TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548x-5p
miRNA Sequence: UGCAAAAGUAAUUGCAGUUUUUG

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51144 11205 2972 859 --
NM_000038chr562030 725 630 422 131 64 1100 ----
NM_000052chrX93404 3394 3386 3310 2945 1317 692 392 216 32533 1037 710 1615 --
NM_000074chrX2951 335 ------
NM_000081chr12647 605 ----11299
NM_000084chrX86023 6006 5297 5115 2092 1923 689 396 --12335 14274
NM_000088chr1721027 974 11331 ----
NM_000090chr22202 169 --1864 --
NM_000092chr293935 3488 2816 1691 1612 1415 1260 749 126 24063 3215 --14516
NM_000093chr942365 2253 839 568 ------
NM_000104chr262701 2146 2000 1056 377 211 12929 3763 596 88 --
NM_000108chr731401 192 120 --11484 150
NM_000109chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_000110chr12968 296 1992 1769 --
NM_000111chr71104 1253 ----
NM_000112chr565559 5183 4196 3556 870 687 34746 4472 88 ----
NM_000115chr1342483 928 821 599 ------
NM_000117chrX3293 219 113 --1241 --
NM_000125chr684173 4047 3780 3249 3208 812 800 370 23814 3770 14138 14221
NM_000129chr631452 513 394 1544 ----
NM_000138chr1522556 1898 32488 1885 355 ----
NM_000139chr1142209 836 527 144 ------
NM_000141chr1011338 2452 320 1582 --
NM_000146chr191139 ------
NM_000151chr1741783 1392 1228 424 ------
NM_000158chr33580 568 44 ----1701
NM_000163chr551500 410 335 282 94 21677 1467 1364 --
NM_000165chr631355 1070 369 21584 1274 ----
NM_000168chr772775 2577 2564 2540 1347 465 370 --21319 552 13326
NM_000170chr91345 1412 ----
NM_000176chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_000189chr221504 137 11757 1103 --
NM_000192chr1251364 1328 1318 326 209 ------
NM_000194chrX1459 2139 108 ----
NM_000208chr1994720 4309 4043 3439 1865 1211 498 356 271 13011 --14612
NM_000210chr242234 1751 864 441 22038 364 ----
NM_000214chr202712 499 21514 383 ----
NM_000216chrX93964 3462 3076 2561 1060 820 473 415 260 34017 3700 2963 1832 --
NM_000217chr1264322 3305 1983 1488 1295 1082 24534 3648 11755 14843
NM_000222chr451979 1936 1847 160 48 11949 ----
NM_000240chrX52275 2256 1776 1659 1458 ------
NM_000245chr751544 1473 1423 693 530 3810 678 669 1440 --
NM_000248chr362837 2481 1143 836 285 161 11114 ----
NM_000252chrX51473 1238 1081 313 250 21393 1353 ----
NM_000253chr44831 772 362 348 1122 1760 --
NM_000259chr1566070 5846 5816 5262 4980 4383 --15228 --
NM_000264chr9103281 3139 3098 2672 2419 2240 676 665 528 158 43146 2644 2313 425 ----
NM_000266chrX2632 224 1701 ----
NM_000267chr17133214 3130 2913 2906 2894 2632 2374 2134 1040 822 814 797 214 23139 830 ----
NM_000278chr1011554 12317 12269 --
NM_000280chr112857 794 ------
NM_000288chr61349 ------
NM_000304chr173347 333 321 --11063 1819
NM_000314chr1062860 2590 2329 1186 472 228 31226 1218 1081 1349 12257
NM_000319chr121283 ------
NM_000321chr1341463 1228 615 121 11724 11615 1356
NM_000329chr12812 26 1130 1899 --
NM_000332chr6126491 5384 4474 4371 4349 2841 2689 2590 2479 2468 1483 986 26810 5278 ----
NM_000333chr32288 42 11115 ----
NM_000337chr5116031 5829 5223 5181 2595 2338 2326 2266 1768 1734 47 1631 14299 15282
NM_000340chr34606 517 231 184 --1535 --
NM_000345chr441020 985 315 235 ------
NM_000346chr1761901 1864 1392 1364 116 102 41992 1428 762 595 11940 --
NM_000358chr5--1391 ----
NM_000361chr201384 21671 235 1632 11642
NM_000362chr2253375 3074 2495 1111 201 ------
NM_000368chr954531 600 530 449 164 24883 4457 23969 903 --
NM_000393chr232009 1566 418 1687 21549 457 --
NM_000396chr12534 94 ------
NM_000397chrX2723 481 ----12418
NM_000399chr1031020 357 317 11007 ----
NM_000405chr541632 417 377 61 1149 ----
NM_000408chr2103334 3120 2910 2841 2128 1360 1004 372 296 265 22258 255 11277 12751
NM_000421chr171242 ------
NM_000428chr1422646 545 12655 22478 900 12638
NM_000430chr1773172 1512 1444 1264 1192 877 554 --11088 --
NM_000439chr582420 2235 2204 2050 958 246 84 60 ------
NM_000441chr762137 2022 880 758 699 383 12165 12207 --
NM_000448chr11103091 3038 3024 2921 2866 2740 2692 2315 947 446 43125 3045 411 32 11320 --
NM_000451chrX2788 742 11436 ----
NM_000461chr344271 3717 3506 75 24444 1575 13465 14583
NM_000462chr155523 469 371 254 93 --21394 337 --
NM_000474chr7--1655 ----
NM_000478chr11703 ------
NM_000489chrX62329 2299 2240 1386 1348 498 33037 2494 2264 12714 22742 447
NM_000495chrX41062 447 291 239 --2780 22 --
NM_000503chr841870 1722 731 439 11773 ----
NM_000509chr4----1192 --
NM_000522chr711149 ------
NM_000523chr23261 219 120 11106 11205 --
NM_000525chr111191 --11463 --
NM_000527chr1922373 2154 32458 2244 875 ----
NM_000533chrX31794 1509 204 11742 11584 --
NM_000536chr113419 87 41 ------
NM_000553chr81450 2597 402 ----
NM_000555chrX157552 6710 6698 6042 5949 5708 5487 4922 4762 2551 1949 1398 1177 326 113 36662 2064 1969 11027 --
NM_000560chr11681 ------
NM_000565chr132108 1544 676 ------
NM_000582chr42400 384 --1360 --
NM_000589chr5123 ------
NM_000597chr21286 ----1307
NM_000598chr731439 1421 155 148 ----
NM_000599chr274323 4234 3996 1439 1194 1146 241 24491 3767 24605 3905 --
NM_000601chr71168 ------
NM_000610chr11101114 902 889 882 875 577 409 154 146 139 32956 2703 2485 22538 702 --
NM_000615chr1162591 1084 989 979 966 917 1194 1147 --
NM_000618chr12156276 6226 6032 5904 5461 5304 5144 4983 4868 4600 4404 4391 4074 2557 2230 1915 15095 --
NM_000618chr12156276 6226 6032 5904 5461 5304 5144 4983 4868 4600 4404 4391 4074 2557 2230 1915 15095 --
NM_000624chr142836 735 1872 --1793
NM_000627chr23618 375 302 1811 ----
NM_000633chr1864962 4896 4886 4870 4774 1836 15000 25014 4938 13861
NM_000641chr1921411 647 21580 388 ----
NM_000681chr101494 ------
NM_000684chr101333 1942 2503 282 --
NM_000701chr11242 1250 ----
NM_000702chr121870 1509 --11656 12200
NM_000706chr123639 295 42 1181 ----
NM_000717chr171116 ------
NM_000719chr1262524 2473 1697 1511 1016 784 21883 1722 2860 706 --
NM_000720chr3------1127
NM_000724chr1031722 1234 36 1124 --1186
NM_000726chr21244 ------
NM_000756chr81323 ------
NM_000767chr1951348 1097 1045 970 234 1390 11315 --
NM_000785chr12--162 ----
NM_000788chr441220 1073 163 115 --2325 183 --
NM_000800chr521678 1646 --1416 --
NM_000801chr204950 416 296 259 1767 ----
NM_000806chr541619 598 533 494 --11633 --
NM_000813chr595120 4879 4620 1979 1658 1181 1084 898 693 15237 14312 14201
NM_000814chr1564143 4118 3968 3710 1050 696 21507 264 ----
NM_000816chr51641 ------
NM_000817chr211181 11073 ----
NM_000826chr442418 1027 881 185 11678 ----
NM_000827chr572590 2549 2446 2141 1894 188 169 ------
NM_000828chrX52046 1691 705 546 224 12184 ----
NM_000829chr11--1933 ----
NM_000831chr111027 26144 6133 ----
NM_000838chr622515 1751 --12757 2933 337
NM_000839chr3--1467 ----
NM_000840chr71136 1375 ----
NM_000844chr32907 51 1840 1808 --
NM_000859chr521705 139 41679 1382 1354 433 11563 --
NM_000861chr352644 1724 1054 836 780 21950 1718 ----
NM_000865chr62160 150 ------
NM_000868chrX32546 995 249 --1310 --
NM_000872chr1021021 377 ------
NM_000875chr15106533 6492 5886 5475 5120 2593 2464 2353 1284 589 26909 5668 ----
NM_000877chr222942 2120 33025 3004 2410 ----
NM_000891chr1783038 3009 2776 914 545 420 381 249 43618 2441 847 739 1443 11076
NM_000899chr12--11647 ----
NM_000901chr42842 825 42403 2275 894 689 2698 446 1764
NM_000909chr431331 534 242 --1150 --
NM_000910chr431738 486 267 11399 ----
NM_000912chr841284 1132 1104 893 12196 ----
NM_000919chr51561 ------
NM_000921chr123671 183 141 --1492 --
NM_000933chr2031740 1518 82 1471 ----
NM_000934chr17--1694 --1683
NM_000935chr34990 961 806 794 ------
NM_000937chr171403 --1384 --
NM_000938chr4--1163 ----
NM_000943chr5--2373 116 ----
NM_000944chr462365 787 764 502 221 45 1626 ----
NM_000945chr2--31815 1580 602 21803 33 --
NM_000949chr52908 214 ------
NM_000950chrX73639 2435 2233 965 674 186 150 31313 656 444 43123 3033 2218 489 11172
NM_000956chr14--1313 ----
NM_000958chr551248 1233 1165 895 139 ------
NM_000961chr2043226 2952 2798 879 13383 ----
NM_000962chr91778 32900 2705 367 12338 --
NM_000964chr172532 513 ------
NM_000965chr331172 865 93 --1389 --
NM_000966chr121134 11086 1857 --
NM_000983chr121584 476 126 ----
NM_001001132chr2121465 500 1408 1267 --
NM_001001323chr1282890 2293 2084 1262 1108 887 761 479 12824 21200 1131 --
NM_001001330chr1031239 870 528 --2915 381 --
NM_001001331chr362280 946 529 476 390 369 ----11705
NM_001001342chr1011204 ------
NM_001001389chr11101114 902 889 882 875 577 409 154 146 139 32956 2703 2485 22538 702 --
NM_001001390chr11101114 902 889 882 875 577 409 154 146 139 32956 2703 2485 22538 702 --
NM_001001391chr11101114 902 889 882 875 577 409 154 146 139 32956 2703 2485 22538 702 --
NM_001001392chr11101160 948 935 928 921 623 455 200 192 185 33002 2749 2531 22584 748 --
NM_001001395chr1272184 1097 807 773 252 235 56 --12190 --
NM_001001396chr194450 3337 3289 2786 1641 1536 1018 953 634 24314 4130 33875 1315 855 --
NM_001001419chr5115178 4642 4045 3761 3519 1904 1755 1011 825 798 149 55211 949 850 689 475 23786 2034 1658
NM_001001420chr5115178 4642 4045 3761 3519 1904 1755 1011 825 798 149 55211 949 850 689 475 23786 2034 1658
NM_001001433chr2053136 2864 2022 396 189 23179 714 ----
NM_001001436chr161222 ------
NM_001001481chr841250 1125 972 281 --21040 994 --
NM_001001483chr113424 356 39 1455 ----
NM_001001484chr1061991 1667 1529 988 652 639 1661 1864 --
NM_001001522chr111389 ------
NM_001001549chr722563 671 52821 2308 2115 400 383 12518 12143
NM_001001550chr722563 671 52821 2308 2115 400 383 12518 12143
NM_001001555chr722563 671 52821 2308 2115 400 383 12518 12143
NM_001001556chr1521201 631 195 ----
NM_001001557chr811671 --1264 --
NM_001001664chr263935 3843 3327 2622 889 104 34105 3888 372 --1863
NM_001001668chr1963522 3406 3318 3219 3187 3160 23785 3349 1124 --
NM_001001740chr12279 256 ------
NM_001001740chr12279 256 ------
NM_001001790chr91401 ------
NM_001001875chr94456 424 281 87 ------
NM_001001890chr21113745 3582 3423 3402 3366 3272 3256 701 683 665 657 --1864 13698
NM_001001928chr22118337 7240 7168 7065 6982 6406 6007 5831 1509 928 379 21931 85 36347 6212 1237 --
NM_001001933chr12475 413 2234 189 ----
NM_001001936chr103934 768 277 ------
NM_001001937chr18139 ------
NM_001001971chr1021023 485 11065 ----
NM_001001974chr1071904 1590 1569 1498 868 735 531 2766 563 --11820
NM_001001994chrX2427 93 ------
NM_001001995chrX51742 1698 1688 1553 1450 11760 ----
NM_001001996chrX2427 93 ------
NM_001002006chr25807 337 155 143 58 ------
NM_001002026chr372476 2422 1740 1617 445 395 92 ------
NM_001002032chr17144 ----1199
NM_001002243chr26911 745 722 313 244 227 1756 1584 --
NM_001002255chr61350 --1132 --
NM_001002257chr263364 3223 1301 1144 877 147 2136 82 ----
NM_001002259chr122136 105 ------
NM_001002269chr92490 375 --1341 --
NM_001002295chr104914 837 440 113 169 ----
NM_001002762chr1022448 1802 ------
NM_001002838chrX2597 135 21868 756 ----
NM_001002843chr1531286 1223 430 ------
NM_001002860chr14104601 3994 3954 3408 3359 3084 2926 175 130 119 2389 297 ----
NM_001002909chr1721525 1433 1840 21633 1494 --
NM_001003406chr2223055 443 12100 1369 --
NM_001003652chr18167565 6635 6151 5409 3122 2880 2802 2183 1570 1380 754 670 660 650 599 465 27432 2771 12290 11148
NM_001003674chr1896086 5863 5518 5343 4726 1981 829 819 472 --16348 25139 1446
NM_001003675chr1896086 5863 5518 5343 4726 1981 829 819 472 --16348 25139 1446
NM_001003679chr152179 1847 1580 551 277 32135 1539 573 ----
NM_001003681chr2222052 1898 12120 ----
NM_001003688chr431010 762 489 11097 --11136
NM_001003698chr6--1354 ----
NM_001003699chr6--1354 ----
NM_001003712chr12123847 3498 3471 3078 3042 2817 2807 2668 1270 1229 1197 800 23956 3648 32785 790 236 --
NM_001003792chr32211 108 ------
NM_001003793chr32211 108 ------
NM_001003800chr933221 2696 2609 ----1824
NM_001003810chr41635 1118 ----
NM_001003940chr1553697 3494 3265 112 100 ----11364
NM_001003942chr1553697 3494 3265 112 100 ----11364
NM_001003943chr1553701 3498 3269 116 104 ----11368
NM_001004019chr32404 115 ------
NM_001004051chrX184 ------
NM_001004065chr963830 3785 2609 1151 1041 223 21536 992 12909 --
NM_001004128chr11684 --1482 --
NM_001004196chr31786 1230 1499 --
NM_001004303chr13720 689 575 ------
NM_001004303chr13720 689 575 ------
NM_001004304chr1273117 3089 2263 1978 823 556 386 ------
NM_001004317chr644167 1008 682 633 23542 3390 23311 493 --
NM_001004329chr1261389 1312 1103 1095 511 424 21459 1250 ----
NM_001004342chr166106 6054 5992 3767 1502 346 15963 1602 14339
NM_001004346chr42389 301 ------
NM_001004360chr231830 1605 1501 1253 ----
NM_001004431chr171243 ------
NM_001004720chr211065 ------
NM_001004722chr211234 ------
NM_001005242chr1231622 1368 388 ------
NM_001005266chr152628 56 ------
NM_001005267chr152628 56 ------
NM_001005268chr152628 56 ------
NM_001005269chr152628 56 ------
NM_001005335chr19166 ------
NM_001005366chr122276 261 1308 2762 756 --
NM_001005375chrY11735 --11159 --
NM_001005386chr281991 1787 1642 900 628 619 572 165 ------
NM_001005404chr1724350 1751 14228 --13144
NM_001005463chr1041961 912 843 466 42369 2133 877 287 2904 771 --
NM_001005473chr5126113 5562 4660 4634 4586 2421 1184 676 603 532 474 438 34597 4433 2236 ----
NM_001005474chr341337 1184 534 280 11395 ----
NM_001005476chr21141 ------
NM_001005502chr1254827 4318 4020 3241 976 34984 818 330 --14736
NM_001005526chr21106 ------
NM_001005527chr321313 390 11014 2405 57 --
NM_001005609chrX43733 3605 1176 502 --13058 --
NM_001005739chr23861 548 188 ------
NM_001005743chr1451269 1192 1130 1115 1096 ------
NM_001005744chr1451269 1192 1130 1115 1096 ------
NM_001005745chr1451269 1192 1130 1115 1096 ------
NM_001005746chr21244 ------
NM_001005747chr21244 ------
NM_001005781chr21229 ------
NM_001005782chr23697 678 180 ----165
NM_001005849chr17--1478 ----
NM_001005861chr34944 911 668 235 1226 ----
NM_001005862chr171492 ------
NM_001006115chr321865 994 --12581 --
NM_001006600chr542489 2445 447 294 21660 273 1481 --
NM_001006610chr1641003 677 330 287 1921 1853 1248
NM_001006634chr16--1496 ----
NM_001006635chr24296 223 104 34 ------
NM_001006657chr263188 2601 2404 1057 917 265 41022 708 135 97 1251 12659
NM_001006665chr11675 ------
NM_001006684chrX3421 412 108 ------
NM_001006945chr14681 632 296 222 ------
NM_001006946chr211441 1515 11188 --
NM_001007024chr1794355 4302 3919 3743 3712 3400 2919 1484 1386 --23288 250 --
NM_001007025chr1794355 4302 3919 3743 3712 3400 2919 1484 1386 --23288 250 --
NM_001007067chr831064 873 752 --1886 --
NM_001007068chr831064 873 752 --1886 --
NM_001007069chr831064 873 752 --1886 --
NM_001007070chr831064 873 752 --1886 --
NM_001007075chr441118 921 843 837 2714 394 ----
NM_001007097chr984419 4134 3924 3632 1490 1398 787 343 ------
NM_001007098chr11894 ------
NM_001007099chr1123 --1321 --
NM_001007100chr1123 --1321 --
NM_001007102chr691619 1591 1321 1311 1057 488 329 257 215 1339 --21274 623
NM_001007157chr7122 ------
NM_001007214chr13622 312 226 1407 ----
NM_001007226chr1711068 21094 427 11119 --
NM_001007227chr1711068 21094 427 11119 --
NM_001007228chr1711068 21094 427 11119 --
NM_001007229chr1711068 21094 427 11119 --
NM_001007230chr1711068 21094 427 11119 --
NM_001007237chr132429 644 376 22392 478 12092 --
NM_001007246chr2121554 481 1282 ----
NM_001007257chr161259 1189 1049 947 533 316 ------
NM_001007267chr21844 1791 1170 --
NM_001007277chr111272 ------
NM_001007278chr13125296 5015 4927 4675 4630 4050 3716 1318 700 377 215 197 33193 941 534 131 --
NM_001007466chr665043 4530 3447 1570 1557 1544 25218 4708 14031 --
NM_001007468chr221260 1267 ----
NM_001007553chr121245 1183 ------
NM_001007559chr1851631 1612 1599 705 107 31788 419 373 ----
NM_001008222chrX1360 --124 --
NM_001008225chr73606 572 83 163 --2595 587
NM_001008239chr18113805 3778 3709 3469 3457 3179 3155 1338 1328 1172 347 --33505 2390 1313 --
NM_001008392chr363090 2751 860 685 407 147 ------
NM_001008401chr1931377 1086 269 ------
NM_001008405chr72379 347 ------
NM_001008407chr731849 1822 1412 ------
NM_001008408chr745511 4873 2032 257 45843 5119 4528 2111 ----
NM_001008491chr241951 1537 544 227 22039 174 --1742
NM_001008492chr241951 1537 544 227 22039 174 --1742
NM_001008495chr861870 1741 1702 1487 805 462 1560 ----
NM_001008540chr24381 175 138 116 ------
NM_001008541chr1052171 2105 1943 607 554 ------
NM_001008541chr1052171 2105 1943 607 554 ------
NM_001008564chr1352021 1894 1880 416 307 42142 1955 1806 1690 1836 --
NM_001008660chr1171603 1596 1538 1369 1295 398 242 ------
NM_001008707chr1441666 1300 763 84 --1192 --
NM_001008723chr102338 168 ------
NM_001008738chr562738 2340 1818 937 190 178 22374 451 ----
NM_001008801chr1942057 1763 1629 1474 1282 ----
NM_001008895chr1361226 1200 1057 972 956 934 ------
NM_001008925chr483568 3025 2988 2334 2315 1232 807 430 1293 13433 --
NM_001009185chr51626 ------
NM_001009555chr421276 445 2162 76 ----
NM_001009571chr741186 219 195 182 1489 1240 --
NM_001009880chr2263927 3722 3681 3558 3339 1160 14903 34251 4049 650 11316
NM_001009881chr12648 605 ------
NM_001009882chr12648 605 ------
NM_001009909chr11103957 3321 2393 1555 1546 896 752 573 536 219 21187 1153 11137 --
NM_001009955chr11378 ------
NM_001009955chr11378 ------
NM_001009959chr222459 382 22082 459 12364 --
NM_001009960chr732406 2275 1028 22375 2233 --12831
NM_001009993chr234280 507 210 ----11319
NM_001009994chr61124 ------
NM_001010853chr6103039 2993 2807 2310 2238 1225 988 896 517 430 73246 3144 2912 2259 678 346 181 ----
NM_001010854chr142258 193 ------
NM_001010861chr13748 639 473 ------
NM_001010862chrX63296 1231 525 321 153 111 1103 1168 --
NM_001010867chr166561 5450 5154 4885 1995 926 25328 2150 ----
NM_001010888chrX114584 4502 4414 3976 3508 3499 3359 3207 3057 1795 426 33471 3388 582 ----
NM_001010891chr5146671 6102 5926 5459 5086 4894 4280 2666 2511 2269 1221 576 426 289 25251 4449 --14250
NM_001010895chr92409 98 11966 ----
NM_001010922chr163647 3317 2922 471 417 195 42953 1274 655 444 24108 1338 --
NM_001010923chr641532 1369 1112 405 11134 ----
NM_001010924chr1031028 783 498 1364 1858 --
NM_001010927chr62386 111 1458 ----
NM_001010932chr71168 ------
NM_001010942chr1221299 905 11215 ----
NM_001010984chr152396 2264 1932 999 960 --12017 --
NM_001010986chrX72514 1649 1640 881 600 354 337 ------
NM_001010989chr16----1133 --
NM_001010990chr16----1133 --
NM_001011513chr484049 3353 2530 2511 1626 1615 979 834 14034 ----
NM_001011515chr42264 172 ------
NM_001011516chr42264 172 ------
NM_001011537chr362318 2308 2052 1930 130 23 11730 ----
NM_001011546chr201248 ------
NM_001011553chr72969 145 1661 ----
NM_001011657chrX2951 310 21080 138 ----
NM_001011666chr786552 6443 6430 4692 4505 2548 1345 422 --25095 1665 --
NM_001011708chr242583 852 742 350 22533 2076 11184 --
NM_001011713chr1461466 1201 616 566 336 214 ------
NM_001011718chr201808 ------
NM_001011720chr831301 93 37 ------
NM_001012393chr1185116 4657 4566 4061 2073 797 130 95 24121 685 14109 11313
NM_001012418chr674295 4070 3916 3757 3400 302 66 11552 --13662
NM_001012426chr611034 23332 2714 13098 --
NM_001012427chr611034 23332 2714 13098 --
NM_001012478chr192634 415 ------
NM_001012514chr2------1974
NM_001012516chr2------1974
NM_001012732chr411213 11228 ----
NM_001012751chr1041523 1218 702 414 ----11948
NM_001012755chrX54699 1819 1790 1195 828 34169 1620 1352 14654 14632
NM_001012756chr1993119 3043 3004 2768 2363 2349 2276 365 354 22639 2505 ----
NM_001012761chr582559 2367 2260 2196 2039 1932 210 33 31680 744 216 ----
NM_001012968chrX72446 2416 2096 1780 187 163 54 11809 22778 891 --
NM_001012977chrX31348 1115 456 ------
NM_001012989chrX2684 61 1632 ----
NM_001012990chrX149 ------
NM_001013031chr1043452 3233 3221 324 1979 ----
NM_001013398chr731439 1421 155 148 ----
NM_001013406chr741514 592 513 85 138 ----
NM_001013415chr441443 1110 557 241 21293 521 ----
NM_001013437chr18169 ------
NM_001013438chr3--1985 ----
NM_001013439chr31272 1831 ----
NM_001013620chr12208481 8026 7969 6971 6615 6398 5722 2831 2821 2665 2457 2355 2192 2166 2158 2147 1537 1393 1327 395 67508 6537 5924 2694 1763 293 28015 2582 1433
NM_001013629chr1022116 1386 ------
NM_001013635chr121428 ------
NM_001013699chr12--274 28 ----
NM_001013843chr153924 264 196 1887 ----
NM_001014286chr13175 ------
NM_001014380chr1395587 4786 4652 2141 1456 769 670 639 34 65468 4965 4373 3938 1961 1750 25825 5733 11915
