TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5571-5p
miRNA Sequence: CAAUUCUCAAAGGAGCCUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX136787 5980 5964 5758 5740 5682 4850 2478 2402 1991 1852 1720 1225 11385 46357 5499 5336 4968 --
NM_000208chr19164800 4166 4064 4050 3681 3532 3100 1896 1668 1517 1183 1000 992 533 267 82 --3708 460 191 --
NM_000259chr15116030 5979 5109 4795 4445 4289 4101 3879 1234 424 256 46298 2036 1033 835 44987 1890 1562 1354 15056
NM_000332chr696971 6089 5439 4833 4783 1472 1434 1411 1278 45337 2715 1081 139 45050 4799 1791 1767 14719
NM_000337chr5146144 5919 5854 5768 4941 4456 4397 1963 1489 1219 1177 651 583 445 14008 ----
NM_000555chrX127237 6895 6815 5790 5474 5322 3115 1940 1352 677 647 637 --1893 --
NM_000618chr12105781 5209 4765 4342 4042 4002 1982 1425 1161 759 26238 5245 16254 11708
NM_000618chr12105781 5209 4765 4342 4042 4002 1982 1425 1161 759 26238 5245 16254 11708
NM_000719chr12136725 6586 6140 5573 5439 5287 4897 2612 2202 2158 1360 1159 1097 15086 25527 953 --
NM_000793chr14154998 4953 4841 4744 4675 4109 3671 3628 2047 1418 853 765 743 674 602 23948 3798 ----
NM_000809chr4189173 8331 7708 7578 7548 7330 6809 6800 6137 2985 2729 2371 1314 1230 1118 1001 464 400 59246 9122 9072 7281 2361 11464 1149
NM_000813chr594462 4217 1731 1613 1155 1134 610 553 294 35540 4663 731 1973 25516 1332
NM_001001419chr5114638 4502 4224 4185 3756 3530 3368 3333 3253 1830 1114 12019 34948 4154 3992 --
NM_001001420chr5114638 4502 4224 4185 3756 3530 3368 3333 3253 1830 1114 12019 34948 4154 3992 --
NM_001001664chr273854 3355 768 298 88 61 31 13303 --1904
NM_001001928chr2297871 7412 6286 5431 1996 1830 1790 1432 1156 38317 5695 2206 42132 1650 781 571 --
NM_001002233chr822007 716 31793 734 725 ----
NM_001003652chr18128141 7507 7427 7038 6823 6410 3131 2913 2040 1909 1287 849 26079 996 ----
NM_001004317chr673008 1774 1525 1343 806 380 200 12873 1273 34067 1102 1038
NM_001005473chr5146418 6277 6204 6118 5901 5228 4364 2468 2244 1916 1827 410 289 109 35059 2620 2389 16425 --
NM_001007023chr14154998 4953 4841 4744 4675 4109 3671 3628 2047 1418 853 765 743 674 602 23948 3798 ----
NM_001007278chr13125265 5069 4897 3907 3235 1891 1748 1630 1515 903 56 49 ----21086 829
NM_001009960chr782605 2341 2130 2091 2027 585 484 322 12762 2311 59 --
NM_001010891chr596884 6345 4916 4605 4303 2521 2241 695 204 35352 4666 1905 26580 2374 --
NM_001010986chrX62318 2207 607 324 216 89 21878 184 --11784
NM_001011513chr492872 2599 1585 1453 1126 716 466 297 31 1416 21480 480 --
NM_001013659chr1995158 4825 4575 4427 3713 3578 3412 3309 1967 --31504 350 34 --
NM_001014797chr10148100 7989 7047 6750 6145 6104 5827 5795 5496 5404 5078 2087 528 244 26173 1902 16922 --
NM_001017440chr7177155 6943 6379 6155 6104 5513 3005 2995 2750 2620 2567 2486 2008 2002 1571 319 254 27183 1468 27504 5103 --
NM_001018067chr1105105 4666 4649 3972 1418 1397 1354 1096 379 71 23865 1567 --14549
