TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-556-3p
miRNA Sequence: AUAUUACCAUUAGCUCAUCUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX127876 7281 6592 6100 5334 5279 2857 2085 1748 1016 146 55 --11899 --
NM_001003652chr18148268 7334 7314 6685 6043 6018 5734 5667 3002 2855 2476 2187 799 296 --37772 2404 315 --
NM_001009899chr376306 6203 4890 4851 4780 4550 2211 16492 24753 313 130
NM_001018067chr164819 3582 1631 1237 914 194 --11464 12125
NM_004274chr1442836 968 375 225 --12002 42545 2276 2088 717
NM_004852chr181112970 11549 10162 9938 9828 3216 2427 2130 1943 564 111 19849 411438 11033 10398 4077 12666
NM_005504chr1285585 5439 4946 4604 2085 1923 121 82 26390 2374 21537 205 --
NM_015310chr898345 8221 6403 5734 5724 1642 1110 971 68 11791 --27124 1348
NM_015458chr845246 5114 3362 133 14633 --25325 5129
NM_018374chr775059 4728 4415 4332 3643 1906 538 --24627 471 1343
NM_022091chr672473 2286 2234 1955 946 510 212 31721 527 327 1307 --
NM_032228chr1163418 3120 3075 1225 411 42 33353 2702 2531 --1992
NM_032458chrX63396 2198 785 754 233 72 12271 --22585 934
NM_144571chr496350 5179 4994 4505 4336 2573 1837 1735 1466 --36785 2553 1718 14858
NM_152624chr597439 7165 6277 5728 5410 4638 2778 466 407 36749 4862 2408 35000 2309 1464 --
NM_172071chr167415 7151 6391 5278 5257 4836 25424 1383 11549 16282
NM_173468chr4105963 5708 5191 4623 2069 1909 1656 805 692 529 34922 2324 2093 1626 --
NM_173496chr1023011 2142 42854 2741 2717 1872 22160 70 12032
NM_182485chr473735 3682 3668 3363 1070 1015 210 13226 --11505
NM_206853chr673287 3156 3040 735 213 185 172 32889 650 348 ----
NM_206854chr684548 4417 4301 1996 1474 1446 1433 751 34150 1911 1609 11164 --