TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-550a-5p
miRNA Sequence: AGUGCCUGAGGGAGUAAGAGCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521281 92 11023 1982 --
NM_000038chr531874 1781 190 11529 ----
NM_000052chrX23331 168 ------
NM_000081chr12672 598 ------
NM_000084chrX46407 6045 5460 1195 16554 --14247
NM_000109chrX----12502 --
NM_000138chr15--2158 95 ----
NM_000182chr21479 ------
NM_000183chr2151 ------
NM_000208chr1953797 3151 3107 1169 27 --11275 11139
NM_000210chr232375 529 49 ------
NM_000217chr1274665 4497 4171 4023 3364 1303 1250 11745 12128 --
NM_000222chr451830 1819 1569 1335 109 ------
NM_000232chr432178 709 697 --32429 1287 861 12772
NM_000256chr11------131
NM_000259chr1576135 4723 4186 1228 675 392 233 ----13893
NM_000264chr911131 12750 11308 --
NM_000267chr1732992 2959 580 ----12950
NM_000332chr656754 5127 2706 2448 1388 21425 219 2403 245 --
NM_000335chr351925 1505 825 231 144 ------
NM_000337chr534683 1065 490 ------
NM_000358chr51508 ------
NM_000368chr943944 1639 436 417 ------
NM_000408chr21677 11085 ----
NM_000411chr2153102 2885 2186 786 451 22750 841 12038 --
NM_000428chr1431772 795 52 12603 11040 --
NM_000430chr1733234 1413 293 --13482 --
NM_000461chr334051 3801 653 ------
NM_000486chr1272997 2701 1181 1138 1132 1110 159 --32234 1118 336 1866
NM_000492chr71225 ------
NM_000503chr8----11415 --
NM_000551chr34440 346 163 125 11791 ----
NM_000555chrX107783 7540 7488 7108 6238 6098 5673 5436 5342 5054 11565 15198 --
NM_000599chr242970 1261 777 393 33332 1203 985 --13426
NM_000609chr1022530 1931 --22498 106 --
NM_000617chr1231671 1514 28 ------
NM_000618chr1224030 1835 1720 25568 5434 --
NM_000618chr1224030 1835 1720 25568 5434 --
NM_000621chr1311008 134 11181 --
NM_000679chr5----1179 --
NM_000702chr142219 1702 1666 1543 --22093 25 --
NM_000719chr1285316 4413 4279 2438 1506 633 240 177 26394 4730 15597 --
NM_000724chr1011259 --1410 --
NM_000725chr122388 64 1925 1226 238 32
NM_000767chr191496 --21172 362 11299
NM_000782chr202210 76 ------
NM_000793chr1444563 4432 1240 662 24068 1700 ----
NM_000794chr521077 85 ------
NM_000810chr152579 563 ------
NM_000813chr522136 1516 12243 11521 --
NM_000814chr1533860 3391 587 --11530 13491
NM_000826chr421774 240 ------
NM_000875chr1531813 1530 648 16238 34794 2731 1553 1748
NM_000891chr1743028 2797 1002 282 1964 ----
NM_000901chr432312 2063 1943 ------
NM_000921chr12--1166 ----
NM_000945chr211333 ------
NM_000949chr5149 ------
NM_000965chr3------11045
NM_001001323chr1222197 1211 12414 ----
NM_001001344chrX21867 952 22016 600 1741 --
NM_001001481chr863445 2637 2481 1183 186 108 22692 672 ----
NM_001001521chr2178 --183 --
NM_001001556chr1541216 1005 997 38 ------
NM_001001713chr211325 ------
NM_001001787chr11205 ------
NM_001001852chr222919 375 --2854 717 --
NM_001001933chr11137 ------
NM_001001971chr101199 ------
NM_001001995chrX11182 ------
NM_001002295chr101343 ------
NM_001002759chr102655 62 --1208 --
NM_001002762chr1041086 650 564 297 12197 2713 695 --
NM_001002860chr1464545 4230 3681 973 878 235 ------
NM_001002909chr1721885 655 ------
NM_001003652chr1867783 7769 6796 1931 409 312 16662 --17592
NM_001003712chr121666 12692 --1425
NM_001003800chr952463 1263 1026 460 130 ------
NM_001003940chr1553732 3469 3294 65 29 1750 --11318
NM_001003942chr1553732 3469 3294 65 29 1750 --11318
NM_001003943chr1553736 3473 3298 69 33 1754 --11322
NM_001004065chr943955 1450 1375 318 ----12433
NM_001004304chr1232778 1077 430 32590 443 284 ----
NM_001004316chr31293 1118 ----
NM_001004317chr653001 2988 2880 1495 1212 ----13088
NM_001004330chr121573 ------
NM_001005158chr31109 1460 ----
NM_001005159chr31109 1460 ----
NM_001005242chr1211637 ------
NM_001005386chr21261 ------
NM_001005473chr535236 4722 4120 24552 801 --16020
NM_001005474chr34995 350 214 48 ------
NM_001005781chr21116 ------
NM_001006600chr511710 ----12088
NM_001006605chr121171 873 ------
NM_001006605chr121171 873 ------
NM_001006610chr162932 62 ------
NM_001006636chr21673 ----1631
NM_001006657chr212478 ----12642
NM_001007023chr1444563 4432 1240 662 24068 1700 ----
NM_001007027chr111178 ------
NM_001007097chr962043 1628 1596 1294 431 222 1814 ----
NM_001007102chr6----1192 --
NM_001007189chr52136 54 ------
NM_001007237chr121827 1082 22650 2056 11982 --
NM_001007466chr635078 695 349 13524 ----
NM_001007471chr92354 216 ------
NM_001008222chrX--1987 1554 --
NM_001008239chr1842606 1494 714 328 --1885 --
NM_001008408chr795285 5096 4980 4786 4634 4475 4310 2260 2091 --25359 4989 21409 707
NM_001008528chr1731243 135 119 --1425 --
NM_001008540chr21200 ------
NM_001008541chr1031954 690 452 ------
NM_001008541chr1031954 690 452 ------
NM_001008564chr1361757 1490 1476 691 563 514 ------
NM_001008701chr1942367 2358 2350 1978 12458 ----
NM_001008726chr141524 ------
NM_001008895chr131216 ------
NM_001009185chr5------1763
NM_001009554chr421801 1643 13155 --13674
NM_001009554chr421801 1643 13155 --13674
NM_001009899chr335896 4421 392 11630 32252 1604 1470 --
NM_001009909chr1143714 2614 1456 819 13224 12522 --
NM_001009993chr2104376 3374 3164 3132 3006 2765 1690 1370 1330 1016 ------
NM_001010852chr61135 ------
NM_001010853chr621199 73 13258 1785 22427 1054
NM_001010861chr132454 1958 758 ------
NM_001010867chr195793 5510 4979 4816 4753 1175 1124 1046 869 22527 781 22207 185 24371 2124
NM_001010888chrX83919 3657 3573 1183 553 537 307 149 ------
NM_001010891chr546097 5608 4595 2776 --25223 2640 --
NM_001010927chr61239 ------
NM_001010971chr11149 ------
NM_001011538chr41211 --1973 1768
NM_001011553chr71824 ------
NM_001011666chr721805 1250 ----14839
NM_001011713chr1411358 ------
NM_001012393chr1143767 1870 1620 714 14597 ----
NM_001012755chrX43755 3408 1461 337 13126 11325 --
NM_001012968chrX22271 627 1754 ----
NM_001012979chrX----168 --
NM_001012990chrX1280 ------
NM_001013031chr1013332 ------
NM_001013399chr61868 --1719 --
NM_001013438chr31993 ------
NM_001013439chr31839 ------
NM_001013693chr182811 2398 1964 1095 706 694 248 109 --22609 2390 --
NM_001013693chr182811 2398 1964 1095 706 694 248 109 --22609 2390 --
NM_001013843chr151737 1234 ----
NM_001014797chr10117568 6735 6658 6557 5862 5144 3126 2630 1844 1778 930 36988 6308 889 17330 --
NM_001014972chr2----1195 --
NM_001015045chr442397 1026 587 203 ------
NM_001015508chr8139 ------
NM_001015880chr102280 211 ------
NM_001017371chr21207 ------
NM_001017415chr11266 ------
NM_001017416chr11266 ------
NM_001017424chr11707 21199 27 1763 11311
NM_001017425chr11707 21199 27 1763 11311
NM_001017440chr7127356 6813 5994 5537 3170 2827 2453 1249 539 365 337 60 --37708 5417 3124 --
NM_001017923chr141145 ------
NM_001017999chr132299 1928 33 11847 ----
NM_001017999chr132299 1928 33 11847 ----
NM_001018000chr132299 1928 33 11847 ----
NM_001018000chr132299 1928 33 11847 ----
NM_001018001chr132299 1928 33 11847 ----
NM_001018003chr8----2645 196 --
NM_001018024chrX2142 74 ------
NM_001018041chr6194 ------
NM_001018050chr22103147 3099 2845 2344 2206 916 887 704 664 386 ------
NM_001018052chr22103147 3099 2845 2344 2206 916 887 704 664 386 ------
NM_001018067chr113898 24262 823 ----
NM_001018068chr113898 24262 823 ----
NM_001018069chr113898 24262 823 ----
NM_001018676chr81117 ------
NM_001018677chr81117 ------
NM_001024401chr1642581 2191 1783 122 22460 538 ----
NM_001024808chr1282275 2138 1841 923 717 627 567 234 32714 679 43 1646 --
NM_001024855chr341829 709 374 251 ------
NM_001024858chr1442546 2141 771 50 42900 830 333 292 22335 1983 --
NM_001024947chr51769 ------
NM_001024948chr11563 --11207 --
NM_001024956chr1151922 1433 1074 825 139 ------
NM_001025068chr321472 1153 163 1494 --
NM_001025069chr321472 1153 163 1494 --
NM_001025076chr1045328 1963 1102 536 --12150 --
NM_001025077chr1036686 2460 1894 ------
NM_001025079chr353910 3430 3397 3248 533 22746 1299 ----
NM_001025105chr511074 ----11124
NM_001025108chr253356 2859 1532 682 576 ------
NM_001025252chr822903 2743 1540 ----
NM_001025253chr822903 2743 1540 ----
NM_001025266chr354509 3988 1722 1361 331 11415 1414 --
NM_001025580chrX1523 1790 13119 --
NM_001025780chr91123 --11185 --
NM_001029858chr622888 920 --11334 --
NM_001029859chr112617 220 12431 22023 1713 11877
NM_001029863chr652275 1183 512 253 100 ------
NM_001029864chr2042265 926 404 328 21726 238 --22355 1780
NM_001029955chr462844 2340 1312 662 590 222 2955 682 1426 --
NM_001030007chr162564 100 --32601 1495 470 --
NM_001030055chr1454666 4145 3671 2898 1299 ------
NM_001031690chr751104 1075 1018 647 544 11250 --1522
NM_001031695chr2253962 1574 1181 1174 511 --15017 --
NM_001031712chr6193 ------
NM_001031732chr4--33465 3021 897 11421 --
NM_001031804chr1633997 3749 1221 ------
NM_001031812chr542215 2120 1623 593 --11459 --
NM_001032282chr82282 178 ------
NM_001033045chr263209 2830 1528 1283 1245 351 11427 13063 --
NM_001033047chr431854 618 270 12334 ----
NM_001033087chr2012756 31172 636 568 21202 243 --
NM_001033117chr363943 3222 1529 1130 851 727 ------
NM_001033551chr1741152 720 291 271 --32998 406 64 --
NM_001033557chr22470 266 ------
NM_001034841chr1664294 4158 1885 1176 440 105 1942 14514 15324
NM_001034852chr1421496 437 11450 51993 1401 1392 725 383 --
NM_001034915chr821502 269 --11077 --
NM_001035003chr411297 ------
NM_001035004chr411297 ------
NM_001035260chr10----2654 62 --
NM_001037132chr722208 1859 21793 716 1656 --
NM_001037133chr722208 1859 21793 716 1656 --
NM_001037164chr711621 --11759 --
NM_001037172chr31227 --11079 --
NM_001037317chr132454 1958 758 ------
NM_001037954chr1132269 817 448 21035 786 ----
NM_001039348chr2----127 --
NM_001039349chr2----127 --
NM_001039479chr1452408 1992 1942 1789 636 32156 777 547 12257 --
NM_001039538chr243608 2997 2388 39 ------
NM_001039547chr377514 7380 6653 5428 2887 2754 1526 ------