NM_001018068chr1105105 4666 4649 3972 1418 1397 1354 1096 379 71 23865 1567 --14549
NM_001018069chr1105105 4666 4649 3972 1418 1397 1354 1096 379 71 23865 1567 --14549
NM_001024647chr12107107 5960 5842 5577 2917 2796 2778 2264 1098 204 22146 1906 25886 2278 --
NM_001025077chr1087310 5017 4745 3045 2248 2215 988 581 24622 679 34585 432 352 14964
NM_001031695chr2285288 3631 2158 2128 1995 1210 902 558 33329 682 403 12174 2968 582
NM_001033045chr273447 3248 2789 1113 793 540 314 13782 13633 12771
NM_001037165chr7138775 7980 7644 7522 7402 7170 6643 6415 6294 5504 2740 599 524 --47773 6307 656 231 --
NM_001039547chr3167566 7330 7305 6704 6502 5393 5277 5166 3060 2402 1311 1188 1063 1045 939 478 37981 5323 2881 35671 2244 1393 --
NM_001039590chrX63688 2966 1604 1454 1149 1001 33521 3264 2867 43778 1312 898 125 --
NM_001039591chrX63688 2966 1604 1454 1149 1001 33521 3264 2867 43778 1312 898 125 --
NM_001039840chrX115787 5748 5324 4657 4369 4090 2148 2142 2030 1325 745 15417 25808 4651 --
NM_001040284chr16155708 5090 4982 4904 4766 3932 3868 3665 2274 1908 1463 1325 1139 382 332 34290 610 324 --1861
NM_001042355chr16115064 4488 4036 3782 3770 3422 3408 3335 1961 802 348 1866 12008 1684
NM_001042412chr16115064 4488 4036 3782 3770 3422 3408 3335 1961 802 348 1866 12008 1684
NM_001042494chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_001042495chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_001042496chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_001042497chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_001042599chr2167730 7645 7085 6456 5776 5710 4773 3072 3044 2265 1384 1364 1014 751 524 245 15004 ----
NM_001042601chr362682 2597 2568 2343 1210 1197 21237 920 13058 --
NM_001100108chr1177532 7224 6949 6692 6664 6238 5602 5373 3274 2595 2287 1944 1884 1645 1272 1134 449 17198 12435 12046
NM_001106chr3148943 8491 8407 8265 7000 6816 6729 6624 6445 6355 3359 1467 744 615 39340 6515 1420 11075 --
NM_001167chrX115367 5023 4713 4410 4209 2598 1724 1191 896 500 84 44679 2514 1987 393 26203 2176 --
NM_001204chr2167633 7339 6834 6710 6577 6528 5958 5631 5578 5013 4764 2224 1966 989 853 700 55413 2803 2271 1940 260 --15485
NM_001460chr182948 2254 1337 1271 1114 1021 706 103 4511 350 341 306 ----
NM_001609chr1074496 4013 3644 1593 1254 825 91 54234 4088 3407 3128 3088 22870 1662 --
NM_001695chr8102829 2693 1660 1595 1382 758 622 515 352 238 11328 24282 997 1582
NM_001821chr184227 1921 1593 1005 909 899 676 52 33679 3581 247 11086 21814 1734
NM_002006chr495385 4866 3957 3848 1973 1361 743 487 71 14772 --14130
NM_002025chrX138968 8855 7290 6059 5740 5719 5646 5630 3065 2563 2507 968 899 13024 58148 7860 2920 2360 500 --
NM_002214chr795521 4913 4798 3769 3724 3459 1127 1103 37 13474 21801 359 --
NM_002336chr12114735 3929 3912 3357 1850 1843 1527 1512 1226 817 141 44403 3642 3413 1003 --24508 1472
NM_002837chr1274508 3964 3743 3650 2813 715 130 54025 3313 3178 552 529 14240 11405
