TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-550b-2-5p
miRNA Sequence: AUGUGCCUGAGGGAGUAAGACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531191 982 92 ----11024
NM_000038chr531781 1542 190 --11529 --
NM_000052chrX23331 168 ------
NM_000081chr11256 ------
NM_000109chrX12502 ------
NM_000115chr1321707 694 ------
NM_000125chr651313 883 606 528 168 --11103 --
NM_000138chr1512176 --1158 196
NM_000168chr712598 1514 13187 --
NM_000176chr522918 1206 ------
NM_000188chr102468 159 ------
NM_000210chr22529 49 ------
NM_000217chr1284613 4431 4171 4023 3365 2128 1744 1250 ------
NM_000232chr472766 2429 1287 1173 861 710 698 12340 12772 --
NM_000234chr19128 ------
NM_000248chr31865 ------
NM_000256chr11------132
NM_000259chr1586135 4723 4186 2386 931 676 392 233 --13893 11230
NM_000260chr111173 1524 ----
NM_000266chrX1246 1215 1764 --
NM_000267chr1722959 580 12255 --12951
NM_000314chr1042760 2631 2172 723 12832 ----
NM_000332chr686754 4919 2448 1388 403 299 245 218 11927 11425 --
NM_000337chr534684 1065 491 ------
NM_000368chr933944 3818 43 14767 ----
NM_000408chr212846 --11085 --
NM_000411chr2142186 2038 787 451 --22750 841 --
NM_000428chr1431772 1040 795 --12603 --
NM_000430chr1733482 3234 293 1860 ----
NM_000461chr331437 1392 136 13324 ----
NM_000462chr1511748 ------
NM_000484chr2111034 ------
NM_000486chr1262234 1132 1118 1110 966 336 --1866 --
NM_000492chr721457 225 ------
NM_000495chrX1311 ------
NM_000503chr811415 ------
NM_000551chr351967 440 346 164 126 11792 ----
NM_000555chrX77540 7108 5674 5436 5342 5198 2482 35396 4966 2110 11565 --
NM_000597chr21251 ------
NM_000610chr11------1645
NM_000618chr1235568 5434 5042 --1720 --
NM_000618chr1235568 5434 5042 --1720 --
NM_000679chr51179 ------
NM_000702chr142219 2093 1702 25 ------
NM_000719chr1295597 5316 4413 2664 2438 1506 593 240 177 --16394 14731
NM_000767chr1921172 362 ----11300
NM_000793chr1421240 847 14069 --11701
NM_000813chr511521 12244 ----
NM_000814chr1543860 3391 1530 589 --13491 --
NM_000826chr421774 240 ------
NM_000828chrX31829 790 23 12130 ----
NM_000829chr1112318 ------
NM_000868chrX--133 1371 --
NM_000875chr1586237 5228 5200 4794 2731 1814 1553 648 35023 1785 1532 1748 --
NM_000891chr1743473 3028 963 210 1353 ----
NM_000901chr412436 ------
NM_000903chr163316 270 190 21203 1156 ----
NM_000921chr12----1166 --
NM_000944chr412408 ------
NM_000945chr211333 ------
NM_000965chr3----11045 --
NM_001001323chr12----12414 --
NM_001001389chr11------1645
NM_001001390chr11------1645
NM_001001391chr11------1645
NM_001001392chr11------1691
NM_001001396chr133784 3625 1679 12893 ----
NM_001001481chr853445 2637 2481 2307 160 --22692 672 --
NM_001001484chr1011875 ------
NM_001001521chr2183 ------
NM_001001664chr21877 ------
NM_001001701chr42861 824 11458 ----
NM_001001709chr911125 2856 163 ----
NM_001001713chr212325 116 ------
NM_001001787chr11205 ------
NM_001001890chr2124146 4121 14001 ----
NM_001001928chr2288330 6871 5856 2855 2089 1705 738 145 --57007 3262 1946 1319 597 --
NM_001001974chr1021992 613 ------
NM_001001995chrX11182 ------
NM_001002269chr9--1385 ----
NM_001002295chr101343 ------
NM_001002860chr1444545 3681 833 235 ------
NM_001003652chr1837783 6974 3084 1259 27592 6662 --
NM_001003674chr1867096 6529 5592 5101 4535 2088 1100 ----
NM_001003675chr1867096 6529 5592 5101 4535 2088 1100 ----
NM_001003712chr12----12692 1426
NM_001003800chr982640 2464 1500 1263 635 491 460 130 ------
NM_001003940chr1533732 1158 29 13871 21318 750 --
NM_001003942chr1533732 1158 29 13871 21318 750 --
NM_001003943chr1533736 1162 33 13875 21322 754 --
NM_001004065chr933955 1450 413 --12433 --
NM_001004304chr1212778 --1284 22591 444
NM_001004317chr642880 1495 1212 1000 --13088 --
NM_001005242chr1221637 252 ------
NM_001005386chr21262 ------
NM_001005473chr534722 4551 58 ----26021 802
NM_001005609chrX23458 1359 22962 926 ----
NM_001005781chr21116 1415 ----
NM_001006605chr121171 873 ------
NM_001006605chr121171 873 ------
NM_001006610chr162932 62 ------
NM_001006657chr212155 11245 12642 --
NM_001006933chrX1214 ------
NM_001007023chr1421240 847 14069 --11701
NM_001007027chr111179 ------
NM_001007097chr921628 1596 --1814 --
NM_001007102chr61192 ------
NM_001007189chr5155 ------
NM_001007237chr131982 1082 805 --22650 2056 --
NM_001007271chr102718 369 ------
NM_001007277chr112840 811 ------
NM_001007466chr625078 350 --13524 --
NM_001007471chr92354 216 ------
NM_001008222chrX1554 --1987 --
NM_001008408chr7105359 5096 4989 4475 4310 3883 2092 1408 1250 75 --1707 --
NM_001008410chr221903 32 22163 1762 11574 --
NM_001008564chr1331758 1491 647 ----1693
NM_001008701chr1922718 2358 --12458 --
NM_001008707chr1441738 1336 638 406 ------
NM_001008726chr141525 ------
NM_001008738chr522756 2534 --1414 --
NM_001008895chr131217 11146 ----
NM_001009555chr41123 131 ----
NM_001009899chr375896 5553 5325 4422 2252 1724 1604 --21630 1471 --
NM_001009993chr294376 3607 3374 3203 3164 3006 1690 1330 1021 11339 ----
NM_001009996chr33226 211 130 --1405 --
NM_001010852chr61135 ------
NM_001010853chr62785 73 1568 23258 1054 12428
NM_001010862chrX33271 2208 1059 ------
NM_001010867chr1105510 4979 4753 4514 2207 1106 1046 780 735 21 25198 2041 34371 2124 186 12528
NM_001010888chrX43919 3573 1184 149 ------
NM_001010891chr566097 5609 5587 5223 4595 2640 15141 ----
NM_001011537chr31745 12063 ----
NM_001011538chr43973 211 144 --1768 --
NM_001011663chr101716 ------
NM_001011666chr726386 1250 --14839 --
NM_001011708chr222290 44 ------
NM_001011713chr1421358 168 ------
NM_001012337chr31104 ------
NM_001012393chr1141870 1620 824 714 --14597 --
NM_001012420chr1532158 968 207 --11048 --
NM_001012755chrX53824 3125 1887 1325 338 ------
NM_001012756chr1912478 23288 2396 ----
NM_001012968chrX22272 627 --1754 --
NM_001012979chrX2214 68 ------
NM_001013399chr61719 ------
NM_001014380chr1321283 281 ----14286
NM_001014797chr1097568 7330 6735 5144 2880 2630 1845 930 888 27850 5044 26308 3127 16989
NM_001014972chr21195 ------
NM_001015508chr8139 ------
NM_001017371chr21207 ------
NM_001017415chr11266 ------
NM_001017416chr11266 ------
NM_001017424chr151198 1180 773 763 707 --127 11312
NM_001017425chr151198 1180 773 763 707 --127 11312
NM_001017926chr81105 ------
NM_001017999chr122299 120 --11847 --
NM_001017999chr122299 120 --11847 --
NM_001018000chr122299 120 --11847 --
NM_001018000chr122299 120 --11847 --
NM_001018001chr122299 120 --11847 --
NM_001018003chr83645 619 196 ------
NM_001018050chr2273009 2344 887 704 664 622 281 --12207 --
NM_001018052chr2273009 2344 887 704 664 622 281 --12207 --
NM_001018054chr131389 1157 318 ------
NM_001018067chr11995 13334 1823 14263
NM_001018068chr11995 13334 1823 14263
NM_001018069chr11995 13334 1823 14263
NM_001018074chr522918 1206 ------
NM_001018075chr522918 1206 ------
NM_001018076chr522918 1206 ------
NM_001018077chr522918 1206 ------
NM_001024094chr522918 1206 ------
NM_001024808chr1272371 2153 1880 923 717 678 646 --2629 43 12715
NM_001024855chr32710 251 ------
NM_001024858chr1472899 2335 2141 1983 1855 829 332 --1292 --
NM_001024956chr1154458 1922 1074 826 139 ------
NM_001025068chr331472 1153 494 --163 --
NM_001025069chr331472 1153 494 --163 --
NM_001025076chr1045328 2150 1963 1102 15412 ----
NM_001025077chr1026686 2460 16770 ----
NM_001025079chr313910 --22746 1299 --
NM_001025105chr511074 ----11125
NM_001025201chr21108 ------
NM_001025252chr822904 2743 --1540 --
NM_001025253chr822904 2743 --1540 --
NM_001025356chr1212254 32905 1022 199 1357 --
NM_001025580chrX23810 3119 ----1791
NM_001029863chr632346 1183 100 ------
NM_001029875chr522991 2789 11141 ----
NM_001029955chr452340 662 591 426 222 12521 2955 682 --
NM_001030007chr1652601 1495 1458 564 470 ------
NM_001030055chr1444666 3671 2898 1295 ------
NM_001031690chr752354 1104 1018 647 544 --1522 11251
NM_001031695chr2255017 4513 1574 1181 669 ------
NM_001031711chr531273 485 441 ------
NM_001031712chr6193 ------
NM_001031732chr411421 --33465 3021 897 --
NM_001031812chr552121 1624 1459 593 575 ------
NM_001032296chr1352557 2401 1058 734 134 11891 ----
NM_001033044chr1--11763 ----
NM_001033047chr431855 618 270 ----12335
NM_001033056chr1--11763 ----
NM_001033087chr2042906 2756 1202 243 11173 --2637 569
NM_001033117chr333837 1523 851 ----13945
NM_001033507chr121982 1518 ------
