TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-557
miRNA Sequence: GUUUGCACGGGUGGGCCUUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541985 658 612 102 2666 409 11301 --
NM_000076chr11----1228 1283
NM_000084chrX96837 4509 2300 1576 1445 1241 1112 1052 23 56737 2235 963 734 336 1432 --
NM_000109chrX52443 1856 1821 1795 403 1312 ----
NM_000115chr1352442 1056 938 509 131 22457 399 ----
NM_000138chr1572643 2417 2307 827 579 365 357 ------
NM_000141chr1021387 395 --1151 11377
NM_000163chr541783 387 213 207 1512 ----
NM_000176chr533344 1473 1400 33799 1269 895 1822 13677
NM_000176chr533344 1473 1400 33799 1269 895 1822 13677
NM_000176chr533344 1473 1400 33799 1269 895 1822 13677
NM_000210chr22793 677 32056 1771 1449 ----
NM_000214chr2021142 598 1201 ----
NM_000216chrX114039 3562 2880 1610 1281 912 808 600 527 132 40 34020 4007 1487 13852 --
NM_000217chr1295238 4536 3922 2098 1508 1472 1300 745 437 54952 4911 3760 837 815 14598 --
NM_000222chr421951 185 --12043 --
NM_000237chr811721 --11741 --
NM_000248chr371116 1105 1076 536 393 372 230 22177 565 --12597
NM_000259chr1566186 4931 4592 1776 748 525 45431 3976 2049 1400 ----
NM_000264chr952764 427 396 221 200 ------
NM_000267chr17103505 3346 3257 3141 3100 3052 1309 832 677 255 12286 --13066
NM_000297chr432040 1756 1734 21877 1867 1215 --
NM_000319chr122891 416 11221 11197 --
NM_000321chr13--2702 511 2219 140 11234
NM_000332chr6106135 5958 5725 2780 2338 1431 929 871 749 373 35235 1276 978 --26920 518
NM_000351chrX134348 4227 3640 2967 2921 2773 1497 1290 1284 1167 1080 943 348 34305 3789 778 1300 1322
NM_000353chr1611099 ------
NM_000378chr111425 1870 11121 --
NM_000393chr231523 547 323 3836 690 269 ----
NM_000399chr102901 764 --11192 --
NM_000430chr1761099 898 716 649 189 108 23329 2465 --13735
NM_000461chr3124589 4446 4160 4145 4048 3978 3242 3060 2843 1273 1020 650 13985 ----
NM_000462chr1521830 1781 ----1595
NM_000474chr72657 609 1493 ----
NM_000477chr4----198 --
NM_000489chrX32894 2813 588 11282 12290 --
NM_000555chrX77874 7733 7029 5614 4958 4847 662 27865 257 26453 1549 --
NM_000599chr233769 3035 2815 21741 199 --13857
NM_000615chr1122756 550 22451 497 12969 1775
NM_000618chr12125924 5344 4988 4793 2265 2160 1420 1389 1102 838 785 684 64155 2537 2405 1289 882 193 ----
NM_000627chr22729 129 1234 146 --
NM_000633chr1884538 4306 4250 4232 4146 3614 3545 360 44845 4048 1482 34 ----
NM_000663chr1662216 2110 2090 511 446 199 32883 2479 2043 12282 --
NM_000719chr12116730 6496 5856 5052 4812 4777 2062 1707 1530 1175 194 36270 5484 1401 14271 15875
NM_000724chr103777 584 569 --11763 --
NM_000767chr1941091 272 171 162 ----1587
NM_000793chr1434406 4235 3874 25042 1334 54838 4380 3616 1912 1308 11837
NM_000813chr555611 5584 4086 4067 437 35422 4775 1492 13960 --
NM_000814chr1524095 1509 12622 21561 806 --
NM_000824chr41295 --1288 --
NM_000828chrX62198 2186 627 347 204 126 31464 294 279 ----
NM_000868chrX62560 2489 2478 2415 2309 92 ------
NM_000891chr1772957 2892 2564 2526 2512 1032 447 12444 ----
NM_000899chr12104213 3911 3467 3288 1054 898 678 652 617 425 54282 3806 3540 3039 850 ----
NM_000901chr482540 2143 1983 1010 902 896 766 502 12519 ----
NM_000933chr2041611 1220 1108 690 61713 1680 1603 1364 550 474 198 --
NM_000941chr7----1326 --
NM_000945chr221328 325 --11906 --
NM_000950chrX73302 2629 2396 1242 1093 446 415 32403 391 320 13519 --
NM_000956chr1431047 1041 177 --21104 87 --
NM_000983chr121271 641 21037 594 ----
NM_001001331chr332720 539 425 11850 --22248 1775
NM_001001396chr184360 3726 3341 3090 2721 1463 1095 235 --23295 932 --
NM_001001419chr542071 691 630 218 3813 478 210 ----
NM_001001481chr833176 1058 312 ------
NM_001001484chr1031800 663 44 32287 808 454 ----
NM_001001664chr243701 1563 855 804 33954 3747 375 ----
NM_001001668chr1974209 4179 3581 3432 3049 2696 1233 ------
NM_001001715chr132557 522 ------
NM_001001890chr2174275 3700 3521 3197 1598 1427 1247 1517 13125 13770
NM_001001995chrX21726 462 ----11360
NM_001002243chr21205 --1928 1766
NM_001002257chr221309 975 23002 1335 --13487
NM_001002296chr8----1318 11309
NM_001002909chr1732035 1995 353 22245 799 ----
NM_001002919chr24543 535 168 116 1513 2552 470 --
NM_001003652chr1888286 8158 7981 7558 6616 2297 1714 1150 57248 7031 2243 2056 1169 15589 --
NM_001003674chr1895153 4731 4551 4317 1637 1078 987 347 167 15529 1543 --
NM_001003679chr1--22024 868 1179 --
NM_001003688chr4--1233 ----
NM_001003792chr31895 11009 1179 11075
NM_001003800chr963148 3108 2917 1491 1057 540 --1809 22886 565
NM_001004065chr953965 3579 2999 1212 400 11296 1101 --
NM_001004317chr6103993 3780 3446 1816 1569 1166 1148 725 57 41 21489 772 ----
NM_001004342chr1116001 5415 4671 4341 2404 1756 1730 549 475 115 103 24438 2305 ----
NM_001004419chr1244259 3509 2830 1302 23748 3673 31519 952 742 --
NM_001005404chr1754276 3789 3146 1642 707 13132 --23573 3068
NM_001005463chr1032135 2110 179 ----11791
NM_001005473chr5106431 6270 5553 4501 4403 1688 1178 1099 778 69 46610 6184 4371 2239 26540 4255 --
NM_001005476chr2----1457 --
NM_001006657chr211094 32971 2662 30 12745 1655
NM_001007097chr965004 4370 3787 1587 400 207 13984 ----
NM_001007214chr151754 1584 1566 418 195 21715 1359 --1382
NM_001008225chr71203 ------
NM_001008239chr1843657 2466 1071 892 1691 --13786
NM_001008410chr251556 791 718 448 334 --32292 104 84 --
NM_001008495chr852056 672 664 370 193 --32293 1595 181 --
NM_001008564chr1331441 454 227 12097 ----
NM_001008738chr552950 2712 1863 1855 1172 --1540 --
NM_001008801chr1972080 1512 863 697 488 346 204 ------
NM_001009958chr73601 579 572 ----157
NM_001009993chr273809 3118 2789 1612 641 430 34 44070 868 366 351 14147 --
NM_001010888chrX54386 4241 1739 1303 464 33391 3093 3047 --23063 2985
NM_001010927chr63208 144 115 173 1443 --
NM_001010986chrX1663 32390 2293 1825 12350 --
NM_001011537chr321732 657 22239 1720 1557 --
NM_001011666chr796612 6396 6345 6309 4621 2230 1390 1382 1316 1966 16232 24424 1939
NM_001011724chr13----1229 --
NM_001012393chr11135183 4793 4725 4639 4311 4245 3437 3338 1876 1670 1444 687 638 ----14455
NM_001012754chr1361986 1716 1549 743 411 377 12009 21884 1791 --
NM_001012761chr552682 2618 1682 904 439 12293 22690 2045 12668
NM_001012968chrX1373 42050 438 412 273 1301 12576
NM_001013031chr1053253 3016 2298 1236 1149 11132 12807 --
NM_001013415chr451601 1313 995 291 116 2262 66 11019 --
NM_001014797chr1087986 6709 6487 5576 5112 2384 1812 1590 48189 3189 1093 457 11704 --
NM_001015877chrX72963 2513 2503 2135 2100 758 396 12204 ----
NM_001017371chr24927 917 900 276 ----2322 98
NM_001017395chr353633 3492 2534 1002 249 1355 22524 1139 --
NM_001017424chr161753 1593 1300 1193 713 425 11562 1728 1617
NM_001017999chr142308 2172 467 434 --2942 61 --
NM_001018054chr131452 411 180 ------
NM_001018056chr94547 421 411 172 ------
NM_001018065chr9115873 4644 4433 2400 1297 1286 965 776 720 638 99 --13849 --
NM_001018067chr154504 4018 1994 912 292 34909 3413 933 14523 --
NM_001018111chr753803 3083 2974 894 792 23956 196 14040 --
NM_001020658chr151566 1394 1112 430 174 ----11341
NM_001023567chr1562491 2350 2259 2073 1540 674 1155 12425 --
NM_001024372chr872278 1953 1678 1568 350 343 303 128 --1396
NM_001024463chr15--1483 --1784
NM_001024647chr1235142 710 120 45867 5524 2425 822 1772 17133
NM_001024649chr542502 941 492 150 2444 52 21131 362 12818
NM_001024947chr551088 917 839 287 102 1714 ----
NM_001025076chr1025543 771 22336 271 36121 5363 543 14056
NM_001025077chr1086901 5068 2129 1373 1269 1259 834 384 21629 848 37479 6721 1901 15414
NM_001025079chr354099 3943 1522 1419 649 11496 --13721
NM_001025105chr541462 989 520 473 11557 21539 128 --
NM_001025108chr2114193 3891 3852 3825 3483 3121 1550 1538 735 431 199 33082 1177 1095 --23422 3099
NM_001025580chrX53372 1376 764 424 39 21590 944 23246 2651 --
NM_001025780chr971447 643 594 470 208 195 91 3535 450 293 ----
NM_001029858chr633273 118 97 ----12706
NM_001029863chr663049 1257 1216 913 855 380 33128 1246 878 ----
NM_001030006chr1742040 1777 448 384 --145 22025 720
NM_001030007chr1643952 3871 2958 667 23891 3816 --1843
NM_001030055chr1444676 3187 1651 757 --1683 --