NM_003034chr12137874 7796 6377 2025 1970 1963 1907 1663 1373 1240 732 623 71 36806 5426 3196 25843 5548 17263
NM_003099chr15156418 6180 6124 5369 5202 5195 4847 4536 4517 4499 2329 1911 443 323 200 36081 4773 245 14233 11997
NM_003108chr2127279 7160 6972 6898 6421 6296 5844 5548 5339 4883 4859 776 11115 25800 1704 17294
NM_003144chr682267 2182 2043 1914 1769 1740 605 540 --1834 169
NM_003298chr3116116 4863 4314 3777 2243 2209 1997 1961 1430 1159 342 22093 384 24426 4159 --
NM_003411chrY41478 1470 1455 1127 21674 118 --11375
NM_003574chr18185788 5595 5563 5491 5357 5261 4591 4224 3739 1908 1895 1120 932 849 504 310 302 273 15632 ----
NM_003663chr352957 2553 2320 697 441 22116 426 1681 1864
NM_003671chr9103252 2705 2618 2343 2287 1130 710 661 361 355 12477 ----
NM_004171chr11169277 8765 8283 8265 7516 7286 7260 6165 6105 5819 2748 2643 2460 2312 1577 266 47431 7119 6507 808 26685 539 --
NM_004331chr832186 231 218 22586 1020 32526 2298 1008 --
NM_004392chr1352564 2105 865 565 210 52151 1918 761 417 287 1483 --
NM_004412chr10125708 4861 4855 2073 2057 1890 1556 1481 1352 1231 220 54 21184 926 13743 --
NM_004464chr494152 4108 3858 3541 3368 3062 824 182 67 23749 799 23463 1257 --
NM_004501chr1103828 3672 3402 2890 2561 1055 578 366 340 229 --23497 3019 --
NM_004622chr252065 1829 1747 195 146 12179 11842 22119 537
NM_004734chr1362776 2503 1317 1025 1006 449 --42999 744 475 461 --
NM_004745chr8116893 6649 6469 6419 5916 4382 1776 1412 1143 1108 753 25239 5001 --14927
NM_004748chr1584074 3761 3682 3248 2960 1090 1012 68 12885 3940 915 93 --
NM_004857chr14134132 4072 3958 3439 3320 2966 2947 2925 1241 1178 1116 1002 47 11193 1826 --
NM_004866chr5134751 4397 4291 4090 3812 3635 3566 3446 1960 1402 704 662 369 23495 625 ----
NM_004956chr764376 4149 3852 3432 3416 607 24063 924 24326 64 --
NM_004999chr694523 4020 3788 3280 2745 1474 1376 1135 580 21796 98 13209 --
NM_005036chr2297871 7412 6286 5431 1996 1830 1790 1432 1156 38317 5695 2206 42132 1650 781 571 --
NM_005063chr1083730 3692 3536 3082 1048 916 891 755 11178 --23059 556
NM_005065chr14104982 4386 3702 3681 1500 1274 1237 1049 924 818 11676 --11616
NM_005135chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_005156chr9114206 3921 2071 1833 1656 1641 1391 1278 1166 1089 704 21404 1023 --1307
NM_005160chr22106064 5935 5554 5325 4139 2024 1831 621 322 69 45216 5188 2660 1491 24265 1448 --
NM_005197chr14105881 4488 4301 4189 4007 3853 1440 1180 578 191 12083 14877 11819
NM_005235chr2167730 7645 7085 6456 5776 5710 4773 3072 3044 2265 1384 1364 1014 751 524 245 15004 ----
NM_005339chr473375 2985 2865 537 327 315 73 --34322 1148 511 14231
NM_005504chr1286367 6063 5136 1734 1196 954 813 35 25478 944 --12144
NM_005748chr1263329 2615 1202 1183 534 146 --1391 1948
NM_005759chr2104769 4499 4330 4078 4012 3925 3703 3327 1717 978 11163 14625 --
NM_005798chr13125265 5069 4897 3907 3235 1891 1748 1630 1515 903 56 49 ----21086 829