NM_001039618chr1154424 4377 4343 1275 769 13656 ----
NM_001039711chr11986 ------
NM_001039712chr11986 ------
NM_001039802chr11316 ------
NM_001039840chrX55738 4363 3986 1490 1395 ------
NM_001039888chr11760 ----1272
NM_001039937chr1311297 12950 ----
NM_001039938chr1311487 ------
NM_001040001chr6--21401 1303 11632 --
NM_001040057chr711367 ------
NM_001040101chr431542 980 173 --11275 --
NM_001040134chr193942 519 499 11104 --11258
NM_001040142chr232437 2030 561 ------
NM_001040143chr232437 2030 561 ------
NM_001040152chr734334 4102 99 11264 ----
NM_001040169chr52108 102 1137 ----
NM_001040272chr922335 254 1632 --1329
NM_001040402chr443057 2760 1068 689 1522 ----
NM_001040409chr21373 ------
NM_001040429chr1323399 22 ------
NM_001040708chr8--1108 ----
NM_001042413chr91814 33641 3599 401 --1457
NM_001042427chr10169 ----1262
NM_001042430chr14182 ------
NM_001042453chrX3630 610 560 ------
NM_001042473chr101353 --21357 590 --
NM_001042481chr1431766 1629 28 --12158 --
NM_001042492chr1732992 2959 580 ----12950
NM_001042533chr333122 1124 513 1264 12259 1170
NM_001042539chr16----126 --
NM_001042550chr92430 408 ------
NM_001042555chr1254664 3406 1205 817 382 13815 24330 168 11369
NM_001042573chr1732072 847 423 --1440 --
NM_001042599chr226618 6259 17555 --14921
NM_001042601chr332438 2262 72 ------
NM_001042604chr3--1976 23146 146 --
NM_001042681chr122226 1970 ------
NM_001042682chr122226 1970 ------
NM_001042682chr122226 1970 ------
NM_001042749chrX21301 325 ------
NM_001042750chrX21301 325 ------
NM_001042751chrX21301 325 ------
NM_001042762chr7124 ------
NM_001043318chr1422889 1657 43427 3373 2748 88 11089 --
NM_001044722chr542215 2120 1623 593 --11459 --
NM_001044723chr542215 2120 1623 593 --11459 --
NM_001046chr5------12284
NM_001050chr172394 227 ------
NM_001078chr1----1560 --
NM_001083620chr421772 239 ------
NM_001099678chr344874 4788 4253 1464 1591 24740 4584 --
NM_001106chr3108280 7615 7453 7341 6810 2527 2130 1781 734 248 12219 12537 36598 6426 692
NM_001117chr1832029 1964 1914 ----11731
NM_001122631chr111433 1205 ----
NM_001122679chr521281 92 11023 1982 --
NM_001128chr162564 100 --32601 1495 470 --
NM_001152chrX----137 --
NM_001163chr92910 741 1852 1746 --
NM_001167chrX86066 5745 4358 2393 1993 1698 1096 932 --26018 5618 --
NM_001173chr1454666 4145 3671 2898 1299 ------
NM_001177chr1242474 2088 1904 525 ------
NM_001186chr2122988 611 ------
NM_001189chr43760 211 104 --1703 --
NM_001201chr443286 2588 1508 1158 13454 11077 --
NM_001204chr225781 805 32939 568 432 14962 --
NM_001219chr711788 --12274 --
NM_001222chr1041879 1512 525 421 ------
NM_001237chr41935 ------
NM_001237chr41935 ------
NM_001257chr1621036 604 --1326 11016
NM_001259chr756393 5638 5085 4274 2478 --1541 1342
NM_001284chr52126 26 ------
NM_001289chrX11392 1342 --11242
NM_001290chr41223 11017 ----
NM_001304chr1733007 2452 1281 ------
NM_001310chr12----1797 --
NM_001346chr332519 645 269 --12243 1529
NM_001356chrX1770 ------
NM_001357chr1150 ------
NM_001364chr1124258 687 --11838 --
NM_001396chr2132806 510 358 ----1608
NM_001397chr142379 699 657 532 --1236 1211
NM_001401chr911511 ------
NM_001402chr621789 1582 --21459 1343 --
NM_001412chrX23085 3001 ------
NM_001419chr1954827 3810 1670 1430 494 --43395 1675 733 662 --
NM_001420chr1982860 2703 1248 1117 533 491 103 37 1973 ----
NM_001423chr12----11419 --
NM_001438chr11857 11341 ----
NM_001447chr53888 412 27 11108 --1520
NM_001448chrX146 31828 588 246 ----
NM_001498chr611015 ----11176
NM_001530chr141381 ------
NM_001542chr121827 1082 22650 2056 11982 --
NM_001546chr611265 11289 ----
NM_001560chrX42563 2133 1741 119 ------
NM_001584chr111353 1917 1928 --
NM_001609chr1031343 718 627 1191 ----
NM_001621chr74723 270 242 107 ----1688
NM_001621chr74723 270 242 107 ----1688
NM_001655chr1121992 586 --41702 818 795 629 --
NM_001656chr521968 1469 1575 ----
NM_001663chr1432529 2247 685 ------
NM_001668chr121550 688 22252 2047 11993 --
NM_001677chr11843 ------
NM_001681chr121766 ------
NM_001682chr1221911 925 12128 ----
NM_001695chr81453 ----13152
NM_001702chr82214 92 1474 --3208 145 76
NM_001716chr1151535 1506 1066 619 44 1236 ----
NM_001717chr151105 11214 ----
NM_001730chr132320 254 --1369 --
NM_001730chr132320 254 --1369 --
NM_001743chr2----1439 --
NM_001755chr162176 150 ------
NM_001759chr1221501 1434 13893 --14571
NM_001769chr121290 ------
NM_001777chr353910 3430 3397 3248 533 22746 1299 ----
NM_001788chr71824 ------
NM_001791chr11316 ------
NM_001797chr162112 74 ------
NM_001800chr19----1399 --
NM_001830chrX53481 3331 1204 638 184 11020 ----
NM_001843chr121163 ------
NM_001854chr1----1122 --
NM_001858chr624402 557 11117 31632 1297 130 13594
NM_001884chr51533 ------
NM_001892chr511074 ----11124
NM_001918chr187703 7225 6044 2934 2412 1022 613 299 1132 47178 7043 2509 2497 --
NM_001938chr11508 ------
NM_001939chrX51305 1028 279 195 173 --12382 --
NM_001949chr613063 --11120 --
NM_001970chr17----1542 --
NM_001977chr411208 ------
NM_001981chr11951 12358 ----
NM_002017chr1111316 ----11134
NM_002023chr151182 1062 558 194 171 --1115 --
NM_002024chrX42052 718 569 94 ------
NM_002025chrX89267 8794 7265 7112 3258 2869 2109 713 15920 --17921
NM_002027chr81117 ------
NM_002039chr41830 --1820 --
NM_002040chr2131019 964 718 11134 ----
NM_002044chr1541216 1005 997 38 ------
NM_002051chr101343 ------
NM_002062chr621609 171 ------
NM_002071chr181582 1661 1550 --
NM_002073chr2221426 374 11284 ----
NM_002105chr1111037 ----1743
NM_002107chr12164 117 ------
NM_002126chr1733776 3642 3242 1109 --14066
NM_002128chr1311981 12404 ----
NM_002130chr51346 ------
NM_002137chr732368 1920 765 ------
NM_002145chr171116 ------
NM_002146chr1721305 891 2554 487 ----
NM_002156chr21302 ------
NM_002158chr212973 ------
NM_002192chr7----2552 445 --
NM_002204chr1731086 920 883 ----1310
NM_002210chr233142 430 272 1586 ----
NM_002214chr725674 4185 --31439 1304 313 --
NM_002232chr121230 1201 ------
NM_002247chr1031525 333 254 ------
NM_002264chr333641 3461 3316 1736 ----
NM_002267chr1312403 ------
NM_002268chr311416 125 ----
NM_002285chr253356 2859 1532 682 576 ------
NM_002336chr1223140 335 ------
NM_002356chr6----171 --
NM_002372chr51727 1652 ----
NM_002374chr243608 2997 2388 39 ------
NM_002376chr14183 ------
NM_002387chr531184 885 114 --11938 --
NM_002390chr1761725 1456 376 330 200 87 11776 --11761
NM_002397chr522012 1588 11470 1124 1521
NM_002429chr1221019 452 --11147 1147
NM_002480chr1211230 ------
NM_002545chr1143767 1870 1620 714 14597 ----
NM_002546chr81589 --173 --
NM_002570chr1531014 803 343 --131 --
NM_002577chr343297 2763 2721 477 --12628 --
NM_002579chr193942 519 499 11104 --11258
NM_002581chr954776 4718 4230 4020 645 ------
NM_002594chr202104 72 --177 --
NM_002641chrX31626 1257 236 ------
NM_002655chr812097 14232 --13791
NM_002657chr2043365 1011 902 233 ------
NM_002662chr332034 723 620 --1430 --
NM_002687chr141312 ------
NM_002709chr222962 2666 ------
NM_002711chr72858 645 1246 ----
NM_002718chr31599 ------
NM_002719chr1421619 125 ------
NM_002734chr1721542 1411 ------
NM_002738chr161155 ------
NM_002748chr15--11027 ----
NM_002752chr51405 ------
NM_002760chrY55804 4437 3909 2355 1526 ------
NM_002763chr11107 ------
NM_002786chr11----151 --
NM_002813chr1231251 956 177 --1280 --
NM_002821chr61280 --1123 --
NM_002827chr2061319 1274 1223 533 427 339 --174 --
NM_002833chr1511081 ------
NM_002836chr201515 ------
NM_002837chr1234566 4034 1176 13366 ----
NM_002841chr31446 ------
NM_002868chr1231619 660 179 1284 1654 --
NM_002874chr921754 685 --11709 --
NM_002880chr33616 610 356 --155 --
NM_002886chr344462 3614 1723 1288 ------
NM_002893chrX176 ------
NM_002941chr311259 ------
NM_002945chr173165 40 22 1562 ----
NM_002959chr133638 2835 629 ------
NM_002968chr162945 323 ------
NM_002973chr121188 ------
NM_002998chr821586 827 ------
NM_003009chr191337 --1308 --
NM_003011chr911606 ------
NM_003014chr721193 1127 ------
NM_003017chr631362 1027 199 11108 ----
NM_003022chrX1471 ------
NM_003028chr933565 3487 1509 --13712 12380
NM_003030chr321314 199 11284 11459 --
NM_003031chr162932 62 ------
NM_003045chr1383813 3584 3542 3183 1938 1596 317 66 24284 1208 13445 --
NM_003051chr1----1657 --
NM_003068chr8178 ------
NM_003070chr9187 ------
NM_003106chr3------11050
NM_003108chr272733 2635 2515 2405 2067 968 444 11401 11030 --
NM_003111chr21207 ------
NM_003137chr612065 --12091 --
NM_003144chr611798 ------
NM_003161chr1722617 371 1219 ----
NM_003173chrX1432 --21358 913 --
NM_003174chr101301 ------
NM_003181chr6181 ------
NM_003182chr7157 ------
NM_003182chr7157 ------
NM_003189chr152561 2206 453 369 222 13065 13293 --
NM_003216chr2252840 2743 2245 2092 419 ------
NM_003222chr201788 ------
NM_003236chr211074 12934 --12892
NM_003246chr151613 --1371 --
NM_003255chr172323 258 --2886 223 --
NM_003257chr151121 ------
NM_003262chr311047 13365 24686 1753 14551
NM_003269chr611199 ------
NM_003270chrX2768 388 ------
NM_003274chr2132891 624 362 ------
NM_003286chr2021063 299 ------
NM_003288chr201620 ------
NM_003290chr192327 263 ------
NM_003291chr132704 612 ------
NM_003295chr131151 ------
NM_003304chr321290 1021 11590 ----
NM_003326chr13893 326 262 --21703 31 --
NM_003330chr1231855 1452 178 ------
NM_003338chr101761 ------
NM_003339chr521481 1228 11072 1249 --
NM_003342chr17--12818 12454 --
NM_003348chr1211196 ------
NM_003350chr82219 174 ----1422
NM_003368chr11266 ------
NM_003373chr1031362 416 254 ------
NM_003374chr51297 1168 ----
NM_003387chr21271 --12212 --
NM_003400chr21231 ------
NM_003405chr221249 ------
NM_003406chr821584 675 ------
NM_003410chrX22243 2202 12834 ----
NM_003413chrX11587 ------
NM_003423chr1922271 790 --22405 2117 12472
NM_003439chr783169 2573 2395 2382 1111 1057 937 308 13238 ----
NM_003458chr353398 2844 2684 289 162 31331 434 304 ----
