 --23685 1748 11564
NM_002222chr331134 347 125 ------
NM_002232chr121261 538 ------
NM_002233chr112474 455 ------
NM_002235chr1221326 325 11408 --1493
NM_002239chr21260 ------
NM_002247chr1021761 1615 11703 ----
NM_002264chr354624 4228 3436 3420 772 24165 3496 ----
NM_002265chr174786 779 760 337 ------
NM_002267chr1342321 2257 1654 938 ------
NM_002268chr311526 11501 ----
NM_002270chr5135273 5200 4771 4582 4388 4138 3858 3807 3777 2155 2109 489 48 --45575 4929 4911 476 11751
NM_002271chr1352468 2181 1754 777 80 1716 22150 417 1826
NM_002285chr283935 3227 3017 2695 1344 834 769 57 --31331 1266 946 14126
NM_002293chr152212 1969 1089 940 891 --1981 --
NM_002296chr161767 1731 701 446 353 281 11720 21548 626 11488
NM_002310chr585979 5952 5352 2392 2217 1482 1461 1448 36560 4819 4352 26017 1061 14184
NM_002335chr11147 ------
NM_002336chr1294556 4329 4266 3350 1277 1025 971 898 252 --11906 --
NM_002345chr123239 54 39 ------
NM_002351chrX2428 57 11228 31730 702 326 --
NM_002355chr122332 189 11086 1355 --
NM_002356chr6132879 2654 2355 2064 1831 1016 978 643 568 499 308 164 122 1800 ----
NM_002358chr44646 620 504 238 ------
NM_002359chr1731265 817 27 --12963 1981
NM_002374chr243644 3211 2257 1352 --33358 1454 476 12302
NM_002376chr142556 503 ------
NM_002380chr82383 345 ------
NM_002395chr611222 141 ----
NM_002397chr51775 11618 124 --
NM_002399chr1511261 ------
NM_002401chr1752145 1986 1961 698 407 11560 ----
NM_002402chr721153 246 ------
NM_002403chr1------1413
NM_002408chr144788 742 663 28 ------
NM_002425chr111272 135 ----
NM_002428chr161163 ------
NM_002430chr2242559 2182 2104 1804 --3929 209 126 --
NM_002442chr1231768 1465 422 11517 ----
NM_002444chrX61977 1963 1943 1783 1467 1243 11644 ----
NM_002449chr5--1254 ----
NM_002451chr91743 12931 12497 --
NM_002455chr1130 ------
NM_002467chr81109 1430 ----
NM_002480chr1251046 526 204 197 177 --1446 --
NM_002481chr1167901 7715 7573 6451 5576 5418 2852 2540 2429 1832 1614 775 615 420 217 206 17660 11501 --
NM_002482chr14659 481 128 38 ------
NM_002485chr871823 1806 833 753 704 664 545 21598 513 --11544
NM_002486chr942391 2026 787 30 1431 ----
NM_002487chr151119 1742 ----
NM_002493chr91273 ------
NM_002499chr1552169 1581 543 325 45 12467 1507 --
NM_002501chr1942550 1529 1446 1311 32628 2572 1272 12578 --
NM_002505chr611300 ----1131
NM_002509chr203672 666 654 ------
NM_002515chr1451977 1393 487 433 329 1731 189 11809
NM_002518chr241203 1192 484 395 ------
NM_002519chr112957 335 --1545 --
NM_002527chr12--182 ----
NM_002536chrX1453 1215 ----
NM_002538chr52606 121 ------
NM_002539chr2296 85 1315 ----
NM_002543chr1261538 1368 1339 1201 307 42 1516 135 --
NM_002545chr1194191 4054 3297 2072 2040 1286 528 135 100 14509 13362 --
NM_002547chrX74048 3817 3448 3323 3305 413 329 24267 3115 44219 3442 1284 61 --
NM_002577chr383937 3461 2792 2483 1355 1344 659 242 --53931 3711 3554 405 376 --
NM_002578chrX2469 416 1350 ----
NM_002581chr965505 4039 3868 3483 3467 1424 15376 13992 --
NM_002583chr121450 ------
NM_002588chr541737 680 667 568 ------
NM_002591chr202643 511 ------
NM_002592chr203295 282 264 --178 --
NM_002594chr2022210 1708 12328 ----
NM_002595chr1221855 213 2447 162 1135 --
NM_002600chr121250 538 1430 --11348
NM_002601chr2138 --1408 --
NM_002605chr1511197 11054 ----
NM_002610chr242181 1130 450 240 32735 2497 2267 1312 --
NM_002611chr171840 ------
NM_002612chr742076 742 290 278 12083 11792 11685
NM_002613chr1645397 4934 4180 3957 11606 1340 --
NM_002628chr32383 346 ----1897
NM_002648chr631314 966 851 ------
NM_002655chr884907 4298 4157 4076 3848 1306 1146 799 23444 1652 23268 834 12032
NM_002657chr2072507 2460 1394 1142 1080 946 921 23909 3807 129 --
NM_002687chr142820 484 1503 11262 1523
NM_002699chr121016 550 21227 561 ----
NM_002701chr6182 ------
NM_002706chr23533 135 110 143 ----
NM_002707chr2271 65 1276 ----
NM_002709chr223331 397 23018 965 ----
NM_002710chr122760 209 ------
NM_002718chr322690 1903 1140 ----
NM_002719chr1452324 2241 2058 766 483 11843 ----
NM_002720chr16--1259 ----
NM_002721chr91398 --1185 --
NM_002731chr163144 2970 2653 2092 822 251 1130 ----
NM_002734chr1711932 --1581 11992
NM_002736chr781971 1940 1464 810 804 553 484 109 22088 768 ----
NM_002737chr17116492 6338 6143 4893 4408 4290 4278 4269 2024 1401 420 14854 --25674 5479
NM_002738chr16176 ------
NM_002740chr352513 2421 966 456 231 32744 2497 2430 --32830 2524 240
NM_002742chr142528 515 ------
NM_002747chr1831959 1749 1579 11906 ----
NM_002748chr154963 173 133 53 21088 1075 1407 --
NM_002755chr151699 1174 ----
NM_002756chr172691 636 1890 ----
NM_002765chrX2243 52 1213 1183 --
NM_002767chr171511 ------
NM_002772chr212484 386 1111 ----
NM_002786chr111269 1247 ----
NM_002809chr171331 ------
NM_002814chrX5648 595 286 121 104 ------
NM_002815chr171166 ------
NM_002819chr1921247 1014 1139 ----
NM_002821chr66791 785 777 761 598 233 1798 ----
NM_002822chr1221644 1553 1146 2540 34 --
NM_002824chr121508 ------
NM_002828chr183968 707 330 --1750 --
NM_002833chr1511612 ------
NM_002835chr71783 ------
NM_002837chr1273745 3410 3395 3258 3072 1701 1087 23219 55 ----
NM_002839chr953234 2730 846 781 647 13359 21002 506 --
NM_002840chr13659 650 448 ------
NM_002841chr31124 --1666 --
NM_002843chr1143204 3172 3103 755 2992 83 12777 --
NM_002844chr631283 873 447 --21057 921 21433 189
NM_002849chr122808 220 ------
NM_002851chr73634 620 569 1776 --1735
NM_002858chr141240 1220 928 418 --196 --
NM_002868chr1262373 2366 2297 2070 1768 803 1547 12342 --
NM_002874chr932156 881 784 1253 ----
NM_002882chr22--186 ----
NM_002886chr3104700 3754 3704 3619 1954 943 937 472 457 395 24954 3288 34468 3421 1858 13240
NM_002887chr5--132 ----
NM_002890chr52958 346 ------
NM_002892chr1481661 1417 1341 690 604 462 446 249 ----21386 1189
NM_002894chr18----138 1207
NM_002901chr111142 --1181 --
NM_002906chr111823 --2612 530 --
NM_002912chr61909 ------
NM_002940chr431238 683 267 1586 1496 --
NM_002941chr3--31060 168 123 1505 --
NM_002942chr311191 --1905 --
NM_002943chr151187 ------
NM_002956chr121206 11043 11031 --
NM_002958chr35983 920 909 667 223 ----1306
NM_002959chr1114232 3544 3120 1519 1509 1401 1346 1249 952 292 286 --31759 1719 1395 --
NM_002971chr33817 303 296 11138 ----
NM_002973chr121589 1101 ----
NM_002979chr12703 150 --1808 --
NM_002994chr451659 274 122 55 40 21643 1301 --11954
NM_002997chr231389 1223 512 ------
NM_002998chr862251 892 479 371 297 86 --1857 --
NM_003010chr17--2887 85 ----
NM_003011chr9----173 11180
NM_003014chr721405 594 --1168 --
NM_003016chr172730 69 3580 400 256 ----
NM_003017chr641041 492 320 76 ----1426
NM_003026chr921171 840 ------
NM_003028chr943663 2774 2757 404 --1984 --
NM_003031chr1651008 1002 375 329 285 ------
NM_003032chr34922 863 610 332 ----12364
NM_003035chr11330 --1940 --
NM_003036chr131193 494 154 11027 ----
NM_003042chr31526 11373 ----
NM_003045chr1344784 4725 3135 915 ------
NM_003048chr222388 1075 22728 669 ----
NM_003060chr541314 1274 942 810 --11133 --
NM_003068chr811030 --11012 --
NM_003069chrX1166 ------
NM_003071chr33594 71 46 21784 542 11665 --
NM_003073chr221264 ----1301
NM_003074chr352182 2115 1747 1429 799 21984 325 21881 350 --
NM_003076chr1261623 1569 1149 648 333 85 11552 ----
NM_003079chr172941 54 ------
NM_003082chr143930 879 36 --1474 124
NM_003093chr62173 85 ------
NM_003095chr12161 ------
NM_003096chr2----1181 --
NM_003106chr32733 711 ----21069 407
NM_003107chr662441 2251 2189 2004 1639 423 12448 ----
NM_003108chr2116752 5761 5708 5570 5563 4847 1523 1067 1010 465 349 --47282 6602 5819 942 1240
NM_003111chr231243 1224 1136 --11021 --
NM_003112chr773230 3093 2730 1985 1295 1280 512 22642 1126 12850 12102
NM_003113chr22804 133 1114 2304 21 --
NM_003115chr11332 ------
NM_003129chr8----1279 --
NM_003136chr14--1308 ----
NM_003137chr651964 803 547 428 121 11821 ----
NM_003144chr672104 1771 1619 811 410 256 199 130 22134 1395 21550 294
NM_003155chr862612 946 832 529 271 67 --12410 --
NM_003161chr1762893 2717 2581 1321 1167 1109 --12360 --
NM_003173chrX1342 --1250 --
NM_003174chr102116 89 1705 ----
NM_003178chr321985 134 2670 318 ----
NM_003184chr8--1978 1726 --
NM_003185chr2031230 1212 111 ----11304
NM_003188chr61630 ------
NM_003189chr173420 2767 2542 2519 2126 332 246 ----12761
NM_003194chr62435 368 ----1389
NM_003199chr18115560 5171 4414 4231 4225 4219 4207 3688 2006 792 462 14238 32000 1781 930 --
NM_003201chr102989 419 --1291 --
NM_003202chr541916 1808 1361 1163 ----11344
NM_003206chr61416 ------
NM_003211chr1231635 189 39 ----1474
NM_003215chr431104 626 521 ------
NM_003217chr1262003 1971 1249 787 781 439 --11781 --
NM_003220chr621724 1681 21405 1151 1599 --
NM_003221chr613903 ------
NM_003222chr202436 305 ------
NM_003223chr166867 759 713 702 673 321 ------
NM_003234chr362419 2130 1805 1666 1567 922 1141 ----
NM_003242chr342457 2337 2244 1579 ------
NM_003246chr1551916 1895 1711 1395 174 ------
NM_003253chr2131583 617 585 11894 ----
NM_003255chr1772193 2097 2050 1934 1899 1878 985 --1710 --
NM_003259chr19------1154
NM_003262chr3105008 4401 4328 4230 3307 1803 1697 1152 898 313 24719 835 21332 1195 1452
NM_003270chrX31152 939 933 11100 ----
NM_003274chr2162605 922 870 799 387 356 32739 2181 1137 12020 1819
NM_003275chr9----1194 --
NM_003285chr11450 ------
NM_003286chr2021055 109 2375 251 ----
NM_003291chr13140 ------
NM_003292chr131894 1440 134 1410 11473 --
NM_003295chr13--1159 ----
NM_003298chr366105 5752 5203 3921 1572 497 --24162 1402 15799
NM_003304chr351271 1111 651 568 284 --2592 180 --
NM_003317chr143299 204 171 --1784 1659
NM_003319chr23278 240 107 ------
NM_003320chr1144374 4329 3917 3316 13882 ----
NM_003336chrX3837 267 140 --2742 243 --
NM_003337chr52549 267 11614 1375 --
NM_003338chr1031421 369 51 41661 1349 329 237 11975 --
NM_003340chr421124 888 ------
NM_003341chr31129 ----1436
NM_003342chr1722410 68 --13168 --
NM_003344chr7--21621 112 ----
NM_003347chr221144 ------
NM_003349chr2051410 1327 1111 533 57 ------
NM_003352chr21993 --1401 --
NM_003360chr42285 218 ------
NM_003362chr126961 840 785 632 400 205 3915 755 707 1847 --
NM_003367chr191108 ------
NM_003368chr11812 1128 1294 --
NM_003369chr1142634 2567 2502 2406 ----1821
NM_003370chr19----1639 1802
NM_003371chr982120 1897 1840 1670 1635 1613 455 112 12138 ----
NM_003374chr53773 742 596 ------
NM_003375chr10--1312 ----
NM_003376chr661798 1649 1382 1294 658 314 --11816 --
NM_003376chr661798 1649 1382 1294 658 314 --11816 --
NM_003379chr62732 716 173 ----
NM_003380chr10----199 --
NM_003383chr9--1157 ----
NM_003390chr1151098 884 835 308 109 1865 1975 --
NM_003392chr363585 3520 1587 1211 479 73 23648 81 43930 3310 1579 1416 12992
NM_003400chr23623 135 22 ------
NM_003403chr141239 ------
NM_003404chr2032000 1865 218 ------
NM_003405chr221600 ------
NM_003406chr821979 1371 21399 151 184 --
NM_003409chr1861289 1227 1066 576 566 423 11157 ----
NM_003410chrX62760 2391 2306 2183 1194 268 22062 1187 23102 1930 --
NM_003411chrY31260 648 68 11630 ----
NM_003413chrX42007 1924 415 87 ------
NM_003418chr3------1790
NM_003420chr33335 315 125 ------
NM_003423chr1952138 2003 1984 703 522 ------
NM_003427chr61649 ------
NM_003430chr1951612 1376 1215 409 241 ------
NM_003432chr52214 43 ------
NM_003439chr762699 2641 2318 1394 1087 801 12706 23086 281 1834
NM_003442chr114712 314 304 94 --139 --
NM_003452chr93671 355 57 21005 881 ----
NM_003453chr132484 107 ------
NM_003457chr17--1247 ----
NM_003458chr333804 3391 262 --1467 --
NM_003462chr121765 1369 ------
NM_003463chr653072 2398 2050 579 126 1678 ----
NM_003467chr24484 444 437 357 --1137 198
NM_003468chr231390 170 65 1419 14121 --
NM_003469chr21427 ----1341
NM_003472chr611229 1306 1617 --
NM_003477chr111614 ------
NM_003478chr1153035 2997 2736 2191 2153 1425 22063 689 --
NM_003482chr1262742 2485 2470 2463 2359 1923 22771 840 --12299
NM_003483chr1221036 96 21937 1810 --12055
NM_003487chr172284 60 ------
NM_003489chr2163421 3133 2305 1237 858 22 22756 824 ----
NM_003498chr1672529 2422 2060 1004 806 555 288 ------
NM_003505chr731886 1764 329 ----1347
NM_003506chr851202 1110 1055 907 530 11079 ----
NM_003507chr23642 618 594 ----11693
NM_003558chr93698 615 143 ------
NM_003565chr1221405 1102 ------
NM_003566chr1282733 2457 1222 1068 743 616 416 72 --33251 2856 882 12713
NM_003567chr12314 74 ------
NM_003574chr1885802 5110 4808 1734 1676 1047 1002 322 35096 4436 4050 35360 4389 543 --
NM_003576chr1352738 2613 1907 158 30 32328 293 253 --12050
NM_003580chr81106 ------
NM_003583chr1243051 2668 1278 452 43655 347 165 88 12590 1198
NM_003590chr293894 3673 3615 2886 2794 1055 667 483 350 1795 ----
NM_003592chr71481 ------
NM_003597chr252170 1852 800 222 103 1377 2468 208 --
NM_003603chr422066 642 11591 22115 657 --
NM_003615chr353684 3614 3603 3344 2887 1118 33646 2780 1282 1583
NM_003618chr221332 1108 ------
NM_003620chr175874 801 754 138 25 ------
NM_003622chr1252411 2265 1748 831 213 11637 139 --
NM_003626chr1121279 1222 --1316 1148
NM_003628chr21128 ------
NM_003629chr183453 3249 2515 2125 768 359 264 236 ----152
NM_003630chr62695 128 --1199 --
NM_003644chr1796610 5054 4572 4442 2348 2294 1556 1097 303 14152 11028 --
NM_003654chr11--2562 65 ----
NM_003659chr2148 ----11055
NM_003663chr363417 2375 1055 844 269 117 11012 13044 --
NM_003668chr12123 ------
NM_003670chr341327 1064 903 361 11181 170 --
NM_003671chr953353 3292 2822 848 376 ----11417
NM_003672chr161987 1669 719 692 466 239 11369 --1535
NM_003676chr11645 ------
NM_003677chr1241679 1521 902 323 ------
NM_003685chr194927 897 818 643 1735 --1715
NM_003692chr92154 54 1187 1173 --
NM_003701chr132953 918 1214 ----
NM_003705chr23786 223 205 ------
NM_003713chr12482 27 --1433 --
NM_003716chr32877 713 ------
NM_003722chr352591 2457 2004 1852 1053 --32416 1943 774 --
NM_003735chr541737 680 667 568 ------
NM_003736chr541737 680 667 568 ------
NM_003741chr31378 ------
NM_003743chr22785 187 --11769 --
NM_003744chr1431128 1084 376 --1863 --
NM_003749chr1352137 1805 1592 326 98 ----11796
NM_003750chr101964 --1697 --
NM_003759chr474218 3689 1396 937 539 193 155 --23378 240 24058 2640
NM_003762chr111234 11184 ----
NM_003763chr2052598 2021 671 194 188 1427 ----
NM_003768chr111527 ------
NM_003772chr1121019 167 1929 1905 --
NM_003774chr1253305 3165 2893 1184 233 13212 ----
NM_003777chr71557 ------
NM_003783chr12277 89 ----21223 1091
NM_003784chr182589 238 --2702 620 --
NM_003786chr171359 ------
NM_003787chr182512 88 --31410 1353 102 --
NM_003794chr32916 682 ------
NM_003795chr61135 ------
NM_003800chr641659 1644 1528 1507 11517 32250 2010 580 --
NM_003816chr851498 1474 1238 335 240 --11225 --