NM_005840chrX127521 6942 6932 6834 5942 5317 4821 2491 2164 1273 449 140 35931 5060 1818 --17001
NM_005901chr18128141 7507 7427 7038 6823 6410 3131 2913 2040 1909 1287 849 26079 996 ----
NM_005903chr5114638 4502 4224 4185 3756 3530 3368 3333 3253 1830 1114 12019 34948 4154 3992 --
NM_005909chr574267 3108 1640 1630 1364 351 341 11029 1439 12667
NM_005935chr475292 4432 1836 1480 1165 1029 966 13977 --35230 5145 3870
NM_006203chr5135605 5287 5161 4342 4122 3935 3886 3568 2185 2023 922 463 292 12086 --14466
NM_006252chr1127425 5882 5843 5835 5339 5052 2957 2880 1522 890 725 645 35580 2900 1941 16002 12127
NM_006282chr20134704 3952 3561 3482 3343 3017 1782 1641 1622 1218 1171 244 218 --1667 --
NM_006420chr2062463 884 653 627 546 391 33384 647 536 ----
NM_006457chr492872 2599 1585 1453 1126 716 466 297 31 1416 21480 480 --
NM_006544chr14136131 5940 5774 5610 5210 5097 4209 2388 1501 1216 1107 982 21 35184 4969 4903 1989 --
NM_006599chr1666393 5192 2630 1639 989 234 57008 5227 1282 1005 262 48161 6086 5310 660 171
NM_006620chr664828 4682 3532 1618 1354 747 34147 855 569 24712 3840 --
NM_006731chr9135801 5581 5543 5461 5202 3655 1536 1159 950 727 558 310 172 34315 4248 1677 34782 3950 25 --
NM_006924chr17153751 3561 3197 3144 2786 1740 1663 1505 1491 968 934 461 437 408 208 --21280 452 --
NM_007137chrX113987 3891 1919 1844 1583 1555 1410 1114 1024 843 328 14961 23581 197 --
NM_007249chr13179320 9182 8920 8560 7976 7804 7798 7349 7144 6097 2498 2474 2446 1970 1704 1490 1316 11863 11784 11262
NM_012164chr9137190 6744 6539 6532 4978 4810 2737 2229 1862 1747 1616 967 262 --21316 1233 --
NM_012252chr7145230 4582 4176 3977 3919 3588 1989 1771 1592 1509 1387 1346 749 150 24957 4230 1570 23854 1999
NM_012382chr574308 4300 3970 3380 3090 2760 684 1152 24124 3847 1914
NM_013231chr1473933 3909 3669 3517 2771 1569 1518 3906 891 724 --1925
NM_013255chr7178715 8310 8120 7672 7413 7127 6645 6385 5369 3454 3340 3215 2816 2405 2316 2140 113 38828 3134 282 15436 13424
NM_013372chr1563349 3282 2693 1365 1295 1260 13247 32275 1278 1167 1998
NM_013989chr14154998 4953 4841 4744 4675 4109 3671 3628 2047 1418 853 765 743 674 602 23948 3798 ----
NM_014048chr16104810 4391 3867 3749 3475 1852 1525 1280 917 335 23909 1308 126 --
NM_014141chr7105198 4552 4446 3254 1811 1715 1511 1247 631 252 11631 --34177 877 40
NM_014309chr2285278 3621 2148 2118 1985 1200 892 548 33319 672 393 12164 2958 572
NM_014331chr4137240 7126 6712 6624 6057 5850 2254 2204 1931 1883 1771 1282 607 32458 1896 785 37548 1536 671 188
NM_014674chr3104002 3801 2596 2540 1516 991 961 765 543 120 --1537 --
NM_014721chr6127463 7019 6155 4944 4875 2912 1515 1497 1033 814 557 515 57338 6039 2480 2472 1724 25584 2704 --
NM_014877chr17147526 7260 6986 6266 5792 5759 5244 3073 2475 2145 2029 925 798 28 37640 622 59 26811 5195 --
NM_014904chr10104029 3691 3229 2874 2683 2604 1579 1386 1192 355 11041 12665 --