NM_001031679chr1243333 3072 682 390 33195 1175 409 --33213 2443 1299
NM_001031684chr251520 1032 134 79 73 --1979 --
NM_001031695chr2285056 4898 4812 4086 4058 3636 1361 22 23629 3452 ----
NM_001031804chr1653931 3498 1645 1130 668 ------
NM_001032288chr202226 158 ----11441
NM_001032394chr642555 2286 210 182 2387 165 22780 191 --
NM_001033047chr472661 1036 869 712 549 377 165 --1654 --
NM_001033057chr351713 1695 1433 576 480 1495 ----
NM_001033507chr151874 1829 793 415 282 ------
NM_001033557chr2------1893
NM_001033578chr832338 2201 574 21987 519 --1157
NM_001033602chr1371992 1060 933 814 773 152 115 1280 2208 187 --
NM_001033925chr1021409 793 21513 1432 21560 1400 --
NM_001034841chr1685125 4663 4069 3837 1925 1795 990 582 53861 3378 1225 100 92 23972 1898 --
NM_001034850chr52637 207 2479 359 ----
NM_001035003chr421182 118 --11410 --
NM_001037164chr711821 21928 369 --11695
NM_001037339chr12719 588 21672 414 ----
NM_001037553chr21114607 4280 4006 3697 3432 3344 3195 2041 1772 727 75 35118 3740 1981 24425 672 --
NM_001037954chr1153543 3326 3142 1122 480 12393 --12321
NM_001039091chrX----1400 --
NM_001039538chr233660 2983 603 23695 173 --1637
NM_001039590chrX63896 3855 3724 3369 1371 1332 53821 3036 2783 926 148 22715 228 --
NM_001039618chr1185470 5304 4958 4203 3744 2007 1604 1268 35863 5792 1682 21079 672 --
NM_001039762chr1071855 961 738 475 455 425 299 1233 11669 11815
NM_001039840chrX86069 5130 4904 4423 1746 1375 675 559 55722 4022 3833 1771 584 26087 2228 15608
NM_001040001chr641764 1754 1703 66 --11492 11865
NM_001040020chr761512 1299 1217 465 294 176 --178 --
NM_001040101chr45370 303 144 113 38 1277 31606 1519 1028 11141
NM_001040152chr774596 4305 3560 1680 1149 798 72 1722 11903 --
NM_001040214chr642377 1797 1494 131 1472 1600 --
NM_001040272chr941886 1801 869 242 21975 645 31716 566 379 --
NM_001040284chr1695694 2095 1692 1408 1380 1148 590 320 35 4796 735 290 173 32199 1831 828 --
NM_001040429chr1363217 2903 2577 1143 1072 1037 43497 2212 1121 680 21368 980 --
NM_001040441chr175519 4899 3476 2196 2188 2060 1498 13974 ----
NM_001040446chr532544 2348 407 22748 544 12530 --
NM_001040665chr794869 4753 4617 4286 3760 3071 2008 1983 335 13212 --13445
NM_001040712chr943114 1241 1027 518 23437 2207 2556 336 1728
NM_001042404chr111595 21520 1499 ----
NM_001042413chr943447 670 447 118 12614 --13407
NM_001042473chr1031945 1933 427 22183 1826 ----
NM_001042486chr2011098 11537 160 11079
NM_001042494chr1543723 3179 2843 492 12983 --1160
NM_001042510chr82408 162 21609 773 1178 1279
NM_001042537chrX62400 1867 1561 649 517 100 31801 996 32 1844 1286
NM_001042543chr441265 164 34 28 --21276 630 --
NM_001042555chr1274357 3430 3239 1923 1168 509 59 34584 3693 1549 ----
NM_001042599chr297761 7476 7253 5966 5398 4860 4846 1505 720 13155 16219 17096
NM_001042601chr3--1552 --22831 983
NM_001042604chr344528 4066 3114 201 34127 3641 2983 34807 3430 112 --
NM_001079874chr182138 2094 2013 1719 1567 669 426 286 --11632 1211
NM_001092chr1762537 2502 2266 2097 2081 405 --2872 671 --
NM_001099678chr3126353 6295 6186 6071 5717 5546 5044 2221 2153 1952 1883 1668 65937 4361 4288 1941 776 766 14317 --
NM_001100108chr1128288 7295 5737 5276 2796 2357 1815 1773 1762 772 625 539 12182 15970 13088
NM_001106chr3139204 9072 8700 8466 8138 7411 3705 2533 2069 1643 973 819 411 49522 8459 3914 275 12979 --
NM_001116chr1632712 2218 1078 --42567 2307 2245 562 12378
NM_001119chr421505 85 197 ----
NM_001146chr822312 461 2849 351 ----
NM_001148chr432015 496 142 2796 712 12001 11707
NM_001149chr104912 872 492 245 21163 150 ----
NM_001160chr1272643 2586 2212 923 625 233 107 12837 ----
NM_001167chrX106374 5560 5500 2222 2162 1904 1838 1031 659 307 45171 1736 1144 951 24776 543 35444 5163 653
NM_001198chr642422 1733 671 96 21585 951 12407 --
NM_001206chr943084 2924 812 604 22186 987 --11227
NM_001241chr242415 2150 1683 788 32253 2078 311 1471 22014 328
NM_001304chr1733829 3454 1218 ------
NM_001315chr662002 1789 1701 596 328 97 --1837 --
NM_001343chr531708 666 21 1160 1249 --
NM_001364chr1194221 4165 1721 1119 1060 780 585 559 331 24725 1906 24586 1352 14617
NM_001390chr1843230 2502 1114 216 13485 22713 792 11262
NM_001391chr1811060 11120 --11135
NM_001396chr2182694 2489 2062 2029 1003 907 707 161 --175 12774
NM_001401chr921606 1044 31590 1235 1077 1330 --
NM_001427chr71257 --31813 1516 1433 --
NM_001438chr163626 3477 2691 1401 721 697 23584 2317 33545 3348 2331 --
NM_001451chr1661199 1081 1029 300 158 29 ----11109
NM_001453chr631763 1531 494 ------
NM_001455chr664956 4728 4452 1966 1885 1874 44936 4589 1001 231 11050 --
NM_001483chr71767 --11011 --
NM_001498chr651162 1055 1028 360 306 11348 11335 --
NM_001584chr1161223 1112 822 467 249 112 21236 213 ----
NM_001609chr1043079 893 760 318 144 13108 --
NM_001616chr233423 1213 219 11029 12418 192
NM_001650chr1883731 3682 3529 3431 1495 1481 1115 102 11175 21424 1052 --
NM_001663chr1451814 842 809 467 455 32768 2545 1882 11915 --
NM_001668chr13889 776 75 21927 616 --11421
NM_001677chr14952 256 202 159 1942 1434 11064
NM_001695chr862921 1040 643 553 430 215 24158 4095 2532 360 --
NM_001704chr6----1599 --
NM_001706chr34780 702 379 241 41035 766 330 303 1118 --
NM_001730chr1381549 1425 1405 1088 1004 563 555 304 ----173
NM_001731chr12----1844 --
NM_001744chr5------2518 116
NM_001748chr141089 739 264 215 ------
NM_001759chr1294403 4178 1383 1200 1016 732 440 295 237 25134 261 11298 14470
NM_001797chr161552 --168 --
NM_001830chrX73908 3013 2723 1447 1318 539 277 63062 1608 1114 1059 939 679 33993 3638 3535 --
NM_001894chr22----11213 --
NM_001895chr2011063 --11243 --
NM_001935chr21729 ------
NM_001946chr121820 11156 11122 --
NM_001949chr6113230 3169 2963 2848 2729 2144 982 896 655 485 277 33132 3030 502 12542 --
NM_001969chr14123531 3338 2887 2808 1243 1170 808 582 454 432 70 41 23480 2660 --185
NM_001981chr152431 2387 1581 290 122 21689 920 1476 --
NM_001987chr12114293 4129 4056 3222 3020 2945 992 848 485 434 143 23692 1413 ----
NM_002006chr494591 4026 4018 2244 1924 1645 1345 1018 921 45777 5411 4065 185 1508 14342
NM_002009chr1512317 2246 236 --12743
NM_002013chr142259 97 ----1216
NM_002015chr1343028 853 703 209 23319 296 23168 2555 --
NM_002017chr1111191 11383 ----
NM_002025chrX88919 8309 8012 6863 3439 2628 1635 1448 69309 9222 7846 3275 1738 141 48893 2602 786 758 12390
NM_002035chr1883818 3480 3400 2965 1219 689 196 147 21539 961 ----
NM_002039chr43726 197 46 1794 ----
NM_002040chr2143020 982 890 565 33192 2912 2315 --12958
NM_002061chr1185 --1513 165
NM_002069chr751868 1626 1569 454 273 --1265 --
NM_002074chr151700 1272 573 325 206 21716 403 ----
NM_002128chr1341788 1701 238 105 1392 22450 2188 --
NM_002136chr121676 --1229 --
NM_002137chr772247 739 692 586 524 418 167 22112 234 ----
NM_002140chr921051 764 11018 --2440 240
NM_002147chr171767 ----1708
NM_002214chr754789 3925 1214 999 815 35751 5365 619 35043 4368 3838 --
NM_002226chr142904 229 ----1107
NM_002239chr22758 152 1729 1244 1161
NM_002240chr21----1217 1151
NM_002247chr1052253 2121 1910 1511 544 32220 604 356 ----
NM_002264chr374776 4352 3633 1420 1333 1083 919 22011 1922 14646 11623
NM_002267chr132421 186 21699 910 22211 2173 --
NM_002270chr585606 5301 4307 3520 3459 2194 1155 858 33684 1943 1301 21745 1536 24199 1192
NM_002271chr1362220 1920 1595 970 898 801 52130 2097 1721 1686 162 --1677
NM_002336chr1264901 4772 1881 1033 263 45 14974 1666 --
NM_002349chr241480 1069 592 439 31280 1224 407 ----
NM_002356chr642115 2077 1087 773 22870 884 2489 340 --
NM_002376chr141192 ----1514
NM_002397chr531481 730 337 42105 819 282 138 ----
NM_002398chr241507 1217 544 46 11279 --11233
NM_002460chr653782 3770 612 229 97 12884 13120 --
NM_002500chr221270 99 11172 1106 --
NM_002514chr83348 259 186 21166 1074 ----
NM_002515chr1461972 1692 1549 254 150 115 2537 78 ----
NM_002519chr112273 171 41412 940 242 217 1284 --
NM_002522chr1753589 3171 855 504 472 --23531 997 --
NM_002547chrX113841 3694 3520 3045 3021 2771 2585 1571 1480 1279 693 1712 ----
NM_002581chr985418 4893 1810 1728 1126 651 560 247 45235 4303 983 479 14788 --
NM_002594chr2042471 2157 1702 1662 ------