NM_003822chr132944 2008 894 12415 1914 --
NM_003825chr1561289 611 573 555 352 82 --21096 486 --
NM_003831chr1821575 415 11518 --11314
NM_003845chr12187 ------
NM_003861chr1442674 2648 2217 1888 ------
NM_003864chr4153 ------
NM_003870chr1551608 1582 755 551 295 1629 ----
NM_003873chr102602 590 12064 11986 --
NM_003877chr121957 ------
NM_003878chr81195 ------
NM_003884chr351854 1781 1430 1291 649 11670 168 --
NM_003885chr1752485 2369 2304 137 68 --1779 --
NM_003887chr231564 1558 1445 1173 21551 1415 --
NM_003888chr1521481 323 ------
NM_003893chr10----1493 --
NM_003895chr2141625 428 301 202 12231 ----
NM_003899chr1372337 1766 954 668 595 295 289 12021 ----
NM_003901chr1052640 2374 2073 703 92 1182 11771 --
NM_003902chr12788 103 1217 1827 --
NM_003906chr21--150 ----
NM_003908chr201320 11176 ----
NM_003909chr842332 2295 2137 286 --1628 --
NM_003913chr6104087 3722 3027 2963 2842 1375 1030 988 857 350 --33356 1316 1278 11391
NM_003921chr161799 1786 1197 332 237 105 21265 1156 1379 --
NM_003922chr151372 1171 ----
NM_003924chr431671 1400 1318 21431 1254 ----
NM_003927chr182844 331 --1226 --
NM_003930chr732422 2283 1678 --1448 21890 255
NM_003931chr6--1517 ----
NM_003934chr921161 381 21241 73 21333 349 --
NM_003947chr331337 1266 873 --1412 --
NM_003948chr442647 2631 2593 2180 ----11715
NM_003953chr142187 2162 413 255 --32796 572 561 --
NM_003955chr1771456 1418 1387 1302 1296 1290 1284 --11277 --
NM_003966chr5106629 6406 2912 2789 2663 2048 1873 1820 1328 281 22177 161 22187 327 1236
NM_003971chr171415 ------
NM_003972chr102484 365 1389 ----
NM_003980chr641493 1126 461 343 21325 1188 ----
NM_003983chr1674165 3792 3704 3175 3108 694 247 --1398 --
NM_003994chr1253846 3785 3321 2934 1496 13957 ----
NM_003998chr41615 ------
NM_004006chrX42588 2300 2118 666 1121 ----
NM_004007chrX42588 2300 2118 666 1121 ----
NM_004009chrX42588 2300 2118 666 1121 ----
NM_004010chrX42588 2300 2118 666 1121 ----
NM_004011chrX42588 2300 2118 666 1121 ----
NM_004012chrX42588 2300 2118 666 1121 ----
NM_004013chrX42588 2300 2118 666 1121 ----
NM_004014chrX42588 2300 2118 666 1121 ----
NM_004015chrX42588 2300 2118 666 1121 ----
NM_004016chrX42502 2214 2032 580 135 ----
NM_004017chrX42588 2300 2118 666 1121 ----
NM_004018chrX42502 2214 2032 580 135 ----
NM_004020chrX42588 2300 2118 666 1121 ----
NM_004021chrX42502 2214 2032 580 135 ----
NM_004022chrX42502 2214 2032 580 135 ----
NM_004023chrX42502 2214 2032 580 135 ----
NM_004028chr1853468 2791 1321 855 308 13483 ----
NM_004035chr1764750 4521 4130 1624 1196 954 24609 368 14470 --
NM_004040chr231262 1085 850 1967 11347 --
NM_004046chr18137 ------
NM_004060chr521213 374 1865 ----
NM_004061chr52262 195 1491 ----
NM_004067chr751290 1251 998 314 218 11050 ----
NM_004080chr711373 --2546 128 1183
NM_004081chrY61852 1740 1174 622 231 150 --21598 1202 21510 420
NM_004087chr321581 1270 1656 178 --
NM_004089chrX41287 1029 813 68 ------
NM_004094chr144932 568 501 77 2966 782 ----
NM_004096chr1051894 1549 770 674 307 22144 507 ----
NM_004098chr1021119 498 ------
NM_004100chr641057 1011 227 200 --12258 --
NM_004105chr22849 230 2954 188 --1412
NM_004117chr621713 459 12180 11660 11529
NM_004124chr14103436 2566 2499 2339 2320 2170 1162 1025 711 648 13228 13552 12222
NM_004126chr72288 53 --1184 --
NM_004130chr31572 ------
NM_004136chr1563189 3020 2505 2261 1230 349 12917 12729 12346
NM_004145chr192377 354 ------
NM_004161chr231497 1030 346 11292 ----
NM_004170chr91556 1355 ----
NM_004171chr11159509 7364 6873 6700 5832 3835 3119 2392 1962 1761 1334 1177 1164 593 183 48575 6080 2783 1855 25998 2601 27219 3434
NM_004172chr562058 1910 1322 640 402 227 ------
NM_004180chr21405 2419 53 ----
NM_004205chr11--1541 ----
NM_004225chr831438 1251 597 ------
NM_004229chrX42114 746 367 356 21693 1645 1788 --
NM_004232chr1883379 3338 3235 1283 1008 407 205 113 23510 1266 --23001 498
NM_004235chr92872 735 ------
NM_004237chr52918 329 ------
NM_004238chr21306 ----1266
NM_004242chr6--1288 1320 --
NM_004244chr12----1439 --
NM_004253chr92715 44 ------
NM_004261chr14807 677 302 79 --2938 103 --
NM_004263chr241621 1536 514 303 ------
NM_004268chr112459 241 1109 1821 --
NM_004272chr541910 1663 1567 448 11873 ----
NM_004274chr1453186 2041 1160 487 232 --22459 730 --
NM_004279chr742349 889 866 267 --21883 172 --
NM_004281chr10--195 ----
NM_004286chr2232211 1998 1754 ----1273
NM_004290chr541360 1333 1156 37 1871 ----
NM_004291chr5--1424 --1102
NM_004293chr942763 1110 877 676 13267 ----
NM_004302chr1262959 2809 2674 2599 1104 979 12379 ----
NM_004326chr14970 382 376 204 --2988 456 --
NM_004329chr1021347 232 2258 48 ----
NM_004331chr841674 726 624 451 1115 12554 --
NM_004338chr18105434 4964 4725 2746 2451 2173 1980 1571 647 132 14977 26840 4836 26153 5926
NM_004342chr732303 2054 383 1515 1377 11448
NM_004346chr42384 24 ------
NM_004349chr831125 873 84 ------
NM_004354chr42728 651 ------
NM_004360chr1621909 70 ------
NM_004364chr1911040 ------
NM_004365chr52269 230 ------
NM_004380chr1652025 1011 959 254 207 ------
NM_004384chr541989 1971 370 212 11440 22370 2177 --
NM_004392chr1372482 2076 1641 926 687 321 166 12546 --11910
NM_004393chr32835 398 22410 2330 --1493
NM_004395chr51736 ------
NM_004396chr172190 32 ------
NM_004397chr11104304 4213 2991 2725 2655 2633 1130 541 420 87 1249 23724 1006 --
NM_004412chr10115676 4668 4491 4187 4091 3793 3759 2380 1892 950 711 25889 5476 1381 --
NM_004417chr52530 451 ------
NM_004426chr123695 424 333 --1495 --
NM_004428chr11785 --1743 --
NM_004429chrX51363 1357 1093 420 112 1371 11397 --
NM_004430chr832230 1720 694 32787 2512 1821 ----
NM_004432chr941999 1905 385 87 1227 --11671
NM_004437chr1103185 2586 1310 1229 1027 925 630 443 269 260 1905 11303 --
NM_004440chr621890 1500 21339 1265 ----
NM_004447chr12133 ------
NM_004448chr171502 --1219 1483
NM_004449chr2161163 1105 391 304 275 175 ------
NM_004454chr352135 2129 1406 814 84 ------
NM_004457chr211577 ----1299
NM_004458chrX42422 1651 284 178 22649 256 ----
NM_004459chr1742081 1498 1333 546 32000 125 83 ----
NM_004463chrX4613 601 148 140 --1592 --
NM_004464chr474344 4126 3631 2913 632 414 160 1597 14297 --
NM_004480chr145550 526 520 514 504 --1827 --
NM_004481chr141904 1814 960 581 12393 --12355
NM_004482chr21655 --2364 76 --
NM_004491chr1984272 4256 4184 3061 2911 1729 1287 826 ------
NM_004500chr144688 557 215 205 1286 21858 1422 --
NM_004501chr153697 3034 2649 557 329 11633 ----
NM_004504chr262809 2557 2481 1112 997 640 --11052 1116
NM_004505chr1742025 1324 570 435 ------
NM_004506chr62695 667 ------
NM_004514chr1753052 2225 559 553 458 22443 2037 1954 --
NM_004516chr1911212 ----1175
NM_004520chr51269 ------
NM_004523chr101527 ------
NM_004524chr17------2281 205
NM_004525chr241143 1112 942 148 ------
NM_004529chr9254 40 ----11463
NM_004535chr202498 321 ------
NM_004537chr1251465 1409 1113 131 125 ----1250
NM_004543chr21107 ------
NM_004571chr2153352 2926 1054 136 61 13416 12943 --
NM_004575chr451579 1481 1204 1196 1132 21514 356 11255 --
NM_004576chr52284 76 --1374 158
NM_004578chr12907 702 --2609 71 --
NM_004586chrX55338 4231 1382 1265 459 14876 24772 4382 25087 4945
NM_004595chrX4310 304 185 110 ------
NM_004596chr191217 ------
NM_004598chr543089 2745 205 28 11301 1530 --
NM_004600chr141457 550 529 275 ------
NM_004612chr9134574 4457 3948 1601 1519 1485 1465 1277 786 774 665 291 269 23719 1560 24211 478 14449
NM_004615chrX1748 ------
NM_004622chr231919 1823 1784 --21709 623 --
NM_004627chr212158 83 ------
NM_004642chr123229 220 112 ------
NM_004643chr146866 714 706 690 684 567 ------
NM_004654chrY2201 46 --11115 --
NM_004655chr1761266 1215 1024 896 881 450 ------
NM_004660chrY32293 2090 528 --2851 577 --
NM_004661chr5--11084 ----
NM_004663chr1551236 1162 974 556 333 --1136 --
NM_004666chr631313 420 213 1526 ----
NM_004671chr18----1311 --
NM_004673chr131473 1361 456 11103 --1115
NM_004674chr8264 58 ------
NM_004685chr1372751 2208 2015 1974 809 554 521 ------
NM_004687chr1741825 1620 1381 537 ------
NM_004694chr17--2819 205 ----
NM_004701chr152159 120 ------
NM_004703chr1711957 2849 41 ----
NM_004707chr531387 540 70 ------
NM_004715chr181176 1167 ----
NM_004718chr2129 ------
NM_004719chr1232670 2218 642 --21875 721 --
NM_004725chr1051135 575 269 256 145 --11386 --
NM_004726chrX145522 5383 4968 4460 4295 3969 3710 1840 1833 1701 1568 1411 1397 292 23657 652 13599 --
NM_004730chr5------21939 266
NM_004731chr124299 281 67 55 --11839 1162
NM_004733chr3147 ------
NM_004734chr1332954 2048 1212 13222 ----
NM_004736chr142147 1911 1761 619 2796 417 ----
NM_004740chr17136 ------
NM_004744chr463905 3754 3324 1216 990 309 --12797 --
NM_004745chr8106895 6360 5514 5128 4361 2409 1747 1477 1364 756 15579 14863 17042
NM_004747chr1031420 1329 1018 ------
NM_004760chr782350 2281 1879 1753 1735 577 521 444 ----11711
NM_004762chr1731985 1971 1893 11946 11853 --
NM_004772chr5--11265 --1174
NM_004774chr1773085 3016 2896 2497 1975 309 212 22030 622 ----
NM_004775chr1872241 1768 1489 815 677 563 397 --11947 12042
NM_004779chr531214 488 213 31316 974 164 ----
NM_004781chr121120 153 ------
NM_004781chr121120 153 ------
NM_004785chr161360 ------
NM_004788chr1142416 2363 2219 1061 --31849 1753 650 --
NM_004791chr131118 ------
NM_004792chr21197 ------
NM_004794chrX----144 --
NM_004796chr14102182 2174 1897 1693 1652 1525 612 436 149 30 ------
NM_004798chr2033588 1254 561 ------
NM_004800chr13284 66 ------
NM_004808chr1062981 2490 2273 2195 674 314 32298 1309 1181 12249 --
NM_004817chr93794 603 566 ----1542
NM_004818chr12157 ----1515
NM_004821chr5------1674
NM_004824chr621261 163 ----11431
NM_004831chr191693 ------
NM_004834chr263091 2417 2348 1011 897 39 11182 ----
NM_004836chr22669 187 1848 ----
NM_004845chrX73933 3857 3644 2988 1629 649 145 ------
NM_004850chr231425 1419 511 --21445 1408 --
NM_004855chr151211 ------
NM_004857chr1463939 3732 2914 1695 1010 607 14562 --1412
NM_004859chr1752310 1937 980 934 860 32475 1187 53 1972 --
NM_004863chr1495186 4615 4394 3732 2043 1957 1437 614 522 11964 11827 --
NM_004866chr594888 4699 4013 3764 1765 1749 1532 1506 1093 --13540 11345
NM_004867chrX2464 199 ------
NM_004869chr1831611 1243 316 ----1543
NM_004871chr1743038 2917 336 290 1212 34301 3266 2897 --
NM_004873chr1463121 3012 751 618 516 325 22970 254 12931 12124
NM_004874chr82379 189 ------
NM_004879chr112301 238 ------
NM_004883chr5--1199 ----
NM_004893chr52158 111 1178 ----
NM_004896chr1041237 1201 619 125 1523 ----
NM_004897chr101119 --1729 --
NM_004898chr431994 945 691 --1746 --
NM_004902chr20--1322 ----
NM_004904chr795861 4980 2519 2310 2050 1958 605 240 155 24130 862 25414 4305 --
NM_004906chr63143 130 117 --2534 470 1608
NM_004912chr71480 --21292 51 --
NM_004921chr162496 2463 2355 2188 1757 270 1650 ----
NM_004926chr1441863 1685 1332 1311 ------
NM_004927chr112583 280 ----11425
NM_004932chr521783 1659 11302 ----
NM_004936chr922684 1185 --12706 --
NM_004946chr51416 1333 ----
NM_004947chr331903 1688 1601 12333 ----
NM_004949chr1872177 1780 1754 1348 852 773 312 ----11858
NM_004956chr774438 1506 1120 765 526 300 29 --11494 --
NM_004958chr1131 ------
NM_004960chr162236 101 ------
NM_004965chr21----195 1303
NM_004966chr10------1998
NM_004967chr41497 ------
NM_004972chr94962 820 772 51 --1167 1376
NM_004973chr621255 92 --21767 1714 --
NM_004985chr12113815 3312 3003 2960 2861 1735 1542 1312 921 208 201 1427 43399 1620 909 168 --
NM_004992chrX117016 7005 5693 5412 3271 3095 2133 1967 1483 992 187 37041 2754 1954 28280 5425 12303
NM_004992chrX117016 7005 5693 5412 3271 3095 2133 1967 1483 992 187 37041 2754 1954 28280 5425 12303
NM_004993chr1431230 976 231 --11502 --
NM_004996chr1641702 594 508 320 11196 21184 426 --
NM_004999chr6104146 3809 3211 2876 1745 1714 1187 947 763 751 11627 13744 11253
NM_005011chr741858 1506 1361 110 --1497 --
NM_005016chr121234 ------
NM_005022chr172217 207 ------
NM_005023chr571514 1485 1286 1095 614 146 104 ------
NM_005028chr1021900 1504 12314 31936 1752 467 --
NM_005036chr2288335 8204 5830 3173 1928 1404 1387 932 --11490 --
NM_005045chr72861 832 ------
NM_005053chr192585 56 ------
NM_005054chr211438 --11522 --
NM_005056chr1295389 4863 4363 4265 3951 3798 1977 994 977 21931 1389 ----
NM_005057chr151871 1214 723 707 400 11181 ----
NM_005063chr1063481 3429 2511 1338 869 362 --23189 302 --
NM_005065chr1454127 3842 3721 2112 1141 --1672 15023
NM_005066chr1140 1779 ----
NM_005067chr33971 812 650 164 1992 --
NM_005078chr1541459 1442 1429 656 11865 ----
NM_005080chr223773 651 37 ------
NM_005087chr32828 759 ----196
NM_005088chrX1722 ------
NM_005093chr2075236 3789 1660 1374 1355 1340 705 15182 ----
NM_005102chr23794 653 210 1319 ----
NM_005104chr62597 554 1758 ----
NM_005109chr382394 2383 2352 1832 1826 1623 787 478 1733 --1132
NM_005112chr42918 772 1851 --1700
NM_005114chr42551 204 ------
NM_005116chr2064472 4418 4372 3386 1731 1319 --34324 3061 1507 14449
NM_005119chr141008 978 340 252 ------
NM_005121chr1773517 3500 3367 2531 1045 966 794 13299 --23152 459
NM_005124chr62882 762 ------
NM_005125chr111150 ------
NM_005126chr311947 --11878 12073
NM_005134chr182989 23 1726 --1810
NM_005135chr1573871 3828 3590 3289 2950 1330 719 --22389 235 --
NM_005151chr1832251 2212 684 12168 21875 784 --
NM_005156chr9115056 4645 4163 4085 3911 3698 1414 1142 987 955 888 12005 34327 3954 3319 24970 1219
NM_005159chr1562281 2132 1561 494 204 62 --11886 --
NM_005160chr22176350 6304 5812 5454 5307 5038 4307 4267 2605 2408 1519 1386 1283 1231 756 731 405 26761 1297 1767 --
NM_005163chr142905 145 2668 82 ----
NM_005168chr241785 1395 471 336 ----1210
NM_005171chr12166 --2890 523 11073
NM_005180chr101587 ------
NM_005184chr1931543 1276 1023 ------
NM_005188chr11167876 7612 5982 5575 5470 5452 5064 2840 2704 2533 2079 1748 1222 582 204 108 11712 57831 6092 2650 1137 1000 15894
NM_005190chr61416 1804 1150 --
NM_005192chr141130 ------
NM_005197chr14115751 5337 4799 4009 1554 1527 1521 1514 1508 1502 111 ----25145 3967
NM_005201chr32922 339 ------
NM_005203chr10166 ------
NM_005204chr101901 1919 ----
NM_005207chr2283564 3277 2884 2686 1220 584 550 288 1914 12659 --
NM_005214chr2--11073 ----
NM_005222chr71953 ------
NM_005229chrX1453 ------
NM_005230chr122226 169 2615 233 ----
NM_005233chr312508 1660 ----
NM_005235chr286161 5992 3094 2962 2372 647 103 77 17316 --14986
NM_005238chr1153430 2653 1373 1319 515 2667 418 43524 3470 2346 933 --
NM_005239chr2141760 1263 757 733 ----1814
NM_005241chr31467 --11021 --
NM_005242chr511316 --11129 --
NM_005243chr221322 ------
NM_005245chr43730 490 217 1743 1769 1698
NM_005252chr142711 616 1643 1537 --