NM_014946chr273012 2931 2885 2817 2695 2101 829 22862 847 21947 570 --
NM_015049chr273227 2530 2504 2136 1179 928 130 43020 2754 1173 922 ----
NM_015068chr793751 3349 3166 2771 1572 1406 1324 1233 996 11208 --13082
NM_015071chr584747 4452 4221 3948 2522 2044 1826 1595 32460 1464 853 11365 35919 2530 1264
NM_015200chr482422 2301 2125 1627 1590 960 823 429 --22253 1899 12359
NM_015208chr1873996 3601 3130 2882 2544 1625 283 22744 2622 --1166
NM_015247chr16115064 4488 4036 3782 3770 3422 3408 3335 1961 802 348 1866 12008 1684
NM_015310chr8198371 7289 7116 6834 6079 5879 5408 5345 3368 3248 3183 2667 2592 2545 818 617 514 471 361 35897 5210 1691 37619 6964 5677 --
NM_015393chr452854 2596 1219 904 759 167 2443 321 23061 29
NM_015394chr1272263 1619 1562 824 733 637 609 1278 3869 350 134 1364
NM_015458chr864095 3653 1776 968 716 466 34610 829 659 34560 1899 734 --
NM_015535chr2114194 4148 4108 3046 1494 1235 1066 846 797 420 366 22614 1146 --1348
NM_015565chr2141555 577 314 308 11931 1752 1671
NM_015602chr171638 1116 728 513 255 182 72 --21502 43 11624
NM_015640chr1105105 4666 4649 3972 1418 1397 1354 1096 379 71 23865 1567 --14549
NM_015879chr18137749 7462 5278 5269 3054 2255 1474 1293 1088 222 157 100 86 17837 16425 --
NM_015886chr855446 5206 1945 1542 1204 84903 4780 4662 4511 4435 1632 989 290 2948 75 25472 5378
NM_016009chr1114597 4109 3546 3095 1427 1226 957 806 580 472 176 --13296 --
NM_016040chr162693 2476 2145 1976 1010 782 1991 --1437
NM_016206chr398092 7488 7167 6833 2912 2851 1718 1294 850 --68523 6800 6657 6443 2537 1375 --
NM_016217chr693628 2835 2642 2542 2481 2427 1254 304 281 ----1113
NM_016248chr1384012 3594 3343 3302 3155 1547 851 356 23519 376 33409 3061 2922 13392
NM_016260chr2157544 5147 5017 4944 2932 2896 2649 2520 2487 2041 1489 1294 574 381 209 27488 354 21827 250 11811
NM_016531chr463189 3060 2908 2782 2731 1358 43938 3443 2984 2852 23657 1279 --
NM_017447chr2173613 3224 1186 1150 1088 842 366 42894 1266 656 223 24009 1595 13542
NM_017563chr3126382 5883 5767 4483 4222 2401 2209 1993 1890 1277 1083 510 --36119 5375 4502 15033
NM_017637chr9179401 9041 9006 8656 8497 7813 7680 6496 3740 3691 3566 3331 3012 2278 2127 1921 1628 12409 ----
NM_017644chr384970 4637 4437 4089 4072 1145 1061 600 11951 44937 2020 1781 921 --
NM_017709chr1103638 3312 3027 1305 1291 1130 828 757 663 570 13759 53928 1409 920 609 335 --
NM_017754chr684951 4853 4256 3664 3222 2002 1734 1387 24333 3389 11599 14762
NM_017919chr9135759 4818 4772 3829 3757 2287 1880 1333 1226 919 805 646 421 25067 4623 23880 3840 --
NM_018243chr464025 3880 3598 1178 403 188 --33703 3238 2764 23661 3330
NM_018351chr1273515 1761 1650 1623 849 432 44 41404 936 634 226 --11691
NM_018373chr14116335 5896 5375 5254 4767 4739 4383 1720 1660 626 377 --12228 1560
NM_018999chr1094884 4778 4720 4634 4310 3930 3450 1555 1191 23803 3795 1289 --
NM_019094chr1253635 3387 761 687 209 33209 1093 478 13117 1421
