TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-556-5p
miRNA Sequence: GAUGAGCUCAUUGUAAUAUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1121016 242 --1760 --
NM_000097chr3--11046 ----
NM_000111chr7--1241 --182
NM_000112chr541998 1863 1838 402 --35492 3648 3392 --
NM_000129chr611513 ----1262
NM_000138chr1551633 1026 680 538 176 11664 1547 --
NM_000151chr1781444 1278 763 599 551 379 301 165 11839 ----
NM_000167chrX11217 --11720 --
NM_000168chr732723 2415 612 --13092 --
NM_000176chr532624 1216 560 ----1776
NM_000191chr1----1549 --
NM_000259chr1575500 5342 5103 4820 1570 1057 896 --25899 2541 --
NM_000264chr952467 2257 945 636 406 --32090 956 129 --
NM_000280chr11----1872 --
NM_000291chrX1297 2805 688 1163 --
NM_000293chr164781 719 706 69 --1308 --
NM_000319chr122429 256 ------
NM_000321chr1321626 1469 ------
NM_000330chrX51852 1751 1435 921 286 --22140 1812 --
NM_000332chr686354 6319 5448 5373 4597 2376 2354 1418 --22832 1017 --
NM_000362chr2231303 982 789 ------
NM_000389chr61959 11236 11146 --
NM_000391chr1141737 1295 1135 53 --21441 120 --
NM_000430chr1733635 3494 3284 --1134 --
NM_000461chr324640 802 ----24665 3665
NM_000486chr1223263 417 ------
NM_000489chrX23059 2156 ------
NM_000495chrX1734 --1442 --
NM_000618chr1235362 4915 1548 ----16182
NM_000663chr1642606 2057 972 568 --22938 2125 --
NM_000684chr101876 ------
NM_000686chrX151 --1619 11575
NM_000793chr1464521 4401 3388 1320 832 278 15115 24459 24 --
NM_000795chr112425 237 ----1250
NM_000809chr489046 8742 8419 8219 5992 3144 2412 2095 --33526 1955 680 --
NM_000814chr1523511 3048 ----23659 1406
NM_000826chr4----22044 296 --
NM_000859chr541636 1551 283 80 --2494 340 --
NM_000868chrX42205 472 334 328 1559 --12126
NM_000891chr1742686 1018 841 751 --1483 --
NM_000899chr1224179 3547 --33730 3659 53 --
NM_000901chr432196 552 391 ----22461 2443
NM_000944chr412040 1246 1114 --
NM_000945chr2--31728 765 743 1710 --
NM_000961chr2083283 3246 2854 2758 2532 1561 1323 987 --23015 933 --
NM_001001132chr211569 --11107 --
NM_001001331chr372745 2646 2394 2173 989 881 544 ------
NM_001001344chrX22325 1739 ----12465
NM_001001349chr1751482 1309 678 616 608 --21699 1524 --
NM_001001419chr5105062 3777 3447 3301 1311 1153 922 240 182 83 --1109 1353
NM_001001521chr2----1214 --
NM_001001668chr194970 629 575 469 13843 ----
NM_001001890chr2133736 1084 1003 ------
NM_001001971chr1011227 ------
NM_001002006chr22332 308 ------
NM_001002243chr21110 ----1945
NM_001002860chr1474406 3518 3444 3109 901 893 541 --182 --
NM_001002909chr1711556 --1720 1847
NM_001003406chr2242950 2457 1279 990 --1312 --
NM_001003698chr6------11983
NM_001003792chr311018 --11058 --
NM_001004419chr1244596 4119 3964 728 --33527 3161 1351 --
NM_001005158chr3----1514 --
NM_001005404chr1754510 3019 1196 1057 912 --11626 --
NM_001005505chr331314 579 463 11854 ----
NM_001005743chr1421355 833 --11253 --
NM_001005782chr22783 143 1317 ----
NM_001006610chr161794 --1648 --
NM_001006641chr931178 700 257 --11155 --
NM_001006684chrX1220 1427 1517 --
NM_001006946chr251929 1885 1706 742 393 1542 ----
NM_001007024chr1774134 4004 3404 3345 2853 700 523 --23077 1352 --
NM_001007098chr1----128 --
NM_001007157chr7----139 --
NM_001007466chr634867 3709 2043 --15012 --
NM_001008239chr1823073 770 --172 --
NM_001008408chr795996 5974 5445 5254 4213 1855 1178 960 451 --12574 --
NM_001008539chr844178 4072 1084 116 12063 21655 873 14372
NM_001008541chr102629 80 1343 1566 --
NM_001008660chr1111057 --11226 --
NM_001008860chr151179 --1850 --
NM_001009881chr1----1175 --
NM_001009958chr7----1150 --
NM_001009960chr762470 2312 2306 468 117 61 --22344 1109 --
NM_001010888chrX64216 4116 2880 1714 1360 1323 --13907 --
NM_001010942chr1221236 859 --1464 --
NM_001011515chr41188 --1429 --
NM_001011537chr332355 1828 229 11565 21799 63 --
NM_001011546chr204620 551 279 257 ------
NM_001011666chr756147 4370 4332 1884 1424 --56489 5847 5660 5349 797 --
NM_001013415chr41494 --11025 --
NM_001015048chr1442984 2921 2716 500 --21170 75 1746
NM_001015508chr8----167 --
NM_001017371chr221305 1275 --1496 --
NM_001017926chr81419 1555 ----
NM_001017999chr121734 1714 --12343 --
NM_001018065chr934099 396 280 14504 21236 323 15559
NM_001018067chr174644 3762 3631 3523 2069 1790 688 15001 15145 --
NM_001020658chr111614 --1405 --
NM_001024666chrX------1583
NM_001024948chr153168 2624 2245 1377 212 ------
