TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5584-3p
miRNA Sequence: UAGUUCUUCCCUUUGCCCAAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000055chr3----1438 --
NM_000067chr82701 260 ------
NM_000081chr181595 1240 665 641 634 486 354 344 ------
NM_000084chrX125510 4977 4968 4865 2775 2643 1932 1225 1021 716 237 34 16570 25964 779 --
NM_000090chr21723 ------
NM_000091chr292903 2018 1995 850 565 536 487 44 22 11935 1941 --
NM_000092chr223863 3845 34151 4113 1080 23611 252 --
NM_000108chr741503 636 360 103 --194 --
NM_000112chr5165326 5197 4892 4858 4670 4551 4529 4408 4299 3754 1641 1487 1101 421 171 22 11188 24729 717 --
NM_000125chr694235 4075 3892 2967 2676 1617 1153 1059 404 --1422 14301
NM_000138chr1552666 2326 2114 2051 1753 21739 57 22405 1631 --
NM_000153chr141460 21080 180 --11093
NM_000161chr1441598 728 637 366 --11894 1297
NM_000163chr542032 1878 1860 176 --2227 46 32118 2017 25
NM_000165chr631324 1182 319 --1245 --
NM_000167chrX31204 180 54 11266 21339 312 --
NM_000168chr752497 2453 988 518 340 1917 1161 --
NM_000176chr553091 2911 2564 1510 1242 1807 12447 --
NM_000196chr161119 ----1453
NM_000208chr19144683 4494 4456 4215 4175 3869 3704 3275 1910 1785 1764 1440 1344 460 --21718 978 --
NM_000214chr2041723 701 656 581 --21654 553 --
NM_000216chrX93894 3250 2859 2594 1460 1003 305 235 93 --2661 140 --
NM_000217chr12115278 5255 5190 4511 4311 4262 4219 4156 1547 1398 805 13906 ----
NM_000242chr1052051 1989 1004 931 526 1779 ----
NM_000245chr772059 1981 1692 1394 835 417 117 12032 22005 1960 22155 1851
NM_000248chr372781 2599 1197 1136 981 388 157 ------
NM_000255chr6------1338
NM_000259chr1575292 5061 4918 4898 1330 400 52 16298 15413 11033
NM_000264chr992727 2428 2323 2210 2170 2138 977 82 69 --32696 2494 1325 --
NM_000267chr1751252 1185 1058 528 365 11395 22618 2363 --
NM_000289chr121279 ------
NM_000321chr1321648 296 21637 1415 21657 707 --
NM_000332chr6216876 6740 6386 5634 5575 5417 4806 4799 4783 4522 2673 2414 2343 1767 1521 1288 1278 705 598 532 264 36789 4719 2221 46971 6857 6117 6089 15337
NM_000337chr5146489 6358 6170 6072 5336 5330 4144 2467 1566 1177 994 945 939 237 --1552 --
NM_000362chr2283358 2842 1352 1062 717 430 263 256 1169 22231 444 22662 605
NM_000367chr642203 2076 935 692 ----1704
NM_000368chr9124522 4468 4338 4177 4003 3985 3550 3542 3470 3432 1431 571 --21340 866 --
NM_000389chr6--1176 ----
NM_000390chrX62629 1113 931 666 427 168 13104 42805 2579 1198 73 --
NM_000391chr1121277 1101 11694 11207 11758
NM_000430chr1763302 2695 2609 2570 1427 829 --22686 1480 --
NM_000439chr5102553 2371 2349 2340 1954 1945 1901 1698 379 191 ------
NM_000448chr1163109 3050 2199 1068 854 338 --1508 12175
NM_000461chr394036 3950 3434 3377 3140 2924 1836 808 493 ----11172
NM_000462chr1521601 670 1402 1497 11161
NM_000484chr212694 386 --2767 257 --
NM_000489chrX63121 1069 682 580 361 81 --22840 2509 --
NM_000495chrX4978 949 722 463 1915 --2379 267
NM_000503chr831852 296 93 11219 1727 11619
NM_000507chr9129 ------
NM_000555chrX167698 7152 6951 6815 5322 2999 2257 2240 2115 1924 1080 893 647 480 459 420 --37794 7405 1369 --
NM_000572chr13945 928 803 ------
NM_000599chr273282 1829 1581 1538 962 375 281 12909 24468 3694 13861
NM_000610chr1172869 2797 2791 2632 2282 2251 350 --32694 765 231 12502
NM_000618chr12116254 5947 5252 5209 4672 4245 4122 3993 2225 676 302 15245 44765 4342 4042 1075 --
NM_000618chr12116254 5947 5252 5209 4672 4245 4122 3993 2225 676 302 15245 44765 4342 4042 1075 --
NM_000633chr18174838 4150 4114 4003 3609 3177 2048 1274 1243 1126 1108 1020 876 676 633 426 407 34100 3333 1607 14035 --
NM_000719chr12106615 5629 5527 5125 4995 2612 2276 2040 453 329 26260 5086 36725 5828 2299 --
NM_000726chr2----11310 --
NM_000788chr411489 11344 ----
NM_000792chr1--11069 ----
NM_000793chr14115156 4446 4149 3826 3645 3411 1839 1613 1299 129 21 24126 1826 33628 297 64 --
NM_000794chr54970 811 301 250 ------
NM_000813chr564766 4715 2221 1919 973 70 25473 4663 --25540 30
NM_000814chr1583574 3360 3122 3064 2937 2757 1264 1180 --23780 1626 --
NM_000817chr261260 1227 921 308 206 125 ------
NM_000831chr1136111 4994 4756 4462 4003 1600 1512 1492 1471 731 382 105 68 34784 1270 608 21670 1145 --
NM_000859chr531213 463 243 --11370 2480 51
NM_000861chr382313 2271 2215 2145 2132 423 313 165 --22554 433 1333
NM_000875chr15186038 5673 5487 5418 5031 4972 4486 2662 2279 2105 1985 1142 989 884 790 286 246 121 14502 26927 6360 15642
NM_000876chr611271 ------
NM_000885chr242126 1688 1646 469 22145 1747 1184 --
NM_000899chr12103527 3406 1656 1356 1283 782 750 536 280 240 1892 44413 1567 254 224 12791
NM_000901chr43736 512 63 --32545 833 22 1372
NM_000902chr342295 2199 395 374 22842 1217 21246 491 --
NM_000910chr451609 1494 1413 787 612 2708 46 11567 --
NM_000912chr873447 3023 2807 1155 392 184 104 1455 13356 1528
NM_000944chr462098 1757 1707 1544 612 581 ----1483
NM_000950chrX63327 3254 2867 2619 1232 927 12660 2408 53 --
NM_000959chr1113787 3444 3090 2665 1497 1441 914 867 619 505 334 1794 23154 1219 13883
NM_001001331chr382455 2080 1963 1924 849 792 542 420 --42729 2134 1699 583 --
NM_001001344chrX32581 823 159 1811 21938 322 1703
NM_001001389chr1172869 2797 2791 2632 2282 2251 350 --32694 765 231 12502
NM_001001390chr1172869 2797 2791 2632 2282 2251 350 --32694 765 231 12502
NM_001001391chr1172869 2797 2791 2632 2282 2251 350 --32694 765 231 12502
NM_001001392chr1172915 2843 2837 2678 2328 2297 396 --32740 811 277 12548
NM_001001395chr1242699 2437 88 26 12326 42000 972 472 77 --
NM_001001419chr5104737 4638 4413 4154 3827 3623 3438 3253 1486 1180 --65200 4853 4185 3756 1772 816 12019
NM_001001420chr5104737 4638 4413 4154 3827 3623 3438 3253 1486 1180 --65200 4853 4185 3756 1772 816 12019
NM_001001433chr2053208 2530 1181 219 212 --21116 530 --
NM_001001481chr833388 2902 2538 12664 33479 2959 574 --
NM_001001556chr1541339 243 211 56 11270 11512 --
NM_001001557chr831371 592 461 11715 2722 628 1824
NM_001001664chr273355 2898 2716 1197 1167 677 497 13303 23281 768 --
NM_001001665chr272891 2826 2756 1292 1054 915 468 --11108 --
NM_001001668chr1984280 4235 4194 4183 3455 1304 855 431 24109 882 --11600
NM_001001701chr472329 2052 1638 1630 1593 161 88 12253 2925 103 --
NM_001001706chr63391 385 225 ----1997
NM_001001711chr111346 1994 167 --
NM_001001924chr861971 1939 271 166 73 57 --32129 1467 655 --
NM_001001925chr861971 1939 271 166 73 57 --32129 1467 655 --
NM_001001928chr22218269 8108 7633 7606 7412 6286 5911 3043 2320 1839 1780 1670 1650 1586 999 781 571 226 192 184 114 12988 38006 7895 581 17127
NM_001001931chr861971 1939 271 166 73 57 --32129 1467 655 --
NM_001001974chr1041968 1749 636 151 22089 1712 ----
NM_001002233chr831875 716 424 --2757 68 1734
NM_001002814chr8113704 3196 3186 2959 2838 2679 2449 1299 1203 716 424 23837 3657 33075 757 68 1734
NM_001002838chrX21623 1384 143 ----
NM_001002860chr1493697 3327 2896 2862 1212 1170 668 496 245 --21528 368 --
NM_001002909chr1711775 --22260 124 --
NM_001003407chr1053311 1680 697 539 91 24221 1924 54907 3709 1617 348 34 --
NM_001003408chr1053311 1680 697 539 91 24221 1924 54907 3709 1617 348 34 --
NM_001003652chr18127323 7077 6955 6756 6446 6058 5845 5808 5429 2960 2468 1287 26079 996 33105 1779 849 17226
NM_001003674chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_001003675chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_001003694chr31468 ------
NM_001003712chr1274089 3739 3578 3106 1577 1518 645 12830 14020 1177
NM_001003760chr683608 3179 2903 2317 1034 973 949 31 --1831 13417
NM_001003800chr9123772 3727 3568 3179 2565 2520 1157 669 591 567 257 167 --23339 3032 12782
NM_001003895chrY1123 ------
NM_001004023chr1----1154 --
NM_001004065chr9153736 3655 3587 3357 2795 2778 1420 1389 1115 1026 764 584 352 323 278 --1217 --
NM_001004317chr643839 983 525 120 21236 1102 1380 12873
NM_001004419chr12124377 4201 3677 3434 1617 1576 1527 1224 1218 718 475 119 34007 3063 632 31368 437 150 --
NM_001005353chr1--11264 ----
NM_001005353chr1--11264 ----
NM_001005375chrY61522 1239 1224 593 563 331 ------
NM_001005386chr272273 1983 1953 1924 1809 1792 1568 1550 2882 651 --
NM_001005404chr1783933 3415 2808 1618 504 439 327 265 --13516 --
NM_001005473chr5146434 6147 5943 5568 4956 4364 4196 2481 2257 1447 993 981 683 289 25059 2620 25923 2244 --
NM_001005502chr1294616 3322 1791 1204 1151 914 803 340 183 --15141 15249
NM_001005609chrX83627 3439 2586 2519 2327 934 821 56 13174 12684 13075
NM_001005746chr2----11310 --
NM_001005747chr2----11310 --
NM_001006600chr552441 1963 591 165 145 2608 372 22428 100 --
NM_001006684chrX----1556 1470
NM_001006944chr111168 ------
NM_001006945chr13612 554 264 ------
NM_001007023chr14115156 4446 4149 3826 3645 3411 1839 1613 1299 129 21 24126 1826 33628 297 64 --
NM_001007033chr12------133
NM_001007097chr9114769 4579 4480 4071 3916 3575 1372 1192 965 766 426 13949 24413 3754 13583
NM_001007099chr15873 667 571 281 76 ----1300
NM_001007100chr15873 667 571 281 76 ----1300
NM_001007102chr681627 1461 1279 1154 589 465 111 68 --1325 11364
NM_001007250chr15995 789 693 403 198 --1128 --
NM_001007466chr674433 4148 3887 3696 3686 3434 1498 11994 23627 1974 11660
NM_001007527chr52283 81 1134 1255 --
NM_001007559chr1822082 275 ----1769