NM_001033723chr812157 1640 1348 --
NM_001034841chr1654514 4294 1885 440 105 --15324 1943
NM_001034852chr1461993 1401 1392 725 437 383 --11450 --
NM_001035260chr102654 62 ------
NM_001037131chr21291 31329 461 314 ----
NM_001037132chr732204 1792 656 ----1717
NM_001037133chr732204 1792 656 ----1717
NM_001037164chr721759 1621 11468 ----
NM_001037172chr321079 227 2874 196 ----
NM_001037954chr1132816 448 170 11036 --1787
NM_001039348chr2127 ------
NM_001039349chr2127 ------
NM_001039479chr1462257 1993 1943 1789 1563 308 154 2777 547 12157
NM_001039538chr243608 2997 2388 40 ------
NM_001039547chr331526 1318 318 ------
NM_001039590chrX33586 2831 1587 ------
NM_001039591chrX33586 2831 1587 ------
NM_001039618chr1144424 4377 4044 1275 --13656 --
NM_001039690chr1631611 772 317 21500 900 ----
NM_001039693chr213755 ------
NM_001039711chr11986 11036 ----
NM_001039712chr11986 11036 ----
NM_001039802chr11316 ------
NM_001039938chr1311487 ------
NM_001040001chr611632 --21401 1303 --
NM_001040101chr431382 1275 504 1176 ----
NM_001040142chr21561 1925 ----
NM_001040143chr21561 1925 ----
NM_001040144chr1631611 772 317 21500 900 ----
NM_001040146chr1631611 772 317 21500 900 ----
NM_001040152chr724334 1313 --11264 --
NM_001040153chr131939 ------
NM_001040169chr51102 --1137 --
NM_001040272chr912335 12024 2632 329 --
NM_001040402chr41689 --1522 --
NM_001040409chr21373 ------
NM_001040429chr13122 ------
NM_001040708chr8----1108 --
NM_001040715chr162882 266 ------
NM_001042413chr923775 814 --33641 3599 401 1458
NM_001042453chrX1630 ------
NM_001042473chr1031357 590 353 ------
NM_001042479chrX31940 107 47 1648 ----
NM_001042480chrX31940 107 47 1648 ----
NM_001042492chr1722959 580 12255 --12951
NM_001042506chrX--1346 ----
NM_001042533chr343122 3095 2259 169 --1514 1265
NM_001042537chrX41628 1542 750 128 ------
NM_001042539chr16126 1232 ----
NM_001042555chr1274664 4330 3406 3056 1205 817 168 --11369 13816
NM_001042599chr216618 --17555 14922
NM_001042604chr323146 146 1770 1976 --
NM_001042681chr132226 1970 420 ------
NM_001042682chr132226 1970 420 ------
NM_001042682chr132226 1970 420 ------
NM_001042749chrX2333 325 ------
NM_001042750chrX2333 325 ------
NM_001042751chrX2333 325 ------
NM_001042762chr7124 ------
NM_001043318chr1453140 2519 1657 1089 982 --43427 3373 2748 88 --
NM_001044305chr61399 ------
NM_001044722chr552121 1624 1459 593 575 ------
NM_001044723chr552121 1624 1459 593 575 ------
NM_001046chr5----12284 --
NM_001078chr11560 ------
NM_001083620chr421772 239 ------
NM_001099678chr344740 4584 1511 1465 --1591 --
NM_001106chr397934 7453 3847 2537 2218 2130 1216 877 691 13629 16598 16427
NM_001117chr1811964 ----11732
NM_001121chr101500 11830 ----
NM_001122631chr111433 --1205 --
NM_001122679chr531191 982 92 ----11024
NM_001123chr10--1140 ----
NM_001126chr11174 ----1977
NM_001128chr1652601 1495 1458 564 470 ------
NM_001152chrX137 ------
NM_001163chr91746 --1852 --
NM_001167chrX66160 6018 5618 4368 1698 933 15568 ----
NM_001173chr1444666 3671 2898 1295 ------
NM_001177chr1262475 2465 1786 1678 526 111 ------
NM_001186chr2123058 2988 ------
NM_001189chr43703 211 104 ------
NM_001204chr254971 4962 2036 805 567 1433 12939 --
NM_001219chr722274 806 ------
NM_001237chr41935 1446 ----
NM_001237chr41935 1446 ----
NM_001241chr221975 820 11920 ----
NM_001241chr221975 820 11920 ----
NM_001259chr746393 5085 4274 541 --1342 --
NM_001284chr51126 ------
NM_001289chrX11392 --11242 1343
NM_001304chr1712452 23487 289 ----
NM_001310chr121797 ------
NM_001343chr51461 11522 ----
NM_001346chr342519 2243 645 195 --1529 --
NM_001349chr22485 131 ------
NM_001356chrX32214 805 429 12258 ----
NM_001357chr1150 ------
NM_001364chr1141838 1686 687 417 ------
NM_001379chr191102 ------
NM_001396chr2132807 510 358 --1608 --
NM_001399chrX23458 1359 22962 926 ----
NM_001401chr911511 ------
NM_001412chrX23189 3085 13511 ----
NM_001415chrX21701 1387 21305 208 --1747
NM_001421chrX51701 1584 1145 1080 216 1598 ----
NM_001423chr1211419 1384 ----
NM_001427chr711509 ------
NM_001438chr112576 ----11342
NM_001448chrX2390 46 1589 21828 246 --
NM_001498chr611015 ----11177
NM_001508chr22860 668 ------
NM_001542chr131982 1082 805 --22650 2056 --
NM_001546chr6------11290
NM_001584chr111928 --1917 --
NM_001616chr233376 2799 543 ------
NM_001635chr72914 785 ------
NM_001655chr1141702 818 795 629 1204 ----
NM_001663chr1412283 ------
NM_001677chr11843 ------
NM_001679chr31114 ------
NM_001682chr12----12128 --
NM_001684chr133501 3342 1396 12610 ----
NM_001743chr21439 1547 ----
NM_001754chr2124146 4121 14001 ----
NM_001755chr1621933 150 ------
NM_001759chr1243892 1434 1229 1115 ----14572
NM_001769chr121290 ------
NM_001777chr313910 --22746 1299 --
NM_001781chr121654 ------
NM_001791chr11316 ------
NM_001792chr182727 127 ------
NM_001797chr161250 ------
NM_001822chr21108 ------
NM_001830chrX43331 1204 638 185 --11020 --
NM_001843chr121163 ------
NM_001854chr11122 ------
NM_001858chr644442 1632 1297 130 25101 4683 23594 1117 --
NM_001892chr511074 ----11125
NM_001918chr177225 7178 7043 2935 2509 1771 1022 18160 12498 1133
NM_001938chr1--11295 ----
NM_001949chr622417 1120 ------
NM_001981chr11951 --12358 --
NM_002025chrX59267 9125 8794 7112 714 16281 17921 15921
NM_002039chr41820 ------
NM_002040chr212964 718 ----11135
NM_002051chr101343 ------
NM_002062chr611609 ------
NM_002065chr1--11763 ----
NM_002094chr16----1341 --
NM_002107chr11117 ------
NM_002126chr1723776 3642 ----24067 110
NM_002128chr1332411 1981 222 --12404 --
NM_002130chr521665 346 ------
NM_002146chr1711305 --1554 1488
NM_002156chr21302 ------
NM_002158chr212973 ------
NM_002192chr72552 445 ------
NM_002199chr41925 1699 ----
NM_002202chr511106 ------
NM_002210chr233545 3142 430 ----1587
NM_002214chr775674 5124 1787 1439 1304 385 313 11222 ----
NM_002232chr111201 ------
NM_002233chr11--1139 ----
NM_002239chr21284 ------
NM_002247chr101254 ------
NM_002253chr411294 --1161 --
NM_002267chr1312403 ------
NM_002268chr3------126
NM_002271chr1331781 1712 510 12313 ----
NM_002298chr132277 54 ------
NM_002310chr511197 1637 ----
NM_002336chr1223140 335 ------
NM_002353chr11281 191 --1755
NM_002356chr6171 ------
NM_002372chr51727 --1652 --
NM_002374chr243608 2997 2388 40 ------
NM_002426chr11--1316 ----
NM_002429chr1241147 1019 575 563 ----1148
NM_002430chr222328 162 ------
NM_002467chr81361 1165 ----
NM_002480chr1221405 1230 ------
NM_002486chr921800 1658 ----1281
NM_002545chr1141870 1620 824 714 --14597 --
NM_002546chr82589 73 ------
NM_002570chr1541015 803 343 31 ------
NM_002581chr944776 4718 2022 1651 ------
NM_002655chr824377 2097 --24232 3791 --
NM_002657chr2053848 2816 2576 1244 1011 ------
NM_002662chr342184 723 621 430 ------
NM_002716chr1133067 1232 308 ------
NM_002734chr1711412 12092 ----
NM_002737chr1764953 4590 4504 1958 1717 1447 24738 308 ----
NM_002740chr332724 1757 741 1957 1331 --
NM_002748chr151476 --11027 --
NM_002760chrY44438 4006 2355 1935 ------
NM_002763chr11107 ------
NM_002813chr122280 177 ------
NM_002836chr201116 ------
NM_002837chr1234566 1429 1176 13106 13366 --
NM_002849chr12--1700 ----
NM_002868chr1221619 654 ----1285
NM_002893chrX176 ------
NM_002941chr311259 ------
NM_002942chr321319 1048 ------
NM_002945chr17----1562 --
NM_002972chr22----1225 --
NM_002973chr121188 ------
NM_002998chr81827 ------
NM_003009chr192337 308 ------
NM_003014chr741284 1193 1127 216 ------
NM_003017chr631362 1027 199 --11108 --
NM_003031chr162932 62 ------
NM_003034chr1267597 7426 6696 6498 3046 959 1848 --16634
NM_003051chr12657 557 ------
NM_003074chr32843 510 1717 ----
NM_003075chr121311 ------
NM_003099chr1556315 6192 6101 4092 1668 --24449 3984 --
NM_003106chr3----11050 --
NM_003107chr622399 971 ------
NM_003108chr275017 2635 2515 2405 2067 1030 444 --11401 --
NM_003111chr21207 ------
NM_003112chr732711 2214 780 ------
NM_003113chr21214 ------
NM_003137chr612091 ------
NM_003143chr7135 ------
NM_003161chr17--1844 1219 --
NM_003181chr6181 ------
NM_003189chr163293 3064 453 369 241 222 13030 ----
NM_003199chr1823638 1558 11597 --11062
NM_003221chr621511 1477 11421 11067 --
NM_003250chr172460 450 ------
NM_003253chr2111388 1728 ----
NM_003257chr1521315 121 ------
NM_003262chr344686 1753 1047 184 --14551 13366
NM_003269chr611199 ------
NM_003270chrX31199 768 388 ------
NM_003274chr211624 ------