NM_001014434chr12271 207 ------
NM_001014443chr12253 85 ------
NM_001014797chr1098046 6362 5597 5267 3046 2635 2080 1474 1158 48227 2135 1896 757 ----
NM_001014809chr4174 1865 ----
NM_001014972chr2163 ------
NM_001015045chr432002 1845 875 1210 ----
NM_001015048chr1493026 2878 2620 619 519 392 246 148 22 32223 1985 35 22320 726 2546 285
NM_001015049chr1493026 2878 2620 619 519 392 246 148 22 32223 1985 35 22320 726 2546 285
NM_001015053chr17144 11572 ----
NM_001015508chr82217 209 --1649 --
NM_001015877chrX63023 2935 2481 2469 2014 1069 --31009 930 630 --
NM_001015881chrX41200 1175 1031 69 11043 ----
NM_001015882chr91219 ----1767
NM_001015885chr20--2336 271 --1351
NM_001015887chr321509 1326 --11256 --
NM_001017368chr1732807 2324 2300 22834 2384 22564 2017 --
NM_001017369chr421119 431 11021 ----
NM_001017371chr251410 1078 1031 212 105 2405 202 ----
NM_001017395chr3103201 2659 2344 1310 1203 1071 866 578 473 197 --22696 2639 --
NM_001017415chr13620 513 92 --1297 --
NM_001017416chr13620 513 92 --1297 --
NM_001017420chr841415 949 531 154 --11432 --
NM_001017424chr131614 1227 250 1423 ----
NM_001017425chr131614 1227 250 1423 ----
NM_001017440chr7108283 7271 6824 6746 6703 6617 5214 1576 1488 227 37827 5252 1459 ----
NM_001017916chr1722026 1411 --11601 --
NM_001017917chr1722026 1411 --11601 --
NM_001017920chr2------1120
NM_001017921chr192710 342 ------
NM_001017922chr111711 --21498 122 11723
NM_001017923chr1431111 352 70 11071 ----
NM_001017926chr811605 ------
NM_001017928chr3--1248 ----
NM_001017930chrX3206 117 104 ------
NM_001017969chr92561 416 ------
NM_001017973chr51100 ------
NM_001017974chr51100 ------
NM_001017977chr12125 106 ------
NM_001017999chr13528 352 329 12170 11704 --
NM_001017999chr13528 352 329 12170 11704 --
NM_001018000chr13528 352 329 12170 11704 --
NM_001018000chr13528 352 329 12170 11704 --
NM_001018001chr13528 352 329 12170 11704 --
NM_001018009chr331154 1028 482 11190 ----
NM_001018037chr921258 1090 2394 271 1509 --
NM_001018038chr9------1111
NM_001018053chr171844 1693 1622 1566 698 349 247 11719 --21972 683
NM_001018054chr121331 565 1409 ----
NM_001018056chr9--1507 --1170
NM_001018064chr961935 1818 1582 570 312 197 11699 ----
NM_001018065chr975587 5100 4306 3877 3707 1401 444 14060 --26011 4642
NM_001018066chr975587 5100 4306 3877 3707 1401 444 14060 --26011 4642
NM_001018067chr175383 5327 4784 4638 1574 1091 556 1204 24833 4676 2278 59
NM_001018068chr175383 5327 4784 4638 1574 1091 556 1204 24833 4676 2278 59
NM_001018069chr175383 5327 4784 4638 1574 1091 556 1204 24833 4676 2278 59
NM_001018074chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_001018075chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_001018076chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_001018077chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_001018078chr9----181 --
NM_001018090chr15132850 2841 2604 2282 2042 1985 1767 916 672 661 638 607 426 22194 226 12488 --
NM_001018091chr15132960 2951 2714 2392 2152 2095 1877 1026 782 771 748 717 536 22304 336 12598 --
NM_001018100chr152858 770 ------
NM_001018102chr15132850 2841 2604 2282 2042 1985 1767 916 672 661 638 607 426 22194 226 12488 --
NM_001018108chr152721 504 --22142 147 --
NM_001018111chr774034 3848 3195 3110 2964 2901 1175 --23767 979 --
NM_001018676chr8--1478 ----
NM_001018677chr8--1478 ----
NM_001020658chr151448 1318 1148 648 297 41636 1564 1442 428 --11419
NM_001020658chr151448 1318 1148 648 297 41636 1564 1442 428 --11419
NM_001023560chr61382 ------
NM_001023567chr1552381 2362 1829 1536 615 --12282 --
NM_001024094chr583298 2937 2386 1230 1007 433 124 88 33572 955 783 ----
NM_001024226chr11185 11122 --1999
NM_001024227chr11185 11122 --1999
NM_001024228chr11185 11122 --1999
NM_001024380chr81115 22028 585 1632 --
NM_001024381chr81115 22028 585 1632 --
NM_001024455chrX22620 2109 --11697 144
NM_001024593chr104848 806 600 177 1333 ----
NM_001024647chr1286193 5637 4660 2851 1637 1025 1000 947 16862 14756 1118
NM_001024649chr532689 2289 519 --12870 --
NM_001024660chr321399 1364 ------
NM_001024666chrX----2677 456 --
NM_001024668chr12----2889 333 --
NM_001024736chr15--11515 ----
NM_001024808chr1262773 2026 1852 1831 418 371 ------
NM_001024809chr172532 513 ------
NM_001024847chr322234 1842 --11561 1582
NM_001024855chr321684 295 --1163 --
NM_001024924chr41473 ------
NM_001024947chr52858 301 ----1171
NM_001024948chr1113435 3416 3177 1349 1229 1137 957 908 757 648 174 --22503 227 1732
NM_001024956chr1165771 5146 4735 3795 1174 864 21426 898 15404 --
NM_001024959chr32867 299 ------
NM_001024960chr32867 299 ------
NM_001025068chr381688 1443 1135 649 633 478 384 97 ------
NM_001025069chr381688 1443 1135 649 633 478 384 97 ------
NM_001025072chr342195 1922 1166 197 --1979 --
NM_001025073chr342195 1922 1166 197 --1979 --
NM_001025076chr10136168 5906 5463 4245 3913 3798 2021 1887 1792 1676 1659 968 551 53883 2466 1303 1177 613 1679 --
NM_001025077chr10207526 7264 6821 5603 5271 5156 5021 4957 4859 4731 4613 3034 3017 2326 1909 1349 1080 647 302 256 55241 4810 2661 2535 1971 12037 --
NM_001025079chr3104132 3995 3604 3506 2873 2840 2641 1472 1357 241 33788 3744 2726 12580 --
NM_001025105chr521257 329 11554 21057 343 --
NM_001025108chr283384 3019 2697 1655 1332 582 529 58 12902 --21353 143
NM_001025201chr2--1148 ----
NM_001025205chr3--1426 ----
NM_001025252chr833162 2965 2180 33219 2571 604 13203 12620
NM_001025253chr833162 2965 2180 33219 2571 604 13203 12620
NM_001025266chr354392 3727 3669 3292 1593 23884 1751 13437 2207 48
NM_001025366chr621465 576 21899 1385 11350 --
NM_001025366chr621465 576 21899 1385 11350 --
NM_001025367chr621465 576 21899 1385 11350 --
NM_001025367chr621465 576 21899 1385 11350 --
NM_001025368chr621465 576 21899 1385 11350 --
NM_001025368chr621465 576 21899 1385 11350 --
NM_001025369chr621481 592 21915 1401 11366 --
NM_001025369chr621481 592 21915 1401 11366 --
NM_001025370chr621465 576 21899 1385 11350 --
NM_001025370chr621465 576 21899 1385 11350 --
NM_001025579chr171855 --1331 --
NM_001025580chrX114057 3882 3785 3552 2628 2611 1275 547 484 340 281 23532 229 --23861 3839
NM_001025595chr461332 1252 1120 1087 324 226 21664 469 --1241
NM_001025596chr111362 ------
NM_001025616chr441179 642 430 374 --1648 --
NM_001025780chr921107 84 11083 --1314
NM_001029839chr31615 --11509 --
NM_001029840chr31615 --11509 --
NM_001029858chr6103332 3159 3121 2209 2165 1206 773 576 263 49 31363 452 353 ----
NM_001029863chr683097 2785 2530 2039 1169 756 698 143 ------
NM_001029875chr572996 2737 1981 1148 813 700 95 22420 641 12783 --
NM_001029884chr682220 1990 1825 1808 867 542 149 41 1103 12514 --
NM_001029991chr141142 ------
NM_001030002chr171383 ------
NM_001030006chr172527 302 1323 12491 1420
NM_001030007chr1643999 3881 3666 3402 --1700 --
NM_001030055chr14124639 4378 4304 3938 3588 3460 3093 2892 1322 1236 1220 398 24492 739 24129 3070 11153
NM_001031623chr62164 123 1158 11570 --
NM_001031665chr191392 ------
NM_001031679chr1243499 3450 2945 111 23057 172 23426 137 1291
NM_001031681chr171310 12331 ----
NM_001031684chr271384 1174 1076 965 246 164 38 21030 935 ----
NM_001031690chr722673 2194 12021 ----
NM_001031695chr2284544 3877 3795 2178 2088 1602 790 676 15339 33573 2184 216 --
NM_001031700chr492258 2220 1923 1780 834 652 371 54 47 12226 12316 --
NM_001031710chr7--1935 ----
NM_001031711chr521701 1450 1157 11243 11372
NM_001031712chr61388 ------
NM_001031716chr22721 454 1338 1376 --
NM_001031717chr31286 --1857 --
NM_001031723chr41349 ------
NM_001031732chr4113594 3407 3164 2754 1246 890 855 367 335 316 58 1751 12568 1789
NM_001031803chr17--1254 ----
NM_001031804chr1683565 2845 1433 1426 1396 1108 1035 500 11161 23336 1085 --
NM_001031812chr562179 1991 1611 492 214 143 12244 1677 --
NM_001032280chr621636 1421 ------
NM_001032282chr821026 254 11202 31306 1076 327 --
NM_001032283chr125938 925 308 287 178 1247 ----
NM_001032284chr125938 925 308 287 178 1247 ----
NM_001032288chr2021451 174 --11089 --
NM_001032296chr1352614 1909 1833 729 26 32794 1021 625 22360 248 --
NM_001032367chr151447 ------
NM_001032380chr1041459 371 284 248 --2496 139 --
NM_001032393chrX1573 1205 ----
NM_001032394chr642732 2154 1131 257 11788 2938 272 12593
NM_001032395chr642599 2021 998 124 11655 2805 139 12460
NM_001032999chr2075272 3803 1663 1357 1351 1343 723 11532 ----
NM_001033002chr17--199 ----
NM_001033025chr141506 1483 585 165 --21549 598 --
NM_001033044chr12720 702 11255 11399 --
NM_001033045chr211090 ------
NM_001033047chr422321 649 --1161 --
NM_001033056chr12720 702 11255 11399 --
NM_001033057chr32272 228 11404 ----
NM_001033059chr641834 1544 822 523 1594 ----
NM_001033081chr11737 31867 1786 1752 --11763
NM_001033082chr11737 31867 1786 1752 --11763
NM_001033087chr2032309 2292 150 --23176 1000 --
NM_001033112chr52305 123 ------
NM_001033117chr344679 3589 3429 1871 --13294 --
NM_001033503chr5----193 --
NM_001033506chr111374 1338 ----
NM_001033507chr131804 1293 117 ------
NM_001033518chr751776 744 554 245 224 --21954 612 --
NM_001033519chr751776 744 554 245 224 --21954 612 --
NM_001033520chr751776 744 554 245 224 --21954 612 --
NM_001033557chr221326 338 ----171
NM_001033561chr175779 767 750 641 147 ------
NM_001033566chr17--1245 ----
NM_001033568chr17--1245 ----
NM_001033578chr832235 918 281 22298 1984 1407 --
NM_001033659chr1721447 1021 21370 1175 11305 --
NM_001033723chr842795 564 392 269 11858 1457 --
NM_001033756chr621399 510 21833 1319 11284 --
NM_001033756chr621399 510 21833 1319 11284 --
NM_001033910chr132099 708 266 1592 12117 --
NM_001033925chr1021931 187 1581 11904 --
NM_001034841chr16185534 5337 5298 5196 5156 4837 4399 4031 4018 3781 3742 3571 1860 1645 1540 1038 704 419 11393 ----
NM_001034850chr541473 1422 1143 202 ------
NM_001034852chr142253 159 ----1376
NM_001034996chr3135 ------
NM_001035chr141062 1030 95 86 11261 --1174
NM_001035003chr41343 21430 1225 ----
NM_001035004chr41343 21430 1225 ----
NM_001035260chr103589 512 421 11289 ----
NM_001035511chr141644 479 207 124 11932 ----
NM_001035512chr141751 586 314 231 12039 --1118
NM_001035513chr141751 586 314 231 12039 --1118
NM_001037131chr211295 11146 11008 --
NM_001037132chr731709 1532 517 ----12149
NM_001037133chr731709 1532 517 ----12149
NM_001037164chr791477 1443 1436 740 537 480 336 220 124 --11669 --
NM_001037165chr7188920 8855 8332 8130 7648 7326 7317 7310 7292 6993 6590 6533 5687 2744 2386 1403 1161 650 27150 5844 ----
NM_001037172chr331375 1202 72 1944 ----
NM_001037174chr232135 710 446 131 11895 --
NM_001037317chr13748 639 473 ------
NM_001037332chr512290 12410 ----
NM_001037333chr512290 12410 ----
NM_001037334chr181771 --1787 --
NM_001037339chr12712 505 1411 11184 21308 586
NM_001037340chr12712 505 1411 11184 21308 586
NM_001037341chr12712 505 1411 11184 21308 586
NM_001037341chr12712 505 1411 11184 21308 586
NM_001037535chrX21228 94 31184 977 101 ----
NM_001037536chrX21228 94 31184 977 101 ----
NM_001037540chrX21228 94 31184 977 101 ----
NM_001037553chr2154516 4475 4049 3750 335 15115 --14452
NM_001037582chr471736 1180 1119 522 212 202 141 21445 375 ----
NM_001037637chr5185 ------
NM_001037872chr21640 2300 129 ----
NM_001037954chr1143125 2154 851 539 --2774 681 --
NM_001038493chr221470 1361 --1574 --
NM_001038628chr341581 483 384 228 11610 ----
NM_001038702chr542598 1944 616 222 32672 1108 244 ----
NM_001039091chrX4537 244 184 53 ------
NM_001039111chr3183 ------
NM_001039395chr972435 2402 2249 2184 1579 460 88 1236 22335 152 12291
NM_001039479chr1442103 1812 598 141 22437 920 ----
NM_001039523chr21350 1424 ----
NM_001039535chr1861552 503 455 303 120 100 2658 296 11469 --
NM_001039538chr222627 243 33692 494 260 ----
NM_001039547chr377153 6890 2627 2517 1943 1397 979 57033 5171 2783 1792 233 36476 2558 869 --
NM_001039570chr2234610 1263 409 --14062 --
NM_001039571chr2234610 1263 409 --14062 --
NM_001039573chr17--1445 ----
NM_001039577chr144310 3173 386 233 43902 3479 1076 954 ----
NM_001039585chr193226 2947 2860 2826 977 710 694 452 42 --23440 2882 --
NM_001039590chrX163735 3633 3482 3354 2894 2705 2641 1518 1505 1493 1475 1435 1408 1339 986 504 23722 201 13058 --
NM_001039591chrX163735 3633 3482 3354 2894 2705 2641 1518 1505 1493 1475 1435 1408 1339 986 504 23722 201 13058 --
NM_001039618chr11165813 5450 5037 4909 4880 4685 4129 4037 2383 2360 2003 1930 1612 1559 999 754 21978 1679 ----
NM_001039693chr283935 3685 3400 1022 1015 944 776 68 22777 1210 22793 1204 14111
NM_001039709chr2075272 3803 1663 1357 1351 1343 723 11532 ----
NM_001039711chr12387 332 ------
NM_001039712chr12387 332 ------
NM_001039802chr15439 411 297 266 243 21154 100 ----
NM_001039840chrX125798 5095 5055 4824 3891 2089 1452 1171 874 495 416 172 54963 3699 2409 1838 198 1137 --
NM_001039916chr1231061 1006 997 ------
NM_001039917chr1231061 1006 997 ------
NM_001039918chr1231061 1006 997 ------
NM_001039919chr1231061 1006 997 ------
NM_001039920chr1231061 1006 997 ------
NM_001039937chr1373776 3393 3043 2725 2637 717 381 31094 422 187 1498 --
NM_001040002chr1711140 ------
NM_001040020chr751602 1442 1433 1087 131 ------
NM_001040031chr191272 ------
NM_001040033chr11681 ------
NM_001040057chr761398 1279 950 383 286 109 1940 1975 --
NM_001040058chr42400 384 --1360 --
NM_001040060chr42400 384 --1360 --
NM_001040092chr8--2340 62 ----
NM_001040110chr72498 112 ------
NM_001040135chr72711 599 ------
NM_001040142chr23905 646 27 22224 468 12217 11590
NM_001040143chr23905 646 27 22224 468 12217 11590
NM_001040152chr753863 3819 3685 3455 706 ------
NM_001040153chr133887 618 277 1249 1105 --
NM_001040157chr482417 2095 2064 1062 1030 691 172 104 2854 140 12016 1572
NM_001040158chr55478 467 419 159 113 ------
NM_001040159chr421298 937 1119 ----
NM_001040167chr73852 813 313 --11190 --
NM_001040202chr452524 2379 2279 1724 814 11863 ----
NM_001040214chr612363 12321 12262 --
NM_001040260chr421141 1032 ------
NM_001040261chr421141 1032 ------
NM_001040272chr921444 441 12376 11765 --
NM_001040284chr1695324 5239 4356 4185 3622 2336 2142 2132 1209 45285 1262 793 476 21932 823 --
NM_001040402chr4112826 2717 1259 1184 1010 974 889 768 369 346 46 1276 --1797
NM_001040409chr22819 384 1780 1747 --
NM_001040429chr1353468 2443 1187 698 309 ------
NM_001040441chr154916 4837 4328 2133 1555 ------
NM_001040450chr152284 113 ------
NM_001040453chr152284 113 ------
NM_001040458chr581884 1824 1733 1431 1369 192 126 50 ------
NM_001040633chr731083 1022 62 1899 ----
NM_001040665chr754728 4070 3270 1629 231 34831 3758 242 --34276 4212 1205
NM_001040666chr7--1533 ----
NM_001040668chr191119 ------
NM_001040708chr84974 364 326 227 ------
NM_001040709chr141835 1700 1610 951 ------
NM_001040712chr993258 3241 3229 3197 2366 1186 1057 837 721 12857 --12204
NM_001040875chr852533 2421 2332 2284 1962 ------
NM_001040876chr441905 678 596 60 31485 736 686 1212 --
NM_001041chr3--1137 ----
NM_001042355chr16105338 5204 3854 3845 1425 1358 1175 1066 662 293 43295 1998 1451 194 23353 161 1404
NM_001042403chr122689 208 ------
NM_001042404chr131974 1947 146 21917 698 1241 --
NM_001042406chr62988 939 --1254 --
NM_001042412chr16105338 5204 3854 3845 1425 1358 1175 1066 662 293 43295 1998 1451 194 23353 161 1404
NM_001042413chr943882 3713 3670 3307 73423 3354 2646 1118 777 731 618 158 --
NM_001042424chr433158 2182 866 23264 539 ----
NM_001042425chr621636 1421 ------
NM_001042453chrX3254 149 101 41608 1575 1265 191 --1378
NM_001042473chr102780 111 21384 160 ----
NM_001042475chr61126 ------
NM_001042481chr1452690 2316 2214 1851 746 32633 2385 2236 1663 --
NM_001042486chr2021117 162 ------
NM_001042492chr17133214 3130 2913 2906 2894 2632 2374 2134 1040 822 814 797 214 23139 830 ----
NM_001042493chr65768 574 382 264 154 11383 11576 --
NM_001042494chr1563843 3831 3283 3265 720 654 12675 23581 1184 --
NM_001042495chr1563843 3831 3283 3265 720 654 12675 23581 1184 --
NM_001042496chr1563843 3831 3283 3265 720 654 12675 23581 1184 --
NM_001042497chr1563843 3831 3283 3265 720 654 12675 23581 1184 --
NM_001042506chrX21125 456 ------
NM_001042510chr851757 1507 1392 879 870 11376 ----
NM_001042511chr851757 1507 1392 879 870 11376 ----
NM_001042517chr131227 --1680 --
NM_001042537chrX42319 1002 897 366 --1451 --
NM_001042552chr12943 387 1541 ----
NM_001042555chr12104405 4305 4246 3560 3443 3235 3150 974 882 486 24618 4196 11851 13581
NM_001042599chr2177826 7713 7363 7162 6542 6048 5893 5480 2975 2964 2915 2642 1993 1562 699 657 641 25955 5210 37284 6144 2119 15244
NM_001042601chr373243 3176 2905 2800 838 292 145 ------
NM_001042603chr12144705 4620 4280 4009 3900 3573 3557 2145 1795 1666 1401 1311 964 735 --31507 1407 345 14128
NM_001042604chr3104749 4672 4508 4394 4387 4377 3560 3277 1197 600 54665 3742 3712 847 618 24420 4001 --
NM_001042631chr191444 ------
NM_001042632chr2022210 194 ------
NM_001042633chr2022210 194 ------
NM_001042635chr142140 30 1165 ----
NM_001042669chr441179 642 430 374 --1648 --
NM_001042681chr132643 2109 1830 22634 884 11936 --
NM_001042682chr132643 2109 1830 22634 884 11936 --
NM_001042682chr132643 2109 1830 22634 884 11936 --
NM_001042683chr631355 490 240 21777 530 ----
NM_001042728chr121134 11086 1857 --
NM_001042749chrX51881 1289 779 261 160 ------
NM_001042750chrX51881 1289 779 261 160 ------
NM_001042751chrX51881 1289 779 261 160 ------
NM_001043318chr1474127 4042 3722 3183 2619 1281 1247 12777 34004 3921 2560 --
NM_001043351chr172248 2069 1408 817 697 383 301 2311 288 ----
NM_001044385chr293685 3357 2976 2843 2753 552 406 105 50 14004 11167 --
NM_001044387chr1974102 3425 2636 2545 1449 807 120 21603 160 ----
NM_001044388chr1974102 3425 2636 2545 1449 807 120 21603 160 ----
NM_001044722chr562179 1991 1611 492 214 143 12244 1677 --
NM_001044723chr562179 1991 1611 492 214 143 12244 1677 --
NM_001046chr542025 1180 503 292 12168 11152 --
NM_001049chr1432268 2195 1916 ------
NM_001068chr31290 --153 176
NM_001071775chr1331415 1186 538 21309 647 11680 --
NM_001077628chr12274 235 1597 ----
NM_001078chr1--2733 490 --1713
NM_001079874chr121947 1754 12136 1368 --
NM_001083620chr442416 1026 880 185 11677 ----
NM_001092chr1732455 1710 396 --1156 --
NM_001094chr171748 ------
NM_001100108chr1116837 6048 5091 5078 2603 2399 2392 1955 1396 1290 468 37322 6592 5182 1817 --
NM_001105518chr12881 78 --1804 --
NM_001106chr3179652 9159 7921 6842 6604 6168 3244 3216 2902 2377 2267 2094 1621 1500 530 182 69 39783 9253 6035 43077 2681 1550 1008 --
NM_001113490chrX83059 2967 2881 2607 2303 1079 1040 647 1432 ----
NM_001115chr8--131 ----
NM_001117chr1812410 22527 398 --12314
NM_001119chr411318 ----11413
NM_001121chr102619 415 31206 736 679 11800 --
NM_001122679chr51144 11205 2972 859 --
NM_001124chr11--2512 486 ----
NM_001128chr1643999 3881 3666 3402 --1700 --
NM_001135chr153823 347 97 ------
NM_001146chr872283 2114 2031 1990 1860 1532 694 1624 11998 --
NM_001148chr462056 2043 1922 1854 1384 308 ------
NM_001151chr4--1184 ----
NM_001153chr22854 823 ------
NM_001160chr12112791 2628 2308 2112 1900 1760 1726 581 434 406 41 52834 2685 2634 741 466 ----
NM_001165chr112515 126 --1201 --
NM_001167chrX106392 2665 1867 1749 1089 1011 913 849 573 421 56536 5774 5649 4997 1141 --1887
NM_001173chr14124639 4378 4304 3938 3588 3460 3093 2892 1322 1236 1220 398 24492 739 24129 3070 11153
NM_001191chr2021236 519 ------
NM_001198chr662145 1959 1821 729 459 25 --12182 1888
NM_001200chr2011005 1307 ----
NM_001201chr441499 1102 827 105 4666 312 246 88 --1855
NM_001204chr2137488 7430 7186 6660 5813 5645 5549 2673 1978 1275 617 501 193 77110 5832 5802 5719 647 208 38 37417 1354 215 27584 7495
NM_001206chr9123067 2673 2644 1990 1164 1099 779 560 319 287 280 271 43129 3082 3040 984 12286 --
NM_001207chr5185 ------
NM_001211chr151129 1340 ----
NM_001219chr742123 1556 865 670 2395 265 ----
NM_001227chr1021266 1234 --1158 --
NM_001233chr731869 917 263 22308 628 ----
NM_001235chr112706 576 ------
NM_001238chr191530 1482 ----
NM_001241chr261778 1629 1551 831 459 445 22148 594 1485 --
NM_001241chr261778 1629 1551 831 459 445 22148 594 1485 --
NM_001256chr1782894 2882 2729 2379 2206 2195 2013 1044 32214 2041 1963 --22417 2182
NM_001257chr1611505 --21057 545 --
NM_001258chr173528 370 183 ------
NM_001259chr7175950 5764 5754 5325 5156 4301 2463 2335 2294 2237 1950 1712 1362 964 930 805 396 1485 25586 1331 --