NM_005254chr153927 345 289 11400 1216 --
NM_005256chr111621 ------
NM_005257chr1821126 140 ----11379
NM_005259chr231125 353 205 --1223 --
NM_005273chr7----1340 --
NM_005277chr431901 1760 397 ------
NM_005281chr12710 266 ------
NM_005295chr7143 ------
NM_005296chrX1408 ----1147
NM_005302chr71296 ----162
NM_005311chr722112 485 11763 22139 1813 --
NM_005313chr1511044 ------
NM_005316chr114787 744 418 404 ------
NM_005318chr2261263 1160 1050 894 813 414 ------
NM_005328chr8--2779 512 ----
NM_005329chr1652238 2175 2128 1973 850 --12346 --
NM_005336chr231955 1886 1417 ------
NM_005339chr433712 1675 1239 21705 413 1881 1964
NM_005342chrX42424 1847 823 381 1685 --1670
NM_005349chr42626 575 --1247 --
NM_005354chr191491 ------
NM_005358chr135750 670 353 159 89 ------
NM_005359chr18146551 5335 4999 2407 2293 2254 2105 2008 1933 1921 1732 1503 1440 616 11822 24270 1110 --
NM_005375chr64861 345 210 161 ------
NM_005376chr111028 --21074 222 --
NM_005378chr21666 ------
NM_005381chr23397 335 329 156 ----
NM_005385chr362603 1948 1834 443 359 351 1777 11082 --
NM_005392chr931877 1517 201 21660 1276 ----
NM_005397chr774033 3844 3661 3586 3204 1173 550 --23109 3063 --
NM_005398chr1031212 911 25 1459 ----
NM_005399chr1104422 3546 1613 1582 1021 954 894 864 656 70 --1470 --
NM_005400chr233108 1210 83 21972 1065 12638 --
NM_005406chr185448 442 326 169 133 --21025 469 --
NM_005409chr44896 771 757 195 ------
NM_005414chr3144 ------
NM_005415chr2----1105 1795
NM_005426chr13788 782 666 1932 1898 --
NM_005433chr1852719 2164 2114 1040 553 1108 2484 448 11738
NM_005436chr1073465 3455 3443 3422 2907 1561 1217 --14103 --
NM_005440chr1732507 2210 567 ------
NM_005445chr101100 ------
NM_005450chr171227 ------
NM_005460chr51508 ------
NM_005461chr2051967 1945 1770 1570 590 21868 1818 ----
NM_005465chr12762 197 --2353 191 --
NM_005475chr1213310 12024 12108 --
NM_005476chr9--165 --11303
NM_005487chr2232056 1653 780 11429 --12033
NM_005493chr63607 591 115 ------
NM_005497chr1776170 5818 4714 2247 1565 1341 1105 14998 31273 1260 293 2561 472
NM_005499chr192526 197 1469 ----
NM_005502chr913045 --2511 243 --
NM_005504chr1295925 5014 4925 4665 4085 1833 1462 670 502 26057 859 15897 26115 5771
NM_005506chr42795 583 12734 ----
NM_005509chr53675 664 343 1111 ----
NM_005517chr151322 1083 237 157 73 1342 ----
NM_005524chr32262 126 ------
NM_005530chr152394 240 ------
NM_005539chr104905 535 313 226 ----1322
NM_005542chr781910 1520 1442 1400 1227 691 362 192 --11706 --
NM_005562chr111269 11480 ----
NM_005565chr52431 390 --1606 --
NM_005570chr181986 --21127 426 11119
NM_005573chr53688 286 162 ------
NM_005576chr151296 1228 ----
NM_005578chr375108 4472 4450 3790 2022 1934 1070 24396 1246 35029 1658 360 11671
NM_005585chr152389 141 ------
NM_005587chr151971 --1309 --
NM_005591chr1172768 2186 2016 2010 1085 436 165 1501 32065 1724 542 --
NM_005595chr13955 866 643 --1633 --
NM_005596chr9116308 5426 4949 4746 4345 3995 3944 1859 1792 1769 454 --55517 5202 4379 2331 1004 --
NM_005604chr652399 2250 1910 1874 1739 ----11842
NM_005605chr82273 210 ------
NM_005607chr83668 247 198 --1694 --
NM_005610chr12657 638 1709 1309 --
NM_005611chr1621127 197 11029 1836 --
NM_005613chr132051 1920 319 ------
NM_005618chr61489 --1601 --
NM_005627chr63786 740 623 1697 ----
NM_005631chr711087 ------
NM_005634chrX2463 141 ------
NM_005637chr1891926 1643 1624 1610 1604 1596 1430 703 667 --1106 --
NM_005638chrX51516 1508 433 416 323 21622 295 ----
NM_005639chr1241927 1905 1436 1265 1362 --11367
NM_005642chr53498 151 27 ------
NM_005647chrX63243 3148 2859 2527 1198 564 --13065 23267 179
NM_005648chr81142 ------
NM_005650chr2221323 1211 ------
NM_005655chr831257 1199 1024 --1505 --
NM_005657chr151116 ------
NM_005660chrX----1228 --
NM_005665chr1154946 4678 4633 4248 4219 3102 1843 1779 1713 951 944 822 502 484 156 --21485 1442 14756
NM_005667chr2174 ------
NM_005668chr564324 3846 1686 1285 971 522 --13493 --
NM_005685chr7----1100 --
NM_005688chr3----21124 214 --
NM_005708chr131329 ------
NM_005711chr52777 95 1151 1434 --
NM_005713chr51105 ------
NM_005717chr141255 1196 502 319 ------
NM_005721chr21195 ------
NM_005722chr282344 2304 1990 1640 1606 777 603 129 ----1328
NM_005725chr13666 574 532 ------
NM_005733chr51183 ------
NM_005734chr114704 672 252 187 ------
NM_005738chr751773 1448 1440 686 655 11942 22015 1476 --
NM_005739chr1532406 1628 1572 12057 12386 11920
NM_005742chr23793 622 326 ------
NM_005746chr762652 2502 2014 1865 1805 1775 1812 1424 11013
NM_005748chr1283073 2544 1185 874 624 559 456 120 ------
NM_005751chr71453 ------
NM_005759chr254423 3887 3757 3075 44 23610 1754 13725 14519
NM_005762chr19--1130 ----
NM_005766chr132347 149 --1505 --
NM_005767chr132307 65 ----1126
NM_005768chr122571 150 --1717 --
NM_005776chr14--1707 ----
NM_005779chr552717 2707 2540 794 523 11254 33110 2778 1048 --
NM_005780chr13----1374 --
NM_005789chr1722104 402 2607 123 ----
NM_005797chr1131476 1299 211 --11661 11275
NM_005798chr13103816 3355 3335 2076 1992 946 938 595 389 24 25204 4057 14332 24909 2018
NM_005801chr174763 746 739 187 ------
NM_005802chr91744 ------
NM_005807chr1--1123 ----
NM_005808chr352734 2535 1342 858 151 22561 2378 1472 --
NM_005813chr242222 779 543 356 12310 ----
NM_005822chr662067 1960 1719 1712 1470 876 ------
NM_005826chr12447 417 1513 1161 --
NM_005828chr1791676 1393 1368 1098 978 936 440 222 103 11533 ----
NM_005832chr3--1171 11316 --
NM_005839chr16892 696 682 367 341 329 ------
NM_005840chrX56574 5873 5706 1432 705 27059 6844 1911 1212
NM_005841chr45388 76 70 64 57 ------
NM_005842chr131635 1483 2275 120 --
NM_005843chr251755 1727 1487 244 163 --11233 11449
NM_005845chr1331732 328 206 1341 21350 50 11156
NM_005857chr14974 946 429 221 2208 77 11274 11114
NM_005859chr511232 --21474 520 --
NM_005862chr32269 111 1887 ----
NM_005863chr105996 920 557 124 60 1525 ----
NM_005868chr742290 697 256 169 ----11673
NM_005871chr1041067 1018 684 677 11101 ----
NM_005880chr1641570 563 551 304 11247 1543 --
NM_005884chr192800 166 ------
NM_005885chr521415 1368 1100 ----
NM_005895chr1293551 3517 3474 3196 3073 544 477 106 83 24024 3755 12754 1859
NM_005898chr1132635 2211 950 13020 12679 --
NM_005899chr1721512 1083 1409 1227 --
NM_005900chr41435 ----1961
NM_005901chr18168690 8490 7429 6633 6545 6072 3448 3431 2767 1581 1549 1048 675 665 658 474 36249 2886 1224 57564 6306 6150 1792 1327 13165
NM_005902chr1553674 1816 1530 1503 583 14011 ----
NM_005903chr585208 3994 1754 1089 1010 579 515 383 --11786 1872
NM_005904chr1841471 1437 215 113 ------
NM_005907chr631667 1587 278 1232 2218 135 --
NM_005909chr564057 3290 2678 1505 599 563 --21463 168 --
NM_005920chr163844 2833 1340 1042 939 537 --1843 --
NM_005923chr61484 1518 ----
NM_005924chr72328 138 11142 ----
NM_005933chr1122505 943 ------
NM_005935chr453646 3638 1948 946 481 11442 25153 4919 13497
NM_005937chr1743316 1637 1540 1526 13013 ----
NM_005941chr873653 1310 1060 1045 801 416 227 11129 ----
NM_005955chr1125267 5236 4917 4575 4401 3783 3665 3432 1871 431 395 374 ------
NM_005962chr1011583 --11795 --
NM_005962chr1011583 --11795 --
NM_005964chr1721202 1092 ------
NM_005966chr232356 1904 949 --12069 22125 1817
NM_005975chr20----1804 --
NM_005977chr132879 30 1251 ----
NM_005989chr71526 ----1613
NM_005999chr141495 1253 1112 982 ------
NM_006007chr9113983 3812 3803 3796 3626 2838 1349 1207 1182 653 108 21519 36 --11323
NM_006011chr1554011 3965 3179 856 769 ------
NM_006015chr111095 1398 ----
NM_006016chr632114 1433 515 ----11787
NM_006020chr1421010 555 11378 ----
NM_006035chr1421326 159 11228 21254 386 --
NM_006036chr2152 22189 1869 22412 449 --
NM_006037chr264437 3500 1915 1826 1797 1729 21710 1694 24427 3391 11502
NM_006047chr2063535 3515 3086 2686 1145 628 1997 --12468
NM_006060chr784170 4050 3607 3228 3154 412 141 134 --13543 --
NM_006063chr2172 ------
NM_006067chr163944 829 299 1166 --1416
NM_006079chr63262 202 191 1280 ----
NM_006080chr742876 2533 2323 284 12301 1740 --
NM_006086chr161232 ------
NM_006089chrX41898 1816 280 161 --2663 84 --
NM_006090chr12722 695 ------
NM_006094chr831525 861 771 ------
NM_006095chr474355 4238 3690 3233 1425 1374 553 --2910 227 --
NM_006100chr33243 212 40 2557 228 ----
NM_006106chr1182140 1367 1352 880 739 730 723 86 ------
NM_006107chr172507 337 --1157 --
NM_006108chr1142055 1526 133 101 11537 --2919 691
NM_006135chr1--1422 11228 --
NM_006136chr741234 334 220 37 --1283 --
NM_006139chr252793 2220 1946 588 214 --12489 --
NM_006141chr1632447 2203 1075 42374 1951 982 887 199 12266
NM_006153chr32267 227 ------
NM_006154chr153670 103 42 42764 1141 218 29 1359 --
NM_006157chr112102 85 ------
NM_006158chr811451 ------
NM_006160chr1721072 623 ------
NM_006164chr2----136 --
NM_006166chr1252646 1945 1659 860 677 ------
NM_006180chr921581 569 ------
NM_006186chr21476 ------
NM_006187chr1212628 --12357 12961
NM_006190chr21297 --1946 --
NM_006195chr951395 1085 435 146 79 ------
NM_006197chr861991 1966 454 284 234 205 ------
NM_006202chr1941495 616 407 136 ------
NM_006203chr5135470 5422 4932 3960 3449 1958 1863 1334 1268 1174 941 695 502 34420 1239 225 21094 173 35609 1485 876
NM_006206chr422912 1839 --21100 774 --
NM_006207chr81304 ----1248
NM_006209chr83154 59 27 --1436 --
NM_006211chr8----1233 --
NM_006212chr1115394 5074 5047 4027 3805 3593 1548 1468 943 863 781 1834 33385 638 238 25301 1167
NM_006235chr1111325 ------
NM_006237chr1352267 2248 2128 905 852 --1927 --
NM_006246chr1441059 388 267 74 11106 ----
NM_006251chr552995 2795 2766 926 506 --12986 --
NM_006252chr1127432 7379 6066 5524 5223 4648 4627 2688 2118 1860 1009 743 34739 2284 2247 46591 5201 1224 531 16465
NM_006256chr122298 982 1117 22647 100 --
NM_006265chr831477 1385 952 --2410 116 --
NM_006268chr1151159 1035 1012 820 387 11215 ----
NM_006275chr2031647 344 279 1885 --1666
NM_006281chr811142 123 ----
NM_006281chr811142 123 ----
NM_006282chr20124482 4389 4224 3250 3037 1720 1288 878 439 310 295 246 34694 4366 2997 13664 11692
NM_006283chr893577 3463 3082 1642 1448 1070 931 691 358 --14130 --
NM_006289chr91358 ------
NM_006300chr1912357 --11933 --
NM_006304chr71127 ------
NM_006306chrX44802 4599 1680 498 33830 1939 1806 14104 --
NM_006311chr17--1313 150 1260
NM_006312chr121609 ------
NM_006313chr1221600 213 --1401 --
NM_006315chr462943 2936 1203 1057 442 331 12781 13893 14548
NM_006325chr12137 ------
NM_006328chr111110 ------
NM_006329chr14--1512 ----
NM_006330chr821649 77 --11173 --
NM_006335chr1--182 ----
NM_006345chr41488 2458 233 ----
NM_006350chr5----152 --
NM_006352chr1112039 1554 830 773 395 366 359 319 213 127 87 --21801 351 --
NM_006353chr651032 392 229 143 74 ------
NM_006359chrX3673 264 189 ----1944
NM_006364chr1431154 902 827 ----1247
NM_006366chr631251 991 458 1838 ----
NM_006369chr1----1436 --
NM_006374chr23591 535 44 ------
NM_006375chrX31418 769 462 31432 1221 246 ----
NM_006378chr931332 223 60 11404 ----
NM_006379chr731936 569 131 ----1540
NM_006380chr1763829 1672 1513 1226 1111 522 1276 23361 2765 --
NM_006386chr2261852 1592 697 379 150 60 ----1892
NM_006390chr1251748 1462 1188 618 320 11230 ----
NM_006393chr1064465 3200 1600 1481 1412 945 12900 13219 --
NM_006401chr91393 ------
NM_006407chr321433 83 21129 951 --1465
NM_006413chr1041434 332 319 134 ------
NM_006420chr2053412 3044 655 552 484 --12861 12545
NM_006421chr831163 289 136 --11250 --
NM_006425chr52562 283 --1247 --
NM_006434chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_006439chr41464 ------
NM_006447chr21--1194 ----
NM_006451chr53799 341 25 ------
NM_006457chr463906 2757 2528 1514 1107 96 ----1506
NM_006460chr17--1286 21791 235 --
NM_006467chr542218 1912 1779 245 12173 ----
NM_006469chr151285 1189 643 616 393 21579 476 ----
NM_006482chr1243051 2668 1278 452 43655 347 165 88 12590 1198
NM_006489chr1451977 1393 487 433 329 1731 189 11809
NM_006496chr11369 1513 21960 1324 11700
NM_006504chr1022961 2092 22968 2640 --22779 550
NM_006520chrX31630 1524 1298 --1444 --
NM_006526chr2051963 1648 1495 529 28 ------
NM_006529chr451321 1246 1059 609 242 --11654 --
NM_006532chr1941804 1754 1534 327 ------
NM_006534chr2053105 791 760 243 194 12546 12529 12470
NM_006536chr12854 782 1238 1115 1874
NM_006537chr152123 54 1583 ----
NM_006538chr252763 1283 726 333 261 ------
NM_006540chr841600 1210 1183 1171 ------
NM_006544chr14135909 5860 5503 5212 3800 3707 2440 2354 2205 2131 2026 1707 1269 35477 4056 284 1966 24127 441
NM_006546chr1766614 5473 5370 1785 1722 408 --16397 --
NM_006547chr772048 1707 1625 1503 759 655 475 --11351 1109
NM_006549chr1242948 2577 1899 138 1290 ----
NM_006558chr81461 --1381 --
NM_006559chr12405 115 ------
NM_006561chr10156182 5879 5577 4242 4037 2209 2027 1721 1424 1299 1254 1051 966 824 140 --45462 3911 3818 549 1523
NM_006565chr1651079 1062 422 411 356 ----1375
NM_006572chr1742370 2182 66 41 ------
NM_006575chr1441440 1145 997 448 --1266 --
NM_006577chr211152 1981 ----
NM_006590chr2--1470 ----
NM_006593chr21295 ----1576
NM_006595chr112413 286 11811 1450 --
NM_006599chr16127288 6792 5622 5289 3131 1917 1901 1731 1357 1068 828 516 28182 2169 26396 2376 --
NM_006601chr121146 ------
NM_006603chrX1158 1475 1216 11471
NM_006609chr262880 2494 2399 1926 889 574 --21842 220 1418
NM_006614chr373048 1014 694 622 544 478 358 11178 ----
NM_006618chr121150 256 11533 2488 472 --
NM_006620chr694115 3439 3266 3099 3032 1326 934 412 353 34289 3761 107 ----
NM_006621chr12292 128 ----1637
NM_006622chr52545 215 ------
NM_006624chr1061941 1702 1694 1433 589 57 --1180 --
NM_006628chr15114568 4394 4217 3277 3160 2841 1841 1667 1107 735 293 --1165 --
NM_006629chr1852388 2337 1089 940 673 11069 22180 269 --
NM_006633chr5--2764 74 --1510
NM_006636chr21687 ------
NM_006646chr1392829 2726 2039 1968 1958 685 451 439 151 ----12779
NM_006654chr1274340 4303 3797 3442 1642 1380 931 32960 1783 1754 2852 776 143
NM_006660chr15----1248 --
NM_006667chrX4999 284 241 101 2912 69 1122 --
NM_006675chr1222144 974 23415 3404 ----
NM_006680chr111104 ------
NM_006693chr71870 ------
NM_006700chr121145 1750 1102 --
NM_006703chr6--1190 ----
NM_006706chr52579 526 166 ----
NM_006708chr641081 1006 989 355 ----21113 918
NM_006713chr5155 ----1312
NM_006716chr731333 995 202 ----11373
NM_006717chr993199 3153 2710 2299 2268 2121 1085 1036 985 --1496 --
NM_006722chr373082 2209 1980 1142 1081 1005 708 22761 2234 1736 1527
NM_006726chr41212 --1151 --
NM_006729chrX53609 3476 2236 2154 1774 --24538 1848 --
NM_006734chr6258 52 1991 ----
NM_006738chr1574525 3459 3261 3124 2821 1733 1641 ------
NM_006746chrX41552 1470 611 93 1238 ----