NM_003286chr2011063 ------
NM_003295chr131151 ------
NM_003298chr365858 4766 4645 2142 575 540 ------
NM_003304chr311021 --11590 --
NM_003326chr131703 263 31 ------
NM_003330chr1211855 ------
NM_003339chr531228 1205 249 ----11073
NM_003342chr1712454 --12818 --
NM_003348chr1211196 ------
NM_003350chr81219 ----1423
NM_003368chr11266 ------
NM_003374chr52761 298 --1168 --
NM_003390chr1111129 ------
NM_003400chr21231 ------
NM_003405chr221249 ------
NM_003406chr841584 1297 280 266 ------
NM_003410chrX12243 --12834 --
NM_003423chr1942405 2117 1915 790 --12472 --
NM_003471chr31309 ----1930
NM_003474chr103865 244 185 --12367 --
NM_003477chr11----1491 --
NM_003483chr12------1904
NM_003489chr2112459 --13266 1291
NM_003506chr8------11232
NM_003559chr1753726 3217 3022 2960 1015 --11467 --
NM_003576chr1352557 2401 1058 734 134 11891 ----
NM_003583chr1243350 3269 2982 2965 --11424 --
NM_003589chr131217 11146 ----
NM_003615chr3----1196 --
NM_003630chr61208 ------
NM_003631chr101167 --1832 --
NM_003633chr522188 1938 12285 ----
NM_003663chr312299 11004 12334 --
NM_003670chr361014 574 567 419 229 121 --11368 --
NM_003672chr111379 ------
NM_003679chr112585 13106 12513 12820
NM_003684chr12919 44 --11031 --
NM_003701chr132118 103 11071 ----
NM_003705chr2------1557
NM_003714chr522257 1994 --12146 12380
NM_003749chr1351855 1817 858 604 159 --12044 --
NM_003759chr423985 687 13641 11212 --
NM_003760chr11171 ------
NM_003773chr32220 59 ------
NM_003787chr1811372 1262 ----
NM_003791chr161174 ------
NM_003822chr112138 ----1154
NM_003850chr13----2649 122 --
NM_003861chr1442551 1112 834 337 --2884 102 --
NM_003884chr3--11845 ----
NM_003888chr152589 174 ------
NM_003895chr2132169 2115 437 --1885 --
NM_003902chr11639 1770 ----
NM_003913chr643331 1617 1292 679 ----11044
NM_003919chr71101 ------
NM_003922chr151301 ------
NM_003924chr41321 --11102 11269
NM_003958chr633710 2943 2775 --11042 --
NM_003980chr62987 328 --11316 --
NM_003983chr1633573 3166 2758 --13038 1414
NM_003998chr4----1469 --
NM_004006chrX12502 ------
NM_004007chrX12502 ------
NM_004009chrX12502 ------
NM_004010chrX12502 ------
NM_004011chrX12502 ------
NM_004012chrX12502 ------
NM_004013chrX12502 ------
NM_004014chrX12502 ------
NM_004015chrX12502 ------
NM_004016chrX12416 ------
NM_004017chrX12502 ------
NM_004018chrX12416 ------
NM_004020chrX12502 ------
NM_004021chrX12416 ------
NM_004022chrX12416 ------
NM_004023chrX12416 ------
NM_004050chr1432577 285 222 1984 1388 1885
NM_004067chr721395 350 ------
NM_004080chr721273 190 ----1594
NM_004087chr311774 ------
NM_004100chr61254 22464 2421 ----
NM_004105chr2127 ------
NM_004112chr1721460 538 1330 ----
NM_004114chrX21094 946 ------
NM_004134chr5----2593 540 --
NM_004161chr2--11544 ----
NM_004171chr1138677 6309 359 11996 22084 170 --
NM_004183chr11--1511 ----
NM_004232chr1813449 33079 789 779 ----
NM_004236chr151553 ------
NM_004242chr61114 ------
NM_004272chr51634 ------
NM_004274chr1432881 2774 1295 1982 ----
NM_004293chr912351 1759 13067 --
NM_004296chr1494027 3704 3132 2921 2860 2853 2458 547 410 --1997 --
NM_004321chr253448 2350 1019 560 259 --23281 2285 13115
NM_004326chr1--11201 ----
NM_004331chr81173 ----1539
NM_004338chr1867096 6529 5592 5101 4535 2088 1100 ----
NM_004370chr622194 1857 --1712 1857
NM_004380chr16165 ------
NM_004384chr552121 1624 1459 593 575 ------
NM_004392chr1332041 949 476 12302 ----
NM_004417chr51215 ------
NM_004426chr1261921 1643 1596 1237 782 624 ------
NM_004434chr1441738 1336 638 406 ------
NM_004437chr143513 1297 836 531 --11443 --
NM_004438chr2--1395 23222 3069 --
NM_004456chr71227 ------
NM_004482chr2----163 --
NM_004485chr154371 3180 3045 1245 1185 11355 23485 696 11623
NM_004501chr123983 1302 --14113 13218
NM_004520chr5------1191
NM_004529chr91919 ------
NM_004575chr4----11368 --
NM_004586chrX65165 4447 4404 3763 1488 912 14820 --14597
NM_004598chr532876 1083 85 11206 ----
NM_004600chr11505 ------
NM_004603chr7--11145 ----
NM_004612chr914358 --13886 --
NM_004631chr131389 1157 318 ------
NM_004654chrY11200 ------
NM_004663chr1551427 1416 1140 1078 597 ------
NM_004687chr1721626 509 --1348 --
NM_004717chr711498 ------
NM_004726chrX54862 3987 1971 1484 1263 11889 ----
NM_004733chr31419 1384 ----
NM_004736chr132242 478 328 ------
NM_004742chr31394 ----1348
NM_004748chr1543537 3138 1368 1346 13200 11612 1486
NM_004760chr721582 80 --1198 --
NM_004768chr11293 ------
NM_004788chr11--22117 1783 ----
NM_004799chr1--1359 ----
NM_004822chr17103614 2673 2613 1548 1205 1106 983 893 397 370 --11266 --
NM_004824chr621351 993 --1498 --
NM_004834chr222607 2596 22410 406 12314 11100
NM_004850chr221514 1272 ------
NM_004857chr1474474 4226 3827 3803 1755 1621 262 13625 --24339 122
NM_004859chr1742820 1010 999 454 --11096 --
NM_004869chr18--1240 --1197
NM_004879chr112718 689 ------
NM_004898chr431072 327 214 1740 11982 --
NM_004904chr726386 1250 --14839 --
NM_004922chr103653 298 21 ------
NM_004958chr11822 ------
NM_004964chr11574 ------
NM_004969chr101542 ------
NM_004985chr1233501 3432 485 23015 2874 130 --
NM_004992chrX98209 7938 7625 5856 3106 2159 1934 1532 317 ------
NM_004992chrX98209 7938 7625 5856 3106 2159 1934 1532 317 ------
NM_004999chr673576 1774 801 627 440 364 254 14136 ----
NM_005010chr732204 1792 656 ----1717
NM_005014chr91590 --1607 --
NM_005023chr511355 ------
NM_005036chr2288330 6871 5856 2855 2089 1705 738 145 --57007 3262 1946 1319 597 --
NM_005044chrX34171 2957 941 1104 ----
NM_005056chr1221173 572 2458 52 11032 --
NM_005063chr1023488 2501 ------
NM_005065chr1425085 1824 1116 1110 13530
NM_005066chr11548 ------
NM_005067chr3137 ------
NM_005079chr822904 2743 --1540 --
NM_005080chr22------1982
NM_005095chr121517 855 ------
NM_005099chr131214 914 31 ----1499
NM_005116chr2054175 1564 817 458 38 --24048 3735 --
NM_005119chr131129 149 42 --1461 --
NM_005120chrX1154 ------
NM_005121chr1762969 1439 1135 1066 1057 786 ------
NM_005126chr31616 1791 ----
NM_005140chrX2779 413 ------
NM_005144chr83887 448 144 1135 --164
NM_005154chr151204 ------
NM_005156chr913549 --14342 --
NM_005159chr1522206 1614 ------
NM_005160chr2246736 5574 672 76 --25801 4416 16074
NM_005180chr1011130 ------
NM_005190chr61719 ------
NM_005197chr1456071 6029 4029 976 549 12207 31088 478 391 --
NM_005229chrX--11026 ----
NM_005233chr322274 2029 ------
NM_005235chr216618 --17555 14922
NM_005238chr1133503 2201 810 ----12422
NM_005241chr321309 291 --1873 --
NM_005244chr201684 ------
NM_005254chr151906 --177 --
NM_005257chr181448 ------
NM_005277chr411846 ------
NM_005324chr1721917 290 ------
NM_005329chr1631848 350 293 --12090 --
NM_005339chr463873 3775 3609 2938 2743 127 13392 ----
NM_005342chrX32104 303 253 ------
NM_005349chr4----1416 --
NM_005359chr1821389 203 ----1787
NM_005375chr61370 1118 ----
NM_005387chr112709 148 ------
NM_005399chr134129 2973 1551 1510 14282 --
NM_005402chr731464 1248 707 ------
NM_005414chr31110 ------
NM_005436chr1022518 84 1979 --13774
NM_005458chr982339 1892 1822 987 727 342 272 105 --1568 --
NM_005465chr121490 98 --3733 528 395 --
NM_005493chr6138 ------
NM_005497chr1785880 5753 5647 5611 5311 4229 4185 1753 14755 1195 24974 1215
NM_005502chr922286 930 --22062 700 --
NM_005504chr1254913 4102 2105 1773 718 --11438 12564
NM_005517chr12908 172 1307 ----
NM_005522chr721198 33 1908 ----
NM_005537chr131177 ------
NM_005565chr51420 ------
NM_005596chr925321 1023 --26110 5803 --
NM_005604chr642487 1994 1941 429 ------
NM_005613chr111357 --21550 1459 --
NM_005665chr124002 1812 --11708 --
NM_005677chr33507 435 203 --11386 --
NM_005715chr662463 2345 1052 715 244 220 --22073 1934 --
NM_005717chr1--150 ----
NM_005721chr21759 ----1790
NM_005722chr21262 ------
NM_005738chr721759 1621 11468 ----
NM_005748chr1222537 71 --12843 --
NM_005756chrX21122 1098 --21044 966 --
NM_005765chrX1710 1776 ----
NM_005775chr83645 619 196 ------
NM_005776chr141795 ------
NM_005779chr543173 2261 1173 506 ----13386
NM_005802chr9--1696 ----
NM_005813chr222243 531 --1162 --
NM_005828chr1744942 4390 1426 1108 ------
NM_005840chrX37401 5308 1878 --24880 419 --
NM_005842chr131673 ------
NM_005845chr13135 ------
NM_005857chr11331 --1216 --
NM_005859chr51626 ------
NM_005862chr3--1694 ----
NM_005898chr1121039 895 ------
NM_005901chr1837783 6974 3084 1259 27592 6662 --
NM_005906chr611711 --11521 --