NM_001262chr1----2338 278 --
NM_001268chr1331082 259 23 ------
NM_001270chr51226 ------
NM_001271chr1523251 53 --12298 --
NM_001273chr122388 368 ------
NM_001280chr192255 216 ------
NM_001282chr172527 302 1323 12491 1420
NM_001284chr5----1104 --
NM_001290chr43926 787 436 1885 ----
NM_001304chr1743191 3124 2640 1146 21347 317 ----
NM_001305chr7--1785 ----
NM_001310chr1252390 2288 1963 1880 411 21917 306 ----
NM_001313chr4174 1865 ----
NM_001315chr631663 1546 1496 32047 1582 1510 21697 371 --
NM_001316chr202383 96 --1336 --
NM_001319chr1911031 ------
NM_001326chr11--1456 147 --
NM_001329chr1041550 1092 1026 441 ------
NM_001330chr161138 2984 321 ----
NM_001331chr1161936 853 823 523 288 48 --31967 1787 319 --
NM_001332chr541386 1104 610 71 --1480 11144
NM_001338chr2151237 987 768 153 49 ------
NM_001343chr521640 1297 11672 ----
NM_001351chr331708 1575 350 --11129 --
NM_001356chrX72170 1774 1546 999 965 519 278 11828 ----
NM_001364chr11134460 4379 3252 3164 1360 1217 1081 998 765 663 544 448 89 31244 778 108 42899 1586 861 349 --
NM_001365chr173786 646 516 ------
NM_001380chr104912 796 736 306 ------
NM_001386chr872046 1964 1831 1797 708 195 91 22350 1734 ----
NM_001389chr212584 219 --1482 --
NM_001390chr1863535 3333 2693 2656 2648 227 23513 1237 ----
NM_001391chr1811190 11184 148 --
NM_001395chrX--1957 1699 --
NM_001396chr21102443 2178 2114 1827 891 453 437 412 282 234 12146 21124 976 1905
NM_001399chrX43733 3605 1176 502 --13058 --
NM_001400chr121020 991 21337 263 21324 931 1867
NM_001401chr91315 --1537 11370
NM_001407chr321110 1076 1226 11068 --
NM_001408chr131648 1316 1166 ------
NM_001412chrX82909 2772 1154 1141 1129 1094 554 141 1797 13403 12891
NM_001415chrX51560 1259 307 292 163 21415 458 ----
NM_001416chr171133 1459 ----
NM_001417chr1231953 1281 681 31402 703 156 ----
NM_001418chr111623 1161 ----
NM_001418chr111623 1161 ----
NM_001419chr19124745 4568 4318 3835 1249 1216 1200 1156 1147 986 973 85 122 11140 44603 4156 1174 993
NM_001423chr1241861 1622 1597 1479 ------
NM_001427chr772086 1942 1496 1459 253 209 200 ------
NM_001429chr222205 78 160 ----
NM_001430chr22541 442 2238 74 ----
NM_001431chr651213 284 254 214 57 --1959 --
NM_001432chr483430 3403 3178 1356 1318 1251 156 145 33637 2659 766 13347 --
NM_001438chr163687 3498 3092 2324 1028 954 23199 1057 ----
NM_001439chr141506 1483 585 165 --21549 598 --
NM_001440chr83760 461 439 12788 ----
NM_001448chrX11118 11279 ----
NM_001449chrX1801 --1523 --
NM_001451chr1651272 473 435 265 137 11179 11279 1522
NM_001452chr61704 ------
NM_001453chr621386 666 ----11529
NM_001457chr321272 1162 --146 --
NM_001458chr7------1684
NM_001463chr25799 709 645 596 154 ----1264
NM_001483chr73940 895 434 1765 ----
NM_001490chr953678 2915 1257 609 598 22562 502 11393 --
NM_001491chr632728 545 62 --176 --
NM_001493chrX1576 ------
NM_001494chr10------2655 92
NM_001495chr8129 1172 ----
NM_001498chr63882 366 202 21026 304 --1546
NM_001514chr11432 ----1206
NM_001530chr1441142 287 220 29 1347 11103 --
NM_001533chr19166 ------
NM_001539chr91100 ------
NM_001542chr132429 644 376 22392 478 12092 --
NM_001543chr574465 3745 3639 3614 3248 1058 948 --13752 14625
NM_001546chr63984 383 274 11025 1228 --
NM_001556chr811169 1948 ----
NM_001557chr221310 1205 ------
NM_001560chrX22597 1632 12674 12285 --
NM_001570chr331203 979 299 21325 490 ----
NM_001584chr112768 430 31040 465 110 ----
NM_001604chr112857 794 ------
NM_001609chr1064399 3626 3529 3032 434 157 33038 1323 853 ----
NM_001614chr17--1598 ----
NM_001614chr17--1598 ----
NM_001616chr273152 3081 2575 2283 803 287 238 1668 --12384
NM_001619chr1121047 40 191 ----
NM_001621chr753009 2524 1971 153 30 11912 ----
NM_001621chr753009 2524 1971 153 30 11912 ----
NM_001629chr132268 229 ------
NM_001634chr641834 1544 822 523 1594 ----
NM_001635chr71677 --177 --
NM_001650chr1863610 3565 1284 1015 978 929 --23550 1342 12895
NM_001655chr1152096 2017 1553 872 367 32127 1416 523 ----
NM_001656chr551669 1357 1317 172 31 1629 ----
NM_001658chr11185 11122 --1999
NM_001659chr1232464 2297 2058 --21740 1024 --
NM_001660chr35769 734 702 302 132 --1684 --
NM_001663chr1482426 2259 1927 1690 967 404 212 102 1445 1169 --
NM_001664chr33734 423 199 --1313 --
NM_001668chr171816 1806 1776 1735 858 480 367 ----11924
NM_001675chr22--175 ----
NM_001678chr17197 ------
NM_001679chr31559 2585 55 ----
NM_001682chr1282604 2007 1798 976 822 601 475 193 12538 31129 914 845 --
NM_001683chr362280 946 529 476 390 369 ----11705
NM_001684chr184167 3054 3006 1358 1253 735 670 351 24031 3847 33592 1032 572 --
NM_001690chr352182 1876 632 401 151 2789 468 ----
NM_001693chr81957 ----166
NM_001695chr8103430 2857 2710 1630 1504 1359 1001 840 626 377 --11124 --
NM_001701chr911038 21106 107 ----
NM_001704chr61416 --1610 --
NM_001706chr34885 786 666 351 1700 --1373
NM_001707chr71843 1228 ----
NM_001709chr11102577 2536 2355 2262 1836 891 820 588 562 552 ------
NM_001714chr121191 2425 43 ----
NM_001722chr8163 1247 ----
NM_001723chr62684 230 ------
NM_001730chr1381629 1587 1503 1373 1313 1280 627 605 51527 1435 1041 553 133 ----
NM_001730chr1381629 1587 1503 1373 1313 1280 627 605 51527 1435 1041 553 133 ----
NM_001731chr122796 52 ------
NM_001735chr9167 ------
NM_001737chr51203 ------
NM_001742chr731601 1384 1230 ------
NM_001743chr2--1459 ----
NM_001744chr51106 ------
NM_001745chr531075 748 296 11152 ----
NM_001746chr532689 2289 519 --12870 --
NM_001753chr731502 1304 188 11562 ----
NM_001754chr21113745 3582 3423 3402 3366 3272 3256 701 683 665 657 --1864 13698
NM_001755chr1621442 502 2447 209 22258 527 --
NM_001759chr12155003 4770 4526 3582 3399 3356 3317 1934 1926 1691 1661 1333 907 651 70 11482 22041 1050 --
NM_001762chr72238 73 ------
NM_001769chr124340 102 72 58 ------
NM_001774chr191272 ------
NM_001777chr3104132 3995 3604 3506 2873 2840 2641 1472 1357 241 33788 3744 2726 12580 --
NM_001788chr72969 145 1661 ----
NM_001791chr15439 411 297 266 243 21154 100 ----
NM_001792chr183924 337 24 2799 251 1384 --
NM_001797chr161560 ------
NM_001798chr122979 436 11025 ----
NM_001806chr1982894 2811 2127 1130 825 714 569 210 12774 12360 12352
NM_001822chr2--1148 ----
NM_001827chr9----1252 --
NM_001829chr41863 1141 ----
NM_001830chrX2448 122 13742 21578 836 --
NM_001842chr9--2479 87 --1110
NM_001845chr133477 231 53 ------
NM_001854chr131476 388 64 11293 ----
NM_001858chr6114999 4025 3547 3533 2059 662 489 456 216 185 114 34196 752 344 11465 24212 3522
NM_001859chr954012 1309 819 352 321 ------
NM_001873chr43515 258 78 ------
NM_001874chr1254827 4318 4020 3241 976 34984 818 330 --14736
NM_001884chr5--1165 ----
NM_001891chr4136 ------
NM_001892chr521257 329 11554 21057 343 --
NM_001894chr2231228 1043 1021 11196 ----
NM_001902chr12351 342 1403 ----
NM_001903chr5--1218 ----
NM_001904chr32917 235 2833 672 --1249
NM_001915chr1722026 1411 --11601 --
NM_001921chr411213 11228 ----
NM_001923chr11----1591 --
NM_001924chr13518 357 47 ------
NM_001938chr131574 640 629 21499 89 ----
NM_001945chr52925 570 ------
NM_001946chr121828 1412 --1361
NM_001949chr652827 2783 2400 2376 2226 53247 3167 3027 2705 894 ----
NM_001951chr82532 489 ------
NM_001954chr61758 ------
NM_001955chr621079 807 ------
NM_001957chr432066 1701 437 2870 793 11977 1307
NM_001962chr52425 121 ------
NM_001964chr521088 746 11059 1779 --
NM_001967chr31456 ------
NM_001968chr44871 672 649 193 2825 681 ----
NM_001969chr1463614 2916 2695 1484 759 232 --1888 12689
NM_001978chr81948 ------
NM_001981chr121722 1491 32311 909 546 21941 265 21785 917
NM_001987chr1284170 4024 3668 3535 3402 2711 1443 317 1432 --13689
NM_001992chr521382 161 ----1505
NM_001998chr32404 115 ------
NM_001999chr531482 1475 358 11493 ----
NM_002006chr4115601 5520 5455 4036 1570 1552 1443 1385 1090 1033 544 11169 13554 --
NM_002009chr1532553 947 931 --12717 --
NM_002010chr131167 ------
NM_002011chr51443 ------
NM_002015chr1383344 859 782 751 693 683 630 373 3904 423 333 1465 --
NM_002017chr11--11312 1166 --
NM_002024chrX31391 743 150 11754 ----
NM_002025chrX129194 9137 5752 3368 3306 2991 1459 1178 985 798 660 257 28094 6271 66967 6821 6252 1789 467 130 --
NM_002027chr8--1478 ----
NM_002033chr1164139 4062 2535 1131 118 52 32916 2692 195 ----
NM_002035chr18103601 2928 2898 2671 1610 1512 1168 934 332 74 22490 958 13969 --
NM_002039chr44644 627 358 61 ------
NM_002040chr2142807 2539 1970 376 23128 2705 --23039 3018
NM_002041chr15192 ------
NM_002044chr1521201 631 195 ----
NM_002049chrX------1122
NM_002051chr104914 837 440 113 169 ----
NM_002063chrX51196 1128 844 361 352 ------
NM_002065chr12720 702 11255 11399 --
NM_002068chr19------1668
NM_002072chr931016 913 760 ------
NM_002074chr12388 259 ----11672
NM_002076chr1262612 2563 2189 1216 626 390 23154 2769 ----
NM_002077chr912137 1110 ----
NM_002086chr1722166 555 ------
NM_002092chr4144860 4840 4541 4463 4161 4148 4023 3708 3092 743 633 526 388 228 34320 3916 2033 11879 --
NM_002106chr41104 2322 113 ----
NM_002126chr1774029 1609 1261 1203 1107 1089 979 33894 1453 708 13263 --
NM_002128chr1341841 1688 956 419 32387 875 141 3598 529 523 --
NM_002129chr4159 2361 124 ----
NM_002130chr541598 1210 1197 429 1389 --11551
NM_002133chr224517 475 429 418 --1578 --
NM_002137chr732169 1852 179 12229 ----
NM_002138chr41635 1118 ----
NM_002140chr921161 750 1762 --1457
NM_002146chr17--11101 1945 --
NM_002148chr22137 127 ------
NM_002155chr12277 246 ------
NM_002158chr2133840 2957 2753 2742 2632 1134 629 572 508 409 222 135 128 23749 3245 13172 --
NM_002160chr93622 389 227 ------
NM_002163chr161407 11262 11123 --
NM_002165chr202390 256 ------
NM_002180chr112820 150 ------
NM_002182chr342205 1021 966 669 ----22740 2199
NM_002193chr221697 739 ------
NM_002196chr204837 699 193 183 ------
NM_002196chr204837 699 193 183 ------
NM_002199chr4149 1945 ----
NM_002202chr541021 946 859 720 ------
NM_002210chr253267 3162 2693 1443 595 12767 1749 1423
NM_002211chr103821 790 246 ------
NM_002214chr775336 5218 4193 1991 1356 1175 665 44543 1332 866 616 ----
NM_002222chr31238 31137 528 314 ----
NM_002223chr1252746 1596 1444 801 348 11132 1609 --
NM_002226chr141101 2902 227 ----
NM_002232chr11539 1181 ----
NM_002235chr1241367 1328 1143 212 --11299 --
NM_002239chr211070 2902 251 ----
NM_002240chr21--1559 ----
NM_002242chr2--22014 708 11565 --
NM_002247chr1031954 842 412 --22358 646 --
NM_002249chr1----1457 --
NM_002264chr394655 4640 4449 3438 3239 3160 3090 1499 1050 --2776 758 --
NM_002265chr176781 775 768 751 339 57 ------
NM_002266chr17150 ------
NM_002267chr1331928 1656 712 22445 2426 1694 --
NM_002270chr5115577 5545 4930 4140 3808 3633 3512 2136 2110 1416 702 55636 4305 3602 771 515 13957 --
NM_002271chr1321756 76 22275 915 --12164
NM_002285chr283384 3019 2697 1655 1332 582 529 58 12902 --21353 143
NM_002291chr7--1118 --1148
NM_002293chr142395 845 783 128 ------
NM_002298chr1331505 1041 516 --1292 --
NM_002310chr5106447 6049 4928 4406 2266 1538 1465 1452 831 569 45405 5355 1713 708 ----
NM_002312chr1311048 193 ----
NM_002314chr721020 990 ------
NM_002317chr52304 126 ------
NM_002332chr121734 ------
NM_002333chr1931251 419 312 ------
NM_002335chr11--1197 ----
NM_002336chr1275028 4092 4051 1907 1140 1026 770 45079 1979 901 261 34526 3373 1545 14971
NM_002345chr12--1123 ----
NM_002350chr811240 1502 ----
NM_002351chrX51715 1698 477 468 327 ----1167
NM_002355chr1231350 356 132 ----21420 257
NM_002356chr672065 2057 1857 1058 979 540 157 52703 2657 1085 881 311 ----
NM_002359chr1743507 3496 1267 1183 24309 200 11286 21094 254
NM_002360chr722499 980 ----12637
NM_002374chr222627 243 33692 494 260 ----
NM_002376chr142497 483 ------
NM_002380chr8--2388 259 ----
NM_002381chr251034 1016 886 710 371 1935 --168
NM_002387chr574351 4298 1724 1710 1106 803 377 54633 4412 1834 996 668 14743 14624
NM_002395chr641218 371 359 182 --4985 605 521 432 --
NM_002397chr51694 3840 749 135 ----
NM_002398chr231548 1348 1227 11276 ----
NM_002399chr1531465 1262 958 --1447 --
NM_002401chr1732077 700 403 11638 ----
NM_002408chr144744 659 590 37 1706 --1731
NM_002430chr2262443 2039 1765 640 469 360 --1278 --
NM_002444chrX51978 1956 1945 1548 563 21930 301 ----
NM_002469chr12--1395 1315 --
NM_002478chr11--1445 --1456
NM_002480chr126464 423 199 178 156 145 --1372 --
NM_002481chr167875 7653 7405 5145 5083 4975 11824 26447 5989 --
NM_002482chr13661 194 64 280 41 ----
NM_002486chr93876 64 34 --12540 --
NM_002487chr151579 1261 1238 --
NM_002489chr71322 ------
NM_002492chr3174 1327 1144 --
NM_002499chr152545 265 --12011 --
NM_002500chr221244 441 1453 ----
NM_002501chr1923994 2562 --11315 --
NM_002509chr201656 ------
NM_002514chr83883 472 333 11163 ----
NM_002515chr1421702 206 --11645 --
NM_002516chr191313 ------
NM_002518chr221011 485 31223 1145 1003 1104 --
NM_002519chr1121285 337 11318 ----
NM_002522chr1783815 3655 2936 1334 1324 1101 147 66 23121 608 12822 13141
NM_002524chr12446 22 1802 ----
NM_002536chrX41531 456 285 210 --11613 --
NM_002540chr92628 619 ----1697
NM_002545chr1185116 4657 4566 4061 2073 797 130 95 24121 685 14109 11313
NM_002547chrX74050 3651 3443 3434 3140 751 95 22583 705 ----
NM_002556chr1142119 1649 1636 1553 --1815 --
NM_002568chr8--1322 ----
NM_002569chr15--11447 --11298
NM_002574chr1------1254
NM_002577chr3124049 3932 3556 3354 2824 2500 1608 1557 1346 787 447 80 12657 1459 --
NM_002581chr995641 5526 5398 4560 4220 3810 3477 2017 1197 11124 14129 --
NM_002582chr161159 1953 ----
NM_002583chr124635 451 253 246 ------
NM_002589chr41137 ------
NM_002592chr202296 221 ------
NM_002594chr201325 12286 ----
NM_002595chr1251650 1235 441 271 82 21375 194 ----
NM_002600chr12712 505 1411 11184 21308 586
NM_002601chr2289 40 ------
NM_002607chr731292 1159 419 21262 1220 ----
NM_002608chr2211569 ------
NM_002610chr242828 2686 2102 795 22918 2597 11178 141
NM_002612chr732077 1669 291 ------
NM_002613chr1611878 --11085 15068
NM_002627chr10--152 ----
NM_002628chr3------1392
NM_002629chr102288 162 ------
NM_002633chr11515 --1390 --
NM_002636chr61450 ------
NM_002641chrX71964 1652 1467 1407 340 86 75 ------
NM_002645chr1152905 2325 2042 206 198 32161 325 101 ----
NM_002648chr641316 1003 852 827 --11332 --
NM_002655chr885093 4300 4159 3358 729 361 335 208 24956 1742 14678 1109
NM_002657chr2073783 3320 3217 3132 2611 254 30 ----13696
NM_002662chr332144 711 125 22074 1557 ----
NM_002668chrX----1143 --
NM_002670chr33368 257 173 1335 ----
NM_002687chr1471263 1201 893 821 485 394 122 2178 168 --1362
NM_002697chr1--1218 ----
NM_002699chr151437 1414 1233 1215 77 11276 ----
NM_002701chr6183 ------
NM_002703chr431938 1678 661 --1578 11699
NM_002706chr23609 84 24 ------
NM_002707chr2167 ------
NM_002709chr292997 2973 2605 1083 994 947 862 684 393 12426 ----
NM_002710chr123761 205 132 ----1230
NM_002713chr1----11080 --
NM_002714chr641092 1037 965 265 21109 1100 ----
NM_002715chr511012 --1272 --
NM_002719chr1441994 1923 1764 475 12423 ----
NM_002721chr9----1380 1364
NM_002729chr103564 315 53 1606 ----
NM_002730chr1921413 51 ------
NM_002731chr151064 1013 504 483 325 11070 ----
NM_002734chr1742258 674 546 287 12204 ----
NM_002736chr741952 1770 806 472 41601 850 745 574 ----
NM_002737chr1795930 5830 4847 4300 4273 2241 1601 1198 900 21251 1226 36385 6196 956 --
NM_002740chr362750 2671 2147 1778 367 277 32646 2517 945 12425 --
NM_002745chr2233806 1565 489 13276 13313 --
NM_002747chr1841821 1795 1745 533 ------
NM_002748chr1521070 49 ------
NM_002750chr101224 ------
NM_002752chr51225 ----1548
NM_002756chr171913 --1669 --
NM_002763chr12482 21 --2220 168 --
NM_002765chrX4537 244 184 53 ------
NM_002767chr171222 ----1433
NM_002787chr72646 71 288 77 ----
NM_002788chr141101 ------
NM_002789chr151225 ------
NM_002796chr1------184
NM_002800chr6--132 ----
NM_002806chr14--2318 257 ----
NM_002808chr3----1116 --
NM_002809chr171333 ------
NM_002814chrX3664 596 490 ------
NM_002815chr17190 ------
NM_002821chr64780 773 763 610 1636 ----
NM_002822chr1241320 226 184 113 ------
NM_002823chr24673 613 585 494 ------
NM_002824chr12--1473 ----
NM_002826chr11988 --1786 --
NM_002827chr2041475 477 235 194 ------
NM_002833chr151275 21615 1534 11148 --
NM_002835chr71129 1555 ----
NM_002836chr20163 149 ----
NM_002837chr1254303 4297 4234 3211 3060 33424 1479 190 1747 13597
NM_002839chr993258 3241 3229 3197 2366 1186 1057 837 721 12857 --12204
NM_002840chr12661 439 1484 ----
NM_002841chr33139 69 57 ------
NM_002843chr1143135 2903 1374 118 1575 ----
NM_002845chr183690 652 104 ------
NM_002848chr1241085 1069 363 187 21143 1024 ----
NM_002849chr123845 270 222 --1829 --
NM_002850chr191802 ------
NM_002851chr7--1174 1697 --
NM_002852chr32511 194 1574 ----
NM_002858chr111236 31245 1223 1209 ----
NM_002865chr81243 ------
NM_002868chr1242368 1827 541 382 --12304 --
NM_002873chr52463 45 ------
NM_002874chr952233 1832 841 811 716 22317 456 12243 1245
NM_002881chr241428 1336 496 330 ------
NM_002886chr3145224 4469 3892 3749 3638 3621 3356 3305 1999 1273 1262 945 775 441 11958 25201 933 --
NM_002890chr53983 653 348 --1823 --
NM_002892chr1431157 625 472 21344 1304 1245 --
NM_002894chr18189 1187 --1155
NM_002897chr22621 158 1108 ----
NM_002902chr152654 438 1567 164 --
NM_002906chr1192342 2118 2033 1819 1752 1745 825 734 201 ------
NM_002907chr124416 337 320 155 164 ----
NM_002912chr62929 678 1746 ----
NM_002922chr12488 93 1602 ----
NM_002924chr11130 ------
NM_002940chr441905 678 596 60 31485 736 686 1212 --
NM_002941chr351642 1320 1071 1024 326 11607 --1320
NM_002942chr3--2879 435 1292 --
NM_002945chr173809 801 358 --1851 --
NM_002946chr13486 170 141 1581 ----
NM_002953chr11675 ------
NM_002955chr6--1354 ----
NM_002956chr1231334 402 221 1449 ----
NM_002957chr923202 645 23501 2523 1368 11435
NM_002958chr34944 911 668 235 1226 ----
NM_002959chr161762 1720 1511 1491 1396 281 11777 ----
NM_002967chr19--1157 ----
NM_002968chr162964 754 11115 --1147
NM_002971chr321120 298 ------
NM_002973chr12196 ------
NM_002977chr272962 1383 1302 1228 734 257 68 32789 1358 179 1913 --
NM_002979chr1123 --1321 --
NM_002982chr17193 2371 341 ----
NM_002993chr421073 993 1702 ----
NM_002996chr1611393 11981 ----
NM_002997chr211441 1515 11188 --
NM_002998chr852161 1742 858 704 88 ----31404 455 61
NM_003001chr141751 586 314 231 12039 --1118
NM_003003chr17--1218 ----
NM_003010chr1721531 357 --22435 234 --
NM_003011chr911564 ------
NM_003013chr4------2718 140
NM_003016chr1771968 1590 1539 1296 1274 731 73 ------
NM_003017chr641412 905 493 78 ------
NM_003020chr151174 ------
NM_003024chr213964 856 371 ------
NM_003026chr921133 1033 --1407 --
NM_003027chr151358 ----1117
NM_003030chr341723 1622 1605 1586 1257 ----
NM_003031chr1641003 677 330 287 1921 1853 1248
NM_003034chr12127572 6680 6382 6364 5905 5616 5145 2962 2090 1037 474 40 37869 6525 5042 1640 16860
NM_003035chr12332 318 1833 ----
NM_003036chr11941 --1291 --
NM_003042chr31527 22014 455 ----
NM_003043chr321290 190 44213 3803 213 113 24233 4175 --
NM_003048chr252765 2553 2131 1835 806 32701 2202 1127 22600 207 --
NM_003051chr161652 1285 781 336 231 148 ------
NM_003060chr531275 1180 838 ------
NM_003068chr81729 ------
NM_003070chr94646 621 574 252 --1701 --
NM_003073chr221260 1267 ----
NM_003074chr382155 1843 1521 1430 795 352 334 173 12185 21743 578 --
NM_003077chr17--2528 191 1851 --
NM_003079chr174922 652 127 56 ------
NM_003081chr201889 11187 1172 --
NM_003100chr51427 ------
NM_003101chr14561 490 311 210 1552 ----
NM_003106chr331105 842 254 1270 1819 --
NM_003107chr662624 2460 2442 1675 484 474 22101 1745 ----
NM_003108chr2136630 6559 6040 5571 5554 4653 1538 1426 1043 919 652 500 264 77138 5279 1470 1184 978 843 352 46855 6481 4873 611 27273 6606
NM_003110chr171956 ------
NM_003111chr251410 1078 1031 212 105 2405 202 ----
NM_003112chr753261 2378 2206 1207 480 53233 3208 2134 2122 916 11989 12082
NM_003113chr22815 740 1138 ----
NM_003115chr13333 120 49 ------
NM_003128chr272665 2595 2423 2389 2380 684 281 12434 11060 --
NM_003131chr612308 ----12269
NM_003133chr13384 202 51 21001 130 ----
NM_003135chr53333 234 89 ------
NM_003136chr14174 ------
NM_003137chr63798 787 315 1806 ----
NM_003144chr682191 1680 1621 814 555 470 427 331 ------
NM_003149chr311316 --11435 --
NM_003150chr1742366 2341 336 305 ------
NM_003152chr17--11211 ----
NM_003154chr41107 ------
NM_003155chr842613 2560 2412 2286 22164 835 ----