NM_006750chr16187863 7814 7630 7370 7326 6550 6440 5505 5328 5310 5304 2648 2162 1893 1349 945 757 740 14962 26582 3230 --
NM_006751chr22778 717 1801 ----
NM_006754chr731075 845 421 ------
NM_006756chr851102 1003 961 129 83 1234 11532 --
NM_006761chr172167 144 ------
NM_006763chr11844 12092 1155 11762
NM_006766chr831732 988 898 ------
NM_006772chr611117 ------
NM_006775chr662936 2372 2196 2177 1108 643 ----12576
NM_006777chrX72399 2260 1098 456 222 172 26 11078 22268 2187 11017
NM_006788chr182321 221 --11684 --
NM_006791chr154631 599 539 426 ------
NM_006801chr195662 582 570 266 167 --2246 201 --
NM_006803chr851845 1555 1437 713 28 --21581 1546 --
NM_006805chr541175 661 576 320 1285 ----
NM_006807chr17----21350 409 --
NM_006808chr9----1157 --
NM_006813chr63807 649 226 ------
NM_006815chr1231172 966 950 --11307 1282
NM_006819chr111287 ------
NM_006822chr17----2606 534 --
NM_006823chr811133 1449 11322 --
NM_006832chr141849 --1758 --
NM_006838chr122676 215 11279 ----
NM_006851chr1242771 2210 823 388 --12505 --
NM_006852chr1752906 2693 2441 2396 775 --11037 --
NM_006868chr1843225 3041 1949 313 --12004 1468
NM_006873chr253104 2315 1375 1256 189 11197 ----
NM_006874chr441013 962 952 334 ------
NM_006877chr61303 ------
NM_006885chr16194047 4032 3616 3430 2905 2899 2893 2887 2755 2689 2683 1505 1487 806 558 494 424 312 196 12775 33848 1468 567 --
NM_006887chr23613 606 205 ------
NM_006888chr1463196 2848 2706 2410 2236 219 1728 2856 311 12269
NM_006892chr2031243 555 515 21181 1124 11380 --
NM_006892chr2031243 555 515 21181 1124 11380 --
NM_006898chr21615 ------
NM_006908chr741109 1042 605 388 11452 1585 11156
NM_006910chr161402 ------
NM_006914chr91201 1414 ----
NM_006915chrX52496 2066 1903 242 195 22260 95 21649 689 1781
NM_006916chr21416 1231 --1408
NM_006920chr2--1111 ----
NM_006922chr272050 2044 2037 1859 1738 1695 1017 1213 ----
NM_006924chr1794154 4052 3995 3279 1678 1078 358 171 46 33970 818 612 ----
NM_006930chr571333 1287 610 523 231 187 71 1133 11803 --
NM_006937chr173558 433 115 1511 ----
NM_006938chr184948 831 816 126 --1220 177
NM_006939chr1421203 756 --150 2456 443
NM_006940chr1271833 1298 466 448 437 285 120 1629 ----
NM_006948chr2152498 2121 1795 986 606 --12199 --
NM_006951chr102581 101 140 1764 1792
NM_006981chr942900 2432 1899 639 ------
NM_006996chr151830 1550 735 678 502 ------
NM_006997chr10--1414 ----
NM_006999chr571446 1419 1286 838 698 468 395 11401 22065 1338 --
NM_007005chr92540 531 --1962 --
NM_007006chr1643482 3210 2467 673 22894 1170 21306 90 --
NM_007007chr12104726 4519 3823 3399 1621 621 562 485 329 42 63874 3200 1391 1320 955 700 23993 3914 --
NM_007011chr1546226 4666 1194 552 15178 25858 4730 11227
NM_007013chr81298 2915 798 ----
NM_007026chr171116 ------
NM_007027chr31146 140 ----
NM_007033chr141761 1565 812 42 1681 --1881
NM_007034chr12837 267 1791 ----
NM_007038chr2155865 4234 2326 1357 973 34669 1685 331 13980 --
NM_007039chr1432081 881 664 ----1392
NM_007042chr352320 865 858 847 377 --22503 2017 --
NM_007046chr21378 ------
NM_007050chr2067899 6302 3178 2055 1261 761 --36070 6000 679 --
NM_007054chr583627 3562 3552 3456 3044 2666 973 606 23594 3532 22541 588 --
NM_007064chr331427 1397 508 --1631 --
NM_007078chr1083031 2964 2338 2010 840 793 785 145 ------
NM_007084chr132394 364 ----11428
NM_007106chr1342747 2126 240 41 --135 12094
NM_007107chr332254 1798 162 22168 99 ----
NM_007111chr13----1300 --
NM_007112chr12240 179 ------
NM_007114chr313026 ------
NM_007124chr61346 1187 ----
NM_007125chrY41467 1060 979 470 11046 21004 453 --
NM_007137chrX105460 4852 4385 4313 4092 3789 1921 1310 1158 1142 --13764 11911
NM_007145chr1921008 276 ------
NM_007146chr1712634 21962 468 --11027
NM_007147chr1921244 1229 1920 ----
NM_007150chrX41986 1635 563 67 --1552 --
NM_007158chr141234 1197 891 134 ------
NM_007173chr1171796 1568 447 439 306 70 35 --2702 563 --
NM_007175chr883530 3518 3239 2327 1274 979 893 725 32828 2584 1057 23550 2739 --
NM_007178chr12--1469 ----
NM_007187chr1321036 761 ----1861
NM_007189chr7--11107 --1470
NM_007191chr122719 167 ------
NM_007192chr1451192 1176 1108 457 104 ------
NM_007195chr1842829 1486 809 455 ----23553 2438
NM_007200chr1574525 3459 3261 3124 2821 1733 1641 ------
NM_007202chr174631 539 264 216 ------
NM_007203chr943821 2735 1523 27 --23048 2607 14011
NM_007207chr1173 ------
NM_007212chr192156 1536 1416 827 749 606 443 427 247 31835 1779 1526 ----
NM_007214chr62964 378 --1115 --
NM_007218chr82902 640 --2741 363 --
NM_007222chr831603 1284 1200 ------
NM_007246chr431053 911 864 --11004 1261
NM_007249chr1399477 7962 7185 6330 5931 2805 2157 1638 665 39235 2469 199 12178 --
NM_007260chr12759 749 ------
NM_007269chr1----1451 --
NM_007274chr11126 ------
NM_007276chr751132 972 374 158 55 1443 ----
NM_007285chr161182 --1195 --
NM_007292chr1764750 4521 4130 1624 1196 954 24609 368 14470 --
NM_007315chr251358 1280 1084 475 37 ----11463
NM_007331chr461929 852 825 788 742 243 12722 ----
NM_007345chr1842079 1745 304 149 --2480 115 --
NM_007347chr1532637 451 368 13093 12232 --
NM_007358chr1--11914 1325 --
NM_007363chrX2371 316 --11033 --
NM_007373chr1041619 1492 221 195 --1719 --
NM_007374chr14----1384 --
NM_007375chr14973 671 477 192 12756 11023 --
NM_012064chr1231071 284 137 ------
NM_012081chr593495 3229 3152 3042 1363 1017 890 882 874 11447 32808 2741 282 --
NM_012082chr81787 ------
NM_012096chr343776 3356 2943 2928 --22650 1472 1868
NM_012102chr142362 2098 1035 296 --11854 --
NM_012104chr1122670 675 12426 23096 2988 13121
NM_012104chr1122670 675 12426 23096 2988 13121
NM_012115chr62621 210 ------
NM_012120chr6----31994 1925 295 12926
NM_012124chr112344 159 ------
NM_012129chr742173 1986 1858 98 12214 22249 2045 22027 157
NM_012154chr8--1843 --1784
NM_012155chr191216 --1225 --
NM_012157chr33941 165 61 ------
NM_012158chr1371668 1434 1261 1141 391 164 57 ------
NM_012160chr6--178 1525 --
NM_012164chr9117245 5688 5503 5458 4918 4728 2760 2635 2421 1405 969 27008 4859 36478 4636 659 32941 2689 2510
NM_012177chr61126 ------
NM_012183chr11454 ------
NM_012193chr11105455 4919 3952 1959 1888 1434 1212 491 426 78 ------
NM_012199chr133874 3784 3671 ------
NM_012207chr1051098 953 825 372 27 ------
NM_012210chr921342 1066 41515 1349 534 155 ----
NM_012215chr10101841 1671 1661 1408 1343 713 406 287 237 68 21540 1227 ----
NM_012218chr193797 411 61 1318 2257 249 --
NM_012219chr373142 2629 2335 892 564 552 426 --13228 --
NM_012223chr24968 434 332 166 ------
NM_012224chr42865 390 2780 344 11046 1404
NM_012234chr393587 3527 2457 2450 1001 633 463 332 325 13499 13755 13261
NM_012238chr1041737 1537 353 143 1617 21651 1261 --
NM_012242chr10----1548 --
NM_012243chr12125 26 1370 ----
NM_012247chr10--134 ----
NM_012250chr1131058 403 298 11244 ----
NM_012255chr20145 ----188
NM_012259chr631184 498 422 --21392 1248 11433
NM_012261chr201673 ------
NM_012262chr155014 3790 720 465 333 --14120 --
NM_012266chr91850 21104 1069 11115 --
NM_012272chr122450 443 ------
NM_012278chrX1145 ------
NM_012281chr732353 2059 905 ----21595 1511
NM_012286chrX1527 --163 --
NM_012287chr344446 4104 924 491 ------
NM_012290chr211520 --1384 11156
NM_012294chr7103814 3485 3395 2788 2655 1413 1194 405 293 102 ----23522 391
NM_012297chr4102334 2077 2021 1967 1874 1853 1795 923 712 23 1854 --12255
NM_012300chr532050 1843 39 2989 945 11790 --
NM_012301chr71804 --11767 --
NM_012307chr181280 ------
NM_012308chr1132194 2057 1695 22332 2183 ----
NM_012309chr1143232 1597 1533 168 14052 1240 14587
NM_012316chr125418 238 24594 276 ----
NM_012327chr1811566 --11501 1998
NM_012328chr721464 146 ------
NM_012329chr1731072 662 619 --1492 --
NM_012330chr1031575 466 181 11554 1535 --
NM_012333chr141498 1326 663 184 ------
NM_012339chr101678 --1539 --
NM_012341chr102470 397 ------
NM_012342chr102485 383 ------
NM_012347chr643019 2415 1967 450 1805 ----
NM_012388chr1522523 179 12049 23082 200 --
NM_012399chr2221897 1427 1755 11360 1705
NM_012412chr71789 ------
NM_012416chr91496 ----11080
NM_012426chr161360 ----1479
NM_012428chr15--11025 ----
NM_012463chr1231433 519 211 --1426 --
NM_012464chr452713 1834 1792 898 494 --11130 --
NM_012479chr762346 2326 2139 1968 542 138 12465 --150
NM_012486chr1165 ------
NM_013229chr1292110 1087 1045 897 600 586 548 462 196 22118 1961 ----
NM_013230chrY41591 539 374 98 --11527 --
NM_013231chr14104412 3935 3791 3779 3678 3604 3405 1240 1195 209 --13989 --
NM_013233chr231030 526 349 ------
NM_013255chr7138515 7903 7568 7368 7344 7110 7060 6803 6513 2572 2059 1898 53 11488 38184 5800 2085 1144
NM_013257chr872239 2233 1956 1597 917 341 296 ------
NM_013261chr442918 1482 1470 639 --12600 --
NM_013262chr641465 1018 1007 993 1511 2473 287 --
NM_013282chr1951341 1223 1084 1078 973 ------
NM_013283chr52799 82 --1744 --
NM_013286chr353153 2999 1425 740 621 ------
NM_013296chr13472 453 363 ------
NM_013322chr711614 ----11294
NM_013336chr31107 --12012 --
NM_013341chr211849 --22582 577 --
NM_013352chr63879 307 220 ------
NM_013354chr83480 425 395 11451 --1963
NM_013357chr81670 --183 --
NM_013365chr221847 ------
NM_013371chr11330 ------
NM_013372chr1572653 2637 2524 2238 1209 581 333 1186 22871 766 --
NM_013373chr22--11005 ----
NM_013374chr332742 1234 379 22411 585 --12597
NM_013377chr122573 163 189 ----
NM_013380chr191807 ------
NM_013381chr1242345 2278 1510 967 ----1142
NM_013390chr941746 1685 1570 509 2355 295 11551 --
NM_013396chr211421 --1587 197
NM_013436chr22271 96 ------
NM_013437chr821332 83 1348 ----
NM_013448chr142245 184 1633 ----
NM_013449chr1242609 1161 577 549 --12509 --
NM_013450chr221185 916 ------
NM_013958chr81471 ------
NM_013959chr81471 ------
NM_013961chr81471 ------
NM_013962chr81471 ------
NM_013981chr5--1199 ----
NM_013982chr5--1199 ----
NM_013983chr5--1199 ----
NM_013986chr221322 ------
NM_013995chrX62540 2484 2425 1723 1713 182 12084 ----
NM_014010chr92434 407 1497 ----
NM_014011chr252601 2304 2119 1852 739 22267 255 1397 --
NM_014021chr153461 3243 3206 2797 2742 12392 12978 --
NM_014023chr1052848 2451 1115 927 622 --12866 12733
NM_014035chr511253 11413 ----
NM_014038chr71156 1168 1406 --
NM_014043chr331230 1089 418 ------
NM_014048chr1655082 4878 4182 3952 581 11233 24856 1969 169
NM_014055chr124505 442 172 130 ------
NM_014089chr1352228 2124 874 306 109 ------
NM_014112chr8105512 5268 4746 4388 4126 4073 3899 2170 2091 526 1630 ----
NM_014117chr1652490 2351 2103 1825 729 1532 ----
NM_014141chr7115369 5310 5110 5094 3844 3820 1487 1144 755 343 206 1354 11007 1557
NM_014154chr321116 371 21075 116 ----
NM_014155chr11177500 7240 6648 6520 6378 5158 4729 2829 2565 2443 1465 1070 732 325 301 295 276 57511 6859 5082 2665 2251 15325 11652
NM_014178chr144556 235 131 125 ----162
NM_014181chr251984 479 473 467 460 ------
NM_014183chr201306 ------
NM_014203chr19164 ------
NM_014211chr52394 34 11725 2462 130 1543
NM_014216chr1441574 1293 487 117 ------
NM_014225chr191357 1384 ----
NM_014231chr1242102 800 610 566 ------
NM_014241chr10161 --1282 --
NM_014243chr4----21917 1617 --
NM_014248chr221111 ------
NM_014250chr2232056 1653 780 11429 --12033
NM_014253chrX42266 1991 1758 260 145 ----
NM_014255chr12--185 ----
NM_014271chrX5813 317 196 149 135 1331 ----
NM_014278chr42131 119 ------
NM_014279chr92933 727 ------
NM_014282chr91432 1221 1884 --
NM_014283chr141064 451 240 184 31570 1249 1077 ----
NM_014290chr91158 ------
NM_014294chr81966 1256 ----
NM_014302chr71104 --123 --
NM_014305chr13--1692 --1555
NM_014309chr2294731 4545 4533 1588 1409 1246 1137 492 476 35439 3779 1711 1665 --
NM_014313chr131159 614 52 --11290 1432
NM_014319chr1241639 611 240 136 --22002 207 --
NM_014329chr161309 ------
NM_014331chr486989 6740 6603 6494 6180 5134 712 690 26695 2725 26118 986 --
NM_014333chr1152578 2569 2150 305 95 32682 1885 775 1459 --
NM_014335chr152123 83 --11216 --
NM_014344chr111768 ------
NM_014351chr2221281 455 21069 913 ----
NM_014361chr112437 187 ------
NM_014363chr13--1348 2920 422 --
NM_014368chr92366 266 11438 ----
NM_014372chr142032 1502 538 479 --21977 1958 --
NM_014382chr341356 1285 691 639 --1545 11211
NM_014392chr4----11225 --
NM_014394chr102842 458 --3968 451 295 11199
NM_014396chr762273 2125 1894 1874 1867 52 ------
NM_014397chr911177 ------
NM_014399chr72701 164 ------
NM_014411chr731347 1317 40 ------
NM_014415chr321616 508 ------
NM_014423chr5104613 4440 4292 4183 3918 2015 1509 1473 141 111 21901 958 ----
NM_014429chr31660 1637 ----
NM_014445chr351739 553 524 401 172 21526 411 1286 --
NM_014447chr421105 323 --11330 --
NM_014452chr62938 55 --1279 1455
NM_014455chr11139 ------
NM_014456chr1081824 1742 537 340 293 188 170 22 11308 175 --
NM_014458chr11224 --11173 --
NM_014462chr82298 103 ------
NM_014469chr112254 190 1108 ----
NM_014487chr4--1155 ----
NM_014494chr1632231 906 772 --22373 597 --
NM_014507chr221903 ------
NM_014515chr121212 --1658 --
NM_014516chr191268 ------
NM_014517chr351938 1711 1612 316 79 ------
NM_014521chr2--1360 ----
NM_014554chr1242162 1729 1722 1657 ------
NM_014570chr222828 92 ------
NM_014573chr1721799 349 --11284 --
NM_014574chr1451412 1401 1391 1358 1186 3992 274 264 2598 310 1589
NM_014575chr33545 456 354 ------
NM_014583chr32512 326 ------
NM_014603chr1721176 384 ------
NM_014606chr42238 232 11431 11464 11473
NM_014607chr23824 550 538 ----1484
NM_014612chr931434 1270 176 --1493 1344
NM_014613chr542940 2650 2528 511 ------
NM_014614chr241318 1137 603 86 11091 ----
NM_014615chr163932 897 816 21015 827 22626 235 --
NM_014620chr123824 720 263 ------
NM_014635chr2----11494 --
NM_014636chr964280 4135 4039 1413 1135 1106 13705 ----
NM_014637chr831073 261 113 ------
NM_014646chr1853147 2678 2630 1053 754 --32996 2196 2005 --
NM_014647chr1642205 594 458 145 --1181 --
NM_014649chr19121 ------
NM_014655chr132170 2032 2003 ----12353
NM_014659chr151308 ------
NM_014660chr721004 363 ------
NM_014661chr1033141 487 283 --13652 --
NM_014663chr11965 ------
NM_014667chr352397 678 622 616 159 ----11567
NM_014670chr221136 343 11317 21544 239 --
NM_014671chr741607 1536 1407 1373 ----1274
NM_014674chr373722 2440 1299 755 637 416 96 1372 21235 694 --
NM_014675chr11492 1513 ----
NM_014676chr121286 425 1399 ----
NM_014677chr811096 11395 ----
NM_014679chr1121253 204 --2488 289 --
NM_014682chr842200 1796 821 237 --1335 --
NM_014685chr161575 1210 --1102
NM_014686chr1942261 2093 1872 964 2489 339 --11828
NM_014689chr2196 1392 ----
NM_014690chr722899 2193 12626 ----
NM_014701chr1552823 2151 1101 854 185 12345 --22798 2420
NM_014702chr653448 3332 432 213 128 22822 139 22406 906 13350
NM_014705chr711735 1357 ----
NM_014707chr751688 1512 1433 444 130 --42307 2090 1888 378 --