NM_001008239chr1833552 1041 850 23639 1435 1205 --
NM_001008388chr41695 ----1198
NM_001008391chr113661 227 221 ----1670
NM_001008408chr796309 5689 5317 4607 4388 3953 1130 390 349 24597 1311 35125 1488 239 --
NM_001008539chr8105334 5036 4900 3340 3279 2123 1975 1917 1474 1205 23708 3387 14676 --
NM_001008660chr1131219 392 180 --2364 210 11146
NM_001008661chr1--1349 ----
NM_001008662chr1--1349 ----
NM_001008738chr512303 12611 ----
NM_001008777chr174505 194 137 29 --1119 --
NM_001008801chr1941409 668 584 315 ------
NM_001008925chr493320 3142 2958 2660 1274 638 542 205 163 22918 2816 ----
NM_001009554chr4104501 4429 4370 4346 3680 3227 1458 1105 337 213 --14269 --
NM_001009554chr4104501 4429 4370 4346 3680 3227 1458 1105 337 213 --14269 --
NM_001009555chr431220 666 131 --136 --
NM_001009881chr1----1438 --
NM_001009882chr1----1438 --
NM_001009894chr1231683 689 543 11606 31632 1282 632 11129
NM_001009899chr3126365 6101 5477 5187 4735 4661 4105 2539 2530 2489 1943 1854 11093 25793 1303 --
NM_001009909chr1123928 1362 --1569 --
NM_001009959chr242560 2322 1832 1016 22418 1880 22618 2392 --
NM_001010846chr193732 3550 3305 3195 3153 1832 1141 1031 993 11511 11793 --
NM_001010853chr61408 ----12124
NM_001010891chr552111 1280 1045 1035 475 --46884 2497 266 123 24666 1905
NM_001010895chr972095 2077 1580 1470 822 703 673 --1791 1306
NM_001010897chr131369 ------
NM_001010971chr11190 --4909 723 338 109 --
NM_001010986chrX31721 216 206 ----32008 1613 184
NM_001011513chr442850 1467 866 480 1416 22599 297 --
NM_001011537chr351760 1651 774 491 182 21914 1787 11710 31576 889 865
NM_001011657chrX5907 261 222 203 71 1914 1212 --
NM_001011663chr104994 874 782 51 1801 11055 1138
NM_001011666chr7156071 6058 5949 5780 5734 5157 4928 4913 4053 4014 2170 1981 1899 1298 467 179 25038 34 --
NM_001011713chr14173 ------
NM_001011885chr1521779 650 --1416 --
NM_001012393chr1194804 4288 4180 4102 3782 3750 1379 1323 1234 --41832 1791 1743 1410 23728 426
NM_001012418chr674270 4019 3369 3343 2660 1219 183 --1479 11638
NM_001012420chr1562473 2425 2261 1066 555 393 --122 1709
NM_001012423chr1562473 2425 2261 1066 555 393 ----1709
NM_001012751chr102534 71 31886 762 603 ----
NM_001012755chrX104880 4497 4481 4027 3541 3461 642 620 390 162 --11943 2591 407
NM_001013620chr12128307 6699 6583 3262 2638 2270 2258 2074 1213 1047 880 61 32608 363 339 35930 5394 177 --
NM_001013659chr1995311 5158 4317 4027 4002 3412 1542 1504 1297 --23309 1113 --
NM_001013734chr62763 46 --2684 590 1527
NM_001013746chr7112152 2146 1936 1801 1459 936 483 403 319 151 66 --1386 --
NM_001014380chr1361187 710 536 498 446 143 --15032 14133
NM_001014797chr10198019 7777 7426 7163 6861 6632 6517 5813 5763 5296 5170 5107 4962 3136 2763 2073 1425 1071 868 36837 1902 150 27019 244 --
NM_001015045chr462022 1623 769 652 539 419 ----12555
NM_001017368chr1762816 2661 988 291 280 208 12549 11061 22678 2274
NM_001017371chr22330 55 ----21234 992
NM_001017415chr12178 75 --1573 --
NM_001017416chr12178 75 --1573 --
NM_001017440chr7218057 7940 7652 7038 6943 6511 6349 6124 5873 5433 5103 3118 3041 2690 2620 2360 1832 1292 644 629 137 --46840 6688 6462 5513 --
NM_001018065chr955712 4711 3852 3747 1338 --15504 24871 44
NM_001018066chr955712 4711 3852 3747 1338 --15504 24871 44
NM_001018074chr553091 2911 2564 1510 1242 1807 12447 --
NM_001018075chr553091 2911 2564 1510 1242 1807 12447 --
NM_001018076chr553091 2911 2564 1510 1242 1807 12447 --
NM_001018077chr553091 2911 2564 1510 1242 1807 12447 --
NM_001018090chr1592641 2204 2062 2029 1991 1847 1773 1107 570 12754 32398 598 454 12800
NM_001018102chr1592641 2204 2062 2029 1991 1847 1773 1107 570 12754 32398 598 454 12800
NM_001018111chr7123700 3685 3521 3515 2929 2592 1496 1115 1032 862 381 38 --33883 3580 3482 --
NM_001024094chr553091 2911 2564 1510 1242 1807 12447 --
NM_001024647chr12116563 5644 2450 2415 2034 1819 1585 1500 1449 1098 565 35677 5664 5552 35577 1980 204 --
NM_001024948chr132779 2316 287 ----23224 2130
NM_001025076chr1056033 5082 1707 1117 857 11453 36107 1687 890 12318
NM_001025077chr10107391 6440 5017 4821 4585 2475 2215 941 432 352 34964 4622 2811 37465 3045 2248 --
NM_001025079chr354103 3699 2960 2688 294 23651 2970 ----
NM_001025233chr12102773 2765 2645 2618 2499 2410 2240 2113 573 512 --12551 --
NM_001025252chr832709 2467 2221 12897 33150 2422 2344 1490
NM_001025253chr832709 2467 2221 12897 33150 2422 2344 1490
NM_001025366chr611685 --11909 --
NM_001025366chr611685 --11909 --
NM_001025367chr611685 --11909 --
NM_001025367chr611685 --11909 --
NM_001025368chr611685 --11909 --
NM_001025368chr611685 --11909 --
NM_001025369chr611701 --11925 --
NM_001025369chr611701 --11925 --
NM_001025370chr611685 --11909 --
NM_001025370chr611685 --11909 --
NM_001025580chrX53135 1688 882 863 277 ------
NM_001025595chr4--11607 --165
NM_001025780chr921294 1259 2483 168 ----
NM_001029860chr8----1233 --
NM_001029875chr542721 1194 195 29 --1574 1288
NM_001029884chr642453 1042 667 108 ----1434
NM_001030007chr1683977 3640 3442 3369 2615 1391 336 118 33187 2776 2460 43703 695 639 47 --
NM_001030055chr1463744 3528 3156 2956 967 645 11198 11849 --
NM_001031679chr1243277 3197 1214 379 --1191 23559 983
NM_001031684chr221149 341 ----1599
NM_001031685chr13856 288 127 --1159 135
NM_001031695chr2285215 4418 4314 3631 3489 1532 1093 145 33329 582 403 181 13980
NM_001031712chr62433 30 --2354 37 --
NM_001031804chr1684388 4337 4231 3177 2988 1305 1195 534 13850 24081 1279 --
NM_001032283chr123692 377 240 ----2402 89
NM_001032284chr123692 377 240 ----2402 89
NM_001032394chr661872 1821 986 913 480 285 12788 ----
NM_001032395chr661739 1688 853 780 347 152 12655 11062 --
NM_001032999chr2094580 4459 4410 3673 3486 3316 1030 865 523 --31918 1315 1088 --
NM_001033044chr121172 400 ----11289
NM_001033045chr264267 3633 3485 1603 1345 289 13782 22789 1113 --
NM_001033056chr121172 400 ----11289
NM_001033059chr641282 439 414 35 11874 21880 1458 --
NM_001033112chr53917 601 201 ------
NM_001033518chr772543 2412 2221 2198 862 56 37 11109 22676 2649 --
NM_001033519chr772543 2412 2221 2198 862 56 37 11109 22676 2649 --
NM_001033520chr772543 2412 2221 2198 862 56 37 11109 22676 2649 --
NM_001033557chr211164 31071 1013 481 1272 --
NM_001033559chr151364 ------
NM_001033566chr17--178 ----
NM_001033568chr17--178 ----
NM_001033578chr842375 2358 2106 2019 --21901 180 --
NM_001033602chr1342389 2186 2031 282 ----1471
NM_001033723chr872451 2275 2109 992 584 209 128 32810 2444 612 31843 821 77 --
NM_001033756chr611619 --11843 --
NM_001033756chr611619 --11843 --
NM_001034841chr1655086 4007 1653 1316 532 --25552 249 1330
NM_001034954chr1063278 2074 890 676 399 357 --1212 --
NM_001034955chr1063278 2074 890 676 399 357 --1212 --
NM_001034956chr1063278 2074 890 676 399 357 --1212 --
NM_001034957chr1063278 2074 890 676 399 357 --1212 --
NM_001035005chr181439 ------
NM_001037132chr792011 1777 813 766 533 453 429 333 236 1604 ----
NM_001037133chr792011 1777 813 766 533 453 429 333 236 1604 ----
NM_001037172chr321427 1132 --21210 403 --
NM_001037290chr1161041 902 799 367 268 84 ----1788
NM_001037334chr1852191 2039 1939 1796 72 --12124 --
NM_001037535chrX71414 1353 1292 1194 415 335 136 1145 ----
NM_001037536chrX71414 1353 1292 1194 415 335 136 1145 ----
NM_001037540chrX71414 1353 1292 1194 415 335 136 1145 ----
NM_001037553chr21115147 5063 4304 4184 3993 3266 1545 869 712 361 275 --1152 --
NM_001039479chr1451489 944 727 611 589 --32466 672 577 --
NM_001039547chr3138051 7058 6124 5671 2244 1393 1188 1108 897 701 458 325 249 21444 1342 35166 5093 939 15323
NM_001039577chr1124544 4446 4363 4355 3585 3217 1783 1424 1110 733 618 315 --22827 523 --
NM_001039580chr464658 3722 1912 1757 541 509 13273 24902 571 --
NM_001039585chr1114044 3701 3347 2922 1698 1171 1124 876 762 591 119 11051 23411 1476 14140
NM_001039590chrX113778 3688 3677 2966 2785 2574 1547 1454 1312 874 747 13264 21470 1149 --
NM_001039591chrX113778 3688 3677 2966 2785 2574 1547 1454 1312 874 747 13264 21470 1149 --
NM_001039618chr1155764 5707 1098 921 462 23691 3624 45570 4005 2379 2079 --
NM_001039649chr131257 1275 125 --
NM_001039693chr2114002 3552 3431 3302 3112 1134 898 771 525 330 164 12927 44062 1543 858 783 13609
NM_001039709chr2094580 4459 4410 3673 3486 3316 1030 865 523 --31918 1315 1088 --
NM_001039715chr1--11069 ----
NM_001039716chr1--11133 ----
NM_001039762chr1061967 1817 1611 841 833 91 1756 32134 1794 430 --
NM_001039840chrX115838 5724 5324 5163 4237 4044 2098 2030 1325 470 455 11098 55870 4369 4301 2055 745 15217
NM_001039937chr1384186 3944 3765 3362 3281 3229 1463 477 13462 11534 --
NM_001040108chr14143279 3139 3091 3038 2941 2776 2202 2195 2117 1139 1034 953 610 27 22760 2628 ----
NM_001040135chr7--1679 ----
NM_001040142chr282320 2200 2168 1975 277 245 176 77 ----11703
NM_001040143chr282320 2200 2168 1975 277 245 176 77 ----11703
NM_001040152chr764802 4422 3594 3138 1644 196 24230 4118 24088 204 --
NM_001040153chr131254 2677 286 ----
NM_001040157chr422761 30 52592 1834 624 595 342 164 --
NM_001040284chr1655006 4742 4561 2158 1908 24290 861 25485 3665 --
NM_001040402chr431203 1003 730 1459 11964 --
NM_001040429chr1332832 590 342 22268 227 23352 1413 21078 302
NM_001040441chr1145315 5200 4306 4179 3976 3925 3449 3418 2086 1896 1309 1042 447 23 11364 12033 1213
