TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-550a-3p
miRNA Sequence: UGUCUUACUCCCUCAGGCACAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX106845 5699 4847 4490 2125 1873 1717 1698 371 246 36798 1255 610 14512 --
NM_000112chr573983 3792 2172 2120 1151 788 548 25041 573 25518 3516 --
NM_000633chr1885274 5120 5059 4731 4715 3311 1947 857 33706 1219 269 ----
NM_000724chr1041693 1687 1660 1326 11599 --11747
NM_000809chr4109170 8866 8288 7389 5665 3446 3338 1827 1376 1070 49218 7919 7507 556 ----
NM_000868chrX42613 973 168 48 ----22482 497
NM_000875chr15126924 6785 6643 5671 5403 4699 4435 2567 2442 2277 1141 1078 37011 6321 5795 ----
NM_000899chr1223459 2787 11730 21487 929 11292
NM_001001419chr574151 3286 1375 1231 1201 1038 987 --24729 4103 23374 663
NM_001001420chr574151 3286 1375 1231 1201 1038 987 --24729 4103 23374 663
NM_001001668chr19114286 4181 4107 4050 3835 3544 1412 1052 530 371 365 13758 1880 11617
NM_001001928chr2278003 6598 5909 3121 2740 1482 820 37005 6299 1887 28298 1851 --
NM_001003652chr1898235 6750 6504 3399 2994 2424 1411 1197 846 11839 17800 11936
NM_001004317chr6114063 4019 3942 3896 3633 3453 1772 1703 1530 883 236 31611 558 206 ----
NM_001005473chr556592 6154 2156 797 31 21380 647 24931 2256 --
NM_001005502chr1295168 4831 4005 3161 897 839 802 407 278 23231 587 21554 672 --
NM_001008408chr785859 4768 4756 4518 1638 1627 1038 846 26149 689 --24799 1100
NM_001009899chr3106143 5978 5833 4061 4054 1895 1282 1275 316 36 15674 14013 --
NM_001011666chr7106495 5266 5260 4872 4116 2450 2373 1132 528 413 46171 5704 4063 1350 15530 1391
NM_001013620chr1298313 6861 6139 5927 5666 2138 1638 192 158 37463 5936 3343 16839 16624
NM_001024647chr1257527 2774 2177 382 101 14703 35900 2995 1760 --
NM_001024956chr1174608 4523 4244 1583 580 300 28 15381 ----
NM_001025076chr1041584 1417 1137 558 45757 846 590 47 --11308
NM_001025077chr1094582 2942 2775 2495 1916 1308 1261 579 140 37115 2204 1948 14689 12666
NM_001025580chrX64249 3703 1714 1305 190 151 --23990 3289 24071 473
NM_001030055chr1484453 4283 3803 3439 3433 1381 966 172 ------
NM_001032395chr622664 911 21995 948 --21775 1021
NM_001039547chr377079 6536 5739 5319 5117 2582 2500 35663 2632 1199 27644 5440 1198
NM_001039580chr474915 1989 1820 1663 1515 1499 242 33656 999 234 11685 --
NM_001040284chr1675268 5183 4928 4818 1577 1277 271 11990 11725 --
NM_001040429chr1373287 3188 3002 1074 987 340 118 1221 1865 1650
NM_001040441chr154520 4433 4161 3510 1712 45323 5192 4946 3459 --1382
NM_001042599chr2136962 6615 6597 6454 5782 5229 2861 2437 1833 1397 1361 1345 565 21866 1205 --22155 280
NM_001043351chr132073 686 669 22275 609 1677 --
NM_001100108chr176662 6451 6132 5490 5314 5304 3245 13337 15678 28122 6316
NM_001106chr3139198 9105 8922 8900 8387 8217 6622 6486 6417 6353 2704 1818 1483 26340 961 --16199
NM_001167chrX66476 4751 2452 1409 1188 115 36623 4950 1421 26280 4488 11697