NM_002595chr1251925 1536 1496 479 276 21294 622 11229 --
NM_002645chr1162013 2007 1936 1069 609 398 --11091 --
NM_002655chr894651 4153 3314 1879 1864 1762 1377 870 400 25115 4631 11801 14545
NM_002670chr311284 ----182
NM_002687chr1421287 78 2222 112 11057 --
NM_002709chr243598 3415 756 344 22722 75 12648 --
NM_002731chr143023 2493 2000 991 43166 3044 2584 2041 ----
NM_002734chr1762058 1496 1475 729 247 59 ----1347
NM_002745chr2274482 3816 3278 3231 2912 782 756 13870 23388 1402 --
NM_002819chr1911180 --11192 --
NM_002828chr1851025 841 823 201 105 ------
NM_002844chr621137 524 --1426 188
NM_002852chr32589 576 1542 ----
NM_002869chr1141906 1580 1559 1499 ------
NM_002874chr942405 984 467 330 1267 --1217
NM_002892chr1431671 1306 643 41693 1644 1360 174 1541 --
NM_002912chr61276 --1668 1874
NM_002941chr351527 605 588 462 97 1552 ----
NM_002942chr35414 307 130 119 81 1882 ----
NM_002959chr133180 473 266 --34375 4186 2717 --
NM_002998chr872173 1425 1406 885 781 532 470 --12078 1648
NM_003010chr1762277 2195 1997 1758 513 110 22303 1766 ----
NM_003013chr43805 720 313 1780 ----
NM_003017chr631417 896 165 11312 --11346
NM_003028chr963650 3484 719 628 595 265 --23173 669 --
NM_003045chr1395042 4839 3964 3925 3912 1266 738 133 88 15002 --24105 1644
NM_003051chr131498 1370 96 ------
NM_003054chr10----1283 --
NM_003068chr82881 330 1170 --1761
NM_003070chr92796 603 ----1168
NM_003105chr11----135 --
NM_003106chr31911 2400 168 --170
NM_003107chr642612 2477 2085 2047 21952 1748 11779 --
NM_003108chr277050 4558 2435 1430 1078 723 489 47276 7141 7100 5282 140 15892
NM_003112chr7113252 3199 3138 2962 2721 2441 2329 2124 1274 918 622 13211 22805 891 1945
NM_003113chr23653 230 102 ------
NM_003144chr642116 1753 1730 1471 22218 1807 176 --
NM_003161chr1763622 3605 2825 659 423 68 32538 1230 591 1496 1177
NM_003183chr21308 ----2260 36
NM_003188chr64750 592 529 34 --1340 --
NM_003211chr1221622 114 --11485 11359
NM_003274chr2162690 2323 2053 1823 1163 1023 ------
NM_003286chr201350 1132 11086 1989
NM_003291chr134711 675 322 175 2775 754 ----
NM_003298chr385733 5254 4811 4182 3876 1739 772 443 45503 5066 4305 2402 2942 89 --
NM_003325chr22--1657 --1716
NM_003336chrX21146 1036 21117 222 ----
NM_003337chr52398 294 1107 --1428
NM_003340chr451168 941 879 873 213 21259 1029 ----
NM_003342chr1763236 2591 2043 1221 1009 252 --1365 --
NM_003392chr363838 3580 3063 3017 646 453 23348 782 --1468
NM_003400chr23565 346 95 1325 ----
NM_003404chr2041779 404 345 65 ----12050
NM_003406chr821941 608 31825 695 531 --1308
NM_003409chr181937 21367 519 11050 --
NM_003410chrX33107 2922 845 12447 --13003
NM_003411chrY21156 23 ----1109
NM_003412chr3112947 2549 2482 1253 1185 890 785 700 406 363 85 --22044 666 --
NM_003413chrX31862 1508 600 11555 ----
NM_003453chr131143 ------
NM_003458chr343916 3473 1437 1145 ------
NM_003463chr663044 2474 2314 1239 1070 734 21228 1001 1815 --
NM_003474chr1051800 871 623 227 192 1210 ----
NM_003478chr1142330 2142 800 64 23359 2031 ----
NM_003483chr1242719 446 387 242 11825 ----
NM_003489chr2143217 2921 2769 988 31136 875 305 12872 --
NM_003505chr781599 1537 721 533 431 410 279 267 21350 155 --11988
NM_003566chr1233044 714 268 43083 1240 1163 673 ----
NM_003567chr11417 --3338 144 95 --
NM_003574chr1855807 1413 1153 685 327 21759 1682 23770 465 11585
NM_003583chr1242911 1555 1450 708 23757 3134 13265 12763
NM_003590chr263092 2572 1540 439 406 365 13929 1729 --
NM_003592chr72500 194 --1524 --
NM_003615chr353226 2941 2894 2705 1123 13433 13328 12433
NM_003620chr172407 169 1209 1219 --
NM_003655chr171777 ----1668
NM_003670chr321411 1214 185 --11404
NM_003693chr171784 ----1293
NM_003701chr13--1424 --1753
NM_003713chr141682 1298 1208 227 21739 33 11083 --
NM_003714chr552574 2331 2017 620 401 1467 22283 2106 --
NM_003722chr332064 2035 279 1215 --11693
NM_003728chr4----1212 1623
NM_003783chr171078 937 931 860 402 36 28 --1447 --
NM_003797chr11------149
NM_003822chr172984 2363 2037 1952 1035 627 208 12217 ----
NM_003846chr11714 --1738 --
NM_003873chr1032415 2189 196 --12366 12255
NM_003877chr122735 268 160 1672 --
NM_003884chr391786 1753 1490 1402 1279 1257 729 623 108 11823 ----
NM_003885chr1792493 2320 2195 1859 1851 1743 1642 952 800 --22076 2047 --
NM_003895chr2141964 1825 627 84 --11818 --
NM_003930chr792562 1929 1698 685 655 598 236 193 39 ------
NM_003941chr772230 1589 650 428 168 148 88 32062 1633 76 21763 216 --
NM_003948chr451981 1865 1652 723 697 ----21025 358
NM_003971chr172508 253 1433 ----
NM_003998chr41606 1508 129 --
NM_004064chr1211182 11087 1827 --
NM_004075chr123631 526 224 ------
NM_004093chr1342759 2682 933 698 42397 2147 2028 308 1470 22619 227
NM_004100chr652669 2475 2435 2365 1083 --1488 12309
NM_004114chrX--1351 1846 --
NM_004124chr1432631 481 189 11222 --1143
NM_004161chr22245 139 21570 539 ----
NM_004171chr11148943 8709 8347 8196 8095 7799 7073 5873 3840 3072 2627 2540 1418 661 49415 8775 3504 311 --39580 5860 1216
NM_004225chr841390 968 529 474 ----21265 437
NM_004232chr1863820 3498 3333 2934 1378 720 --13902 2247 123
NM_004241chr103681 602 509 1501 1748 --
NM_004267chr3------1505
NM_004272chr521987 166 ----1424
NM_004280chr6180 --1135 --
NM_004282chr61529 ----143
NM_004367chr651614 1221 1077 306 210 41762 1706 559 58 ----
NM_004370chr662144 2006 1994 1603 408 383 32103 1579 881 ----
NM_004392chr1352405 2206 954 722 219 22561 505 ----
NM_004397chr1142943 1713 997 721 --21570 454 --
NM_004419chr103942 148 84 --1831 11093
NM_004429chrX11418 1445 11386 --
NM_004438chr253296 3036 1243 1108 819 43278 3270 2265 260 ----
NM_004458chrX52071 1630 289 195 30 22594 1993 ----
NM_004459chr172773 316 41839 1538 1422 408 11282 --
NM_004474chr1----1891 --
NM_004480chr143741 313 247 1652 ----
NM_004491chr1974065 3635 3515 1725 975 566 199 14382 22767 1482 14329
NM_004504chr222689 256 22857 954 --1160
NM_004505chr1741822 1537 1349 232 --21892 486 --
NM_004551chr11----161 --
NM_004593chr3------1343
NM_004612chr974257 4170 4091 4066 3645 3639 127 --24477 4325 11223
NM_004643chr14----1626 --
NM_004654chrY51332 1293 542 359 230 ------
NM_004667chr15----1273 --
NM_004709chrX41750 1668 1193 719 --21805 1178 11165
NM_004719chr1282886 2202 1848 1124 497 397 48 42 ------
NM_004725chr1041171 1043 325 316 11522 --1596
NM_004734chr1321082 524 22440 1155 13071 1182
NM_004738chr201287 --11928 182
NM_004745chr8116789 6563 6228 5618 4742 4331 2679 2601 1801 803 56 67018 5645 5150 1897 1786 1018 ----
NM_004795chr1351878 1570 188 94 45 21541 389 --1308
NM_004808chr1042464 1273 1116 622 22898 1195 31055 681 546 --
NM_004824chr621424 937 11008 11322 1250
NM_004834chr253320 3084 2586 2482 887 1919 2731 120 --
NM_004840chrX4841 688 481 416 --32207 2043 892 --
NM_004852chr181812419 11891 11661 11442 10941 10704 9765 9633 9456 8873 4707 4545 3249 2595 1538 1296 922 135 813681 13085 11311 10025 4510 4024 2544 1241 1212 --
NM_004863chr1463855 2101 914 594 351 161 --1893 13798
NM_004869chr1841521 1305 1088 322 21463 418 --11720
NM_004926chr1421701 1479 21534 1427 ----
NM_004929chr831057 342 97 1944 11501 --
NM_004956chr761449 1175 660 603 494 220 43793 1747 541 53 1404 23761 2845
NM_004985chr1284078 2948 2817 2733 1697 997 521 117 13065 14288 11753
NM_004992chrX108028 7120 5812 2248 1863 1724 806 545 284 23 47419 6765 2467 1751 17556 28151 6754
NM_005006chr22221 57 2317 88 1197 --
NM_005032chrX1741 ------
NM_005056chr12105598 5196 5118 3717 3659 3601 3417 2183 1841 438 25489 4409 1150 --
NM_005065chr14155095 4965 4624 4503 4405 3945 3897 3697 3462 2108 1877 1816 1771 1746 427 1714 13959 1408
NM_005080chr221893 --1313 --
NM_005095chr111783 11366 1159 12114
NM_005109chr332152 917 761 12510 --1670
NM_005116chr2044430 1315 1033 133 12824 11134 13993
NM_005121chr1753060 2744 2627 2478 737 --11268 126
NM_005124chr61784 --1666 --
NM_005147chr1621205 944 21225 1185 ----
NM_005156chr955212 5004 4713 4277 1359 22041 1585 24763 1244 --
NM_005168chr2--31634 1499 637 --144
NM_005171chr1221176 414 11276 ----
NM_005204chr104930 908 885 750 --1682 --
NM_005221chr71276 --1119 --
NM_005224chr19----1618 --
NM_005239chr2131634 659 620 1392 ----