NM_001040450chr1542533 2027 1924 496 1887 12653 --
NM_001040453chr1542533 2027 1924 496 1887 12653 --
NM_001040458chr551805 1415 566 253 146 ----11272
NM_001040619chr1101505 1304 1296 1249 1134 570 531 437 390 315 1449 11110 --
NM_001040712chr952997 2913 2314 662 301 12667 1175 --
NM_001040876chr441817 1641 108 55 ----11218
NM_001042355chr1645268 4802 1291 931 1866 35115 1887 802 --
NM_001042383chr353291 1344 1260 549 216 12605 32627 362 191 1863
NM_001042412chr1645268 4802 1291 931 1866 35115 1887 802 --
NM_001042413chr964001 3179 969 306 232 148 1162 --13635
NM_001042453chrX--11203 ----
NM_001042473chr1072119 1646 683 516 422 272 37 ----1189
NM_001042481chr1422302 840 12339 --1194
NM_001042490chr5----163 1279
NM_001042492chr1751252 1185 1058 528 365 11395 22618 2363 --
NM_001042493chr651889 1870 1670 638 584 --11431 --
NM_001042494chr1543661 2977 970 775 1273 33716 442 165 --
NM_001042495chr1543661 2977 970 775 1273 33716 442 165 --
NM_001042496chr1543661 2977 970 775 1273 33716 442 165 --
NM_001042497chr1543661 2977 970 775 1273 33716 442 165 --
NM_001042510chr832036 1580 403 ------
NM_001042511chr832036 1580 403 ------
NM_001042529chr17--1291 ----
NM_001042530chr17--1291 ----
NM_001042531chr17--1291 ----
NM_001042532chr17--1291 ----
NM_001042533chr382756 2693 2491 2403 2239 716 287 183 12845 32780 1230 341 --
NM_001042599chr2156535 5841 4893 4828 3072 2816 2347 1666 1641 1242 751 567 483 264 202 15004 27730 422 11200
NM_001042601chr363058 2682 2643 2403 1210 1143 21291 1237 ----
NM_001042603chr12125267 4993 4884 4673 4304 3989 3295 1634 781 707 613 596 --34556 1817 1137 --
NM_001042604chr384286 4279 3423 1776 1255 1134 885 721 1669 --13104
NM_001042632chr20132609 2398 2197 2062 1998 1876 1736 1704 1625 729 718 485 246 --21862 631 --
NM_001042633chr20132609 2398 2197 2062 1998 1876 1736 1704 1625 729 718 485 246 --21862 631 --
NM_001042749chrX61679 1667 1431 567 468 183 --1621 --
NM_001042750chrX61679 1667 1431 567 468 183 --1621 --
NM_001042751chrX61679 1667 1431 567 468 183 --1621 --
NM_001044385chr263946 3473 3453 3187 1493 1220 23508 923 23347 2599 --
NM_001045556chr881555 666 387 329 296 255 178 37 1479 3564 534 344 11121
NM_001045557chr881555 666 387 329 296 255 178 37 1479 3564 534 344 11121
NM_001046chr522357 845 2638 546 --12707
NM_001048183chr163803 2614 1361 677 101 74 ------
NM_001071775chr1351814 1672 1505 588 548 1181 --1131
NM_001099678chr3126460 6034 5809 5413 5330 5273 4468 2429 2264 296 167 68 45151 1174 794 521 25596 948 --
NM_001100108chr1187974 7601 7417 7327 7288 7175 6949 6611 6382 6238 5316 2827 2769 2170 1964 1583 1313 637 12444 52254 1884 965 534 57 --
NM_001106chr3209543 8801 8786 8774 8491 7864 7435 7351 7156 6588 6099 3443 2310 1820 1467 787 756 451 427 295 49761 6515 6045 675 28744 7484 11420
NM_001117chr18112476 2337 1895 1835 1796 1662 1570 887 748 527 240 --1781 --
NM_001128chr1683977 3640 3442 3369 2615 1391 336 118 33187 2776 2460 43703 695 639 47 --
NM_001151chr4----1256 --
NM_001167chrX66203 4283 1596 1556 896 239 --32598 2432 2424 --
NM_001173chr1463744 3528 3156 2956 967 645 11198 11849 --
NM_001186chr2172537 2122 940 864 797 509 256 22697 2211 ----
NM_001201chr463121 2466 727 391 293 283 13158 32991 697 177 --
NM_001204chr256834 6681 5631 5404 5266 45413 2803 1940 976 25958 2819 1739
NM_001206chr9122874 2492 2046 1963 1261 1095 1012 1002 745 611 479 379 12542 ----
NM_001222chr10101892 1743 1519 685 632 587 579 547 514 438 --1427 --
NM_001233chr731784 1466 810 21699 218 ----
NM_001235chr111172 --1658 --
NM_001241chr242255 2154 975 358 22068 2000 12246 11989
NM_001241chr242255 2154 975 358 22068 2000 12246 11989
NM_001248chr3----21015 330 11097
NM_001256chr17102579 2561 2246 1004 924 864 633 448 324 246 12641 1656 --
NM_001259chr7134867 4242 3905 2435 2417 2025 2019 1809 882 497 240 83 38 11963 11946 16111
NM_001290chr4--1968 1724 --
NM_001316chr20------1430
NM_001329chr103283 273 82 11650 11617 1152
NM_001331chr1162812 2002 1806 651 570 306 12528 21004 373 12422
NM_001346chr3132781 2725 2473 2183 2097 1937 1871 1035 718 708 663 449 305 12233 21817 961 --
NM_001351chr361496 1208 1193 690 495 346 ----11656
NM_001364chr11104043 3048 2977 1797 1168 882 334 317 47 35 1599 33920 3066 569 --
NM_001386chr852244 2195 1501 391 108 --22418 2296 --
NM_001390chr1863296 2817 2309 1313 783 150 --22506 594 11268
NM_001399chrX83627 3439 2586 2519 2327 934 821 56 13174 12684 13075
NM_001402chr651863 1498 264 62 50 ------
NM_001420chr1993074 2428 2212 2164 1935 1078 632 442 310 ------
NM_001429chr221196 --2781 126 --
NM_001431chr61908 ----1141
NM_001432chr473669 3218 2957 2677 1529 856 495 --1328 --
NM_001438chr183362 2841 2800 2224 1308 990 941 672 11475 12946 --
NM_001451chr1651302 1254 1059 839 480 --1545 11158
NM_001460chr153047 2978 2611 1027 68 31051 511 350 21337 1114 2765 341
NM_001483chr721072 1000 ----1174
NM_001497chr982754 2047 1101 989 738 349 320 268 ------
NM_001527chr653697 3278 961 948 701 14653 11044 11499
NM_001609chr1094209 4062 4050 3976 3796 3462 3156 2913 2893 33751 3407 401 --34514 4088 3829
NM_001616chr293172 2957 2677 2597 2478 2331 1119 258 194 12290 --11219
NM_001634chr641282 439 414 35 11874 21880 1458 --
NM_001650chr18133751 3599 3425 3327 3150 3047 2881 2835 665 519 321 169 41 14024 1990 13796
NM_001656chr571906 1881 1594 1285 769 752 357 1182 --1566
NM_001677chr111157 --1900 --
NM_001683chr382455 2080 1963 1924 849 792 542 420 --42729 2134 1699 583 --
NM_001695chr863196 2693 1660 783 758 434 1816 1983 --
NM_001709chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_001742chr731734 237 91 --1708 1116
NM_001769chr12----1334 --
NM_001777chr354103 3699 2960 2688 294 23651 2970 ----
NM_001799chr51238 ------
NM_001821chr174832 4779 4490 1850 1665 68 52 43679 3581 1814 1601 24142 676 23484 3089
NM_001854chr131416 481 473 --11463 --
NM_001858chr674523 4008 1404 1380 1367 1143 1085 --53433 3238 1281 566 513 --
NM_001873chr42674 562 --1174 --
NM_001874chr1294616 3322 1791 1204 1151 914 803 340 183 --15141 15249
NM_001904chr3169 11085 1748 --
NM_001918chr1148128 8065 7741 7596 7466 7415 7380 5686 3153 2996 2547 1814 1471 1162 39123 8848 8028 16476 --
NM_001939chrX83859 3497 3490 2880 2853 2843 2338 653 23101 331 13697 --
NM_001942chr1841760 1270 1257 172 21818 212 11714 31547 364 220
NM_001968chr4--2808 291 --1226
NM_001977chr451315 1273 1153 609 567 1459 ----
NM_001981chr172275 2248 2199 2102 942 685 448 12124 ----
NM_001999chr551426 1261 1230 1089 605 ----175
NM_002006chr445631 5003 4204 3545 14130 11213 14772
NM_002014chr12----186 --
NM_002015chr1383233 2489 2408 2223 775 580 569 491 12635 3509 235 56 --
NM_002024chrX4871 735 729 672 --21948 138 1831
NM_002025chrX208968 8721 8598 8061 7984 7757 7682 5646 5619 3583 3065 1971 1338 804 623 500 440 388 320 76 --36126 6059 5719 26451 2491
NM_002035chr1883978 2886 2721 1424 817 605 392 285 1260 33554 3019 842 --
NM_002040chr2163033 2653 2446 1942 599 573 1490 32788 2514 696 12862
NM_002044chr1541339 243 211 56 11270 11512 --
NM_002065chr121172 400 ----11289
NM_002076chr1293243 2452 2070 1195 830 517 498 420 239 --1847 --
NM_002092chr494873 4370 3574 3511 3421 3134 1736 1573 474 ------
NM_002099chr481730 1508 1323 705 274 263 212 33 11501 1786 --
NM_002130chr521519 1125 21278 1265 2588 384 --
NM_002140chr91866 --172 1813
NM_002202chr5--31082 1068 205 1766 --
NM_002214chr7125652 5141 4913 4524 4403 4252 2138 1489 1103 484 342 291 13474 45608 3906 3724 3459 --
NM_002247chr1042167 608 589 285 --32101 1937 1628 --
NM_002264chr3114344 3847 3783 1981 1807 1700 1600 1189 880 787 338 14415 --24745 670
NM_002267chr1361546 717 527 485 221 72 --1668 --
NM_002270chr574948 3537 3474 1062 423 388 353 ----1531
NM_002271chr1382089 2040 1808 1763 1723 726 339 145 12048 11892 --
NM_002290chr641455 510 122 75 11227 --11163
NM_002313chr1053311 1680 697 539 91 24221 1924 54907 3709 1617 348 34 --
NM_002334chr11112078 1902 1822 1651 1572 1543 494 415 369 300 208 ------
NM_002336chr1263912 3397 3114 1959 1850 1512 24508 4403 --11003
NM_002345chr122437 179 1527 1493 --
NM_002349chr251246 389 315 221 99 --11149 11607
NM_002350chr841083 883 340 149 1388 --1862
NM_002376chr14------1427
NM_002392chr12--123 ----
NM_002395chr621395 140 11203 11214 1958
NM_002397chr551783 1663 1418 500 472 --2871 833 --
NM_002427chr113217 183 38 ----21157 85
NM_002451chr9103737 3719 3595 3544 3346 3283 1546 974 470 341 13467 13523 1524
NM_002467chr81325 --1172 --
NM_002480chr123562 141 87 11181 ----
NM_002481chr1127606 7472 7089 7043 6479 6367 6228 5491 5218 5078 1747 110 --36038 2916 567 --
NM_002500chr21460 ------
NM_002519chr1121164 21 --11141 11467
NM_002545chr1194804 4288 4180 4102 3782 3750 1379 1323 1234 --41832 1791 1743 1410 23728 426
NM_002547chrX83658 2715 1548 1464 1217 1107 575 105 --32857 1639 256 --
NM_002568chr81376 --1275 --
NM_002577chr373821 3800 3701 3473 1274 830 590 --13340 --
NM_002581chr9125442 4425 4216 3602 2232 2208 2132 1904 1322 1309 1267 796 33494 892 614 45216 2247 153 27 --
NM_002601chr2----129 --
NM_002613chr16144881 4720 4603 4569 3973 3638 3611 3529 1735 1223 1120 998 458 181 --15026 --
NM_002645chr1173030 2712 2699 2675 1189 1160 127 12202 22933 1007 22623 511
NM_002655chr875283 4741 3590 1257 1161 1039 932 14332 11783 14531