NM_003467chr21200 ------
NM_003468chr243612 3453 2866 1749 13877 ----
NM_003471chr311956 1929 1309 --
NM_003474chr1042366 1664 553 243 --2865 185 --
NM_003477chr11--1491 ----
NM_003489chr211998 23266 290 ----
NM_003502chr164645 152 66 31 --148 --
NM_003559chr1723452 3080 11467 23022 1015 --
NM_003583chr1263639 3349 3269 3005 2965 1423 --12982 --
NM_003589chr131216 ------
NM_003607chr163772 3664 3553 3055 2894 837 ------
NM_003615chr3--1196 ----
NM_003618chr21234 ------
NM_003631chr10--1832 ----
NM_003663chr32396 141 12334 ----
NM_003670chr32419 121 11368 1567 --
NM_003672chr111379 ------
NM_003679chr112585 12513 --12819
NM_003705chr21723 1556 ----
NM_003714chr533055 2257 1994 12379 12145 --
NM_003749chr1331816 858 159 12044 21855 604 --
NM_003750chr101295 ------
NM_003759chr443859 1490 1361 687 11212 ----
NM_003760chr11171 ------
NM_003787chr1811372 ------
NM_003825chr1521265 563 ------
NM_003850chr13--2649 122 ----
NM_003861chr1432755 1111 834 2884 102 ----
NM_003895chr211437 1885 ----
NM_003913chr643331 2854 1341 1292 11618 --11043
NM_003934chr911315 --1266 --
NM_003941chr7----12196 --
NM_003953chr142758 2472 887 101 12110 ----
NM_003958chr673709 3126 2942 2775 1173 803 38 ----11042
NM_003972chr1021217 1175 ------
NM_003980chr62510 327 ----11316
NM_003983chr1623555 3166 13038 --1413
NM_003998chr4--1469 ----
NM_004006chrX----12502 --
NM_004007chrX----12502 --
NM_004009chrX----12502 --
NM_004010chrX----12502 --
NM_004011chrX----12502 --
NM_004012chrX----12502 --
NM_004013chrX----12502 --
NM_004014chrX----12502 --
NM_004015chrX----12502 --
NM_004016chrX----12416 --
NM_004017chrX----12502 --
NM_004018chrX----12416 --
NM_004020chrX----12502 --
NM_004021chrX----12416 --
NM_004022chrX----12416 --
NM_004023chrX----12416 --
NM_004036chr21715 1217 ----
NM_004050chr1422010 159 42578 388 286 223 --1884
NM_004063chr8----2399 276 --
NM_004067chr7----1350 --
NM_004086chr142623 135 ------
NM_004087chr331811 1774 1370 ------
NM_004090chr1752767 2362 1138 508 114 ----22387 1063
NM_004098chr101416 1176 --1482
NM_004105chr2----127 --
NM_004112chr1711460 --1538 --
NM_004113chr321863 1773 11373 ----
NM_004133chr812545 ------
NM_004134chr5--2593 540 ----
NM_004171chr1177731 6309 2367 2215 1817 1386 1254 --1169 12084
NM_004183chr111745 ------
NM_004200chr1152520 877 640 302 219 --12162 12315
NM_004235chr91608 ------
NM_004272chr511827 ------
NM_004274chr1412773 --11295 --
NM_004296chr1463704 2853 2647 2458 410 48 --33132 2860 547 1997
NM_004319chr143130 2363 932 359 12412 ----
NM_004321chr232269 560 501 43449 3281 2285 260 --13114
NM_004331chr81173 1538 ----
NM_004342chr721859 451 11810 ----
NM_004370chr642194 1714 1643 1353 2856 712 ----
NM_004380chr16----165 --
NM_004384chr542215 2120 1623 593 --11459 --
NM_004392chr13----1949 --
NM_004420chr1181958 1500 980 928 920 873 700 581 --2631 556 --
NM_004432chr932222 1974 1852 1218 ----
NM_004437chr163513 3115 3076 2525 835 531 ----11443
NM_004438chr212051 23222 3069 ----
NM_004440chr631697 779 654 ------
NM_004449chr2111036 --11081 --
NM_004457chr221415 1361 ------
NM_004458chrX21645 833 ------
NM_004459chr1711981 ------
NM_004464chr423841 1360 11428 --12617
NM_004482chr2--163 ----
NM_004485chr184371 4265 1756 1689 1245 1185 828 694 11622 23180 3045 13485
NM_004501chr123135 1302 23984 3217 --14113
NM_004504chr222681 148 ------
NM_004505chr1731707 743 210 ------
NM_004529chr91919 ------
NM_004537chr122273 206 1552 ----
NM_004567chr3129 --134 --
NM_004575chr4--11368 ----
NM_004586chrX65165 4447 3763 3539 996 65 14596 ----
NM_004588chr113720 583 558 1279 12555 11135
NM_004598chr552875 2692 1083 973 85 11205 ----
NM_004600chr11505 ------
NM_004612chr9--13886 ----
NM_004626chr11----1119 --
NM_004654chrY11200 ------
NM_004660chrY2786 635 ------
NM_004663chr1541427 1139 1078 597 11417 ----
NM_004670chr102280 211 ------
NM_004696chr1----1547 1270
NM_004705chr111642 ------
NM_004714chr191310 ------
NM_004717chr7----11498 --
NM_004719chr1242330 1781 909 775 22494 2023 ----
NM_004726chrX44862 2269 2105 1773 11264 33987 1971 1484 --
NM_004733chr3----1419 --
NM_004736chr11478 --22242 328 --
NM_004742chr31394 1347 ----
NM_004745chr886208 5438 5048 4805 1961 1518 653 428 ------
NM_004748chr1511346 1485 23537 3138 11612
NM_004756chr1931232 1086 940 31211 1039 61 11185 --
NM_004760chr721780 1747 --11582 1198
NM_004762chr1731798 1617 1344 ------
NM_004768chr111059 --1293 --
NM_004774chr17163 1158 ----
NM_004798chr2063480 2965 2221 1154 1026 548 --12473 --
NM_004816chr91514 ------
NM_004817chr92595 504 ------
NM_004822chr1762613 1424 1106 983 893 651 32674 1266 1206 1397 --
NM_004834chr212607 22314 405 12596 11099
NM_004842chr61675 ------
NM_004859chr1742820 1010 999 88 11096 ----
NM_004869chr18--1196 ----
NM_004898chr432493 1071 327 21982 739 ----
NM_004902chr201657 ------
NM_004904chr721805 1250 ----14839
NM_004922chr103653 360 298 ------
NM_004937chr1782388 2160 2144 2042 392 300 289 257 --32178 1816 206 12347
NM_004938chr91858 ------
NM_004969chr101542 ------
NM_004976chr1154650 4622 4584 1831 148 --13526 --
NM_004978chr141393 691 291 130 ------
NM_004985chr1233500 3431 484 130 ----
NM_004992chrX128047 7937 6083 5746 3162 3133 3106 1934 1532 1314 834 809 28210 7626 22159 317 --
NM_004992chrX128047 7937 6083 5746 3162 3133 3106 1934 1532 1314 834 809 28210 7626 22159 317 --
NM_004999chr663968 3575 2760 1773 627 440 ------
NM_005010chr722208 1859 21793 716 1656 --
NM_005023chr521354 1043 ------
NM_005032chrX11100 --1216 --
NM_005044chrX54360 4171 2956 1625 931 ------
NM_005056chr12----11173 11032
NM_005063chr1063488 2501 1248 535 284 43 ------
NM_005065chr1465085 4547 3528 1760 1119 109 ------
NM_005066chr11152 ------
NM_005068chr621466 1130 ----1570
NM_005073chr13163 ------
NM_005076chr1104207 3954 3783 2881 1643 1413 1093 706 220 214 --13834 --
NM_005079chr822903 2743 1540 ----
NM_005080chr22--1981 ----
NM_005087chr31839 ------
NM_005095chr111517 ------
NM_005116chr2041246 817 458 38 24048 3735 14175 --
NM_005119chr131129 149 42 1461 ----
NM_005120chrX1154 ------
NM_005121chr1742630 1134 1065 786 ------
NM_005126chr31615 ------
NM_005140chrX1779 --1413 --
NM_005144chr83868 144 39 2888 134 1448 163
NM_005154chr15----1204 --
NM_005156chr921826 1812 14342 13549 --
NM_005160chr2256027 5826 5574 672 76 46737 6073 5801 4416 ----
NM_005180chr1031265 1130 228 ------
NM_005188chr11137500 7066 5793 5779 5124 3004 2601 2516 2417 1872 972 788 442 15375 ----
NM_005190chr61868 --1719 --
NM_005197chr1446071 4134 4029 390 21088 478 26029 549 --
NM_005233chr332274 2029 421 ------
NM_005235chr226618 6259 17555 --14921
NM_005241chr321309 291 1873 ----
NM_005244chr201684 ------
NM_005249chr14180 ------
NM_005254chr151906 177 ----
NM_005256chr111231 ------
NM_005277chr41426 --11846 --
NM_005312chr9102462 2319 2241 2186 2050 1994 1668 1074 592 224 186 --12538
NM_005324chr1722114 290 ------
NM_005329chr1652084 1872 350 293 264 --11848 12090
NM_005339chr443248 2743 1297 126 --13873 --
NM_005342chrX52411 2104 1088 303 253 ------
NM_005349chr4--1416 ----
NM_005359chr1854575 4401 2122 1409 1389 1786 1203 --
NM_005374chr173922 774 511 1350 12164 1860
NM_005375chr61370 ------
NM_005387chr111709 --1148 --
NM_005399chr132955 2831 1551 14282 ----
NM_005402chr711472 --11464 --
NM_005406chr181194 ------
NM_005412chr121131 --1218 1536
NM_005414chr31109 ------
NM_005436chr1012629 --12518 13773
NM_005440chr1752183 1256 931 437 112 12087 11077 --
NM_005458chr9102339 1891 1822 1653 987 727 583 342 272 105 ----1568
NM_005465chr12689 98 3733 528 395 ----
NM_005475chr1273194 2389 2314 2253 2168 827 49 42585 2307 1218 541 12552 --
NM_005497chr1785753 5647 5311 5265 4185 2396 2166 2029 11214 35880 4229 1753 24973 195
NM_005502chr922823 2286 12062 1699 --
NM_005521chr10----1712 1543
NM_005522chr711137 --133 --
NM_005565chr51420 ------
NM_005596chr934436 1208 1023 16110 --15803
NM_005604chr661994 1016 937 502 242 230 ------
NM_005610chr12731 116 ------
NM_005613chr111357 21550 1459 ----
NM_005650chr2231136 1015 930 ------
NM_005655chr82282 178 ------
NM_005668chr554399 3281 1780 1023 932 --1799 --
NM_005677chr33940 507 203 --1435 11386
NM_005715chr642463 2345 715 244 22073 1934 11052 --
NM_005722chr21261 ------
NM_005725chr142412 1795 1784 958 ------
NM_005734chr111692 ------
NM_005738chr711621 --11759 --
NM_005748chr1232724 2412 71 12843 ----
NM_005756chrX--21044 966 ----
NM_005765chrX1710 ------
NM_005775chr8----2645 196 --
NM_005776chr14----1795 --
NM_005813chr232243 2082 531 1162 ----
NM_005828chr1774942 4389 3630 1465 1108 991 295 ------
NM_005840chrX87401 5600 5589 5482 5308 2629 1878 1116 14880 --1419
NM_005842chr132673 267 ------
NM_005845chr13135 ------
NM_005857chr1--1216 ----
NM_005859chr521075 625 ------
NM_005868chr722120 1638 --1804 --
NM_005880chr1611198 ------
NM_005898chr1111039 --1900 --
NM_005901chr1867783 7769 6796 1931 409 312 16662 --17592
NM_005904chr1821015 234 ------
NM_005906chr611710 11521 ----
NM_005909chr563898 808 556 536 529 307 ------
NM_005911chr211228 ------
NM_005920chr132648 1563 808 1560 ----
NM_005924chr73871 421 264 --1123 --
NM_005935chr434551 4481 2041 --14319 --
NM_005941chr8--33489 3171 1331 ----
NM_005955chr164202 1553 683 625 387 49 157 21985 1443 --
NM_005962chr1031954 690 452 ------
NM_005962chr1031954 690 452 ------
NM_005964chr171397 1169 ----
NM_005977chr131917 ------
NM_006003chr19--1232 ----
NM_006007chr951693 1666 1650 1285 169 13523 13769 --
NM_006011chr153516 212 57 --32662 2611 1304 --
NM_006016chr632228 1820 1747 ------
NM_006037chr264467 4120 3291 3147 3055 326 21051 360 1842 --
NM_006047chr2023235 3056 ------
NM_006080chr722885 2689 --12294 --
NM_006095chr434037 820 676 ------
NM_006106chr1133397 793 618 ------
NM_006135chr141451 1112 1100 955 ------