NM_005259chr241441 979 504 139 11299 ----
NM_005261chr811009 2908 176 --1784
NM_005277chr451425 1320 569 294 191 21928 265 ----
NM_005316chr111236 2754 727 1800 11029
NM_005324chr1751462 828 733 609 448 3213 143 43 ----
NM_005339chr423131 165 42953 1245 820 788 1191 1237
NM_005359chr1876287 6121 2131 1232 1133 908 565 35262 1902 330 --1988
NM_005400chr273023 2233 2023 1994 1082 335 221 22907 37 148 22886 2711
NM_005402chr721489 253 1460 1569 11237
NM_005433chr1832476 2075 835 ----11753
NM_005436chr1063233 2677 1198 1086 294 144 42608 826 389 343 --1926
NM_005458chr942461 2404 738 261 2293 70 ----
NM_005475chr1243265 3053 2350 688 --12357 --
NM_005504chr12106585 6387 6317 6236 5969 5861 5785 5155 1222 1166 11394 15909 14301
NM_005509chr551655 1606 1500 349 209 11903 11546 --
NM_005537chr132727 184 1803 2771 79 189
NM_005578chr3115124 4873 4613 4232 1726 1410 1066 1038 566 550 442 24088 1266 ----
NM_005596chr9106285 5722 5402 4838 4036 3921 2216 2141 881 687 46427 5612 5507 4628 26321 4246 --
NM_005603chr1891982 1948 1926 1898 1873 1836 1786 1384 1340 11329 ----
NM_005614chr73931 405 390 ------
NM_005618chr61461 1438 1585 --
NM_005632chr161992 ------
NM_005665chr144080 3003 1146 374 11111 --1239
NM_005668chr534424 734 166 24623 4615 --11454
NM_005717chr13808 293 137 21295 460 11219 11230
NM_005737chr252499 2477 2350 1019 196 32150 1124 738 1956 --
NM_005748chr1232281 1307 47 42511 2308 1337 1119 1363 12107
NM_005786chr181895 21277 1044 ----
NM_005806chr2141208 1181 381 154 31313 1271 501 21154 995 --
NM_005832chr341468 521 158 90 31330 588 141 ----
NM_005839chr13709 630 25 2162 134 ----
NM_005842chr132719 306 1298 1615 --
NM_005853chr161159 2525 518 ----
NM_005859chr541409 1267 1040 81 1402 ----
NM_005870chr1331455 1096 257 3910 196 48 --1231
NM_005880chr162537 353 --1644 --
NM_005898chr1122949 114 43196 2428 666 619 22175 2158 --
NM_005904chr1851391 1334 1291 380 97 ------
NM_005907chr62671 268 2405 340 ----
NM_005909chr564279 4245 1439 1197 746 147 32776 414 225 ----
NM_005935chr495017 4084 4038 2030 1678 1434 524 333 256 45304 5176 3807 191 ----
NM_005937chr1763994 3609 3205 2815 2567 250 24184 551 11605 --
NM_005941chr883885 3766 3638 3484 2595 1619 1576 1009 33662 3580 3425 12895 --
NM_005955chr184702 4452 3865 3729 1898 1599 795 672 25284 3540 31085 950 721 11459
NM_006011chr15--21674 1344 --1125
NM_006016chr642175 2016 619 44 12279 1323 --
NM_006037chr284279 3785 3421 3133 1281 1269 1262 131 13813 24903 455 --
NM_006047chr2062842 2636 2606 2522 1165 602 33375 3300 259 12669 13251
NM_006080chr762977 2704 2611 2601 2352 226 12595 --12739
NM_006094chr862180 2159 2022 1956 1767 756 ----1222
NM_006106chr1133071 2131 1104 33116 2697 2174 --12227
NM_006135chr131121 1073 904 11021 1220 --
NM_006136chr73951 856 489 159 ----
NM_006154chr1522485 2014 --12077 12916
NM_006158chr861729 1639 1564 402 200 181 ----11741
NM_006186chr221303 486 1830 ----
NM_006195chr921245 1118 31169 376 110 ----
NM_006206chr472442 2073 2061 1800 694 361 80 22026 1094 22929 2113 --
NM_006226chr221346 1188 11107 ----
NM_006243chr12393 128 164 ----
NM_006246chr144922 460 222 87 ------
NM_006251chr573268 2658 2619 2408 2252 545 207 22825 173 ----
NM_006257chr10------11039
NM_006275chr2032222 641 253 190 1582 1953
NM_006281chr8----11172 --
NM_006283chr864312 4287 1815 1610 1402 97 54921 3051 1928 1504 1005 23353 1252 13134
NM_006292chr111188 ------
NM_006306chrX54541 1910 1629 1349 1329 75607 5533 5308 4061 2309 919 378 12270 --
NM_006336chr9------21544 238
NM_006352chr111609 ------
NM_006375chrX51856 1351 1261 735 448 3655 571 258 ----
NM_006380chr1723948 210 4847 677 295 155 23160 435 --
NM_006393chr1064551 4491 4458 3921 3190 714 21656 1577 1486 --
NM_006420chr2033407 2932 1201 33422 2241 37 --23228 1248
NM_006421chr831270 1158 334 21173 898 ----
NM_006449chr24874 837 676 273 41832 1773 567 161 1844 --
NM_006451chr52965 953 1368 ----
NM_006504chr1082925 2896 2773 2364 675 491 475 320 42904 1033 336 53 ----
NM_006526chr205864 637 428 413 153 11691 22196 173 --
NM_006527chr44724 681 568 205 2777 671 ----
NM_006534chr2073436 3356 3026 2524 2165 971 707 33093 1002 645 22890 2498 --
NM_006540chr831389 1242 254 1274 --1426
NM_006557chr931608 425 338 --21707 1591 11382
NM_006565chr161383 ------
NM_006575chr143534 501 120 21334 454 ----
NM_006577chr221217 1105 ------
NM_006599chr1698267 7149 6742 6635 6440 6247 6171 5775 1468 32669 729 144 25349 566 --
NM_006624chr1031995 1616 1473 21936 1533 --11760
NM_006628chr15104380 3834 3494 3486 1826 1364 1356 834 723 580 21016 414 1975 --
NM_006667chrX1385 31063 975 41 ----
NM_006729chrX95389 4225 1811 1374 1352 652 351 286 112 1163 34006 1109 233 --
NM_006750chr16108108 8051 7570 7292 5553 2012 1777 1380 653 123 23030 2524 27691 6472 11631
NM_006751chr21285 1388 1860 --
NM_006754chr74966 796 197 179 ------
NM_006775chr62658 107 22866 843 --1958
NM_006777chrX62489 2132 1112 914 568 505 2646 67 183 --
NM_006800chrX1605 1629 ----
NM_006813chr61167 1111 --127
NM_006815chr1221349 1147 ----11003
NM_006873chr223122 652 33250 2916 2375 22844 2815 --
NM_006876chr11--1230 1655 --
NM_006888chr1483488 3419 3048 2957 2566 970 915 845 21275 72 --1493
NM_006908chr721329 375 11436 1424 11128
NM_006914chr921084 159 --1435 --
NM_006915chrX41762 1624 884 553 --11564 --
NM_006920chr21456 21435 696 3757 295 184 12058
NM_006939chr1431107 267 44 1277 ----
NM_006981chr962992 2280 1868 998 610 187 --1484 --
NM_006997chr102459 39 --1385 --
NM_007006chr1643505 576 514 490 32344 1125 715 22332 180 --
NM_007007chr1284483 3241 1839 1507 847 786 737 377 21281 746 44033 996 443 294 14573
NM_007011chr1535117 4792 2598 15508 ----
NM_007050chr20138040 8017 7999 7548 6817 6758 5797 5742 4922 2834 2110 1956 347 37455 3057 767 16265 1924
NM_007106chr131107 12001 --1810
NM_007118chr54851 806 307 168 1259 ----
NM_007124chr621662 231 11826 1237 --
NM_007137chrX84390 4154 2049 911 737 642 409 343 15292 1870 2481 334
NM_007144chr171286 ------
NM_007146chr1782887 2094 1841 1140 1073 662 592 359 12878 ----
NM_007172chr2233318 3153 2969 33177 2233 22 22201 984 1214
NM_007207chr13675 327 158 --2742 700 1959
NM_007214chr641133 876 346 237 ----11335
NM_007249chr1379148 9084 8931 7502 3621 1996 535 29117 1090 27682 1486 --
NM_007350chr1274483 3704 3563 3184 1662 1061 638 13053 24577 811 --
NM_007358chr141769 1391 535 452 1483 11608 1515
NM_007361chr143269 215 70 1438 --1144
NM_007373chr101232 11723 1592 --
NM_007374chr14190 ----142
NM_007375chr132368 2288 595 22131 78 42607 1757 939 856 --
NM_012072chr20124533 4308 4275 4177 3652 3348 2917 1683 1549 1320 671 592 43934 3829 3058 982 ----
NM_012081chr542545 1098 611 448 33187 2657 2521 2771 394 --
NM_012089chr131199 624 401 255 42 --1137
NM_012090chr13455 327 318 ----1105
NM_012096chr362994 2969 1100 731 495 470 23492 2891 ----
NM_012120chr682664 2625 2458 2437 1043 863 227 125 ------
NM_012156chr2073226 2798 2386 903 794 492 278 23076 645 ----
NM_012214chr286033 4998 4729 2097 1629 806 571 487 1870 11803 15267
NM_012233chr221150 876 1842 21178 369 1408
NM_012234chr322881 2362 11454 23317 868 12769
NM_012238chr102386 112 11248 ----
NM_012243chr13821 775 342 2307 283 ----
NM_012262chr1115154 5132 4339 3812 3418 3204 1397 1385 961 799 791 25246 4458 13591 --
NM_012281chr721588 92 1340 1621 11567
NM_012288chr685506 5422 5306 4942 4133 2188 1708 618 45613 4840 1932 1030 ----
NM_012290chr231615 1507 318 21440 1125 11067 --
NM_012294chr763548 2727 2688 1377 976 851 13990 ----
NM_012297chr442212 969 394 385 21696 986 ----
NM_012300chr542248 2111 282 135 --11868 --
NM_012302chr131150 496 343 --21233 1194 1128
NM_012309chr1184437 4388 3457 3268 1686 954 827 711 23681 3413 ----
NM_012316chr195666 5427 4877 4279 3901 1022 870 787 426 ----14313
NM_012325chr2041505 604 340 146 21315 63 ----
NM_012330chr1041605 607 398 248 1108 21360 672 --
NM_012347chr632421 2170 954 22300 2293 13012 --
NM_012388chr1533043 3035 2589 22899 964 ----
NM_012398chr1972739 2561 2440 2343 2187 550 458 --12079 --
NM_012399chr2231755 1742 606 21941 343 11973 --
NM_012410chr16----1114 --
NM_012414chr12726 157 4783 772 754 122 --1672