NM_003156chr1121192 946 ------
NM_003161chr1741322 1248 1221 547 ------
NM_003162chr2--21122 147 1101 11093
NM_003174chr104847 745 323 76 1169 ----
NM_003178chr321838 831 22179 2143 12241 --
NM_003179chrX21338 995 ------
NM_003182chr71442 ------
NM_003182chr71442 ------
NM_003185chr2041208 931 888 866 31254 416 54 ----
NM_003186chr111389 ------
NM_003188chr62642 98 ------
NM_003189chr163102 2503 1204 1038 306 228 11284 --21360 1340
NM_003193chr11143 ------
NM_003198chr11112 --1257 --
NM_003199chr18195561 4415 4267 4209 4198 4099 3906 3754 3680 3669 2001 1856 1469 1318 1228 932 787 463 345 45273 5032 4616 107 33939 1699 690 24960 3485
NM_003202chr531363 1356 1304 11846 ----
NM_003203chr282205 1922 1848 1548 807 737 621 256 2973 963 ----
NM_003204chr1711367 ------
NM_003206chr62426 418 ----1317
NM_003211chr1231414 1196 275 2432 192 1690 1206
NM_003217chr1281972 1761 1434 1251 782 717 225 149 163 --1118
NM_003220chr621636 1421 ------
NM_003221chr623904 722 --22803 579 --
NM_003222chr203932 437 263 ------
NM_003223chr164789 703 685 652 ------
NM_003234chr362453 1825 1667 1586 863 726 12292 ----
NM_003236chr223386 1125 12886 1140 --
NM_003242chr322234 1842 --11561 1582
NM_003246chr1541933 1906 1554 253 11996 ----
NM_003247chr681909 1681 1662 1624 1413 1393 1378 427 11847 ----
NM_003250chr171185 ------
NM_003253chr2131600 1575 1348 2703 620 ----
NM_003255chr1752517 2500 1900 713 389 1379 ----
NM_003257chr152874 244 1259 21388 973 --
NM_003262chr365258 4405 4370 900 524 305 35306 4578 1155 ----
NM_003264chr43512 200 151 ------
NM_003274chr2132361 2222 923 ----22051 859
NM_003275chr931231 1218 389 --2601 108 --
NM_003286chr2021038 246 1391 --1978
NM_003290chr191404 1146 181 --
NM_003292chr132293 1896 472 1509 ----
NM_003298chr355949 5204 2415 2006 208 --35164 1575 500 13926
NM_003299chr12165 ------
NM_003300chr141472 ------
NM_003304chr351458 1147 593 513 239 2339 207 --21370 507
NM_003315chr171234 ------
NM_003317chr142677 304 ------
NM_003319chr2--2243 110 ----
NM_003320chr1144467 4408 3114 2953 11429 11653 --
NM_003330chr1221799 431 11157 ----
NM_003336chrX31044 975 743 ------
NM_003337chr51331 1292 ----
NM_003338chr1061976 1940 1874 1603 652 310 1205 ----
NM_003340chr441109 964 125 68 1892 --1871
NM_003341chr31146 ------
NM_003342chr1732880 2357 2252 23112 693 12656 1534
NM_003344chr751608 1573 1511 600 424 --11712 --
NM_003345chr163518 452 216 170 --1210
NM_003348chr1251681 1084 674 415 369 1622 ----
NM_003349chr2021451 174 --11089 --
NM_003350chr81856 ------
NM_003352chr23697 678 180 ----165
NM_003359chr451180 1118 116 105 41 21293 271 ----
NM_003368chr13620 513 92 --1297 --
NM_003370chr192641 625 ------
NM_003372chrX2230 167 2936 694 ----
NM_003373chr1011389 --11955 --
NM_003374chr52782 601 140 1521 --
NM_003376chr621465 576 21899 1385 11350 --
NM_003376chr621465 576 21899 1385 11350 --
NM_003379chr63922 748 734 ------
NM_003383chr9--1507 --1170
NM_003387chr232875 2729 661 --1260 --
NM_003392chr394333 3622 2902 1581 1175 818 261 227 74 ----11420
NM_003400chr24797 661 618 262 1140 1185 --
NM_003403chr141561 2609 242 ----
NM_003404chr2021476 352 1295 ----
NM_003405chr223627 542 216 1665 ----
NM_003406chr851392 1373 638 275 86 ------
NM_003407chr191671 1587 ----
NM_003409chr182577 88 11108 ----
NM_003410chrX52394 2343 1931 623 161 23105 1015 1652 1829
NM_003411chrY3559 461 355 --21617 615 --
NM_003412chr342905 2798 829 214 1655 12929 12791
NM_003413chrX51992 1977 1925 714 484 2803 598 --1581
NM_003418chr3--1741 ----
NM_003420chr32331 320 ------
NM_003423chr1942143 1991 1970 1876 32300 706 419 ----
NM_003427chr61645 ------
NM_003430chr1931463 1364 568 ------
NM_003432chr5144 ------
NM_003436chr19--1717 2818 334 --
NM_003439chr773076 2701 2693 2204 1355 1234 1088 12185 22219 37 --
NM_003440chr122765 723 1208 ----
NM_003442chr113833 684 672 --2848 161 --
NM_003452chr921000 666 1899 1714 --
NM_003453chr133648 504 485 1110 ----
NM_003454chr1651525 1386 1204 241 219 ------
NM_003458chr333805 858 384 --1926 --
NM_003462chr1--11768 ----
NM_003463chr642173 1206 1060 955 22305 1318 ----
NM_003467chr24381 175 138 116 ------
NM_003468chr284122 3829 3770 1111 632 206 67 54 14224 13349 --
NM_003470chr1641818 1347 1180 180 --1447 --
NM_003471chr351845 1690 1648 601 83 ------
NM_003472chr611225 2582 252 1963 --
NM_003473chr102747 713 ------
NM_003478chr1173318 2811 2203 2171 469 219 151 12916 1420 --
NM_003482chr1242751 2566 1924 701 22685 1808 ----
NM_003483chr1222629 47 12006 22141 970 21910 1822
NM_003487chr172285 62 1257 ----
NM_003488chr171877 2699 34 ----
NM_003489chr2173411 2308 2296 576 362 335 167 22804 715 22275 525 --
NM_003498chr1652641 2502 947 899 289 --2373 259 --
NM_003505chr721909 1572 21889 289 1577 --
NM_003506chr881319 1196 1167 1121 995 890 435 334 3963 933 70 1903 198
NM_003507chr231996 1318 739 21952 1935 11870 11587
NM_003558chr93721 700 287 ------
NM_003563chr1711068 21094 427 11119 --
NM_003566chr12103252 2604 2347 2217 916 884 738 617 417 173 11034 ----
NM_003567chr12445 75 ------
NM_003574chr18135661 5119 5105 5043 4733 4692 4616 4040 3852 3691 2292 1916 109 15805 --25576 4254
NM_003575chr711477 --11005 --
NM_003576chr1352614 1909 1833 729 26 32794 1021 625 22360 248 --
NM_003579chr11159 ------
NM_003581chr211065 ------
NM_003583chr1273094 2857 2591 1279 1259 217 160 23417 706 12823 1738
NM_003587chr6182 ------
NM_003589chr1361226 1200 1057 972 956 934 ------
NM_003590chr293516 3482 2750 1562 1267 1257 748 685 256 43474 3403 3083 376 ----
NM_003592chr71471 ------
NM_003597chr292172 1855 1753 1501 1494 1421 602 550 211 2435 339 22184 914 1193
NM_003603chr422093 624 21544 1521 ----
NM_003607chr194203 4127 3492 3244 3184 1557 1167 813 345 14104 12978 14282
NM_003610chr20--2336 271 --1351
NM_003615chr373996 3647 3605 3346 2687 1283 1270 23631 253 23662 403 11004
NM_003618chr251193 1183 1125 1017 152 --1981 --
NM_003620chr1721061 123 1182 ----
NM_003622chr1262407 2253 1722 715 548 352 22414 969 ----
NM_003626chr1111337 --11294 1374
NM_003628chr21141 ------
NM_003629chr1113457 2957 2325 1341 853 581 466 419 265 240 116 1100 --11268
NM_003630chr61200 ------
NM_003631chr102769 214 --2817 266 --
NM_003632chr171818 ------
NM_003633chr542311 807 764 204 22546 756 ----
NM_003637chr131360 317 140 11130 1278 --
NM_003644chr1785582 4573 4555 4309 4275 4227 2106 1604 1306 16281 --
NM_003648chr222630 1762 --1505 --
NM_003651chr122526 419 ------
NM_003654chr111155 ------
NM_003659chr231078 985 153 1303 ----
NM_003663chr353482 3419 3372 3156 878 63352 1059 686 618 120 79 22946 2196 --
NM_003664chr52480 190 ------
NM_003670chr341328 1071 224 71 --1481 --
NM_003671chr911245 12613 ----
NM_003672chr151937 1904 693 589 479 1722 ----
NM_003676chr11647 2710 62 ----
NM_003685chr194999 980 80 56 ------
NM_003686chr1--1262 ----
NM_003688chrX1280 ------
NM_003692chr92999 96 1270 ----
NM_003701chr1331065 948 394 1223 ----
NM_003702chr81191 --1668 --
NM_003704chr41677 ------
NM_003710chr151447 ------
NM_003713chr12707 484 31680 1665 30 2317 104 11708
NM_003716chr32863 735 --1983 --
NM_003722chr372721 2688 2417 2006 1756 775 367 21969 1855 ----
NM_003728chr41423 --1507 --
NM_003741chr3--1381 ----
NM_003743chr261868 691 557 325 188 81 1288 1165 11954
NM_003744chr1451269 1192 1130 1115 1096 ------
NM_003745chr16153 ------
NM_003749chr1372222 2180 2149 737 350 234 104 ------
NM_003750chr102833 341 ------
NM_003754chr11------1143
NM_003758chr1511152 --1118 --
NM_003758chr1511152 --1118 --
NM_003759chr483380 3112 3016 2786 865 826 241 194 23658 469 1351 --
NM_003760chr11526 ------
NM_003763chr2053136 2864 2022 396 189 23179 714 ----
NM_003764chr61713 ------
NM_003766chr17146 ------
NM_003768chr131529 1169 550 ------
NM_003772chr11--31191 830 412 2348 170 --
NM_003778chr3--3714 701 133 ----
NM_003781chr341581 483 384 228 11610 ----
NM_003783chr121139 461 ------
NM_003787chr1831708 1354 228 --11551 --
NM_003794chr321082 967 2921 895 ----
NM_003795chr61137 ------
NM_003796chr192473 199 1593 ----
NM_003797chr111210 ------
NM_003799chr1884494 4241 3881 3547 2969 2788 1305 419 ----1178
NM_003800chr632312 617 582 21662 69 22306 1899 11878
NM_003816chr841451 1239 337 284 122 21427 1307 --
NM_003818chr201124 1438 ----
NM_003822chr132945 968 694 ------
NM_003825chr1571167 631 556 487 370 354 156 1576 2377 290 --
NM_003829chr921207 206 1277 ----
NM_003831chr1851747 1640 1570 575 404 ------
NM_003838chr151399 332 323 224 34 165 ----
NM_003850chr131237 --1219 --
NM_003861chr1442730 2455 410 126 ------
NM_003862chr5--1110 ----
NM_003872chr232714 861 292 11932 ----
NM_003873chr1042361 1988 758 332 22344 2237 11944 1982
NM_003877chr121824 ------
NM_003884chr331431 650 128 21784 1277 ----
NM_003885chr1752371 2210 785 169 70 22675 2565 ----
NM_003887chr241722 1553 1440 1425 22047 1661 ----
NM_003895chr2141640 812 655 36 ------
NM_003902chr14634 334 141 99 ------
NM_003908chr202925 116 21349 22 ----
NM_003909chr852980 2890 865 529 287 12768 123 --
NM_003913chr6113875 3724 3597 3573 3257 3127 1583 1317 816 660 178 --21371 1281 11117
NM_003919chr71194 1179 ----
NM_003922chr151399 1309 ----
NM_003927chr183744 267 161 --184 1230
NM_003929chr141500 614 552 516 ------
NM_003930chr722490 452 1234 1721 --
NM_003934chr97928 327 241 206 192 110 90 ------
NM_003939chr1083068 2974 2782 1516 1307 1298 1289 359 --34058 3334 248 --
NM_003941chr792498 2475 1870 1670 1565 756 744 128 116 1924 ----
NM_003953chr162868 2849 2599 1954 975 564 1258 --1777
NM_003955chr1721402 1279 ------
NM_003956chr102373 204 1156 ----
NM_003957chr1131014 823 774 ------
NM_003961chr161189 ------
NM_003966chr5156938 6895 6768 6407 6228 5865 5573 5463 5245 2664 2291 2042 1329 747 283 27790 3112 36811 5756 2685 12191
NM_003968chr3------1677
NM_003971chr17----186 --
NM_003972chr1011266 ------
NM_003973chr3135 ------
NM_003980chr62937 338 --11070 1594
NM_003983chr1694485 4347 4318 4290 4166 3733 3109 1491 103 14387 ----
NM_003987chr1011554 12317 12269 --
NM_003988chr1011631 12394 12346 --
NM_003989chr1011490 12253 12205 --
NM_003990chr1011490 12253 12205 --
NM_003993chr1--1308 ----
NM_003994chr12--11647 ----
NM_004006chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004007chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004009chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004010chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004011chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004012chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004013chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004014chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004015chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004016chrX112400 2209 2196 2033 1795 1780 1745 1655 442 159 99 31707 485 434 ----
NM_004017chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004018chrX112400 2209 2196 2033 1795 1780 1745 1655 442 159 99 31707 485 434 ----
NM_004020chrX112486 2295 2282 2119 1881 1866 1831 1741 528 245 185 31793 571 520 ----
NM_004021chrX112400 2209 2196 2033 1795 1780 1745 1655 442 159 99 31707 485 434 ----
NM_004022chrX112400 2209 2196 2033 1795 1780 1745 1655 442 159 99 31707 485 434 ----
NM_004023chrX112400 2209 2196 2033 1795 1780 1745 1655 442 159 99 31707 485 434 ----
NM_004028chr1863610 3565 1284 1015 978 929 --23550 1342 12895
NM_004046chr18139 ------
NM_004050chr1422728 969 ------
NM_004061chr53536 258 250 ------
NM_004063chr821071 148 1304 ----
NM_004067chr721513 520 11179 1222 --
NM_004068chr3--1426 ----
NM_004071chr21215 178 ----
NM_004077chr121960 --166 --
NM_004080chr72241 129 ------
NM_004081chrY11735 --11159 --
NM_004086chr14------1557
NM_004087chr331582 1272 318 11742 ----
NM_004089chrX41200 1175 1031 69 11043 ----
NM_004096chr1052110 1900 853 772 342 --22017 1505 11662
NM_004097chr2----1289 --
NM_004098chr1041287 1222 1214 493 1502 ----
NM_004100chr631977 1790 1073 31970 1917 828 1564 --
NM_004113chr32617 442 2514 453 ----
NM_004114chrX21120 418 --1881 --
NM_004117chr622212 1782 11877 21709 455 --
NM_004124chr1473304 2567 2349 1434 1397 1027 356 23147 247 23555 3105 --
NM_004126chr71290 ------
NM_004130chr3----2609 247 --
NM_004136chr1562664 2565 2389 2200 1051 787 2352 285 22912 52 --
NM_004161chr231433 1282 303 21232 373 ----
NM_004162chr31813 --1804 --
NM_004171chr11199440 8665 8451 8150 7387 6679 6336 5828 3769 3474 3098 2503 2394 1831 1786 1762 1103 916 888 58194 7071 6690 3838 2112 39651 9513 6096 --
NM_004175chr222165 154 --195 --
NM_004185chr1--1582 1677 --
NM_004187chrX21119 580 ----1152
NM_004199chr51100 ------
NM_004200chr1133272 3250 628 13125 ----
NM_004209chr16--11095 ----
NM_004215chr81471 --1412 --
NM_004225chr841506 592 310 142 11495 --21388 65
NM_004229chrX41982 389 357 350 --22126 2117 1180
NM_004232chr1853850 2447 885 866 630 23625 1371 22465 92 --
NM_004235chr91831 2848 796 ----
NM_004236chr153414 157 136 1463 ----
NM_004237chr54880 823 721 331 --1906 --
NM_004240chr191257 ------
NM_004241chr102559 291 1233 1737 --
NM_004242chr61164 179 --1349
NM_004261chr12671 81 --131 --
NM_004263chr2----11147 --
NM_004267chr3----1499 --
NM_004272chr551563 595 418 349 138 1485 1451 --
NM_004277chr621660 184 11678 ----
NM_004280chr61126 1179 ----
NM_004286chr2212012 32167 962 252 --12844
NM_004290chr541334 1200 1143 1133 ------
NM_004291chr5--1297 ----
NM_004293chr943315 2383 774 678 12552 ----
NM_004299chrX126 ------
NM_004301chr31248 1109 133 188
NM_004302chr1242675 1967 1142 920 12812 12906 --
NM_004311chr1073056 2815 2769 2513 2150 1973 733 --12359 --
NM_004316chr1211076 3888 774 732 ----
NM_004326chr171132 1110 772 385 377 269 235 ------
NM_004327chr2232383 981 592 --1612 1911
NM_004329chr1041349 1341 995 233 ------
NM_004330chr151460 31093 468 280 --1141
NM_004331chr872691 1866 805 796 600 297 197 ------
NM_004337chr842232 1745 1600 291 164 ----
NM_004338chr1896086 5863 5518 5343 4726 1981 829 819 472 --16348 25139 1446
NM_004342chr772091 2069 1944 801 634 467 378 176 ----
NM_004343chr192571 140 ------
NM_004346chr42524 386 11522 1548 11466
NM_004349chr821306 88 ----1924
NM_004360chr1662034 1836 1749 1543 395 342 --11772 --
NM_004364chr1951146 1128 1058 1041 934 ------
NM_004370chr641553 657 580 569 1607 11727 --
NM_004379chr221237 706 ----1159
NM_004380chr166961 291 277 250 212 161 ----149
NM_004384chr562179 1991 1611 492 214 143 12244 1677 --
NM_004386chr1952229 2140 2126 2008 491 ------
NM_004388chr1----193 --
NM_004392chr1342515 1973 899 114 21959 635 21847 1671 12344
NM_004393chr35536 373 267 233 219 11726 11463 --
NM_004396chr17--1196 ----
NM_004397chr11114305 4214 4047 4022 3656 3032 2758 1346 1058 679 190 11706 --11610
NM_004398chr111462 ------
NM_004404chr241951 1537 544 227 22039 174 --1742
NM_004407chr41967 21015 761 ----
NM_004415chr63694 622 297 ------
NM_004419chr103977 419 49 1949 ----
NM_004423chr312672 --1262 --
NM_004429chrX31400 1358 422 21429 115 1381 --
NM_004430chr852501 2439 2087 1902 1880 11996 11102 12452
NM_004432chr91833 31813 894 525 12394 --
NM_004434chr1441666 1300 763 84 --1192 --
NM_004437chr182901 1313 1305 1252 1207 1035 656 190 --13411 --
NM_004438chr233175 2447 384 13008 ----
NM_004440chr661996 1892 1849 1801 596 285 21608 712 ----
NM_004441chr3------11237
NM_004444chr72577 563 1857 ----
NM_004447chr126984 969 783 382 208 34 ------
NM_004448chr171492 ------
NM_004449chr2111458 ------
NM_004451chr112729 620 ------
NM_004454chr382130 1970 864 764 736 724 85 74 1809 ----
NM_004458chrX42609 1060 751 688 31628 287 181 12253 --
NM_004459chr1752082 1785 1741 383 165 31665 1441 1326 --22038 805
NM_004464chr494127 3706 2873 1232 790 419 400 361 162 13677 2410 240 --
NM_004472chr52175 78 2579 551 ----
NM_004480chr141509 2739 649 ----
NM_004482chr24892 859 366 77 1297 ----
NM_004484chrX198 ------
NM_004485chr174361 3349 2899 2746 1309 1069 550 33073 1464 724 1540 --
NM_004491chr1954268 4257 4186 2999 1740 ------
NM_004499chr54517 483 437 427 ------
NM_004500chr1461859 1456 597 498 230 207 1698 --11678
NM_004501chr123966 3036 1164 ----
NM_004504chr292794 2768 2734 1204 1114 1067 874 641 588 ------
NM_004505chr1721319 565 ------
NM_004506chr63698 500 102 186 1137 --
NM_004514chr1752239 1141 971 822 555 --1590 --
NM_004516chr1921070 253 21033 404 1867 --
NM_004520chr55591 251 221 145 116 1613 1160 --
NM_004521chr101354 1347 ----
NM_004523chr1021270 1185 --11165 --
NM_004524chr17--1226 ----
NM_004525chr21943 ----143
NM_004527chr1711140 ------
NM_004529chr961393 1297 1089 78 64 48 ------
NM_004535chr2051431 1354 1116 500 246 11399 11496 --
NM_004537chr122984 126 2194 134 ----
NM_004540chr212606 207 --1171 --
NM_004561chr1131762 733 201 1195 ----
NM_004566chr1062199 2121 2059 818 696 348 12555 --1810
NM_004569chr141208 --1673 --
NM_004571chr2143429 2963 846 29 ----1108
NM_004575chr451560 1445 1349 1262 79 ------
NM_004577chr72534 234 ------
NM_004578chr11703 --1919 --
NM_004583chr17--1735 ----
NM_004586chrX65043 4464 4232 4045 1804 928 45438 5037 462 452 25217 1994 --
NM_004588chr1134004 2620 976 ----14028
NM_004594chr161760 1943 ----
NM_004595chrX2364 191 --1300 --
NM_004596chr191204 ------
NM_004598chr562814 2722 1165 359 228 211 42910 823 171 31 ----
NM_004600chr151459 1103 1026 277 250 ------
NM_004602chr2041363 1176 936 603 ------
NM_004607chr5167 129 ----
NM_004612chr92787 770 23218 576 14843 2927 118
NM_004615chrX2744 209 ------
NM_004619chr132099 708 266 1592 12117 --
NM_004622chr261984 1914 1581 653 202 160 21925 626 1526 --
NM_004627chr213636 120 79 2655 602 ----
NM_004630chr112970 439 1999 ----
NM_004631chr121331 565 1409 ----
NM_004637chr31348 1532 ----
NM_004642chr122481 224 1172 ----
NM_004643chr146867 797 709 702 685 530 --1540 --
NM_004654chrY51396 1377 507 337 294 1204 ----
NM_004655chr1751297 1217 1025 897 885 --11284 --
NM_004660chrY62104 2092 1706 1518 711 276 31758 581 531 ----
NM_004663chr1541238 552 379 138 2977 567 21386 90 --
NM_004687chr1721689 664 ----11591
NM_004689chr141305 1358 ----
NM_004690chr61731 ------
NM_004694chr172542 195 --1161 --
NM_004703chr1741959 959 796 521 ------
NM_004709chrX11379 ----21314 1191
NM_004715chr18--2712 151 --1200
NM_004718chr22618 31 2452 109 ----
NM_004719chr1272908 2672 2516 2066 1876 300 144 12486 1649 12200
NM_004721chr32285 94 ------
NM_004723chr121043 675 1699 1686 --
NM_004725chr1051189 1118 1009 287 146 11475 1399 --
NM_004726chrX165324 5238 4953 4715 4461 4388 3600 2171 2023 1843 1835 1696 1401 1081 748 56 44407 3973 1999 412 ----
NM_004730chr531880 1815 1734 11980 --11932
NM_004733chr31180 ----1614
NM_004734chr1322803 2049 ------
NM_004736chr151977 1969 1914 1898 426 12151 ----
NM_004739chr11----1595 1565
NM_004741chr104638 617 337 194 1180 ----
NM_004742chr341646 365 208 37 21598 1584 21654 130 --
NM_004745chr836812 6516 339 25692 2375 21115 201 --
NM_004748chr15114257 3728 3551 3492 3265 2873 2856 1059 898 757 329 13812 33388 2709 2684 --
NM_004757chr42534 189 2229 100 ----
NM_004759chr121767 1601 32153 871 113 --11695
NM_004760chr742391 2099 578 445 --1884 --
NM_004762chr1731986 1972 1895 11874 21624 141 11525
NM_004765chr16----168 --
NM_004768chr1----11100 --
NM_004770chr8--1196 ----
NM_004772chr531277 1154 471 ----11521
NM_004774chr1753095 2499 1233 1069 311 13068 ----
NM_004775chr1882331 2301 2287 2227 2199 1564 846 705 2400 338 1587 --
NM_004776chr2063180 2134 2126 2103 1204 67 23315 3225 ----
NM_004779chr541120 824 539 94 11324 1138 --
NM_004781chr13678 109 52 2492 199 1541 --
NM_004781chr13678 109 52 2492 199 1541 --
NM_004785chr161361 ------
NM_004786chr18----1196 --
NM_004788chr1162359 2221 2160 871 638 376 ------
NM_004792chr21158 ------
NM_004796chr1482047 1600 1577 1527 625 613 605 246 11704 --11844
NM_004799chr1----195 --
NM_004800chr13167 ------
NM_004804chr222764 264 ------
NM_004805chr22364 301 ------
NM_004808chr1042198 1292 676 264 12260 ----
NM_004815chr1124814 4673 4004 3562 1136 839 462 371 122 65 46 26 33212 1955 1216 2770 129 2891 96
NM_004821chr53631 544 330 ------
NM_004822chr1733920 3058 928 --11435 --
NM_004824chr62988 295 21362 1254 ----
NM_004827chr431706 519 79 ------
NM_004831chr191184 ------
NM_004834chr273248 3148 1012 959 868 651 600 33357 805 507 ----
NM_004836chr22189 113 1606 ----
NM_004840chrX22067 1717 11820 2678 96 --
NM_004841chr131065 762 292 ------