NM_001173chr1484453 4283 3803 3439 3433 1381 966 172 ------
NM_001204chr266997 6113 5489 2922 2477 1288 47730 1663 1018 384 15094 25257 2172
NM_001663chr1482575 2432 2335 1014 747 693 600 535 --11817 --
NM_001699chr19111555 1531 1464 1367 1286 1244 1221 1209 1194 714 390 ------
NM_001874chr1295168 4831 4005 3161 897 839 802 407 278 23231 587 21554 672 --
NM_002025chrX87838 7780 3231 3021 2726 1799 1782 497 37274 2709 2538 13606 12765
NM_002203chr521432 1188 23519 728 --33234 2864 1255
NM_002210chr232981 2401 1041 21119 268 --23480 2772
NM_002977chr263440 3213 2744 681 218 205 ----12137
NM_003034chr12128077 7232 6713 5701 5245 5174 3185 3135 3083 1603 1544 427 36372 1284 739 11506 --
NM_003794chr32797 372 --1399 1820
NM_003994chr1223459 2787 11730 21487 929 11292
NM_004171chr11147847 7428 7400 6794 5933 3387 3267 3064 2641 2614 1575 1323 775 670 21617 1141 ----
NM_004748chr15103582 3565 3312 2727 2703 2691 1472 1112 666 50 12912 --11070
NM_004866chr594632 3985 3875 3609 3259 1399 1358 895 660 21201 1107 --14070
NM_004904chr7106495 5266 5260 4872 4116 2450 2373 1132 528 413 46171 5704 4063 1350 15530 1391
NM_004985chr1283988 3137 1793 1548 1474 656 410 250 32893 719 28 ----
NM_005036chr2278003 6598 5909 3121 2740 1482 820 37005 6299 1887 28298 1851 --
NM_005156chr994112 2131 1545 1163 951 727 714 652 474 11074 --1615
NM_005188chr11118187 8053 7230 6328 6062 5825 5116 1118 860 413 340 27201 2600 17378 --
NM_005235chr2136962 6615 6597 6454 5782 5229 2861 2437 1833 1397 1361 1345 565 21866 1205 --22155 280
NM_005759chr284430 3811 1703 1619 1199 902 722 299 ----13380
NM_005840chrX106617 5673 5248 5172 1915 1278 1229 1101 971 403 16477 15182 --
NM_005901chr1898235 6750 6504 3399 2994 2424 1411 1197 846 11839 17800 11936
NM_005903chr574151 3286 1375 1231 1201 1038 987 --24729 4103 23374 663
NM_005909chr583484 3019 2661 1385 486 448 355 345 21378 807 --21486 999
NM_006203chr5105335 5283 5167 4797 4462 4089 3623 1645 1257 456 55585 5257 4960 3990 3635 ----
NM_006306chrX115728 5526 5501 4677 4652 4619 4219 4140 1798 778 649 25510 5336 24547 4260 25451 3638
NM_006544chr1455236 5025 1800 938 734 31945 1699 1537 --14159
NM_006561chr1041584 1417 1137 558 45757 846 590 47 --11308
NM_006729chrX85150 5064 1911 1398 1207 502 307 288 25671 4613 ----
NM_006750chr16137581 7500 6982 5814 5804 2367 1978 1933 1272 1241 793 639 379 25271 1292 --26524 5534
NM_006811chr203827 819 145 ----2999 321
NM_006918chr1174608 4523 4244 1583 580 300 28 15381 ----
NM_007038chr2195858 5768 4812 4751 3708 1984 1678 1205 571 --11075 --
NM_007249chr13108233 7784 7238 6580 6113 5988 2779 1671 920 30 48422 7662 3409 3329 16132 17854
NM_007350chr12114160 4076 4035 3869 3822 2917 2853 1245 1157 782 738 34667 2942 352 14312 --
NM_012214chr285141 4731 4714 4700 4458 4308 616 120 12554 35949 4346 2494 --
NM_014048chr16134766 4699 4553 4532 4357 4060 3614 1202 1021 831 435 416 376 14465 ----
NM_014106chr1562526 2180 1168 1139 891 137 2550 339 --12927