NM_012425chr1041818 1052 958 259 1624 21836 912 11865
NM_012428chr154992 978 716 386 --1203 --
NM_013243chr151396 61291 1267 1243 1201 1177 1070 11024 --
NM_013254chr122627 142 --1124 --
NM_013261chr4113750 3604 3249 2975 1330 1162 1050 957 924 895 80 11296 --1655
NM_013309chr1552627 1886 1674 887 69 1881 ----
NM_013354chr821464 1118 21429 1200 1563 --
NM_013372chr1532670 574 237 22088 715 12253 --
NM_013374chr353123 2001 819 448 277 22652 2538 ----
NM_013381chr1232210 1484 233 32418 797 447 ----
NM_013396chr2151553 1414 1355 400 162 1125 ----
NM_013956chr81102 2150 33 ----
NM_014003chr16--1410 1334 --
NM_014011chr272075 1691 1046 1008 960 770 525 1579 ----
NM_014016chr311459 31517 316 256 1694 21049 50
NM_014023chr1052648 2018 725 538 57 ------
NM_014028chr643165 2410 1263 546 42192 1019 600 260 ----
NM_014043chr311298 3374 185 96 164 1239
NM_014044chr2174 166 ----
NM_014048chr1694626 4317 4142 3839 3743 3345 3288 1615 1346 24798 654 11431 --
NM_014112chr895457 5026 4891 4369 4271 3748 1714 1631 595 55229 5069 4825 3878 1198 ----
NM_014117chr1661868 944 780 575 502 72 22384 1677 ----
NM_014154chr331274 1218 287 1995 1401 --
NM_014181chr232380 2302 593 2802 756 11013 12878
NM_014212chr121815 ------
NM_014240chr3104148 3310 3161 1640 1465 982 848 758 524 256 21526 514 ----
NM_014243chr421796 1491 1495 1478 31855 1771 849
NM_014253chrX41733 779 404 101 11002 --1491
NM_014264chr44650 494 432 133 ------
NM_014294chr811285 1515 --11277
NM_014366chr3--1154 ----
NM_014372chr141800 1583 206 137 1645 1280 --
NM_014382chr341495 1417 1196 27 --1654 --
NM_014415chr341694 1463 1321 220 ------
NM_014421chr43227 193 30 41809 1486 603 90 ----
NM_014432chr621394 238 21520 383 138 1277
NM_014454chr65995 909 382 343 261 --1714 --
NM_014458chr1--31222 447 158 --21013 187
NM_014461chr31142 ------
NM_014491chr74822 797 687 681 --1713 --
NM_014494chr16--51579 1532 820 610 355 ----
NM_014577chr223615 355 306 ------
NM_014586chr2184520 4055 3213 2959 1511 1428 1315 1028 14288 13686 --
NM_014616chr363080 2304 968 672 652 407 22343 1215 ----
NM_014682chr852207 2191 1877 804 275 1287 21479 1463 --
NM_014701chr1543088 2828 2731 834 --12982 1947
NM_014705chr751924 1731 689 522 441 --1465 11497
NM_014706chr12----1860 --
NM_014707chr762239 738 715 668 598 102 1783 ----
NM_014711chr1642056 1826 1820 280 1416 11577 --
NM_014717chr192636 244 1827 187 --
NM_014729chr872288 2234 2185 1922 1816 745 413 2822 714 ----
NM_014746chr263991 3189 2947 2663 1712 243 23572 3529 13758 --
NM_014747chr175665 5571 5518 5160 5048 4022 1260 44897 3817 2213 2146 13807 --
NM_014751chr862137 2099 1805 1469 447 201 32002 1788 301 ----
NM_014755chr293955 3816 3700 3169 2985 1717 774 660 327 33669 3278 374 13080 23132 728
NM_014765chr172629 2442 2294 1878 976 641 406 22599 1021 --12452
NM_014783chr154704 310 290 32 --11153 --
NM_014802chr122997 929 1941 ----
NM_014810chr1113694 3563 3430 3405 3345 3335 3284 3237 1462 867 237 23612 3135 33647 3515 3478 --
NM_014819chr542403 373 247 47 1168 32479 982 71 --
NM_014820chr372076 2060 1712 669 284 256 210 2676 425 ----
NM_014841chr63887 246 142 ------
NM_014849chr1--11310 1160 --
NM_014872chr941920 1575 691 416 2401 334 --1308
NM_014873chr194742 4711 4478 4391 3632 3096 1253 1144 743 34307 3025 722 21089 79 14435
NM_014877chr17106978 6908 5824 3079 2661 2648 1797 1790 1767 297 26425 1529 1881 26715 5476
NM_014887chr13----1161 --
NM_014892chr62440 35 1500 ----
NM_014893chrY42179 2125 787 646 4603 500 129 54 --1536
NM_014897chr1732514 2414 642 31304 826 675 ----
NM_014899chr543088 2297 647 226 22125 1248 ----
NM_014900chr2----1247 --
NM_014903chr1282431 2405 2322 2270 1901 1514 545 346 ------
NM_014906chr1793943 3875 3624 3290 2821 2678 1173 1095 132 33647 2577 203 --1568
NM_014912chr1083519 3449 3044 3027 2954 2741 669 202 22277 195 ----
NM_014924chr1422799 2708 ------
NM_014936chr622162 398 --22879 777 --
NM_014946chr252838 2702 326 300 181 2843 26 --1903
NM_014947chr1103075 2788 2764 2698 2187 1130 1050 964 331 48 12632 32943 2587 360 --
NM_014950chr1451462 1226 507 364 149 --1234 11195
NM_014951chr1052523 1951 1622 400 214 11790 1421 --
NM_014961chr432227 1429 398 153 11776 12086
NM_014962chr2032912 2127 79 1605 22869 2025 --
NM_014988chr442639 2423 2021 529 22174 405 --1414
NM_014989chr612062 11445 ----
NM_014990chr14----11226 --
NM_014991chr483175 2984 2700 2529 902 426 407 390 73221 3146 3114 2444 2049 1090 874 ----
NM_015000chr1272907 2371 2351 2151 938 770 423 ------
NM_015025chr221832 1751 2543 172 1321 --
NM_015032chr13102702 2664 2334 2280 1131 924 628 256 223 216 12722 1991 --
NM_015039chr163144 1537 1391 1109 252 147 24365 3815 ----
NM_015045chr1072250 2089 2077 1929 1562 1452 350 11689 1396 --
NM_015054chr12--3519 446 340 ----
NM_015057chr132661 627 ----1136
NM_015076chr664418 4021 2788 1538 149 86 11411 ----
NM_015090chr1105550 5506 5003 3919 1964 1445 1391 484 73 35 26224 1086 35484 4328 2035 --
NM_015092chr1663521 3469 3440 1411 1042 474 34184 4104 3787 ----
NM_015093chr661549 1539 715 610 575 385 ------
NM_015094chr2274655 3720 3712 3372 1257 929 438 23489 1530 23330 475 --
NM_015113chr1732405 2197 1937 12374 --1222
NM_015137chr841974 723 418 35 32167 1786 461 --1829
NM_015138chr1562848 2634 2272 1122 786 609 21905 726 12044 --
NM_015143chr4----11461 --
NM_015144chr1673905 3868 3382 1496 943 707 523 --21204 270 1572
NM_015147chr262914 2853 2654 2616 979 28 3529 394 85 --12997
NM_015155chr1053284 3166 651 328 72 12837 --13327
NM_015156chr1473759 3478 2941 2668 1495 979 837 13988 1994 12648
NM_015161chr1611446 --1592 11554
NM_015186chr91369 ----1404
NM_015192chr2062617 2459 2349 1987 986 513 12154 --1359
NM_015194chr1741722 1499 1398 366 11938 --22069 1303
NM_015199chr352970 2498 2459 849 737 1436 ----
NM_015206chr1552825 1467 956 586 228 53873 3455 3032 2665 2414 --43830 3673 1259 1124
NM_015215chr163189 3067 2646 2232 828 655 33123 3011 1264 ----
NM_015231chr114764 380 300 101 ------
NM_015236chr431087 1035 932 11487 ----
NM_015268chr31624 1613 --1578
NM_015271chr463543 3489 3335 899 325 291 21540 546 1603 --
NM_015272chr1641714 1659 1421 641 21956 1414 ----
NM_015288chr543240 2551 759 295 22405 1336 1551 12867
NM_015310chr8178397 7841 7141 7112 6669 6377 5832 5797 5624 5071 3269 3244 3219 3036 1724 1631 549 77378 6127 5912 5377 2906 1889 1813 38245 5533 1164 --
NM_015313chr1153147 1527 1320 941 88 23820 494 --1928
NM_015316chr1411208 11219 11374 --
NM_015317chr261155 1140 563 321 306 145 11927 ----
NM_015326chr122659 2392 12792 12774 12860
NM_015335chr1231802 1763 79 32398 2286 573 --22084 1669
NM_015336chr1222628 2165 42682 1860 935 880 --12123
NM_015344chr841953 1826 1338 491 --1537 1725
NM_015347chr1242755 1026 879 197 ----12967
NM_015349chr642374 2196 1946 454 42948 2924 2139 883 ----
NM_015423chr1121725 425 --11568 --
NM_015455chr593908 3317 2922 1552 1488 983 526 424 39 1584 13943 --
NM_015460chr331798 1788 480 --11888 --
NM_015534chr1----1758 --
NM_015550chr743503 3378 3368 2513 2933 671 13400 --
NM_015553chr664086 3261 2054 1724 1660 1378 2497 63 ----
NM_015564chr513098 --1283 --
NM_015565chr2142019 1828 703 188 22207 1413 12125 --
NM_015568chr2033978 3930 1363 23843 882 11216 14104
NM_015570chr761843 1837 1705 1660 525 473 61495 1411 437 398 353 128 ----
NM_015576chr362271 1878 1018 1000 666 267 --1992 12472
NM_015601chr102953 405 2911 115 --134
NM_015630chr241071 468 96 40 4383 187 162 67 1753 --
NM_015678chr1331738 1675 219 21684 471 ----
NM_015691chrX42058 1900 619 483 32769 2287 121 22465 95 --
NM_015872chr131804 489 408 1251 ----
NM_015878chr872160 2118 2071 1940 1835 782 373 21712 495 1460 --
NM_015885chr117754 638 554 322 283 276 180 --1224 1253
NM_015886chr8104971 4915 4424 3643 1616 1114 914 823 761 729 45117 4892 3809 541 35693 4215 1668 --
NM_015899chr12------190
NM_015904chr2------1552
NM_015906chr174741 4688 4404 3598 980 330 215 --23173 509 1948
NM_015912chr862280 2219 1864 1639 736 437 32438 2410 909 1459 --
NM_015914chr16185 ------
NM_015986chr1721072 422 11220 --11190
NM_015995chr15105526 4103 3654 3637 1778 1670 1519 1446 584 94 15503 12186 13581