NM_006153chr31498 ------
NM_006154chr1531845 1167 353 --1247 --
NM_006159chr121403 --1520 --
NM_006161chr5292 47 ----1550
NM_006166chr1242413 2220 2087 2036 ------
NM_006203chr565292 2163 1478 1379 379 307 15242 ----
NM_006206chr41526 11014 --12747
NM_006224chr1762532 1866 1719 598 579 121 ------
NM_006237chr1321805 49 --11553 --
NM_006243chr1132 ------
NM_006245chr65933 878 400 368 139 ------
NM_006256chr1--11909 ----
NM_006275chr20151 1115 11000 --
NM_006278chr11----1495 --
NM_006281chr82143 108 ------
NM_006281chr82143 108 ------
NM_006282chr2043900 3309 3159 201 --11841 1434
NM_006298chr633168 2821 904 --11267 --
NM_006306chrX85245 4838 4616 4009 1138 503 477 125 --34090 3677 791 --
NM_006321chr332106 1402 99 --11530 --
NM_006345chr421212 877 ------
NM_006351chr19253 21 ----146
NM_006369chr1----2325 181 --
NM_006371chr384557 3947 3310 3263 1352 1344 1078 486 --1353 --
NM_006380chr1733692 3251 3016 1914 13937 --
NM_006386chr2221879 1586 11730 --12392
NM_006390chr1241658 1511 505 134 ------
NM_006393chr1034022 803 623 --34332 3092 140 --
NM_006449chr241708 1657 604 241 2850 38 ----
NM_006482chr1263639 3349 3269 3005 2965 1423 --12982 --
NM_006483chr191310 ------
NM_006484chr191310 ------
NM_006516chr121098 65 --11624 --
NM_006517chrX32058 1698 898 --11560 --
NM_006521chrX4538 216 157 108 ------
NM_006526chr202708 401 12047 ----
NM_006534chr2011260 13172 2918 87 --
NM_006538chr213378 --13982 --
NM_006540chr821334 291 11220 ----
NM_006544chr1414453 24646 573 ----
NM_006546chr17115867 5047 4339 4173 4088 1612 1455 1077 888 245 43 24766 613 ----
NM_006547chr741823 698 571 138 ------
NM_006559chr11417 ------
NM_006561chr1045328 1963 1102 536 --12150 --
NM_006589chr1----2395 42 --
NM_006598chr521264 530 11702 21855 35 --
NM_006599chr1647357 2725 2231 1804 35181 479 286 ----
NM_006601chr121267 ------
NM_006603chrX21301 325 ------
NM_006609chr262719 2542 1975 1156 1104 485 ------
NM_006614chr333139 2714 766 --1975 --
NM_006621chr13448 328 302 --11704 --
NM_006624chr101481 1829 ----
NM_006628chr1583893 3807 3710 3575 3372 3323 1596 118 1997 11853 --
NM_006629chr1842870 2319 2048 431 22803 2771 22076 398 --
NM_006636chr21373 ------
NM_006654chr1254664 3406 1205 817 382 13815 24330 168 11369
NM_006660chr152303 86 ------
NM_006690chr2072121 2047 1697 1444 793 629 336 ------
NM_006696chr51108 ------
NM_006706chr51626 ------
NM_006731chr964839 3887 3629 3527 577 375 11378 --15748
NM_006738chr1564002 3541 3136 1077 1027 487 1990 1732 1601
NM_006751chr2179 ------
NM_006759chr2178 --183 --
NM_006775chr61120 1755 ----
NM_006791chr151488 ------
NM_006802chr141082 991 324 142 ------
NM_006807chr1711288 ------
NM_006813chr61344 1314 ----
NM_006827chr1442374 2335 101 76 13334 ----
NM_006854chr712047 171 ----
NM_006874chr41932 ------
NM_006884chr321314 199 11284 11459 --
NM_006885chr161266 11271 13676 --
NM_006902chr122188 1053 ------
NM_006912chr132356 2205 2046 --11985 --
NM_006918chr1151922 1433 1074 825 139 ------
NM_006920chr21501 ------
NM_006930chr52663 636 ------
NM_006943chr2093162 2524 2268 2048 1115 1015 934 604 61 ------
NM_006948chr2132453 1947 457 1242 ----
NM_006981chr92470 221 ------
NM_007011chr15166217 5386 5057 4982 4899 4870 4863 2578 2504 2328 1692 1012 613 223 155 125 ----24950 4944
NM_007030chr584048 3502 3185 1655 1134 825 421 288 14723 ----
NM_007034chr12156 37 ------
NM_007036chr52927 319 ------
NM_007038chr2165971 4754 4450 3720 1224 743 25023 2158 --15462
NM_007039chr1421641 1517 21423 733 ----
NM_007040chr191205 --1182 --
NM_007107chr311633 11525 --1625
NM_007146chr1742596 910 807 550 12052 ----
NM_007173chr1141604 1484 547 524 1228 ----
NM_007175chr843343 3267 1075 199 ------
NM_007200chr1564002 3541 3136 1077 1027 487 1990 1732 1601
NM_007203chr943955 1450 1375 318 ----12433
NM_007235chr121169 ------
NM_007249chr13109367 9013 8057 6458 2491 2456 938 838 552 545 21251 146 28598 245 --
NM_007341chr211325 ------
NM_007345chr183777 437 241 --1230 --
NM_007347chr1543157 2768 2504 1158 --22648 2368 --
NM_007358chr111583 150 ----
NM_007375chr11814 ------
NM_012081chr522610 2269 ------
NM_012095chr10169 --13137 --
NM_012102chr122226 1970 ------
NM_012120chr612308 11123 ----
NM_012141chr1311297 12950 ----
NM_012157chr34295 123 114 35 ------
NM_012161chr4--1975 --11055
NM_012164chr975293 2830 2755 2482 1284 1178 824 16151 --27219 4942
NM_012183chr11248 ------
NM_012193chr1145278 5272 5006 4734 11989 ----
NM_012197chr931322 499 164 ------
NM_012214chr276265 5991 5486 4284 3894 1635 1397 --34121 2459 1264 --
NM_012218chr1922250 486 22684 2484 22043 1901 --
NM_012238chr101225 ------
NM_012247chr10----1324 --
NM_012249chr212427 1237 --12911
NM_012252chr733938 1530 799 33625 1306 265 1945 14760
NM_012257chr71255 ------
NM_012261chr20151 ------
NM_012262chr134145 3849 1973 --1191 --
NM_012281chr71537 ------
NM_012286chrX1476 ------
NM_012287chr343718 1509 644 130 --11376 --
NM_012288chr621223 629 1597 31507 809 287 --
NM_012294chr743077 2866 2733 689 ------
NM_012296chr1121332 186 11048 11383 21126 1031
NM_012301chr73861 112 41 ------
NM_012306chr1282679 2633 2570 2213 1292 1276 852 795 22968 407 22620 459 12997
NM_012309chr1144326 1756 406 351 --13530 21069 1021
NM_012319chr181159 ------
NM_012327chr182515 235 --1195 --
NM_012329chr1731513 1507 1118 ------
NM_012334chr543842 3233 1189 522 23823 3032 24080 1618 --
NM_012384chr2032392 96 72 21920 937 1676 --
NM_012417chr17------1414
NM_012425chr1011001 ----12193
NM_012428chr15------1170
NM_012443chr103807 256 222 --1746 --
NM_012454chr61239 ------
NM_012464chr4--12687 12872 --
NM_013230chrY1413 ------
NM_013255chr745561 3188 600 307 22452 1198 11079 --
NM_013272chr151264 --1306 1112
NM_013281chr201607 11527 ----
NM_013283chr52619 123 ------
NM_013293chr71474 ------
NM_013396chr211454 ------
NM_013411chr122701 2055 ------
NM_013444chrX2800 380 ------
NM_013446chr731110 1042 92 --11009 --
NM_013448chr141506 ------
NM_013449chr1222781 915 --12147 --
NM_013989chr1444563 4432 1240 662 24068 1700 ----
NM_013995chrX21859 364 ------
NM_013996chr7157 ------
NM_013996chr7157 ------
NM_013997chr7157 ------
NM_013997chr7157 ------
NM_013998chr7157 ------
NM_013998chr7157 ------
NM_014000chr1031362 416 254 ------
NM_014011chr23711 615 584 ------
NM_014016chr3------1429
NM_014038chr7----1317 --
NM_014043chr31351 ------
NM_014044chr2------1157
NM_014048chr1664678 4651 3444 1686 936 706 ------
NM_014057chr9--1401 ----
NM_014089chr1361757 1490 1476 691 563 514 ------
NM_014106chr1522484 229 --2844 115 --
NM_014112chr8115470 5196 5039 4920 4355 4263 4236 2117 1047 805 463 14169 ----
NM_014117chr161255 ------
NM_014141chr742098 682 279 129 34894 3359 3264 23964 1850 --
NM_014154chr3--166 ----
NM_014155chr1156781 6126 5932 1665 1388 --25910 5422 --
NM_014157chr1693964 3751 3572 3421 2639 2508 1133 894 214 13154 ----
NM_014159chr3136 ------
NM_014166chr132411 102 ------
NM_014171chr2--165 ----
NM_014181chr242269 2157 1960 1887 ------
NM_014186chr1151433 921 804 473 102 ----1874
NM_014190chr441639 635 608 275 11451 ----
NM_014214chr181332 ------
NM_014217chr11707 21199 27 1763 11311
NM_014221chrX2142 74 ------
NM_014240chr313399 11104 33679 1075 762 23652 876
NM_014243chr411877 ------
NM_014246chr225880 844 423 406 363 --1208 1330
NM_014253chrX------1959
NM_014283chr11110 ------
NM_014309chr2253952 1564 1171 1164 501 --15007 --
NM_014323chr221980 ------
NM_014333chr1122369 2000 ------
NM_014338chr224743 689 128 90 ------
NM_014368chr931736 1571 724 11582 11660 --
NM_014382chr31428 ------
NM_014391chr10152 ------
NM_014392chr431542 980 173 --11275 --
NM_014393chr812064 1565 --1467
NM_014423chr555314 5237 5153 4909 3900 ------
NM_014426chr201591 ------
NM_014445chr31423 22064 954 ----
NM_014447chr411363 ------
NM_014454chr6166 ------
NM_014488chr111238 --1522 --
NM_014497chr2----1195 --
NM_014504chr721477 1446 1123 1822 --
NM_014505chr12------1153
NM_014507chr2221058 297 --1163 1173
NM_014517chr331603 1418 511 1672 --1253
NM_014572chr1311548 ------
NM_014574chr14------1130
NM_014575chr3----1195 --
NM_014584chr1411523 171 ----
NM_014586chr2174736 4608 3994 3185 1537 858 322 2928 904 --14371
NM_014602chr3164 ------
NM_014612chr911246 1481 ----
NM_014615chr16------11334
NM_014621chr2199 ------
NM_014629chr831199 836 517 --21204 407 --
NM_014630chr1573328 1568 1204 911 831 715 683 23890 773 1688 --
NM_014634chr2273238 2770 1357 1254 1038 194 86 12578 ----
NM_014647chr1611565 ------
NM_014665chr8123305 3267 3163 3126 3054 3019 2631 2511 2448 1473 1032 53 32643 527 139 33107 2958 444 --
NM_014679chr111378 ------
NM_014683chr1721971 427 1647 11651 --
NM_014690chr751104 1075 1018 647 544 11250 --1522
NM_014703chr371267 1222 1090 924 487 179 108 ------
NM_014705chr731396 492 82 21957 834 ----
NM_014711chr1632104 1683 677 ------
NM_014717chr191723 ------
NM_014719chr72843 289 ------
NM_014720chr1011364 ------
NM_014730chr1264873 4550 3275 1946 1858 416 24571 3299 ----
NM_014730chr1264873 4550 3275 1946 1858 416 24571 3299 ----
NM_014733chr51135 11754 ----
NM_014737chr2083569 1607 1476 1448 1337 327 71 27 ------
NM_014739chr611165 --13813 --
NM_014741chr1111370 ------
NM_014747chr134325 1578 860 --21601 1278 --
NM_014755chr263854 3398 2912 2643 1247 484 ----1784
NM_014765chr142021 1697 1679 340 1394 ----
NM_014767chr1053518 2756 1122 825 62 ------
NM_014772chr1873369 486 382 122 70 33 22 11033 1523 1648
NM_014779chr311151 ------
NM_014788chr931875 1195 295 1380 132 --
NM_014802chr121149 ------
NM_014810chr123353 471 --2833 825 --
NM_014826chr163772 3664 3553 3055 2894 837 ------
NM_014838chr2212725 --2384 111 --
NM_014839chr121701 771 ------
NM_014849chr12947 384 --11028 134
NM_014850chr363943 3222 1529 1130 851 727 ------
NM_014877chr1757139 5815 5346 1488 629 17446 26179 6045 1643
