TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-551a
miRNA Sequence: GCGACCCACUCUUGGUUUCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_002843chr1153216 3055 2812 2661 502 ----1377
NM_004501chr133689 3095 1526 ----1141
NM_022474chr14------21736 550
NM_173468chr41128 ----25615 1883