NM_014709chr2281 67 ------
NM_014711chr1642093 1847 1799 822 11900 ----
NM_014712chr161213 ------
NM_014713chr23178 170 112 --2209 191 --
NM_014720chr1021641 136 1156 ----
NM_014723chr201103 ------
NM_014729chr862073 1573 1529 460 256 207 ------
NM_014730chr1265270 4555 1681 1215 1069 765 ------
NM_014730chr1265270 4555 1681 1215 1069 765 ------
NM_014733chr561912 1640 915 632 467 459 1709 ----
NM_014735chrX42088 1445 1300 811 --2861 146 1171
NM_014741chr111857 ------
NM_014742chr202658 181 --21612 218 --
NM_014743chr453078 2302 2170 1265 1053 32978 2792 2417 ----
NM_014746chr234196 925 633 1454 1375 13624
NM_014747chr1115281 4939 4831 4063 3997 1822 1681 745 464 87 78 15433 11097 --
NM_014749chr14192 ----1167
NM_014751chr821989 1782 --22104 295 11897
NM_014752chr1151650 764 713 592 258 --11398 --
NM_014755chr294277 4263 4084 4000 3209 1083 1028 589 365 33585 3461 1073 43351 3041 1680 140 --
NM_014756chr111365 --1457 --
NM_014757chr542238 912 847 699 2479 23 ----
NM_014759chr811111 ------
NM_014764chr124915 504 302 123 1393 1410 --
NM_014765chr172670 2330 2121 1692 914 561 328 --12071 --
NM_014774chr132122 761 412 12958 11246 --
NM_014779chr35955 941 928 421 294 21084 286 ----
NM_014783chr1521678 191 --11399 --
NM_014793chr152535 47 ------
NM_014795chr241357 1288 1189 920 ------
NM_014800chr721023 988 --21109 1000 --
NM_014803chr1082747 2636 2630 2390 2195 2042 1170 198 --22803 584 --
NM_014807chr111640 ------
NM_014819chr51588 --12408 --
NM_014820chr341480 1326 558 188 11773 --11853
NM_014824chr1181731 1653 1597 1562 1546 1316 68 62 21745 289 ----
NM_014827chr181727 1531 1365 1220 1135 1054 496 335 ------
NM_014828chr144918 911 881 64 --12471 --
NM_014829chr552347 2201 1531 907 488 1568 1510 --
NM_014830chr1273817 3380 2398 1514 1298 319 240 13917 13290 --
NM_014836chr1032005 1801 1243 11464 ----
NM_014838chr2252302 2289 2117 830 286 --1277 1495
NM_014839chr132186 642 226 --22030 739 12094
NM_014840chr1263412 3195 2968 2839 2435 2195 13425 12082 12249
NM_014841chr621075 353 1913 ----
NM_014847chr12480 469 ------
NM_014849chr11205 ----11297
NM_014860chr282629 1895 1634 548 432 191 119 57 ----22658 184
NM_014864chr153085 1576 416 268 137 14155 24085 1663 --
NM_014868chr124806 49 43 37 2244 194 1266 --
NM_014871chr121596 ------
NM_014874chr121850 1190 21806 1173 ----
NM_014876chr2252187 1677 871 583 570 --1112 --
NM_014877chr17257673 7633 7365 7350 7220 6758 6546 6273 5908 5902 5445 5257 4865 2973 2938 1947 1466 1292 1144 1135 950 758 663 570 511 47614 7592 6628 732 14929 26213 2239
NM_014892chr6--1636 ----
NM_014893chrY52294 1675 1481 864 99 11923 ----
NM_014897chr1763121 2629 2488 2452 2179 871 --1583 --
NM_014898chr1932265 123 71 22411 930 ----
NM_014899chr552646 2430 2202 2057 169 23140 1181 --12779
NM_014901chr522098 1493 --1790 --
NM_014902chr2041180 458 317 74 ------
NM_014903chr1262308 1905 1566 895 719 683 1670 12317 --
NM_014904chr1063784 2960 1543 1398 1094 136 22917 541 1744 11134
NM_014905chr231960 276 129 ----1757
NM_014912chr1022330 132 12149 23438 993 --
NM_014918chr152566 414 130 175 --
NM_014920chr633595 2332 910 --1164 --
NM_014923chr1362378 1877 1551 701 225 207 --11468 --
NM_014924chr1482986 2741 2078 608 484 393 227 133 --2643 470 1708
NM_014926chr32403 365 --11166 --
NM_014932chr321914 1811 --11278 2696 406
NM_014936chr672711 2127 1976 1916 666 374 30 22701 2491 ----
NM_014939chr184598 586 497 476 --142 --
NM_014946chr2103049 2914 2697 2567 2536 2456 749 397 274 115 13108 ----
NM_014947chr123002 938 --22754 396 1439
NM_014949chr12358 21 1662 ----
NM_014951chr1042136 636 609 75 ----12619
NM_014953chr1334213 4131 427 43617 3398 624 511 23737 1202 13643
NM_014962chr2042118 1003 455 301 21982 235 12566 --
NM_014970chr1--1119 ----
NM_014974chr1031799 1747 1215 ------
NM_014982chr1484855 4190 3945 3495 2051 2034 1655 833 14351 23463 286 --
NM_014988chr462557 2325 882 440 190 168 1522 ----
NM_014989chr61697 --3513 474 128 --
NM_014991chr441193 992 595 564 12906 ----
NM_014992chr14----1648 --
NM_014996chr321012 58 ------
NM_014999chr1261155 623 242 232 221 211 ------
NM_015000chr1263019 2881 2543 2536 2516 2158 ----12991
NM_015001chr13979 965 737 1327 ----
NM_015008chr3103183 3073 2342 1351 994 886 863 725 139 86 21250 922 22293 195 --
NM_015013chr12288 282 ------
NM_015017chr141017 867 248 196 11320 21127 218 --
NM_015018chr6----181 --
NM_015020chr1653803 1216 272 132 101 ------
NM_015025chr242270 1962 642 52 --1180 --
NM_015026chr12104724 3564 3126 1606 1545 1450 979 892 386 64 24493 2936 23992 3685 13961
NM_015027chr1621862 1756 21316 439 ----
NM_015032chr1332350 1090 204 11034 11180 2861 815
NM_015035chr20116311 6168 6129 6060 5635 4362 4287 2428 1838 1723 1236 11094 15196 --
NM_015040chr2113206 3182 3162 3099 3093 3087 946 771 602 431 186 22094 622 ----
NM_015042chr1543478 3429 903 589 ----14365
NM_015045chr1042245 2237 2052 1889 21996 1405 11872 --
NM_015046chr9102689 2507 2362 1994 1698 932 628 395 256 88 ------
NM_015051chr942847 874 467 262 22126 131 33370 2990 2297 12184
NM_015061chr94836 256 210 87 ------
NM_015071chr5105270 4696 4299 4159 2207 2081 1726 1017 979 618 11945 32075 2004 1277 24235 1935
NM_015076chr632951 505 410 13968 --1928
NM_015080chr112960 297 --1926 --
NM_015087chr1352613 2364 791 649 336 22685 2505 12511 --
NM_015091chr143776 748 613 ------
NM_015092chr1694681 4268 3526 3364 3357 3316 1164 1088 264 22946 1624 24293 2935 --
NM_015093chr621722 516 ----11768
NM_015094chr2274659 3352 1535 1459 906 634 615 ------
NM_015097chr351711 1690 732 440 116 --21658 123 --
NM_015100chr1102036 1978 1598 1462 1316 732 552 428 397 251 11401 ----
NM_015107chrX62394 2382 2067 2061 2055 1906 ------
NM_015110chr952396 1910 562 205 195 2953 727 11886 --
NM_015115chr421242 44 22874 2744 ----
NM_015120chr2--1274 ----
NM_015124chr221671 ----12256
NM_015129chrX41743 1737 1187 1135 11796 ----
NM_015130chr411316 --174 --
NM_015132chr741303 1235 793 576 --1102 --
NM_015134chr171647 ------
NM_015137chr872545 2406 2106 2048 2020 315 157 12061 12620 --
NM_015138chr1522799 281 32652 1057 257 ----
NM_015139chr1------141
NM_015143chr4------11400
NM_015144chr1683924 3863 3675 3315 2791 2680 2635 1365 33989 3934 692 ----
NM_015153chr62297 232 --1503 --
NM_015155chr1053244 2521 2069 1248 972 12310 1347 --
NM_015163chr1441774 1627 1488 568 ----1143
NM_015170chr832279 1989 1707 11916 ----
NM_015172chr141613 1399 1275 416 11158 ----
NM_015173chr41184 1197 11181 --
NM_015180chr141740 ------
NM_015184chr3----1639 --
NM_015185chrX3510 436 291 ------
NM_015192chr2052663 2656 2524 2463 615 1339 ----
NM_015197chr141118 --13353 --
NM_015199chr382213 2169 1032 934 589 460 169 156 12411 23022 574 --
NM_015200chr432467 2264 513 2792 389 --1361
NM_015202chr1611198 ------
NM_015203chr1--178 ----
NM_015206chr1563714 3335 2884 2537 1101 1069 ------
NM_015208chr1863523 3260 2912 2666 492 477 --23759 3543 --
NM_015209chr16527 363 357 351 316 257 --12167 1736
NM_015213chr111653 1712 ----
NM_015215chr183044 2166 2114 2031 1939 1133 980 148 32257 633 66 ----
NM_015216chr521476 440 196 ----
NM_015229chr172761 179 11153 11196 --
NM_015231chr111806 --1926 --
NM_015233chr1382262 1820 824 809 768 697 450 310 ------
NM_015236chr431329 1029 472 ------
NM_015238chr51709 1558 ----
NM_015239chr9--155 ----
NM_015246chr1621320 1299 12031 ----
NM_015247chr1685082 4871 4256 3452 1190 743 223 106 --1547 14012
NM_015260chr1911577 ------
NM_015263chr1521216 355 ----11200
NM_015264chr2264255 3680 3585 1244 1157 877 34798 4459 3139 ----
NM_015265chr292379 2302 953 146 127 107 99 93 86 --171 11948
NM_015267chr1241756 1355 456 139 11437 12032 --
NM_015269chr1--1197 --1239
NM_015271chr454080 3992 1634 233 34 ----192
NM_015272chr1652164 1905 653 450 151 11488 22048 646 --
NM_015275chr1231588 1370 603 ------
NM_015277chr1831298 681 667 11703 ----
NM_015278chr652779 2726 2595 2345 787 22545 795 12416 --
NM_015282chr272904 2895 2887 2162 1867 529 204 --22678 822 1306
NM_015291chr173463 3457 3141 3005 2713 2230 1004 12737 12815 --
NM_015296chr1321023 340 11179 --1998
NM_015308chr115275 178 147 70 60 ------
NM_015310chr8158023 7914 7786 7012 5871 5865 5658 5631 5075 3276 1984 981 402 166 50 28338 8277 ----
NM_015313chr1154563 4170 3100 803 422 21759 437 13340 --
NM_015314chr782421 2304 2190 2097 706 697 449 123 --12169 --
NM_015315chr5103053 2901 2467 2461 2455 2449 2238 890 859 300 ------
NM_015317chr242865 2857 2368 2346 ----1340
NM_015320chr22752 169 --157 --
NM_015321chr1964898 3578 3343 2995 912 577 23531 998 ----
NM_015326chr182582 1890 1026 964 953 922 514 438 --1834 --
NM_015328chr772635 969 771 712 680 374 313 12842 ----
NM_015331chr12617 611 ------
NM_015335chr1252076 2025 2011 940 632 11894 22190 2038 --
NM_015336chr1252057 1892 709 354 65 12545 22455 138 --
NM_015344chr832048 452 277 1748 1814 --
NM_015349chr662589 963 920 471 463 304 12316 1495 --
NM_015350chr11510 ------
NM_015355chr176782 746 526 427 349 76 31974 1377 83 ----
NM_015358chr2131104 1073 301 11219 1839 --
NM_015359chr832621 1902 1817 11885 ----
NM_015361chr21227 ------
NM_015365chrX124280 4055 3747 2995 1519 1385 1226 611 589 482 310 251 22783 455 --1430
NM_015375chr154721 4701 3793 1575 311 11313 11132 14840
NM_015382chr142697 614 --1152 --
NM_015385chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_015387chr262079 1989 1591 1392 439 117 1205 21518 502 --
NM_015393chr453450 2743 1325 1186 130 --11152 --
NM_015394chr1241571 671 252 105 ------
NM_015396chr31220 ------
NM_015397chr91595 21908 1310 11482 --
NM_015419chrX1959 1719 1876 1421
NM_015423chr1111621 11381 1105 --
NM_015428chr1961707 1452 1265 601 521 134 --1538 --
NM_015429chr31925 1770 11154 --
NM_015435chr821324 299 --1592 11007
NM_015436chr442941 2252 560 386 --3721 549 247 13043
NM_015441chr13430 411 335 ------
NM_015442chr31185 ------
NM_015443chr1751427 1159 956 486 176 ----1108
NM_015446chr15643 483 369 318 129 21676 1556 ----
NM_015455chr564107 3708 3277 3157 1240 233 --11252 13457
NM_015458chr895214 5053 4279 3683 1901 1718 943 533 435 14325 33264 1561 1282 --
NM_015464chr71249 --2188 173 --
NM_015475chr241026 352 330 141 ------
NM_015483chr73912 420 172 ------
NM_015508chr31171 ------
NM_015511chr2041175 1147 1087 852 ------
NM_015517chr111529 ------
NM_015520chr312819 ------
NM_015530chr22991 698 ------
NM_015532chr15122694 2522 2485 1948 1923 1766 750 684 667 634 359 149 ----11092
NM_015534chr13435 401 387 ------
NM_015535chr283666 2646 1360 1336 904 437 35 24 1340 13303 --
NM_015542chr1031031 947 936 ------
NM_015550chr783334 3177 2309 1233 1189 1178 978 836 13225 --13050
NM_015554chr1572833 2430 2424 1834 1079 829 105 --32950 2388 1008 --
NM_015555chr62428 122 11238 11215 --
NM_015564chr512848 --1131 --
NM_015568chr2021433 1081 13094 --14328
NM_015569chr184221 4089 3956 1269 1256 888 312 123 11909 ----
NM_015570chr761624 1489 1447 1279 1261 743 ------
NM_015571chr642603 2269 1752 1639 ------
NM_015575chr2103443 3314 3308 3302 2578 2467 2435 2397 671 381 ------
NM_015577chr531800 1196 43 ----11787
NM_015578chr198808 779 765 455 319 142 131 125 11294 171 11867
NM_015599chr61274 ----147
NM_015601chr103868 257 56 ------
NM_015602chr151746 1535 1424 676 529 21692 1463 11641 --
NM_015607chr13225 219 212 ------
NM_015622chr7----1283 --
NM_015626chr171888 187 11235 --
NM_015640chr1104532 3245 1473 1360 1346 861 845 540 367 201 23849 1639 --15254
NM_015641chr7--11099 11022 --
NM_015642chr33213 126 120 ------
NM_015652chr101253 1261 ----
NM_015660chr71247 ------
NM_015670chr171117 ------
NM_015678chr1321440 172 ------
NM_015686chrX11773 ------
NM_015691chrX92889 2543 2255 2198 2032 2019 2001 466 190 180 --1270
NM_015693chr41299 ------
NM_015695chr651398 810 596 523 157 ------
NM_015702chr21296 ----181
NM_015713chr863482 2248 1442 1427 1352 1029 13014 12668 --
NM_015723chr71573 ------
NM_015726chr131146 462 440 11196 ----
NM_015850chr862346 2262 1860 1853 1675 681 1794 ----
NM_015866chr141407 945 547 315 ------
NM_015874chr42626 575 --1247 --
NM_015878chr86680 656 618 572 385 368 22203 1500 12077 1342
NM_015879chr1897308 5980 5648 3392 2306 2268 2101 159 129 28625 2548 ----
NM_015885chr112643 24 ------
NM_015886chr855751 5605 3943 1971 1294 --45360 4868 3969 2056 --
NM_015891chr642009 1880 486 179 11646 ----
NM_015906chr1134863 4797 4676 3472 3258 3106 1753 1031 896 880 832 563 538 --14703 1571
NM_015907chr42276 63 ------
NM_015932chr133322 306 148 2567 237 ----
NM_015955chr21366 ------
NM_015975chrX51494 1485 1314 257 172 ------
NM_015982chr17----155 --
NM_015990chr41841 --11026 --
NM_015995chr1545312 4235 886 333 ------
NM_015999chr11577 ------
NM_016009chr183853 3808 1933 1704 1620 1285 591 427 ----1729
NM_016019chr71228 11071 ----
NM_016021chr662859 2744 2247 827 709 255 ------
NM_016022chr1------1996
NM_016023chr832168 733 115 32083 322 143 31414 806 689 --
NM_016025chr1652001 1907 1592 359 21 2475 180 ----
NM_016037chr15729 245 202 183 140 --11141 --
NM_016045chr203738 628 456 --1102 11510
NM_016048chr531004 973 329 ------
NM_016061chr231020 662 564 1372 ----
NM_016072chr1272317 2035 2028 1555 936 669 281 ------
NM_016073chr15--11069 ----
NM_016076chr142928 2526 470 211 --1126 --
NM_016078chr174999 435 150 110 ----21051 165
NM_016079chr222315 2269 12332 ----
NM_016083chr622759 1013 ----1867
NM_016087chr751640 1515 1405 1292 1153 11416 ----
NM_016096chr831710 1703 878 --11754 11641
NM_016097chr1841008 950 365 156 21043 958 ----
NM_016103chr52463 115 ----1380
NM_016107chr54510 480 294 58 --1129 --
NM_016120chrX21162 1037 --1158 --
NM_016121chr13957 803 419 ----180
NM_016129chr4--1384 ----
NM_016131chr242226 2094 1521 692 --11672 --
NM_016132chr15113368 3362 3200 3133 2512 1327 1321 1063 1015 799 449 2239 188 23146 313 --
NM_016133chr241380 1039 1021 106 --11215 --
NM_016138chr1661422 1230 327 283 180 135 ------
NM_016144chr53682 623 613 1272 --1314
NM_016147chr1111145 2792 445 1937 --
NM_016151chr162335 311 ------
NM_016152chr31135 --2864 92 --
NM_016166chr151181 ------
NM_016192chr21199 --1243 --
NM_016200chr71737 ----178
NM_016203chr741034 1016 896 269 ------
NM_016206chr3147413 7375 7359 7116 6650 6239 5561 2088 1787 1582 1041 707 604 74 46714 5934 988 659 55644 5441 1561 736 284 --
NM_016213chr15138 ------
NM_016216chr3240 23 ------
NM_016217chr652837 2762 2727 1426 729 --13229 --
NM_016227chr141064 451 240 184 31570 1249 1077 ----
NM_016230chr6164 ------
NM_016231chr1741533 1452 321 112 ------
NM_016239chr171755 ------
NM_016248chr1383896 3623 3554 3279 2617 2597 2442 1041 22646 494 --1996
NM_016255chr651341 760 708 573 444 22876 1155 ----