NM_002656chr62400 145 1364 1837 --
NM_002670chr331395 511 159 1548 ----
NM_002687chr141293 --2889 99 --
NM_002709chr263467 2901 2878 2549 1365 42 --22781 477 --
NM_002711chr71789 ------
NM_002734chr1722195 2085 --1836 --
NM_002737chr17156410 6217 6081 6039 5646 5537 5447 4609 2585 2485 2321 1102 728 433 185 11595 --14156
NM_002745chr2284361 3683 2894 2827 1003 911 193 28 14397 1175 12815
NM_002822chr1241463 1300 392 63 ----11798
NM_002829chr961198 1091 1071 798 337 88 --31226 938 171 --
NM_002834chr12103955 3083 3053 1125 1069 609 467 272 102 70 24089 543 11079 23162 2862
NM_002837chr1244044 2813 1756 966 24025 316 13650 21728 552
NM_002839chr952997 2913 2314 662 301 12667 1175 --
NM_002857chr1102529 2512 2494 2440 2104 2046 1823 1815 1665 642 --12714 --
NM_002858chr141135 369 230 149 11251 ----
NM_002874chr962510 2199 1900 1761 394 377 ------
NM_002881chr261411 1243 1090 1020 472 39 --1310 --
NM_002886chr395210 4930 4738 4494 3737 3520 1782 1362 500 24004 1582 ----
NM_002940chr441817 1641 108 55 ----11218
NM_002959chr1103188 2954 2842 1171 1093 846 781 751 529 142 11054 13355 --
NM_002977chr253467 2945 756 209 198 --33295 2577 2410 --
NM_002979chr15873 667 571 281 76 ----1300
NM_002994chr42614 514 --1429 --
NM_003002chr111148 --128 --
NM_003010chr1741768 842 794 381 --42200 778 438 60 --
NM_003017chr611348 --1214 --
NM_003022chrX1421 169 ----
NM_003034chr12187640 7453 7391 6196 5893 5703 5548 3085 2125 1989 1907 1373 1072 1001 979 732 412 328 23196 1508 31963 623 23 --
NM_003046chr8105334 5036 4900 3340 3279 2123 1975 1917 1474 1205 23708 3387 14676 --
NM_003048chr282070 1983 1916 956 637 530 423 293 ------
NM_003099chr15146418 5905 5670 5441 5280 5122 4945 4223 4193 4162 2241 1964 1038 748 26081 1997 65328 5202 4517 1815 971 317 --
NM_003108chr2166391 6066 6036 6015 5844 5800 5348 4859 2415 2184 1704 1584 1304 1257 557 43 --26421 567 --
NM_003111chr22330 55 ----21234 992
NM_003112chr752909 2649 2191 947 671 ----1983
NM_003114chr83814 589 229 1537 2824 548 --
NM_003137chr651845 1741 1451 901 707 --11708 1325
NM_003144chr662182 1955 1914 1740 834 540 ------
NM_003184chr821018 41 1456 --177
NM_003189chr172940 2903 2878 2674 2132 1351 83 --12142 12778
NM_003199chr1875693 2097 2069 2062 1306 945 601 --14893 --
NM_003211chr12----11773 --
NM_003221chr663746 3662 3479 1117 1038 401 --13952 1103
NM_003236chr243320 3096 2849 389 --2245 166 --
NM_003246chr1532066 436 389 3706 400 64 31885 1550 512 --
NM_003253chr213741 505 82 1628 1187 --
NM_003262chr375109 3825 3353 3190 1596 949 359 25154 1123 ----
NM_003298chr344376 1534 1442 332 --46116 4863 4472 4314 --
NM_003304chr3--1174 --1106
NM_003340chr43507 250 229 11032 ----
NM_003342chr1752774 2206 357 174 132 22127 785 1247 --
NM_003350chr83389 259 137 --1101 --
NM_003368chr12178 75 --1573 --
NM_003372chrX----1104 --
NM_003376chr611685 --11909 --
NM_003376chr611685 --11909 --
NM_003387chr252816 2433 1842 518 363 --32176 59 36 --
NM_003392chr373467 3291 3201 2842 1232 581 575 13676 2151 110 1764
NM_003403chr14----1101 --
NM_003405chr221646 ----1314
NM_003409chr1851402 908 482 417 280 11270 ----
NM_003410chrX92849 2563 2401 1916 1887 1070 779 581 281 1123 --11054
NM_003411chrY21808 1140 31207 1169 118 21470 1455 --
NM_003412chr362469 2279 1929 968 555 77 1373 32360 941 731 --
NM_003423chr1951846 767 202 120 36 --1170 --
NM_003439chr773314 2566 2163 1376 1264 963 558 --32610 2214 640 --
NM_003463chr672882 2870 2793 2056 1244 762 34 ----1413
NM_003468chr273389 2756 1456 1286 1141 156 33 13285 43579 3479 1012 918 12884
NM_003471chr34686 541 355 273 --22355 1536 --
NM_003473chr101145 --1248 --
NM_003474chr1062331 2217 1914 1597 684 611 11842 1125 --
NM_003483chr1242827 2652 2595 435 12292 --2525 181
NM_003489chr2163111 2443 2385 1097 1024 74 1760 33287 3177 3141 12529
NM_003558chr9--179 1236 --
NM_003566chr1263423 2739 937 718 476 334 23101 252 11147 --
NM_003574chr18165448 5415 5299 5261 4978 4499 4305 3906 3653 2008 1972 1908 1459 1400 650 504 12015 35595 310 273 --
NM_003582chr1----1154 --
NM_003583chr1272893 2464 1329 1218 943 753 492 --23021 2435 --
NM_003603chr411516 --11412 --
NM_003615chr373890 3399 3125 1379 922 423 77 ----1965
NM_003617chr1124926 3771 3316 3300 3036 1647 1557 1336 1290 1233 812 369 23172 1799 11865 --
NM_003618chr221237 41 1851 41101 926 384 283 1870
NM_003622chr124559 538 419 326 --32033 792 750 --
NM_003663chr342656 2553 2191 1257 1864 22957 298 --
NM_003671chr9123443 3252 2705 2618 2564 2431 2221 1179 1130 582 41 22 --2761 355 --
NM_003677chr121378 11770 1845 --
NM_003679chr183218 3170 2707 2285 2133 978 428 342 1373 23002 2098 --
NM_003692chr93968 960 65 ------
NM_003702chr82713 697 --2836 44 --
NM_003722chr352159 2082 1884 520 217 --22405 998 --
NM_003750chr104996 949 740 326 ------
NM_003759chr4124138 3549 3182 2996 2761 2665 1595 805 604 594 84 49 --23845 498 --
NM_003763chr2053208 2530 1181 219 212 --21116 530 --
NM_003772chr1111172 ------
NM_003797chr11--157 ----
NM_003799chr1893870 3325 1653 1607 1059 821 628 375 193 --1246 --
NM_003822chr172256 2232 2208 1256 546 458 70 --13141 1371
NM_003825chr1541320 1137 1001 392 ----11224
NM_003829chr92921 806 11223 11242 1296
NM_003848chr32312 120 --1344 --
NM_003861chr1482528 2490 2210 2122 1031 917 514 390 32175 1848 784 1655 12624
NM_003885chr1772362 2084 2052 1056 955 634 246 12428 41979 255 156 50 --
NM_003895chr213693 310 58 150 22096 402 --
NM_003913chr6104207 3781 3645 3146 3073 2888 2867 1139 724 622 ------
NM_003927chr187852 803 760 674 340 212 120 --1684 --
NM_003930chr75897 789 498 488 468 12443 1283 --
NM_003939chr1083998 3617 3585 3081 2853 2645 595 262 ----1397
NM_003942chr111168 ------
NM_003956chr102471 364 ----1441
NM_003968chr32495 164 ------
NM_003980chr63949 297 42 --2928 484 --
NM_003983chr1684432 4220 4212 3533 1529 1004 858 805 --11272 13281
NM_003994chr12103527 3406 1656 1356 1283 782 750 536 280 240 1892 44413 1567 254 224 12791
NM_004024chr1101414 1213 1205 1158 1043 479 440 346 299 224 1358 11019 --
NM_004028chr18133751 3599 3425 3327 3150 3047 2881 2835 665 519 321 169 41 14024 1990 13796
NM_004073chr11314 ------
NM_004075chr122400 211 --1198 --
NM_004081chrY61522 1239 1224 593 563 331 ------
NM_004087chr361802 1669 1435 513 249 216 --11928 11631
NM_004090chr1773454 3275 3176 2625 2298 952 658 33379 2487 867 12701 1430
NM_004094chr1482905 2498 2447 880 705 512 252 32 ----2973 648
NM_004100chr662534 2448 2228 1030 790 458 --2299 144 --
NM_004113chr361977 1843 1388 580 373 262 --11354 --
NM_004136chr1532175 494 300 ------
NM_004171chr11179043 8532 8485 8447 8048 7252 7209 6924 5917 3404 3388 3336 3272 2474 1193 672 632 37163 7119 2719 48283 7028 6732 2338 19055
NM_004180chr2--1561 ----
NM_004232chr1873763 3620 3401 2765 1127 471 41 2815 809 13871 --
NM_004235chr93342 191 42 1866 ----
NM_004261chr11998 ------
NM_004262chr471287 1243 1108 450 330 306 300 1191 ----
NM_004274chr1473254 3162 3115 2587 2443 2092 2027 --13132 --
NM_004279chr732396 1808 240 151 22268 452 --
NM_004293chr9103783 3759 3044 1422 1226 1201 1028 1014 519 449 23029 1271 23290 2825 --
NM_004302chr1262920 2447 2014 430 349 241 21979 42 22831 1901 --
NM_004304chr2--1335 ----
NM_004331chr882526 2439 2298 2186 1909 1008 761 218 ------
NM_004338chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_004369chr2----1604 --
NM_004379chr221703 138 1380 1533 --
NM_004392chr1342617 1015 441 101 2761 417 32564 565 40 --
NM_004397chr1184337 4125 4070 3637 1631 925 807 326 32876 2708 107 31688 435 125 --
NM_004412chr10105953 5823 4888 4795 4642 4289 1691 642 536 306 22364 1184 35623 4624 1231 --
NM_004437chr173499 3395 2879 2867 2680 1058 222 12553 53231 3070 2333 380 197 --
NM_004439chr41140 ------
NM_004440chr671692 1441 1415 1311 530 330 45 12002 51222 704 682 447 319 --
NM_004457chr251698 1513 1348 1162 250 --21116 388 --
NM_004458chrX62596 2478 1779 808 619 63 ------
NM_004459chr17139 --21965 1842 --
NM_004464chr464189 3463 1058 374 337 266 --23858 785 --
NM_004496chr14----41356 943 848 470 --
NM_004501chr153497 3483 3340 2561 203 21595 614 33828 1055 340 1430
NM_004504chr243057 2001 1133 700 11933 2897 510 --
NM_004516chr194826 272 262 155 --1858 --
NM_004529chr921442 317 --1951 130
NM_004540chr211651 --1215 1322
NM_004576chr5--1131 ----
NM_004580chr1561779 1451 1409 1156 486 282 1755 ----
NM_004586chrX84796 4159 2163 1785 1466 905 794 746 --14202 --
NM_004612chr994675 4311 4252 3366 3258 3165 1446 686 551 11296 23701 3085 --
NM_004634chr31468 ------
NM_004643chr14------164
NM_004650chrX61274 482 474 403 293 182 --11354 21179 413
NM_004654chrY51271 1025 962 430 123 --11103 --
NM_004663chr153612 478 302 --1447 --
NM_004680chrY1123 ------
NM_004703chr1782265 2053 1781 1019 599 590 410 387 ------
NM_004719chr1282628 2398 2366 2157 2050 1154 261 22 ------
NM_004726chrX105709 5371 5262 4846 4276 4166 3519 1466 1459 368 14053 24688 336 --
NM_004734chr13102503 2457 2237 2127 1118 972 568 461 449 229 --23047 763 --
NM_004744chr4113691 3406 3221 3012 2969 2837 1431 1347 533 250 168 12844 33415 1225 445 13430
NM_004745chr895950 5373 5220 5214 1716 1654 1268 1108 382 15239 11776 16295
NM_004748chr15114074 3741 3656 3248 3151 1578 1319 1078 1005 217 93 --53780 3761 3585 1090 377 --
NM_004760chr742455 2130 280 21 ----12240