NM_001025076chr1086097 5897 5183 4607 4192 2487 2060 574 --25831 68 --
NM_001025077chr1077455 7255 6541 5965 5550 1932 1111 15002 37189 1426 1039 --
NM_001025105chr511401 ----183
NM_001025366chr6----11442 --
NM_001025579chr171832 ------
NM_001025580chrX43274 2914 2895 1683 --11369 21645 1177
NM_001030006chr1722356 890 --1336 --
NM_001031695chr2264903 4612 4321 3581 3323 847 --44673 853 313 43 --
NM_001031732chr463483 2723 2417 2334 942 298 --1111 --
NM_001031740chr151732 1426 1080 339 34 ------
NM_001031804chr162471 269 --1457 11672
NM_001031812chr542257 1465 726 43 ----1486
NM_001032289chrX1641 --1782 --
NM_001032394chr632406 1969 70 --1483 --
NM_001033503chr5----2434 339 --
NM_001033578chr871924 1825 1761 931 610 499 361 11723 1219 --
NM_001033925chr101192 --22103 416 --
NM_001034025chr12----1205 --
NM_001037131chr221338 452 ----11126
NM_001037132chr71297 11576 1568 --
NM_001037164chr721735 575 --11348 --
NM_001039538chr222895 358 --43638 3425 2870 2245 --
NM_001039590chrX1852 --13445 11293
NM_001039618chr1145376 4524 2072 318 31755 1493 604 12184 --
NM_001039690chr1661965 1928 1694 1688 269 230 ------
NM_001039762chr102676 215 ------
NM_001039802chr11935 --11264 --
NM_001039888chr12109 68 --1743 --
NM_001039937chr1323771 1088 --1644 --
NM_001040057chr7----11006 --
NM_001040108chr1473202 2986 2953 2669 2155 1238 123 ------
NM_001040142chr211787 --11564 --
NM_001040284chr1645047 4862 233 137 24258 1772 33935 3847 3701 --
NM_001040624chr832464 608 233 12599 1853 --
NM_001040712chr921218 363 1445 ----
NM_001042555chr1264510 4398 1874 999 952 707 1410 13846 --
NM_001042599chr232517 2456 1475 --26809 6091 --
NM_001042601chr332459 403 232 ------
NM_001042604chr374855 4659 4512 3774 1827 1596 1533 11210 13647 --
NM_001042632chr2032000 826 637 --11586 --
NM_001042749chrX2691 123 --1800 --
NM_001044385chr252794 2601 1363 968 714 --12735 11324
NM_001046chr5----12690 --
NM_001106chr3119164 8594 7880 6753 6685 6214 3225 2260 1180 1027 543 --29560 7510 --
NM_001153chr22938 97 ----1211
NM_001167chrX56071 6027 5578 4167 2402 --26743 1281 --
NM_001189chr4----1422 --
NM_001204chr286988 6857 6366 5984 5679 4838 934 921 --26428 170 2970 844
NM_001206chr922116 887 --22553 2099 --
NM_001259chr796198 4248 2486 2437 2363 1885 1527 207 54 --25942 1249 --
NM_001358chr41387 ------
NM_001364chr1154567 3382 1845 1808 1422 ------
NM_001386chr81199 --1140 1254
NM_001387chr532258 984 879 --13175 11131
NM_001396chr211217 ----12194
NM_001438chr133617 2972 2564 13383 ----
NM_001455chr643243 1208 901 120 14621 ----
NM_001530chr143762 125 44 --1205 --
NM_001560chrX32445 1990 528 ----1126
NM_001616chr233441 2149 1419 ------
NM_001627chr322351 2226 --1129 --
NM_001650chr1831217 893 541 --1344 13031
NM_001681chr121221 --1523 --
NM_001695chr864298 4251 3104 2970 2591 599 ----13667
NM_001701chr911120 --1538 --
NM_001731chr12----1858 --
NM_001753chr711317 11416 ----
NM_001755chr1621784 290 --1368 --
NM_001839chr1----1108 --
NM_001845chr131862 --1905 --
NM_001854chr12599 331 ------
NM_001856chr1------159
NM_001858chr655132 4334 1177 1122 683 13297 13804 14604
NM_001866chrX------146
NM_001885chr11----185 --
NM_001964chr5--11145 11080 --
NM_001981chr11769 ------
NM_001995chr411208 --11146 --
NM_002024chrX22176 597 --12130 --
NM_002025chrX98956 8913 7695 5904 2591 2484 2163 1472 1168 27043 5713 ----
NM_002033chr1153813 2905 2591 742 300 ------
NM_002128chr1321954 926 11657 --1343
NM_002158chr222696 1369 33716 2990 1247 ----
NM_002199chr41246 --1973 --
NM_002214chr764301 3826 3588 1690 1591 609 15559 24703 3675 15656
NM_002264chr3103933 3911 3626 3070 1428 1302 1087 1002 801 123 ------
NM_002267chr1311799 --11842 --
NM_002268chr351598 514 493 268 120 ------
NM_002270chr514738 33827 1733 889 ----
NM_002336chr1254873 3427 1876 1732 959 ----13881
NM_002356chr642757 2212 2089 241 --21812 653 --
NM_002373chr1511082 --11383 --
NM_002376chr14----1469 1446
NM_002430chr2221647 486 --22502 2149 --
NM_002469chr12----1337 --
NM_002480chr1211435 ----11470
NM_002481chr187028 6957 6512 5441 2504 2062 1918 282 --36333 5252 890 --
NM_002515chr1421649 676 --12064 --
NM_002524chr11965 --1317 --
NM_002526chr61455 --2611 328 --
NM_002658chr10----1809 --
NM_002687chr14----1938 --
NM_002709chr222791 1154 1784 ----
NM_002710chr121349 1999 ----
NM_002715chr521046 404 --1202 --
NM_002719chr1432158 1973 163 ----12458
NM_002734chr1741893 1792 922 765 1184 ----