NM_014155chr1177527 6420 5275 2630 2177 1736 504 1623 25949 1691 --
NM_014423chr5125592 4147 3477 2062 1803 1727 1483 1314 478 348 259 235 23635 1366 ----
NM_014739chr643713 3080 879 776 23023 292 33130 2948 2627 --
NM_014864chr143122 1537 1194 1073 33452 987 541 23350 2875 14329
NM_014934chr1343419 3157 1499 218 13833 --32837 1461 1421
NM_014953chr1384142 3558 3106 1351 1247 1041 588 354 53636 1730 1705 1464 687 14266 14297
NM_015025chr21680 22514 817 --1708
NM_015271chr423464 1063 1937 1534 32875 1142 921
NM_015310chr896773 6725 6372 6364 6135 5953 1404 615 497 37649 6116 1036 ----
NM_015365chrX64249 3703 1714 1305 190 151 --23990 3289 24071 473
NM_015569chr1124295 4253 4235 3940 3602 3571 1883 1303 1206 957 538 508 --14322 --
NM_015852chr742911 2655 1381 110 42586 2310 1200 783 --11449
NM_016009chr194661 4326 3624 3249 1295 1224 1061 733 443 44019 3840 1603 700 13686 --
NM_016206chr3128090 7755 7137 6318 5954 5662 3605 3503 3431 2881 1449 550 46208 1908 1428 92 18004 --
NM_016953chr286046 4033 2442 1564 1042 960 891 752 35800 4343 1989 1616 --
NM_017447chr2154251 3548 3538 3221 2746 1125 23078 945 13451
NM_017637chr998613 8435 8425 7849 7755 3342 2527 2125 1632 19018 16556 27188 7168
NM_017644chr363795 3550 3185 2086 644 263 24954 4207 12061 13998
NM_017813chr864647 3789 1687 799 218 99 24823 4578 --1875
NM_018085chr1116605 5891 5874 5429 5029 3042 2577 2342 2261 569 412 32931 1776 885 37602 7367 5854 25410 2888
NM_018373chr14135434 5317 4807 4014 2539 2243 1795 1082 722 661 569 469 248 --12442 12090
NM_018440chr8147247 6660 6217 5846 5424 5379 3045 3015 2590 1649 1603 1076 1034 434 36926 6186 167 ----
NM_018638chr1255612 4640 4159 1261 401 23902 2195 11741 --
NM_019050chr411854 22289 754 --11780
NM_020673chr2077759 6017 5981 4812 509 450 280 37305 7097 2718 37613 4806 2976 15013
NM_020734chr1233348 153 122 --1168 23257 2358
NM_020739chr15103582 3565 3312 2727 2703 2691 1472 1112 666 50 12912 --11070
NM_020783chr1841837 979 904 354 1219 12409 22424 2366
NM_021163chr763717 2471 2391 1524 644 105 53512 3180 2354 1539 625 --1781
NM_021913chr19111555 1531 1464 1367 1286 1244 1221 1209 1194 714 390 ------
NM_021964chr376473 6390 6263 2092 1976 1929 616 ----15012
NM_022048chr1546280 4720 454 203 --1441 35200 704 616
NM_022456chr1257527 2774 2177 382 101 14703 35900 2995 1760 --
NM_024345chr965520 5110 4299 2036 644 409 35147 1870 581 12296 15262
NM_024770chr276519 6211 5048 4424 4180 2286 1035 45040 2465 1848 1067 1912 --
NM_024947chr3129252 9088 8986 7755 6369 5994 2130 1916 1890 1609 571 59 48071 7145 3487 716 --13006
NM_030647chr795261 4788 4021 3956 2089 791 587 437 108 11262 24100 748 --
NM_030648chr475515 4595 4177 3397 1155 774 768 34871 1054 243 ----
NM_031427chr1434742 3994 931 55147 4111 4053 3782 113 --22265 1192
NM_032012chr995076 4146 3620 3595 3542 3362 1689 1156 243 1429 14231 24693 1699