NM_020718chr16136513 6241 5757 5610 5412 5207 5127 4748 4483 2109 1760 1401 852 56581 5523 5503 5031 4659 --15117
NM_020739chr1584074 3761 3682 3248 2960 1090 1012 68 12885 3940 915 93 --
NM_020748chr1741782 1633 701 533 --2620 288 2454 162
NM_020752chr1062785 2592 2362 2261 1882 1854 22613 1125 22384 87 12220
NM_020772chr17148321 6871 6708 6005 5898 5830 5595 3215 3011 2911 2600 2330 1494 533 17646 ----
NM_020774chr1855088 4194 1940 597 502 45787 4772 3867 2225 24423 1957 15536
NM_020802chr11113003 2962 2836 2750 2449 2082 1351 997 317 202 194 23208 1059 --2866 847
NM_020810chr1482948 2224 1190 813 608 600 583 54 11373 13556 1135
NM_020935chr274641 1563 1354 1348 1337 1002 89 21408 342 182 --
NM_021072chr54817 784 344 258 12150 --32084 849 477
NM_021090chr22103959 3869 3837 3668 3559 3307 3292 2011 1463 358 21326 1024 13388 13735
NM_021116chr7118787 8738 7712 7302 6052 3499 2423 1331 1040 418 42 28830 2757 26435 614 17894
NM_021911chr594462 4217 1731 1613 1155 1134 610 553 294 35540 4663 731 1973 25516 1332
NM_022456chr12107107 5960 5842 5577 2917 2796 2778 2264 1098 204 22146 1906 25886 2278 --
NM_024345chr955570 1731 825 430 50 23881 2032 22206 1049 13787
NM_024408chr163565 2804 2417 1390 409 282 13669 --22814 397
NM_024513chr363835 3618 2989 1513 1395 855 33706 1194 965 23213 338 23258 2550
NM_024947chr3189179 7882 7193 6976 6948 6226 6171 6051 2750 2703 2678 2439 2096 2062 1837 1753 606 534 77435 6683 2184 1893 1435 844 578 --16387
NM_025040chr1972414 2282 1597 1567 929 911 533 --11639 11632
NM_025054chr864155 2699 1524 955 830 562 24104 3667 33751 3053 816 --
NM_025073chr1114673 4641 4397 3658 3547 3036 1482 1448 1280 532 138 23509 1195 --14204
NM_025151chr822007 716 31793 734 725 ----
NM_030648chr4115511 5355 4406 3913 2227 2143 2087 2070 1678 1018 816 --11321 14181
NM_030674chr1284661 1897 1819 1753 1687 1360 1108 984 1786 11435 15091
NM_030806chr1169463 9230 8156 8091 7342 6827 6797 6200 5775 5717 3606 2870 1848 1239 1212 1188 37801 2030 656 --11529
NM_031427chr14105617 5471 5398 4901 4454 2160 1714 1152 629 476 11447 44577 4557 4325 1077 --
NM_031453chr10102580 2568 2007 1810 933 896 819 493 126 88 12082 2320 108 --
NM_031468chr7177155 6943 6379 6155 6104 5513 3005 2995 2750 2620 2567 2486 2008 2002 1571 319 254 27183 1468 27504 5103 --
NM_031844chr1103828 3672 3402 2890 2561 1055 578 366 340 229 --23497 3019 --
NM_032291chr131872 1847 1655 11540 129 21895 1220
NM_032373chr1094456 4226 4081 2176 2160 1960 1781 956 560 25636 1247 ----
NM_032446chr573129 1549 1519 1392 508 434 394 2963 649 13099 12619
NM_032859chr13103168 3054 2607 2552 1321 1259 1189 1180 921 746 1891 22994 812 --
NM_033143chr494483 4439 4189 3872 3699 3393 1155 513 398 24080 1130 23794 1588 --
NM_033224chr7127615 7378 7297 6495 6438 5772 5265 2008 1280 1210 706 321 26864 4913 158 --
NM_033331chr9103252 2705 2618 2343 2287 1130 710 661 361 355 12477 ----
NM_052811chr13125265 5069 4897 3907 3235 1891 1748 1630 1515 903 56 49 ----21086 829