NM_004842chr61552 ------
NM_004844chr331154 1028 482 11190 ----
NM_004849chr62637 614 21608 476 21355 68 --
NM_004850chr211414 ------
NM_004857chr1431890 1493 368 23325 1650 1475 --
NM_004859chr1742325 862 643 130 1975 --22340 1956
NM_004863chr1455269 4457 1959 1828 1407 43853 1442 266 159 15098 --
NM_004865chr6--1372 ----
NM_004866chr561930 1102 917 854 244 31 44776 1813 1687 512 ----
NM_004867chrX1201 1473 1460 --
NM_004869chr1821612 56 ------
NM_004871chr1794355 4302 3919 3743 3712 3400 2919 1484 1386 --23288 250 --
NM_004873chr1493026 2878 2620 619 519 392 246 148 22 32223 1985 35 22320 726 2546 285
NM_004874chr82488 77 1412 ----
NM_004879chr112392 150 1371 ----
NM_004884chr1541734 1342 1258 432 ------
NM_004888chr93690 260 139 1166 ----
NM_004893chr55478 467 419 159 113 ------
NM_004895chr12564 497 2528 487 1375 --
NM_004896chr103504 427 336 11204 ----
NM_004897chr102813 595 ------
NM_004898chr441109 960 749 254 1601 1699 --
NM_004902chr202759 701 ------
NM_004904chr786552 6443 6430 4692 4505 2548 1345 422 --25095 1665 --
NM_004906chr64251 180 122 96 --179 --
NM_004912chr741514 592 513 85 138 ----
NM_004921chr142498 1947 635 272 ------
NM_004924chr1921009 988 ------
NM_004926chr1461379 1300 1218 1208 1131 283 21823 1363 ----
NM_004930chr13651 640 250 1660 ----
NM_004937chr171675 12696 ----
NM_004946chr5--1419 ----
NM_004947chr3--1524 22389 2134 --
NM_004949chr1831644 1349 154 --22087 834 --
NM_004952chr11814 --1772 --
NM_004956chr793856 3685 1638 1507 1496 1435 1340 584 30 24445 529 --11333
NM_004957chr9----181 --
NM_004958chr11918 ----146
NM_004960chr162104 36 169 ----
NM_004964chr12547 527 ------
NM_004966chr102986 336 1100 ----
NM_004968chr7----1637 --
NM_004973chr671769 1716 1608 545 356 296 142 3319 174 42 --11118
NM_004976chr1155199 5156 5030 3610 2023 ------
NM_004978chr121342 1321 --1513 --
NM_004979chrX268 40 ------
NM_004985chr1294494 3595 3232 2774 1431 546 345 269 209 44309 4279 3315 54 24327 1188 14195
NM_004992chrX108281 7455 7430 7146 7126 6257 5519 5414 3298 1847 28353 5762 47054 5396 1853 1242 16205
NM_004992chrX108281 7455 7430 7146 7126 6257 5519 5414 3298 1847 28353 5762 47054 5396 1853 1242 16205
NM_004993chr1451504 1382 1371 605 255 1311 ----
NM_004995chr1411508 ------
NM_004996chr161510 11664 --11718
NM_004999chr684148 1747 1494 1189 951 765 494 138 1862 ----
NM_005010chr731709 1532 517 ----12149
NM_005011chr72498 112 ------
NM_005016chr121242 ------
NM_005022chr172209 85 --1203 --
NM_005023chr531109 1091 510 ------
NM_005026chr12777 569 --1129 --
NM_005028chr1052221 2087 1937 1586 487 ------
NM_005032chrX3856 758 393 --1321 --
NM_005036chr22118337 7240 7168 7065 6982 6406 6007 5831 1509 928 379 21931 85 36347 6212 1237 --
NM_005045chr72791 640 ------
NM_005054chr221614 645 11683 1117 --
NM_005056chr12134949 4864 4524 4253 4144 3817 3801 2039 1910 1645 1555 1208 979 --31751 1651 589 14372
NM_005057chr151872 708 608 426 316 11879 1452 --
NM_005063chr1033201 2513 1456 --23113 483 --
NM_005065chr1465030 4129 1602 1518 674 323 43999 3908 3895 950 ----
NM_005066chr14754 732 43 36 ------
NM_005067chr33967 814 122 --1399 --
NM_005069chr2161731 1375 1221 1115 624 547 --11708 --
NM_005076chr1--1143 ----
NM_005077chr91444 2438 416 ----
NM_005078chr1531454 1433 1386 11578 1339 --
NM_005079chr833162 2965 2180 33219 2571 604 13203 12620
NM_005080chr221749 --2867 337 --
NM_005087chr31272 1831 ----
NM_005093chr2075272 3803 1663 1357 1351 1343 723 11532 ----
NM_005095chr132176 1606 270 --1580 --
NM_005096chrX11117 ------
NM_005099chr121255 536 21087 942 ----
NM_005104chr6----1748 2781 623
NM_005105chr142081 557 281 152 32136 713 443 1678 --
NM_005109chr382536 2384 1828 1715 788 773 591 567 ------
NM_005114chr41537 1196 ----
NM_005116chr20104420 4364 4325 4235 4011 3274 2806 1831 1222 1074 11109 ----
NM_005119chr14981 342 315 217 ------
NM_005120chrX--1173 ----
NM_005121chr1773430 3372 3358 3318 2669 2622 2533 2906 618 ----
NM_005124chr65884 746 730 691 677 ------
NM_005126chr372293 2177 2020 1976 1879 1571 47 11691 --12029
NM_005135chr1563843 3831 3283 3265 720 654 12675 23581 1184 --
NM_005141chr42125 21 149 ----
NM_005151chr181771 --1787 --
NM_005154chr15----1469 --
NM_005156chr995057 4521 3666 3320 1678 1230 1138 945 88 54723 4648 4330 991 161 14240 --
NM_005157chr921937 1906 --11752 --
NM_005164chr1262606 2499 2310 2101 982 798 ------
NM_005168chr251396 1288 344 329 144 --11673 --
NM_005171chr12124 21183 987 ----
NM_005178chr19--1424 --1408
NM_005180chr1021338 393 ----2657 119
NM_005188chr11118218 7620 7187 6018 5354 3040 2706 2315 2088 1826 313 23213 2082 68359 6002 5579 2547 2234 1707 --
NM_005194chr204587 472 456 180 1485 ----
NM_005197chr14105753 5287 4495 1556 1544 1516 1497 1447 149 112 26089 4022 24700 4016 15388
NM_005203chr10175 1142 1170 --
NM_005204chr101993 2767 698 1949 1748
NM_005207chr22113714 3689 3620 3279 3256 1178 1044 587 575 555 223 1742 1500 --
NM_005219chr511799 --31679 1369 404 --
NM_005221chr7247 30 1132 ----
NM_005222chr72954 240 ------
NM_005224chr193610 541 442 ------
NM_005229chrX4962 484 454 281 ------
NM_005230chr124579 537 227 170 ------
NM_005231chr1161408 1258 976 280 177 117 --1166 --
NM_005233chr351951 784 649 622 427 22379 211 ----
NM_005235chr2177826 7713 7363 7162 6542 6048 5893 5480 2975 2964 2915 2642 1993 1562 699 657 641 25955 5210 37284 6144 2119 15244
NM_005238chr1153512 3472 2912 2193 588 21202 952 12860 --
NM_005239chr2152057 1351 758 736 726 22020 618 1362 21499 370
NM_005241chr361269 1235 975 961 563 195 21024 201 --1395
NM_005242chr541318 1249 1201 1021 21192 1132 ----
NM_005244chr202566 430 ------
NM_005245chr43514 219 97 ------
NM_005254chr1561198 1089 928 303 290 33 21354 1039 --11017
NM_005257chr1851429 1288 1151 1087 331 21301 325 166 --
NM_005259chr241551 1453 355 224 21439 977 ----
NM_005261chr81720 2905 173 ----
NM_005277chr451902 1790 1596 506 231 11866 --1347
NM_005278chrX2427 93 ------
NM_005281chr111017 ------
NM_005284chr62456 433 1491 ----
NM_005295chr71225 ------
NM_005296chrX3986 422 159 ------
NM_005302chr7--1350 ----
NM_005308chr10--2370 338 ----
NM_005310chr171383 ------
NM_005311chr722563 671 52821 2308 2115 400 383 12518 12143
NM_005313chr151478 1285 1984 21012 940
NM_005316chr1151077 760 406 331 27 ------
NM_005318chr2251256 944 869 289 231 --198 --
NM_005324chr1722154 2022 274 28 --1324
NM_005328chr82773 277 2547 521 ----
NM_005329chr1621446 952 12143 --12268
NM_005334chrX21784 1753 --1280 --
NM_005339chr463190 3006 2852 1483 567 331 11242 13730 14253
NM_005342chrX41848 1031 824 481 1799 12349 --
NM_005349chr42583 259 --1508 --
NM_005358chr134286 178 126 93 --11846 --
NM_005359chr18166552 5937 5701 5620 4979 4857 4800 4109 2574 2273 2091 1365 1150 1059 623 423 41113 1035 852 563 46483 1817 1634 92 22249 1359
NM_005369chrX2498 259 --1427 --
NM_005375chr661132 939 906 864 347 107 ------
NM_005376chr11225 1909 1290 --
NM_005378chr21693 ----1711
NM_005381chr24398 345 319 301 ------
NM_005382chr8----1385 --
NM_005384chr91239 166 ----
NM_005385chr32766 342 22606 1061 --12665
NM_005388chr931514 218 66 --11271 --
NM_005389chr62522 117 ------
NM_005392chr921518 1429 11906 ----
NM_005397chr774034 3848 3195 3110 2964 2901 1175 --23767 979 --
NM_005398chr1051213 1044 912 452 120 11198 ----
NM_005399chr161674 1401 1311 1053 812 658 34262 3929 1455 11770 23889 150
NM_005400chr231212 1107 1022 12939 11967 --
NM_005402chr71589 ----1716
NM_005406chr183470 444 282 ------
NM_005407chr1451477 1309 1156 1002 90 ------
NM_005410chr51223 ----1532
NM_005415chr2--2597 277 1157 --
NM_005417chr20--11878 ----
NM_005418chr112507 473 1201 ----
NM_005433chr1812641 --1968 1533
NM_005436chr1083485 3434 3423 3051 1513 1406 1212 300 11236 13936 --
NM_005437chr101558 21474 494 1440 11459
NM_005439chr121523 ------
NM_005440chr1733081 2212 569 ------
NM_005442chr35560 454 160 126 62 139 1512 --
NM_005445chr10--1215 ----
NM_005455chr151598 1296 1144 677 400 ------
NM_005460chr5--1530 ----
NM_005461chr2041995 1969 1702 1485 21432 686 ----
NM_005465chr12339 192 1200 ----
NM_005467chr112318 158 ------
NM_005474chr17144 11572 ----
NM_005475chr1223271 1080 1668 ----
NM_005487chr2222052 1898 12120 ----
NM_005488chr22------1740
NM_005493chr62593 116 ------
NM_005494chr73206 164 74 ------
NM_005497chr17126151 6073 4716 4710 4109 3760 1843 1625 1566 1343 1107 663 54873 4864 1798 347 296 ----
NM_005499chr192570 143 1613 ----
NM_005502chr943046 1292 981 322 23214 3115 1553 12561
NM_005504chr1276553 5898 5342 1418 757 504 370 36449 4651 1465 16334 1293
NM_005506chr441995 1162 300 267 22148 1099 1693 --
NM_005509chr561628 1334 1204 748 676 277 41498 1448 718 347 ----
NM_005517chr131127 158 93 11087 ----
NM_005519chr101160 ------
NM_005520chr51283 1498 ----
NM_005522chr731350 924 299 ----1948
NM_005524chr31102 ------
NM_005530chr1521151 395 2973 246 ----
NM_005534chr211510 --1102 --
NM_005536chr82474 288 21351 203 ----
NM_005537chr13--1943 1164 --
NM_005542chr761783 1516 1444 1415 1229 364 31931 1275 1268 ----
NM_005544chr2--1779 ----
NM_005546chr522338 2024 32331 2324 2012 ----
NM_005561chr134926 848 208 187 ------
NM_005566chr111450 ------
NM_005573chr52263 148 4519 474 275 165 --1459
NM_005575chr53685 642 25 ----170
NM_005576chr151213 ------
NM_005578chr361881 1798 1072 1024 538 429 34871 1408 239 11865 --
NM_005584chr131628 --1790 --
NM_005585chr151390 ------
NM_005587chr151875 1312 129 --
NM_005594chr12123 ------
NM_005595chr13941 861 131 ------
NM_005596chr9156274 6047 6038 5443 5166 5021 4380 4281 3997 2435 1943 1861 1569 1402 1005 34925 1991 1622 24750 2011 15934
NM_005602chr331068 303 176 2328 143 1271 1860
NM_005603chr1822006 1351 21871 1338 11367 --
NM_005604chr642453 2371 2252 622 11913 ----
NM_005607chr84922 188 119 36 1698 ----
NM_005611chr165981 838 431 382 257 1467 ----
NM_005613chr142040 1883 881 170 21510 742 --22140 577
NM_005614chr711101 ----11025
NM_005618chr63612 476 427 1555 ----
NM_005625chr831064 873 752 --1886 --
NM_005626chr12443 358 ----143
NM_005627chr63967 161 65 1795 ----
NM_005631chr71676 11090 ----
NM_005632chr1611113 ------
NM_005637chr1851631 1612 1599 705 107 31788 419 373 ----
NM_005638chrX2570 289 --2419 238 --
NM_005639chr1211676 1595 11773 --
NM_005644chr12342 304 ------
NM_005647chrX31280 1003 426 13246 23159 3056 --
NM_005650chr2231175 1094 405 11181 ----
NM_005652chr162947 99 1256 --11175
NM_005655chr821026 254 11202 31306 1076 327 --
NM_005656chr2141129 587 475 58 11514 --11194
NM_005664chr1521061 238 ------
NM_005665chr1114867 4250 4223 3748 1650 1622 1443 1203 1038 953 66 31846 1716 666 13147 --
NM_005667chr2175 ------
NM_005668chr594163 3206 1824 1328 1315 1211 679 547 528 31540 979 828 12919 11298
NM_005676chrX--1193 1158 --
NM_005686chr121572 1503 ------
NM_005688chr341362 938 447 215 21127 417 ----
NM_005704chr13961 943 355 --1953 --
NM_005708chr131150 ------
NM_005715chr632500 2425 156 ----1983
NM_005717chr161281 1270 1256 503 332 321 31292 1199 338 ----
NM_005718chr32867 299 ------
NM_005721chr2168 1273 --1913
NM_005722chr281991 1787 1642 900 628 619 572 165 ------
NM_005731chr2--1128 ----
NM_005734chr115667 646 254 154 97 1166 ----
NM_005735chr2168 --1786 1861
NM_005736chr101500 --11149 --
NM_005737chr242447 2339 949 750 22455 2100 32902 2061 256 --
NM_005738chr791477 1443 1436 740 537 480 336 220 124 --11669 --
NM_005740chr221116 ------
NM_005744chr151136 ------
NM_005746chr712035 32647 1779 372 1496 --
NM_005748chr1241162 627 616 560 22207 1156 --12869
NM_005749chr171590 1636 ----
NM_005751chr72474 377 1437 169 278 51
NM_005752chr1651162 1122 796 176 152 ------
NM_005754chr531176 208 136 --1926 --
NM_005759chr264530 3761 3349 1784 1736 130 24427 1125 --14488
NM_005765chrX3135 123 51 ------
NM_005766chr13------1516
NM_005767chr13168 ------
NM_005768chr121181 ------
NM_005776chr141157 --1343 --
NM_005779chr542953 2882 2874 2551 33662 2710 1051 1526 --
NM_005782chr171211 1197 ----
NM_005783chr22601 233 ------
NM_005786chr1811056 1142 --1251
NM_005788chr11--1589 ----
NM_005795chr272855 2229 1944 811 496 102 31 32342 900 522 13008 --
NM_005797chr113609 600 279 ----11754
NM_005798chr13125296 5015 4927 4675 4630 4050 3716 1318 700 377 215 197 33193 941 534 131 --
NM_005801chr172740 630 ------
NM_005806chr2121099 985 11268 ----
NM_005808chr363090 2751 860 685 407 147 ------
NM_005813chr242404 2304 633 54 32424 2236 251 ----
NM_005819chr163500 3242 3183 2836 613 335 ----11366
NM_005822chr621713 1471 ------
NM_005826chr12539 108 1484 ----
NM_005828chr1744769 1666 1596 1370 ----139
NM_005832chr331071 200 27 11297 11173 --
NM_005839chr19987 910 893 791 686 678 362 344 332 ----1707
NM_005840chrX36247 5469 2080 35178 3075 2183 1120 17455
NM_005841chr44875 763 277 59 1959 1265 --
NM_005842chr134687 496 276 145 ------
NM_005843chr251817 1549 576 539 246 --1619 --
NM_005845chr1361635 1352 420 329 262 51 ----11132
NM_005859chr531234 1147 530 ----1364
NM_005862chr331050 424 91 1144 ----
NM_005863chr104998 910 125 62 1358 ----
NM_005869chr51108 1150 ----
NM_005871chr102918 679 31070 787 322 --1237
NM_005875chr33401 294 41 ------
NM_005877chr222516 37 2525 371 ----
NM_005880chr163559 546 306 11573 1656 --
NM_005885chr531369 1115 48 1580 ----
NM_005896chr22729 36 2536 104 ----
NM_005898chr1162256 2234 1031 871 768 690 --32757 2438 1268 22539 805
NM_005900chr431010 762 489 11097 --11136
NM_005901chr18167565 6635 6151 5409 3122 2880 2802 2183 1570 1380 754 670 660 650 599 465 27432 2771 12290 11148
NM_005902chr1554164 1619 1111 585 318 21533 1506 --11444
NM_005903chr5115178 4642 4045 3761 3519 1904 1755 1011 825 798 149 55211 949 850 689 475 23786 2034 1658
NM_005904chr184418 218 168 119 ------
NM_005906chr641461 1146 602 503 21548 429 21679 422 --
NM_005907chr651604 636 393 279 220 2669 129 ----
NM_005909chr583665 3168 2951 2745 2636 1507 572 169 ------
NM_005911chr231430 1050 203 --1157 --
NM_005920chr163846 2867 2835 1383 1345 538 ------
NM_005923chr6--1556 ----
NM_005924chr711137 --2432 279 --
NM_005927chr541119 1099 492 83 ----11161
NM_005930chr14--1136 188 1723
NM_005933chr1112011 32510 1915 971 12428 --
NM_005935chr4104804 4013 3816 3648 3641 1197 948 475 455 441 24972 43 35212 3956 2128 --
NM_005937chr1742734 1615 1581 1527 14181 ----
NM_005938chrX--1379 ----
NM_005941chr874141 4090 3187 2850 802 590 449 ----132
NM_005944chr31786 1230 1499 --
NM_005955chr1135506 5407 5208 5144 4786 3673 2158 1873 1859 1573 930 833 433 55450 4921 4896 2012 1064 33628 1879 263 --
NM_005962chr1052171 2105 1943 607 554 ------
NM_005962chr1052171 2105 1943 607 554 ------
NM_005964chr1721326 1093 11483 ----
NM_005966chr262357 2239 1900 1691 587 400 12132 ----
NM_005967chr122721 464 ------
NM_005968chr19--1201 ----
NM_005975chr201807 ------
NM_005977chr133810 266 62 1801 --1285
NM_005982chr14--195 --1221
NM_005985chr20--3773 755 287 ----
NM_005986chr1342566 1947 623 504 5993 632 585 486 256 --2352 95
NM_005989chr721605 1510 ------
NM_005990chr51359 12740 12432 --
NM_005996chr1231493 1154 1034 --11328 1109
NM_005999chr171525 1107 1035 977 236 228 32 11489 1296 --
NM_006007chr9114525 3984 3805 3798 3627 2889 2840 1677 1351 1184 338 13817 1875 --
NM_006010chr3--173 ----
NM_006015chr121262 1096 ------
NM_006016chr652107 1932 1722 495 422 12014 11410 --
NM_006036chr252567 2517 2494 450 143 32442 1977 1949 ----
NM_006037chr2104788 4757 4441 4428 4071 3507 3405 1704 893 703 53717 3567 3473 1718 1537 14735 --
NM_006042chr171481 ------
NM_006047chr2093516 3322 2786 2687 2389 1105 769 620 306 --1724 --
NM_006060chr7104208 3462 3202 3183 3156 2711 901 178 143 136 13231 --13754
NM_006067chr161344 2908 832 --1746
NM_006079chr64813 713 693 192 2798 205 ----
NM_006080chr762878 2671 2217 1900 741 451 ------
NM_006089chrX41270 664 499 85 21410 92 ----
NM_006094chr841729 955 863 842 22410 1738 157 --
NM_006095chr484496 4240 3691 3288 3081 1328 898 198 13134 44456 3910 1254 1007 13418
NM_006100chr3--149 ----
NM_006106chr11103442 3362 2638 780 734 725 714 704 689 147 --2314 241 --
NM_006107chr17155 ------
NM_006108chr1162079 2002 953 936 795 739 1111 21616 567 11795
NM_006113chr121947 1754 12136 1368 --
NM_006133chr11--12375 ----
NM_006135chr161477 1373 1306 575 250 97 --1174 --
NM_006136chr74359 336 284 177 ------
NM_006139chr252821 2565 2491 432 408 ------
NM_006141chr1692505 2490 2368 2205 2175 1984 881 838 101 --1240 --
NM_006143chr12--1116 ----
NM_006145chr194860 827 784 346 1836 ----
NM_006148chr1742670 1853 875 641 --22521 141 --
NM_006154chr1552327 2310 1803 560 316 1525 1656 --
NM_006155chr241951 1537 544 227 22039 174 --1742
NM_006157chr116391 345 334 162 98 88 ------
NM_006161chr5--2659 611 --1243
NM_006162chr1821788 109 ----1666
NM_006166chr1252657 1883 1858 529 228 1235 --2974 347
NM_006178chr1741569 1409 1350 1087 ------
NM_006180chr961935 1818 1582 570 312 197 11699 ----
NM_006183chr121565 ------
NM_006186chr231115 1014 975 ------
NM_006190chr24431 334 298 158 ------
NM_006194chr142841 379 31055 938 405 ----
NM_006195chr911440 31276 965 82 ----
NM_006197chr83322 228 118 12229 ----
NM_006201chrX1479 ------
NM_006202chr1941536 1496 248 192 31579 1480 631 ----
NM_006203chr595423 4903 4755 4301 3834 3630 3499 1136 896 3868 585 560 14355 --
NM_006204chr101214 ------
NM_006206chr492913 2765 2595 2430 2257 1159 775 545 511 ------
NM_006207chr8--1307 ----
NM_006209chr8--2340 62 ----
NM_006211chr82255 234 ------
NM_006212chr175395 5129 4708 3560 1620 1109 866 35050 4670 1438 21241 438 --
NM_006216chr21527 3676 669 97 ----
NM_006224chr1722510 426 2540 29 1360 --
NM_006228chr81401 ------
NM_006235chr1131759 1329 1319 11484 ----
NM_006237chr1342268 1959 1908 54 ------
NM_006238chr612013 1361 --1402
NM_006241chr382408 1971 1948 1622 714 698 688 670 11890 --1254
NM_006243chr121089 52 21029 42 1973 --
NM_006246chr141854 11063 --1510
NM_006251chr5133039 2832 2768 2706 2608 2105 1270 1016 968 509 413 265 193 12406 --22980 28
NM_006252chr1177398 7381 6593 6068 5866 5683 5202 4842 2348 2262 2120 1891 1318 1241 1227 804 73 35609 5261 822 1739 --
NM_006253chr1211226 ------
NM_006255chr1411113 11139 1791 --
NM_006256chr192481 2171 1926 1902 895 852 679 274 102 22302 2102 --11038
NM_006259chr41277 --1833 --
NM_006265chr841478 1464 1215 100 --11194 --
NM_006273chr171433 ------
NM_006275chr2082507 1940 1856 922 733 637 347 232 ----1251
NM_006279chr11330 ------
NM_006281chr82422 94 --11150 --
NM_006281chr82422 94 --11150 --
NM_006282chr2054483 3416 3048 3026 879 44581 4530 3205 1906 21605 965 --
NM_006283chr854132 1955 954 734 383 54124 1925 1918 1731 1203 13042 --
NM_006289chr91360 ------
NM_006290chr611800 --11366 --
NM_006292chr112195 145 ------
NM_006299chr61245 ------
NM_006306chrX84600 4105 4038 3989 1814 1681 1469 103 13633 11783 --
NM_006307chrX1325 1248 ----
NM_006309chr31104 --163 --
NM_006310chr1741290 1202 519 383 ------
NM_006311chr17151 1347 ----
NM_006312chr122759 685 ------
NM_006313chr1241662 402 359 306 ------
NM_006315chr463965 3908 3894 2876 1204 871 23874 2738 12812 1131
NM_006317chr52620 240 ------
NM_006321chr351640 1367 861 383 177 --1835 --
NM_006323chr41640 ------
NM_006324chr16154 ------
NM_006328chr11------1634
NM_006330chr821174 1101 31164 115 97 ----
NM_006334chr91224 187 ----
NM_006350chr5153 ------
NM_006352chr181896 1883 1624 825 361 354 321 301 32042 1481 130 11579 --
NM_006359chrX42319 1002 897 366 --1451 --
NM_006360chr11122 ------
NM_006363chr202598 560 1237 ----
NM_006364chr145914 897 809 427 204 2844 112 ----
NM_006366chr621253 1239 1986 ----
NM_006367chr131003 299 92 ------
NM_006374chr22531 45 ------
NM_006380chr1784244 3992 3613 3362 1624 1346 661 267 21258 292 13665 --
NM_006386chr2252441 1680 1504 699 375 32468 426 227 32292 508 357 --
NM_006390chr1291775 1749 1682 1668 1293 707 633 395 321 ------
NM_006391chr111242 ------
NM_006393chr1084159 3970 3562 3461 1736 1247 1165 426 24489 294 24543 2873 12887
NM_006401chr9--164 ----
NM_006403chr621347 376 31132 92 73 --1263
NM_006407chr341436 1155 931 84 ------
NM_006413chr1031160 315 304 ------
NM_006416chr6------1699
NM_006420chr2083366 3046 2821 2579 657 561 553 485 1330 12833 12787
NM_006421chr841251 932 290 184 1485 ----
NM_006427chr14--1131 ----
NM_006451chr52285 141 1738 ----
NM_006457chr484049 3353 2530 2511 1626 1615 979 834 14034 ----