NM_002736chr722222 1728 ----1198
NM_002745chr2233012 103 21 34410 3318 3115 21121 1072 --
NM_002747chr18------11860
NM_002748chr151850 --1810 --
NM_002820chr123865 781 697 ----1619
NM_002826chr12821 258 --1300 --
NM_002844chr61507 11396 11381 1344
NM_002851chr7----1609 --
NM_002874chr942145 1915 1583 971 185 ----
NM_002890chr52945 841 ------
NM_002906chr1121503 687 12270 12420 --
NM_002907chr121365 --1134 1266
NM_002942chr31311 1332 ----
NM_002957chr963092 2759 2504 2439 1345 1038 --12585 --
NM_002968chr16----1181 --
NM_003011chr921126 402 --1228 --
NM_003036chr13950 239 190 --1459 --
NM_003043chr374151 4019 2743 1646 1328 972 857 ------
NM_003070chr9----173 --
NM_003074chr311801 11955 ----
NM_003075chr12----1103 --
NM_003108chr235470 5440 2789 ----15930
NM_003113chr2------1335
NM_003133chr11114 --1348 --
NM_003155chr822754 2242 1424 12205 --
NM_003161chr1753425 3134 2520 819 690 --1558 --
NM_003188chr62816 284 ------
NM_003201chr101188 11042 1137 --
NM_003205chr1552282 2069 1896 1761 1555 --1207 --
NM_003253chr2111477 ------
NM_003291chr13----1280 --
NM_003320chr1153169 2737 1657 1644 764 --14109 --
NM_003340chr41156 1487 --11097
NM_003404chr203665 647 147 1675 1565 --
NM_003410chrX2902 702 1817 ----
NM_003413chrX11462 --21575 1331 --
NM_003439chr763557 3533 3296 2256 1339 432 ----13398
NM_003442chr111838 --1860 --
NM_003473chr10------198
NM_003478chr1111340 ----1738
NM_003482chr12------11766
NM_003483chr1242432 1194 657 260 12348 --12412
NM_003489chr2133049 1306 1195 --22590 471 11219
NM_003505chr71517 ------
NM_003506chr82983 144 1883 --1417
NM_003558chr9----1450 --
NM_003583chr1273616 2713 1171 1013 355 155 76 ----11524
NM_003590chr244028 3959 3187 607 --1313 --
NM_003592chr7----146 178
NM_003603chr411418 ----11822
NM_003629chr112642 ----13338
NM_003632chr172898 106 ------
NM_003713chr12473 244 ----11780
NM_003743chr221904 1704 --1863 --
NM_003762chr11956 --1278 --
NM_003768chr111338 --1185 --
NM_003787chr1821658 326 --11245 --
NM_003831chr1821630 167 --11392 --
NM_003846chr14808 798 679 575 ------
NM_003887chr232149 2081 466 --22184 671 --
NM_003913chr63999 701 263 13317 ----
NM_003958chr633695 2927 969 13436 13791 1560
NM_004040chr2----11305 --
NM_004050chr1422214 409 --12712 --
NM_004079chr152771 917 854 567 156 ------
NM_004112chr1731436 417 350 11109 ----
NM_004117chr61258 --1270 --
NM_004124chr141564 13262 --13526
NM_004162chr321156 461 --11138 --
NM_004183chr112738 140 ------
NM_004187chrX21408 1377 --11427 --
NM_004331chr832413 2035 1856 11817 165 --
NM_004397chr1152861 1537 1125 127 33 11020 33816 709 438 13440
NM_004414chr212347 191 11408 1126 --
NM_004432chr92945 572 ----11731
NM_004438chr232245 528 245 1485 12541 13086
NM_004469chrX1169 ----1457
NM_004480chr14153 --1578 --
NM_004491chr1963100 2833 2637 1669 1514 1209 --13892 --
NM_004501chr133414 3360 689 1472 11159 --
NM_004504chr212278 12258 1865 --
NM_004506chr6----1516 --
NM_004549chr1141259 1140 1048 306 --2171 87 --
NM_004586chrX64588 3779 1496 697 577 400 14394 14701 1473
NM_004607chr5----1168 --
NM_004612chr924282 3467 1987 23343 737 11546
NM_004642chr12----2721 59 --
NM_004643chr141229 --1814 --
NM_004655chr1731198 495 346 --11336 --
NM_004663chr1521402 319 ----1395
NM_004685chr1322426 764 12234 ----
NM_004687chr1791989 1978 1426 603 566 495 243 105 88 ------
NM_004742chr32709 591 ------
NM_004779chr521069 277 --11231 --
NM_004788chr1122146 2008 12288 ----
NM_004845chrX73787 3630 3564 3416 3033 1267 109 1573 33890 2738 1146 --
NM_004849chr631665 1445 1330 --1387 --
NM_004852chr181413262 11684 10665 10379 10078 9599 9145 5684 3491 3010 750 679 540 329 13528 12073 112253
NM_004898chr41292 1755 12618 1971
NM_004902chr202236 169 ------
NM_004926chr141119 11223 11163 --
NM_004947chr332355 2042 601 --22229 452 --
NM_004985chr1253202 3040 1683 1129 144 --23654 969 --
NM_004991chr3------1432
NM_005028chr1031742 1492 904 ------
NM_005032chrX31089 788 78 1234 1139 --
NM_005103chr112265 114 ----1302
NM_005109chr321607 571 --22052 305 --
NM_005126chr3--12110 --12242
NM_005229chrX21135 86 ------
NM_005256chr111766 --1649 175
NM_005257chr1831321 474 418 ----1562
NM_005271chr101357 ------
NM_005337chr12------1416
NM_005358chr1331811 626 58 ------
NM_005359chr1854542 4012 2149 1770 209 26260 2544 --11011
NM_005378chr22899 777 ------
NM_005406chr1821476 245 --1396 --
NM_005429chr4----123 --
NM_005455chr1193 --11788 --