NM_005909chr53808 537 307 ------
NM_005911chr211353 ------
NM_005917chr21141 ------
NM_005920chr122649 2639 --1560 --
NM_005924chr71123 ------
NM_005933chr1142943 2123 821 104 ------
NM_005937chr1731352 1010 79 21121 536 23568 862 --
NM_005941chr8----23171 1331 13490
NM_005955chr144202 1985 1443 49 11906 --158
NM_005964chr17------1170
NM_005985chr20----1727 --
NM_006003chr19------1233
NM_006007chr974265 3769 3161 3014 1694 1285 402 --13523 --
NM_006011chr1532662 2611 1304 179 ----
NM_006038chr20--11413 ----
NM_006047chr2021110 235 ------
NM_006080chr712294 ------
NM_006089chrX21508 253 ------
NM_006095chr421798 676 ------
NM_006106chr1153397 3162 2572 1185 618 ------
NM_006107chr171129 178 ----
NM_006141chr162746 85 --11892 --
NM_006159chr121520 ------
NM_006166chr1222220 799 ------
NM_006203chr525514 379 ----15243
NM_006206chr41526 --12747 11015
NM_006237chr1341806 1553 921 49 ------
NM_006256chr112239 --11909 --
NM_006258chr101410 1393 ----
NM_006264chr41422 ------
NM_006282chr2011841 --1434 --
NM_006298chr632821 1267 869 12401 ----
NM_006306chrX95245 4090 4010 3774 3677 1138 791 477 126 15121 ----
NM_006313chr1221300 1261 1477 ----
NM_006319chr161797 --1741 --
NM_006321chr331879 1807 1530 ------
NM_006359chrX41628 1542 750 128 ------
NM_006371chr384557 3947 3310 2073 1344 1079 353 270 ------
NM_006375chrX21874 421 ------
NM_006380chr1723937 897 1667 1914 --
NM_006386chr2211879 --22392 1730 --
NM_006390chr1221658 1511 ------
NM_006393chr1054332 4022 3092 623 140 ------
NM_006420chr2033473 2197 66 ------
NM_006421chr821218 1150 ------
NM_006451chr511003 ------
NM_006469chr121115 266 --162 --
NM_006482chr1243350 3269 2982 2965 --11424 --
NM_006516chr121624 1098 ------
NM_006517chrX21560 898 1533 ----
NM_006526chr201708 ----12048
NM_006534chr2031261 918 87 --13172 --
NM_006538chr223982 1123 ------
NM_006540chr811334 --11220 --
NM_006544chr1424453 3767 --24646 573 --
NM_006546chr1734765 1077 245 1735 --1614
NM_006559chr11417 ------
NM_006561chr1045328 2150 1963 1102 15412 ----
NM_006572chr1722871 1076 --1281 --
NM_006593chr2------1593
NM_006598chr531855 1301 530 --21702 36 --
NM_006599chr1626727 1804 12025 25181 479 1287
NM_006603chrX2333 325 ------
NM_006609chr242719 2542 1157 485 ------
NM_006614chr323139 975 ------
NM_006621chr131704 328 302 ------
NM_006624chr101481 --1829 --
NM_006628chr1523711 1853 --1997 --
NM_006636chr21373 ------
NM_006654chr1274664 4330 3406 3056 1205 817 168 --11369 13816
NM_006660chr15186 ------
NM_006696chr51108 ------
NM_006721chr10--1140 ----
NM_006722chr31865 ------
NM_006731chr933619 1754 577 --15748 11379
NM_006738chr1554002 3136 989 732 600 ------
NM_006759chr2183 ------
NM_006766chr821697 490 ------
NM_006771chr17------1257
NM_006775chr61120 --1755 --
NM_006777chrX22755 969 1440 ----
NM_006791chr151489 ------
NM_006807chr1711289 ------
NM_006813chr62344 71 --1314 --
NM_006815chr121980 1198 ----
NM_006827chr1422335 76 12275 23334 102 --
NM_006828chr61445 ------
NM_006885chr1623676 266 --11271 --
NM_006902chr122244 1053 ------
NM_006912chr122356 1985 ------
NM_006918chr1154458 1922 1074 826 139 ------
NM_006924chr1723589 807 ------
NM_006930chr52663 636 ------
NM_006939chr141875 ------
NM_006947chr421786 1574 11388 11526 --
NM_006948chr21------1243
NM_006981chr92470 222 ------
NM_006996chr111722 11664 ----
NM_007011chr1585388 4870 2578 2505 1692 613 224 125 --36218 4950 4944 --
NM_007017chr51881 ------
NM_007030chr594722 4561 4365 4173 1452 1252 1231 573 288 --13186 --
NM_007036chr52927 672 ------
NM_007039chr1441642 1518 146 129 --21423 733 --
NM_007084chr132500 57 ------
NM_007106chr1321046 569 ------
NM_007150chrX51830 1806 1426 855 449 --12077 --
NM_007159chr31297 ------
NM_007173chr1131604 547 369 11929 1228 --
NM_007189chr721409 297 --11263 --
NM_007200chr1554002 3136 989 732 600 ------
NM_007203chr933955 1450 413 --12433 --
NM_007222chr81105 ------
NM_007236chr1542343 1751 981 193 12368 ----
NM_007249chr1379367 8598 8057 839 755 545 245 --21251 146 --
NM_007294chr17----121 --
NM_007295chr17----121 --
NM_007296chr17----121 --
NM_007297chr17----121 --
NM_007298chr17----121 --
NM_007299chr17----121 --
NM_007300chr17----121 --
NM_007302chr17----121 --
NM_007303chr17----121 --
NM_007304chr17----121 --
NM_007305chr17----121 --
NM_007324chr1--1359 ----
NM_007325chrX31829 790 23 12130 ----
NM_007341chr212325 116 ------
NM_007345chr1842223 1484 437 230 ------
NM_007358chr1----150 --
NM_007375chr11814 ------
NM_012081chr522610 2269 ------
NM_012102chr132226 1970 420 ------
NM_012161chr4----21055 975 --
NM_012164chr926150 215 12266 27219 4942 --
NM_012197chr911322 21648 1139 ----
NM_012214chr256265 5486 4284 4121 1264 --12460 --
NM_012223chr221010 390 ------
NM_012224chr4--11081 ----
NM_012234chr332836 2695 2650 ------
NM_012238chr1021670 225 --121 --
NM_012249chr222427 1263 --12911 1238
NM_012252chr775064 4206 3938 2050 1554 1530 945 14005 33625 1306 265 14761
NM_012281chr71538 ------
NM_012286chrX1477 ------
NM_012287chr333718 1376 130 11294 ----
NM_012288chr665391 1507 1223 809 629 287 13839 1597 --
NM_012296chr1143902 1383 1125 186 --21048 1031 --
NM_012297chr4135 ------
NM_012306chr1272996 2620 2213 1098 795 459 406 --12968 --
NM_012309chr1154326 4081 3530 1068 1020 ------
NM_012319chr181159 ------
NM_012329chr1711513 1458 ----
NM_012334chr544080 3233 1618 1189 --23823 3032 --
NM_012417chr17------1415
NM_012428chr15----1170 --
NM_012446chr51203 ------
NM_012464chr412872 184 12687 --
NM_013255chr758151 7381 5561 3188 1079 --22452 1198 --
NM_013281chr20------11528
NM_013309chr15----12652 --
NM_013336chr351810 1457 1406 1231 86 11972 ----
NM_013341chr222290 44 ------
NM_013354chr8--11051 ----
NM_013438chr921346 391 ----11645
NM_013943chr132839 2201 752 1422 ----
NM_013989chr1421240 847 14069 --11701
NM_014011chr23616 584 519 ------
NM_014016chr3----1429 --
NM_014038chr71317 ------
NM_014043chr32352 265 ------
NM_014044chr2----1157 --
NM_014048chr1644678 4651 3378 1686 ------
NM_014057chr9----1401 --
NM_014080chr15------1417
NM_014089chr1331758 1491 647 ----1693
NM_014106chr153844 230 115 ------
NM_014112chr865196 4920 4355 4236 883 621 ----14170
NM_014141chr784893 4791 3964 3358 1850 1727 682 279 13878 --13265
NM_014154chr311106 ----167
NM_014155chr1156781 5910 2968 1389 633 --15423 --
NM_014157chr1673965 3572 3153 2640 958 894 214 ------
NM_014171chr2----165 --
NM_014217chr151198 1180 773 763 707 --127 11312
NM_014240chr343822 3679 1070 762 13559 33652 1104 876 --
NM_014253chrX12019 1932 1959 --
NM_014278chr42433 72 ------
NM_014283chr11110 ------
NM_014309chr2255007 4503 1564 1171 659 ------
NM_014368chr941736 1660 1413 724 --11582 --
NM_014372chr122041 462 ------
NM_014382chr31428 ------
NM_014391chr10152 ------
NM_014392chr431382 1275 504 1176 ----
NM_014393chr8----1467 1566
NM_014423chr555314 5238 5153 4909 1601 ------
NM_014445chr31424 --22064 954 --
NM_014447chr411363 ------
NM_014454chr6166 1168 ----
NM_014456chr1041797 1580 1571 1437 1111 ----
NM_014462chr81211 ------
NM_014497chr21195 ------
NM_014517chr31216 --1253 1673
NM_014584chr1411638 1225 --172
NM_014586chr2154832 4736 4608 3420 322 12967 34371 928 904 --
NM_014602chr3164 ------
NM_014607chr21739 11430 11518 --
NM_014612chr9------1482
NM_014614chr241423 1404 236 59 ------
NM_014615chr1612215 --11334 --
NM_014621chr2199 ------
NM_014630chr1563889 1568 1205 772 715 688 ------
NM_014636chr953629 3506 1480 969 80 21160 547 13612 --
NM_014646chr1822173 973 12302 ----
NM_014647chr1611565 ------
NM_014665chr8123305 3267 3174 3126 3107 3054 2958 2631 1473 1032 444 138 --22643 527 --
NM_014671chr721049 486 ------
NM_014682chr8--1914 ----
NM_014683chr1731651 1624 299 ----1648
NM_014690chr752354 1104 1018 647 544 --1522 11251
NM_014701chr1513345 --1779 --
NM_014702chr61492 --12985 --
NM_014705chr721956 83 ----1835
NM_014717chr192723 140 ------
NM_014720chr1011364 ------
NM_014726chr173550 267 166 ------
NM_014729chr821872 1594 ------
NM_014730chr1255117 4570 3298 1946 416 13771 ----
NM_014730chr1255117 4570 3298 1946 416 13771 ----
NM_014737chr2064085 1607 1476 356 72 27 ------
NM_014739chr623813 1274 11624 ----
NM_014747chr154325 3880 1601 1578 1278 ------
NM_014751chr841874 1633 1407 617 ------
NM_014755chr243854 3398 1247 484 11117 1784 --
NM_014788chr9132 --1380 --