NM_016258chr13311 298 290 1534 ----
NM_016260chr2207297 6639 6265 6054 5801 5476 5454 5168 4990 2780 2669 2256 2147 1561 1141 1132 784 708 698 383 27342 4959 37236 7173 1063 17609
NM_016269chr41255 11025 ----
NM_016270chr192486 467 1443 ----
NM_016271chr1852326 2307 2022 1992 1540 --2691 126 --
NM_016272chr2262559 2526 2043 1082 1076 280 ------
NM_016275chr352215 1757 825 414 277 12354 11092 --
NM_016277chr621547 1097 21431 646 ----
NM_016287chr141600 745 702 77 1294 11838 --
NM_016289chr232178 142 122 22075 1736 1872 --
NM_016290chr5197 ------
NM_016300chr31440 1522 ----
NM_016303chrX2452 185 ------
NM_016306chr3281 67 2363 88 ----
NM_016308chr151928 1893 1734 1332 385 11391 11977 --
NM_016315chr221420 103 21833 432 --11526
NM_016316chr22637 239 ----194
NM_016322chr973117 2852 2825 2762 2143 1999 1027 13180 12659 12179
NM_016328chr7----1100 --
NM_016329chr3--1488 ----
NM_016333chr161487 ------
NM_016337chr141184 ------
NM_016338chr52968 357 ------
NM_016351chr71578 ------
NM_016352chr761402 1396 573 552 472 222 1423 ----
NM_016356chr672941 2855 2622 2030 987 950 871 ----12848
NM_016357chr1221226 1052 ----1509
NM_016376chr1744101 3562 2790 367 --1515 --
NM_016383chrX2750 744 ------
NM_016395chr15158 --186 --
NM_016396chr1562830 1975 1180 1157 1070 551 --1577 1218
NM_016400chr15272 63 ------
NM_016404chr111122 --121 --
NM_016417chr141442 ------
NM_016422chr1142714 2377 2139 624 --1471 --
NM_016424chr1732012 1842 367 --21662 517 --
NM_016436chr2032478 1793 518 12485 1266 --
NM_016441chr232356 2139 1710 --1899 22104 228
NM_016463chr5--1141 ----
NM_016475chr1441139 480 404 138 ------
NM_016480chr53784 300 131 --1122 --
NM_016485chr64873 448 177 87 ------
NM_016488chr1241869 1462 1429 522 ------
NM_016506chr11191 --1726 --
NM_016507chr1773108 2458 2267 2130 1001 450 388 --22818 2430 --
NM_016513chr633595 2332 910 --1164 --
NM_016529chr131353 ------
NM_016530chr1574075 3143 2546 1212 1172 1099 241 11127 43920 3226 2855 2524 --
NM_016542chrX31262 1218 347 --1502 11344
NM_016544chr293738 3614 3594 3021 2948 2673 2480 1186 80 12656 13239 --
NM_016559chr31318 --1577 --
NM_016562chrX31340 1225 191 11046 ----
NM_016586chr142466 173 ------
NM_016587chr751132 972 374 158 55 1443 ----
NM_016603chr512130 ------
NM_016605chr522743 579 --1529 --
NM_016607chrX198 21343 155 11632 --
NM_016612chr81540 1558 1474 --
NM_016613chr442106 703 424 296 159 ----
NM_016618chr23523 395 365 ------
NM_016620chr14575 550 327 219 1203 11274 --
NM_016621chr11134555 4540 4518 4495 4150 3436 1708 1638 1290 1206 1087 1022 995 --24534 1171 --
NM_016623chr81509 --168 --
NM_016625chr3--159 ----
NM_016626chr1841748 1137 466 446 11306 ----
NM_016628chr101562 ------
NM_016644chr5126 --1454 --
NM_016651chr147938 760 390 317 263 245 35 11081 ----
NM_016653chr2167 1445 1121 --
NM_016654chr153927 345 289 11400 1216 --
NM_016824chr1031176 519 220 ------
NM_016931chr111361 ------
NM_016936chr1631662 858 670 --1866 --
NM_016937chrX21025 849 2980 955 1885 --
NM_016946chr173486 3133 3010 2761 1212 1057 1019 22268 144 ----
NM_016950chr42405 250 1565 1274 1193
NM_016952chr11113196 3091 3080 1356 1331 1324 1306 935 465 451 413 --13985 --
NM_016953chr2116099 5850 5665 4350 4045 1572 1558 1536 710 679 415 16138 ----
NM_017410chr12--11262 ----
NM_017412chr831167 457 225 1491 ----
NM_017415chr573326 1727 1539 755 734 690 228 13742 --13872
NM_017420chr1472733 1447 967 802 523 397 104 12368 1320 13667
NM_017423chr442215 1633 1538 829 1435 ----
NM_017426chr43637 515 122 --1451 --
NM_017440chr12----188 --
NM_017447chr2184059 3589 2989 1685 1561 927 173 93 11291 33103 2837 2723 11190
NM_017450chr1731505 1002 107 ------
NM_017455chr15--11025 ----
NM_017456chr1731985 1971 1893 11946 11853 --
NM_017459chr1------1413
NM_017491chr42918 772 1851 --1700
NM_017514chrX1930 --1909 --
NM_017519chr62855 223 ------
NM_017526chr12164 104 ------
NM_017548chr362092 1637 1452 1366 805 756 ------
NM_017563chr336369 4136 2157 14759 ----
NM_017569chr132117 42 ------
NM_017572chr191194 185 ----
NM_017580chr102895 676 21486 670 1781 --
NM_017593chr41326 ------
NM_017599chr1242066 2013 1675 460 --11749 --
NM_017610chr1531534 351 342 --1760 11555
NM_017617chr9--21266 111 ----
NM_017626chr1031684 1256 639 11558 ----
NM_017628chr4115030 4855 4842 4429 3552 1908 1652 1639 1632 1261 390 --31158 1041 115 --
NM_017629chr171901 1793 558 549 539 349 105 ------
NM_017631chr4162 --148 --
NM_017632chr41113 ------
NM_017633chr643032 3026 2821 2452 33303 3101 1149 ----
NM_017635chr1131273 1149 488 11097 1327 --
NM_017637chr9169361 8228 8165 7882 3659 2734 2456 2424 2029 1826 904 710 468 367 346 221 29276 717 27557 3451 --
NM_017638chr1289 73 ------
NM_017640chr63759 229 22 --1358 --
NM_017641chr121187 1806 ----
NM_017643chr1722479 2463 32864 2618 1103 --11974
NM_017644chr3105182 5046 4074 3977 3691 3656 1541 1379 520 461 24688 626 11271 1758
NM_017649chr102388 377 21092 367 ----
NM_017650chr795978 4336 3873 2215 1837 1346 1339 1118 955 ------
NM_017658chr1494492 4192 3757 1463 1193 285 165 135 71 --31013 884 774 --
NM_017660chr1943418 3131 2942 904 11187 1464 --
NM_017661chr15----11285 1209
NM_017664chr135804 798 687 270 104 --2895 244 --
NM_017666chrX42193 1991 357 253 ------
NM_017667chr71118 1498 169 --
NM_017670chr11169 ------
NM_017672chr1511112 ------
NM_017693chr1351653 1343 1279 457 388 ------
NM_017703chr19135 ------
NM_017709chr143909 1066 1051 963 14019 13152 --
NM_017714chr201860 164 ----
NM_017719chr342288 1939 649 161 1944 ----
NM_017724chr32277 102 1232 ----
NM_017736chr1683164 3015 2967 2759 2285 635 488 335 22749 2695 42154 453 163 93 1357
NM_017737chr141963 1884 1783 636 2494 175 ----
NM_017738chr931260 1159 862 11179 ----
NM_017739chr1--1117 ----
NM_017744chr172008 2001 1994 1988 1951 784 728 ------
NM_017745chrX2584 164 1257 --1193
NM_017752chrX52019 1560 786 601 562 22153 1536 ----
NM_017753chr93754 324 28 ------
NM_017757chr1821157 341 ------
NM_017758chr1771451 414 117 110 103 97 79 --11154 --
NM_017769chr1423108 175 22520 542 12827 12970
NM_017772chr621422 135 21239 1198 --11732
NM_017778chr841137 437 295 288 1303 ----
NM_017780chr84847 665 240 90 ------
NM_017784chr321080 41 --1344 11011
NM_017787chr1042386 2132 1166 720 ------
NM_017798chr2011234 ----1796
NM_017801chr372581 2217 1005 980 947 512 140 21807 265 12620 --
NM_017811chr983102 3003 2703 2553 2107 1010 1004 700 1334 1360 11254
NM_017813chr8125716 5513 5148 5065 5056 4562 4189 4174 4076 1655 1251 835 65708 4805 3988 1821 670 208 --25438 788
NM_017824chr1032208 2056 1931 22699 1070 1782 11779
NM_017831chr1844578 3324 1873 1616 14800 --13066
NM_017845chr42586 295 ------
NM_017848chrX54378 3722 460 450 362 14270 13143 --
NM_017880chr2----1466 --
NM_017893chr10--11299 ----
NM_017896chr20123547 3325 3307 2988 2952 2450 2397 777 689 602 449 441 12541 22444 422 --
NM_017913chr92171 109 ------
NM_017919chr965260 4707 4203 2309 1028 983 24376 4354 ----
NM_017921chr1731887 1618 408 ------
NM_017925chr931872 1405 1319 21385 536 21699 71 --
NM_017933chr221503 304 1123 ----
NM_017938chrX1108 ------
NM_017944chr1131028 977 35 1567 33120 2967 1184 --
NM_017948chr92477 72 ------
NM_017958chr242857 2690 2497 103 --12124 192
NM_017987chr1051998 1656 741 304 180 ------
NM_017988chr12--1230 1181 --
NM_017994chr772771 1968 1196 747 584 576 570 --1556 --
NM_017998chr951360 1001 940 303 247 ------
NM_018000chr221925 414 ----1147
NM_018003chr1582472 1942 970 916 511 348 136 73 --22399 166 --
NM_018004chr3----122 --
NM_018008chr31276 ------
NM_018011chr135662 93 87 81 74 1590 ----
NM_018015chrX21151 132 --11089 --
NM_018017chr1092815 2756 2341 1880 1765 808 524 483 206 12824 --1674
NM_018026chr1121434 1306 --21277 995 --
NM_018027chr1023033 924 11171 ----
NM_018030chr183942 180 45 160 ----
NM_018032chr162317 311 1344 ----
NM_018036chr1444332 3543 3016 816 23770 625 1713 --
NM_018040chr1180 ------
NM_018043chr111181 ------
NM_018046chr51703 --2563 33 --
NM_018048chr1272004 1938 1654 1538 1277 671 286 2613 80 31789 483 279 --
NM_018049chr192104 97 ------
NM_018061chr131176 708 243 1626 ----
NM_018067chr1--1136 ----
NM_018070chr11376 ------
NM_018078chr43929 709 237 1965 11047 --
NM_018084chr283249 3032 2883 2836 1152 892 770 740 ------
NM_018086chr221809 1414 ------
NM_018095chr11191 --1726 --
NM_018105chr82276 187 ------
NM_018110chr1651312 1097 1083 1073 355 ------
NM_018112chr94984 958 663 250 --1677 --
NM_018115chr43638 632 623 1152 ----
NM_018120chr851445 1179 1011 382 49 ----1108
NM_018121chr1053058 2535 2185 2093 234 32838 1077 595 ----
NM_018124chr1652305 1924 1807 1604 775 --12362 --
NM_018126chr461531 1360 1284 1259 486 181 --1253 --
NM_018133chr372221 2017 1814 1644 1521 726 50 22129 1721 ----
NM_018151chr23762 230 27 1723 ----
NM_018155chr362251 1074 971 516 307 131 --23252 910 12427
NM_018157chr1222264 166 12640 ----
NM_018164chr12--2257 112 ----
NM_018177chr42261 142 --1349 --
NM_018178chr151708 1362 1317 1275 69 ------
NM_018179chr122242 51 158 ----
NM_018180chr101113 --1343 1219
NM_018182chr1721488 514 12255 2665 60 --
NM_018184chr331473 755 329 --1872 --
NM_018191chr1351964 1906 284 278 114 11431 ----
NM_018195chr1131984 1892 1399 1461 1601 --
NM_018200chr15102584 2553 2537 2178 1978 1905 1899 559 402 253 21643 42 ----
NM_018202chr12680 337 --2331 181 --
NM_018214chr641196 1021 395 275 ------
NM_018227chr473223 3216 2920 957 948 401 255 43164 1089 1042 855 1904 --
NM_018237chr101260 ------
NM_018243chr473917 3501 1611 1361 740 460 82 ------
NM_018247chr611965 2926 726 1135 --
NM_018254chr132421 1592 837 22124 304 1292 --
NM_018263chr242176 1829 997 63 ------
NM_018270chr20------1769
NM_018285chr15129 ----1441
NM_018286chr174988 926 906 378 1892 ----
NM_018293chr342237 1075 217 113 22411 2048 11881 --
NM_018299chr833381 3357 382 1567 42204 1235 1049 72 12894
NM_018302chr452102 848 837 712 570 1787 ----
NM_018307chr17--1736 ----
NM_018312chr1172005 1794 1352 822 812 708 326 --1569 --
NM_018313chr382620 2445 2262 2132 366 344 325 280 --12093 --
NM_018315chr441615 1248 1208 518 --11290 --
NM_018317chr4----136 --
NM_018323chr431835 1363 575 149 21610 157 1116
NM_018327chr203665 622 543 1152 --11498
NM_018330chr1071613 1375 1338 1100 444 419 60 ------
NM_018332chr16--11349 ----
NM_018334chr7----1385 --
NM_018351chr1294617 4467 3920 3334 3255 3028 1007 474 175 23481 693 34137 1777 374 13345
NM_018362chr11143925 3189 3172 3166 3159 2882 2672 2652 2641 1482 1243 447 353 50 33478 1570 236 1590 1657
NM_018364chr1123981 3871 3571 3506 3185 2947 2816 2692 979 601 84 61 53969 3450 2723 412 373 24097 865 --
NM_018369chr53669 539 190 1592 --1144
NM_018370chr121320 1214 ----
NM_018374chr7134493 4486 3970 3826 3708 1618 1597 1590 1556 1281 1171 679 553 24524 379 13427 --
NM_018375chr141300 ------
NM_018383chr241397 1262 554 149 --1367 --
NM_018388chrX21271 382 21400 499 --11080
NM_018403chr3114141 4080 3859 3678 3514 3491 2580 1646 1501 934 446 23835 607 12704 21509 490
NM_018412chr71155 ------
NM_018416chr1262666 2620 2242 564 437 208 ------
NM_018426chr65603 585 573 562 392 ------
NM_018429chr542414 2260 2112 1068 --12835 42655 2371 2271 2014
NM_018440chr8128727 8695 8431 7343 5655 5419 2463 1904 1826 727 664 391 58362 7020 3177 3057 1260 26883 2759 --
NM_018442chr11105 --1114 --
NM_018444chr831653 1633 552 21640 674 11471 --
NM_018448chr1221080 163 --1871 --
NM_018462chr31121 ------
NM_018466chrX2761 681 ------
NM_018477chr141773 11064 1875 --
NM_018482chr821976 1034 --22547 2116 --
NM_018489chr142035 1995 1742 328 1769 ----
NM_018490chr1141758 1676 1274 1247 21184 605 21549 287 --
NM_018502chr51293 ------
NM_018534chr22587 189 ------
NM_018557chr211335 --1141 --
NM_018566chr194640 4146 3348 1797 1478 1383 1182 1041 846 24444 3148 2926 518 --
NM_018569chr431320 1150 1142 21164 265 ----
NM_018590chr1031711 1615 1437 21657 602 ----
NM_018602chr1531562 636 142 ----11189
NM_018638chr12125565 5408 5013 3842 2265 2100 1831 1225 854 783 388 326 33622 1720 1042 24343 380 14198
NM_018640chr1231871 334 251 12830 ----
NM_018641chr72270 143 --161 --
NM_018649chr102590 542 ------
NM_018650chr111756 21961 384 21596 57 1642
NM_018657chr32804 246 2715 166 ----
NM_018667chr1612562 ----12780
NM_018682chr72751 229 --1614 --
NM_018695chr572387 2137 1789 959 662 426 270 32021 626 227 --1764
NM_018700chr531356 1197 255 11229 ----
NM_018703chr161402 ------
NM_018704chr11843 ------
NM_018710chr811132 --1137 11173
NM_018712chr1121098 261 ------
NM_018715chr122159 291 --1308 --
NM_018724chr14647 521 109 52 1168 ----
NM_018834chr5--2390 53 1201 --
NM_018840chr201389 ----1364
NM_018841chr133633 2954 1036 23668 2865 12835 --
NM_018844chr73617 369 323 --32041 1828 526 --
NM_018846chr72932 83 ------
NM_018847chr951937 1715 1290 310 234 1684 21732 412 --
NM_018890chr741109 1042 605 388 11452 1585 11156
NM_018898chr521582 372 --137 --
NM_018899chr521582 372 --137 --
NM_018900chr521582 372 --137 --
NM_018901chr521582 372 --137 --
NM_018902chr521582 372 --137 --
NM_018903chr521582 372 --137 --
NM_018904chr521582 372 --137 --
NM_018905chr521582 372 --137 --
NM_018906chr521582 372 --137 --
NM_018907chr521582 372 --137 --
NM_018908chr521582 372 --137 --
NM_018909chr521582 372 --137 --
NM_018910chr521582 372 --137 --
NM_018911chr521582 372 --137 --
NM_018912chr541737 680 667 568 ------
NM_018913chr541737 680 667 568 ------
NM_018914chr541737 680 667 568 ------
NM_018915chr541737 680 667 568 ------
NM_018916chr541737 680 667 568 ------
NM_018917chr541737 680 667 568 ------
NM_018918chr541737 680 667 568 ------
NM_018919chr541737 680 667 568 ------
NM_018920chr541737 680 667 568 ------
NM_018921chr541737 680 667 568 ------
NM_018922chr541737 680 667 568 ------
NM_018923chr541737 680 667 568 ------
NM_018924chr541737 680 667 568 ------
NM_018925chr541737 680 667 568 ------
NM_018926chr541737 680 667 568 ------
NM_018927chr541737 680 667 568 ------
NM_018928chr541737 680 667 568 ------
NM_018929chr541737 680 667 568 ------
NM_018932chr52611 249 ----1667
NM_018945chr673656 3469 2514 1024 892 749 438 --11096 --
NM_018947chr783815 3723 3699 1946 1773 1416 1138 486 1716 1183 --
NM_018951chr74946 904 799 25 --1931 --
NM_018957chr221320 ------
NM_018958chr1583423 3356 2970 2628 1349 1112 682 638 13791 ----
NM_018959chr191563 1170 ----
NM_018964chr2121056 1004 1882 ----
NM_018970chr772816 2414 1958 1207 1154 685 109 --2707 138 --
NM_018977chrX2985 968 --1930 --
NM_018979chr123717 667 296 22043 139 ----
NM_018992chr1621551 255 ------
NM_018994chr11492 ------
NM_018999chr10124837 4525 4157 3378 3274 2993 1929 1915 1901 1894 1557 1285 34447 3118 1635 24613 4438 --