NM_053016chr9117675 7614 7111 6999 6781 6638 6010 3181 2497 1099 328 36941 5360 1464 34863 2687 1624 --
NM_080759chr1352564 2105 865 565 210 52151 1918 761 417 287 1483 --
NM_080760chr1352564 2105 865 565 210 52151 1918 761 417 287 1483 --
NM_133646chr2145483 5155 4855 4756 4735 4150 3977 3656 3592 3514 1810 1550 1093 699 34706 4657 4217 2786 586 1194
NM_133647chr1583661 3207 2863 2361 1549 1050 442 407 22641 273 12977 13008
NM_138444chr1373985 3693 3156 1834 1226 536 463 44637 4527 1260 573 24824 3879 --
NM_138459chr6103633 3442 3122 1156 1136 691 620 556 396 153 13164 33546 2373 714 --
NM_138468chr2145892 5417 5411 4517 4296 4216 3910 2377 1735 1548 867 526 258 72 --32511 468 377 --
NM_138494chr782605 2341 2130 2091 2027 585 484 322 12762 2311 59 --
NM_138694chr663502 2484 2411 1385 1200 110 13601 32854 673 631 12564
NM_138713chr1666393 5192 2630 1639 989 234 57008 5227 1282 1005 262 48161 6086 5310 660 171
NM_138714chr1666393 5192 2630 1639 989 234 57008 5227 1282 1005 262 48161 6086 5310 660 171
NM_138731chr1444065 3897 931 884 1562 13082 21525 1457
NM_144578chr14125422 4403 4275 4229 3776 3588 2125 2073 1508 845 419 284 ------
NM_145259chr2156874 6676 6388 6221 5577 5454 4681 4673 4593 2618 2000 1994 1942 1112 517 22684 1128 36751 6082 2401 15843
NM_145307chr1094158 1551 1485 1433 1156 921 877 762 476 21258 1038 2594 389 --
NM_148955chr15156418 6180 6124 5369 5202 5195 4847 4536 4517 4499 2329 1911 443 323 200 36081 4773 245 14233 11997
NM_152529chr273447 3248 2789 1113 793 540 314 13782 13633 12771
NM_152622chr583521 3150 2971 2556 2243 729 561 206 --22769 2533 11343
NM_152624chr5147156 6566 5930 5591 2927 2765 2536 1935 1452 1246 1122 550 337 145 47204 6377 6087 1583 34821 1555 1166 --
NM_152636chr1163049 2774 2713 2619 1904 227 --21121 379 12106
NM_152754chr7103430 3411 928 632 537 525 448 371 279 28 23025 223 --11241
NM_152787chrX83773 3286 2941 2545 1518 1506 1428 243 13524 --11114
NM_152826chr15156418 6180 6124 5369 5202 5195 4847 4536 4517 4499 2329 1911 443 323 200 36081 4773 245 14233 11997
NM_152902chr142043 1953 1483 388 22059 683 21839 461 21864 83
NM_153050chr22103959 3869 3837 3668 3559 3307 3292 2011 1463 358 21326 1024 13388 13735
NM_153051chr22103959 3869 3837 3668 3559 3307 3292 2011 1463 358 21326 1024 13388 13735
NM_153456chr13125806 5119 4914 4592 4203 3875 2533 1405 1354 1334 919 421 11087 24834 2285 --
NM_153810chr1064584 3451 1585 498 346 128 --11744 24425 1461
NM_172071chr1127225 6949 6680 6168 4522 2965 2459 1825 1698 1580 1420 583 2813 706 27024 494 16086
NM_173214chr1666393 5192 2630 1639 989 234 57008 5227 1282 1005 262 48161 6086 5310 660 171
NM_173468chr4125623 4810 4612 4352 3881 2408 2026 1115 860 787 707 562 55582 1949 1772 456 370 ----
NM_173470chrX72510 1975 1094 1086 1080 935 925 1219 ----
NM_173582chr1175541 5285 4764 3923 2195 1163 918 25627 5454 56253 4553 1900 1645 1427 --
NM_173602chr1253036 996 989 600 318 11439 3653 331 167 1503