NM_014802chr122901 149 ------
NM_014810chr143353 833 825 156 ------
NM_014819chr52818 300 1715 ----
NM_014838chr222384 111 ------
NM_014839chr121701 771 ------
NM_014850chr333837 1523 851 ----13945
NM_014877chr1767139 6179 6045 5815 689 629 --1643 17447
NM_014897chr1722604 2229 ------
NM_014904chr10----1516 23956 3819
NM_014905chr21743 ------
NM_014906chr1731559 943 466 ----1855
NM_014912chr1032162 1031 62 ----13013
NM_014914chr21291 31329 461 314 ----
NM_014915chr1011446 ------
NM_014920chr653212 3193 1539 1248 499 196 ----
NM_014921chr1922718 2358 --12458 --
NM_014932chr31286 --1545 --
NM_014934chr131283 13887 23412 3057 13209
NM_014939chr18------11419
NM_014946chr223087 1065 ------
NM_014949chr11189 ------
NM_014953chr1373934 3911 3535 3023 1717 1589 1094 --33570 3523 1673 --
NM_014969chr11796 ------
NM_014991chr423272 74 ------
NM_015000chr121236 12470 ----
NM_015001chr11833 ------
NM_015009chr3----1787 --
NM_015011chr131822 ----11156
NM_015025chr222348 664 ------
NM_015026chr1224261 516 ----13038
NM_015032chr1321984 552 --12852 --
NM_015035chr2095272 5027 4912 2645 2375 2092 1659 1522 115 ----26329 511
NM_015045chr10------1717
NM_015059chr1563580 3398 2977 2458 1345 79 1192 ----
NM_015068chr723186 165 --1116 --
NM_015074chr194611 3546 3327 1947 1620 1220 1079 962 416 1677 15001 11436
NM_015079chr1531259 853 536 --1609 1569
NM_015087chr1332560 2084 979 ------
NM_015090chr174063 1720 1588 1024 909 834 321 24293 1112 14563 14906
NM_015100chr121535 81 ------
NM_015115chr41689 --1522 --
NM_015132chr7--1436 ----
NM_015156chr1422922 591 --1127 --
NM_015170chr821475 550 ----1288
NM_015172chr111231 ------
NM_015185chrX31916 723 252 ------
NM_015199chr351110 956 413 405 65 ------
NM_015203chr1121 ------
NM_015208chr181826 1439 23809 2810 --
NM_015209chr122299 120 --11847 --
NM_015216chr511364 ------
NM_015238chr5190 ------
NM_015245chr632644 635 49 ------
NM_015263chr15--11116 144 --
NM_015267chr121781 ------
NM_015268chr31212 ------
NM_015270chr1251967 1748 507 444 89 ------
NM_015275chr1221427 754 1236 --1513
NM_015285chr1831763 944 125 --21651 198 --
NM_015288chr543374 3290 3116 3091 ----13404
NM_015299chr1463896 2911 1605 1225 460 102 --23233 1112 --
NM_015305chr142632 427 ------
NM_015310chr897313 7019 6714 5748 3066 2747 2060 1561 798 22715 1475 ----
NM_015316chr141197 ------
NM_015317chr212395 12013 12034 --
NM_015335chr1212554 --2669 147 --
NM_015336chr1211782 12107 ----
NM_015355chr1721931 105 ------
NM_015365chrX23810 3119 ----1791
NM_015382chr141530 --1682 --
NM_015393chr452463 2422 1086 1056 819 1179 ----
NM_015397chr92483 137 ------
NM_015423chr1111586 ------
NM_015435chr81147 1485 ----
NM_015455chr512777 12884 ----
NM_015475chr21690 1126 ----
NM_015493chr19--11972 ----
NM_015503chr16--1493 ----
NM_015523chr111224 ------
NM_015530chr21108 ------
NM_015549chr141548 ------
NM_015550chr7--33248 3207 64 ----
NM_015553chr645039 4663 3790 3460 14094 14009 --
NM_015564chr523573 3379 --23398 2539 --
NM_015565chr2131640 551 48 ------
NM_015569chr133122 856 285 13846 --13460
NM_015578chr1921829 1637 ------
NM_015601chr10192 ------
NM_015604chr141227 ------
NM_015608chr101586 ------
NM_015640chr11995 13334 1823 14263
NM_015678chr1321274 1106 ------
NM_015713chr833181 3082 978 ------
NM_015718chr6124 ------
NM_015850chr862386 2185 989 744 323 284 ------
NM_015874chr4----1416 --
NM_015886chr854571 4332 1894 1235 733 ------
NM_015906chr154343 4234 3901 2982 116 ------
NM_015938chr31274 --1888 --
NM_015948chr6198 ------
NM_015980chr521209 241 ------
NM_015995chr1585471 5075 4402 3680 1857 947 918 834 13667 11886 --
NM_016018chr81666 ------
NM_016032chrX1554 --1987 --
NM_016053chr12143 ------
NM_016072chr121372 ------
NM_016076chr13796 428 174 1408 1417 --
NM_016078chr171956 1808 ----
NM_016083chr621360 171 ------
NM_016107chr511258 ------
NM_016125chr17167 ------
NM_016132chr1513052 11378 --1826
NM_016152chr3----11045 --
NM_016156chr1112206 ------
NM_016173chr363770 3540 3500 1242 801 455 --1412 --
NM_016206chr367142 6953 2807 2633 2483 1080 25603 828 1103 17663
NM_016221chr542320 1761 606 154 ------
NM_016227chr11110 ------
NM_016231chr1711674 ----11644
NM_016250chr142716 270 ------
NM_016260chr255153 4829 2456 2107 1907 --1279 15262
NM_016287chr11154 ----1417
NM_016322chr9--11271 ----
NM_016333chr161477 ------
NM_016338chr511138 ------
NM_016351chr71248 --1488 --
NM_016424chr1741634 718 705 407 11583 31376 453 196 --
NM_016436chr2042650 444 395 42 131 --11056
NM_016441chr21830 12094 ----
NM_016472chr1421088 38 ------
NM_016484chrX2693 680 ----1221
NM_016485chr61777 ------
NM_016513chr653212 3193 1539 1248 499 196 ----
NM_016542chrX1630 ------
NM_016578chr111453 ------
NM_016603chr5199 12142 ----
NM_016617chr1321769 80 ------
NM_016626chr1821348 51 ------
NM_016628chr102800 648 ------
NM_016644chr5--1128 ----
NM_016654chr151906 --177 --
NM_016824chr101500 11830 ----
NM_016830chr122538 530 ------
NM_017412chr821265 181 ------
NM_017416chrX------1116
NM_017420chr1433690 714 449 --11023 --
NM_017440chr12--141 ----
NM_017443chr9134 ------
NM_017455chr15----1170 --
NM_017522chr131389 1157 318 ------
NM_017544chrX1308 ------
NM_017548chr312155 --11989 --
NM_017553chr1511024 --1318 --
NM_017563chr385698 5254 3933 1861 1701 743 416 220 14150 ----
NM_017578chr31106 ------
NM_017592chr1962570 2242 2184 1879 913 885 --22408 2226 --
NM_017610chr15--1136 ----
NM_017628chr474286 4279 4239 4199 3733 1885 1761 --24009 545 11537
NM_017633chr611183 --11008 --
NM_017634chr831709 1487 319 --2692 288 --
NM_017637chr938556 1442 1208 26549 955 --26921 3580
NM_017644chr344257 1162 561 404 --21884 870 --
NM_017650chr755953 5483 4112 3732 616 --11757 --
NM_017651chr631438 633 483 --11558 11391
NM_017671chr2052229 1700 1651 158 48 --1846 --
NM_017672chr15--1322 ----
NM_017694chr21627 ------
NM_017709chr132615 1258 85 ------
NM_017714chr20135 ----1891
NM_017737chr11487 1799 ----
NM_017741chr432071 312 176 155 ----
NM_017752chrX41810 1756 1376 822 1331 ----
NM_017763chr1741223 1175 1077 63 ------
NM_017768chr11917 ------
NM_017772chr631586 527 248 ------
NM_017778chr81216 ------
NM_017779chr12939 863 11718 ----
NM_017780chr81734 ------
NM_017786chr82259 180 ------
NM_017787chr101202 --22765 165 22525 2257
NM_017813chr865039 4927 4420 1153 876 22 --34825 2083 250 --
NM_017824chr1032391 933 399 ------
NM_017849chr243005 2554 2417 1157 ------
NM_017856chrX31940 107 47 1648 ----
NM_017866chr81725 ------
NM_017913chr91343 ------
NM_017934chr6----144 --
NM_017938chrX11773 175 --11475
NM_017943chr141137 ------
NM_017994chr762882 2806 2653 2529 762 215 ------
NM_018003chr1511701 ------
NM_018027chr101565 ------
NM_018060chr11394 ------
NM_018063chr101349 ------
NM_018073chr1111043 --11352 --
NM_018084chr223214 2624 ------
NM_018086chr2141 11597 ----
NM_018114chr33226 211 130 --1405 --
NM_018115chr42563 312 ------
NM_018159chrX21099 449 ------
NM_018171chr121932 --182 --
NM_018184chr321337 592 ------
NM_018211chr121783 1642 12081 12237 --
NM_018214chr61529 ------
NM_018234chr221903 32 22163 1762 11574 --
NM_018241chr4--1357 1870 1130
NM_018247chr632810 1069 108 1607 ----
NM_018299chr853445 2637 2481 2307 160 --22692 672 --
NM_018330chr1021743 700 --11482 --
NM_018360chrX1145 ------
NM_018362chr1133081 2847 1366 ------
NM_018364chr142551 480 448 419 --11123 13196
NM_018374chr744705 3779 988 787 1893 --14835
NM_018403chr353392 2897 2528 699 668 ----13399
NM_018409chr423135 2648 12030 ----
NM_018424chr931855 1812 1358 --11691 --
NM_018429chr532749 2190 1107 ------
NM_018433chr21457 ------
NM_018440chr878679 6913 6280 5705 2727 2292 176 --1226 --
NM_018452chr6_random43821 3399 3063 1495 --1655 --
NM_018490chr111511 ------
NM_018555chr1941742 1549 912 812 --11903 --
NM_018557chr2------11315
NM_018569chr4--11531 ----
NM_018584chr11958 --11047 --
NM_018602chr15--161 1338 21426 382
NM_018638chr121581 15163 ----
NM_018650chr1--11797 151 --
NM_018674chr21720 ------
NM_018682chr7174 ------
NM_018710chr81986 ------
NM_018837chr202792 38 ------
NM_018976chr1221876 889 12643 --1605
NM_018981chr21946 ------
NM_018994chr11420 ------
NM_018999chr1054943 4666 4340 3785 3763 11963 13891 --
NM_019001chr323146 146 1770 1976 --
NM_019004chr732173 2011 641 --138 --
NM_019016chr17185 ------
NM_019018chr51772 --1132 --
NM_019022chr181452 13198 ----