NM_014883chr442397 1026 587 203 ------
NM_014884chr19----133 --
NM_014897chr1722877 2736 --22604 2229 --
NM_014904chr1011020 23818 516 --13955
NM_014906chr1744091 2976 943 466 ----1854
NM_014912chr1032162 1031 62 13012 ----
NM_014915chr1011446 ------
NM_014920chr633212 2905 499 --23193 1539 --
NM_014921chr1942367 2358 2350 1978 12458 ----
NM_014924chr1442595 2003 1157 504 1868 12921 11110
NM_014932chr31285 ----1545
NM_014934chr1333346 3056 283 13208 --13412
NM_014939chr18--11418 ----
NM_014953chr1363934 3910 1212 1093 1068 634 23570 1673 13023 13523
NM_014962chr2052486 2049 1908 163 124 11939 ----
NM_014977chr14--173 127 --
NM_014990chr14173 ------
NM_014991chr4174 --13272 --
NM_015000chr122236 40 ------
NM_015009chr31801 1787 ----
NM_015011chr13--11155 ----
NM_015020chr162964 66 --1247 --
NM_015026chr1244260 3748 3355 996 13037 ----
NM_015032chr1332735 1984 552 12852 ----
NM_015035chr2095026 4912 4799 2645 2375 2142 1659 493 115 36328 1523 510 ----
NM_015042chr1563543 2943 2760 943 668 285 ------
NM_015050chr651189 1089 287 266 167 1983 ----
NM_015051chr943108 2839 2708 2616 ----12382
NM_015062chr101188 ------
NM_015068chr723186 2954 1116 ----
NM_015071chr574432 4111 1994 1909 500 451 291 --12065 --
NM_015074chr184611 3980 3299 3085 1620 1127 1069 840 15001 33327 1947 416 21435 1080
NM_015079chr1542108 2087 1259 535 --1853 2609 568
NM_015090chr1104911 4576 4298 4067 1588 1117 1024 909 834 492 34905 4563 1721 ----
NM_015094chr2284361 3847 3652 3614 3281 2913 898 318 --11418 11364
NM_015097chr312045 --12050 --
NM_015115chr443057 2760 1068 689 1522 ----
NM_015156chr1443445 2512 346 58 1127 ----
NM_015163chr141702 --1777 --
NM_015170chr811475 1287 1550 --
NM_015172chr1----11231 --
NM_015185chrX2723 252 --11916 --
NM_015199chr331110 412 65 ------
NM_015203chr1121 ------
NM_015205chr1374145 3791 3390 1866 1074 880 257 ------
NM_015209chr132299 1928 33 11847 ----
NM_015216chr521364 128 ------
NM_015245chr642644 2399 635 505 ------
NM_015256chr5------1763
NM_015263chr15163 144 ----
NM_015270chr1241852 1748 507 89 --21967 444 --
NM_015271chr453461 2867 1215 1060 987 ------
NM_015275chr1221427 754 1512 ----
NM_015277chr182342 276 --1108 --
NM_015278chr632981 2822 672 ------
NM_015285chr1842106 1977 239 197 11651 ----
NM_015288chr543374 3290 2514 1176 23403 3117 13091 --
NM_015291chr143011 2573 1261 61 --13491 --
NM_015299chr1433154 1225 102 23233 1112 13896 --
NM_015305chr142631 579 --1427 --
NM_015313chr1123261 1348 14581 21098 767 --
NM_015316chr142868 197 ------
NM_015317chr2----12400 12034
NM_015328chr712912 1921 ----
NM_015335chr12------2669 147
NM_015355chr1711244 --1105 --
NM_015365chrX1523 1790 13119 --
NM_015375chr173654 1873 1840 1726 1628 514 144 --34268 4256 697 13520
NM_015397chr931322 483 136 ------
NM_015423chr1111586 ------
NM_015435chr81147 ------
NM_015442chr31241 ------
NM_015455chr554019 3255 2946 2777 1591 ------
NM_015461chr182555 271 ------
NM_015475chr23861 689 108 ------
NM_015530chr21107 ------
NM_015535chr21239 --43796 2621 1153 1018 13451
NM_015564chr5--23398 2539 13379 --
NM_015565chr212551 48 ------
NM_015569chr133818 331 110 13459 ----
NM_015578chr1921637 581 ------
NM_015601chr10192 ------
NM_015604chr141227 ------
NM_015608chr101113 --1586 --
NM_015630chr21851 ------
NM_015635chr911407 --21373 121 11646
NM_015640chr113898 24262 823 ----
NM_015678chr1321274 1106 ------
NM_015680chr21598 ------
NM_015686chrX52272 2163 1982 616 465 1382 --1880
NM_015691chrX42495 2473 2147 324 --1714 --
NM_015718chr6----124 --
NM_015850chr842386 2185 989 744 --2323 284 --
NM_015874chr4--1416 ----
NM_015886chr854571 4155 1235 1102 733 11895 14332 --
NM_015906chr164342 4234 3901 3203 2982 116 ------
NM_015938chr31274 1888 ----
NM_015948chr6198 ------
NM_015975chrX11527 ------
NM_015976chr11143 ------
NM_015980chr51241 --11209 --
NM_016018chr822763 2609 --1666 --
NM_016032chrX--1987 1554 --
NM_016072chr121371 ------
NM_016076chr141189 796 428 363 1417 ----
NM_016083chr61171 --11360 --
NM_016100chr20123 ------
NM_016125chr172240 67 ------
NM_016132chr1523058 649 1825 ----
NM_016152chr3------11045
NM_016156chr1112205 ------
NM_016173chr364066 3661 3327 1056 411 318 1802 23770 1242 --
NM_016206chr347142 2571 1713 1080 32634 2484 103 --17662
NM_016221chr552320 1832 606 154 148 ------
NM_016227chr11110 ------
NM_016230chr61154 ------
NM_016231chr17--11643 ----
NM_016242chr4131 ------
NM_016260chr264657 2456 1949 1906 1732 630 25261 279 ----
NM_016272chr2232134 1777 1752 --21974 145 --
NM_016287chr11153 1416 ----
NM_016320chr113996 958 913 --1889 --
NM_016329chr31109 1460 ----
NM_016333chr161477 ------
NM_016351chr71248 1488 ----
NM_016377chr61675 ------
NM_016424chr1711360 2453 196 2718 705 11376
NM_016436chr2032650 725 42 2396 30 1444 11055
NM_016441chr21597 --1830 --
NM_016472chr14----11088 --
NM_016485chr62777 698 ------
NM_016513chr633212 2905 499 --23193 1539 --
NM_016542chrX3630 610 560 ------
NM_016577chr3104124 3819 3760 3649 3630 3564 2782 1620 743 658 --23088 2756 --
NM_016603chr522115 577 --199 --
NM_016617chr131247 --21769 80 --
NM_016626chr18151 ------
NM_016628chr101648 --1800 --
NM_016654chr151906 177 ----
NM_016830chr121530 ------
NM_016937chrX1670 ------
NM_016952chr1162859 1408 1251 895 871 703 --22565 579 --
NM_017412chr821264 181 ------
NM_017416chrX--1115 ----
NM_017420chr1433133 2590 2570 11023 1714 --
NM_017443chr931466 102 34 ------
NM_017455chr15------1170
NM_017456chr1731798 1617 1344 ------
NM_017519chr61518 ------
NM_017548chr311743 11989 12155 --
NM_017553chr1531037 480 139 --11024 1318
NM_017563chr3125831 5698 5692 4260 4210 4067 1861 1700 1603 742 416 220 --13933 --
NM_017580chr103963 367 33 ------
NM_017582chr1----2253 35 --
NM_017590chr2252447 2058 1868 881 114 ----1182
NM_017592chr1952451 2242 2184 1879 27 --32570 913 885 22408 2226
NM_017610chr1522106 305 ------
NM_017628chr464665 4531 4279 1885 293 248 14009 24239 1535 1545
NM_017629chr12654 618 ------
NM_017633chr613828 11008 ----
NM_017634chr831709 773 318 1692 --1288
NM_017637chr947198 7183 1442 1208 26920 954 --13579
NM_017641chr122451 86 ------
NM_017643chr17------12025
NM_017644chr354256 3926 3493 1162 404 11884 1561 1870
NM_017650chr745953 5483 3732 615 11757 14112 --
NM_017651chr621438 483 11390 1633 11558
NM_017658chr1443160 3031 1731 1236 ------
NM_017671chr2062229 1699 565 427 234 48 --11651 1846
NM_017681chrX----146 --
NM_017709chr141258 477 84 58 --12615 --
NM_017714chr20135 1890 ----
NM_017737chr1----1487 --
NM_017742chr1811230 ------
NM_017745chrX1469 ------
NM_017768chr11917 ------
NM_017780chr8----1734 --
NM_017786chr83259 180 54 ------
NM_017787chr1032764 2523 780 1203 --22256 165
NM_017813chr855744 5039 4927 1153 876 24825 250 14420 12083
NM_017824chr1042391 2105 1783 399 --1933 --
NM_017848chrX23837 3421 ------
NM_017849chr253005 2553 1157 772 639 --12417 --
NM_017866chr81725 ------
NM_017902chr1065673 5537 4941 2043 1275 1241 14864 ----
NM_017913chr91343 ------
NM_017915chr121360 ------
NM_017919chr954738 2321 1435 1347 228 --14242 11899
NM_017923chr41289 ------
NM_017934chr6------144
NM_017943chr141347 --1137 --
NM_017955chr1421076 200 --1813 --
NM_017987chr1021964 1457 ------
NM_017994chr722806 2529 --22882 2653 --
NM_018003chr152633 220 --11701 --
NM_018043chr1151418 408 69 51 34 ------
NM_018045chr142218 2138 1225 359 --12267 --
NM_018060chr11394 ------
NM_018062chr21118 ------
NM_018063chr101349 ------
NM_018073chr1131362 1043 81 11352 ----
NM_018084chr222624 168 --13214 --
NM_018086chr21551 ------
NM_018131chr101825 1611 ----
NM_018133chr311510 ------
NM_018157chr1252902 2250 659 398 182 ------
NM_018159chrX21099 448 ------
NM_018211chr121782 142 22237 2080 ----
NM_018241chr4--1870 --1129
NM_018299chr863445 2637 2481 1183 186 108 22692 672 ----
NM_018313chr322493 817 --1822 --
NM_018364chr132551 1350 1073 13195 --11123
NM_018374chr734705 3779 988 14834 ----
NM_018383chr21119 11558 --11358
NM_018424chr931855 1812 1358 11691 ----
NM_018427chr1621702 333 ------
NM_018429chr532749 2189 1107 ------
NM_018440chr878679 8661 6912 3227 2727 2291 176 --16280 1226
NM_018452chr6_random63821 3399 3385 3063 2756 1495 1655 ----
NM_018489chr152122 1784 667 384 139 --1354 --
NM_018490chr111510 ------
NM_018584chr11958 11047 ----
NM_018650chr11220 151 ----
NM_018667chr1662504 2176 2166 2122 2057 515 12432 12101 1750
NM_018674chr21720 ------
NM_018682chr7174 ------
NM_018689chr1542642 2440 1887 793 ------
NM_018695chr511710 ----12088
NM_018704chr121414 216 ------
NM_018710chr81986 ------
NM_018712chr111248 ------
NM_018717chr411829 11997 1566 --
NM_018837chr203792 56 38 ------
NM_018841chr153395 1348 1094 881 835 23029 1216 ----
NM_018948chr11534 11239 ----
NM_018958chr1522577 2549 ----1805
NM_018970chr732953 2920 1047 11149 ----
NM_018976chr1221875 889 1604 ----
NM_018981chr21946 ------
NM_018993chr2031302 510 293 ------
NM_018999chr1054666 4340 3785 1037 932 ----13891
NM_019001chr3--1976 23146 146 --
NM_019004chr732011 1565 641 ----138
NM_019016chr17184 ------
NM_019035chr421445 340 ----11845
NM_019046chr10----1668 --
NM_019058chr101527 ------
NM_019063chr241930 1505 1423 64 ----11843
NM_019080chr13--11453 ----
NM_019084chr1011757 --1120 --
NM_019087chr5--1705 ----
NM_019593chr2022289 181 12674 ----
NM_019596chr212876 563 --22550 885 1431
NM_019605chr1----1173 --
NM_019606chr71455 --1463 --
NM_019842chr6----1355 125
NM_019891chr1------11289
NM_020116chr4--1623 ----
NM_020122chr245218 4623 3800 193 --13642 --
NM_020144chr731309 602 418 ----11884
NM_020148chr1822629 1064 22314 2123 ----
NM_020159chr41625 ------
NM_020177chr523046 1086 12219 --12851
NM_020194chr21532 1681 ----
NM_020198chr1721152 623 ------
NM_020199chr5181 ------
NM_020200chr10----191 --
NM_020205chr112873 1245 ----