NM_004772chr52207 137 ------
NM_004775chr1842377 942 255 115 21919 1740 2638 515 --
NM_004776chr20113363 3030 2879 2658 2140 1134 812 749 451 190 97 --1726 --
NM_004788chr1142168 2077 576 140 --1181 21038 746
NM_004796chr143856 157 93 31554 907 103 ----
NM_004798chr20113557 3343 3333 2440 1283 1218 1178 1137 1120 480 98 --11428 --
NM_004799chr11438 --1299 --
NM_004804chr252781 2367 1015 978 153 --22477 1859 1198
NM_004805chr221310 110 --11397 1434
NM_004808chr10102834 2536 1319 1141 1014 706 238 83 65 24 13379 --12212
NM_004815chr154255 3028 381 103 73 34124 3710 1099 23882 1584 --
NM_004824chr661308 1280 1231 330 128 49 ----11034
NM_004827chr471957 1187 644 605 545 276 181 --1757 --
NM_004834chr2103024 2960 2517 2394 2324 2198 1319 819 321 54 12211 21105 688 --
NM_004849chr611457 1424 ----
NM_004856chr153456 96 26 1470 --1596
NM_004857chr14104444 3958 3933 3607 3320 3217 1206 938 826 110 11193 34393 3560 47 --
NM_004859chr1782139 1892 1114 962 926 727 300 197 --2272 122 --
NM_004863chr14115353 4738 3832 3800 2085 2063 2011 1403 1338 1316 77 --44475 4341 898 28 1371
NM_004866chr5104751 3876 3812 3446 3158 2017 1960 1236 496 352 24445 3899 24397 704 1625
NM_004896chr1051455 1335 1147 600 222 1511 11581 --
NM_004898chr442190 1900 1026 267 12637 --12393
NM_004904chr7156071 6058 5949 5780 5734 5157 4928 4913 4053 4014 2170 1981 1899 1298 467 179 25038 34 --
NM_004921chr151997 1893 1657 696 209 11645 21637 551 12431
NM_004924chr19--1767 1413 1749
NM_004956chr7124376 4326 4244 4224 3915 3852 3783 3750 3387 1666 1376 64 14063 14149 1924
NM_004965chr211716 ----1694
NM_004972chr941137 1043 845 205 1784 11005 --
NM_004976chr11124501 1812 1644 1536 1247 1172 1153 1033 672 527 166 153 1256 24656 1695 --
NM_004982chr124662 614 217 77 ----1288
NM_004992chrX177559 7298 6890 6767 5142 3358 3025 2807 2680 2628 2614 2315 1753 1464 1358 606 39 38111 1094 974 27567 1199 18043
NM_004992chrX177559 7298 6890 6767 5142 3358 3025 2807 2680 2628 2614 2315 1753 1464 1358 606 39 38111 1094 974 27567 1199 18043
NM_004999chr6114523 4094 3333 3286 3081 2786 2765 1376 591 580 326 ------
NM_005010chr792011 1777 813 766 533 453 429 333 236 1604 ----
NM_005036chr22218269 8108 7633 7606 7412 6286 5911 3043 2320 1839 1780 1670 1650 1586 999 781 571 226 192 184 114 12988 38006 7895 581 17127
NM_005056chr12125511 5237 5128 4917 4548 4233 3539 1878 1025 951 857 840 --34800 2061 1381 --
NM_005065chr1495226 4982 4399 4239 3873 958 648 511 460 21616 1542 11913 --
NM_005079chr832709 2467 2221 12897 33150 2422 2344 1490
NM_005093chr2094580 4459 4410 3673 3486 3316 1030 865 523 --31918 1315 1088 --
NM_005109chr362021 1737 719 463 436 91 ------
NM_005114chr41658 --170 1249
NM_005121chr1773720 3394 2763 1320 888 350 33 ------
NM_005135chr1543661 2977 970 775 1273 33716 442 165 --
NM_005151chr1852191 2039 1939 1796 72 --12124 --
NM_005154chr152649 482 ------
NM_005156chr9144975 4754 4355 4293 4287 4171 3820 2071 1744 1737 1656 1641 1434 1391 11023 14206 --
NM_005159chr1542069 1467 889 173 1442 --12308
NM_005164chr1242541 2121 693 450 1755 2846 827 --
NM_005188chr11138180 8136 7974 7772 7309 7231 6467 5903 5827 1519 1023 843 334 46865 5527 1776 1541 28306 7902 12118
NM_005197chr14155975 5958 5368 4519 4207 4156 4001 2474 2399 2227 2106 1613 504 366 223 22424 1819 1191 --
NM_005233chr331844 1823 1029 --12309 1277
NM_005235chr2156535 5841 4893 4828 3072 2816 2347 1666 1641 1242 751 567 483 264 202 15004 27730 422 11200
NM_005238chr1183388 3226 3128 788 377 188 106 46 1494 23586 1407 --
NM_005245chr4--1615 ----
NM_005256chr11------1961
NM_005257chr182912 377 1266 21394 899 --
NM_005261chr81306 1763 1322 --
NM_005313chr1571387 1338 1060 952 887 388 350 170 31117 1097 33 --
NM_005339chr481550 1148 930 867 796 693 537 511 14231 12985 12738
NM_005342chrX82731 2117 2022 1134 1078 752 701 414 ------
NM_005347chr931461 1385 1087 --3203 75 49 --
NM_005358chr1341393 1253 271 115 --21428 1247 --
NM_005359chr18136530 6403 6011 5955 4882 4215 4064 2616 2504 1643 1213 214 193 --16147 15023
NM_005385chr382434 2007 1005 675 632 479 398 386 --1160 --
NM_005397chr7123700 3685 3521 3515 2929 2592 1496 1115 1032 862 381 38 --33883 3580 3482 --
NM_005398chr1061468 1382 1309 1093 559 156 ------
NM_005399chr184287 3264 3042 1777 1042 549 347 170 12745 13614 --
NM_005406chr181548 ------
NM_005414chr3----185 --
NM_005426chr13856 288 127 --1159 135
NM_005433chr1862796 1118 664 656 333 273 1230 2671 49 --
NM_005436chr10123852 3786 3389 3349 3189 3019 2840 1462 1363 1335 550 314 --11597 --
NM_005475chr1263112 2940 2013 949 855 318 13037 23091 971 12808
NM_005497chr17125931 4884 3980 3850 2390 2259 1305 1025 516 337 258 225 --22013 1362 12205
NM_005502chr963133 2841 2336 2123 809 85 ----143
NM_005509chr51460 11230 ----
NM_005513chr331515 1401 1077 --11417 --
NM_005526chr81271 ------
NM_005530chr151479 1342 31527 952 189 --
NM_005544chr21666 --1287 1765
NM_005578chr364185 4154 3635 1688 614 35 13987 31915 555 225 --
NM_005596chr9105939 5924 5872 5368 4099 3934 2259 1150 1117 83 14066 45893 4521 4005 964 --
NM_005637chr1822082 275 ----1769
NM_005652chr162418 25 ------
NM_005662chr8----1124 --
NM_005667chr21147 ------
NM_005668chr5114510 4501 3469 3106 2948 1668 481 365 356 229 124 ------
NM_005669chr522178 569 --22213 2038 --
NM_005715chr692833 2180 2096 1779 1035 916 751 728 110 --12131 --
NM_005717chr11375 ------
NM_005722chr272273 1983 1953 1924 1809 1792 1568 1550 2882 651 --
NM_005724chr151327 1279 --1652
NM_005725chr1102096 1969 1790 1639 1574 947 648 424 351 295 2730 581 2465 333 --
NM_005737chr292835 1963 757 641 311 175 117 96 46 32230 1823 272 ----
NM_005739chr1542245 2011 1622 212 21587 800 180 --
NM_005744chr151129 ------
NM_005746chr782628 2298 2207 1985 1835 1797 821 277 1588 ----
NM_005748chr1283035 2850 2492 2334 1202 428 391 146 --22615 534 --
NM_005759chr294735 4665 4572 3771 3734 1583 1489 1441 1185 11163 34789 4499 3603 --
NM_005778chr31442 ------
NM_005792chr161438 --1415 --
NM_005795chr231985 1147 120 22675 1140 152 11880
NM_005797chr1141745 1625 42 36 ----11818
NM_005802chr92617 57 128 ----
NM_005819chr1143512 3475 3249 2961 2863 2727 2469 2437 2256 1378 1322 708 623 500 1268 22704 2672 --
NM_005824chr72309 261 ----174
NM_005828chr1764854 4813 3299 1822 996 837 --21290 521 --
NM_005840chrX157383 7327 6834 6805 5183 4680 2475 2164 1703 1649 1407 1273 1154 291 26 15931 12969 35553 5060 1818
NM_005875chr3125 ------
NM_005880chr1631331 1107 1100 --1426 --
NM_005899chr1731585 1237 180 --11114 1416
NM_005901chr18127323 7077 6955 6756 6446 6058 5845 5808 5429 2960 2468 1287 26079 996 33105 1779 849 17226
NM_005903chr5104737 4638 4413 4154 3827 3623 3438 3253 1486 1180 --65200 4853 4185 3756 1772 816 12019
NM_005909chr573979 1387 1230 1046 769 640 392 23023 2667 23712 1364 --
NM_005930chr141651 --1316 --
NM_005935chr4105124 5067 5035 3809 2034 1607 1480 960 782 246 25145 35 31660 1267 543 --
NM_005941chr863788 3402 3246 2658 2564 1083 33898 2752 1023 43682 2908 2871 68 --
NM_005955chr185413 5386 5197 5187 4134 4023 1669 1481 11297 13912 1174
NM_005996chr1221079 1016 ------
NM_005999chr131398 1012 37 ----1496
NM_006003chr19----1109 --
NM_006007chr984284 3230 1052 900 737 268 174 68 --21684 415 --
NM_006016chr662044 1825 852 649 389 380 1915 126 1550
NM_006037chr264170 4024 3430 1746 1513 731 --14569 13911
NM_006047chr2083270 3112 2380 2288 613 405 350 215 12315 13331 12539
NM_006054chr1171431 1076 615 595 324 227 211 ----1201
NM_006055chr273036 2971 2261 1975 779 283 135 13234 ----
NM_006080chr752730 2203 1998 1953 211 12935 11070 22420 1198
NM_006085chr131040 529 208 2479 405 ----
NM_006089chrX81760 1699 1558 693 456 438 132 124 ------
NM_006094chr841992 942 72 52 --32278 2251 1497 --
NM_006095chr443678 2809 1547 1518 148 23930 461 --
NM_006106chr1153378 3302 3080 2381 211 --13220 11138
NM_006141chr161551 1820 22441 1878 --
NM_006153chr31121 ------
NM_006154chr1552732 2632 2142 2098 1158 180 1815 1874
NM_006167chr861590 869 711 526 397 376 12182 --12228
NM_006196chr2----2320 138 1329
NM_006203chr5115078 4122 3846 3568 2116 1577 1490 648 590 425 249 24466 1698 34939 2023 1850 33712 2086 1567
NM_006218chr32129 117 ------
NM_006224chr1732466 2256 803 ------
NM_006226chr231236 555 400 11212 142 11047
NM_006242chr2052051 1824 1615 1578 1379 11343 11843 --
NM_006251chr563240 3102 2593 2368 890 387 1628 22866 979 --
NM_006252chr1147029 6988 6002 5977 5882 5558 5493 2957 2552 2451 2377 2322 688 460 36511 2900 2209 35835 2484 579 11960
NM_006255chr144308 149 104 33 --31109 929 132 --
NM_006256chr162683 2015 1820 742 735 657 --11832 --
NM_006258chr1071550 1424 1337 1326 1212 377 154 11463 ----
NM_006264chr41477 ------
NM_006275chr2062363 2294 1926 1812 762 417 1206 ----
NM_006282chr2074704 3343 3017 2924 1218 1095 259 --23561 1206 --
NM_006283chr8104396 4349 4089 3803 3768 3471 1742 1551 1144 592 --34507 659 577 --
NM_006298chr663242 3193 3178 2195 1350 953 22508 2384 22759 291 12477
NM_006306chrX105842 5535 5436 5234 4564 3618 3579 1053 442 150 --25629 5126 11301
NM_006371chr3144894 4887 4722 4533 4266 3697 3541 2012 1956 1719 1412 1387 1359 1019 11093 ----
NM_006379chr73776 366 296 ------
NM_006393chr1094416 4224 4090 3895 3637 3267 2778 1323 501 ------
NM_006407chr321413 436 11075 --1299