NM_019035chr41340 --11845 --
NM_019046chr101668 ------
NM_019071chr71593 ------
NM_019080chr1311182 --11453 --
NM_019087chr511295 ----1706
NM_019096chr62970 717 ------
NM_019596chr2152550 885 876 573 430 ------
NM_019605chr11173 ------
NM_019842chr61355 --125 --
NM_019891chr1------11290
NM_019903chr101500 11830 ----
NM_020116chr4------1624
NM_020122chr235218 3800 3642 11080 ----
NM_020123chr101233 11491 ----
NM_020144chr731309 602 418 ----11885
NM_020148chr1832629 2130 2122 --12314 --
NM_020150chr1031655 1577 280 1592 ----
NM_020177chr511087 --12219 12852
NM_020194chr21532 ----1682
NM_020205chr123119 2873 ----1246
NM_020228chr111329 ------
NM_020245chr624984 256 --13430 --
NM_020319chr71693 --1656 --
NM_020341chr201179 ----11597
NM_020346chr1111260 1608 ----
NM_020357chr31136 ------
NM_020374chr1241969 1640 1415 329 --11997 --
NM_020384chrX31489 1296 700 --11907 --
NM_020390chr343657 3591 1197 636 ----13819
NM_020403chr1321424 1307 ------
NM_020432chr71894 --11798 --
NM_020449chrX1562 ------
NM_020466chr664709 4485 3381 1748 1535 1239 ----13591
NM_020640chr321484 912 1370 ----
NM_020693chr11--1208 --1348
NM_020699chr155050 1711 1522 1198 597 ----13384
NM_020713chr2082177 2075 1950 920 442 425 389 191 ------
NM_020734chr1223071 2359 ------
NM_020739chr1543537 3138 1368 1346 13200 11612 1486
NM_020747chr51615 ------
NM_020760chr221645 571 --11857 --
NM_020772chr1748287 7748 2050 723 ----12785
NM_020773chr432532 2492 2297 ------
NM_020779chr212155 11245 12642 --
NM_020794chr11454 ------
NM_020800chr311166 ------
NM_020801chr532350 1058 231 12080 ----
NM_020803chr422329 2185 ----146
NM_020805chr181543 196 ----
NM_020809chr1132259 1810 393 ------
NM_020841chr12----12692 1426
NM_020854chr1811506 ------
NM_020856chr1941200 991 92 57 --1330 --
NM_020858chr15--12281 ----
NM_020886chr111102 ----2329 180
NM_020918chr1033558 1105 56 --1869 --
NM_020919chr211289 ------
NM_020924chr91325 --1313 --
NM_020925chr121273 409 ------
NM_020940chr1031807 1131 363 12665 ----
NM_020951chr1941904 1775 1602 859 ------
NM_020952chr92354 216 ------
NM_020956chr1954124 3744 3699 1256 426 --33900 1845 1767 --
NM_020983chr1251967 1748 507 444 89 ------
NM_020993chr1272371 2153 1880 923 717 678 646 --2629 43 12715
NM_021007chr21561 1925 ----
NM_021012chr1783104 2781 2774 2754 1990 1234 814 598 ------
NM_021020chr853115 2861 2210 1009 856 --23047 1170 --
NM_021033chr1342537 2404 1334 1072 --1238 --
NM_021064chr621781 436 ------
NM_021072chr5----12335 --
NM_021079chr1731305 469 291 ------
NM_021097chr232955 990 201 --12373 1705
NM_021132chr101883 ------
NM_021144chr9----1217 --
NM_021145chr7--1854 141 --
NM_021148chr721727 975 ------
NM_021159chr41142 ------
NM_021239chr141461 ----1219
NM_021249chr1421253 1085 ------
NM_021252chr1011951 12025 ----
NM_021255chr1421121 428 13164 1525 --
NM_021622chr1021992 613 ------
NM_021627chr31112 ------
NM_021629chr374806 4488 4402 3194 1864 537 184 --1407 --
NM_021638chr484296 4030 3913 3320 3168 562 483 442 ----11194
NM_021643chr2--11429 ----
NM_021722chr71207 --1447 --
NM_021723chr71248 --1488 --
NM_021728chr14173 --1135 --
NM_021785chrX168 ------
NM_021813chr634438 3605 1241 ------
NM_021814chr611585 ------
NM_021911chr511521 12244 ----
NM_021912chr1543860 3391 1530 589 --13491 --
NM_021935chr31212 1883 ----
NM_021940chr61399 ------
NM_021945chr673317 2837 2651 1395 1373 1187 48 ------
NM_021946chrX11443 ------
NM_021947chr172392 346 ------
NM_021961chr1157297 7139 7079 2348 214 ------
NM_021964chr334793 2100 2068 11382 ----
NM_021999chr131535 ------
NM_022037chr21956 ------
NM_022048chr1546084 4448 2056 1666 ------
NM_022079chr10192 ------
NM_022091chr622416 711 22081 804 1193 --
NM_022116chr7124 ------
NM_022137chr1461993 1401 1392 725 437 383 --11450 --
NM_022143chr711209 1239 ----
NM_022154chr4135 ------
NM_022173chr21956 ------
NM_022340chr363536 3369 3309 2329 2309 1367 ----23147 2851
NM_022351chr81545 ------
NM_022454chr81131 ------
NM_022459chr1342096 1987 1431 289 --11371 --
NM_022462chr1943807 3601 3349 2895 --23424 3412 12305
NM_022465chr122662 53 ----12432
NM_022473chr1543706 3404 772 250 --1126 --
NM_022484chr711093 --1348 11040
NM_022716chr122088 897 ------
NM_022719chr2263690 2859 2701 1487 1074 715 1165 23802 258 --
NM_022726chr611595 ----1676
NM_022739chr17--1403 ----
NM_022745chr132676 437 183 --1610 --
NM_022749chr831297 1036 446 --11149 --
NM_022751chr181262 ------
NM_022755chr932435 2276 2267 --11992 --
NM_022776chr32546 143 ----11146
NM_022781chr913038 12049 ----
NM_022817chr2----138 --
NM_022818chr16--1519 --11664
NM_022828chr511604 1244 ----
NM_022845chr1621887 104 ------
NM_022893chr222994 2279 ------
NM_022894chr241474 686 593 48 ------
NM_022898chr1444629 1330 787 268 13345 ----
NM_022901chr921246 100 ----1580
NM_022918chr111421 ------
NM_023010chrX1124 ------
NM_023016chr221859 500 1907 42712 1053 733 717 --
NM_023018chr171398 1309 1279 1265 1073 472 102 ----11208
NM_023037chr131860 1234 ----
NM_023071chr1211102 ------
NM_023079chr1731774 245 79 11480 ----
NM_023105chr862386 2185 989 744 323 284 ------
NM_023106chr862386 2185 989 744 323 284 ------
NM_023110chr862386 2185 989 744 323 284 ------
NM_023111chr862386 2185 989 744 323 284 ------
NM_023929chr822247 95 ------
NM_024019chr41302 ------
NM_024052chr17--33031 976 521 ----
NM_024063chr15----1179 --
NM_024090chr411689 171 ----
NM_024094chr82595 113 ------
NM_024345chr956111 5311 2186 461 177 --11548 --
NM_024416chr9----1401 --
NM_024490chr152537 133 ------
NM_024496chr14----1310 --
NM_024513chr343503 2482 1047 476 12862 22852 496 --
NM_024524chr322746 298 --13152 --
NM_024529chr11932 --11094 --
NM_024551chr1222525 151 ------
NM_024551chr1222525 151 ------
NM_024561chr132559 122 ------
NM_024581chr61177 ------
NM_024613chr821784 1540 ------
NM_024639chr622467 661 ------
NM_024657chrX2555 511 ------
NM_024665chr334111 1169 614 1871 14635 --
NM_024674chr152436 2361 2229 1158 1075 --1792 --
NM_024698chr1121037 397 11073 ----
NM_024713chr1511281 ------
NM_024721chr81869 11649 ----
NM_024740chr1143383 3204 1088 987 12986 23069 972 13810
NM_024749chr132291 596 182 ------
NM_024753chr23672 538 228 ------
NM_024757chr91977 ------
NM_024761chr944871 1874 1568 300 11107 --14848
NM_024763chr11938 ------
NM_024770chr296684 6437 5948 5878 5372 2066 1920 792 783 ----25942 24
NM_024786chr52885 630 ------
NM_024795chr21573 --11384 --
NM_024824chr1421554 477 ------
NM_024854chr1221447 1393 ----11156
NM_024881chr1973444 3212 3076 2993 849 832 478 --11057 --
NM_024884chr1463302 3006 1653 1064 189 180 11310 1891 --
NM_024887chr141821 1681 1605 80 --11887 --
NM_024939chr162257 124 1586 ----
NM_024949chr421247 239 ------
NM_024953chr1251782 603 582 560 21 --1532 --
NM_024971chr92354 216 ------
NM_025057chr143508 290 197 ------
NM_025106chr11755 ----21431 779
NM_025134chr161239 ----1527
NM_025146chr3--12257 --11849
NM_025160chr113267 --14092 --
NM_025179chr154347 4017 3562 1570 1015 ----1275
NM_025208chr111717 --22135 320 --
NM_025212chr4129 ------
NM_025248chr1762487 2453 2419 2330 1969 721 12371 ----
NM_030625chr102499 258 ------
NM_030627chr511257 12892 ----
NM_030637chr141709 ------
NM_030640chr121661 ------
NM_030647chr723865 2339 11456 --25138 4156
NM_030648chr444419 1880 1666 969 12178 --11077
NM_030650chr223519 524 --1678 --
NM_030664chr1011875 ------
NM_030670chr1221519 1479 ------
NM_030671chr1221519 1479 ------
NM_030762chr12--11599 1596 1139
NM_030791chr1441653 1511 722 603 --1294 --
NM_030799chr511451 --12194 --
NM_030806chr178874 8501 7996 7931 6585 6575 2350 --29135 8767 --
NM_030816chr133591 3309 661 --12260 --
NM_030817chr1263531 2861 2634 1363 1090 291 12764 --12772
NM_030881chr2211879 --22392 1730 --
NM_030934chr121761 1236 ------
NM_030949chr621377 554 ------
NM_030964chr533200 2893 1463 13018 ----
NM_030981chr1161156 984 775 495 71 33 ------
NM_031284chr15----1120 --
NM_031417chr1972539 2389 1991 1763 762 534 217 --12377 --
NM_031422chr183523 501 404 1160 ----
NM_031435chr1232488 2453 351 --1480 12735
NM_031483chr2033052 527 416 ------
NM_031492chr111503 ------
NM_031844chr123983 1302 --14113 13218
NM_031845chr243608 2997 2388 40 ------
NM_031847chr243608 2997 2388 40 ------
NM_031922chr62527 227 ------
NM_032021chr111936 ------
NM_032116chr1321283 281 ----14286
NM_032128chr4--1718 ----