NM_019000chr541420 1147 1141 671 21106 274 1346 --
NM_019001chr3104392 4375 3963 3739 3328 3075 2952 1349 1339 598 43625 3565 1650 553 44134 3486 3119 1196 --
NM_019004chr73744 552 404 --11994 21960 1795
NM_019005chr72265 142 ------
NM_019006chr152461 61 --1728 --
NM_019022chr1853217 3145 2837 2194 644 12596 --1440
NM_019027chr472486 917 910 883 300 288 155 11652 1166 11823
NM_019028chr112373 38 1120 ----
NM_019045chrX1734 ----1795
NM_019049chr11743 ------
NM_019050chr472121 1974 1929 1544 690 573 303 2895 618 31834 1805 1756 11576
NM_019054chr104495 196 190 58 ------
NM_019063chr241410 526 178 141 12205 ----
NM_019072chr552675 1354 1339 1291 1068 --1389 --
NM_019074chr153904 869 90 ----1894
NM_019080chr1361565 1547 1306 985 341 152 ------
NM_019084chr1022621 448 --1407 22378 1783
NM_019087chr511208 11728 31509 1157 1144 --
NM_019091chr231160 1073 1046 11126 183 --
NM_019094chr1263799 3685 2360 1246 901 139 --22646 296 --
NM_019114chr922042 439 21030 811 1196 1479
NM_019116chr1662538 1354 1013 704 449 355 --22426 576 --
NM_019117chrX43336 1322 1085 875 23349 177 21254 383 --
NM_019555chr331793 1529 1340 --11326 --
NM_019556chrX31270 1226 1048 ----1952
NM_019557chr13598 285 111 ------
NM_019558chr2--1262 ----
NM_019590chr1031239 1071 956 11516 ----
NM_019591chr1241079 818 413 355 ------
NM_019592chr91625 ----1651
NM_019594chr91650 --1657 --
NM_019597chrX1202 ------
NM_019600chr15------3726 542 128
NM_019605chr14586 517 250 85 ------
NM_019610chr121571 307 ------
NM_019860chr1011099 ------
NM_019862chr1641702 594 508 320 11196 21184 426 --
NM_019885chr232856 2071 311 22780 2640 12701 --
NM_019891chr1--2453 292 21324 1304 --
NM_019898chr1641702 594 508 320 11196 21184 426 --
NM_019899chr1641702 594 508 320 11196 21184 426 --
NM_019900chr1641702 594 508 320 11196 21184 426 --
NM_019903chr1031176 519 220 ------
NM_020066chr13857 836 640 ------
NM_020116chr431481 633 145 11411 1587 --
NM_020119chr731483 1231 86 11424 ----
NM_020120chr221516 1274 11420 2302 65 147
NM_020122chr284410 4175 1780 1766 1070 893 400 381 1900 34280 1289 1222 1782
NM_020123chr1011581 ------
NM_020127chr151538 1236 1178 600 481 ------
NM_020132chr2154473 3806 1493 934 177 34523 690 342 ----
NM_020141chr131467 844 622 ----12013
NM_020150chr1031901 415 29 11522 1783 --
NM_020152chr212255 219 ------
NM_020156chr71239 --1507 --
NM_020159chr451498 1441 421 358 251 21245 1193 ----
NM_020168chr1521309 325 1452 ----
NM_020177chr522329 715 1323 2448 364 --
NM_020182chr2023298 3102 --21003 280 --
NM_020184chr242278 2255 1769 245 ------
NM_020193chr1151130 1069 434 293 257 11017 21286 415 11193
NM_020194chr23605 273 267 1635 ----
NM_020198chr1731503 1321 105 1579 ----
NM_020204chr12691 248 --1270 126
NM_020205chr153328 2581 2307 727 358 43497 2698 2650 1343 13479 23294 745
NM_020210chr15--1953 ----
NM_020216chr11413 ------
NM_020225chr4----1107 --
NM_020226chr41266 ------
NM_020228chr1172533 1878 1732 470 277 201 125 12279 ----
NM_020234chr15269 25 ------
NM_020239chr121602 807 21682 351 12206 --
NM_020240chr511922 --21904 250 --
NM_020245chr6154843 4611 4152 3162 1778 1658 1502 1493 1487 1481 1474 1461 1448 899 52 25037 3552 ----
NM_020311chr25583 554 199 97 40 ------
NM_020336chr202551 500 --1372 12993
NM_020337chr422954 2161 22275 2099 12048 --
NM_020338chr1043553 3481 3239 1016 23251 3089 ----
NM_020341chr2021629 465 ------
NM_020342chr292567 2175 2049 1988 1710 1599 818 745 184 11898 ----
NM_020348chr1082585 2511 2119 1933 1087 821 735 246 22104 696 ----
NM_020353chr361921 1538 1502 1462 1327 458 --1564 --
NM_020378chr191579 ------
NM_020379chr14373 355 339 333 ------
NM_020381chr64595 556 349 199 ------
NM_020382chr1251458 1403 541 525 237 1121 ----
NM_020383chr10125 ------
NM_020390chr394075 3833 3579 3215 1963 1823 1135 785 143 --14821 1730
NM_020403chr1321414 153 11470 ----
NM_020416chr472480 2171 1655 1081 612 557 277 22495 331 ----
NM_020420chrY61852 1740 1174 622 231 150 --21598 1202 21510 420
NM_020432chr732313 1725 1558 11760 11648 1192
NM_020440chr143358 2860 1167 1039 ------
NM_020443chr1116715 6480 6351 5926 5601 5227 5157 908 771 399 277 1834 16639 --
NM_020445chr7----1707 1540
NM_020449chrX2782 300 ------
NM_020453chr441326 1294 594 88 11473 --1411
NM_020455chr642844 1768 1129 131 1141 ----
NM_020456chr1321638 352 --1906 --
NM_020457chr162695 648 ------
NM_020463chr231099 595 34 --11404 --
NM_020465chr1611552 ------
NM_020466chr695004 4279 3989 3275 3066 3048 1629 655 87 11902 23920 3744 --
NM_020474chr1841889 1866 1327 732 --2752 252 --
NM_020475chr822337 327 ------
NM_020476chr822337 327 ------
NM_020477chr822337 327 ------
NM_020478chr822400 390 ------
NM_020480chr822337 327 ------
NM_020529chr14155 ------
NM_020546chr582816 2728 2437 2154 650 624 585 85 ------
NM_020548chr2161 ----1189
NM_020640chr341680 1443 922 288 ------
NM_020644chr115740 725 368 353 320 --1221 --
NM_020647chr832306 1909 565 21813 440 ----
NM_020651chr261695 1427 1209 284 222 206 21493 661 186 --
NM_020654chr341545 1531 1174 108 ------
NM_020655chr161183 ------
NM_020662chr621654 625 1245 128 --
NM_020666chr52758 175 ----1736
NM_020673chr20187602 7512 7364 7177 7063 5768 5418 5373 3027 2917 2173 1238 1010 990 300 106 99 84 11394 16342 --
NM_020686chr1642847 2811 2419 149 ------
NM_020689chr2011317 ------
NM_020693chr11171 ------
NM_020697chr83932 515 231 1169 --1157
NM_020698chr1243093 2686 1259 966 --11102 139
NM_020699chr164148 4029 2007 1495 570 242 ------
NM_020711chr232657 2079 754 21816 1635 12236 --
NM_020715chr1441715 1440 662 644 --1856 --
NM_020718chr16126377 5800 5719 5703 5659 5334 4435 4301 2047 1491 1410 1321 24041 2216 1536 26231 1667
NM_020727chr2183802 3770 3433 2490 1250 327 320 261 23632 2725 13657 --
NM_020732chr62855 223 ------
NM_020734chr1243356 1326 557 334 23318 2811 42893 2382 1199 760 --
NM_020742chrX52674 2668 1835 1694 117 11990 ----
NM_020747chr51830 --2971 797 --
NM_020748chr1732114 1808 776 --11525 --
NM_020749chr821322 389 --1716 11680
NM_020750chr611268 ----11198
NM_020752chr102827 743 22545 2058 12375 --
NM_020754chr31487 ------
NM_020755chr62207 87 ------
NM_020760chr231748 1473 223 --11435 --
NM_020766chrX51611 1581 921 769 417 --11321 --
NM_020768chr542365 1181 432 337 ----12746
NM_020771chr631411 1233 1175 --11517 --
NM_020772chr17128416 8238 7424 6188 5302 2594 2135 2127 1584 1502 964 268 31206 1078 293 27866 286 --
NM_020773chr41352 --22552 461 --
NM_020774chr1885957 5371 5223 4948 4921 1854 192 185 55251 4816 3951 1746 817 21442 1105 11486
NM_020779chr273013 2700 1056 1019 867 264 94 12091 11195 --
NM_020782chr12124868 4730 4459 4003 3928 3922 3889 3866 3490 3284 2998 816 --34298 3967 43 --
NM_020783chr1822022 944 135 --11998
NM_020791chr171206 ------
NM_020794chr151127 255 249 237 201 1262 ----
NM_020796chr562740 2329 2218 2175 2107 1994 32366 2182 1968 12769 --
NM_020800chr321293 1138 --1269 --
NM_020801chr542661 2315 897 247 11675 ----
NM_020802chr1143179 1064 999 307 ------
NM_020803chr491990 1968 1602 940 690 564 391 345 106 12041 ----
NM_020805chr1811509 ------
NM_020806chr142319 83 ------
NM_020808chr13331 105 73 ------
NM_020809chr1141965 1869 676 649 1426 ----
NM_020810chr1453086 3006 2932 669 570 33191 677 90 1755 --
NM_020818chr142384 364 ------
NM_020819chr621152 994 --11018 --
NM_020824chr102547 514 --1540 --
NM_020825chr1622647 721 13831 11182 --
NM_020830chr293280 3270 3117 2831 2549 2225 1194 1063 294 ------
NM_020841chr1263845 3091 1349 886 805 433 21236 79 2629 319 13508
NM_020844chr8107359 7303 6756 6145 3086 2391 2170 563 524 314 22468 653 22723 1625 --
NM_020845chr1221603 814 --12082 --
NM_020854chr1851586 1574 1103 250 96 --21481 294 --
NM_020861chr631123 1113 363 ----11367
NM_020866chr131293 ------
NM_020868chr231828 1767 250 1526 11925 --
NM_020870chr472113 1987 1677 1651 1560 1424 804 1717 ----
NM_020871chrX4743 614 470 464 12194 1921 --
NM_020872chr321268 87 --21290 1183 1679
NM_020873chr32811 48 1220 ----
NM_020890chr32192 152 ------
NM_020897chr131337 1098 1087 ------
NM_020899chr1772344 2326 2320 1728 923 213 168 ------
NM_020918chr1063658 3362 2600 2471 907 479 1614 ----
NM_020919chr231198 823 64 ------
NM_020921chr1453350 724 459 315 288 11036 2300 139 --
NM_020922chrX41502 481 218 34 11546 ----
NM_020926chrX----131 --
NM_020940chr1022080 1030 12397 32384 2186 988 --
NM_020948chr163558 2376 1432 831 615 121 23664 455 13628 --
NM_020951chr1952400 2131 2019 434 23 1113 3922 310 227 --
NM_020952chr9----168 --
NM_020967chr2041240 1097 872 216 ------
NM_020975chr1051671 1588 1271 229 132 ------
NM_020977chr431691 703 317 ------
NM_020987chr101484 ----134
NM_020993chr1222025 1850 ------
NM_021005chr1521063 475 --31129 368 277 --
NM_021007chr232240 2221 1532 2638 112 21922 1899 --
NM_021012chr1713144 1376 ----
NM_021025chr51347 --1507 --
NM_021033chr1373237 3171 3125 1380 1357 555 190 23145 776 12631 --
NM_021069chr422066 642 11591 22115 657 --
NM_021072chr582606 2522 2485 2248 2198 1688 819 791 ------
NM_021083chrX123347 3207 2729 2482 2271 1028 943 862 509 404 383 351 23070 2611 ----
NM_021097chr241201 976 367 291 ------
NM_021102chr191351 --1373 --
NM_021106chr91493 ------
NM_021110chr82753 258 --1605 --
NM_021132chr1031037 434 345 1412 ----
NM_021136chr142527 91 2232 147 ----
NM_021137chr1742001 1604 637 401 1445 11930 --
NM_021140chrX4862 846 341 74 --2894 425 --
NM_021144chr91483 --1558 --
NM_021145chr741075 413 225 189 --1400 --
NM_021148chr762020 845 822 794 750 96 22313 1740 1692 --
NM_021151chr72962 304 ----11079
NM_021159chr421635 681 11263 1486 --
NM_021163chr783556 2739 915 760 684 587 510 237 1715 --1453
NM_021177chr63287 129 102 ------
NM_021180chr1--1708 ----
NM_021183chrX41032 995 627 166 12328 ----
NM_021188chr143430 370 348 ------
NM_021190chr151090 1060 1012 108 102 --1430 21320 540
NM_021191chr1232576 2538 2184 12280 22288 884 --
NM_021192chr21368 ------
NM_021194chr11232 ------
NM_021203chr33342 276 46 ------
NM_021204chr42801 345 ------
NM_021213chr1721034 325 11274 ----
NM_021215chr2082349 2335 2317 2251 2243 2237 2118 1678 --12092 --
NM_021227chr4156 ------
NM_021229chr1251028 993 980 176 134 11245 11067 --
NM_021238chr1282114 1954 1678 741 359 291 251 102 --41792 1543 598 499 1592
NM_021239chr1431276 1014 78 --1555 --
NM_021249chr14--1426 --1647
NM_021252chr1042010 2000 1612 653 --1204 --
NM_021255chr1483844 3359 3283 1618 1467 1054 942 703 1290 23789 301 --
NM_021619chr911145 ------
NM_021622chr1051537 1510 1497 903 763 194 ----
NM_021627chr32991 801 --1959 --
NM_021629chr364723 4331 1578 1397 1379 386 34880 4827 1528 23478 1257 13590
NM_021637chrX21227 76 ------
NM_021643chr241895 1735 1503 1381 ------
NM_021644chr1051098 953 825 372 27 ------
NM_021647chr463365 2984 2874 1868 439 419 24039 3442 ----
NM_021705chr611300 ----1131
NM_021723chr71578 ------
NM_021728chr142223 63 ------
NM_021738chr102116 89 1705 ----
NM_021809chr2072508 2481 1786 1595 986 890 131 --1914 --
NM_021813chr6245788 5633 5519 5441 5373 5046 4281 4275 4268 3685 2339 2235 2229 1577 1563 1271 869 812 806 800 771 409 266 127 15646 ----
NM_021815chr23819 359 234 32574 2082 799 --1295
NM_021818chr1421427 26 --11229 --
NM_021830chr102871 308 ------
NM_021911chr5125458 5131 5125 5119 4954 4878 4498 3404 1983 1051 879 626 1922 14123 13634
NM_021912chr1534116 3025 694 13342 1314 172
NM_021914chr1452055 1895 694 556 85 ------
NM_021935chr32758 54 --1807 --
NM_021940chr61279 ------
NM_021943chr632151 2145 1588 --1882 --
NM_021945chr633064 533 144 1786 ----
NM_021946chrX41448 166 160 66 ------
NM_021951chr93612 349 267 ------
NM_021956chr62440 40 --21183 1124 --
NM_021957chr121507 1266 ----
NM_021960chr152785 1818 1061 1035 969 12332 1759 12244
NM_021961chr11107399 6872 6144 4620 2862 2679 2453 1612 1084 888 15886 11660 --
NM_021964chr3155974 5605 5358 4712 4209 4121 2516 2185 1915 1881 1863 1461 1343 802 576 45587 4723 4510 1803 36564 1660 376 22381 2219
NM_021973chr42708 658 ------
NM_021979chr141181 --1113 --
NM_021988chr2051410 1327 1111 533 57 ------
NM_021991chr173797 783 143 ------
NM_021998chrX31322 1216 503 ------
NM_022041chr1642713 2325 2027 988 11804 22201 1055 --
NM_022048chr15125790 5693 4809 4766 4754 4615 4597 4583 1949 1918 1835 1619 26239 356 44736 4525 1711 761 --
NM_022049chr12481 338 21337 603 2614 510 --
NM_022051chr1--1248 ----
NM_022062chr1111780 ------
NM_022063chr1051688 1634 1348 585 562 --1153 --
NM_022066chr171991 ------
NM_022079chr103868 257 56 ------
NM_022080chr2042492 2369 751 45 22196 316 ----
NM_022114chr164236 4220 1658 761 538 215 ------
NM_022116chr73685 171 41 ----1247
NM_022118chr13--1243 ----
NM_022123chr141461 ------
NM_022130chr51207 2926 196 152 --
NM_022136chr211498 1617 ----
NM_022166chr16106147 5947 5713 4891 4879 4051 4045 3865 1877 1630 25290 1147 14763 15850
NM_022170chr71216 1166 ----
NM_022351chr873244 2834 2767 1205 769 754 608 13693 11171 23570 3161
NM_022373chr73721 237 118 --1185 1746
NM_022374chr21340 ------
NM_022442chr2051410 1327 1111 533 57 ------
NM_022443chr3129 ------
NM_022454chr83343 112 91 1744 ----
NM_022459chr13206030 5723 5695 5689 5596 5134 4826 4611 4415 4247 4228 4062 2481 2222 1826 1506 552 511 221 74 12454 14698 --
NM_022465chr1263052 2653 2424 473 213 87 --12938 --
NM_022469chr133140 2862 2694 --12563 --
NM_022474chr1452511 2442 1927 1875 588 --3930 894 635 --
NM_022476chr161838 ------
NM_022495chr141510 141 ----
NM_022496chr122351 334 --1499 --
NM_022552chr251178 508 493 486 474 ------
NM_022553chr62435 96 ------
NM_022566chr152540 431 ----1590
NM_022574chr772029 1346 1340 350 342 336 196 ------
NM_022650chr52958 346 ------
NM_022659chr81361 ------
NM_022716chr162363 1132 794 577 331 248 --1502 --
NM_022726chr61638 1369 --1190
NM_022728chr71741 ------
NM_022733chr13933 878 868 ------
NM_022739chr17--3793 755 200 ----
NM_022753chr172778 2624 2469 2306 930 750 254 31837 1087 904 1244 --
NM_022754chr531815 688 253 ------
NM_022756chr141522 488 451 191 1466 ----
NM_022758chr633222 374 161 1580 ----
NM_022763chr362567 1262 934 798 312 91 ------
NM_022770chr1641375 1140 1134 185 11264 ----
NM_022771chr12--1999 ----
NM_022780chr281505 729 722 708 662 405 259 208 --11191 --
NM_022781chr9113156 3092 2763 2734 2713 2451 813 602 537 267 170 --12348 --
NM_022782chr121111 ----1381
NM_022783chr83283 146 115 ------
NM_022802chr1031161 1025 93 --1245 --
NM_022817chr262278 1633 518 478 233 147 1207 12107 --
NM_022824chr5--11462 --1241
NM_022826chr231191 840 244 ------
NM_022831chr131434 658 561 1234 --11341
NM_022832chr442068 1873 1769 369 1157 1697 --