NM_020245chr634984 601 255 13430 ----
NM_020319chr71693 1656 ----
NM_020337chr42815 719 ------
NM_020340chr642037 1699 636 610 ------
NM_020341chr20--11596 1179 --
NM_020357chr311520 ------
NM_020374chr1241969 1640 1250 329 11997 11415 --
NM_020384chrX21488 700 ----11907
NM_020403chr1321424 1220 --11307 --
NM_020432chr7--11798 ----
NM_020449chrX1562 ------
NM_020456chr1321561 1502 ------
NM_020466chr674876 4485 4396 3381 1748 1535 938 13590 11239 --
NM_020473chrX31626 1257 236 ------
NM_020638chr121245 ------
NM_020640chr31911 --11484 --
NM_020666chr51832 ------
NM_020699chr131993 1711 1522 13383 ----
NM_020713chr2072829 1950 1223 919 446 425 312 1192 32177 2075 389 --
NM_020715chr1422301 827 --1594 --
NM_020718chr162574 220 12559 ----
NM_020732chr61518 ------
NM_020734chr1233296 3071 2359 ------
NM_020739chr1511346 1485 23537 3138 11612
NM_020747chr52615 104 ------
NM_020752chr1042735 1176 324 135 ------
NM_020760chr231856 571 35 --11645 --
NM_020766chrX53885 3002 1237 1230 175 ------
NM_020769chrX2360 300 ----2849 130
NM_020771chr61104 ------
NM_020772chr1728287 2050 12784 ----
NM_020779chr212478 ----12642
NM_020783chr1822103 42 ------
NM_020796chr542622 1842 1134 38 ------
NM_020801chr512350 --11058 --
NM_020803chr422319 381 145 12185 --
NM_020805chr181543 ------
NM_020810chr1452799 2486 2402 1137 419 ------
NM_020814chr27996 472 452 333 305 299 99 ------
NM_020841chr121666 12692 --1425
NM_020850chr1643030 3007 2657 73 --23106 537 --
NM_020854chr1821505 1407 ------
NM_020856chr1921200 57 --1991 1330
NM_020886chr111953 2179 103 --1328
NM_020918chr1053558 1105 847 572 56 ----1869
NM_020919chr211289 ------
NM_020924chr92325 144 1313 ----
NM_020925chr111273 ------
NM_020940chr1021807 363 22664 1132 ----
NM_020948chr153203 3168 2644 2305 1214 ------
NM_020951chr191859 --31904 1775 1602 --
NM_020952chr92354 216 ------
NM_020956chr1984124 3923 3603 3221 1256 817 446 426 43900 3745 1845 1767 13699 --
NM_020962chr1542475 962 295 32 --12016 --
NM_020983chr1241852 1748 507 89 --21967 444 --
NM_020993chr1282275 2138 1841 923 717 627 567 234 32714 679 43 1646 --
NM_021003chr141644 ------
NM_021007chr232437 2030 561 ------
NM_021020chr843347 3115 2861 585 22211 1170 1856 13047
NM_021032chr321863 1773 11373 ----
NM_021033chr1312404 1238 11072 --
NM_021038chr333134 2973 768 --12761 --
NM_021072chr5--12335 ----
NM_021097chr232123 990 201 12373 --1704
NM_021132chr1011290 --1883 --
NM_021144chr9--1217 ----
NM_021145chr7121 141 ----
NM_021148chr711770 --1975 --
NM_021159chr41142 ------
NM_021184chr65617 573 472 191 60 ------
NM_021202chr2052656 1919 1025 759 508 21038 634 ----
NM_021213chr171939 11088 ----
NM_021238chr1211666 ------
NM_021239chr142991 461 ----1218
NM_021627chr3----1112 --
NM_021629chr344806 4402 537 184 --13194 1407
NM_021638chr4114764 3913 1979 1958 1865 1357 765 562 442 419 276 23169 1193 34030 3320 3174 --
NM_021647chr421801 1643 13155 --13674
NM_021722chr71207 1447 ----
NM_021723chr71248 1488 ----
NM_021728chr14--1135 173 --
NM_021738chr101301 ------
NM_021785chrX168 ------
NM_021813chr644934 4438 215 46 --23605 1241 --
NM_021814chr621585 1262 ------
NM_021907chr2--194 --134
NM_021911chr522136 1516 12243 11521 --
NM_021912chr1533860 3391 587 --11530 13491
NM_021935chr31212 ------
NM_021945chr663317 2484 1395 1187 1131 837 22652 49 22837 1373 --
NM_021961chr1157139 7079 2169 1508 712 ------
NM_021964chr344769 2099 2067 784 ------
NM_021979chr141408 ------
NM_021999chr131534 ------
NM_022037chr21956 ------
NM_022048chr1566084 4414 2056 1666 696 159 --14448 --
NM_022075chr11187 ------
NM_022079chr10192 ------
NM_022091chr622415 711 1193 ----
NM_022116chr7124 ------
NM_022137chr1421496 437 11450 51993 1401 1392 725 383 --
NM_022154chr4135 ------
NM_022173chr21956 ------
NM_022336chr24860 740 591 230 ------
NM_022340chr383181 2849 2587 2457 1367 912 827 72 --23369 2309 13146
NM_022351chr81544 ------
NM_022373chr71958 ------
NM_022374chr21372 ------
NM_022459chr1352096 1987 1416 389 289 ----11371
NM_022462chr1953806 3601 3349 1159 1024 --23423 2895 23412 2304
NM_022465chr121582 12431 2662 53 --
NM_022473chr1543706 1731 1330 772 ----1126
NM_022475chr41711 ------
NM_022477chr2021469 452 --21371 1236 --
NM_022484chr7--21039 348 11093 --
NM_022497chr323635 2509 --23128 622 --
NM_022726chr611595 1675 ----
NM_022739chr171293 ------
NM_022745chr132676 590 183 --1437 1610
NM_022749chr83929 446 209 --11036 11149
NM_022751chr181262 ------
NM_022776chr32546 143 ----11145
NM_022828chr521603 1288 ------
NM_022841chr1512340 12016 2761 726 --
NM_022845chr162130 104 ------
NM_022893chr222994 2278 ------
NM_022898chr1434408 1330 787 --24629 268 --
NM_022901chr91327 --21246 100 1579
NM_022977chrX21645 833 ------
NM_023016chr231859 661 500 42712 1053 733 717 ----
NM_023037chr13----1860 --
NM_023071chr1211102 ------
NM_023105chr842386 2185 989 744 --2323 284 --
NM_023106chr842386 2185 989 744 --2323 284 --
NM_023110chr842386 2185 989 744 --2323 284 --
NM_023111chr842386 2185 989 744 --2323 284 --
NM_024007chr511031 ----1893
NM_024063chr15--1179 ----
NM_024090chr411598 ------
NM_024094chr82599 113 ------
NM_024315chr71367 ------
NM_024345chr925311 4730 --22186 177 11548
NM_024416chr9--1401 ----
NM_024496chr14--1310 ----
NM_024529chr1--11094 1932 --
NM_024539chrX21137 209 ------
NM_024567chr81117 ------
NM_024569chr142835 2549 964 178 12187 ----
NM_024581chr61177 ------
NM_024594chr531695 1662 61 ------
NM_024596chr884985 4845 4676 4377 3852 3395 1330 1309 35101 5091 3883 ----
NM_024612chr171441 ------
NM_024624chr221491 96 ------
NM_024639chr632832 2467 959 ------
NM_024641chr612645 ------
NM_024643chr14154 ------
NM_024656chr1921561 162 21129 314 21053 381 --
NM_024659chr21673 ----1631
NM_024674chr1155 --32436 2361 2229 1792
NM_024713chr15----11281 --
NM_024721chr81869 ------
NM_024740chr1163754 3382 1088 1004 987 227 23809 972 13204 13069
NM_024749chr142291 875 596 182 ------
NM_024751chr431996 1362 482 --1569 --
NM_024753chr21538 --1672 --
NM_024755chr151737 1234 ----
NM_024761chr965048 4871 4030 3504 1738 61 14847 ----
NM_024770chr286679 6437 5948 5372 4194 2066 2053 696 25941 23 25878 783 --
NM_024779chr1211308 --1535 --
NM_024795chr211171 --1573 11384
NM_024817chr1545380 4278 4228 704 14237 21819 105 14284
NM_024824chr1421554 477 ------
NM_024830chr53706 539 276 --1108 --
NM_024854chr12--11155 11447 --
NM_024881chr1943444 1237 1188 849 --23212 3076 11057
NM_024884chr141384 1891 21064 180 --
NM_024887chr141681 634 455 80 11887 ----
NM_024947chr368327 7210 6541 2995 2014 157 --28818 7577 --
NM_024949chr424405 4272 --11247 --
NM_024953chr125842 680 582 62 21 --1603 1532
NM_024971chr92354 216 ------
NM_024989chr228141 2452 25352 2506 ----
NM_025047chr31386 ------
NM_025054chr812588 ------
NM_025057chr142290 197 ------
NM_025058chr11653 ----1764
NM_025074chr441147 1085 709 374 ----12106
NM_025106chr11557 1756 --21430 778
NM_025126chr121605 ------
NM_025134chr161239 ----1526
NM_025160chr113039 14092 ----
NM_025179chr144582 3537 1570 273 14018 11015 --
NM_025187chr161430 --1364 --
NM_025191chr142876 2696 2421 692 ------
NM_025195chr821484 1457 ------
NM_025203chr251508 1359 1139 1032 104 --1616 --
NM_025208chr1121875 717 ----22135 320
NM_025212chr4129 ------
NM_025221chr411297 ------
NM_030621chr1443384 1343 1309 941 ------
NM_030625chr101257 ------
NM_030627chr521257 712 ------
NM_030640chr121660 ------
NM_030647chr756061 5912 4334 2339 1544 14155 13865 15137
NM_030648chr434419 1880 1556 21667 1076 ----
NM_030650chr264146 4061 3827 3519 3300 523 1678 ----
NM_030670chr1211519 --11479 --
NM_030671chr1211519 --11479 --
NM_030762chr121465 1596 --1138
NM_030791chr1461653 1511 1436 603 433 69 1294 1722 --
NM_030799chr51769 12194 ----
NM_030806chr1108874 8501 7931 7633 7067 6499 5937 5835 5692 270 18767 16585 19135
NM_030809chr1232407 804 385 ------
NM_030815chr20----1308 1529
NM_030881chr2221879 1586 11730 --12392
NM_030934chr111235 --11761 --
NM_030939chr61414 ------
NM_030949chr61553 --11377 --
NM_030953chr521523 1032 --1339 --
NM_030962chr1131578 578 296 ------
NM_030981chr114775 218 71 33 --21156 495 --
NM_031216chr1811612 ------
NM_031243chr732368 1920 765 ------
NM_031284chr151266 ----1120
NM_031417chr1962539 2261 1991 1006 762 534 12377 1217 --
NM_031419chr34995 350 214 48 ------
NM_031422chr182523 500 ------
NM_031427chr1474137 4112 2243 2049 1958 1527 1055 ------
NM_031442chrX22166 218 ------
NM_031459chr131374 1259 410 1285 21460 1287 --
NM_031462chrX----123 --
NM_031468chr7127356 6813 5994 5537 3170 2827 2453 1249 539 365 337 60 --37708 5417 3124 --
NM_031483chr2043482 2946 743 416 --13052 --
NM_031844chr123135 1302 23984 3217 --14113
NM_031845chr243608 2997 2388 39 ------
NM_031847chr243608 2997 2388 39 ------
NM_031866chr101849 ------
NM_032013chr2021469 452 --21371 1236 --
NM_032021chr111936 ------
NM_032042chr522705 2314 ------
NM_032047chr342056 1560 734 401 ------
NM_032050chr221980 ------
NM_032052chr2211365 ------
NM_032105chr155419 4941 2319 1571 673 27196 792 23090 2332 --
NM_032146chr31157 ------
NM_032148chr12------1413
NM_032182chr101265 ------
NM_032199chr1033852 1554 592 --2362 237 --
NM_032221chr2021281 667 1215 ----
NM_032228chr1133173 2903 988 13064 ----
NM_032229chr132997 190 11066 ----
NM_032239chr411376 --11213 --
NM_032268chr1642151 1189 278 116 --23043 817 --
NM_032271chr1621366 133 11225 3604 434 217 11072
NM_032281chr1982860 2703 1248 1117 533 491 103 37 1973 ----
NM_032287chr2273171 3000 2887 2621 1067 549 41 23253 294 ----
NM_032316chr352379 839 736 686 633 --12434 --
NM_032364chr12------2393 250
NM_032436chr132394 278 ------
NM_032438chr6----1192 --
NM_032452chr1441155 977 466 460 ------
NM_032457chr443282 2876 1096 1065 1538 ----
NM_032505chr322694 281 12377 ----
NM_032509chr811740 ----11617