NM_016057chr121304 --11299 11250
NM_016068chr7----1170 --
NM_016070chr171258 --186 --
NM_016071chr71217 ----1194
NM_016072chr1252409 849 752 623 527 ----1296
NM_016073chr1511138 11038 ----
NM_016075chr1362981 2365 378 324 124 118 12309 --22095 236
NM_016081chr442202 1519 727 664 21721 284 ----
NM_016120chrX41060 916 760 98 ----1934
NM_016123chr1231087 480 358 2488 459 ----
NM_016131chr241462 570 489 328 2666 59 ----
NM_016206chr378498 7918 7438 7328 3468 1677 236 68376 7020 3613 3450 1536 474 28326 8044 --
NM_016289chr251999 1423 656 525 373 1878 1566 11872
NM_016322chr973097 2539 2399 2323 2076 1020 983 21285 133 ----
NM_016356chr652902 2491 742 697 280 11090 ----
NM_016374chr121551 1475 11068 ----
NM_016376chr1723797 670 13924 11480 11591
NM_016396chr1523019 230 12556 ----
NM_016436chr2072577 2155 2108 919 894 839 348 22689 2417 ----
NM_016441chr231813 1789 440 12281 12192 1166
NM_016488chr1231956 1854 317 3475 303 68 1250 11982
NM_016529chr134842 788 450 382 21166 807 1176 1503
NM_016530chr1573999 3128 2850 2709 1155 872 765 43866 3149 2725 267 ----
NM_016531chr4124019 3569 3503 3430 3121 2741 1237 1045 861 805 508 301 13485 ----
NM_016575chr1295402 4715 4688 3963 3548 1651 1579 1303 1106 24474 742 ----
NM_016577chr383459 3106 1660 1630 1463 1435 1328 364 21779 1055 24208 3443 14495
NM_016628chr104330 264 225 44 2343 179 ----
NM_016631chr216907 759 309 295 283 69 187 2301 52 --
NM_016831chr131743 1549 719 32417 817 796 12287 --
NM_017415chr554195 4075 2925 2805 1786 24469 599 --14289
NM_017420chr1482914 2821 2726 1482 1269 638 371 109 23409 2876 ----
NM_017423chr452109 1908 1885 1798 821 11733 ----
NM_017540chr563035 2139 2036 1150 1066 50 --12266 198
NM_017548chr361983 1656 1556 1506 251 105 1499 --12172
NM_017551chr1022682 243 --1146 --
NM_017629chr161960 1820 642 586 506 445 --31941 602 255 --
NM_017633chr6103940 3679 3402 3260 3241 2390 960 688 597 115 33690 681 244 ----
NM_017634chr831780 1462 698 21738 30 ----
NM_017635chr1141379 1033 1005 214 1246 1176 --
NM_017637chr9189394 8493 7916 7809 7195 6735 6630 6537 5766 3664 3367 2948 2583 1810 1388 849 527 332 2558 412 18470 17050
NM_017641chr1261151 1071 1062 941 886 24 11019 ----
NM_017644chr364600 3717 3193 2009 1587 1413 1102 24760 3242 11294
NM_017650chr743808 2044 1566 1274 --26034 5290 --
NM_017651chr6----11308 --
NM_017658chr1484450 4250 4165 3955 1869 812 529 455 44678 3119 1802 1588 ----
NM_017709chr164241 3885 3628 2726 790 315 24264 1661 13936 --
NM_017741chr432540 1793 1011 --12379 --
NM_017776chrX41515 633 253 63 11302 --21092 262
NM_017799chr1431954 750 344 2631 188 --11897
NM_017813chr855667 5446 4432 1992 1302 23606 166 --12282
NM_017824chr1062228 1958 1805 514 474 292 21755 850 2941 308 --
NM_017851chr1521229 1195 ------
NM_017915chr1221018 887 1177 185 1815
NM_017919chr965776 5767 4532 4461 3779 3597 33544 1210 569 --14058
NM_017922chr142124 74 2616 478 ----
NM_017944chr1183065 2445 1975 1160 862 742 588 214 --1390 1234
NM_017983chr17184 ----1327
NM_017998chr941267 568 531 471 21437 498 1905 --
NM_018011chr13--1106 1631 --
NM_018013chr642513 2139 1112 987 --12743 1876
NM_018018chr1231824 1237 640 21367 152 ----
NM_018027chr1052719 2458 2330 823 763 33289 3214 3146 13028 23076 2086
NM_018084chr232620 1198 914 22630 598 22113 450 --
NM_018086chr251859 1677 1353 1215 102 1620 1273 --
NM_018098chr341214 490 412 397 2936 196 ----
NM_018121chr1042478 2434 1005 677 22725 835 1229 --
NM_018179chr121221 185 --1101
NM_018214chr641111 1098 866 257 2986 909 1453 --
NM_018222chr11--11917 ----
NM_018254chr132149 628 112 ----1477
NM_018279chr1212824 12983 --12662
NM_018287chr1041147 406 208 189 ------
NM_018318chr123972 901 263 2847 335 ----
NM_018321chr5----162 --
NM_018325chr91285 --11630 --
NM_018328chr21363 --1488 --
NM_018361chr853148 1162 1088 904 305 21479 603 1100 --
NM_018362chr1153215 3034 2497 1623 257 23993 788 1585 --
NM_018364chr164111 3778 3542 1492 1289 170 14072 11545 --
NM_018368chr61206 ----1246
NM_018373chr14136240 6050 5933 5468 5305 5273 4723 4181 2096 2057 1286 748 525 24577 2304 24867 991 15680
NM_018374chr744806 3796 1552 733 35249 4798 613 11997 12024
NM_018387chr94532 517 155 117 ------
NM_018388chrX21240 1151 ----11104
NM_018394chr33157 110 26 11318 --11167
NM_018403chr374106 4044 3703 3481 1082 646 473 23788 948 --11624
NM_018416chr1272155 2126 2096 2076 2019 1800 645 22401 149 --12393
NM_018439chr1852115 2003 990 762 638 22317 1770 179 --
NM_018465chr9------1241
NM_018482chr842365 625 315 151 31685 692 43 ----
NM_018489chr132295 2168 360 11911 1808 12025
NM_018566chr154944 3324 1980 1246 1134 13393 23795 174 --
NM_018638chr12115671 4931 4745 4297 4090 3735 2280 1948 1888 435 352 23747 231 ----
NM_018685chr721179 988 1161 1770 --
NM_018898chr532278 2079 696 31832 849 128 21793 543 --
NM_018945chr63954 916 798 ----1448
NM_018963chr212280 206 --11245 1410
NM_018976chr1252744 2719 2406 901 851 11893 22795 111 1139
NM_018993chr2021439 960 --11333 1308
NM_018999chr1084919 3877 3523 1753 837 791 495 177 64895 3395 3229 1230 645 425 13771 --
NM_019004chr762243 2099 954 898 653 544 22403 2266 ----
NM_019041chr6--12478 1524 --
NM_019063chr24671 537 492 281 11908 ----
NM_019072chr563965 3847 3602 1544 648 614 12649 14244 13823
NM_019084chr1042542 2507 916 69 ------
NM_019087chr511671 ----11372
NM_019091chr22857 254 3189 120 44 ----
NM_019094chr1282951 2701 2663 2521 1287 114 92 34 1816 --1179
NM_019116chr1663734 2963 2621 2492 983 413 23496 482 13282 --
NM_019555chr361615 1241 1188 567 420 180 21505 622 31247 1201 610 11270
NM_019556chrX61486 1472 1345 1198 261 124 31390 1232 172 11453 --
NM_019610chr131607 778 705 32090 602 487 ----
NM_019884chr19----1375 --
NM_020066chr16941 778 713 671 272 186 21033 231 1818 --
NM_020116chr421556 251 11422 ----
NM_020122chr254072 4051 2372 1299 212 32125 2037 248 --23761 1145
NM_020137chrX----1427 --
NM_020177chr553084 2917 2669 2254 1018 --12266 --
NM_020182chr2073231 3107 3032 803 750 559 437 1191 ----
NM_020228chr1111653 22323 1619 --12555
NM_020336chr2053704 3681 2966 852 719 182 23722 1459 --
NM_020337chr473167 2913 2869 2814 2690 994 257 12949 1863 --
NM_020338chr1053558 3445 3029 2708 2592 13099 12549 11140
NM_020341chr2022050 1924 31884 1708 84 ----
NM_020346chr1161601 1567 1328 164 93 85 4398 364 173 123 ----
NM_020383chr10--131 ----
NM_020390chr364541 3739 978 970 148 48 34712 4175 3038 ----
NM_020403chr1331617 532 441 --21380 240 --
NM_020416chr482385 1945 1055 595 589 119 78 42 ----11737
NM_020424chr165783 332 143 55 26 ------
NM_020432chr741433 1412 606 139 12215 ----
NM_020440chr142972 2757 2704 805 23241 1119 23182 963 12179
NM_020443chr146448 5786 4341 1470 1556 --26673 2326
NM_020466chr623175 1448 31934 1707 711 1277 --
NM_020530chr221727 1782 21024 746 --
NM_020640chr342126 1791 1550 442 12064 ----
NM_020666chr5190 --1121 --
NM_020673chr20117654 7542 6015 4887 2571 2453 2048 933 881 330 199 --27769 2084 27159 118
NM_020696chr31239 --1276 --
NM_020698chr1262812 2175 1056 883 738 105 --22064 131 --
NM_020699chr175418 4846 4102 3308 1415 508 469 21245 939 --13658
NM_020704chr721863 1796 1792 32110 596 134 --
NM_020708chr2082358 2291 2275 2243 2182 2079 913 876 ----11940
NM_020718chr16135946 5072 4766 4470 4458 4263 4168 4031 1724 1326 541 167 32 16066 11255 --
NM_020747chr52658 130 1902 ----
NM_020748chr1752142 2033 591 525 415 21594 1494 22046 510 1720
NM_020752chr1062915 2723 2653 2522 574 360 12609 ----
NM_020772chr17106997 5520 5484 2938 2256 1885 1769 1130 1002 307 36834 6602 803 28282 7080 11346
NM_020774chr18115499 5469 5017 4748 4293 1937 1829 1571 935 316 136 35171 3966 964 ----
NM_020796chr532878 2575 2081 52887 2498 1909 999 457 ----
NM_020800chr311145 31514 388 149 --1137
NM_020801chr522484 288 ----21926 1716
NM_020805chr1831908 1586 1495 21551 290 11934 --
NM_020810chr1412782 22946 2219 --12345
NM_020813chr1952392 2271 1809 1790 256 --31820 897 312 --
NM_020858chr1532410 2353 821 21813 1578 22374 2241 12078
NM_020860chr441033 907 798 43 21143 364 ----
NM_020871chrX42575 2009 688 592 ----12175
NM_020909chr244067 3632 3173 2665 11639 --14042
NM_020921chr1463642 3626 2447 2349 1363 917 13343 --1345