NM_032154chr101716 ------
NM_032160chr1833885 1590 1097 13370 ----
NM_032195chr211108 ------
NM_032199chr1043147 910 362 237 ------
NM_032229chr131997 --11066 --
NM_032239chr421376 1213 ------
NM_032268chr1683238 3054 3043 2151 2109 817 278 116 ------
NM_032271chr1651246 604 434 217 107 --11072 11226
NM_032288chr31745 12063 ----
NM_032294chr1711458 --1432 --
NM_032364chr12----1250 1394
NM_032415chr73343 185 57 ------
NM_032436chr132395 279 ------
NM_032438chr61192 ------
NM_032440chr101844 --11832 --
NM_032445chr15187 ----11625
NM_032457chr433282 2876 1173 --1538 --
NM_032501chr2051327 1102 269 69 37 ------
NM_032505chr31281 21004 232 --12378
NM_032560chr1411069 ------
NM_032632chr141590 2345 84 11758 --
NM_032682chr312282 12396 ----
NM_032689chr191127 ------
NM_032778chr343122 3095 2259 169 --1514 1265
NM_032782chr53391 316 177 1501 ----
NM_032796chrX2741 87 ------
NM_032810chr1011192 11223 1539 11086
NM_032828chr1974340 4330 4273 1776 1476 474 409 11255 24464 4390 --
NM_032859chr1313999 13585 1708 --
NM_032873chr1164267 3739 3522 3503 2919 256 ------
NM_032918chr122330 288 --1913 --
NM_032926chrX1214 ------
NM_032961chr411264 ------
NM_032983chr763023 2520 1122 727 614 30 ------
NM_032998chr11986 11036 ----
NM_033012chr132118 103 11071 ----
NM_033014chr9----1401 --
NM_033020chr154343 4234 3901 2982 116 ------
NM_033119chr162840 62 ------
NM_033135chr111717 --22135 320 --
NM_033158chr32220 59 ------
NM_033181chr621360 171 ------
NM_033211chr52278 175 ------
NM_033224chr726871 6202 1415 12633 2856 839
NM_033225chr81822 1135 22983 255 --
NM_033272chr21104 ------
NM_033285chr853721 866 696 667 335 --1609 --
NM_033300chr131389 1157 318 ------
NM_033326chr1122152 696 ------
NM_033360chr1233622 3553 606 23136 2995 1151 --
NM_033380chrX1311 ------
NM_033381chrX1311 ------
NM_033389chr1794716 4521 4340 4036 3712 3521 3387 448 337 ------
NM_033394chr2----11206 --
NM_033425chr1132816 448 170 11036 --1787
NM_033426chr1462108 773 527 490 353 177 ------
NM_033430chr443973 3842 3309 538 13243 --12867
NM_033437chr443973 3842 3309 538 13243 --12867
NM_033496chr102468 159 ------
NM_033497chr102468 159 ------
NM_033498chr102468 159 ------
NM_033500chr102468 159 ------
NM_033503chr1533732 1158 29 13871 21318 750 --
NM_033512chr822809 1959 ------
NM_033535chr4----21055 975 --
NM_033550chr2042339 1808 1730 1680 --1847 --
NM_033642chrX21094 946 ------
NM_033656chr2121986 497 --11641 --
NM_052834chr1831763 944 125 --21651 198 --
NM_052875chr1182183 2036 1901 1528 1360 657 586 29 ------
NM_052879chr1213583 --12846 --
NM_052885chr1233974 1592 548 --1712 --
NM_052898chr811538 ------
NM_052905chr241891 1585 1190 613 1537 ----
NM_052910chr132463 62 1121 ----
NM_052911chr182768 705 ------
NM_052966chr132664 240 58 11017 ----
NM_053016chr956739 5687 3139 2642 1232 ------
NM_053023chr112964 449 --13288 --
NM_053043chr7105359 5096 4989 4475 4310 3883 2092 1408 1250 75 --1707 --
NM_053056chr1163018 2831 2407 771 550 360 12961 11986 --
NM_054016chr12635 29 ------
NM_054016chr12635 29 ------
NM_054016chr12635 29 ------
NM_057159chr911511 ------
NM_057175chr411974 ------
NM_058172chr431138 40 28 ------
NM_058241chr221875 720 11820 ----
NM_058241chr221875 720 11820 ----
NM_080388chr13485 177 29 ------
NM_080491chr1143902 1383 1125 186 --21048 1031 --
NM_080538chr33507 435 203 --11386 --
NM_080539chr33507 435 203 --11386 --
NM_080541chr33507 435 203 --11386 --
NM_080552chr201698 ------
NM_080629chr11122 ------
NM_080630chr11122 ------
NM_080632chrX1124 ------
NM_080645chr622194 1857 --1712 1857
NM_080666chr141525 ------
NM_080676chr2042906 2756 1202 243 11173 --2637 569
NM_080682chr11560 ------
NM_080683chr41422 ------
NM_080684chr41422 ------
NM_080685chr41422 ------
NM_080738chr1----11326 --
NM_080742chr6--1191 ----
NM_080743chr652281 1922 1790 771 120 --183 --
NM_080759chr1332041 949 476 12302 ----
NM_080760chr1332041 949 476 12302 ----
NM_080840chr201116 ------
NM_080841chr201116 ------
NM_080867chr1423837 331 13622 1312 --
NM_080927chr31185 --2326 137 --
NM_100264chr102800 648 ------
NM_100486chr102800 648 ------
NM_130434chr151486 ------
NM_130436chr2132807 510 358 --1608 --
NM_130438chr2143384 1087 935 427 --11185 --
NM_130838chr1511748 ------
NM_130839chr1511748 ------
NM_130846chr12--1700 ----
NM_133370chr411421 --33465 3021 897 --
NM_133372chr522756 2534 --1414 --
NM_133468chr721853 447 22472 644 ----
NM_133477chr41675 12977 13057 --
NM_133478chr242071 2062 741 732 ------
NM_133493chr644454 3446 1718 565 --13796 --
NM_133496chr143878 3869 2960 1362 1735 11525 --
NM_133631chr311259 ------
NM_133646chr254904 3791 3672 1690 1275 11081 ----
NM_138288chr1421367 398 ------
NM_138295chr72107 25 ------
NM_138319chr1541015 803 343 31 ------
NM_138338chr2273009 2344 887 704 664 622 281 --12207 --
NM_138340chr181427 ------
NM_138357chr101178 ------
NM_138426chr71510 ------
NM_138444chr1354592 4387 3341 3207 744 14049 ----
NM_138473chr1254352 3671 930 902 784 14676 ----
NM_138476chr14124 ------
NM_138576chr1444629 1330 787 268 13345 ----
NM_138621chr223982 1123 ------
NM_138713chr1626727 1804 12025 25181 479 1287
NM_138714chr1626727 1804 12025 25181 479 1287
NM_138722chr121146 1564 ----
NM_138723chr121146 1564 ----
NM_138730chr61139 ------
NM_138773chr51720 --1162 --
NM_138782chr512085 ------
NM_138786chr31389 ------
NM_138802chr2165 ------
NM_138927chr211399 ------
NM_138967chr1542292 1966 803 522 11890 1409 --
NM_139067chr121311 ------
NM_139131chr112709 148 ------
NM_139283chr1211658 21733 379 1468 --
NM_139316chr72914 785 ------
NM_144571chr455086 4906 2596 2444 1334 ------
NM_144595chr131939 ------
NM_144599chr1544704 3623 931 38 12218 21041 499 --
NM_144609chr171104 ------
NM_144644chr41180 ------
NM_144767chr1554002 3136 989 732 600 ------
NM_144949chr23616 584 519 ------
NM_144967chrX150 ------
NM_144979chr4----1227 --
NM_145008chr113626 302 155 ------
NM_145011chr101830 --170 --
NM_145176chr663224 3070 3052 2536 952 408 12833 --1196
NM_145259chr2--11934 25999 843 --
NM_145307chr1044194 3544 2877 62 ----13311
NM_145320chr7--33248 3207 64 ----
NM_145321chr7--33248 3207 64 ----
NM_145322chr7--33248 3207 64 ----
NM_145332chr62141 33 ------
NM_145333chr62141 33 ------
NM_145341chr1041797 1580 1571 1437 1111 ----
NM_145686chr222607 2596 22410 406 12314 11100
NM_145687chr222607 2596 22410 406 12314 11100
NM_145690chr841584 1297 280 266 ------
NM_145698chr1031357 590 353 ------
NM_145861chr1----11326 --
NM_147150chr933955 1450 413 --12433 --
NM_148955chr1556315 6192 6101 4092 1668 --24449 3984 --
NM_152233chr1421253 1085 ------
NM_152247chr223750 641 217 ------
NM_152253chr22104136 4027 3603 3149 3112 3089 2821 2643 1372 952 1721 12827 --
NM_152261chr1222383 471 12423 ----
NM_152282chr321079 227 2874 196 ----
NM_152309chr1031932 1464 779 ----1179
NM_152407chr522606 91 ------
NM_152409chr512615 13334 ----
NM_152417chr8163 ------
NM_152418chr81651 --1671 --
NM_152424chrX63719 3370 1592 1301 625 589 ------
NM_152462chr17--2568 231 ----
NM_152515chr2192 ------
NM_152523chr21498 ------
NM_152556chr722189 259 ------
NM_152594chr151529 ------
NM_152622chr521122 464 --1907 --
NM_152629chr923775 814 --33641 3599 401 1458
NM_152636chr1122797 396 ----12486
NM_152641chr121807 --12808 --
NM_152678chr352712 924 915 713 229 --11812 --
NM_152695chrX11520 ------
NM_152754chr72819 613 ----1115
NM_152756chr523056 138 ------
NM_152758chr812993 --1284 --
NM_152772chr12--1397 ----
NM_152787chrX23892 3483 --23278 633 --
NM_152826chr1556315 6192 6101 4092 1668 --24449 3984 --
NM_152835chr122414 642 ------
NM_152838chr2021110 235 ------
NM_152890chr13859 463 167 ------
NM_152924chr1585388 4870 2578 2505 1692 613 224 125 --36218 4950 4944 --
NM_152994chr21438 ------
NM_152998chr71227 ------
NM_153020chr61596 21195 204 ----
NM_153182chr343122 3095 2259 169 --1514 1265
NM_153184chr3------11366
NM_153207chr1233895 3204 1156 --13354 --
NM_153208chr161865 --1941 --
NM_153218chr131320 ------
NM_153332chr81520 --1173 --
NM_153347chr111111 --11025 --
NM_153367chr1053017 2771 1357 1101 648 --1660 --
NM_153487chr683092 1364 1351 1305 1190 588 173 42 1342 ----
NM_153607chr523141 455 --1256 --
NM_153616chr15--12281 ----
NM_153617chr15--12281 ----
NM_153618chr15--12281 ----
NM_153619chr154932 798 727 486 13519 ----
NM_153620chr721589 424 11299 ----
