TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-550b-3p
miRNA Sequence: UCUUACUCCCUCAGGCACUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000813chr594790 4183 4015 2192 2095 1783 1245 1225 750 1727 --1867
NM_001001419chr554727 4526 4263 4053 3945 14102 2379 223 23372 3286
NM_001001420chr554727 4526 4263 4053 3945 14102 2379 223 23372 3286
NM_001034954chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_001034955chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_001034956chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_001034957chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_001039547chr387599 6373 5897 5703 2276 1167 1147 195 36536 5439 5319 11157 17643
NM_001039618chr11125703 5539 5509 4475 3853 3765 3724 2179 1741 1084 837 292 ------
NM_001042599chr2117112 6614 6180 5402 3064 2840 2491 2478 2393 1849 939 1565 26507 1360 --
NM_001106chr3169213 9065 8516 8397 8267 8065 6677 6461 3743 3527 3361 3086 2324 2084 1523 539 16622 13127 --
NM_001167chrX64443 1978 1912 1726 1603 1187 26476 115 11694 26279 4487
NM_001204chr256382 5049 999 964 24 36997 5255 2477 --26113 5093
NM_001918chr1119305 8656 5797 3615 3033 2785 2579 2302 2016 1846 519 28622 1583 --38700 2060 1160
NM_002025chrX139004 8976 8697 8552 8128 7823 6841 6752 6693 2808 2204 1498 946 12726 --13605
NM_002092chr4114650 4481 4276 4089 3638 3606 3122 1445 929 902 431 1820 11776 13648
NM_002203chr573384 3117 3028 2726 1366 1205 908 33232 1253 1188 ----
NM_003034chr12128089 6482 5828 5244 3082 2325 2065 1972 1886 823 525 362 48077 7232 5701 1544 11602 --
NM_004171chr1199108 8808 8277 7851 7502 2351 2067 1384 345 57428 6794 5933 3267 775 11500 --
NM_005235chr2117112 6614 6180 5402 3064 2840 2491 2478 2393 1849 939 1565 26507 1360 --
NM_005903chr554727 4526 4263 4053 3945 14102 2379 223 23372 3286
NM_006434chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_007249chr1387783 7576 6718 6267 5859 3434 2634 2510 37852 6131 920 26112 450 16580
NM_014155chr11106348 6048 5923 5864 4582 2962 750 676 565 272 --15274 15948
NM_014721chr686740 6100 4534 2782 2666 2453 1582 1259 1240 --17217
NM_015035chr20106460 6225 5658 5490 2110 1923 1873 1549 1412 1035 16293 35823 2551 2547 1879
NM_015310chr898193 7347 7291 6201 6145 2234 1853 1385 795 26773 497 27921 5611 15953
NM_015385chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_017447chr2184311 4017 3513 3236 3113 3076 1744 969 33548 3221 944 1855 --
NM_017637chr998689 8176 6903 6870 6835 6498 3167 2876 897 37186 7166 6555 --11632
NM_017650chr784711 4388 3722 2414 2120 1965 717 105 25062 530 --14716
NM_018440chr877711 5950 3478 3135 2661 2354 303 23045 3015 37841 5500 1971 36660 5379 1603
NM_020774chr18116174 5965 4903 4434 4370 4187 1649 1321 1199 574 389 15444 13786 --
NM_020935chr274513 4018 3736 1630 1596 487 150 ----24286 1640
NM_021911chr594790 4183 4015 2192 2095 1783 1245 1225 750 1727 --1867
NM_024770chr2136691 6518 5817 5770 5492 5275 5248 4266 2138 1834 1541 1389 867 ----16211
NM_024947chr3157865 7819 7273 7032 6995 6868 6001 5907 3718 3179 3027 2705 2524 1787 901 22130 571 25993 1608 --
NM_024989chr297130 6270 5753 2639 2303 2155 1140 586 398 16447 13019 11190
NM_024991chr1052803 2632 2279 723 286 32030 109 83 --22036 1265
NM_033224chr7127669 7110 6918 5729 5332 5298 2432 1818 1300 751 405 83 13232 16640 16097
NM_033505chr2126765 6699 5919 5577 5270 5236 4736 4599 4347 2455 1099 410 --25710 4913 --
NM_133493chr694420 4029 3979 3961 3883 3791 3677 1128 879 23994 1536 13999 --
NM_133646chr244683 4010 622 85 45451 4753 3468 497 --24926 4054
NM_144571chr4115761 5574 5103 4763 4667 2569 1734 756 356 177 76 22798 557 16162 --
NM_152624chr5106740 5522 5026 4859 4715 2843 2481 2307 1782 147 16481 16599 --
NM_152835chr122949 2656 --12106 22319 1884
NM_172071chr1105836 5396 4631 2646 2320 1605 1547 1409 1102 369 27154 1576 11187 27038 5306
NM_173582chr1165936 5361 4732 1459 832 300 14545 --25545 1718
NM_173829chr595101 4700 4502 3805 1735 1074 725 413 407 11522 11186 11977
NM_177538chr2208870 8423 7974 7420 6915 6733 6223 5915 5572 3113 2955 2499 2461 2312 2073 1846 1780 1739 1183 1023 33457 3181 2509 --17294
NM_181521chr1696674 6250 5780 5421 4729 4568 2177 1238 1197 25199 1974 14832 26115 5007
NM_206909chr898193 7347 7291 6201 6145 2234 1853 1385 795 26773 497 27921 5611 15953