NM_005471chr52866 372 --11288 --
NM_005494chr71567 --1136 --
NM_005522chr72883 430 --178 11302
NM_005561chr133959 781 693 --1129 --
NM_005584chr13------1719
NM_005587chr15----1804 --
NM_005596chr966183 5714 5313 4866 4852 1234 26385 5860 ----
NM_005604chr622151 2025 ------
NM_005627chr62876 124 --1189 --
NM_005647chrX32405 552 275 --23426 3194 --
NM_005648chr8157 ------
NM_005664chr1541074 999 918 422 --1226 --
NM_005668chr584539 3738 3532 2923 752 727 309 130 14228 14546 --
NM_005717chr111010 11104 1397 --
NM_005749chr17------193
NM_005759chr233567 1571 914 1779 24459 4283 --
NM_005797chr1131239 1186 248 --11682 --
NM_005802chr9----1238 --
NM_005862chr31747 ------
NM_005898chr1163150 2909 2840 2825 2520 583 12185 11179 --
NM_005904chr1811099 --1192 --
NM_005906chr611124 --11208 --
NM_005909chr544331 3995 3360 1201 13058 23446 243 --
NM_005955chr1125557 5444 5160 5071 4844 1916 1431 1109 934 856 642 630 ------
NM_005977chr131931 ------
NM_006011chr154683 365 199 30 ------
NM_006016chr61687 1611 12265 --
NM_006037chr244360 3549 1316 53 --1480 --
NM_006043chr16141 1701 ----
NM_006047chr2052874 2776 2344 2265 814 --1283 --
NM_006089chrX41327 1316 525 146 ----1633
NM_006106chr1122318 260 23387 1293 --1612
NM_006158chr82252 245 ------
NM_006166chr121656 --1415 --
NM_006178chr1721552 181 --11404 --
NM_006191chr121750 11018 ----
NM_006224chr171608 --1390 --
NM_006226chr22907 89 --1479 --
NM_006241chr3----11520 --
NM_006267chr231467 1414 55 ----1133
NM_006275chr2022232 365 --21848 265 --
NM_006279chr12879 693 ------
NM_006288chr11----11175 --
NM_006313chr1231677 1429 1151 --1417 --
NM_006393chr1033326 3299 245 --1885 --
NM_006416chr6--1640 --1512
NM_006420chr201173 --1887 --
NM_006431chr12----1206 --
NM_006496chr151737 1678 356 317 266 --22028 707 --
NM_006520chrX21373 1190 ----1182
NM_006544chr1435440 3700 2324 11264 ----
NM_006593chr21202 --1604 --
NM_006599chr1687621 6449 3233 2615 2271 2210 1422 437 --16991 --
NM_006601chr122824 361 ----1794
NM_006621chr151380 1268 623 530 201 --11974 --
NM_006644chr131148 --1673 --
NM_006710chr21796 1780 1908 --
NM_006717chr962384 2227 1247 1193 661 94 ------
NM_006729chrX45105 4040 3871 3782 --35433 4356 1899 --
NM_006743chrX----1825 --
NM_006754chr72473 209 --11112 --
NM_006756chr8----2521 490 11416
NM_006761chr172607 588 ------
NM_006763chr131777 415 37 --12114 --
NM_006769chr1148 1646 ----
NM_006777chrX22831 2294 1987 1230 --
NM_006814chr2032633 2112 111 11768 12103 --
NM_006885chr1664247 3733 3143 991 791 320 ------
NM_006888chr1433075 2997 410 --196 --
NM_006896chr71717 --1954 --
NM_006915chrX42206 1780 394 205 --12466 --
NM_006940chr1221687 56 --31508 1380 750 --
NM_006981chr9----1255 12274
NM_006996chr111673 --1710 --
NM_006999chr541612 585 268 188 --1179 --
NM_007006chr1623260 666 1220 --12904
NM_007008chr21186 --130 1958
NM_007013chr8186 --1160 --
NM_007034chr13958 739 118 1251 ----
NM_007035chr12----2599 278 --
NM_007050chr2097922 6593 6459 6271 6227 5402 3212 2421 83 --26479 3122 --
NM_007111chr131744 --2685 279 --
NM_007152chr112289 74 ----1308
NM_007159chr3----11519 --
NM_007174chr1292049 1721 1669 1604 739 605 589 503 115 --22276 307 --
NM_007187chr131708 --11070 --
NM_007191chr12186 ----141
NM_007218chr8----151 --
NM_007249chr13118324 8178 7744 6549 5922 5698 3633 3493 1716 692 217 --48628 3708 3616 1817 --
NM_007270chr7----21502 577 --
NM_007372chr17------1327
NM_007375chr1----22192 543 --
NM_012081chr533752 3712 3591 --142 --
NM_012090chr12944 928 ------
NM_012095chr1042495 950 899 643 --1203 --
NM_012158chr1321561 433 ------
NM_012238chr1021207 278 ----11274
NM_012249chr253293 2621 2467 600 100 --22927 1255 --
NM_012257chr721092 402 --11006 --
NM_012281chr751696 1631 694 665 599 ------
NM_012290chr221431 1218 ------
NM_012293chr222290 465 --12246 --
NM_012301chr731948 1439 569 ----1787
NM_012343chr511054 --1819 --
NM_012397chr1831717 1665 1205 --1415 --
NM_012416chr92834 361 --11093 --
NM_013261chr4--11279 1871 --
NM_013277chr121704 1334 ----
NM_013316chr72415 371 ------
NM_013374chr332911 2046 1246 ----1246
NM_014011chr22529 114 11762 11013 22179 2135
NM_014034chr6----1568 11432
NM_014181chr232664 2162 2111 --21080 898 --
NM_014240chr373688 3660 3491 3353 3328 2800 384 --1901 --
NM_014243chr431807 752 146 --1109 --
NM_014252chr13--1427 152 --
NM_014279chr9----1786 --
NM_014289chrX11374 ----11465