NM_022841chr1542768 2581 2546 434 --1956 --
NM_022843chr13--31465 449 147 ----
NM_022845chr1631843 1559 781 1488 1228 --
NM_022893chr283133 3095 2224 1122 1007 517 348 191 13026 22752 549 --
NM_022894chr261707 1108 371 362 143 67 ------
NM_022898chr14104566 4293 4017 3685 3419 1866 822 609 603 340 11295 33064 1572 568 --
NM_022900chr711006 --1251 --
NM_022909chr53527 219 202 ------
NM_022910chr1611552 ------
NM_022912chr233087 358 302 12552 --1433
NM_022918chr1132093 453 136 1345 ----
NM_022965chr411362 ----11308
NM_022970chr1011205 ------
NM_022977chrX42422 1651 284 178 22649 256 ----
NM_023000chr1481661 1417 1341 690 604 462 446 249 ----21386 1189
NM_023001chr1481661 1417 1341 690 604 462 446 249 ----21386 1189
NM_023010chrX3588 576 143 --1595 --
NM_023015chr13743 733 721 1782 ----
NM_023016chr23790 636 176 1474 12803 1363
NM_023037chr13----21107 845 --
NM_023039chr5163 1110 ----
NM_023079chr1741880 728 551 470 11844 11872 --
NM_023105chr862346 2262 1860 1853 1675 681 1794 ----
NM_023106chr862346 2262 1860 1853 1675 681 1794 ----
NM_023110chr862346 2262 1860 1853 1675 681 1794 ----
NM_023111chr862346 2262 1860 1853 1675 681 1794 ----
NM_023923chr153769 2947 2603 1527 167 13597 42900 2584 685 247 --
NM_023927chr52842 523 2983 913 ----
NM_023929chr832614 574 433 22422 1038 ----
NM_024007chr552830 2436 2068 1192 317 1387 ----
NM_024036chr111244 2251 96 ----
NM_024052chr1792821 2811 1258 1027 983 954 561 231 198 23007 243 1786 --
NM_024065chr2--195 ----
NM_024076chr1922079 2056 ------
NM_024077chr9179 ----1634
NM_024082chrX1138 ------
NM_024104chr193996 945 84 --1930 --
NM_024294chr633222 374 161 1580 ----
NM_024295chr811961 --21290 118 --
NM_024312chr1251132 597 569 404 75 --21108 376 --
NM_024334chr341864 1735 1278 746 --1694 --
NM_024345chr995500 4630 4236 4085 3976 2051 602 586 396 25868 2129 25141 4213 15809
NM_024408chr152716 1127 892 861 817 13165 --12597
NM_024415chr5153 ----169
NM_024422chr1861969 1572 1546 644 565 104 1692 2753 684 11650
NM_024429chr741034 1016 896 269 ------
NM_024496chr144706 570 540 143 ------
NM_024501chr21739 --1503 --
NM_024524chr362880 2625 2215 1040 880 326 --32487 933 340 12691
NM_024525chr11598 --1653 --
NM_024529chr131187 1137 883 --1233 --
NM_024539chrX2409 277 ------
NM_024545chr24781 627 304 75 ------
NM_024546chr134909 337 293 281 11171 1211 --
NM_024548chr341401 643 498 169 ------
NM_024551chr1231700 1003 981 ------
NM_024551chr1231700 1003 981 ------
NM_024556chr113450 401 381 ------
NM_024561chr133926 375 208 ------
NM_024569chr142264 2239 490 332 --32873 649 638 --
NM_024576chr61144 ------
NM_024582chr421017 985 ----1883
NM_024590chr441964 1324 595 537 1769 ----
NM_024594chr541790 1595 1306 508 ------
NM_024613chr811636 11867 11390 --
NM_024624chr251548 1444 1183 1150 388 --2598 245 --
NM_024638chr332350 2163 1002 ------
NM_024639chr622917 2317 11899 21960 889 12610
NM_024640chr13941 300 134 --1694 --
NM_024646chr143916 3576 2717 283 ------
NM_024659chr2--1360 ----
NM_024665chr3174500 4468 3833 3812 3564 3294 1826 1422 1355 1023 995 987 797 758 485 259 182 24339 1254 33935 2861 325 --
NM_024670chr1021149 422 ------
NM_024674chr143042 861 445 43 ------
NM_024675chr16165 ------
NM_024700chr131008 790 416 --2130 51 --
NM_024713chr1531583 1133 33 11298 --11515
NM_024715chr51406 1230 1425 --
NM_024721chr842327 799 605 134 11888 22513 1822 --
NM_024740chr1173737 3144 2952 2674 719 280 103 23548 2603 ----
NM_024744chr212367 12484 --12077
NM_024749chr17901 719 713 497 433 396 268 --1562 --
NM_024753chr21697 ------
NM_024755chr152921 194 ------
NM_024757chr941098 1089 1022 907 --11111 --
NM_024779chr1211088 ------
NM_024789chr10173 --296 63 --
NM_024803chr101365 ------
NM_024811chr1141937 1849 1722 31 11825 ----
NM_024813chr1197 --1226 --
NM_024824chr1451661 593 200 125 44 1212 ----
NM_024828chr92430 84 ----11211
NM_024834chr1051699 1625 1570 1256 419 ------
NM_024847chr1641274 1013 977 934 ------
NM_024893chr20--1152 ----
NM_024896chr932220 1977 935 12385 21027 217 --
NM_024909chr61451 ------
NM_024920chr421289 293 --21422 1246 --
NM_024930chr572796 606 229 223 217 211 173 --1537 12269
NM_024941chr531473 1325 994 ------
NM_024945chr91385 31137 988 793 ----
NM_024947chr3149208 8913 8709 8702 6236 5925 3645 3509 2744 2029 683 502 407 34 17676 38217 6667 640 29159 2530
NM_024949chr474359 3682 3634 1936 1460 95 76 ------
NM_024953chr1272655 2352 2335 2318 1953 1011 776 --3623 612 403 --
NM_024969chr22702 140 ------
NM_024971chr9----168 --
NM_024979chr1321203 418 ------
NM_024989chr2167615 6192 5914 3181 3023 2843 2721 2710 2191 1926 1659 1638 1589 1431 1326 145 38075 5261 2650 1518 27350 444
NM_024991chr1053004 2997 2083 872 852 22414 2213 32964 2822 2254 --
NM_024993chr221324 485 11049 ----
NM_025047chr32326 61 ------
NM_025054chr853930 3341 3275 3046 292 22861 1600 --23973 1577
NM_025065chr15874 729 544 537 229 ------
NM_025073chr1114683 4649 4587 4294 3887 3499 3114 2994 1022 964 905 14037 1810 --
NM_025076chr2----2525 259 --
NM_025077chr11233 ------
NM_025126chr121766 ------
NM_025133chr21804 1297 1896 --
NM_025134chr1652416 2131 794 652 361 ------
NM_025138chr1321464 1077 11402 11190 11181
NM_025146chr351715 692 253 152 121 1441 12646 12414
NM_025154chr751557 1491 1146 553 350 1261 ----
NM_025160chr182977 2961 2832 2781 2634 1550 618 311 --21288 1235 --
NM_025181chr21767 --170 --
NM_025191chr1113570 2882 2818 2708 2455 2432 1322 1139 1133 1061 614 11146 32753 2395 535 --
NM_025196chr4--127 ----
NM_025205chr41122 1234 ----
NM_025208chr1172401 2170 2042 821 764 697 297 21793 403 12392 --
NM_025211chr9----2241 100 --
NM_025214chr1822570 44 32367 2108 354 ----
NM_025221chr441279 563 341 273 ------
NM_025224chr2032342 1587 413 ------
NM_025230chr1431301 757 383 2528 295 --11222
NM_025235chr1031986 848 200 ------
NM_025248chr172189 177 --23220 1124 --
NM_025268chr141396 ------
NM_030583chr82383 345 ------
NM_030594chr154526 257 182 150 --11362 1898
NM_030621chr14104219 4126 3728 3224 1504 641 623 508 318 199 13133 1206 23561 693
NM_030625chr1032055 227 219 ------
NM_030627chr51230 23451 343 1434 43898 3790 3721 2631
NM_030629chr1621680 1612 11694 2603 127 --
NM_030636chr742154 2089 1553 490 ----1905
NM_030637chr142164 105 ------
NM_030647chr7115790 4420 4267 4233 2440 2363 2150 1602 1406 629 548 35836 2060 452 25692 985 16118
NM_030648chr4104961 4619 3968 3889 1329 1323 1260 518 357 332 --15478 11867
NM_030650chr273728 2641 1551 1056 874 652 41 11708 21510 1441 13983
NM_030652chr6----1283 --
NM_030660chr1431230 976 231 --11502 --
NM_030661chr741277 569 498 334 1175 ----
NM_030664chr1051990 1552 1528 868 293 ------
NM_030751chr1051702 1602 1355 482 243 --11894 11642
NM_030751chr1051702 1602 1355 482 243 --11894 11642
NM_030755chr14102613 2439 2390 2384 2378 2167 879 564 480 292 ----1610
NM_030756chr101318 --1257 --
NM_030759chr10--1733 ----
NM_030761chr12298 122 ------
NM_030771chr11164 ------
NM_030780chr851479 1202 519 416 161 11511 ----
NM_030791chr142354 253 1554 21393 639 --
NM_030806chr197738 6730 6529 5854 3666 3475 2165 1915 1892 1766 25878 3248 --
NM_030809chr125945 931 699 212 120 --31777 1688 1015 --
NM_030811chr202370 356 ------
NM_030816chr142741 952 199 176 52655 1296 922 708 296 11342 --
NM_030820chr631055 300 51 1117 1948 --
NM_030877chr201101 ------
NM_030881chr2261852 1592 697 379 150 60 ----1892
NM_030885chr342030 1884 912 296 22249 2236 --1604
NM_030918chr134724 1850 551 11298 35236 264 172 --
NM_030920chr112003 1744 --11498
NM_030923chr22251 101 ------
NM_030926chr2--1982 ----
NM_030937chr121157 973 ------
NM_030938chr1731120 1062 439 ------
NM_030939chr641055 823 358 339 1895 150 --
NM_030940chr921370 418 ------
NM_030949chr65472 355 196 112 106 ------
NM_030953chr52349 178 ------
NM_030958chr8127 ----1396
NM_030962chr1131437 1188 241 ------
NM_030963chr63603 587 231 ------
NM_030965chr1----1539 --
NM_031216chr1862120 1879 1570 1556 1456 1427 ----1704
NM_031217chr111211 --1220 --
NM_031243chr761952 1809 827 435 388 293 11478 ----
NM_031244chr631126 864 194 ------
NM_031262chr92980 828 ------
NM_031263chr931037 885 759 --153 --
NM_031268chr1645397 4934 4180 3957 11606 1340 --
NM_031283chr21858 1850 ----
NM_031292chr1231194 458 221 --11726 --
NM_031296chr462605 2317 2198 584 452 434 12375 ----
NM_031305chr441325 640 568 290 --1234 --
NM_031314chr144688 557 215 205 1286 21858 1422 --
NM_031369chr42333 278 --1634 --
NM_031370chr42333 278 --1634 --
NM_031407chrX130 ------
NM_031411chr521582 372 --137 --
NM_031417chr1911015 1846 ----
NM_031418chr1142552 2400 1744 391 12448 21932 988 --
NM_031419chr331303 1189 1025 --11392 --
NM_031427chr1495889 5449 5126 4599 2175 2162 1856 599 332 1642 ----
NM_031431chr1351769 1663 1514 1471 60 11853 11168 --
NM_031435chr125832 267 261 254 98 --23277 2346 1493
NM_031439chr851884 1601 364 294 241 ------
NM_031442chrX52518 2240 2230 701 254 1811 11976 --
NM_031443chr71327 ------
NM_031452chr15183 ------
NM_031453chr1032301 755 336 22548 762 ----
NM_031463chr164760 352 331 26 1397 ----
NM_031469chr674089 3834 3747 3598 2594 1317 139 12724 ----
NM_031476chr1662734 2719 2590 2041 910 719 12365 11066 --
NM_031483chr2083351 2873 1206 994 851 588 514 326 --12610 --
NM_031492chr111477 ------
NM_031844chr153697 3034 2649 557 329 11633 ----
NM_031845chr243644 3211 2257 1352 --33358 1454 476 12302
NM_031847chr243644 3211 2257 1352 --33358 1454 476 12302
NM_031849chr521582 372 --137 --
NM_031857chr521582 372 --137 --
NM_031858chr1721512 1083 1409 1227 --
NM_031860chr521582 372 --137 --
NM_031862chr1721512 1083 1409 1227 --
NM_031866chr101961 --1935 --
NM_031889chr471927 1871 1209 454 427 345 123 ------
NM_031890chr2232609 2426 27 ------
NM_031903chr7--187 ----
NM_031953chr41127 1443 ----
NM_031989chr121234 ------
NM_031990chr1921247 1014 1139 ----
NM_031991chr1921247 1014 1139 ----
NM_031992chr71216 1166 ----
NM_032041chr862755 2361 2335 1858 911 656 21736 844 ----
NM_032047chr321737 315 2821 689 ----
NM_032088chr541737 680 667 568 ------
NM_032092chr541737 680 667 568 ------
NM_032102chr1142987 1236 835 570 13047 --13134
NM_032116chr13115812 5465 5381 5169 4962 4784 2272 1876 1822 1795 1487 1660 24200 342 24030 1322
NM_032119chr51252 ------
NM_032121chrX72275 2268 1964 856 653 639 525 1817 12343 11901
NM_032125chr11927 ------
NM_032132chr1----1131 --
NM_032144chr221212 1156 1658 ----
NM_032145chr641646 471 465 408 21729 593 ----
NM_032147chr122877 199 --1402 --
NM_032153chr31940 --12321 --
NM_032154chr102915 314 --1435 --
NM_032160chr1894326 4265 4231 3302 2851 1285 979 604 452 --3674 646 308 --
NM_032165chr12----1248 --
NM_032182chr1041419 1088 62 36 ------
NM_032186chr14575 550 327 219 1203 11274 --
NM_032189chr1324748 2034 34966 1970 1765 ----
NM_032199chr10103380 2503 2412 1435 1280 700 689 680 624 207 11483 ----
NM_032208chr263110 2895 2731 1251 1007 1000 --2983 61 --
NM_032221chr2061837 1809 1638 1520 1437 627 ------
NM_032228chr1193434 2963 2617 2369 2353 768 704 482 454 13546 ----
NM_032229chr1321113 1103 ------
NM_032236chr111083 --11110 --
NM_032239chr431343 284 261 11259 ----
NM_032246chr1531275 1076 362 ----1313
NM_032256chr1241042 1036 1029 826 1332 167 --
NM_032271chr16--1309 ----
NM_032288chr372316 2186 841 709 625 380 139 11843 ----
NM_032291chr141560 1372 793 283 11926 ----
NM_032312chr2--1262 --1583
NM_032320chr112287 166 --1782 --
NM_032321chr273221 3020 2462 994 801 466 197 1517 1871 --
NM_032354chr1781182 1121 1049 982 929 889 859 225 ------
NM_032368chr12641 54 1471 ----
NM_032373chr10155732 5449 5125 4878 4836 4192 3864 2166 1753 1326 1270 1229 1219 479 372 13664 14371 24820 1461
NM_032403chr541737 680 667 568 ------
NM_032408chr741200 844 796 82 ------
NM_032410chr831059 897 394 1182 ----
NM_032424chr112532 241 ------
NM_032433chr1931295 1289 1274 ----21556 1360
NM_032435chr171923 1636 807 530 425 296 184 ------
NM_032436chr133935 870 678 ------
NM_032438chr641602 1447 1319 1020 --11589 --
NM_032441chrX41143 983 308 132 ------
NM_032446chr553513 3422 2540 1083 226 13476 ----
NM_032452chr1421535 144 --11243 --
NM_032457chr473888 2996 2841 1447 1180 890 734 --11501 --
NM_032458chrX83263 3057 2809 2776 2740 2668 2377 168 11079 11230 --
NM_032466chr841536 649 316 294 11639 ----
NM_032468chr841536 649 316 294 11639 ----
NM_032482chr191193 ------
NM_032485chr201662 ------
NM_032491chr1221274 371 ------
NM_032505chr392441 1858 1793 1775 1052 639 625 102 56 21800 1119 ----
NM_032507chr61228 ------
NM_032509chr842407 805 545 49 2206 130 190 --
NM_032510chr1832485 235 93 3472 367 317 22323 2165 --
NM_032511chr62347 114 ----1319
NM_032521chr2052606 2464 2272 790 701 11201 ----
NM_032539chrX3336 170 86 ------
NM_032547chr421137 290 ------
NM_032557chr41322 2401 140 ----
NM_032558chr931229 523 165 11463 1947 --
NM_032560chr142995 829 ----1851
NM_032569chr1611929 21913 1573 11358 --
NM_032575chr1611982 ------
NM_032576chrY1118 ------
NM_032581chr751868 1588 366 341 79 --1227 --
NM_032582chr1751343 1172 585 569 446 --11300 --
NM_032594chr142962 401 ------
NM_032595chr1711238 ------
NM_032598chr17141 ------
NM_032603chr21149 ------
NM_032622chr431257 1044 462 1633 1195 183
NM_032631chr192186 128 ------
NM_032632chr1451894 1840 1769 466 117 --21540 437 --
NM_032664chr821474 1463 11549 11432 --
NM_032682chr343443 3045 837 691 22302 726 ----
NM_032689chr1921146 270 ----1119
NM_032711chr1731265 817 27 --12963 1981
NM_032737chr1931750 650 396 12638 12104 --
NM_032765chr52862 93 ------
NM_032778chr352522 2268 1143 637 401 23131 2398 13300 --
NM_032780chr1121188 920 ------
NM_032784chr6----11029 --
NM_032801chr1151995 1971 1744 979 724 ------
NM_032804chr1032166 2158 1949 1464 1420 11651
NM_032810chr1031279 1045 283 1598 ----
NM_032813chr133951 250 92 ------
NM_032826chr754293 3472 1890 1449 331 --14740 --
NM_032828chr1983454 3422 3007 1507 613 197 159 131 1309 ----
NM_032829chr1211111 ------
NM_032842chr711478 11500 31247 388 316 --
NM_032857chr152156 45 1207 ----
NM_032859chr13103932 3496 2837 2823 1160 1138 1128 839 698 571 13761 2906 155 12698
NM_032864chr12502 160 --41388 352 193 108 --
NM_032870chr63453 213 126 ------
NM_032871chr1121524 680 1789 ----
NM_032873chr1153353 1658 1146 862 46 11622 ----
NM_032875chr17--1340 ----
NM_032883chr201596 ------
NM_032884chr12296 290 ------
NM_032900chr1073895 3837 2493 2423 492 456 420 1401 12447 --
NM_032905chr1041315 386 350 164 11247 ----
NM_032918chr121153 --1320 --
NM_032927chr45664 559 209 43 21 1642 ----
NM_032932chr17106156 5395 4653 4165 1670 1316 1243 1144 854 730 14599 ----
NM_032960chr121435 1147 11544 11193 1275
NM_032961chr41