NM_173642chr1138372 8306 8246 7033 7017 6910 6765 6742 5671 3556 2379 2232 470 48732 1305 1096 342 23362 2876 --
NM_173654chr362250 2205 1828 1809 794 30 21920 63 12153 --
NM_173694chrX62384 2273 673 390 282 155 21944 250 --11850
NM_175623chr12107107 5960 5842 5577 2917 2796 2778 2264 1098 204 22146 1906 25886 2278 --
NM_175624chr12107202 6055 5937 5672 3012 2891 2873 2359 1193 299 22241 2001 25981 2373 --
NM_175625chr12107202 6055 5937 5672 3012 2891 2873 2359 1193 299 22241 2001 25981 2373 --
NM_176081chr10125708 4861 4855 2073 2057 1890 1556 1481 1352 1231 220 54 21184 926 13743 --
NM_176083chr10125708 4861 4855 2073 2057 1890 1556 1481 1352 1231 220 54 21184 926 13743 --
NM_178151chrX127237 6895 6815 5790 5474 5322 3115 1940 1352 677 647 637 --1893 --
NM_178152chrX127237 6895 6815 5790 5474 5322 3115 1940 1352 677 647 637 --1893 --
NM_178153chrX127237 6895 6815 5790 5474 5322 3115 1940 1352 677 647 637 --1893 --
NM_178498chr11113720 3366 3339 3215 2455 1607 1539 1216 1052 900 839 53942 3069 2834 2590 1462 --13259
NM_182503chr6115562 5252 4992 4641 4197 2133 1904 1397 1277 857 327 22167 798 ----
NM_182515chr19106039 5837 4735 4191 1904 1514 1403 1321 983 33 --11242 24990 4875
NM_182762chr7136237 5345 4928 4707 4238 3872 3843 2353 2169 1834 1782 1737 920 65943 4133 4087 4045 4002 3962 12494 --
NM_194247chr2134368 4303 4196 4136 3763 3210 1601 1412 1115 665 620 564 373 --13472 --
NM_194283chr5114122 4078 3933 3796 3756 3599 2880 2850 2812 1252 758 178 --1300
NM_194314chr195132 4855 4692 4577 3940 3552 2204 1312 495 55487 5008 4983 4811 411 1763 --
NM_194434chr18185788 5595 5563 5491 5357 5261 4591 4224 3739 1908 1895 1120 932 849 504 310 302 273 15632 ----
NM_198468chr6104472 3814 3076 1826 1566 1138 752 655 274 117 24299 590 ----
NM_198484chr3136063 5679 5486 5139 4426 4290 1515 1263 1229 1141 873 801 602 15005 36073 5337 682 --
NM_198581chr286982 6188 6072 4778 2985 2890 1586 877 16543 --11575
NM_198859chr384921 3562 1738 1204 1099 856 740 474 --24633 434 24725 1981
NM_199040chr1253635 3387 761 687 209 33209 1093 478 13117 1421
NM_199072chr7113267 2878 2706 2507 2488 2356 2311 1985 1083 102 35 --21048 612 11004
NM_199436chr273012 2931 2885 2817 2695 2101 829 22862 847 21947 570 --
NM_203451chr1372179 1724 1610 733 611 475 218 21983 935 --1825
NM_203458chr183114 2393 1524 1456 1384 704 660 520 11128 21448 244 23260 2560
NM_206855chr6126165 6150 5862 5252 5173 4337 3990 2549 2519 2231 1672 513 11384 ----
NM_206909chr8198371 7289 7116 6834 6079 5879 5408 5345 3368 3248 3183 2667 2592 2545 818 617 514 471 361 35897 5210 1691 37619 6964 5677 --
NM_207303chr1073943 3717 2731 2573 1298 561 427 14050 33421 1597 373 12774
NM_207406chr485712 4696 4688 2063 1543 1004 80 44 16267 35839 5450 5327 --
NM_213589chr285443 5429 3489 3470 1779 1529 894 547 35239 4031 2081 15042 24662 232
NM_213590chr13125265 5069 4897 3907 3235 1891 1748 1630 1515 903 56 49 ----21086 829