NM_020927chr164921 855 626 289 11573 12231 --
NM_020940chr1032508 487 119 22903 2236 12635 --
NM_020960chr975015 4943 4848 4749 4452 3751 393 14886 --35024 3090 1898
NM_020964chr1894834 4721 4517 4046 3422 1866 1098 367 130 11786 2743 274 1566
NM_021025chr5----1332 --
NM_021033chr1333493 2246 2201 52149 920 657 86 77 ----
NM_021038chr32940 362 33119 2579 1083 12381 --
NM_021072chr532257 1761 714 32032 914 147 ----
NM_021097chr232415 873 425 12261 --22872 740
NM_021140chrX11055 --1785 --
NM_021183chrX32380 1807 606 52495 944 547 481 98 ----
NM_021190chr11176 21339 980 1915 1417
NM_021201chr1131889 1342 589 ------
NM_021215chr2052031 1849 994 596 220 11717 1801 --
NM_021239chr1441477 942 302 177 2485 334 --1549
NM_021784chr203620 493 100 ----1413
NM_021813chr6125876 5763 5388 5317 4763 4632 4360 4244 4076 3665 1343 826 55654 4992 2008 1716 485 25118 4549 25780 4618
NM_021818chr1441403 1395 1292 67 ------
NM_021914chr1442424 2382 1958 322 21582 890 ----
NM_021935chr33207 146 49 ----1997
NM_021954chr131796 1958 33592 3429 1218 --
NM_021956chr62978 515 21163 553 --21451 94
NM_021961chr11137404 7337 6803 6675 6212 2845 2262 1019 898 472 318 264 94 67265 7064 5808 2892 1672 223 37237 6573 5969 45494 4826 4544 1906
NM_021963chrX2670 662 1772 ----
NM_021964chr366415 5915 5331 5082 2290 781 56172 6042 5641 4064 1072 173 --
NM_021974chr22----163 --
NM_021978chr11----1513 --
NM_021979chr145445 439 421 142 125 ------
NM_021998chrX31428 1121 242 11447 ----
NM_022041chr1672540 1987 1796 1032 641 407 23 32565 2364 301 ----
NM_022058chr251681 703 336 222 176 1298 12034 --
NM_022085chr61208 1508 1227 --
NM_022114chr1114621 4358 4279 3413 3024 2956 945 745 583 530 464 13530 11825 --
NM_022130chr531271 1083 557 11387 ----
NM_022133chr8--191 ----
NM_022150chr71498 1163 --1511
NM_022166chr16125938 5443 4801 4715 4371 2505 2063 2034 1890 781 514 425 46338 6248 6160 3935 ----
NM_022351chr883461 3313 3226 3215 1519 825 406 389 --13792 139
NM_022459chr1375905 5296 4444 2204 1496 788 40 12140 1276 24555 1557
NM_022473chr1594430 4055 3445 2784 1658 1356 849 696 525 14365 12777 --
NM_022497chr353849 3668 3318 2950 514 11479 --1150
NM_022756chr11409 11455 --11482
NM_022763chr363138 3071 2099 737 402 318 1169 ----
NM_022780chr211183 --11851 --
NM_022781chr953271 2218 874 784 456 22155 296 12479 --
NM_022824chr531751 1595 162 11932 ----
NM_022826chr2--11199 ----
NM_022831chr141245 1155 254 141 ------
NM_022832chr452385 2369 2206 2180 1861 --32420 512 490 12061
NM_022843chr1341363 596 530 127 ------
NM_022893chr252857 2812 2607 1042 323 22870 2121 12422 11051
NM_022897chr5----1185 --
NM_022898chr14124449 4116 3953 3878 3653 3235 3069 1219 467 264 218 155 23829 1647 ----
NM_022912chr272334 1147 905 549 449 443 170 33016 2057 587 ----
NM_022918chr1132052 572 300 31938 1931 1334 ----
NM_023004chr22------1259
NM_023016chr262888 2499 2228 416 341 26 22880 533 12047 12179
NM_023076chr1642763 1054 391 251 --22138 628 11866
NM_023915chr3----142 --
NM_024007chr582696 2367 2112 985 957 187 159 126 23143 3128 3662 618 399 --
NM_024016chr17------1329
NM_024037chr1--1957 1146 --
NM_024295chr832095 2082 2052 21654 238 1230 --
NM_024297chr171568 ------
NM_024337chr51301 --199 --
NM_024491chr32660 194 192 130 --
NM_024511chr453220 2353 2143 1379 262 1957 12964 --
NM_024524chr333182 2566 2553 ------
NM_024539chrX41262 1218 949 459 2840 448 ----
NM_024551chr1272237 2165 2080 2038 1871 576 478 1278 12354 --
NM_024590chr441570 1444 785 203 --11911 11309
NM_024613chr831376 607 212 11157 ----
NM_024636chr742082 899 759 218 42243 847 469 335 1958 --
NM_024645chr821427 393 11595 11051 11564
NM_024665chr324516 3468 14441 14448 23260 3241
NM_024680chr112500 100 ------
NM_024692chr221292 384 21508 1224 21272 46 --
NM_024721chr852118 1991 964 397 191 11675 ----
NM_024814chr7--1279 --1378
NM_024835chr17--1364 --1399
NM_024852chr1--1449 ----
NM_024920chr421067 326 ----1541
NM_024949chr463573 1275 944 491 182 167 34863 3197 289 ----
NM_024989chr2107965 7778 6543 5224 2759 2229 1354 1299 741 357 25534 617 27844 2274 --
NM_025054chr874161 2640 1152 988 777 504 434 84059 4013 3898 3786 3401 3088 1312 763 14182 1601
NM_025133chr2--1778 1220 --
NM_025134chr1632244 1030 65 21597 929 22258 133 1223
NM_025138chr131186 11363 11035 --
NM_025145chr10------1196
NM_025235chr1041943 1641 1527 405 1398 12187 --
NM_025237chr1731258 503 104 21503 553 ----
NM_025244chr2------1235
NM_030571chr521631 1011 31254 192 90 --2544 172
NM_030625chr102606 38 42121 1794 1731 366 11674 21605 558
NM_030627chr5104093 3557 3459 3438 3400 3155 2780 2652 1207 182 43241 3234 3125 762 21252 1242 --
NM_030640chr122878 67 ----1127
NM_030647chr765332 4575 2087 1061 789 53 45467 5371 5211 4942 11892 --
NM_030762chr1221960 119 2268 254 --12022
NM_030790chr16----1319 --
NM_030806chr1119063 8960 8560 7547 7119 5899 3027 1928 688 169 73 48976 7971 2876 1517 38923 1621 42 22320 827
NM_030885chr33670 419 91 ----1246
NM_030918chr135432 3508 516 34366 3661 1202 13500 180
NM_030920chr162102 1967 1872 709 105 42 11598 ----
NM_030939chr611022 2974 763 --1882
NM_031217chr111509 --1482 --
NM_031418chr1152331 907 729 350 304 12323 ----
NM_031435chr1222605 1285 33116 703 582 --12927
NM_031442chrX32730 1188 229 ----11154
NM_031445chr232106 1100 625 --33411 3346 909 --
NM_031483chr2072896 2630 2474 629 347 192 118 181 1432 --
NM_031937chr22------1341
NM_031942chr231116 885 811 152 11175 --
NM_031953chr4138 --1416 --
NM_032042chr552833 2247 2034 598 170 --12262 11844
NM_032117chr4146 ------
NM_032142chr18----122 --
NM_032144chr251505 1437 1416 1356 432 ------
NM_032153chr352701 2687 2312 2134 1736 12361 31747 947 154 --
NM_032172chr72998 664 21014 241 --1371
NM_032199chr1033591 2823 2793 --1855 --
NM_032208chr273336 2437 2386 705 685 610 340 32646 551 272 12349 13316
NM_032228chr1162688 2635 2528 2393 384 313 163 33181 2463 1021 --
NM_032229chr135925 869 813 230 63 ------
NM_032239chr4--3965 592 224 ----
NM_032291chr181985 1779 1251 679 662 333 241 200 21821 1338 1688 1720
NM_032373chr1075688 5496 1953 1256 927 761 117 25739 1617 35173 543 242 --
NM_032410chr831205 1157 260 ------
NM_032434chr21103 --1139 --
NM_032440chr1052594 2422 432 189 114 11033 ----
NM_032456chr45667 541 461 148 29 1553 ----
NM_032457chr483925 3895 3599 2931 1533 1510 1326 313 12654 ----
NM_032458chrX73293 2843 2833 2465 2430 1088 726 12534 ----
NM_032520chr161174 ----1201
NM_032521chr2062541 1295 1287 949 924 123 22835 2674 1345 --
NM_032547chr431359 1308 1111 2999 472 1198 --
NM_032558chr931261 253 243 --11300 --
NM_032582chr1741834 1560 1368 244 --21904 497 --
NM_032682chr363145 2542 1446 1363 395 293 33218 2879 1241 ----
NM_032784chr63881 776 375 ------
NM_032804chr1031906 792 775 2986 926 --12400
NM_032826chr734952 4599 592 1649 25407 1302 24701 119
NM_032859chr1393815 2769 1476 1411 602 556 497 341 296 33195 2755 2615 --145
NM_032873chr1194441 4114 4008 4002 3686 3530 1385 980 962 23216 783 1158 21427 356
NM_032932chr1755505 1956 1732 240 101 52289 2244 1909 1417 299 36461 5739 613 --
NM_032961chr42553 108 ----21047 200
NM_032968chrX83799 3260 3217 1209 722 311 107 95 23749 2823 31638 789 551 --
NM_032973chrY83791 3255 3212 1209 722 311 107 95 23741 2818 2789 551 --
NM_033030chr211470 ------
NM_033081chr202936 294 21351 1091 1136 --
NM_033121chr1251843 735 414 370 137 ----1146
NM_033132chr1331927 939 539 2809 603 ----
NM_033211chr541828 1411 1275 214 1644 ----
NM_033224chr7128042 7756 7574 7461 5787 4886 2913 2736 2457 2450 2059 222 98104 7929 6405 6335 6197 3027 2957 2275 1916 17436 --
NM_033225chr853173 3159 2767 2518 141 53041 2943 2756 1043 1022 22406 2152 22898 2255
NM_033274chr573363 3047 2538 1433 388 227 50 43568 2472 2450 362 12781 --
NM_033285chr873866 3758 3736 3024 2942 1369 778 12933 1710 --
NM_033389chr1774407 4180 3747 3331 1763 616 58 43576 1933 902 45 14854 --
NM_033407chr1131 1592 --1620
NM_033515chr621170 1100 --168 --
NM_033546chr18----1197 --
NM_033656chr2176002 4976 4291 3729 1075 1002 475 11980 --15994
NM_052832chr842649 2508 2238 2081 2386 219 ----
NM_052879chr1253060 1645 1575 495 287 32862 682 416 --13080