NM_014319chr1231679 1369 215 1473 11843 --
NM_014325chr1242110 1621 1462 723 --12075 --
NM_014326chr1531272 571 80 ------
NM_014351chr221571 --1378 --
NM_014393chr832276 1471 73 --11751 1678
NM_014573chr1761295 695 664 412 272 247 --11862 --
NM_014660chr7----2736 23 --
NM_014670chr23611 472 311 --11422 --
NM_014671chr71442 --11558 --
NM_014682chr831921 1698 71 --11716 --
NM_014686chr191918 ----1585
NM_014701chr1532705 2499 158 12697 1225 --
NM_014705chr742111 1340 484 133 11687 21305 387 --
NM_014711chr1622047 2023 11949 11753 --
NM_014729chr822007 489 ------
NM_014730chr1273554 1741 1206 1175 1102 1088 796 ------
NM_014747chr185496 4670 4360 1134 1080 939 216 131 ------
NM_014755chr243877 3592 927 291 13409 11415 --
NM_014757chr5131 1330 --12288
NM_014764chr1211212 --11151 --
NM_014770chr123506 372 210 ------
NM_014774chr121155 691 22930 2860 ----
NM_014779chr31777 --1369 --
NM_014795chr24987 888 521 85 ------
NM_014810chr142866 1401 706 477 22982 1111 --1141
NM_014824chr1131701 709 424 ------
NM_014827chr131543 1289 547 ------
NM_014829chr532373 2091 2060 ------
NM_014830chr1263616 2783 2666 2514 1119 552 --12554 11354
NM_014832chr1331605 722 155 --1251 --
NM_014869chr3170 --21500 1058 --
NM_014874chr151813 655 565 514 292 21907 205 ----
NM_014877chr1767708 7405 5973 2547 2527 1725 --14885 --
NM_014904chr1073441 3370 3212 2571 1556 1343 420 --13122 11596
NM_014910chr19----1301 --
NM_014912chr1032320 1389 509 --11380 11276
NM_014924chr1452762 2352 1118 851 196 --1744 --
NM_014939chr1811240 21380 226 ----
NM_014942chr632244 1906 275 ------
NM_014943chr831232 975 127 1202 ----
NM_014962chr2062780 2723 2578 2136 1042 907 --172 12927
NM_014982chr1435039 1041 704 ----25057 3575
NM_014991chr453197 2667 2659 2639 613 --21021 961 --
NM_014999chr1231420 1232 303 --11117 --
NM_015009chr32807 751 ------
NM_015017chr121305 292 1940 1846 --
NM_015018chr6127 1194 ----
NM_015020chr1653344 2897 1563 1518 1443 13764 13154 --
NM_015025chr232334 1955 751 22474 2179 ----
NM_015026chr1274662 3662 3052 1296 690 658 145 24626 1044 23915 294 --
NM_015035chr2086052 5280 5143 4217 1668 1462 673 274 --22383 2344 1283
NM_015045chr1041611 470 452 405 ------
NM_015049chr232936 2748 454 2488 419 1687 --
NM_015051chr953240 3229 2085 1211 511 ----11334
NM_015064chr1243414 2875 2418 751 12311 ----
NM_015076chr633368 2806 496 --13952 --
NM_015094chr2254368 3812 3636 2907 1297 --24545 659 --
NM_015097chr322336 2224 --21828 1747 --
NM_015111chr583679 1439 1411 1278 1260 766 411 62 --1895 --
NM_015132chr7128 ------
NM_015138chr1521955 1129 --1298 12712
NM_015147chr272923 2464 2423 1258 776 710 316 --12934 --
NM_015156chr1463713 3186 3141 3104 691 170 13910 ----
NM_015176chr131485 48 40 ------
NM_015187chr4------1775
NM_015191chr1122393 1876 --185 --
NM_015198chr71905 --2971 201 --
NM_015235chr1011578 21974 351 11664 --
NM_015236chr4----11109 --
NM_015272chr1621384 556 --21780 670 --
NM_015293chr6------1484
NM_015315chr532857 2671 1323 13277 1318 --
NM_015335chr1251055 903 474 168 29 --12521 --
NM_015336chr121625 --11711 --
NM_015339chr201925 ------
NM_015349chr632571 2535 2081 1277 ----
NM_015435chr821402 530 11366 1541 --
NM_015455chr544091 4003 3550 612 ------
NM_015457chr112857 776 ------
NM_015483chr72769 296 --1306 --
NM_015488chr221477 432 --11541 --
NM_015497chr152985 267 --11144 2907 189
NM_015534chr111082 ------
NM_015550chr753596 2776 2209 267 119 1492 ----
NM_015553chr695162 5045 4982 4104 1041 306 256 219 68 ------
NM_015557chr143368 2588 177 35 ------
NM_015569chr1104416 4358 4079 3994 1611 1106 984 726 157 144 14304 23392 337 13468
NM_015576chr331005 145 113 --11883 12923
NM_015577chr52733 583 ------
NM_015609chr131150 648 363 ------
NM_015627chr121264 234 ------
NM_015638chr202543 527 ------
NM_015652chr101613 --186 --
NM_015678chr1311561 --11600 1210
NM_015713chr821121 970 --22504 2204 --
NM_015878chr832103 1930 755 --1379 --
NM_015888chr133057 2170 1004 ----13238
NM_015902chr83880 615 159 ------
NM_015906chr143438 1629 1406 484 --11180 --
NM_015980chr531428 291 228 ------
NM_016018chr83865 316 93 22824 2311 1675 --
NM_016073chr15------1930
NM_016081chr421764 1461 ------
NM_016131chr231710 1535 249 --1225 --
NM_016132chr1522308 401 23140 2587 22571 1121 1607
NM_016248chr1313913 ----1172
NM_016269chr4----2468 24 --
NM_016284chr16------159
NM_016289chr252053 1502 1447 793 271 1895 11918 --
NM_016374chr111181 ----11514