NM_006459chr1041945 1662 1632 1591 ------
NM_006460chr1731278 451 280 ----11597
NM_006464chr284670 3788 3178 3151 979 865 645 79 14546 14485 --
NM_006471chr18------192
NM_006472chr14915 822 356 45 21298 369 ----
NM_006482chr1273094 2857 2591 1279 1259 217 160 23417 706 12823 1738
NM_006489chr1421702 206 --11645 --
NM_006496chr171722 1710 1609 1585 1569 1417 1326 21403 150 21251 61 11462
NM_006497chr171234 1530 ----
NM_006504chr1052962 2734 1159 442 117 150 ----
NM_006509chr191398 ------
NM_006517chrX32197 1552 74 --12023 --
NM_006519chr61101 --2329 34 --
NM_006520chrX41525 1440 1068 598 21301 302 11580 --
NM_006526chr2072215 2063 1964 1871 1670 1636 265 31651 557 318 --1194
NM_006527chr41138 1189 --1762
NM_006529chr421655 1323 21250 387 ----
NM_006532chr1931806 1755 1737 22032 382 11951 --
NM_006534chr2043107 2726 792 245 32380 1024 969 21136 309 --
NM_006537chr153508 168 125 ------
NM_006538chr293208 1601 1520 741 719 591 277 263 41 24097 2731 --1381
NM_006540chr821293 1179 21387 1213 ----
NM_006544chr14196126 6066 5807 5711 5504 4654 4486 4471 4411 3999 3709 2307 1886 1834 1346 503 375 201 118 33988 2363 760 ----
NM_006546chr1756658 2402 1717 1710 1676 11727 15562 --
NM_006547chr781729 1505 1497 1352 770 761 612 145 12051 --11702
NM_006548chr331635 1520 1147 21362 1156 ----
NM_006554chr24296 223 104 34 ------
NM_006557chr9--11394 --1303
NM_006558chr82519 193 ----1450
NM_006559chr121142 908 ------
NM_006560chr111362 ------
NM_006561chr10136168 5906 5463 4245 3913 3798 2021 1887 1792 1676 1659 968 551 53883 2466 1303 1177 613 1679 --
NM_006565chr162424 87 11166 1431 --
NM_006571chr8251 32 1118 1243 --
NM_006572chr1793204 2736 2401 1170 1020 568 62 42 34 23142 468 22929 966 --
NM_006574chr31312 1292 ----
NM_006575chr1421134 572 1451 11152 --
NM_006577chr241240 1154 1133 312 124 --1858
NM_006587chr431598 1332 403 21434 1133 2251 26 --
NM_006591chr11--11246 21651 1332 --
NM_006595chr1172050 1949 1805 1333 673 495 255 1289 --32069 1999 210
NM_006599chr16218224 8088 7885 7815 6794 6115 5914 5633 5623 5588 3063 2764 2191 2084 2071 1995 1953 1684 1655 1439 422 27609 1970 21727 373 --
NM_006602chr201857 1158 1576 --
NM_006603chrX51881 1289 779 261 160 ------
NM_006606chr2053063 2303 1199 1049 729 32705 1969 25 ----
NM_006609chr262954 2832 2400 2241 891 559 ------
NM_006614chr343550 1088 683 200 33472 3081 2699 ----
NM_006618chr131476 489 189 2262 201 21445 996 --
NM_006620chr674085 1533 1415 724 665 508 361 24356 3644 ----
NM_006621chr13790 736 669 11980 ----
NM_006624chr1031752 454 58 52092 1933 1530 139 103 1159 --
NM_006625chr12743 397 ------
NM_006625chr12743 397 ------
NM_006625chr12743 397 ------
NM_006626chr9102366 2346 2326 2144 1930 1665 1655 1001 697 115 11878 ----
NM_006628chr1594593 4571 4564 4007 3787 3450 1842 402 166 43604 738 721 411 31005 709 654 1851
NM_006633chr52161 68 1732 ----
NM_006636chr22819 384 1780 1747 --
NM_006640chr1711637 11875 11843 --
NM_006644chr133484 119 45 ------
NM_006646chr1333093 2917 1893 1688 22244 447 21983 105
NM_006654chr12104405 4305 4246 3560 3443 3235 3150 974 882 486 24618 4196 11851 13581
NM_006658chr72358 93 ------
NM_006660chr15----145 --
NM_006667chrX11015 238 31 ----
NM_006670chr61601 ------
NM_006681chr4164 ------
NM_006691chr1111028 1290 ----
NM_006693chr72178 164 ------
NM_006698chr203909 465 127 1500 ----
NM_006699chr152421 857 762 82 38 12533 ----
NM_006700chr124522 280 147 139 --1626 --
NM_006704chr133427 324 98 ------
NM_006711chr163745 706 56 ------
NM_006713chr51267 --171 --
NM_006717chr972713 2305 986 807 377 180 140 22642 845 ----
NM_006722chr362837 2481 1143 836 285 161 11114 ----
NM_006726chr441228 919 808 165 1145 ----
NM_006729chrX75082 4413 4249 2238 1890 1832 792 24126 4116 25273 3907 --
NM_006732chr1941910 642 480 186 22074 2067 ----
NM_006734chr631413 353 47 --1133 --
NM_006735chr7160 2346 310 ----
NM_006738chr1584567 3427 3127 1735 1472 1448 1414 881 1619 11288 --
NM_006745chr421119 431 11021 ----
NM_006746chrX21228 94 31184 977 101 ----
NM_006750chr16117633 7611 5333 5324 5305 5098 2642 1974 1264 772 742 22117 1320 25419 2716 15551
NM_006754chr731218 1138 1123 11272 ----
NM_006756chr881536 1458 1430 1407 1331 1104 993 130 2577 50 11110 --
NM_006761chr17----2764 691 --
NM_006763chr122135 846 11732 ----
NM_006766chr832065 183 171 12514 ----
NM_006769chr11563 --1494 --
NM_006772chr611633 --11250 11296
NM_006775chr672982 2940 2668 2500 2450 1103 977 22906 2137 ----
NM_006777chrX72224 2188 1817 817 424 135 28 12743 ----
NM_006788chr1831783 1615 1523 21689 1342 ----
NM_006790chr5166 ------
NM_006791chr15148 1542 1422 --
NM_006800chrX2640 543 ------
NM_006801chr194584 565 247 203 1665 ----
NM_006803chr841582 1547 1438 1385 ------
NM_006805chr541177 322 226 112 ------
NM_006807chr1721351 410 ------
NM_006810chr3153 ------
NM_006813chr65808 724 707 248 228 2274 165 ----
NM_006815chr1291309 1135 997 975 960 951 883 551 426 --1304 --
NM_006820chr183946 3287 2855 2826 2770 1316 108 93 --22746 99 14278
NM_006822chr171535 1610 ----
NM_006823chr821323 973 2497 241 ----
NM_006826chr2--1330 ----
NM_006827chr14113381 3207 3079 3072 2489 2244 1157 1066 842 399 135 32654 1281 222 12974 --
NM_006831chr111419 ------
NM_006832chr141713 ------
NM_006838chr1261846 1649 1571 1267 305 279 ------
NM_006842chr11126 1124 ----
NM_006852chr1772743 2576 1976 1162 1124 776 609 ------
NM_006854chr751312 1287 1256 451 301 --21583 111 --
NM_006856chr123799 731 396 ------
NM_006857chr2--269 62 ----
NM_006868chr1843182 2843 506 262 33044 1987 1952 ----
NM_006870chr201248 ------
NM_006873chr272693 530 327 302 239 190 173 23166 3107 ----
NM_006874chr431062 925 386 --1824 --
NM_006875chrX3714 577 268 ----1780
NM_006884chr341723 1622 1605 1586 1257 ----
NM_006885chr16174060 3850 3432 2968 2888 2859 2684 2625 1495 1488 1469 1332 1241 849 599 580 259 1949 1930 --
NM_006887chr23727 608 242 ------
NM_006888chr1432812 2774 2708 12829 13357 11342
NM_006892chr2031381 1245 428 21321 1216 ----
NM_006892chr2031381 1245 428 21321 1216 ----
NM_006893chr1------184
NM_006895chr261462 1439 735 603 591 420 ----11661
NM_006896chr7----1190 --
NM_006897chr12--1424 ----
NM_006908chr741045 189 162 128 11492 11466 --
NM_006910chr162385 55 ------
NM_006914chr91202 ------
NM_006915chrX62497 2388 2061 1723 373 244 32216 1880 526 176 --
NM_006916chr251016 930 369 345 106 ------
NM_006918chr1165771 5146 4735 3795 1174 864 21426 898 15404 --
NM_006920chr261925 1776 1304 801 692 417 1454 ----
NM_006922chr252052 2039 1854 526 507 21863 436 --21713 1021
NM_006924chr17164418 4232 3965 3726 2790 2712 1680 1672 1630 1393 1386 1373 1351 708 689 93 54256 3598 2827 675 23 ----
NM_006930chr531806 1335 367 --11575 --
NM_006937chr17--1478 ----
NM_006938chr181221 148 2916 907 --
NM_006939chr1421080 758 --1326 --
NM_006940chr1261698 1293 450 439 408 400 ------
NM_006948chr2131920 825 152 22488 2320 11604 --
NM_006951chr104800 765 102 24 1783 ----
NM_006963chr1041201 465 439 26 31278 480 309 1124 --
NM_006979chr61541 ------
NM_006981chr952702 2433 2266 1070 292 ----12255
NM_006988chr2111289 --21225 274 --
NM_006996chr121570 1559 21833 681 ----
NM_006999chr562011 1596 1339 1300 705 446 ------
NM_007005chr961202 567 535 397 295 64 ------
NM_007006chr1663379 3211 1187 894 430 93 33273 2961 230 33115 2273 109 --
NM_007007chr12134844 4704 4620 4110 4089 3703 3566 3302 3103 1718 1638 1063 563 33826 3332 332 1624 1250
NM_007008chr21772 ------
NM_007010chr1731579 1363 1229 --2686 652 --
NM_007011chr15106883 6822 6633 6574 6038 4630 4233 388 334 185 --11148 --
NM_007013chr81894 ----1787
NM_007014chr16--11741 ----
NM_007017chr52687 646 ------
NM_007018chr92382 374 ------
NM_007019chr203175 116 66 ------
NM_007033chr141700 813 676 592 ------
NM_007034chr13745 268 109 ------
NM_007038chr2185408 4951 4675 4654 2117 1855 1358 1057 36042 5445 1090 26094 1529 --
NM_007039chr1442082 1569 860 377 21914 1892 1511 --
NM_007040chr1931074 1059 283 1776 ----
NM_007043chr125807 696 336 172 111 22018 573 --140
NM_007045chr6--1535 ----
NM_007050chr2057975 2429 912 704 680 --2309 60 26074 6025
NM_007052chrX4592 548 138 34 --1383 --
NM_007055chr1031006 523 73 1836 ----
NM_007064chr321399 1364 ------
NM_007067chr1751257 1176 1134 593 558 ------
NM_007078chr1053038 2954 1908 795 754 23022 2846 ----
NM_007084chr1351555 1102 390 366 342 ------
NM_007107chr332397 401 164 ------
NM_007111chr134301 284 241 86 1631 1656 --
NM_007114chr352839 990 672 200 177 33243 882 758 ----
NM_007118chr52828 563 1305 ----
NM_007123chr11259 --1122 --
NM_007124chr641947 1267 738 182 ------
NM_007125chrY31005 471 222 169 ----
NM_007129chr131399 ----1767
NM_007139chr731165 854 795 1434 --11122
NM_007145chr1911009 21232 930 ----
NM_007150chrX32119 530 69 12087 1133 --
NM_007158chr121245 1183 ------
NM_007159chr321450 1201 11681 ----
NM_007166chr1171603 1596 1538 1369 1295 398 242 ------
NM_007172chr2273294 2899 2461 2059 661 376 235 12481 32558 2405 124 --
NM_007173chr1151797 1788 1581 442 72 21910 309 11875 1236
NM_007174chr1222161 1892 ----1277
NM_007175chr823284 3218 42742 2663 602 592 ----
NM_007195chr1873386 3234 3158 3083 2684 2413 1173 43012 1335 1063 812 22803 924 --
NM_007197chr123747 663 191 --1297 --
NM_007200chr1584567 3427 3127 1735 1472 1448 1414 881 1619 11288 --
NM_007203chr963830 3785 2609 1151 1041 223 21536 992 12909 --
NM_007207chr12626 175 195 ----
NM_007212chr151944 1774 1708 1686 176 31556 865 781 ----
NM_007214chr6149 2892 478 ----
NM_007217chr3--1159 ----
NM_007219chr201865 --1116 --
NM_007222chr811605 ------
NM_007225chr17----11010 --
NM_007231chrX32249 1620 920 21788 270 --12138
NM_007235chr12168 1426 ----
NM_007236chr1532401 728 641 11644 ----
NM_007241chr172134 72 1241 ----
NM_007246chr43865 324 167 ------
NM_007249chr13129131 8517 8174 8011 7771 2678 1678 1615 688 666 321 155 49391 7981 2183 1542 17942 --
NM_007259chr12524 458 ------
NM_007269chr12534 169 ------
NM_007270chr721212 295 11477 ----
NM_007276chr72437 376 1162 --1945
NM_007279chr192634 415 ------
NM_007282chr34323 234 147 67 ------
NM_007285chr162202 148 ------
NM_007313chr921937 1906 --11752 --
NM_007324chr1----195 --
NM_007325chrX52046 1691 705 546 224 12184 ----
NM_007331chr44891 853 727 675 12489 12558 11950
NM_007345chr1862073 1479 1460 1451 919 49 22158 1788 31869 1524 206 --
NM_007347chr1583104 2639 2535 2239 824 485 452 300 12197 11987 --
NM_007358chr151990 1731 1245 397 327 ------
NM_007361chr14--1136 1154 --
NM_007363chrX2326 51 --1851 --
NM_007372chr172799 225 --2847 776 --
NM_007373chr1041812 1541 676 354 11463 1511 --
NM_007375chr162830 2804 1024 778 194 144 42449 2286 2166 977 1468 --
NM_012064chr1211084 --1156 --
NM_012073chr541572 1509 1253 1211 ----1199
NM_012081chr572847 2757 2598 1082 885 877 408 --1917 --
NM_012089chr1--21108 241 1299 --
NM_012090chr13989 831 517 31200 453 149 --11168
NM_012092chr21129 11547 ----
NM_012096chr383682 3352 2931 2651 2277 1139 779 400 43766 3519 3088 2813 ----
NM_012097chr232135 710 446 131 11895 --
NM_012102chr132643 2109 1830 22634 884 11936 --
NM_012105chr212752 157 --1661 1699
NM_012110chr41118 1271 ----
NM_012115chr63623 211 104 1570 ----
NM_012118chr4161 ------
NM_012120chr672940 2717 2638 2365 1995 1926 172 ------
NM_012124chr111162 1347 2183 84 --
NM_012129chr792306 2262 2250 1917 915 743 199 99 71 11644 21949 540 --
NM_012130chr21--2231 109 ----
NM_012141chr1373776 3393 3043 2725 2637 717 381 31094 422 187 1498 --
NM_012153chr1141742 894 777 179 1371 --11729
NM_012156chr2033215 3155 2900 12648 ----
NM_012157chr31622 ------
NM_012158chr1341502 1143 451 93 11754 1716 --
NM_012161chr451076 875 434 193 99 ------
NM_012164chr9127247 6384 5666 5459 4698 2219 1572 1370 900 660 403 144 47029 6976 2973 2147 15700 16438
NM_012175chr113793 693 186 1887 ----
NM_012176chr51236 1102 ----
NM_012180chr41207 2222 188 1142 --
NM_012183chr11432 ------
NM_012193chr11105457 5027 4754 4466 4260 3905 1967 1883 1023 181 25435 776 ----
NM_012197chr911276 21358 1332 21605 48 --
NM_012198chr22778 200 1615 145 --
NM_012199chr143672 2916 1697 1599 1918 --1818
NM_012207chr1011099 1931 --179
NM_012214chr2105896 5411 5273 2549 2410 1052 514 497 482 351 24996 2540 25828 2054 --
NM_012215chr1051767 1708 1608 1321 231 31346 716 546 ----
NM_012218chr191250 21114 260 1359 --
NM_012223chr23960 429 61 21229 990 ----
NM_012224chr431047 773 194 ------
NM_012233chr231192 939 789 ----1946
NM_012234chr363561 3473 3410 2459 1033 327 ------
NM_012238chr1041716 1320 482 318 11679 --1691
NM_012242chr101549 1307 ----
NM_012243chr11271 1340 ----
NM_012244chr1451854 1834 1740 1716 1702 11681 1110 --
NM_012247chr104980 967 945 29 3876 708 641 1897 --
NM_012249chr233499 2974 2726 23382 2512 ----
NM_012250chr1141239 856 420 357 --1526 --
NM_012257chr71799 11041 1919 --
NM_012259chr661463 1249 1180 1137 227 185 11398 ----
NM_012262chr155258 4848 4367 466 334 34123 3793 1024 14684 14520
NM_012266chr9--21130 1120 1908 --
NM_012272chr122445 439 ------
NM_012281chr782364 2354 2219 2198 2156 2061 920 786 ------
NM_012286chrX251 27 1530 ----
NM_012287chr3114248 4166 4004 3611 3515 3434 1542 1046 926 492 454 23898 3356 23632 313 --
NM_012289chr191467 158 ----
NM_012290chr221516 296 ------
NM_012295chr221403 ------
NM_012297chr492418 2407 2344 1925 1791 865 335 101 74 1938 ----
NM_012300chr562224 2042 1844 951 575 483 12053 12444 --
NM_012302chr1--1364 ----
NM_012304chr512418 --21673 948 --
NM_012307chr181758 ------
NM_012308chr1152196 2169 2050 1783 1754 --1816 --
NM_012309chr1154547 3227 3182 1593 1534 1328 43746 3308 1806 1128 14150
NM_012316chr11211 --35276 4074 3671 1575
NM_012322chr74454 323 285 31 1149 ----
NM_012323chr22--11586 ----
NM_012325chr201464 --41568 1550 1193 76 --
NM_012327chr1831568 1129 459 1190 11052 --
NM_012328chr761466 1277 1190 1162 237 154 1372 1911 --
NM_012329chr171120 31423 564 496 ----
NM_012330chr1061782 1583 588 537 431 206 1488 ----
NM_012333chr131499 1327 1223 141 --1446
NM_012338chr741211 1202 934 57 ------
NM_012339chr10--2572 555 ----
NM_012347chr653020 2931 2837 2389 1130 1453 --21945 32
NM_012382chr594380 4362 4344 1710 1638 1542 936 473 37 --33464 1386 356 14214
NM_012383chr9----144 --
NM_012388chr1593083 2370 2043 2032 817 526 489 210 180 13008 12447 --
NM_012394chr1199 ------
NM_012399chr2231777 1718 580 1768 --11431
NM_012411chr1--1136 ----
NM_012414chr11714 ----1119
NM_012420chr1021608 512 --11570 --
NM_012421chr11440 ------
NM_012426chr16144 1363 --1317
NM_012428chr152974 865 --1802 2734 384
NM_012430chr32667 537 ------
NM_012434chr631553 1198 1162 11178 ----
NM_012446chr51452 1517 1154 --
NM_012448chr1752122 1553 1013 524 90 1971 ----
NM_012449chr7124 ------
NM_012454chr62386 111 1458 ----
NM_012463chr1241826 1435 507 205 61149 1139 673 665 299 170 ----
NM_012464chr452561 2419 1131 751 344 12190 22534 270 --
NM_012475chr12253 85 ------
NM_012479chr762597 2460 2372 778 703 160 --11840 --
NM_012482chr13615 145 45 ------
NM_013227chr153823 347 97 ------
NM_013229chr12112791 2628 2308 2112 1900 1760 1726 581 434 406 41 52834 2685 2634 741 466 ----
NM_013230chrY11394 --21692 1530 --
NM_013231chr1463991 3680 3570 1596 1408 912 23938 212 ----
NM_013243chr152506 89 1212 11472 --
NM_013254chr122472 167 ------
NM_013255chr7148869 7818 7062 7040 5719 5645 5548 2168 2088 2054 1900 1534 1179 55 18388 11814 --
NM_013257chr832235 918 281 22298 1984 1407 --
NM_013261chr473265 3037 2779 2748 2735 2424 1142 --1791 12964
NM_013262chr641327 1091 1009 994 2433 400 --1477
NM_013264chr112195 161 ------
NM_013282chr1961279 1101 1079 444 72 30 21087 1027 ----
NM_013283chr52351 212 185 1860 --
NM_013286chr331427 974 271 13799 ----
NM_013293chr72580 274 --1140 --
NM_013302chr16124012 3834 3644 3302 1876 740 655 628 591 282 267 142 34328 1051 459 ----
NM_013309chr15--11720 --22665 2181
NM_013316chr73818 688 198 ------
NM_013322chr72512 474 11435 ----
NM_013336chr32170 108 11330 1282 --
NM_013341chr242583 852 742 350 22533 2076 11184 --
NM_013351chr172663 265 --1718 --
NM_013354chr811132 2976 428 --11462
NM_013357chr8194 ------
NM_013368chr192604 84 ------
NM_013372chr1542639 1213 589 334 1235 ----
NM_013374chr352738 2730 1236 688 502 2555 430 ----
NM_013377chr122186 101 1128 ----
NM_013380chr191167 ------
NM_013381chr1252279 2054 2010 149 60 1933 ----
NM_013386chr151739 1604 1518 309 151 ------
NM_013392chr21441 ------
NM_013396chr2131209 1174 499 21427 1078 1262 11551
NM_013423chrX11126 --1508 --
NM_013427chrX11126 --1508 --
NM_013433chr1921834 576 11847 ----
NM_013436chr24764 272 98 36 ------
NM_013437chr81970 161 1390 --
NM_013438chr93464 278 39 1427 ----
NM_013444chrX31119 370 41 1749 ----
NM_013445chr21129 ------
NM_013446chr741283 1072 1060 1047 21415 231 --11429
NM_013448chr142256 186 2572 248 ----
NM_013449chr1262610 2511 2493 1849 1156 123 --12369 --
NM_013450chr21933 11160 ----
NM_013943chr182637 1271 1194 1014 792 588 443 342 32586 453 98 32697 2516 621 --
NM_013993chr61758 ------
NM_013994chr61758 ------
NM_013995chrX61733 1633 594 468 423 336 12344 1415 12420
NM_013996chr71442 ------
NM_013996chr71442 ------
NM_013997chr71442 ------
NM_013997chr71442 ------
NM_013998chr71442 ------
NM_013998chr71442 ------
NM_014000chr1011389 --11955 --
NM_014011chr242467 2454 825 229 1958 ----
NM_014016chr3--1379 ----
NM_014021chr183299 2980 2962 2707 2451 2216 730 340 42800 2377 762 493 ----
NM_014023chr1052876 2453 2068 462 87 --1193 --
NM_014033chr1262110 440 161 141 112 96 22298 606 ----
NM_014034chr621368 460 ------
NM_014038chr72152 46 ------
NM_014043chr341634 1458 1070 24 193 21616 162 2422 258
NM_014048chr16105301 4817 3391 3234 1972 1554 612 603 584 553 25295 5169 --15239
NM_014051chr6--169 ----
NM_014058chr44679 297 46 39 ------
NM_014059chr13--1364 ----
NM_014089chr1352021 1894 1880 416 307 42142 1955 1806 1690 1836 --
NM_014106chr1562812 2550 2275 2218 584 457 42899 2116 739 504 ----
NM_014109chr881238 1179 1021 946 881 422 326 55 ------
NM_014110chr1----11080 --
NM_014112chr8105397 4800 4382 2067 2056 1382 1013 736 678 152 22201 1991 44035 1686 714 138 --
NM_014117chr1662003 1993 1692 849 393 362 1455 11673 --
NM_014141chr775101 4557 3822 3812 3313 986 296 14002 24257 437 --
NM_014142chr10--129 ----
NM_014154chr341448 1101 389 174 1212 ----
NM_014155chr11177543 7366 7157 7039 7010 6792 6516 5326 4730 4696 2566 2026 1201 733 303 297 278 37171 1429 717 ----
NM_014160chr321416 1068 1905 ----
NM_014170chr3----1327 --
NM_014178chr143565 236 126 ----1588
NM_014181chr252588 740 599 462 455 1487 ----
NM_014184chr11133 ------
NM_014189chr411318 ----11413
NM_014190chr421670 1145 ----11765
NM_014211chr521341 463 ------
NM_014212chr122973 21 1813 ----
NM_014217chr131614 1227 250 1423 ----
NM_014223chr12187 43 ------
NM_014225chr191362 ------
NM_014231chr12--1570 ----
NM_014239chr141342 ------
NM_014240chr353272 2647 973 918 779 23571 3432 21350 1114 --
NM_014241chr101286 --1273 --
NM_014243chr431618 675 320 --1175 11780
NM_014245chr32715 164 2874 360 ----
NM_014246chr2252227 2194 2149 1996 1752 ------
NM_014249chr151526 ------
NM_014250chr2222052 1898 12120 ----
NM_014253chrX22239 889 12269 ----
NM_014263chr1051380 1213 525 484 253 ------
NM_014264chr43605 542 45 3648 492 463 ----
NM_014267chr113755 640 296 1189 ----
NM_014271chrX3299 213 151 ------
NM_014278chr41121 --1108 --
NM_014279chr91728 ------
NM_014280chr11123 1292 --1164
NM_014283chr151310 1167 1071 452 35 --1374 --
NM_014286chr963627 2559 859 627 604 546 --23647 334 --
NM_014290chr91160 ------
NM_014294chr861418 1053 472 262 251 113 1483 ----
NM_014296chr31217 41000 522 426 256 ----
NM_014305chr132698 103 1507 ----
NM_014309chr2284534 3867 3785 2168 2078 1592 780 666 15329 43563 2180 2174 206 --
NM_014313chr12521 236 11461 --178
NM_014315chr141151 ------
NM_014317chr10158 ------
NM_014319chr1241381 295 208 63 3390 243 88 11508 1767
NM_014325chr1252152 1806 790 456 235 1556 11932 --
NM_014329chr162343 304 ------
NM_014331chr486287 4969 2923 2410 2005 1887 1863 1321 37798 2489 371 --27673 5556
NM_014333chr1142571 2244 1927 307 22749 1772 1468 --
NM_014335chr1561217 1071 483 435 85 63 1335 ----
NM_014342chr114916 303 219 147 2945 369 ----
NM_014344chr111784 ------
NM_014345chr65998 784 766 257 246 ------
NM_014350chr521018 449 11134 ----
NM_014352chr1131410 1071 935 11228 ----