NM_032105chr1117996 7471 7077 6372 5682 5349 4978 4912 2606 1960 1331 1884 1486 --
NM_032208chr273254 2545 1229 958 632 524 311 11102 --13053
NM_032373chr1065042 4505 3611 1185 767 123 24489 1555 25598 2012 --
NM_033224chr797998 7058 6606 6492 6097 5383 3232 600 159 16524 25731 2844 --
NM_033656chr21115296 5231 4743 4110 3988 3909 3851 1831 1332 814 718 ------
NM_053023chr1123004 2833 --1768 23286 748
NM_053043chr785859 4768 4756 4518 1638 1627 1038 846 26149 689 --24799 1100
NM_133334chr486347 6214 4214 2309 1761 782 458 160 25689 2021 26045 955 1172
NM_133646chr295585 4753 3601 3468 1391 950 595 273 86 --55452 4927 4055 2145 498 --
NM_138286chr1964129 3964 3123 2728 1497 1039 41602 1126 629 59 1968 --
NM_138444chr13114755 4721 4697 4285 3729 3462 1842 1369 1026 874 577 --44624 985 966 136 --
NM_138468chr265939 4964 4646 4015 772 374 136 23987 531 14058
NM_145756chr1841327 1183 1065 489 1610 41399 1057 457 210 --
NM_152263chr1136032 5577 5389 5216 5065 4549 4323 3771 3749 2152 1893 743 639 1789 ----
NM_153207chr1263528 3318 2877 2801 883 422 --12629 24119 3352
NM_153649chr132073 686 669 22275 609 1677 --
NM_153689chr221753 264 22139 662 --21972 841
NM_172071chr1107363 7154 7038 5217 5202 1576 1255 1188 1107 62 26071 5557 15307 --
NM_173468chr475519 4783 4714 4125 2290 2195 1197 14176 22363 2096 --
NM_173642chr1189207 8857 8751 8536 8162 8113 7989 7950 7933 7669 3565 3096 3080 2784 1643 1038 587 229 39122 2014 275 12616 --
NM_175623chr1257527 2774 2177 382 101 14703 35900 2995 1760 --
NM_178815chr102528 279 2834 78 22302 2010 12461
NM_182503chr654229 3884 2245 855 227 35504 3859 1755 --11609
NM_182515chr1976712 6630 6487 4268 2242 873 493 34538 1425 520 26286 2084 1561
NM_182898chr7106495 5266 5260 4872 4116 2450 2373 1132 528 413 46171 5704 4063 1350 15530 1391
NM_182899chr7106495 5266 5260 4872 4116 2450 2373 1132 528 413 46171 5704 4063 1350 15530 1391
NM_182975chr1142 ----21193 235
NM_194285chr1153263 2769 2561 1346 1089 --12808 21333 734
NM_194314chr195603 4815 4575 4459 4426 3412 2201 1733 451 54796 4732 3535 1294 1150 2637 618 --
NM_198320chr1295168 4831 4005 3161 897 839 802 407 278 23231 587 21554 672 --
NM_198465chrX62650 2630 2624 2318 2066 379 12669 --11955
NM_198549chr153132 2903 2724 2178 674 23038 2927 11060 12961
NM_198569chr622664 911 21995 948 --21775 1021
NM_198581chr287141 6443 5484 2952 2648 1007 875 405 35159 4856 1615 --11252
NM_198968chr1343419 3157 1499 218 13833 --32837 1461 1421
NM_201570chr1041693 1687 1660 1326 11599 --11747
NM_201571chr1041693 1687 1660 1326 11599 --11747
NM_201572chr1041693 1687 1660 1326 11599 --11747
NM_201590chr1041693 1687 1660 1326 11599 --11747
NM_201593chr1041693 1687 1660 1326 11599 --11747
NM_201596chr1041693 1687 1660 1326 11599 --11747
NM_201597chr1041693 1687 1660 1326 11599 --11747
NM_206909chr896773 6725 6372 6364 6135 5953 1404 615 497 37649 6116 1036 ----
NM_207406chr4115886 5863 5710 5552 5502 4851 4582 2522 2379 1861 1776 --25568 5037 --