NM_016451chr11--189 1105 --
NM_017508chr1122310 1945 12554 ----
NM_017542chr131737 1529 1194 ------
NM_017544chrX3934 171 110 --1881 --
NM_017594chr932999 2866 1331 ------
NM_017628chr455280 4774 3565 1128 50 135 15178 --
NM_017634chr81569 --11439 --
NM_017650chr765127 4065 2064 1355 1023 215 14950 ----
NM_017658chr1453842 3794 1688 1047 127 1294 11403 --
NM_017660chr1932750 620 359 ----12190
NM_017666chrX51925 1371 402 311 61 12114 2719 22 --
NM_017672chr15----11205 --
NM_017712chr19136194 6034 5083 4901 4592 4466 4282 4020 1859 1581 1369 829 767 ------
NM_017742chr1821646 1510 1212 11816 --
NM_017752chrX51657 1464 1414 768 79 22056 1438 22100 856 --
NM_017762chr1532434 2116 250 12043 ----
NM_017770chr632444 1925 738 12836 12038 22223 114
NM_017780chr81132 181 ----
NM_017798chr202986 461 --1228 --
NM_017799chr1451884 1630 618 357 28 --11664 --
NM_017811chr942559 2527 507 405 11088 ----
NM_017813chr864793 4427 2010 1418 842 702 ----11927
NM_017831chr1823598 3537 --1968 --
NM_017848chrX63846 3813 3466 2905 1622 1316 --1755 13177
NM_017902chr1065165 4315 2277 1683 1439 678 --11247 15366
NM_017944chr1142980 780 656 149 1366 ----
NM_018013chr672628 2522 2025 1952 358 90 30 ------
NM_018015chrX--21073 762 ----
NM_018036chr1494247 4049 3022 2842 1766 499 260 101 50 --182 --
NM_018078chr4------1374
NM_018086chr2----1594 11185
NM_018098chr31401 ----11021
NM_018157chr1223067 2106 --22426 1117 --
NM_018159chrX----21675 114 --
NM_018227chr463058 3034 2992 2893 2481 564 ----185
NM_018229chr142387 259 --21068 918 --
NM_018237chr10----1278 --
NM_018246chr852773 2720 2682 2016 653 ----12888
NM_018254chr13511 168 58 ------
NM_018268chr5----1266 --
NM_018293chr352219 2006 1863 985 605 1281 11815 --
NM_018312chr11----1843 --
NM_018364chr153231 2996 2734 1128 695 --13138 --
NM_018403chr363608 3408 3151 2768 1330 378 ----11640
NM_018416chr1222406 2110 --11697 --
NM_018471chr22193 36 --1204 --
NM_018476chrX2211 64 ------
NM_018553chr174655 607 481 438 --21149 341 --
NM_018638chr1235572 5169 1080 25539 4286 ----
NM_018710chr821356 154 --1947 --
NM_018711chr122377 156 1236 ----
NM_018712chr1141511 502 432 78 1204 ----
NM_018715chr112167 1237 ----
NM_018841chr133581 3039 854 12825 32697 1481 82 --
NM_018898chr52707 465 ----11872
NM_018937chr51746 1674 1624 --
NM_018945chr663394 2841 2789 2527 1047 609 --1720 --
NM_018948chr111060 --11321 --
NM_018970chr732872 1978 149 ----11225
NM_018976chr1231126 799 763 ------
NM_018999chr1064727 4001 3906 3297 3248 1973 ----24965 1839
NM_019040chr11----166 --
NM_019050chr4--11513 22176 1676 --
NM_019071chr71552 --1675 --
NM_019084chr1021902 854 --12131 --
NM_019087chr531748 598 320 ----1505
NM_019091chr2------1344
NM_019116chr1652791 1210 1091 1079 175 1104 ----
NM_019593chr2042785 903 282 105 12244 23071 2877 1325
NM_020116chr421784 1374 --11657 --
NM_020177chr552909 2434 980 696 257 --21173 969 --
NM_020193chr11----1991 1488
NM_020194chr2----1645 --
NM_020198chr17----11384 --
NM_020338chr1053644 3203 2430 2373 773 ------
NM_020390chr334386 1013 988 --14017 --
NM_020463chr221150 540 ------
NM_020546chr542000 1168 380 362 ------
NM_020662chr61400 --11884 --
NM_020699chr163500 1796 1287 794 730 489 --23460 1272 --
NM_020715chr1422091 182 ----11406
NM_020772chr1778223 7364 7288 6553 6401 5465 53 --27315 1654 --
NM_020774chr1856060 5415 5305 4708 2371 --25877 4587 --
NM_020794chr11182 ------
NM_020796chr5161 --1963 --
NM_020801chr5------11827
NM_020808chr13989 741 706 --1912 --
NM_020809chr11----11433 --
NM_020830chr232923 2798 2571 11124 ----
NM_020850chr1622485 2287 --1410 --
NM_020854chr1811369 --11427 --
NM_020870chr42821 24 12030 ----
NM_020918chr1032767 1339 70 21221 758 ----
NM_020935chr243105 3081 794 119 --11319 --
NM_021003chr14155 1312 ----
NM_021033chr1323363 3267 --1962 --
NM_021035chr201444 ----11338
NM_021076chr222539 59 1578 ----
NM_021079chr1752699 2381 2320 603 504 --3960 475 281 --
NM_021097chr22568 227 --1562 --
NM_021111chr9----1858 --
NM_021183chrX22283 2132 --1891 --
NM_021191chr1251665 1022 935 557 120 ----12159
NM_021202chr2072396 2080 2015 1115 994 556 369 12170 ----
NM_021249chr14----2450 259 --
NM_021252chr1031894 1548 634 ------
NM_021813chr655677 1128 632 255 75 --12143 --
NM_021814chr641664 1217 623 74 --1447 --
NM_021818chr1421418 551 --11524 --
NM_021914chr1462235 1635 1615 598 310 53 --12176 --