NM_014361chr11--1190 126 --
NM_014368chr932094 1804 1373 12075 1463 --
NM_014372chr1----159 --
NM_014376chr512290 12410 ----
NM_014382chr351702 1190 1153 634 594 31640 549 535 1218 --
NM_014393chr841600 1566 808 182 1439 1204 --
NM_014395chr441970 1951 1387 298 11357 ----
NM_014397chr911173 11180 ----
NM_014410chr181389 ----1361
NM_014415chr31147 1364 --1231
NM_014417chr19--2943 930 ----
NM_014423chr555445 2268 865 455 142 45187 5144 4999 1885 21338 1085 11168
NM_014431chr10--21682 1436 --11381
NM_014432chr6----126 --
NM_014445chr341588 526 439 352 1648 ----
NM_014447chr461331 1251 1119 1086 324 226 21663 469 --1241
NM_014452chr62305 81 ------
NM_014455chr1----1434 --
NM_014456chr1031820 1744 183 2344 296 --1258
NM_014458chr12226 202 11219 ----
NM_014461chr3133 ------
NM_014476chr41221 3483 364 211 ----
NM_014488chr111625 --1269 --
NM_014489chr111888 ------
NM_014494chr1672375 1671 1642 774 763 718 365 --1902 --
NM_014497chr2163 ------
NM_014498chr3--1302 --1131
NM_014500chrX----1231 --
NM_014502chr111317 1398 ----
NM_014506chr941629 138 118 96 11072 1622 --
NM_014507chr221905 ------
NM_014515chr122702 259 2672 382 ----
NM_014516chr191222 ------
NM_014522chrX1202 ------
NM_014547chr151739 ------
NM_014547chr151739 ------
NM_014552chr211491 11265 11023 11469
NM_014554chr1221723 1626 22165 190 11645 1170
NM_014570chr224999 830 152 106 195 ----
NM_014572chr1381443 1179 567 500 275 238 170 97 1577 ----
NM_014573chr1771823 1802 1450 1356 376 353 345 ------
NM_014574chr1471554 1413 1313 982 499 358 193 11404 ----
NM_014577chr221285 2821 304 1742 --
NM_014583chr33514 484 384 ------
NM_014585chr22896 95 2416 61 ----
NM_014587chr163625 609 217 11381 --11552
NM_014602chr31346 1289 ----
NM_014606chr441425 1412 233 175 ------
NM_014607chr271645 1411 851 569 552 540 323 11965 ----
NM_014608chr152450 182 --1381 --
NM_014612chr941436 1271 980 92 1414 1532 --
NM_014613chr552530 2381 2338 2078 734 1536 ----
NM_014614chr231191 1083 230 ------
NM_014615chr1662832 2628 1413 936 915 888 23425 819 1417 --
NM_014616chr321365 745 ----1832
NM_014618chr91408 ------
NM_014620chr121721 ----1534
NM_014634chr2223357 1027 1867 1678 12796
NM_014635chr221592 609 11661 181 --
NM_014636chr954268 4254 2754 2729 1705 31666 1300 453 12950 --
NM_014637chr83944 374 169 11433 1175 --
NM_014644chr13981 713 287 --185 --
NM_014646chr1873045 3038 2651 2631 2006 1255 1002 ------
NM_014647chr1632259 1440 348 --12237 --
NM_014653chr1211765 21560 1407 ----
NM_014660chr71268 1279 1165 --
NM_014662chr223439 163 133 ------
NM_014663chr121064 966 ----1393
NM_014666chr541115 976 879 495 ------
NM_014667chr351958 1924 1850 916 617 22443 162 ----
NM_014669chr162127 101 ------
NM_014674chr394039 3713 3342 2948 1302 1000 826 428 404 43936 3761 2716 840 --12500
NM_014676chr151448 1318 1148 648 297 41636 1564 1442 428 --11419
NM_014677chr8--11224 --11292
NM_014682chr832089 1885 1437 32138 560 273 --12205
NM_014683chr1732154 830 820 1631 ----
NM_014685chr16----1133 --
NM_014686chr191402 22548 1967 21918 1875 --
NM_014689chr22142 115 1168 ----
NM_014690chr722673 2194 12021 ----
NM_014699chr16--1355 1318 --
NM_014701chr1573338 3193 2752 2431 2153 2092 1347 52826 980 231 130 81 ----
NM_014702chr642578 2416 2407 836 22857 462 ----
NM_014705chr751753 1330 758 621 546 21738 1454 21766 582 1262
NM_014707chr762231 1798 1569 1514 664 379 21812 389 --11972
NM_014711chr1682095 2018 1990 1940 1811 1801 804 386 1278 ----
NM_014713chr26343 210 181 173 151 42 --1115 --
NM_014720chr1071402 728 671 580 432 140 131 ------
NM_014721chr6106089 5522 4803 2740 2182 1883 1829 873 718 469 12501 46831 6656 6329 2717 14714
NM_014723chr20----13215 --
NM_014729chr82740 258 3730 706 463 11532 --
NM_014733chr551900 682 574 554 108 1775 ----
NM_014735chrX102070 2020 1626 1542 1532 1499 862 812 383 147 --11569 --
NM_014739chr694046 3908 2693 2677 1362 483 256 133 65 11120 11196 --
NM_014742chr2031779 1124 221 --11615 --
NM_014743chr473081 2711 2678 2357 2172 1078 987 1294 --12443
NM_014746chr264216 4197 3125 2853 1109 660 34277 3750 3282 23145 771 14417
NM_014751chr832106 248 124 31992 1785 99 --1409
NM_014752chr1161666 1399 553 462 260 121 ----1289
NM_014753chr102303 272 ------
NM_014755chr284085 3985 1111 1079 1008 441 200 141 1560 24099 997 24272 2771
NM_014757chr532395 562 545 11525 12086 --
NM_014759chr811112 ------
NM_014761chr162954 854 --11096 --
NM_014764chr1221102 943 ------
NM_014765chr132332 400 250 22651 877 22503 1039 --
NM_014767chr1012597 --1323 --
NM_014774chr152972 2260 2124 2118 288 --12603 --
NM_014779chr32950 933 ------
NM_014781chr82217 210 --1390 --
NM_014783chr1531141 597 580 1404 ----
NM_014786chr1121188 1167 ------
NM_014787chr152809 2801 2178 822 535 12185 1848 --
NM_014791chr9--1232 ----
NM_014795chr251397 1226 1184 897 883 3943 923 207 ----
NM_014802chr1251136 761 176 142 58 ------
NM_014803chr1052549 2453 2004 974 585 22639 1802 ----
NM_014807chr11--1644 ----
NM_014810chr143017 985 525 380 23570 3060 1252 --
NM_014811chr91229 3254 197 187 ----
NM_014812chr131974 1947 146 21917 698 1241 --
NM_014813chr11571 2549 50 ----
NM_014819chr562135 1922 1654 859 519 463 ------
NM_014820chr321768 465 11278 21484 1428 12058
NM_014822chr41579 ------
NM_014824chr1131831 1450 187 --31810 1601 420 1795
NM_014826chr194203 4127 3492 3244 3184 1557 1167 813 345 14104 12978 14282
NM_014827chr161606 1532 1222 1203 226 196 --11585 11565
NM_014828chr1442207 926 913 65 ------
NM_014829chr542260 2221 511 417 1606 ----
NM_014830chr1293381 2793 2687 2407 1509 1485 593 250 98 43829 3820 2755 1517 --11544
NM_014835chr2022192 625 11615 12240 --
NM_014836chr1041459 371 284 248 --2496 139 --
NM_014838chr2222293 1158 --1431 --
NM_014839chr152497 904 865 842 643 2423 261 11867 12190
NM_014841chr65998 557 381 354 285 1952 ----
NM_014844chr1414033 14151 1314 11683
NM_014847chr11475 1494 ----
NM_014848chr1522699 656 1473 12708 12381
NM_014850chr344679 3589 3429 1871 --13294 --
NM_014853chr1721480 1454 ------
NM_014860chr271897 1804 600 558 549 454 24 160 1671 1173
NM_014864chr174269 3324 1664 1190 1034 993 388 13088 23648 863 --
NM_014868chr123610 269 38 --2849 68 --
NM_014871chr121598 ------
NM_014872chr962383 2004 1499 851 629 55 1331 ----
NM_014873chr184194 4004 3906 3738 3443 1651 1510 734 44740 1371 719 687 ----
NM_014874chr121629 1619 ------
NM_014876chr2262251 2207 2182 584 572 180 1739 ----
NM_014877chr17126505 6238 5904 5053 1949 1467 1032 704 665 533 453 190 47223 6073 650 184 27730 5668 --
NM_014883chr432002 1845 875 1210 ----
NM_014888chr751602 1442 1433 1087 131 ------
NM_014892chr61631 1497 192 133
NM_014893chrY52212 1671 1482 866 100 ----11831
NM_014897chr1782767 2638 2476 2443 2092 2056 838 449 22632 586 ----
NM_014899chr532432 761 595 33163 3086 237 12198 12061
NM_014902chr2021117 162 ------
NM_014903chr1241636 1567 969 356 32429 2311 2244 1370 --
NM_014904chr1083362 3022 2962 2931 2612 2533 1551 903 13949 ----
NM_014906chr1794112 4033 3824 3502 2957 1240 915 723 499 12660 ----
NM_014912chr1073440 3394 3182 2913 2428 2332 627 23320 2739 42733 779 691 348 12189
NM_014914chr211295 11146 11008 --
NM_014917chr12847 827 1750 --1699
NM_014918chr15101597 1284 1124 1061 593 578 568 410 275 76 163 1403 --
NM_014920chr683262 3176 2698 1428 938 911 768 572 2262 203 22614 635 --
NM_014923chr1382197 1908 1489 796 211 203 127 42 ------
NM_014924chr1462962 2832 2754 2566 538 124 42989 2690 2032 488 12628 --
NM_014925chr125976 939 692 619 272 ------
NM_014926chr321167 931 --1248 --
NM_014932chr341915 1807 255 30 ------
NM_014936chr672712 2369 1917 1758 315 285 156 31082 898 438 ----
NM_014937chr101293 --11287 --
NM_014939chr182139 43 ------
NM_014942chr662637 2333 2102 881 847 550 151 ----
NM_014945chr522002 1868 --11981 --
NM_014946chr222963 193 22945 2700 11138 13054
NM_014947chr173027 3004 2937 2755 926 325 128 32612 1083 260 ----
NM_014949chr11872 2969 889 ----
NM_014950chr1421558 1432 ------
NM_014952chr1532039 1961 1842 11947 ----
NM_014953chr1323627 322 ----24112 3322
NM_014959chr1952727 2596 2330 1416 847 53510 3135 2572 827 490 ----
NM_014961chr42613 598 --31888 1623 507 --
NM_014962chr2062697 1117 888 457 344 303 22446 1006 --12431
NM_014964chr173665 613 445 ----12138
NM_014969chr11951 --1449 --
NM_014974chr1041801 1245 1226 328 --11787 --
NM_014977chr14----1504 --
NM_014978chr1041667 1553 1493 47 21857 1539 1102 --
NM_014982chr14145447 5372 4643 4341 4036 3797 3464 2035 1957 1501 1379 1121 452 387 1241 21806 1626 --
NM_014988chr422552 352 1204 ----
NM_014989chr65518 475 432 415 114 31612 1442 822 31597 1383 423 --
NM_014991chr482997 2973 2855 2829 2719 2430 2406 1188 12792 12151 --
NM_014992chr141737 1651 ----
NM_014999chr1281195 1157 1148 1102 247 237 227 216 1404 ----
NM_015000chr1273131 2945 2537 2109 1933 1024 213 --13022 --
NM_015001chr13981 313 276 --1381 --
NM_015008chr3103201 2659 2344 1310 1203 1071 866 578 473 197 --22696 2639 --
NM_015009chr3--186 1767 --
NM_015015chr1922030 523 ------
NM_015017chr131130 870 236 2819 392 ----
NM_015018chr6--192 ----
NM_015020chr1693836 3827 3778 2999 1089 1035 908 107 88 12582 13572 --
NM_015023chr131855 1802 124 ------
NM_015025chr282681 2611 590 557 507 464 181 54 42575 2524 646 200 ----
NM_015026chr1264725 3319 2968 1145 1039 950 43995 2927 1062 389 ----
NM_015027chr1621347 351 11809 ----
NM_015032chr1372933 2315 2262 2209 2032 1091 61 22164 1066 12803 --
NM_015035chr2056708 6312 4608 1730 1301 36623 1854 1841 ----
NM_015039chr164329 4210 4198 3312 2865 1546 13920 1485 --
NM_015040chr2123388 3208 3105 3088 2635 2169 862 715 631 603 425 187 13185 12867 12729
NM_015042chr1543525 3391 1467 1206 ------
NM_015045chr1071874 1739 1442 663 540 530 488 12248 1481 --
NM_015046chr952622 2508 2447 2212 2014 192 ----
NM_015047chr13340 309 158 --1377 --
NM_015049chr253293 2575 2471 2446 2437 2961 665 ----
NM_015050chr61504 --1995 --
NM_015051chr932299 2152 537 ------
NM_015055chr1152894 2795 2782 1820 866 11897 --22673 2251
NM_015056chr2121049 241 32420 2378 94 1195 22563 37
NM_015059chr1542805 2640 654 626 --1327 --
NM_015061chr94644 593 574 89 ------
NM_015064chr12130 13229 ----
NM_015071chr5126533 6129 6034 4770 4698 4302 2217 2076 1674 812 798 300 --26411 439 --
NM_015072chr142389 104 ------
NM_015073chr1931900 1893 1372 ------
NM_015074chr144719 3612 939 575 14821 14901 1362
NM_015075chrX11489 ----11999
NM_015076chr654457 3726 3106 2750 1178 33889 2906 1649 23538 1241 --
NM_015087chr1352512 2382 2328 1080 54 32616 441 255 --2653 577
NM_015090chr176211 6041 5027 4166 1575 677 421 36055 5606 482 --16242
NM_015091chr143678 548 257 1751 ----
NM_015092chr16104609 4545 4303 4210 3874 3359 3138 3059 2937 970 23555 1315 23110 949 --
NM_015093chr631819 1176 95 21628 1368 1726 --
NM_015094chr2244457 4424 629 622 13355 11158 --
NM_015097chr341542 442 393 125 31740 818 142 ----
NM_015100chr172032 2025 1729 1585 400 356 252 1780 ----
NM_015107chrX32383 2062 1990 1712 11810 --
NM_015110chr952398 1913 1889 108 36 ------
NM_015115chr4112826 2717 1259 1184 1010 974 889 768 369 346 46 1276 --1797
NM_015120chr2--1264 172 --
NM_015124chr22----22390 2055 1110
NM_015129chrX71746 1738 1138 539 294 234 146 ------
NM_015132chr761905 1348 730 698 578 33 2446 223 ----
NM_015134chr171638 1542 ----
NM_015137chr882621 2306 2049 2038 1744 787 479 401 12265 --11841
NM_015138chr1552800 2141 1052 1027 508 --22807 277 --
NM_015143chr421011 101 ------
NM_015144chr1653925 3795 2497 446 257 23866 1412 23809 1283 11094
NM_015153chr64752 670 620 504 ------
NM_015155chr1033245 1126 587 12107 13311 11331
NM_015156chr1493786 3220 3007 2610 1583 1561 1252 863 502 --31431 1315 460 --
NM_015158chr9--1259 --1618
NM_015163chr141281 --11670 --
NM_015170chr852118 1990 1870 1654 596 ------
NM_015172chr141452 1271 419 282 ------
NM_015176chr131201 499 449 ------
NM_015178chr81458 12725 ----
NM_015186chr91468 151 ----
NM_015187chr4--1126 1270 --
NM_015192chr2052971 2657 2465 898 236 22951 2330 --22003 1985
NM_015197chr1413390 ------
NM_015199chr361901 1010 835 585 577 480 1263 1981 12536
NM_015200chr421005 520 42470 2427 2165 2105 11011 --
NM_015206chr1543389 3342 3064 1425 --1552 --
NM_015208chr1873432 2914 2887 1439 625 484 74 13764 ----
NM_015209chr13528 352 329 12170 11704 --
NM_015213chr112541 142 1793 ----
NM_015215chr162252 1135 981 810 616 565 23053 3038 ----
NM_015225chr962375 2007 1093 532 382 197 22119 1182 ----
NM_015231chr111909 193 --1233
NM_015234chr611356 11191 --1155
NM_015235chr105709 537 459 409 135 11591 ----
NM_015236chr41473 21442 1033 ----
NM_015238chr51275 1475 ----
NM_015245chr622732 2619 --22581 1856 12123
NM_015247chr16105338 5204 3854 3845 1425 1358 1175 1066 662 293 43295 1998 1451 194 23353 161 1404
NM_015250chr931523 351 120 ------
NM_015251chr1642345 2277 1823 216 12077 --1144
NM_015252chr25907 780 346 210 100 ------
NM_015256chr51626 ------
NM_015263chr1511217 ------
NM_015264chr2263927 3722 3681 3558 3339 1160 14903 34251 4049 650 11316
NM_015265chr2152679 2514 2202 1701 1011 693 625 606 565 158 142 122 110 88 73 ------
NM_015267chr1232034 457 141 1691 ----
NM_015268chr31467 ------
NM_015269chr12648 605 ------
NM_015270chr1211763 2431 419 ----
NM_015271chr4114000 3844 3671 3585 2697 2643 1615 1323 761 642 491 34025 3364 289 13877 1360
NM_015272chr1631906 1787 648 2154 74 ----
NM_015275chr1221372 217 12093 157 --
NM_015277chr1861300 1242 744 668 562 507 2686 461 --278 57
NM_015278chr642417 1269 898 788 1750 ----
NM_015282chr263052 3002 2907 2897 2890 578 --11871 --
NM_015286chr1572464 1913 1886 1851 744 391 214 22343 290 ----
NM_015288chr523570 981 13670 ----
NM_015291chr153465 3458 3391 3200 2375 33477 3385 1128 12610 11089
NM_015292chr121700 1762 ----
NM_015294chr1721152 51 --11130 --
NM_015308chr11143 2181 27 1156 --
NM_015310chr8148296 8029 5975 5873 5755 3263 3100 3086 2357 1800 744 703 279 142 35795 1938 200 45634 3142 2419 184 16124
NM_015313chr1153362 2930 1504 1493 399 11156 13452 --
NM_015314chr762306 1954 1040 625 451 264 12480 ----
NM_015315chr543055 2902 2444 880 ------
NM_015316chr1421107 223 ------
NM_015317chr262710 1801 996 883 832 54 21819 304 12275 --
NM_015319chr121460 ------
NM_015321chr1911106 --14894 --
NM_015323chr621398 570 31670 1644 184 11610 --
NM_015326chr121898 1027 ------
NM_015328chr722609 2456 ------
NM_015329chr1932934 2750 2091 11833 ----
NM_015331chr11606 1636 ----
NM_015335chr1262077 1735 811 633 620 597 12461 12434 1333
NM_015336chr1282589 2472 1846 1797 712 586 274 266 32679 2302 1975 --12202
NM_015339chr201994 ------
NM_015342chr5--1122 ----
NM_015344chr882173 1503 815 734 629 299 241 197 11901 ----
NM_015347chr12------32802 2736 1907
NM_015349chr682983 2380 982 964 510 498 300 287 32945 2921 923 ----
NM_015350chr11512 ------
NM_015352chr2083929 1440 1296 1126 1000 756 485 401 ------
NM_015355chr1771564 1462 1298 778 769 527 77 22009 330 ----
NM_015358chr2151253 1105 974 75 42 11129 --1519
NM_015361chr23764 275 130 1376 ----
NM_015365chrX114057 3882 3785 3552 2628 2611 1275 547 484 340 281 23532 229 --23861 3839
NM_015367chr2221635 589 ------
NM_015375chr194586 4141 3902 3620 3374 1578 1345 391 55 --24704 1140 --
NM_015378chr121860 290 ------
NM_015381chr2242038 1945 1343 827 ------
NM_015384chr5------1123
NM_015387chr241521 1310 503 441 1120 --11998
NM_015393chr473634 2649 2626 1277 334 131 114 13558 ----
NM_015396chr34430 286 210 174 1122 --11234
NM_015397chr941931 187 181 63 11845 ----
NM_015412chr342195 1922 1166 197 --1979 --
NM_015416chr12----2889 333 --
NM_015429chr32228 86 11109 ----
NM_015435chr831436 1292 246 1595 21111 1105 --
NM_015436chr483387 2844 2807 2153 2134 1051 626 249 1112 23252 1319 --
NM_015443chr1731104 604 166 21368 1115 ----
NM_015446chr14553 527 478 287 ------
NM_015447chr9------2245 143
NM_015455chr5104109 3398 2696 1444 1255 1226 911 635 354 91 1494 22525 1577 34037 1060 648
NM_015460chr331948 1612 1451 ------
NM_015461chr18135 --1168 --
NM_015475chr24911 435 304 23 21029 873 ----
NM_015477chr15--31018 789 692 1967 --
NM_015492chr1511050 ------
NM_015496chr8--2265 214 ----
NM_015497chr1531125 1109 821 1777 ----
NM_015511chr2031088 854 437 --11119 --
NM_015513chr3198 --1669 --
NM_015514chr143598 488 142 1623 ----
NM_015517chr112530 195 ------
NM_015520chr331945 970 926 12102 ----
NM_015523chr11----1257 --
NM_015530chr21992 1628 ----
NM_015532chr15132850 2841 2604 2282 2042 1985 1767 916 672 661 638 607 426 22194 226 12488 --
NM_015534chr121010 389 11035 --1894
NM_015535chr294208 4089 3668 3652 3305 3041 2697 2647 894 13825 --1415
NM_015541chr341253 1076 888 431 ------
NM_015542chr103954 926 858 11122 1932 1221
NM_015548chr62727 170 1712 1670 --
NM_015550chr753534 3259 2494 838 465 11181 11171 --
NM_015554chr1562878 2425 2267 854 780 106 32860 832 800 ----
NM_015555chr62164 123 1158 11570 --
NM_015556chr14------1179
NM_015560chr352869 2736 2626 1167 213 12576 165 --
NM_015564chr552850 2707 2570 767 132 --12844 --
NM_015565chr2152252 2116 2037 1388 656 ----12299
NM_015567chr13--1309 2450 373 130
NM_015569chr194771 4605 4574 4172 3630 2991 1331 685 638 23959 954 14624 --
NM_015570chr751731 1597 1281 253 232 21492 166 ----
NM_015571chr651950 1703 938 905 689 21781 1755 2882 239 --
NM_015575chr2113303 3227 3029 2580 2454 2437 1027 929 842 377 176 33668 3317 2414 1948 --
NM_015576chr362667 2540 2128 363 299 31 12526 ----
NM_015577chr531846 1796 416 11688 11602 --
NM_015578chr1981800 804 797 540 471 178 133 126 11499 11287 11474
NM_015589chr141142 ------
NM_015601chr101209 1403 ----
NM_015602chr131642 531 86 --1525 --
NM_015607chr12214 168 --1195 --
NM_015609chr142294 2274 997 488 ------
NM_015610chr751776 744 554 245 224 --21954 612 --
NM_015626chr1721225 1032 --21152 286 --
NM_015630chr21356 2373 159 --1256
NM_015635chr921943 1518 21673 98 ----
NM_015640chr175383 5327 4784 4638 1574 1091 556 1204 24833 4676 2278 59
NM_015641chr75961 484 259 137 125 31090 1025 802 ----
NM_015642chr31121 ------
NM_015646chr1221299 905 11215 ----
NM_015675chr191553 ------
NM_015678chr132650 308 ----1468
NM_015686chrX12479 --1422 --
NM_015691chrX52891 2749 2004 467 414 1118 --12390
NM_015695chr6--11566 ----
NM_015711chr19--1768 ----
NM_015713chr863574 3517 3428 2640 1353 869 33561 3279 2853 1198 --
NM_015726chr151568 441 288 264 109 1616 11555 --
NM_015836chr121539 1395 11307 132 11547
NM_015845chr181476 --1683 --
NM_015850chr872085 1988 1862 1854 1630 814 372 11678 1824 --
NM_015866chr161259 1189 1049 947 533 316 ------
NM_015874chr42583 259 --1508 --
NM_015878chr852079 1587 682 554 107 ------
NM_015879chr1858645 2950 2500 2259 396 11873 12797 22755 140
NM_015885chr112618 305 1552 1830 --
NM_015886chr862143 1927 1347 852 836 99 180 --14982
NM_015888chr1101099 1071 1063 974 918 807 409 402 263 154 33313 625 67 ----
NM_015891chr652010 1747 495 175 36 12085 1624 --
NM_015898chr1911601 1301 ----
NM_015902chr81281 3639 601 48 --1892
NM_015906chr154677 3095 3011 999 389 24548 4249 11477 11507
NM_015907chr4164 ------
NM_015908chr7--177 ----
NM_015912chr822502 1596 --1154 --
NM_015913chr11712 1736 ----
NM_015920chr15133 2629 114 ----
NM_015939chr204665 577 504 28 1611 1151 --
NM_015956chr192226 202 ------
NM_015975chrX51310 1286 712 459 258 ----11337
NM_015980chr551619 1587 1575 1365 190 1625 11084 --
NM_015982chr171338 ------
NM_015986chr171567 21332 139 1914 --
NM_015990chr441118 921 843 837 2714 394 ----
NM_015995chr1514236 15464 24161 953 163
NM_016002chr11187 1745 --1803
NM_016003chr751776 744 554 245 224 --21954 612 --
NM_016009chr164043 3977 3781 1500 1454 261 14787 1459 --
NM_016018chr832300 1754 293 ------
NM_016019chr72742 310 ------
NM_016021chr672747 2720 2711 2261 829 322 120 22035 97 ----
NM_016022chr11136 1989 1149 --
NM_016023chr872170 1826 1800 1578 1346 877 296 11557 22038 837 --
NM_016025chr1641862 1594 497 361 ------
NM_016027chr82559 33 ------
NM_016032chrX1360 --124 --
NM_016037chr14786 730 408 184 1953 ----
NM_016045chr2051422 1263 541 470 117 31493 741 631 11838 --
NM_016048chr54906 274 222 126 ------
NM_016059chr63902 597 340 ------
NM_016061chr231684 1607 1034 31339 1023 173 ----
NM_016072chr1241788 1574 957 671 1525 1550 --
NM_016073chr152822 267 ------
NM_016076chr122036 491 192 13167 --
NM_016083chr622404 837 22967 423 13097 --
NM_016090chr113902 774 74 1320 ----