NM_006420chr2083373 3104 2875 2719 1223 1056 979 524 23384 647 ----
NM_006421chr84974 835 371 53 ----1324
NM_006434chr1063278 2074 890 676 399 357 --1212 --
NM_006451chr51772 ------
NM_006457chr442850 1467 866 480 1416 22599 297 --
NM_006482chr1272893 2464 1329 1218 943 753 492 --23021 2435 --
NM_006496chr14423 385 302 160 --1502 1209
NM_006520chrX21479 321 1424 141 --
NM_006534chr2093234 2238 1323 733 433 381 370 158 106 11294 23361 616 1820
NM_006538chr2103972 3420 2983 1614 1259 601 496 397 285 189 --12533 --
NM_006544chr14116020 5916 5774 5421 5027 4345 4209 1370 1277 989 794 35172 4969 1419 1982 --
NM_006546chr1765308 2674 2166 1887 987 161 14954 46370 6271 1874 565 --
NM_006557chr971343 554 529 333 225 219 137 --1708 --
NM_006561chr1056033 5082 1707 1117 857 11453 36107 1687 890 12318
NM_006575chr1421218 144 --1568 --
NM_006577chr221251 890 ------
NM_006599chr16136360 6132 5971 5843 5770 5310 5192 5166 2360 1853 1327 1306 148 66233 5227 2526 899 262 71 --37008 6954 1282
NM_006601chr12172 --1966 --
NM_006603chrX61679 1667 1431 567 468 183 --1621 --
NM_006618chr161630 1196 1048 152 88 44 ----21068 219
NM_006620chr6114879 4712 4121 3862 3840 1943 1554 1053 523 84 62 1855 44682 3532 1498 1354 --
NM_006624chr1061670 1357 665 387 240 87 ----1380
NM_006629chr18102732 2722 2568 2107 2005 1910 1834 1055 732 293 --12676 --
NM_006646chr1392389 2274 2072 2012 1938 1011 867 727 696 ------
NM_006699chr182489 2329 2100 842 678 499 491 338 --32627 2262 2136 --
NM_006713chr5--1621 1119 --
NM_006718chr62400 145 1364 1837 --
NM_006720chr1053311 1680 697 539 91 24221 1924 54907 3709 1617 348 34 --
NM_006722chr372781 2599 1197 1136 981 388 157 ------
NM_006729chrX115619 5558 5020 4938 3876 3503 2058 1481 561 388 64 --1983 1399
NM_006731chr9145801 4844 4782 4497 3950 3536 1512 1494 950 618 602 570 408 25 33677 1677 1453 11219 --
NM_006734chr641437 1350 1031 310 11144 11369 1149
NM_006746chrX71414 1353 1292 1194 415 335 136 1145 ----
NM_006748chr881555 666 387 329 296 255 178 37 1479 3564 534 344 11121
NM_006750chr16217515 7502 7398 6499 5395 5368 5252 3208 2702 2315 1885 1540 1445 1308 1029 647 640 289 158 116 23 --26413 1901 --
NM_006751chr23988 885 310 1181 ----
NM_006756chr8----11375 --
NM_006763chr172103 1511 729 697 420 222 81 ----21803 102
NM_006766chr882435 1784 663 522 327 294 231 49 12134 22680 2322 --
NM_006777chrX52931 2299 1965 589 282 1615 --32773 2507 2058
NM_006805chr521485 1199 --21566 410 --
NM_006806chr213395 325 284 ------
NM_006814chr2082022 1986 947 643 622 383 364 333 --22087 1750 --
NM_006827chr1473162 2348 2326 2119 1133 854 124 ----12072
NM_006828chr6197 --2510 41 --
NM_006873chr262859 2587 2547 2518 1158 836 13013 13059 --
NM_006885chr1644131 3159 1614 782 11172 11196 --
NM_006902chr142043 1331 667 135 1282 23367 2528 13138
NM_006912chr152434 2363 2318 662 223 12421 12479 21690 917
NM_006914chr951391 1046 324 296 154 31361 1293 128 ----
NM_006922chr262486 2462 1990 1958 736 472 --21926 547 --
NM_006924chr1743144 2786 1533 391 --23197 737 --
NM_006939chr142880 470 --2250 146 --
NM_006997chr101175 ------
NM_007011chr15135573 5369 4690 4498 4434 4201 2593 2383 2136 2115 1079 480 364 21517 1507 25108 428 --
NM_007027chr31583 --1109 --
NM_007038chr21106026 5374 4544 4401 4295 3906 3709 2285 919 292 12030 34185 551 523 11699
NM_007039chr1492287 2141 1950 1897 1839 1718 1546 676 215 22021 1960 12007 --
NM_007043chr1221483 535 128 --1847
NM_007050chr2096914 6500 6344 2692 1921 1891 1647 740 730 32922 2440 1390 16225 --
NM_007054chr543986 2446 460 348 23246 2988 1153 --
NM_007078chr1072897 2178 2046 1088 465 345 264 --1273 --
NM_007106chr1382469 2270 1948 1055 399 174 167 118 21843 331 --12221
NM_007112chr1232 25 ------
NM_007114chr352973 2845 2703 383 307 192 --1954
NM_007124chr621672 1361 ----21967 379
NM_007137chrX114147 3581 2145 2104 1555 1114 1082 1024 921 659 197 --11844 --
NM_007146chr1752663 2545 2021 448 372 2438 277 21999 1771 --
NM_007153chr19144406 4157 4083 4033 3893 3193 2990 1056 905 597 429 260 91 57 11508 53799 3625 3558 2957 141 34022 2950 1312
NM_007159chr321704 119 11641 ----
NM_007166chr1131219 392 180 --2364 210 11146
NM_007172chr2242671 2205 1191 605 125 53137 2170 291 199 101 --
NM_007195chr1893495 3481 3448 3022 659 545 345 246 133 --1675 --
NM_007203chr9153736 3655 3587 3357 2795 2778 1420 1389 1115 1026 764 584 352 323 278 --1217 --
NM_007217chr3----2289 247 --
NM_007249chr13249097 8405 8382 8370 7976 7804 7690 6133 5786 3194 3061 2970 2882 2474 2411 2282 1939 1704 1551 1297 1050 876 784 191 47042 2539 1920 1863 32751 1024 33 --
NM_007269chr13639 552 429 --1137 --
NM_007287chr342295 2199 395 374 22842 1217 21246 491 --
NM_007288chr342295 2199 395 374 22842 1217 21246 491 --
NM_007289chr342295 2199 395 374 22842 1217 21246 491 --
NM_007324chr11438 --1299 --
NM_007350chr1274569 3870 3376 3263 3173 968 38 11591 24276 468 --
NM_007373chr103663 430 158 --1574 --
NM_007375chr122209 987 1363 2642 97 21990 173
NM_012096chr383665 3605 2827 2689 2589 502 455 393 13398 23619 278 12878
NM_012108chr4--3137 131 78 ----
NM_012120chr673010 2445 2419 1138 1003 799 279 --1724 1648
NM_012137chr162749 1941 1830 680 662 339 22482 238 22048 920 --
NM_012141chr1384186 3944 3765 3362 3281 3229 1463 477 13462 11534 --
NM_012153chr1152504 2131 1981 758 625 --22119 60 22216 1954
NM_012158chr1311470 ----11642
NM_012160chr61205 1445 --1100
NM_012164chr9117301 7125 6891 2823 2029 1978 1856 979 778 735 474 --24810 1747 16581
NM_012193chr11135226 4865 4724 4534 4228 3895 3735 2078 2063 1224 1164 770 550 --1966 --
NM_012199chr174069 3549 3423 3187 3121 1732 805 --14264 1481
NM_012214chr2145560 5510 5196 4844 4811 4715 4360 4243 4220 4112 3907 2404 1473 1194 25115 4398 25230 4687 --
NM_012247chr10--1228 ----
NM_012249chr282380 1310 619 541 319 307 155 135 12818 12475 --
NM_012252chr7155299 5230 5030 4766 4638 3807 1989 1618 1509 1315 1095 932 749 712 570 21999 330 1150 14957
NM_012255chr20------1347
NM_012262chr175058 5026 3580 3513 1966 1908 699 14781 ----
NM_012281chr75825 489 280 51 28 12049 11865 11654
NM_012287chr374375 3829 3676 2825 974 421 183 22872 536 14513 --
NM_012294chr793866 3763 3316 3065 1628 1602 1570 557 365 --23831 1270 --
NM_012297chr432236 695 277 1220 1226 --
NM_012309chr11134902 4642 4473 4444 3927 3868 1939 1924 1895 1275 992 921 859 23674 1557 --13949
NM_012311chr102501 263 --1164 --
NM_012316chr164095 3954 3834 919 611 55 33944 1627 310 24223 1220 --
NM_012334chr5113917 3864 3850 3712 3612 1114 939 484 350 267 100 1711 11274 --
NM_012345chr1331482 283 240 --21184 309 --
NM_012347chr6102913 2583 2245 936 883 618 476 191 157 60 ------
NM_012382chr5124300 4017 3578 3488 3434 3098 2987 2760 1554 1447 1222 93 --13090 --
NM_012388chr1563158 2510 2423 2092 1173 682 --1585 --
NM_012416chr93914 379 87 1141 21112 359 --
NM_012433chr22267 102 ----1121
NM_013231chr14104020 3429 2974 1319 676 640 513 304 282 49 24199 925 12918 1891
NM_013250chr1141319 1183 465 44 1139 11100 --
NM_013255chr7158860 7922 7413 6604 6385 5591 5369 3000 2788 2140 1771 969 796 605 102 38828 3424 640 32405 1853 888 1282
NM_013257chr842375 2358 2106 2019 --21901 180 --
NM_013261chr4113445 3325 3283 2714 2658 1337 1207 1024 461 379 155 22950 733 12480 --
NM_013262chr621457 527 --21437 419 1407
NM_013269chr12124304 4128 3604 3361 1544 1503 1454 1151 1145 645 402 46 33934 2990 559 31295 364 77 --
NM_013296chr12310 77 ------
NM_013301chr19--1370 ----
NM_013309chr1562498 1910 1825 1796 1066 790 --2914 325 --
NM_013313chr2283479 3222 3210 3037 2738 1003 946 818 ----21395 252
NM_013372chr1573394 3349 2275 2167 976 632 106 ----13247
NM_013374chr352933 2767 2387 642 480 ----12321
NM_013380chr191174 --161 --
NM_013410chr1--11264 ----
NM_013446chr71378 --21251 125 --
NM_013450chr23327 143 42 --1252 1484
NM_013943chr1113188 2685 2375 2329 2001 1051 864 814 561 338 45 12232 --12075
NM_013989chr14115156 4446 4149 3826 3645 3411 1839 1613 1299 129 21 24126 1826 33628 297 64 --
NM_014011chr272041 1931 999 943 654 465 326 1196 1307 12200
NM_014016chr33661 151 52 --11556 --
NM_014021chr143357 2660 2189 810 --1640 1794
NM_014034chr62610 375 152 2510 101 --
NM_014043chr341212 561 215 170 11360 --1662
NM_014048chr16134642 4445 3960 3929 3475 3401 1376 1177 1010 957 273 124 42 13909 54300 1563 1525 1280 917 --
NM_014058chr42304 78 1586 ----
NM_014112chr8104609 4479 4291 3462 3456 3389 1461 1174 349 205 1310 25305 1333 --
NM_014141chr7114958 4552 4537 3779 3388 3352 3247 690 566 537 359 24177 1631 ----
NM_014149chr71582 ------
NM_014155chr11217119 7073 6462 5485 5263 4857 2701 2632 2609 2573 2510 2162 1265 945 902 515 250 203 126 60 24 26885 6428 46289 5278 983 399 --
NM_014178chr14----170 --
NM_014181chr262693 2356 2007 981 580 562 --1680 --
NM_014240chr3114122 3591 3481 3178 3135 3048 3033 1623 1183 863 497 --2927 750 --
NM_014243chr42201 130 1647 41858 1836 1774 409 --
NM_014253chrX61904 1014 377 319 239 88 --11915 --
NM_014263chr1021002 43 ----1229
NM_014268chr18159 --11135 --
NM_014289chrX31146 903 96 ------
NM_014296chr351444 1108 621 569 61 1180 31525 329 163 11303
NM_014309chr2285205 4408 4304 3621 3479 1522 1083 135 33319 572 393 171 13970
NM_014317chr10----154 --