NM_021949chrX52620 2034 1818 1790 108 ----12760
NM_021951chr92236 46 --1817 --
NM_021954chr1333599 1266 637 --23608 2413 --
NM_021960chr132196 627 217 ------
NM_021961chr1166665 5026 4715 1840 1439 1076 36167 2231 184 ----
NM_021964chr332145 1202 880 ------
NM_022048chr1576254 5893 5403 5272 3902 2417 1056 --45212 2128 1429 1129 --
NM_022051chr1--1472 ----
NM_022114chr123687 134 --1576 --
NM_022166chr1675354 5344 4563 1174 581 444 209 ------
NM_022343chr92907 171 --1379 --
NM_022346chr41977 --2469 357 --
NM_022374chr2----1497 --
NM_022459chr13106053 5755 5646 5349 4878 4150 3984 2408 2295 1331 --193 15408
NM_022739chr1711100 11037 21200 914 --
NM_022756chr1------1513
NM_022763chr3----2951 558 --
NM_022781chr963079 2646 2538 2488 234 159 22465 1194 11306 --
NM_022893chr242970 2265 977 786 13163 11090 --
NM_022898chr1424766 4055 ------
NM_022918chr112863 85 11729 1351 --
NM_023012chr12----1238 --
NM_024007chr543069 2991 566 296 --1623 --
NM_024071chr14----1623 --
NM_024295chr831858 1843 1624 11274 ----
NM_024312chr1251329 1189 622 271 240 ------
NM_024520chr2----123 --
NM_024586chr1189 ------
NM_024612chr17----1158 1145
NM_024665chr354173 1654 1643 1482 1092 ------
NM_024721chr822687 583 --12667 --
NM_024738chr1231246 329 261 1766 11826 --
NM_024785chr221524 1327 --11066 --
NM_024852chr1----1558 --
NM_024857chr171323 --1277 --
NM_024947chr388859 8120 7660 7370 6622 3268 1919 948 --29615 3453 --
NM_024948chr10----1246 --
NM_024949chr454265 3452 1774 1564 1489 --31731 1544 761 --
NM_024989chr287384 7166 6385 2966 2247 2119 787 369 37192 1271 756 26668 6414 15231
NM_024993chr21382 --1210 --
NM_025054chr834090 1084 255 13312 --13724
NM_025146chr321755 964 --1553 12264
NM_025160chr142756 744 517 109 ------
NM_025179chr154249 4049 3330 1110 739 11280 ----
NM_025191chr143150 1243 541 392 23177 960 32773 2403 879 --
NM_025244chr2----1297 --
NM_030621chr1433323 2881 371 --23423 1263 --
NM_030627chr521658 56 13826 14046 --
NM_030647chr766271 6127 5616 5001 4447 4225 11418 ----
NM_030648chr445145 1789 1637 92 1704 --14302
NM_030756chr101313 ------
NM_030762chr1231992 1588 194 --11605 --
NM_030775chr121907 --1146 --
NM_030791chr1421788 234 ----11531
NM_030806chr1139165 8297 8262 8044 7861 7723 7651 3307 2881 2649 2579 2132 799 --12330 --
NM_030906chr112163 146 --1536 --
NM_030938chr1711136 ----1729
NM_031291chr42711 595 ------
NM_031435chr1253389 2431 1314 729 717 --32902 539 295 --
NM_031469chr613639 11051 --1852
NM_031918chr193791 752 503 ------
NM_032027chr1----1238 --
NM_032047chr31257 1748 2480 192 11796
NM_032199chr1043129 2746 2383 1226 175 --22553 926
NM_032211chr1021215 444 --154 --
NM_032221chr2011286 --21312 242 --
NM_032228chr111202 1168 ----
NM_032239chr4----11354 --
NM_032246chr1521145 174 ------
NM_032294chr1751720 1577 1435 1418 417 11230 ----
NM_032295chr731448 940 442 ------
NM_032311chr2221688 684 --169 --
NM_032352chr14----1502 --
NM_032373chr1074987 3905 3699 3639 2252 1770 350 --34777 1179 528 15608
NM_032410chr81463 --189 --
NM_032440chr1022340 1866 --22131 1185 --
NM_032457chr4----1963 --
NM_032487chr31163 --1318 --
NM_032505chr311907 1703 ----
NM_032557chr4----1929 --
NM_032569chr16----21584 83 --
NM_032575chr1611809 --11940 --
NM_032595chr1711244 1166 ----
NM_032682chr332722 1412 1327 --12650 23509 1132
NM_032689chr1931127 463 112 ------
NM_032812chr101246 --1362 --
NM_032818chr942341 1861 254 192 --22620 2160 --
NM_032828chr19164585 4294 4068 3701 3465 3051 1868 1423 1290 1061 817 792 657 524 483 229 --11266 165
NM_032924chr731120 838 78 --11041 --
NM_032982chr732127 618 609 12614 1912 --
NM_033089chr201379 --21255 41 --
NM_033224chr797845 7451 6688 6663 5151 5102 2924 2440 73 --27641 3062 --
NM_033285chr823808 1038 14332 1593 --
NM_033495chrX------1986
NM_033656chr2146014 5656 3971 3704 --25422 22 15728
NM_044472chr1----1596 --
NM_052879chr1234029 2818 2627 ------
NM_052885chr1244903 3840 880 472 --34331 4158 1726 23813 3483
NM_052907chr1244146 1116 469 260 --1699 --
NM_052911chr18--1279 1168 --
NM_052917chr243145 2960 2596 159 --12089 --
NM_052937chr842570 1798 796 226 ----1360
NM_053023chr1131122 308 33 ------
NM_058172chr441530 1506 1353 113 ------
NM_080546chr91194 --21756 1673 1594
NM_080664chr1421335 365 --12020 --
NM_080672chr20181 --1449 --
NM_080738chr131895 1695 1437 ------
NM_080867chr1475062 4916 3934 1754 1078 1062 189 --21890 888 --