NM_016096chr851757 1507 1392 879 870 11376 ----
NM_016100chr20--1362 ----
NM_016101chr16192 ------
NM_016103chr5----193 --
NM_016107chr541273 406 396 287 1485 11368 --
NM_016120chrX3794 159 79 ----1846
NM_016125chr171411 ------
NM_016131chr262074 1923 1523 549 504 101 32202 2097 369 12144 --
NM_016132chr15143371 3363 3149 3128 2901 2840 2714 1329 1322 1315 972 314 165 39 ------
NM_016133chr211216 ----124
NM_016138chr162329 111 --1352 196
NM_016141chr32765 245 1228 ----
NM_016144chr53788 614 485 153 ----
NM_016147chr1111147 ------
NM_016151chr161331 ------
NM_016152chr331172 865 93 --1389 --
NM_016166chr15------1190
NM_016169chr1033220 2999 1093 23138 513 --23210 3102
NM_016203chr731083 1022 62 1899 ----
NM_016205chr451374 1123 1012 465 190 ------
NM_016206chr3209010 8682 8115 8104 7378 7371 7360 6457 6240 6195 6117 5647 3411 3307 3270 1789 1215 600 445 285 27557 403 48237 5968 3102 250 11816
NM_016213chr15140 ------
NM_016216chr36721 656 541 43 36 24 1200 ----
NM_016217chr633315 3071 2672 --33564 3232 2490 --
NM_016221chr552356 2306 2296 1667 517 --12232 --
NM_016224chr651725 1705 1487 832 236 --1187 --
NM_016226chr12126 1108 ----
NM_016227chr151310 1167 1071 452 35 --1374 --
NM_016230chr61494 182 --1175
NM_016231chr1721185 317 --1663 --
NM_016247chr31519 ------
NM_016248chr13133898 3834 3619 3026 2494 1460 1444 1045 1010 880 545 478 385 21420 313 11234 23938 180
NM_016252chr21186 ------
NM_016255chr633019 2683 1228 1392 ----
NM_016257chr133091 2675 1006 --1274 --
NM_016258chr11293 --1563 --
NM_016260chr2166985 6821 5754 5601 5457 2924 2670 2653 2482 2252 2217 2148 2002 471 243 142 --16479 --
NM_016262chr62499 117 173 ----
NM_016270chr192454 423 1489 ----
NM_016271chr1892126 1994 1739 1458 625 550 313 287 127 21543 275 1908 --
NM_016275chr352731 2217 2021 820 583 --12089 132
NM_016277chr621310 280 11164 41543 1529 1149 1016 --
NM_016279chr5--1505 ----
NM_016281chr121797 ----11095
NM_016284chr162626 193 2928 898 ----
NM_016287chr141839 1656 1630 704 11292 11911 --
NM_016289chr232179 2070 629 1875 1138 1772
NM_016297chr23677 536 98 11037 13352 --
NM_016302chr32799 588 ------
NM_016306chr33375 82 70 ------
NM_016307chr9----1286 --
NM_016308chr172078 1979 1930 1851 1328 437 164 ------
NM_016312chr12--1432 1392 --
NM_016315chr221535 104 ------
NM_016316chr21640 2300 129 ----
NM_016319chr122207 187 --1710 --
NM_016322chr963119 3072 2839 2764 2707 2000 31282 1030 1018 1479 --
NM_016331chr3157 ------
NM_016340chr521109 466 11267 ----
NM_016351chr72568 172 ------
NM_016352chr761405 1392 1093 575 561 223 11288 21381 236 --
NM_016356chr62988 952 21901 1892 12148 --
NM_016374chr141432 1338 1274 365 ------
NM_016374chr141432 1338 1274 365 ------
NM_016376chr1764102 3601 3495 3156 2719 1285 21499 1453 ----
NM_016377chr61552 ------
NM_016395chr1521323 495 11762 ----
NM_016396chr1552511 1873 701 491 52 31007 101 93 ----
NM_016404chr112123 44 ------
NM_016410chr92465 454 ------
NM_016422chr1133188 625 123 22694 325 ----
NM_016423chr141394 1323 ----
NM_016424chr1781560 1531 1312 794 519 380 205 71 1220 ----
NM_016433chr1251185 1156 334 327 182 ------
NM_016436chr2072551 2480 1921 1884 1073 1017 973 1271 11961 1641
NM_016441chr262357 2134 2068 1903 900 674 11787 ----
NM_016448chr131688 1555 1332 --1505 --
NM_016451chr111280 ----173
NM_016454chr151236 ------
NM_016463chr51156 ------
NM_016467chr251296 1017 950 544 537 11319 ----
NM_016475chr1431141 482 145 ------
NM_016480chr52305 123 ------
NM_016485chr64875 449 106 31 ------
NM_016488chr1231964 1759 1286 11872 ----
NM_016506chr113727 574 95 ------
NM_016507chr1783109 2774 2658 997 929 761 574 422 13151 1503 --
NM_016513chr683262 3176 2698 1428 938 911 768 572 2262 203 22614 635 --
NM_016516chr23861 548 188 ------
NM_016519chr4171 ------
NM_016522chr1111051 ------
NM_016529chr131495 --1236 --
NM_016530chr1583966 3832 3003 2846 2627 2539 2527 1521 23146 2574 1355 21655 1356
NM_016531chr443674 3076 1472 792 24128 1043 ----
NM_016542chrX3254 149 101 41608 1575 1265 191 --1378
NM_016545chr11274 3902 868 809 1220 --
NM_016557chr311047 1287 124 --
NM_016559chr32593 320 31370 1304 580 --1431
NM_016569chr1231493 1154 1034 --11328 1109
NM_016570chr12131 --1399 --
NM_016575chr12164504 4496 4277 4225 3757 3465 2167 2147 2108 1278 1257 1145 247 240 111 87 21420 125 44520 1804 1598 632 14251
NM_016577chr384156 4010 3022 2742 1288 346 301 212 1354 ----
NM_016578chr112639 203 ------
NM_016584chr121300 ------
NM_016587chr72437 376 1162 --1945
NM_016603chr551661 1646 355 338 92 41429 598 260 119 ----
NM_016604chr531276 1035 251 ------
NM_016607chrX31634 1205 243 --11646 --
NM_016612chr82541 475 193 ----
NM_016617chr1382103 1929 1704 1691 727 295 145 55 11797 ----
NM_016620chr12402 221 31277 425 331 ----
NM_016621chr1184556 4535 4520 3191 1703 1464 990 107 ------
NM_016623chr8--1535 1499 --
NM_016626chr1821466 1154 11460 11602 --
NM_016628chr10170 1236 ----
NM_016631chr212975 672 2240 59 ----
NM_016640chr51102 --1191 --
NM_016651chr1461008 954 365 336 247 197 2986 87 ----
NM_016652chr20127 ------
NM_016653chr24462 394 122 68 1479 ----
NM_016654chr1561198 1089 928 303 290 33 21354 1039 --11017
NM_016655chr15192 ------
NM_016823chr171370 ------
NM_016824chr102619 415 31206 736 679 11800 --
NM_016831chr172310 1733 1652 773 763 359 148 22252 224 1952 --
NM_016836chr22621 158 1108 ----
NM_016839chr22621 158 1108 ----
NM_016931chr111362 ------
NM_016936chr16--11628 12141 --
NM_016946chr153099 2599 2260 1185 978 13276 ----
NM_016950chr421298 937 1119 ----
NM_016952chr1193922 3197 3157 1336 1326 1311 1052 453 442 33094 239 123 --24009 3989
NM_016953chr275852 4834 4750 4338 1560 1537 441 45640 4494 1718 372 25887 77 --
NM_017409chr12------1773
NM_017412chr8----11038 166
NM_017416chrX1144 ------
NM_017420chr1483548 3517 2908 1396 513 398 197 27 2812 107 12736 --
NM_017423chr451667 1470 515 455 236 ------
NM_017426chr43633 511 124 2623 454 ----
NM_017437chr1492016 2002 1995 1983 1611 638 190 82 73 52305 2160 349 162 88 ----
NM_017440chr122556 76 ------
NM_017444chr831805 1460 463 21308 758 ----
NM_017447chr21144439 4256 4130 3591 3436 3159 3024 2786 1599 1586 1557 1438 953 703 23097 1503 14115 --
NM_017451chr17----1999 --
NM_017452chr2041363 1176 936 603 ------
NM_017453chr2041363 1176 936 603 ------
NM_017454chr2041363 1176 936 603 ------
NM_017455chr152974 865 --1802 2734 384
NM_017456chr1731986 1972 1895 11874 21624 141 11525
NM_017489chr831129 317 58 1533 21158 96 --
NM_017519chr62330 280 ------
NM_017522chr121331 565 1409 ----
NM_017544chrX146 122 ----
NM_017548chr341928 828 795 764 11455 ----
NM_017551chr1022664 249 ------
NM_017554chr322211 855 --12088 --
NM_017563chr366406 6283 2264 2159 1502 500 36372 5491 3963 36049 5407 4677 --
NM_017569chr132112 55 ------
NM_017575chr1711618 ------
NM_017580chr1032394 2341 1546 1487 ----
NM_017582chr131526 580 383 11810 ----
NM_017588chr951949 1696 1488 689 348 ------
NM_017590chr2212644 1705 ----
NM_017593chr4268 42 2420 315 ----
NM_017599chr1252070 1319 1312 446 217 1677 11859 --
NM_017610chr1542029 761 346 336 1243 ----
NM_017617chr921591 1280 21217 1049 ----
NM_017626chr1031286 640 56 ------
NM_017628chr4115108 4845 4834 3309 1647 1634 1628 778 623 521 59 11044 --14036
NM_017629chr141669 1253 531 316 --1679 --
NM_017631chr42541 63 ------
NM_017632chr4--3307 116 94 --161
NM_017633chr6103907 3796 3601 3450 3034 3028 2806 2615 553 111 23938 3400 12979 --
NM_017634chr841977 1881 1856 247 ------
NM_017635chr1151275 1226 1059 490 454 11377 ----
NM_017637chr9179416 9270 9264 9248 9064 6798 5702 3453 3053 2425 2194 1892 1819 1666 1566 589 193 68168 8158 6989 3662 2032 1937 36755 3124 471 29365 2709
NM_017638chr13900 74 67 1246 ----
NM_017640chr62760 359 1181 ----
NM_017641chr122801 262 11016 1320 --
NM_017643chr1792828 2637 2507 2464 402 304 230 210 100 1243 1466 --
NM_017644chr3145223 5123 4864 4809 4695 4682 3978 3667 3435 3367 1826 842 369 200 33834 2007 830 33475 3226 1339 --
NM_017645chr972554 1978 1931 1275 833 818 360 ------
NM_017649chr10------1381
NM_017650chr785284 4292 2059 2050 1559 1341 301 254 12218 25982 1746 --
NM_017657chr26911 745 722 313 244 227 1756 1584 --
NM_017658chr1454345 4236 1156 970 137 24495 4415 --21017 681
NM_017661chr1531286 1223 430 ------
NM_017666chrX51780 1754 706 493 330 11479 1249 --
NM_017672chr153417 154 29 11338 11152 --
NM_017673chr12881 78 --1804 --
NM_017680chr93818 225 168 ------
NM_017693chr1331655 1607 1561 ------
NM_017694chr2--11577 2705 526 --
NM_017704chr111287 ------
NM_017709chr194147 3911 3467 3214 3153 1471 1046 895 519 ------
NM_017719chr3--32114 732 652 1974 --
NM_017724chr32190 104 1560 2838 63 --
NM_017730chr32590 266 ------
NM_017734chr1178 ------
NM_017737chr152144 2125 1886 527 58 ------
NM_017738chr921160 809 21208 1133 ----
NM_017739chr11374 183 ----
NM_017741chr462765 2626 2002 1808 981 851 --1616 --
NM_017742chr1861699 1286 1237 396 177 82 ----1510
NM_017752chrX21932 1785 ------
NM_017753chr94419 394 290 186 41032 757 141 130 1971 --
NM_017757chr1821158 831 1873 ----
NM_017758chr1781199 370 148 121 112 105 98 75 --161 --
NM_017762chr1541940 1576 269 191 11908 ----
NM_017768chr13903 782 274 2380 207 1618 --
NM_017769chr1452663 2263 789 452 179 22149 340 --12780
NM_017770chr641028 962 361 106 ----12789
NM_017778chr83589 297 289 11100 ----
NM_017784chr331172 1081 78 144 21181 781 --
NM_017789chr2------156
NM_017798chr205963 456 393 219 137 ------
NM_017799chr1451677 1603 1330 387 237 1656 11695 --
NM_017801chr342507 796 577 108 1732 ----
NM_017811chr963098 3068 3026 2555 1000 702 12764 ----
NM_017813chr8175718 5655 5622 5190 5073 4773 4535 4130 3979 3956 3659 2118 1159 1104 665 381 214 35516 4044 2112 11043 --
NM_017824chr1041911 1761 549 264 --11711 1354
NM_017831chr1874196 4152 2948 1480 1213 1087 886 11831 13999 --
NM_017845chr41250 --1753 --
NM_017848chrX74485 4412 4039 4004 3391 3340 455 1530 ----
NM_017849chr222286 847 12447 13201 --
NM_017866chr81978 ----171
NM_017873chr932693 2173 90 11250 1633 --
NM_017880chr21184 --2314 26 --
NM_017890chr851889 516 384 178 45 11709 ----
NM_017896chr2063490 3326 691 571 442 124 13364 1773 --
NM_017902chr10105184 4695 4671 4652 4069 1901 1750 1632 537 279 13537 ----
NM_017913chr94173 110 99 36 1142 ----
NM_017919chr984348 4207 3592 1806 1396 823 154 80 23954 3777 ----
NM_017922chr142437 229 2663 238 --1263
NM_017925chr911565 11849 --11824
NM_017926chr141927 2584 310 1359 --
NM_017938chrX31716 1385 501 22041 1888 22183 606 21981 43
NM_017943chr141749 ------
NM_017944chr1173122 3038 3000 2387 1185 1071 573 23063 586 ----
NM_017954chr741186 219 195 182 1489 1240 --
NM_017957chr171234 ------
NM_017964chr21985 2265 157 ----
NM_017972chr141927 2584 310 1359 --
NM_017994chr771176 586 579 560 530 465 22 --22742 999 --
NM_017998chr941262 1181 1002 249 11149 --11124
NM_018003chr1562474 2440 2407 2138 1920 119 1524 ----
NM_018009chr121114 ------
NM_018011chr133644 585 76 ------
NM_018015chrX3214 145 67 ------
NM_018017chr1042818 2291 116 89 1209 --12376
NM_018023chr332032 602 396 11927 ----
NM_018027chr1012188 33286 3253 1147 ----
NM_018028chr191978 --21314 148 --
NM_018036chr1474409 4126 3938 3908 3360 1039 714 --1267 13470
NM_018046chr521561 489 11957 --1698
NM_018047chr52927 340 1331 ----
NM_018049chr193105 98 87 ------
NM_018054chr16--1496 ----
NM_018056chr11127 ------
NM_018061chr12352 244 1359 ----
NM_018070chr11378 ------
NM_018078chr451048 960 949 938 650 ------
NM_018084chr273271 2829 2812 1320 1035 939 477 13354 --12795
NM_018085chr1107735 6495 6414 5638 5367 3240 2799 1501 600 343 37591 6095 55 14953 17190
NM_018086chr261788 1416 1359 1332 486 375 ------
NM_018087chr11215 ------
NM_018090chr111143 ------
NM_018092chr1631562 1158 1091 --11334 --
NM_018095chr113727 574 95 ------
NM_018105chr81168 ------
NM_018110chr1651093 1085 1075 1057 356 ------
NM_018115chr43666 627 145 ------
NM_018117chr102677 496 1559 ----
NM_018120chr831259 1182 515 1557 21014 500 --
NM_018121chr1052661 2644 1184 1127 345 --12472 --
NM_018124chr1621665 771 ----11608
NM_018126chr431515 1367 1285 21467 1459 ----
NM_018131chr101770 3846 259 92 ----
NM_018133chr392177 2028 1816 1673 1640 1570 1560 1522 387 31931 1652 1471 ----
NM_018142chr8--3237 211 202 ----
NM_018144chr10260 22 1309 ----
NM_018151chr2--2812 165 ----
NM_018155chr3133349 3269 3253 1377 1098 1076 973 903 860 741 517 290 133 1947 12960 --
NM_018156chr121860 290 ------
NM_018157chr1252363 2265 2031 310 168 22232 522 ----
NM_018159chrX1243 3643 605 384 2467 231 11699
NM_018164chr12147 ------
NM_018178chr171703 1277 831 505 291 97 71 ------
NM_018179chr122629 46 --1544 --
NM_018181chr1861924 1725 1638 1244 1237 58 41299 1269 368 302 11339 11262
NM_018184chr332089 1981 1375 1721 11384 --
NM_018192chr31808 21045 71 ----
NM_018193chr15------1205
NM_018195chr1171894 1845 1603 1531 1459 203 66 2604 239 ----
NM_018199chr141227 ------
NM_018200chr1541980 1901 834 448 12556 12005 --
NM_018201chr912488 ------
NM_018202chr13359 332 102 1882 ----
NM_018211chr121545 1409 11941 21461 733 --
NM_018214chr63505 434 276 21225 468 ----
NM_018222chr1131901 1173 580 ------
NM_018227chr4103217 2898 2665 2256 2244 952 942 610 392 257 22140 840 ----
NM_018230chr1----1480 --
NM_018241chr42307 67 1159 ----
NM_018243chr453812 3168 3096 1521 147 --13145 144
NM_018247chr652958 2935 2495 976 378 ----11021
NM_018254chr152396 2179 913 841 293 32158 2147 770 ----
NM_018261chr41473 ------
NM_018264chr71762 1295 1980 --
NM_018270chr203758 740 595 1808 ----
NM_018279chr1292938 2902 2848 2808 2731 2629 555 328 318 12617 11092 --
NM_018287chr1041255 1061 121 82 1110 ----
NM_018293chr342584 2495 2263 1883 12968 22073 706 --
NM_018299chr841250 1125 972 281 --21040 994 --
NM_018300chr193600 462 107 ------
NM_018307chr17--1245 ----
NM_018312chr1182100 2049 1996 1796 825 800 570 213 --1808 --
NM_018313chr342645 1799 345 326 2778 220 ----
NM_018315chr441443 1110 557 241 21293 521 ----
NM_018321chr5--149 ----
NM_018323chr451542 1358 1293 594 159 31793 578 221 11239 --
NM_018330chr1021340 421 11439 --1353
NM_018351chr1264687 3190 1792 1779 1716 140 ----14214
NM_018360chrX277 38 ------
NM_018361chr8124061 4017 3354 3319 3133 2678 1471 1398 817 739 324 49 33279 1173 303 2939 447 --
NM_018362chr11113771 3527 3177 3161 3154 2674 2658 2647 404 263 30 43340 2495 1398 525 21140 811 --
NM_018364chr173502 3054 2702 2634 1419 816 802 34029 3413 609 11223 --
NM_018365chr15--3190 115 36 167 --
NM_018370chr121321 1303 22063 685 --
NM_018371chr831221 584 310 1350 --146
NM_018372chr14681 632 296 222 ------
NM_018373chr14146187 5873 5430 5313 5283 2512 2420 2042 1895 1664 1594 1186 1034 253 35586 3976 1639 ----
NM_018374chr7104268 4231 3700 1602 1591 1276 1180 1036 681 554 1976 11857 --
NM_018375chr141249 21477 733 ----
NM_018386chr13--1140 ----
NM_018387chr91138 ------
NM_018388chrX61428 925 517 405 383 337 ------
NM_018394chr321600 345 21606 108 ----
NM_018403chr343970 2558 982 602 33722 3121 1254 11533 --
NM_018409chr473061 2729 2436 1291 612 450 420 2167 86 ----
NM_018412chr71156 ------
NM_018413chr12--188 ----
NM_018416chr1241671 439 421 118 12625 1311 --
NM_018424chr961600 1510 1270 1199 535 129 11180 ----
NM_018426chr63598 588 579 1565 ----
NM_018429chr5--22263 208 1395 --
NM_018434chr5260 33 ------
NM_018439chr1831942 1868 687 42613 2556 2113 988 11673 --
NM_018442chr12125 106 ------
NM_018444chr871634 1623 1483 936 645 553 117 ------
NM_018448chr123993 438 343 1166 --11177
NM_018452chr6_random63651 3568 3479 3119 746 701 --11511 --
NM_018460chr22141 119 ------
NM_018471chr21584 ------
NM_018475chr42258 117 1104 ----
NM_018477chr143289 153 85 ------
NM_018482chr832130 2119 1036 12272 --12073
NM_018489chr11690 --21964 1738 --
NM_018490chr1131276 709 566 21654 1534 ----
NM_018509chr1721715 1390 ----1364
NM_018534chr23618 589 203 167 ----
NM_018553chr1741542 1333 1224 714 31246 1231 280 ----
NM_018557chr271683 1579 1485 1348 330 157 143 ----157
NM_018566chr1125065 4998 4978 4632 4415 4076 3870 3423 3362 1480 1175 978 31936 1056 1044 21733 1080 --
NM_018569chr471579 1561 1520 1144 1104 1010 382 189 ----
NM_018590chr1041712 1617 192 88 --11643 --
NM_018593chr6138 ------
NM_018602chr1541563 264 157 145 ------
NM_018638chr12185650 5305 5290 4945 4316 3923 2266 2102 1926 1844 1832 1568 1249 1226 889 855 618 152 14347 21715 1208 --
NM_018640chr1272184 1097 807 773 252 235 56 --12190 --
NM_018649chr103538 526 59 --1451 --
NM_018650chr131602 733 58 22291 2170 11759 --
NM_018657chr33654 605 172 1287 ----
NM_018662chr164319 4265 4230 3814 3176 2866 13335 1631 --
NM_018682chr72462 146 1207 1552 1618
NM_018685chr75885 858 716 222 34 ----1154
NM_018686chr12164 ------
NM_018693chr2----1297 1108
NM_018695chr542489 2445 447 294 21660 273 1481 --
NM_018698chrX61990 1949 1244 575 559 367 11968 11431 --
NM_018700chr551360 1314 1250 1198 602 ------
NM_018703chr162385 55 ------
NM_018704chr131942 1629 680 2846 145 ----
NM_018708chr1921530 1319 ------
NM_018710chr83443 252 183 ------
NM_018719chr721419 134 11113 --11236
NM_018834chr53769 698 202 --1113 --
NM_018841chr133954 3744 3607 22957 1576 ----
NM_018844chr73621 589 49 ------
NM_018846chr7--1935 ----
NM_018847chr931214 413 237 --11904 --
NM_018890chr741045 189 162 128 11492 11466 --
NM_018898chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018899chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018900chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018901chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018902chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018903chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018904chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018905chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018906chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018907chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018908chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018909chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018910chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018911chr552203 2164 1921 1740 169 140 11607 21553 801
NM_018934chr52244 29 162 173 --
NM_018945chr643658 2294 1420 617 23598 3477 ----
NM_018947chr7114461 3817 3059 1948 1775 1679 1140 882 419 184 123 23109 1933 33766 3118 776 --
NM_018948chr141426 937 514 467 1530 ----
NM_018951chr75947 937 831 801 171 ------
NM_018953chr121839 ------
NM_018957chr22--1324 ----
NM_018959chr193565 293 134 --1584 --
NM_018964chr2121057 963 ----1115
NM_018970chr721960 686 32878 604 451 --13093
NM_018972chr852533 2421 2332 2284 1962 ------
NM_018976chr1271772 1133 988 972 500 155 102 42269 2024 598 442 ----
NM_018977chrX2970 875 --1933 --
NM_018979chr1232393 373 222 12549 12657 --
NM_018992chr1631519 139 101 11358 ----
NM_018993chr2031513 335 206 21463 543 21396 1143 11437
NM_018999chr1084641 4614 4439 3854 2994 1917 1896 1559 11208 ----
NM_019000chr541473 1422 1143 202 ------
NM_019001chr3104749 4672 4508 4394 4387 4377 3560 3277 1197 600 54665 3742 3712 847 618 24420 4001 --
NM_019004chr751663 1507 745 492 220 12241 ----
NM_019006chr153589 138 126 ------
NM_019008chr2272859 2651 1464 411 303 194 172 --23355 2816 --
NM_019022chr18123146 2878 2866 2838 2639 2464 2416 2190 1235 858 541 115 ----12537
NM_019027chr451697 924 912 884 289 1368 11756 --
NM_019028chr113424 356 39 1455 ----
NM_019036chr62988 939 --1254 --
NM_019042chr72315 68 2826 816 ----
NM_019045chrX5813 366 316 225 129 ------
NM_019050chr482054 1976 1661 730 716 574 503 398 11900 ----
NM_019053chr1021098 360 ------
NM_019054chr103198 191 60 --186 --
NM_019063chr22528 49 --11717 --
NM_019066chr15172 ------
NM_019071chr71752 ------
NM_019072chr563559 1342 1330 1242 391 218 24204 1662 11364 --
NM_019074chr151900 2999 919 ----
NM_019080chr1331567 533 153 1207 1473 --
NM_019084chr1062403 2351 2193 492 473 437 2903 67 ----
NM_019087chr561734 1636 1510 489 459 339 ------
NM_019091chr251075 1049 996 237 153 11163 ----
NM_019094chr12103669 2647 2562 1255 587 565 540 330 298 213 22699 1404 ----
NM_019114chr932387 1821 778 1358 ----
NM_019116chr162611 577 1465 11324 12961
NM_019555chr311468 21796 565 1102 --
NM_019590chr103521 486 170 31173 1074 349 ----
NM_019593chr2063009 2888 2440 908 857 91 1958 --11232
NM_019594chr91659 ------