NM_014331chr4217342 7171 7126 6995 6712 6645 6391 6373 6057 5888 5850 5458 4774 2997 2601 2254 1931 1758 1536 671 326 37390 2458 88 26187 2204 11896
NM_014342chr112528 342 152 ----
NM_014344chr111830 ------
NM_014350chr541051 986 934 299 --2423 81 --
NM_014363chr1321013 129 ------
NM_014372chr132071 647 76 --1842 12010
NM_014381chr14143279 3139 3091 3038 2941 2776 2202 2195 2117 1139 1034 953 610 27 22760 2628 ----
NM_014396chr751773 1622 882 347 179 --31720 737 701 --
NM_014423chr595259 4881 3875 2009 1869 1292 819 501 98 --24338 481 --
NM_014447chr4--11606 --165
NM_014454chr62347 202 --31093 387 331 --
NM_014456chr1041623 1159 621 331 11218 1479 --
NM_014571chr192898 2750 2117 1967 1961 1862 1136 1126 926 --22247 1010 --
NM_014585chr251033 993 784 353 71 1128 ----
NM_014586chr21194379 4282 4125 3918 3852 3782 3756 3717 3428 3363 1801 1782 1506 1332 1117 1071 1055 411 53 ------
NM_014607chr242029 1922 429 235 21510 332 11373 --
NM_014613chr592958 2948 2777 2671 1961 1144 858 602 426 --12377 11027
NM_014630chr1593576 2862 1371 1354 1244 1009 695 483 390 1576 23883 3196 --
NM_014647chr1661830 1800 1663 887 839 247 123 1227 --
NM_014667chr3112464 2005 1988 1856 1822 1770 1614 777 535 464 309 2905 499 --1212
NM_014674chr373943 3645 2968 2721 907 765 749 --23439 868 --
NM_014677chr851136 482 281 202 196 --11189 1213
NM_014683chr1742086 1743 702 124 1285 --11967
NM_014701chr1541325 893 364 319 --31047 422 194 22868 2287
NM_014702chr663484 3477 3093 2251 1392 188 --11281 1555
NM_014721chr6116798 6193 5172 4553 2164 1637 1252 1198 1106 808 494 11724 26155 679 47338 2863 2472 1041
NM_014729chr821958 1563 11830 11991 --
NM_014730chr12175181 4878 4687 4593 4418 4379 3855 3617 3578 3487 3362 3341 2096 1801 1107 488 468 11233 54096 4030 1689 1375 315 23254 1246
NM_014730chr12175181 4878 4687 4593 4418 4379 3855 3617 3578 3487 3362 3341 2096 1801 1107 488 468 11233 54096 4030 1689 1375 315 23254 1246
NM_014732chr16115228 5072 4542 4519 4063 4039 2140 2065 549 149 30 25586 135 1303 --
NM_014733chr542287 719 677 570 12083 ----
NM_014739chr674217 4019 3807 1445 674 80 34 --22922 1459 --
NM_014746chr2103883 3079 2784 1732 1296 1232 1128 1018 999 742 --24246 383 --
NM_014752chr111725 --3494 412 78 --
NM_014764chr1241071 985 344 167 1899 --1363
NM_014766chr773724 3640 3313 2923 2817 690 669 1315 1950 --
NM_014774chr1103205 2788 2781 2686 2638 1062 997 984 640 495 ------
NM_014776chr1272892 2829 2780 2328 2293 840 71 --21008 508 --
NM_014781chr831161 1137 1062 1459 1858 --
NM_014787chr152718 1984 1085 1032 463 21896 548 2565 215 12516
NM_014802chr124906 796 245 156 --2112 22 --
NM_014803chr1062439 1899 1843 466 426 410 1809 42756 2295 754 716 --
NM_014810chr1113203 3173 2864 2706 2571 2427 2332 2281 1435 1127 712 --23094 628 --
NM_014824chr1141404 1355 757 305 3671 662 438 11839 --
NM_014839chr172151 2128 1913 1729 197 139 121 ------
NM_014871chr123246 167 57 ------
NM_014873chr194702 4360 4046 3924 3180 1596 1152 813 209 --24218 467 11036
NM_014877chr1775371 5244 5195 2652 2598 2145 1053 35010 2091 59 1925 --
NM_014883chr462022 1623 769 652 539 419 ----12555
NM_014892chr61403 1104 ----
NM_014898chr1972114 1597 874 722 460 231 139 --2380 218 --
NM_014899chr552854 1148 898 683 47 22749 2502 21242 1173 --
NM_014900chr24467 230 165 123 --11056 --
NM_014904chr10104029 3555 3290 2874 2683 2631 1143 788 355 251 --11192 11041
NM_014912chr1072695 2538 2352 1403 1066 950 197 --31377 1008 125 --
NM_014920chr642641 2558 2487 1124 23423 2773 23708 653 33165 3086 601
NM_014923chr1362363 1637 1479 707 639 400 --31513 944 720 --
NM_014932chr331857 1632 1442 --21570 133 31786 312 247
NM_014935chr193862 3134 2617 2399 1487 1269 677 467 386 23247 415 22524 1092 --
NM_014946chr272931 2885 2751 1923 369 344 103 32426 1989 991 12101 42862 2213 924 847
NM_014947chr153116 2682 2463 2447 591 1904 32035 1233 646 --
NM_014951chr103227 183 152 22607 1827 ----
NM_014962chr2042309 933 844 401 12599 1622 1206
NM_014982chr1475264 4812 4156 3804 1747 426 68 14674 34419 1315 693 24545 2119
NM_014991chr442327 1108 854 210 21068 333 1460 13160
NM_014999chr1221659 189 1112 11221 21546 1470
NM_015000chr1273050 1133 954 795 583 251 33 1887 32335 2145 1926 --
NM_015020chr16103481 3174 2919 2520 2507 2472 1441 1349 974 629 11154 ----
NM_015025chr272554 2519 2099 1671 995 956 480 --21973 533 --
NM_015026chr1274167 3905 3312 1466 486 421 77 ------
NM_015032chr1342817 2078 2010 691 --22835 373 --
NM_015035chr20146484 5645 4956 4902 4884 4826 2483 1942 1914 1682 1643 1360 126 62 15620 21269 26 --
NM_015039chr183898 3494 3446 3289 2744 1074 520 151 13656 23589 1411 13582
NM_015040chr262706 1263 465 409 57 50 12363 ----
NM_015042chr1574185 4094 3009 2916 2774 1686 213 13048 11609 1532
NM_015049chr242943 2504 2322 371 43063 3020 2754 1173 12530 --
NM_015051chr983353 3117 3072 2923 2771 2104 912 331 1765 --1821
NM_015059chr1574018 3918 3227 3174 2698 1595 1114 --21279 862 13737
NM_015064chr12103433 3002 1233 1178 1160 788 645 430 271 61 1422 33332 2507 618 --
NM_015068chr753654 3274 2446 1050 496 23082 2970 42940 1381 996 941 --
NM_015071chr5124444 4360 4221 4064 2556 2481 2242 2012 1983 1610 894 670 35919 5333 2530 15199 --
NM_015076chr693567 3513 1421 1210 1067 965 706 153 72 --33768 808 665 1756
NM_015090chr1126250 5601 4960 4780 3941 2498 1928 1640 1316 822 448 220 --34525 2178 848 --
NM_015091chr143796 328 58 ------
NM_015092chr16104444 4142 3811 3406 3166 2991 2959 2861 885 349 33842 1780 578 24233 607 13924
NM_015115chr431203 1003 730 1459 11964 --
NM_015132chr72627 260 21668 42 ----
NM_015144chr16173962 3433 3210 3056 2871 2695 2490 1551 1506 1188 1161 974 559 508 363 292 207 ------
NM_015154chr1541268 1044 613 48 12520 --2957 159
NM_015156chr1463990 2884 2695 1518 970 202 --11528 12496
NM_015172chr141249 1151 252 117 155 1476 --
NM_015192chr2073033 2545 2105 2041 302 289 216 --1158 --
NM_015199chr362433 2240 2012 440 274 233 32869 715 681 32337 854 181 --
NM_015200chr412422 22359 2325 ----
NM_015208chr1833601 3028 1018 1166 --12744
NM_015215chr14752 435 368 247 22594 837 23100 847 --
NM_015230chr441530 1158 607 492 --198 --
NM_015233chr1342389 2186 2031 282 ----1471
NM_015234chr63571 484 294 ------
NM_015247chr1645268 4802 1291 931 1866 35115 1887 802 --
NM_015250chr962074 2029 1870 1481 822 487 --21641 1334 --
NM_015251chr1632264 1986 1554 --12191 --
NM_015265chr232674 1876 483 ----1369
NM_015268chr3----1220 --
NM_015269chr1----1438 --
NM_015271chr484166 3931 1658 1501 1338 966 587 367 13075 --13661
NM_015275chr124643 449 194 43 11402 22058 591 --
NM_015277chr1881815 1675 1490 1435 720 597 546 245 ------
NM_015282chr2102766 2731 2382 1208 1042 701 628 538 239 229 --12745 --
NM_015288chr573552 1379 1327 1313 905 575 319 --21503 312 --
NM_015291chr173405 3211 2992 2505 1201 137 72 --23249 1017 --
NM_015299chr14103971 3875 2770 2701 2682 1457 1209 1151 633 402 --33882 3825 3117 --
NM_015310chr8248075 8037 7619 7589 7532 7197 7148 7056 6964 6850 6778 6655 6381 6137 5485 5096 3338 2481 1883 1575 1412 623 499 471 36889 1691 1486 35408 2107 361 25897 5210
NM_015313chr1193954 3271 3222 1925 1903 1435 1422 1232 282 13717 ----
NM_015317chr23910 609 585 2848 438 148 --
NM_015328chr762227 845 612 156 40 24 --2567 76 --
NM_015335chr1272500 2295 1863 1741 661 467 62 12642 ----
NM_015336chr1252076 1958 1064 800 99 --12413 --
NM_015352chr20103447 3169 3044 2857 1380 1320 1245 525 387 185 1979 23942 2772 --
NM_015355chr1721963 322 11679 --169
NM_015365chrX53135 1688 882 863 277 ------
NM_015375chr1134461 4308 3749 3709 3583 3467 3351 3256 1242 771 421 109 70 1566 --14740
NM_015385chr1063278 2074 890 676 399 357 --1212 --
NM_015387chr232101 1436 339 --21336 252 --
NM_015409chr1282671 2388 2027 1993 1801 840 679 322 ----12296
NM_015436chr483139 2961 2777 2479 1093 457 361 24 22737 2635 ----
NM_015455chr573600 3556 2952 1606 1041 672 104 13194 13331 13240
NM_015458chr8125075 4830 4809 4395 4119 3747 3730 1776 1386 1358 734 28 ------
NM_015460chr311666 --1712 22112 1942
NM_015461chr18127 --1601 --
NM_015525chr64459 350 244 182 ------
NM_015530chr2----1234 --
NM_015532chr1592641 2204 2062 2029 1991 1847 1773 1107 570 12754 32398 598 454 12800
NM_015535chr243256 2799 1235 420 33158 2779 2614 34148 797 366 --
NM_015550chr752362 2350 1078 782 527 --2716 401 --
NM_015554chr1542288 2238 2030 795 ------
NM_015564chr5113488 2933 2839 2513 2439 2323 2199 1431 1136 1073 509 ----23308 3013
NM_015565chr2161958 1788 752 413 308 217 1671 ----
NM_015567chr1341010 950 877 330 ------
NM_015568chr2094310 4033 3808 3486 2980 2737 1662 1488 434 --1126 --
NM_015569chr1114237 4165 3885 3716 1565 1283 1104 1098 1055 549 539 --2960 614 --
NM_015578chr1961984 1953 1422 687 536 80 --1647 --
NM_015602chr16546 474 205 79 72 43 ----195
NM_015610chr772543 2412 2221 2198 862 56 37 11109 22676 2649 --
NM_015642chr3182 ------
NM_015678chr1351566 1302 603 492 323 --11743 --
NM_015711chr192824 808 ------
NM_015713chr8123475 3087 2892 2631 2373 1140 1095 832 623 600 577 239 1544 22593 99 1845
NM_015852chr7183609 3482 3083 2288 1402 1237 1156 1072 988 904 820 568 484 400 316 243 232 64 --43071 618 534 198 --
NM_015886chr855446 2189 2092 1141 75 55472 5378 4662 4435 1632 --1989
NM_015939chr203661 105 99 ------
NM_015948chr6129 ------
NM_015975chrX31796 1376 1342 ------