NM_153702chr41195 ------
NM_153810chr1015088 ------
NM_170696chr152589 174 ------
NM_170697chr152589 174 ------
NM_170739chr111270 ------
NM_170750chrX1334 ------
NM_170751chr621351 993 --1498 --
NM_170752chr621351 993 --1498 --
NM_170774chr2064085 1607 1476 356 72 27 ------
NM_171998chrX3896 508 218 --1821 --
NM_172058chr811415 ------
NM_172059chr811415 ------
NM_172060chr811415 ------
NM_172071chr146026 5173 1634 53 16251 12337 15560
NM_172103chr61254 22464 2421 ----
NM_172105chr61254 22464 2421 ----
NM_172110chr201684 ------
NM_172111chr201684 ------
NM_172112chr201684 ------
NM_172113chr201684 ------
NM_172127chr421860 86 ------
NM_172128chr421816 42 ------
NM_172159chr31309 ----1930
NM_172160chr31309 ----1930
NM_172206chr1711458 --1432 --
NM_172240chr12----1164 --
NM_172337chr14173 --1135 --
NM_172373chr131215 ------
NM_173075chr431736 1557 443 ------
NM_173078chrX2356 97 ------
NM_173083chr11130 ------
NM_173172chr221490 1023 11151 ----
NM_173198chr92470 222 ------
NM_173200chr92470 222 ------
NM_173214chr1626727 1804 12025 25181 479 1287
NM_173355chr231003 883 383 ------
NM_173359chr3------1353
NM_173478chr171297 184 ----
NM_173495chrX3972 173 113 ------
NM_173511chr211543 11461 --22726 2719
NM_173519chr81238 ------
NM_173547chr1731239 245 28 1611 11436 --
NM_173552chr32752 548 ------
NM_173559chr61121 ------
NM_173563chr6187 ------
NM_173582chr1165243 4099 2278 1387 1243 36 ------
NM_173595chr1264840 4231 4020 1206 955 80 ------
NM_173602chr1213308 --11014 --
NM_173642chr179040 8618 7479 5765 5727 276 120 ------
NM_173681chr771699 1589 1521 775 731 588 97 ------
NM_173822chr22639 331 ------
NM_173825chr312910 --12654 --
NM_173848chr81275 ------
NM_173851chr883970 3782 3175 3037 2471 1551 1533 167 --23563 1354 11348
NM_175038chr121163 ------
NM_175069chr91926 151 ----
NM_175610chr1521315 121 ------
NM_175736chr12117365 6969 6721 6273 5900 5666 1387 1262 978 296 162 --11734 --
NM_175748chr1421904 391 11499 ----
NM_175852chr122893 2682 11963 ----
NM_175854chr13----1143 --
NM_175861chr1245303 4444 1713 675 34982 4191 90 ----
NM_175866chr1199 ------
NM_175876chr132087 656 461 ------
NM_175884chr711131 ------
NM_175907chr182901 44 --3859 775 648 --
NM_175910chr1912342 ------
NM_175913chr204884 822 360 69 ------
NM_175921chr543954 3082 2671 597 12898 12759 --
NM_176814chr71188 --11162 --
NM_176824chr41943 --21103 330 --
NM_176871chr873086 2183 807 712 584 558 170 22036 1205 12350 --
NM_177398chr121982 1518 ------
NM_177399chr121982 1518 ------
NM_177549chr202436 425 11081 ----
NM_177925chr1242671 2114 1961 250 32851 1029 586 ----
NM_177968chr211785 --1228 --
NM_177990chr201179 ----11597
NM_178123chr2----1926 1169
NM_178140chr532341 1805 98 --1478 --
NM_178151chrX77540 7108 5674 5436 5342 5198 2482 35396 4966 2110 11565 --
NM_178152chrX77540 7108 5674 5436 5342 5198 2482 35396 4966 2110 11565 --
NM_178153chrX77540 7108 5674 5436 5342 5198 2482 35396 4966 2110 11565 --
NM_178314chr122743 557 ------
NM_178423chr721182 101 1131 ----
NM_178424chr51618 ------
NM_178425chr721182 101 1131 ----
NM_178554chr353001 2550 2337 1377 976 --22365 1225 --
NM_178565chr821142 1090 ------
NM_178566chr91118 --11265 11786
NM_178585chr423272 74 ------
NM_178818chr1611622 --11923 --
NM_181340chr141227 ------
NM_181354chr831722 661 439 ------
NM_181459chr2------11063
NM_181481chr1867096 6529 5592 5101 4535 2088 1100 ----
NM_181482chr1856529 5592 5101 4535 2088 1100 ----
NM_181483chr1867096 6529 5592 5101 4535 2088 1100 ----
NM_181534chr17153 ------
NM_181659chr2031261 918 87 --13172 --
NM_181659chr2031261 918 87 --13172 --
NM_181671chr171658 ----1726
NM_181784chr232193 1944 142 12208 ----
NM_181832chr2273368 3120 1493 792 786 645 370 11411 12987 --
NM_181838chr531228 1205 249 ----11073
NM_182314chrX21874 421 ------
NM_182511chr1811258 ------
NM_182515chr1995304 5169 4693 2632 2579 2543 1991 1426 304 --24851 1857 --
NM_182580chr172361 2170 2151 960 769 713 699 --1449 --
NM_182663chr111897 --22009 691 --
NM_182664chr112027 --22139 821 --
NM_182665chr111897 --22009 691 --
NM_182691chr71134 ------
NM_182692chr71134 ------
NM_182729chr1211855 ------
NM_182742chr1211855 ------
NM_182743chr1211855 ------
NM_182765chr1031625 425 292 ----1167
NM_182789chr511003 ------
NM_182847chr21720 ------
NM_182898chr726386 1250 --14839 --
NM_182899chr726386 1250 --14839 --
NM_182915chr221903 32 22163 1762 11574 --
NM_182931chr7174 ------
NM_182944chr141339 ------
NM_182970chr2043255 1273 683 78 --13806 --
NM_182972chr121962 1115 11069 ----
NM_182975chr1176 ----1755
NM_183078chr633616 2849 2681 --1948 --
NM_183323chr511003 ------
NM_183419chr81147 1485 ----
NM_194247chr211777 --23144 2840 --
NM_194278chr1453140 2519 1657 1089 982 --43427 3373 2748 88 --
NM_194282chr422762 2157 --1577 23037 1220
NM_194314chr133536 1840 1586 1190 13635 --
NM_194317chr221923 1832 ----11070
NM_194328chr913038 12049 ----
NM_194329chr913038 12049 ----
NM_194330chr913038 12049 ----
NM_194332chr913038 12049 ----
NM_197941chr552899 2368 2279 843 678 --23043 2140 --
NM_198066chr14--12186 11921 --
NM_198158chr31865 ------
NM_198159chr31865 ------
NM_198177chr31865 ------
NM_198178chr31865 ------
NM_198217chr131177 ------
NM_198218chr131177 ------
NM_198219chr131177 ------
NM_198391chr20------11528
NM_198399chr331472 1153 494 --163 --
NM_198465chrX32545 2131 200 ------
NM_198485chr311019 ----11757
NM_198504chr3----1380 --
NM_198513chr82652 241 ------
NM_198562chr322258 2072 --1368 --
NM_198595chr484296 4030 3913 3320 3168 562 483 442 ----11194
NM_198597chr103653 298 21 ------
NM_198793chr313906 --22742 1295 --
NM_198859chr3----14256 --
NM_198900chr12117365 6969 6721 6273 5900 5666 1387 1262 978 296 162 --11734 --
NM_198968chr131283 13887 23412 3057 13209
NM_199000chr711882 ------
NM_199129chr201129 --21203 404 --
NM_199160chr941677 1601 1354 665 --11523 --
NM_199188chr1213583 --12846 --
NM_199190chr1213583 --12846 --
NM_199229chr221634 317 ------
NM_199245chr1232582 2574 281 1600 ----
NM_199355chr1621307 1191 ------
NM_199421chr1423837 331 13622 1312 --
NM_199436chr223087 1065 ------
NM_199437chr111329 ------
NM_199438chr111329 ------
NM_199439chr111329 ------
NM_199440chr21302 ------
NM_199453chr51205 --1240 --
NM_199511chr31295 --1782 --
NM_199512chr31295 --1782 --
NM_201278chr1112206 ------
NM_201281chr1112206 ------
NM_201413chr2111034 ------
NM_201414chr2111034 ------
NM_201535chr142716 270 ------
NM_201536chr142716 270 ------
NM_201537chr142716 270 ------
NM_201538chr142716 270 ------
NM_201539chr142716 270 ------
NM_201540chr142716 270 ------
NM_201541chr142716 270 ------
NM_201542chr1--190 ----
NM_201591chr411846 ------
NM_201592chr411846 ------
NM_203283chr4----1416 --
NM_203284chr4----1416 --
NM_203301chr1421588 1245 ------
NM_203327chr2054175 1564 817 458 38 --24048 3735 --
NM_203342chr143513 1297 836 531 --11443 --
NM_203343chr143513 1297 836 531 --11443 --
NM_203364chr1131252 1242 1185 --1837 --
NM_203406chr522155 356 ------
NM_203446chr2122979 2925 ----1667
NM_203459chr112601 ------
NM_203463chr244547 4223 3175 196 --11831 --
NM_203487chr1321424 1307 ------
NM_203504chr4135 ------
NM_203505chr4135 ------
NM_205860chr112138 ----1154
NM_205861chr141821 1681 1605 80 --11887 --
NM_206594chr112576 ----11342
NM_206595chr112576 ----11342
NM_206839chr151489 ------
NM_206853chr623415 433 ----1780
NM_206854chr634676 1694 786 ----12041
NM_206855chr645641 4015 1751 682 ------
NM_206866chr2123058 2988 ------
NM_206909chr897313 7019 6714 5748 3066 2747 2060 1561 798 22715 1475 ----
NM_206914chr1212069 --21532 350 --
NM_206944chr92354 216 ------
NM_206945chr92354 216 ------
NM_206946chr92354 216 ------
NM_206947chr92354 216 ------
NM_207009chr10------1355
NM_207123chr41820 ------
NM_207171chr121535 81 ------
NM_207311chr122923 348 --11261 --
NM_207325chr1921329 674 --1309 11708
NM_207380chr1563662 3652 3142 2741 2533 222 --13113 12927
NM_207396chr141586 1287 536 232 1453 --145
NM_207422chrX2945 245 ------
NM_207660chr1421554 477 ------
NM_207661chr1421554 477 ------
NM_207662chr1421554 477 ------
NM_212460chr721759 1621 11468 ----
NM_212471chr1711412 12092 ----
NM_212472chr1711412 12092 ----
NM_212558chr942948 1428 356 161 ------
NM_213589chr244170 2059 1442 585 --1299 --
NM_213651chr121340 600 --11550 --
NM_213654chr311106 ----167