NM_080927chr333317 2897 1235 11304 32851 2705 2290 --
NM_101395chr212885 26 --1666 12862
NM_133433chr5----1204 --
NM_133446chr10------1301
NM_133477chr433014 2940 603 11155 ----
NM_138348chr576164 5251 4842 4204 2091 1850 1396 --12539 --
NM_138459chr613325 ----1105
NM_138468chr255879 4519 2199 1722 1372 16344 25424 333 15514
NM_138473chr1274263 4146 4115 1991 1849 1021 604 1614 --1634
NM_138731chr1443707 3630 3228 2935 13416 1248 --
NM_138795chr121429 499 ------
NM_138799chr221843 1598 --1744 --
NM_139015chr1211641 --2610 151 --
NM_139201chr12------1228
NM_139244chr61729 ----1652
NM_139279chr212795 --13525 --
NM_144563chr2----1258 --
NM_144567chr142782 1789 842 646 --12396 --
NM_144571chr486852 6173 5872 5381 5059 2417 2304 1884 ------
NM_144582chr252520 871 333 169 159 --1511 --
NM_144600chr1621099 289 --1177 --
NM_144618chr141220 1089 621 137 133 --1235
NM_144632chr21303 --21819 274 --
NM_144973chr1221646 310 24181 3437 24258 167 --
NM_145052chrX1975 ------
NM_145176chr6----23064 579 --
NM_145203chr131817 1782 --182
NM_145206chr1023327 3219 --11211 --
NM_145257chr151523 692 579 357 337 ----14170
NM_145756chr1841203 636 536 325 ------
NM_145800chrX3804 644 207 ------
NM_145805chr15------1597
NM_145808chr732643 2591 570 12340 23086 3027 --
NM_145913chr121856 ------
NM_147202chr952284 2244 1989 787 177 --182 --
NM_152280chr111368 --13277 --
NM_152387chr231054 101 32 ----11024
NM_152409chr542730 1238 972 918 12622 ----
NM_152442chr1221379 45 --11428 --
NM_152512chr22----1228 --
NM_152556chr732049 748 182 --22171 594 --
NM_152594chr15126 --11542 --
NM_152622chr52987 365 13015 ----
NM_152641chr1222825 1036 --1247 --
NM_152682chr411540 11551 1155 --
NM_152749chr7----1359 --
NM_152758chr832974 2751 481 --12913 --
NM_152835chr112924 ----12517
NM_152890chr141241 1190 1157 1148 --1895 --
NM_152994chr2--1470 1616 --
NM_153042chr6----11814 --
NM_153183chrX21236 1223 --1116 1373
NM_153235chr632211 875 374 --12108 --
NM_153262chr152863 2793 2710 2137 558 11221 1657 --
NM_153377chr12127 ------
NM_153607chr542184 971 505 493 13084 22215 1277 13106
NM_153687chr121466 --2516 155 --
NM_153706chr5----1253 --
NM_170721chr1711047 --11273 --
NM_170768chr1121186 1166 21578 1415 1212 --
NM_172071chr176138 6041 5752 5043 4614 2948 176 16409 1871 --
NM_173468chr455652 3996 3842 3790 396 --24536 1803 --
NM_173469chr1521159 180 ------
NM_173475chr1641751 1638 1239 688 11407 ----
NM_173495chrX22580 1666 --1317 --
NM_173623chr172200 118 ------
NM_173632chr1983403 2624 2265 1162 717 635 481 306 12817 23342 564 --
NM_173670chr5----11033 --
NM_173808chr154312 3747 1064 601 143 ------
NM_173825chr352448 2394 1041 583 373 --155 --
NM_173851chr8----23709 1121 --
NM_175736chr12167721 7449 5714 5176 4730 3101 2506 2203 1739 1692 1677 913 571 534 253 81 --21618 448 --
NM_175854chr133829 559 492 --11822 --
NM_176814chr71521 --137 --
NM_177539chr13301 284 183 ------
NM_177966chr341643 740 665 396 ----178
NM_178123chr2------134
NM_178815chr1022779 2021 --12280 --
NM_180989chr1332233 2179 606 1382 --11996
NM_181358chr163545 3300 998 840 709 262 13401 ----
NM_181457chr21359 --11239 --
NM_181504chr533101 217 34 --1578 23234 1068
NM_181571chr1011069 ------
NM_181670chr1211480 --11319 --
NM_181723chr832258 1870 1530 ------
NM_181807chr11----1136 --
NM_181836chr532232 888 546 --12154 --
NM_181873chr12193 26 ------
NM_182527chr2231840 1658 647 --1711 12176
NM_182700chr721865 1668 ------
NM_182717chr1031474 1003 190 ----1354
NM_182970chr2054282 3983 3668 1487 349 --24297 1377 --
NM_183416chr11749 --157 --
NM_194314chr144861 4194 792 605 ----11668
NM_197941chr532870 985 455 --12187 13091
NM_198270chrX----13229 --
NM_198404chr131351 --1927 1576
NM_198467chr7--2485 477 ----
NM_198503chr1--22259 608 1442 12192
NM_198513chr81284 --11802 --
NM_198570chr7------1308
NM_198844chr172989 660 --1965 --
NM_198859chr354493 1451 1313 975 100 --14345 --
NM_198935chr2052699 2588 2015 138 43 22982 2037 12803 --
NM_199000chr72834 270 --2816 235 --
NM_201262chr102286 48 ------
NM_203365chr22600 162 --1102 --
NM_203406chr5------1207
NM_203458chr143672 2835 2360 2334 12342 ----
NM_203459chr131871 1589 709 --12076 --
NM_205848chr122208 817 --191 --
NM_206853chr632530 462 88 --1489 1276
NM_206886chr1------176
NM_207111chr711022 --12687 --
NM_207406chr436384 5956 5360 ----14320
NM_212559chrX2319 79 ------
NM_213589chr265321 5250 5107 1832 1291 54 --35583 4701 1194 --