NM_032511chr6167 ------
NM_032580chr171426 ------
NM_032582chr1751715 1278 766 512 222 ------
NM_032632chr14------11758
NM_032682chr342863 2545 2526 1105 ------
NM_032689chr192126 26 ------
NM_032778chr333122 1124 513 1264 12259 1170
NM_032796chrX3728 249 87 --1741 --
NM_032804chr101665 --1164 11766
NM_032810chr1011191 1539 --11085
NM_032813chr132741 731 150 ----
NM_032828chr1984340 4329 3764 3256 1476 1427 1336 765 14390 44273 1776 474 409 14464
NM_032842chr7----1522 --
NM_032859chr1323385 2643 1708 ----
NM_032864chr121089 85 ------
NM_032873chr1174267 3780 3739 3645 3521 3503 256 ------
NM_032876chr1431936 1787 656 21796 246 ----
NM_032906chr4181 ----1309
NM_032918chr122330 287 ----1913
NM_032966chr1151535 1506 1066 619 44 1236 ----
NM_032995chr241540 1138 468 327 --1187 1598
NM_032998chr11986 ------
NM_033014chr9--1401 ----
NM_033020chr164342 4234 3901 3203 2982 116 ------
NM_033119chr163944 803 62 ------
NM_033133chr1733098 999 220 12334 --11377
NM_033135chr1121875 717 ----22135 320
NM_033138chr721859 451 11810 ----
NM_033139chr721859 451 11810 ----
NM_033140chr721859 451 11810 ----
NM_033143chr424172 1691 11759 --12948
NM_033147chr2--194 --134
NM_033148chr2--194 --134
NM_033157chr721859 451 11810 ----
NM_033181chr61171 --11360 --
NM_033211chr5----1175 --
NM_033224chr736202 5213 1629 22633 838 16871 1855
NM_033225chr8--22983 255 ----
NM_033227chr51498 ------
NM_033228chr51538 ------
NM_033272chr21104 ------
NM_033274chr552938 2556 660 393 243 --1648 --
NM_033285chr853803 3721 1132 696 334 --1866 1609
NM_033326chr1132152 696 383 ------
NM_033360chr1233621 3552 605 1151 ----
NM_033387chr91733 12649 ----
NM_033389chr1774716 4340 4036 3520 3387 448 337 --13712 --
NM_033394chr2--11206 ----
NM_033396chr11139 1147 1395 --
NM_033425chr1132269 817 448 21035 786 ----
NM_033426chr1442108 1936 660 490 2528 178 ----
NM_033430chr463973 3842 3623 3309 623 538 12866 ----
NM_033437chr463973 3842 3623 3309 623 538 12866 ----
NM_033449chr54638 624 558 474 11720 11436 --
NM_033503chr1553732 3469 3294 65 29 1750 --11318
NM_033505chr224385 1339 ------
NM_033512chr822809 1958 ------
NM_033515chr61449 ------
NM_033535chr4--1975 --11055
NM_033550chr2072339 1808 1797 1729 774 638 185 1847 11680 --
NM_033631chr1103697 3248 3195 2719 1485 1010 953 718 147 94 ------
NM_033656chr2144960 3646 1986 497 11641 ----
NM_052834chr1842106 1977 239 197 11651 ----
NM_052840chr152637 526 --11474 --
NM_052845chr1252835 2593 1259 593 270 ------
NM_052847chr1973397 3094 2485 2427 1124 953 75 23326 2330 11087 --
NM_052860chr51708 ------
NM_052874chr163575 206 117 ----1633
NM_052875chr1162183 2036 1528 1360 657 29 --21901 586 --
NM_052898chr811537 ------
NM_052902chr21233 ------
NM_052905chr21613 ----11586
NM_052906chr2294830 4667 4620 3102 1790 928 715 489 69 13429 ----
NM_052910chr132696 463 --162 --
NM_052911chr181705 ------
NM_052954chr2132037 901 75 ------
NM_053016chr947537 6673 3129 806 ------
NM_053023chr1123185 2862 13288 1964 --
NM_053043chr795285 5096 4980 4786 4634 4475 4310 2260 2091 --25359 4989 21409 707
NM_053056chr1152407 2276 2253 549 359 23019 2960 21985 771 12832
NM_057159chr911511 ------
NM_057175chr421974 1075 ------
NM_058172chr441581 1138 452 28 ------
NM_079421chr19----1399 --
NM_080388chr12485 177 --129 --
NM_080491chr1121332 186 11048 11383 21126 1031
NM_080538chr33940 507 203 --1435 11386
NM_080539chr33940 507 203 --1435 11386
NM_080541chr33940 507 203 --1435 11386
NM_080618chr201273 ------
NM_080629chr1----1122 --
NM_080630chr1----1122 --
NM_080645chr642194 1714 1643 1353 2856 712 ----
NM_080666chr141524 ------
NM_080676chr2012756 31172 636 568 21202 243 --
NM_080682chr1----1560 --
NM_080738chr141834 1583 1460 488 ----11326
NM_080742chr6188 ------
NM_080743chr632380 1922 982 32282 1791 83 ----
NM_080759chr13----1949 --
NM_080760chr13----1949 --
NM_080840chr201515 ------
NM_080841chr201515 ------
NM_080862chr31354 ------
NM_080867chr1423702 330 --13837 1312
NM_080927chr3--1137 --1326
NM_100264chr101648 --1800 --
NM_100486chr101648 --1800 --
NM_130434chr152793 749 ------
NM_130436chr2132806 510 358 ----1608
NM_130438chr2133383 1087 935 ----11185
NM_130439chr1031954 690 452 ------
NM_130439chr1031954 690 452 ------
NM_130798chr1521265 563 ------
NM_133329chr221472 316 ------
NM_133370chr4--33465 3021 897 11421 --
NM_133433chr51564 ------
NM_133445chr983459 2441 1479 1238 706 696 574 488 ------
NM_133478chr242061 1720 984 818 ----1733
NM_133493chr613744 13796 11718 --
NM_133496chr133878 1565 1362 11525 ----
NM_133631chr311259 ------
NM_133646chr223791 1175 13673 24904 1275 --
NM_138295chr72107 24 ------
NM_138319chr1531014 803 343 --131 --
NM_138338chr22103147 3099 2845 2344 2206 916 887 704 664 386 ------
NM_138357chr10----1178 --
NM_138426chr71535 --1510 --
NM_138444chr1334437 3207 744 --24592 3341 --
NM_138473chr1234352 930 784 14675 23671 902 --
NM_138476chr14124 ------
NM_138479chr1----1110 --
NM_138554chr932161 853 29 12741 ----
NM_138576chr1434408 1330 787 --24629 268 --
NM_138621chr213378 --13982 --
NM_138633chr61675 ------
NM_138694chr632323 1416 229 ------
NM_138713chr1647357 2725 2231 1804 35181 479 286 ----
NM_138714chr1647357 2725 2231 1804 35181 479 286 ----
NM_138722chr122676 146 ------
NM_138723chr122676 146 ------
NM_138773chr52720 273 1162 ----
NM_138927chr211399 ------
NM_139045chr9187 ------
NM_139068chr51536 ------
NM_139069chr51536 ------
NM_139070chr51405 ------
NM_139131chr111709 --1148 --
NM_139132chr113996 958 913 --1889 --
NM_139159chr1971188 988 949 845 295 102 65 --1993 --
NM_139280chr1731195 364 56 ------
NM_139283chr12----11658 1468
NM_139321chr2073326 3307 2737 1505 1273 1051 498 ------
NM_144567chr121021 481 --31998 1861 889 --
NM_144571chr437020 4454 2444 ------
NM_144578chr1444502 4143 1867 1210 ------
NM_144582chr25904 690 312 207 91 11044 ----
NM_144599chr1555095 3910 1862 991 37 33624 1041 499 ----
NM_144633chr321353 216 ------
NM_144644chr4----1180 --
NM_144657chrX1563 ------
NM_144732chr191205 --1182 --
NM_144767chr1564002 3541 3136 1077 1027 487 1990 1732 1601
NM_144949chr23711 615 584 ------
NM_144979chr4--1227 ----
NM_145008chr112626 312 --1155 --
NM_145011chr101709 170 ----
NM_145013chr1172796 2530 2318 1935 738 597 498 11822 1449 --
NM_145055chr1842606 1494 714 328 --1885 --
NM_145176chr633224 3070 2536 22832 195 ----
NM_145247chr102655 62 --1208 --
NM_145259chr214621 25999 843 ----
NM_145290chr4121 ------
NM_145307chr1074194 3544 2935 2877 301 283 62 13310 ----
NM_145349chr1742101 688 557 180 --12027 --
NM_145686chr212607 22314 405 12596 11099
NM_145687chr212607 22314 405 12596 11099
NM_145690chr821584 675 ------
NM_145698chr101353 --21357 590 --
NM_145858chr211475 ------
NM_145861chr141834 1583 1460 488 ----11326
NM_145909chr641106 859 312 51 ------
NM_147150chr943955 1450 1375 318 ----12433
NM_147156chr101963 ------
NM_147181chr411297 ------
NM_147182chr411297 ------
NM_147183chr411297 ------
NM_147202chr932407 2093 58 --11821 --
NM_148976chr11----151 --
NM_152227chr201591 ------
NM_152238chr11143 ------
NM_152247chr221750 --2641 217 --
NM_152253chr2264136 3820 3224 3089 952 435 13113 54027 3603 3149 2826 1372 --
NM_152261chr1232383 471 355 ------
NM_152263chr1106104 4837 4563 3945 3865 2085 1919 1735 507 113 15419 45701 4160 4014 2277 --
NM_152280chr133130 1187 207 --1367 --
NM_152282chr31227 --11079 --
NM_152309chr1032007 1932 177 --1779 --
NM_152330chr1431766 1629 28 --12158 --
NM_152407chr573111 2605 2345 2250 1130 748 91 ------
NM_152417chr8163 ------
NM_152418chr831602 651 579 1671 ----
NM_152424chrX33747 3370 1301 --13719 --
NM_152515chr2192 ------
NM_152523chr21498 ------
NM_152529chr263209 2830 1528 1283 1245 351 11427 13063 --
NM_152553chr6129 ------
NM_152556chr71259 ------
NM_152594chr1521874 529 ------
NM_152622chr5--1907 1464 --
NM_152629chr91814 33641 3599 401 --1457
NM_152636chr1142797 2361 2312 396 12485 ----
NM_152641chr1221133 807 12808 ----
NM_152678chr332712 713 229 11812 1915 --
NM_152695chrX----11520 --
NM_152724chr1011001 ----12193
NM_152731chr6121 ------
NM_152754chr733548 819 613 1114 ----
NM_152756chr5190 ------
NM_152787chrX43892 3483 2457 1266 23278 633 ----
NM_152789chr711367 ------
NM_152835chr132521 2414 642 ------
NM_152838chr2023235 3056 ------
NM_152857chr6------1940
NM_152858chr6------1940
NM_152890chr12167 41 ------
NM_152902chr131406 1316 150 ------
NM_152924chr15166217 5386 5057 4982 4899 4870 4863 2578 2504 2328 1692 1012 613 223 155 125 ----24950 4944
NM_152994chr21438 ------
NM_153035chr143046 1121 374 31 --13145 --
NM_153040chr15150 ------
NM_153182chr333122 1124 513 1264 12259 1170
NM_153184chr3--11365 ----
NM_153207chr1223204 1156 13354 ----
NM_153208chr16--1941 ----
NM_153218chr133732 721 561 --1320 --
NM_153235chr662452 2057 1792 1710 138 77 11693 ----
NM_153246chr63580 354 317 --11966 --
NM_153255chr63920 376 350 ------
NM_153262chr122023 987 --1533 --
NM_153332chr822555 520 1173 ----
NM_153347chr1132720 683 611 11025 1111 --
NM_153367chr1032771 647 235 1660 11101 --
NM_153487chr684283 3092 1749 1724 1351 1304 1189 588 --1173 --
NM_153607chr523141 2823 1256 ----
NM_153619chr1542980 2475 932 798 ------
NM_153620chr711528 --1424 --
NM_153702chr42288 195 ------
NM_153810chr1023157 1306 ------
NM_170665chr1264601 3399 3390 3076 2854 1603 --11023 --
NM_170739chr111270 ------
NM_170750chrX----1334 --
NM_170768chr1121613 1570 --1686 --
NM_170774chr2083569 1607 1476 1448 1337 327 71 27 ------
NM_171998chrX41589 896 508 241 --2820 218 --
NM_172058chr8----11415 --
NM_172059chr8----11415 --
NM_172060chr8----11415 --
NM_172070chr21628 ------
NM_172071chr156026 5173 2648 1634 51 15559 12336 --
NM_172110chr201684 ------
NM_172111chr201684 ------
NM_172112chr201684 ------
NM_172113chr201684 ------
NM_172159chr311956 1929 1309 --