NM_052896chr162451 2401 2072 1926 1668 238 --12351 2581 562
NM_052906chr22104849 4018 3627 3439 2007 957 766 468 296 125 14065 13892 --
NM_052907chr1243949 3901 3810 1052 14015 1267 --
NM_053002chr321211 778 ----11085
NM_054111chr6----1915 --
NM_078483chr543806 2598 1636 1576 23907 967 11482 13345
NM_080867chr1434043 3614 337 45119 4604 757 406 --34841 4723 4214
NM_080872chr873826 3734 3660 3198 3180 2726 896 22888 453 ----
NM_080927chr332757 2651 920 23294 3017 1795 --
NM_133264chr1743682 3457 3234 1075 22803 2614 ----
NM_133369chr51988 ------
NM_133494chr1125 ------
NM_133496chr183838 3815 3797 2762 1754 1223 727 566 34231 4017 1019 ----
NM_133646chr244587 3476 1869 894 ----15194
NM_138286chr1983173 1653 1160 747 595 551 467 431 43689 3651 3392 974 23926 1752 12783
NM_138357chr1041702 1459 493 326 ----11797
NM_138371chr12------1268
NM_138423chr1541473 461 104 82 21964 41 --11710
NM_138426chr722307 870 2446 200 ----
NM_138459chr622686 776 12857 12697 23436 1119
NM_138694chr693731 3448 3437 3399 3200 1434 1121 931 301 23411 696 ----
NM_138731chr1454283 3978 1672 1621 648 14100 22771 72 --
NM_138782chr582385 2356 2261 905 645 621 319 198 1537 --12159
NM_138799chr261565 1501 672 610 480 435 ------
NM_138927chr212762 224 1267 --1253
NM_139169chr1031621 632 593 162 155 --
NM_139321chr2044054 4034 2811 634 34131 3525 874 13344 1350
NM_144571chr496284 5833 4812 2466 2410 2036 1901 1804 57 26305 2694 11044 16768
NM_144628chr2052240 2019 1087 909 769 12487 12253 --
NM_144720chr4----130 --
NM_144778chr1332228 1050 1015 1348 12687 --
NM_144973chr1294218 3650 3262 1451 1058 887 840 382 372 24026 1147 1223 --
NM_144979chr43503 186 59 1460 136 --
NM_144982chr125697 685 641 517 98 ------
NM_145206chr1062670 2630 2540 894 789 535 22275 853 1142 1152
NM_145251chr1441534 1031 362 280 175 ----
NM_145332chr64898 740 677 182 195 ----
NM_145808chr772949 2709 2692 2183 2031 1907 422 33136 2911 1243 ----
NM_147156chr1021445 1324 21384 553 --21185 585
NM_152271chr841083 842 467 151 11131 1984 --
NM_152275chr22383 182 12150 ----
NM_152280chr192937 2558 2488 2352 667 504 277 203 163 33501 2687 782 ----
NM_152281chr11952 --1960 --
NM_152381chr231651 1483 82 31831 235 170 21930 731 2648 224
NM_152409chr533073 2692 219 21439 1350 --13608
NM_152470chr1874141 4089 4050 3482 1434 1112 115 11092 23503 3377 --
NM_152581chrX1563 21367 1011 2322 249 --
NM_152605chr1921100 299 1309 3969 226 131 1549
NM_152621chr4----1125 --
NM_152622chr583105 2977 2802 901 761 557 235 32 32450 2305 1399 32325 665 416 --
NM_152638chr122954 115 ------
NM_152641chr12112692 2654 2531 2387 2215 1130 1067 1015 819 802 617 32569 1931 343 1790 --
NM_152660chr13342 135 87 1667 --1351
NM_152705chr13----1191 11361
NM_152744chr732841 999 261 --22899 2521 13517
NM_152756chr573880 3282 2655 1485 1445 1281 1237 33969 350 263 13982 --
NM_152758chr852862 2141 2054 620 304 12261 ----
NM_152765chr83770 579 399 --21499 377 --
NM_152774chr742028 787 741 522 --3952 671 366 --
NM_152787chrX63820 3545 3126 2782 893 383 43961 3768 2984 2904 ----
NM_152835chr122742 394 22038 743 1211 --
NM_153020chr61669 11171 11670 --
NM_153042chr621310 142 11543 --11834
NM_153207chr1273877 2939 2746 2644 1442 1090 1032 21473 559 1160 13397
NM_153234chr542101 810 766 525 --168 --
NM_153256chr1011611 --1305 --
NM_153261chr1691577 1295 1134 338 328 252 240 132 100 ------
NM_153262chr132475 1274 722 23023 1246 1600 --
NM_153487chr674025 3711 1702 1641 1407 291 140 --23449 1388 13945
NM_153607chr552833 2452 2268 99 60 12984 1573 --
NM_153689chr23493 154 147 11662 1590 --
NM_153690chr3--1818 --2805 714
NM_153812chr152331 2273 2136 422 254 1727 ----
NM_170665chr1274536 4455 3026 1260 1134 1056 236 54171 4100 3860 3020 1126 24384 1639 1675
NM_172037chr851382 1335 1280 1097 464 --21212 146 --
NM_172127chr41409 --1663 --
NM_172193chr1431118 191 173 21091 215 21349 1264 --
NM_172373chr1351216 1173 395 330 61 1424 ----
NM_173172chr221611 109 21138 97 ----
NM_173468chr455985 5885 5357 4914 568 45366 858 766 286 25740 21 1412
NM_173470chrX62690 1798 746 687 619 177 3804 719 260 ----
NM_173500chr1521325 1212 2111 83 ----
NM_173502chr16----1207 --
NM_173511chr253813 3583 2608 1453 1104 23658 397 --13464
NM_173576chr1021544 592 21745 1431 --1805
NM_173582chr1132289 779 604 ----25078 2222
NM_173602chr1243682 2697 1021 678 23456 532 22404 1491 --
NM_173822chr24692 511 280 212 ----161
NM_173825chr32576 298 43106 2803 489 232 1244 --
NM_173851chr853644 3330 1406 991 116 1815 ----
NM_174916chr1552365 1984 964 883 769 42358 935 827 455 ----
NM_175056chr321355 807 12188 12119 --
NM_175061chr722184 613 --1864 11848
NM_175571chr7----11567 --
NM_175607chr341739 1345 524 445 31595 1083 354 11665 11485
NM_175747chr62441 357 1879 1781 1431
NM_175854chr1352624 2413 779 530 369 21772 423 12132 --
NM_175884chr71409 --11055 --
NM_177968chr22857 783 11582 ----
NM_178011chr1083053 2483 2220 2192 2173 917 323 206 33232 2155 288 12250 21064 530
NM_178140chr582745 2677 2643 2097 721 658 637 164 12513 11889 --
NM_178167chr16----1407 --
NM_178812chr831223 1152 35 --1518 --
NM_178839chr21339 ----1303
NM_178868chr31301 2348 53 ----
NM_181354chr831598 1271 89 11189 ----
NM_181358chr154063 3953 3755 3113 1525 54085 3635 1177 911 623 --14158
NM_181504chr532592 1370 309 32537 295 101 ----
NM_181521chr16157305 6694 6423 6398 6386 5386 4564 2771 2477 2283 2142 1803 1453 957 749 12109 --26286 1492
NM_181670chr12--31020 503 470 ----
NM_181704chr2181284 1199 451 337 296 195 188 180 --1319 --
NM_181704chr2181284 1199 451 337 296 195 188 180 --1319 --
NM_181705chr595684 5162 5062 4355 3822 3669 2290 1038 78 43682 3597 1025 885 ----
NM_181714chr661587 797 777 727 676 33 11607 ----
NM_181723chr822293 1759 1926 ----
NM_181784chr222235 944 1695 22630 1735 12525
NM_182485chr4133464 3120 3025 2996 2942 1065 1033 1003 959 935 806 675 269 31264 526 81 22981 623 --
NM_182503chr685488 4693 4278 3901 2083 1551 1163 186 24742 950 ----
NM_182664chr132341 1593 399 12423 11609 163
NM_182700chr761853 1844 1351 1336 714 168 11256 11525 --
NM_182717chr1011048 41067 605 303 220 ----
NM_182765chr1052055 1794 1669 550 472 ------
NM_182767chr122716 204 1527 --2658 193
NM_182830chr1451688 1650 1496 437 65 32019 1963 1431 11772 1889
NM_194071chr775473 4403 1911 1392 728 598 336 ----1201
NM_194247chr263712 3053 2795 531 335 220 43561 2924 213 112 24288 886 --
NM_194250chr24415 310 161 152 ------
NM_194272chr152955 763 11098 ----
NM_194282chr452803 2051 992 413 52 63108 2447 2385 2330 2035 886 --11961
NM_194292chr151721 1584 1431 1405 1222 ----11668
NM_194314chr133752 3498 1465 --11458 15510
NM_194317chr232749 2731 2418 11875 22633 2388 1607
NM_198077chr1----1400 --
NM_198270chrX73510 3391 3318 3293 3203 2294 453 --1481 --
NM_198404chr132243 150 ------
NM_198465chrX62720 2503 2232 2077 1070 705 21144 1026 ----
NM_198467chr72517 190 --2597 412 --
NM_198581chr2117507 6252 6133 5190 4899 4891 3023 2259 2050 1792 252 1469 1564 --
NM_198859chr3125157 4170 3917 3516 2013 1797 1372 1305 782 426 415 48 25116 4190 ----
NM_198935chr2023247 2160 32797 2408 1159 ----
NM_198991chr182551 76 2243 23 --1197
NM_199000chr782275 2249 2132 2058 1940 841 573 356 22308 332 ----
NM_199181chr20----1274 --
NM_199320chr432572 2321 1844 --1554 12140
NM_201613chr12------2262 197
NM_203394chr1242679 1826 690 71 32395 2153 921 --1512
NM_203406chr572940 2924 2212 1983 713 612 453 1977 ----
NM_203459chr152340 2164 2145 671 148 42572 2113 1953 587 --1171
NM_203463chr293099 1921 1846 1783 997 916 719 276 68 --11003 21529 437
NM_206853chr644130 3959 3807 516 43717 2721 1192 426 --24027 3990
NM_207015chr341757 661 212 150 1396 ----
NM_207111chr712791 12101 --12757
NM_207303chr1043090 621 592 472 13600 --14118
NM_207321chr105957 938 895 391 270 ------
NM_207406chr466313 4617 4511 4466 2197 566 24766 4759 14373 25666 4722
NM_207413chr8--276 69 1344 --
NM_207429chr1172563 2226 2086 2074 1004 438 113 ------
NM_212554chr1021203 323 11627 1175 --
NM_212558chr974046 3593 3482 1047 788 346 154 1284 23796 1701 --
NM_213589chr274780 4416 4274 4018 1613 1363 634 34883 4288 1621 25546 5354 --