NM_172160chr311956 1929 1309 --
NM_172169chr1041879 1512 525 421 ------
NM_172170chr1041879 1512 525 421 ------
NM_172171chr1041879 1512 525 421 ------
NM_172173chr1041879 1512 525 421 ------
NM_172240chr121956 1164 ----
NM_172242chr103814 263 229 --1753 --
NM_172337chr14--1135 173 --
NM_172344chr221472 316 ------
NM_172373chr13----1215 --
NM_172375chr141175 ------
NM_173075chr441754 1557 1547 442 ------
NM_173078chrX196 ------
NM_173083chr11130 ------
NM_173198chr92470 221 ------
NM_173200chr92470 221 ------
NM_173214chr1647357 2725 2231 1804 35181 479 286 ----
NM_173476chr1661887 1815 706 481 223 136 21453 76 32060 618 562 22122 1910
NM_173478chr171777 --1297 --
NM_173495chrX----1113 --
NM_173500chr1541345 1259 1106 178 ------
NM_173511chr212643 22725 2718 11543 --
NM_173517chr71355 ------
NM_173519chr82726 238 ------
NM_173559chr61121 ------
NM_173563chr6----187 --
NM_173582chr1166100 4098 2322 1387 493 384 ------
NM_173595chr1264840 4231 4020 1206 385 80 --1955 --
NM_173602chr12----13308 11014
NM_173642chr189040 8048 7478 5835 2823 1086 276 120 18619 15727 --
NM_173653chr311410 11368 --11314
NM_173681chr771868 1521 731 679 644 588 97 --11699 --
NM_173797chr51938 ------
NM_173808chr124110 3262 11022 14151 --
NM_173814chr151168 ------
NM_173822chr232165 2155 639 ------
NM_173825chr312910 12654 ----
NM_173829chr534399 2353 592 ------
NM_173848chr81275 ------
NM_173851chr873970 3877 3782 3175 1533 1329 167 33038 1354 1347 11551 13563
NM_174911chr82845 195 ------
NM_174916chr1522061 1542 ------
NM_175038chr121163 ------
NM_175061chr711988 ------
NM_175069chr91926 ------
NM_175610chr151121 ------
NM_175624chr1236811 2566 2187 27533 6840 ----
NM_175625chr1236811 2566 2187 27533 6840 ----
NM_175733chr1152082 2057 1867 1809 443 1838 ----
NM_175736chr12137365 7108 6721 6273 5900 5731 5666 2281 2215 2011 1251 978 162 21734 297 26969 1262 --
NM_175852chr122215 522 --22893 2682 --
NM_175854chr1322289 472 ----1143
NM_175856chr51815 ------
NM_175861chr1241713 1540 1513 675 24445 89 ----
NM_175863chr61518 ------
NM_175866chr121239 99 ------
NM_175873chr51517 ------
NM_175907chr1842813 2700 901 44 3859 775 648 ----
NM_175921chr553954 3082 2671 596 458 12759 ----
NM_176787chr182515 235 --1195 --
NM_176801chr441639 635 608 275 11451 ----
NM_176814chr71188 11162 ----
NM_176871chr832183 1283 1267 1808 3712 584 170 12350
NM_177438chr1443384 1343 1309 941 ------
NM_177553chr111231 ------
NM_177952chr141644 ------
NM_177968chr2------1228
NM_177976chr31157 ------
NM_177990chr20--11596 1179 --
NM_178011chr101651 ------
NM_178123chr2--2926 168 ----
NM_178126chr171409 11929 1902 --
NM_178127chr11196 ------
NM_178140chr522341 1864 1478 ----
NM_178151chrX107783 7540 7488 7108 6238 6098 5673 5436 5342 5054 11565 15198 --
NM_178152chrX107783 7540 7488 7108 6238 6098 5673 5436 5342 5054 11565 15198 --
NM_178153chrX107783 7540 7488 7108 6238 6098 5673 5436 5342 5054 11565 15198 --
NM_178314chr122634 557 --1743 --
NM_178426chr131650 1452 788 22352 2147 12093 --
NM_178427chr121550 688 22252 2047 11993 --
NM_178505chr1023096 1070 --13234 --
NM_178554chr333001 2336 832 12365 --11225
NM_178566chr92556 117 11265 --11785
NM_178568chr1761625 1574 1263 674 579 277 1459 11514 --
NM_178585chr4174 --13272 --
NM_178586chr1421619 125 ------
NM_178812chr811177 --11145 --
NM_178818chr1632330 1622 1001 11923 ----
NM_180976chr65933 878 400 368 139 ------
NM_180977chr65933 878 400 368 139 ------
NM_181050chr164645 152 66 31 --148 --
NM_181054chr141527 ------
NM_181093chr11460 ------
NM_181340chr141227 ------
NM_181443chr2052486 2049 1908 163 124 11939 ----
NM_181492chr2231074 953 868 ------
NM_181504chr542808 2555 1482 538 ------
NM_181521chr16107111 6403 5782 2876 1569 1052 776 494 414 404 16704 ----
NM_181523chr542808 2555 1482 538 ------
NM_181524chr542808 2555 1482 538 ------
NM_181527chr20123 ------
NM_181528chr20178 ------
NM_181534chr17153 ------
NM_181656chr173828 28 21 ------
NM_181659chr2011260 13172 2918 87 --
NM_181659chr2011260 13172 2918 87 --
NM_181671chr171658 ----1725
NM_181672chrX31930 1409 409 1813 ----
NM_181673chrX31930 1409 409 1813 ----
NM_181715chr1176 ------
NM_181746chr11187 ------
NM_181809chr123205 1426 1224 31269 1178 821 23050 401
NM_181825chr222812 174 --128 --
NM_181832chr2273266 1274 840 792 719 687 370 --43120 2986 1493 645 --
NM_181838chr521481 1228 11072 1249 --
NM_181897chr31599 ------
NM_182488chr131196 ------
NM_182511chr1811258 ------
NM_182515chr1954866 2632 1426 799 303 14851 35304 5169 1991 11857
NM_182526chr1462872 2675 2356 1127 972 425 1128 ----
NM_182580chr162361 2170 2002 1928 1894 769 32152 700 449 2960 713 --
NM_182607chrX21637 1286 --2607 473 --
NM_182641chr1711981 ------
NM_182648chr141506 ------
NM_182663chr111897 22009 691 ----
NM_182664chr122027 84 22139 821 ----
NM_182665chr111897 22009 691 ----
NM_182691chr721211 134 ------
NM_182692chr721211 134 ------
NM_182729chr1231855 1452 178 ------
NM_182742chr1231855 1452 178 ------
NM_182743chr1231855 1452 178 ------
NM_182765chr1031625 425 230 1166 1292 --
NM_182767chr1231620 583 504 1229 ----
NM_182796chr52619 123 ------
NM_182830chr1411834 --139 --
NM_182847chr21720 ------
NM_182898chr721805 1250 ----14839
NM_182899chr721805 1250 ----14839
NM_182918chr2111036 --11081 --
NM_182925chr541327 1172 541 55 1410 11314 1453
NM_182931chr7174 ------
NM_182944chr141339 ------
NM_182975chr1175 1754 ----
NM_182978chr181582 1661 1550 --
NM_183043chr131917 ------
NM_183044chr131917 ------
NM_183078chr673615 3032 2848 2681 1523 1079 709 ----1948
NM_183360chr2--194 --134
NM_183361chr2--194 --134
NM_183376chr1542499 1972 1866 1659 ------
NM_183419chr81147 ------
NM_184234chr201657 ------
NM_194247chr233328 1210 321 12840 --13144
NM_194271chr121605 ------
NM_194277chrX2860 53 ------
NM_194278chr1422889 1657 43427 3373 2748 88 11089 --
NM_194282chr412615 --12157 33036 1219 577
NM_194292chr121493 1273 ------
NM_194314chr144072 3536 1840 1586 13635 ----
NM_194317chr211923 11069 11832 --
NM_194463chrX21137 209 ------
NM_197941chr521213 1031 12140 22368 2279 13043
NM_198056chr351925 1505 825 231 144 ------
NM_198066chr1442950 2101 1914 534 22185 1921 ----
NM_198086chr1431936 1787 656 21796 246 ----
NM_198215chr101199 ------
NM_198243chr151118 ------
NM_198264chr1----2395 42 --
NM_198270chrX12319 ------
NM_198391chr201607 11527 ----
NM_198399chr321472 1153 163 1494 --
NM_198400chr1531845 1167 353 --1247 --
NM_198465chrX52681 2545 2020 200 47 12132 ----
NM_198485chr3----11019 11756
NM_198504chr3------1380
NM_198513chr81651 --1241 --
NM_198595chr4114764 3913 1979 1958 1865 1357 765 562 442 419 276 23169 1193 34030 3320 3174 --
NM_198597chr103653 360 298 ------
NM_198679chr9102462 2319 2241 2186 2050 1994 1668 1074 592 224 186 --12538
NM_198793chr353906 3426 3393 3244 529 22742 1295 ----
NM_198859chr323901 1853 14256 ----
NM_198900chr12137365 7108 6721 6273 5900 5731 5666 2281 2215 2011 1251 978 162 21734 297 26969 1262 --
NM_198968chr1333346 3056 283 13208 --13412
NM_199000chr711882 ------
NM_199054chr193827 574 559 1422 41710 845 236 120 --
NM_199072chr722720 2616 1989 1425 --
NM_199129chr20----1129 21203 404
NM_199160chr931677 1512 665 11523 11601 --
NM_199320chr41511 ------
NM_199320chr41511 ------
NM_199355chr1611190 ------
NM_199359chr201620 ------
NM_199360chr201620 ------
NM_199361chr201620 ------
NM_199362chr201620 ------
NM_199363chr201620 ------
NM_199421chr1423702 330 --13837 1312
NM_199440chr21302 ------
NM_199453chr52211 205 1240 ----
NM_199461chr1083661 3215 2203 1121 705 671 380 288 12860 ----
NM_199462chr173654 1873 1840 1726 1628 514 144 --34268 4256 697 13520
NM_199511chr3------1782
NM_199512chr3------1782
NM_201278chr1112205 ------
NM_201281chr1112205 ------
NM_201521chr62416 261 ------
NM_201522chr62416 261 ------
NM_201523chr62416 261 ------
NM_201570chr1011259 --1410 --
NM_201571chr1011259 --1410 --
NM_201572chr1011259 --1410 --
NM_201590chr1011259 --1410 --
NM_201591chr41426 --11846 --
NM_201592chr41426 --11846 --
NM_201593chr1011259 --1410 --
NM_201596chr1011259 --1410 --
NM_201597chr1011259 --1410 --
NM_201629chr92595 504 ------
NM_201999chr41932 ------
NM_203283chr4--1416 ----
NM_203284chr4--1416 ----
NM_203327chr2041246 817 458 38 24048 3735 14175 --
NM_203342chr163513 3115 3076 2525 835 531 ----11443
NM_203343chr163513 3115 3076 2525 835 531 ----11443
NM_203364chr1111251 1837 11185 --
NM_203372chr221415 1361 ------
NM_203406chr532154 767 356 ------
NM_203446chr21--1666 ----
NM_203463chr254546 4404 4223 3209 195 --13175 11831
NM_203487chr1321424 1220 --11307 --
NM_205861chr141681 634 455 80 11887 ----
NM_206594chr11857 11341 ----
NM_206595chr11857 11341 ----
NM_206839chr151488 ------
NM_206854chr632039 1694 786 ------
NM_206855chr611751 --1682 --
NM_206866chr2122988 611 ------
NM_206876chr222962 2666 ------
NM_206914chr12--11532 --1350
NM_206944chr92354 216 ------
NM_206945chr92354 216 ------
NM_206946chr92354 216 ------
NM_206947chr92354 216 ------
NM_207012chr10169 --13137 --
NM_207123chr41830 --1820 --
NM_207292chr333134 2973 768 --12761 --
NM_207293chr333134 2973 768 --12761 --
NM_207294chr333134 2973 768 --12761 --
NM_207295chr333134 2973 768 --12761 --
NM_207296chr333134 2973 768 --12761 --
NM_207297chr333159 2998 793 --12786 --
NM_207311chr12164 11261 2923 348 --
NM_207325chr1911328 31707 675 309 ----
NM_207396chr121586 1287 --2536 232 144
NM_207422chrX1245 --1945 --
NM_207660chr1421554 477 ------
NM_207661chr1421554 477 ------
NM_207662chr1421554 477 ------
NM_212460chr711621 --11759 --
NM_212471chr1721542 1411 ------
NM_212472chr1721542 1411 ------
NM_212558chr943756 2947 356 160 ------
NM_213589chr285214 4729 3895 3667 3555 2059 585 111 1299 14170 --
NM_213651chr121339 600 11550 ----
NM_213654chr3--166 ----