NM_016003chr772543 2412 2221 2198 862 56 37 11109 22676 2649 --
NM_016009chr1154948 4699 4582 4195 4172 3095 1890 1174 628 472 395 283 202 188 176 14188 64597 3753 1523 1510 1314 437 --
NM_016018chr85435 289 240 161 26 --1457 --
NM_016021chr632382 1885 981 13016 32704 1011 74 --
NM_016023chr852202 2139 1601 866 221 --12093 1676
NM_016025chr1621710 734 --11376 11355
NM_016070chr17----1218 --
NM_016075chr1383081 2757 771 761 665 608 107 97 --23075 2408 --
NM_016083chr673986 3681 3090 2950 714 518 295 33147 2681 1546 2686 35 --
NM_016096chr832036 1580 403 ------
NM_016107chr521347 120 --2935 99 --
NM_016131chr221440 340 22058 353 21605 529 --
NM_016205chr471455 1216 990 208 111 65 33 1167 --1531
NM_016206chr3168652 8450 8121 8027 7756 7011 6800 6657 6443 5607 3294 3253 2675 1196 1063 793 18963 37298 2395 499 17834
NM_016217chr6103595 3144 2462 2287 1320 1254 1158 759 707 249 23214 448 23293 325 --
NM_016220chr7112152 2146 1936 1801 1459 936 483 403 319 151 66 --1386 --
NM_016224chr661624 1593 1458 828 794 262 --22201 808 --
NM_016248chr1363409 3302 3061 2606 1030 247 23519 3392 1851 --
NM_016255chr632502 2236 469 22845 2689 32626 294 166 --
NM_016260chr2147553 6558 6359 2932 2896 2568 1964 1827 1648 1595 1489 443 395 257 41945 1811 1231 354 22649 41 --
NM_016271chr1832084 1935 750 12226 ----
NM_016275chr362645 2156 1965 1767 1009 53 1620 ----
NM_016299chr10137 --122 --
NM_016315chr211614 ------
NM_016374chr111470 ----11564
NM_016374chr111470 ----11564
NM_016376chr17104028 3402 3222 3149 3109 2715 1224 808 603 133 ----13285
NM_016396chr1532902 764 511 1224 1279 --
NM_016436chr207966 856 745 696 620 544 510 ----1671
NM_016441chr222305 72 22386 509 11795 --
NM_016480chr53917 601 201 ------
NM_016485chr61627 ----21876 44
NM_016513chr642641 2558 2487 1124 23423 2773 23708 653 33165 3086 601
NM_016519chr4----1545 --
NM_016530chr1593750 3390 2741 1602 1558 1276 515 403 177 11068 1599 --
NM_016531chr4104211 3845 2969 2827 1620 1600 818 346 286 212 22995 2984 14114 --
NM_016542chrX--11203 ----
NM_016569chr1221079 1016 ------
NM_016570chr12----1469 --
NM_016578chr111511 ------
NM_016603chr51702 22111 1983 32253 860 318 --
NM_016605chr532182 2156 363 --12211 --
NM_016613chr452181 958 617 521 512 32615 2038 1071 12672 --
NM_016621chr11114443 4072 3225 3167 1755 1508 1400 776 637 101 47 --14216 --
NM_016639chr162544 529 ------
NM_016652chr2081760 1699 1544 1426 1292 1123 569 55 11639 2707 185 11255
NM_016929chr674483 4398 3447 1838 1045 410 140 13529 21758 38 --
NM_016953chr2156048 5440 5386 4104 4034 3991 2444 1133 1044 1004 532 507 461 292 181 1618 15300 --
NM_017412chr831367 506 447 1400 41419 561 482 198 --
NM_017413chrX72511 2416 1581 822 805 461 210 --12391 --
NM_017415chr594473 4139 2841 1408 1370 1268 1157 723 118 --21621 604 --
NM_017420chr14123029 2979 2944 2783 2721 2595 976 602 309 240 177 64 --22616 1109 --
NM_017437chr143210 154 103 1401 --1699
NM_017440chr12--1647 2588 185 --
NM_017516chr1131055 837 30 --193 122
NM_017540chr5123259 3056 3012 2713 2707 1984 1037 1029 920 758 319 198 --11048 --
NM_017544chrX2807 257 --1150 1973
NM_017563chr3136382 6260 6119 5957 4700 4234 1946 1898 1811 1660 1512 1370 510 15033 12552 --
NM_017580chr1061846 724 595 572 240 189 ----12055
NM_017599chr1262114 1739 1335 353 313 129 2655 525 --11588
NM_017628chr464993 4377 4048 2131 981 95 24915 4179 1618 1127
NM_017633chr6113583 3252 3074 2935 2626 2425 1579 1261 725 620 489 --13144 --
NM_017637chr9128884 8532 7854 7610 7590 7541 7238 6930 6821 3331 2802 494 28856 8544 37350 6862 452 --
NM_017643chr1742212 2086 1020 48 22006 687 42276 638 286 238 --
NM_017644chr395061 4089 3967 3683 3552 2087 1875 600 72 11951 14437 11435
NM_017650chr7105741 5436 4868 4734 3745 1581 1415 681 469 335 24784 315 31213 983 131 15475
NM_017658chr1464454 3635 3618 3080 1515 1304 12838 24590 4322 --
NM_017666chrX21978 1814 --11955 --
NM_017667chr7--1446 ----
NM_017676chr561867 1488 1301 447 238 214 ----11335
NM_017694chr261555 1368 462 431 280 241 ------
NM_017705chr1563805 3531 2826 2744 571 524 --43068 2843 1137 400 --
NM_017709chr1114276 3771 3638 3588 1158 1141 757 609 335 194 105 --31666 1291 828 --
NM_017736chr1663055 2785 2234 1973 935 574 22684 593 22634 627 --
NM_017737chr141488 772 299 291 --1728 21933 839
NM_017741chr422409 2259 1469 ----
NM_017753chr94899 390 259 215 1936 ----
NM_017754chr6104805 4193 4047 3222 3190 1630 1515 585 547 432 34762 3467 1132 24853 3872 --
NM_017769chr1432774 2709 739 1622 --12348
NM_017813chr884383 4377 1897 1688 1460 1025 885 356 --34086 3951 3689 25285 5095
NM_017831chr1844724 1437 1185 730 1805 1940 --
NM_017847chr162030 2004 1511 1500 669 37 ----11702
NM_017848chrX83916 3844 3482 3279 2828 1679 1514 1484 11547 33306 3133 1703 --
NM_017915chr1231183 484 179 1933 --21074 448
NM_017919chr993967 3880 3819 3757 1887 1061 958 646 414 --35759 1333 303 15067
NM_017922chr141255 ------
NM_017923chr42701 33 ----1264
NM_017935chr41139 ----1774
NM_017988chr12------1892
NM_018027chr1042223 1304 451 394 33217 2215 51 23262 1265 --
NM_018046chr551817 1221 586 77 47 2314 96 --1528
NM_018061chr11592 ------
NM_018084chr272507 2474 871 347 304 287 247 --11315 --
NM_018098chr31456 --11207 --
NM_018155chr313076 --1893 23299 2588
NM_018157chr1272848 1062 779 713 459 258 194 33012 2623 2327 1417 --
NM_018181chr1851602 1584 779 443 290 11504 1491 --
NM_018184chr372151 1723 862 795 666 253 174 21763 49 --1704
NM_018191chr1381899 1840 1604 1582 804 797 677 149 --1309 --
NM_018195chr1152104 1561 541 285 105 1380 --1775
NM_018200chr1532519 1875 1854 --11015 1130
NM_018207chr131459 1262 52 11148 11388 21589 547
NM_018211chr162134 1949 1636 441 367 285 1454 21667 125 21993 1778
NM_018243chr483880 3742 3238 2764 2511 1244 1047 777 ------
NM_018246chr882746 2693 2439 1820 946 901 411 22 ----1869
NM_018247chr653149 1906 1266 702 585 22916 659 43026 2157 2033 776 22225 613
NM_018254chr15784 761 653 479 84 --11751 1905
NM_018266chr32992 26 ----1926
NM_018279chr12102860 2781 2299 2263 2235 1896 1196 1158 207 74 12254 33023 674 198 --
NM_018287chr1031193 1110 1055 ------
NM_018294chr102808 711 --173 --
NM_018299chr833388 2902 2538 12664 33479 2959 574 --
NM_018307chr17--178 ----
NM_018313chr351970 1830 388 306 86 11016 32482 2339 2269 --
NM_018314chr11----1699 --
NM_018323chr451627 492 449 338 300 138 ----
NM_018325chr931665 150 98 21126 412 ----
NM_018330chr10--11598 ----
NM_018351chr1234596 4244 929 1226 11623 21404 634
NM_018361chr863998 2830 1323 719 679 136 --23365 1310 --
NM_018362chr1153627 2521 1423 1417 1291 13303 23895 1102 --
NM_018364chr163459 3284 3011 2743 1040 286 --1465 --
NM_018368chr61299 ------
NM_018372chr13612 554 264 ------
NM_018373chr14164697 4487 4478 4448 4120 4072 2228 2148 1914 1468 1130 1059 894 663 474 249 25913 560 35968 1217 626 --
NM_018374chr754679 3526 3324 957 426 24889 4214 ----
NM_018403chr3123790 3640 3429 3244 2820 2503 1626 1520 1391 872 501 137 1992 1340 --
NM_018413chr12------165
NM_018425chr10112665 2359 2098 1993 1757 1642 690 250 174 142 109 --11632 1750
NM_018429chr512447 12037 21786 896 12573
NM_018440chr8148424 8136 7086 6948 5848 5510 3315 3244 2615 2527 1845 1413 851 343 37829 6981 6603 28506 1606 23019 2584
NM_018452chr6_random51439 1117 432 406 98 --21185 76 12738
NM_018465chr9--138 ----
NM_018482chr842428 1781 759 354 --31922 767 301 --
NM_018489chr122105 1920 11608 1859 1459
NM_018490chr1141162 491 345 166 1556 ----
NM_018561chr631027 812 706 --191 1406
NM_018566chr1154876 4782 4667 4614 4539 4016 3674 3560 1988 1679 1642 1275 986 586 88 --21669 716 13460
NM_018569chr4--1175 11574 --
NM_018638chr1285335 5105 4661 4420 1969 1882 1751 1120 1639 24707 4292 --
NM_018640chr1242699 2437 88 26 12326 42000 972 472 77 --
NM_018650chr11112 1431 ----
NM_018660chr892852 2716 1983 1224 885 733 496 342 100 --2797 406 1276
NM_018665chr6129 ------
NM_018695chr552441 1963 591 165 145 2608 372 22428 100 --
NM_018698chrX41785 1624 1614 1372 31921 1233 731 1177 11936
NM_018710chr821295 1063 11188 11083 --
NM_018945chr632688 450 289 13038 23195 2525 13643
NM_018947chr7134955 4016 3899 3619 3511 3085 1556 1298 1261 1087 1027 747 92 34524 3316 3260 ----
NM_018958chr1584094 3436 2938 2698 2601 2593 625 128 ------
NM_018963chr212940 312 --21520 343 --
NM_018976chr1212762 --22512 1920 --
NM_019001chr384286 4279 3423 1776 1255 1134 885 721 1669 --13104
NM_019015chr7189 ------
NM_019022chr1872714 2567 2542 2382 1264 97 32 1466 ----
NM_019041chr682147 1791 1725 1656 912 873 763 742 22339 727 1978 --
NM_019045chrX------1659
NM_019049chr11297 167 ----
NM_019050chr42726 150 --1513 --
NM_019053chr10------21076 748
NM_019083chr12428 181 11041 1617 --
NM_019084chr1062261 2173 2110 1762 841 110 22269 701 ----
NM_019094chr1263860 3647 3387 2849 2776 1128 --13635 11093
NM_019095chr202230 187 ------
NM_019114chr931611 624 418 --11586 21977 515
NM_019117chrX42531 1335 1224 354 --12808 1506
NM_019590chr1031207 334 298 21118 394 ----
NM_019610chr142145 2052 764 604 ----21652 87
NM_019860chr1021092 306 ----11265
NM_019891chr141339 1141 526 279 1385 1100 --
NM_020066chr131017 698 208 ------
NM_020122chr285753 5372 5291 4887 4599 4333 1513 1308 13818 15279 --
NM_020132chr21115147 5063 4304 4184 3993 3266 1545 869 712 361 275 --1152 --
NM_020133chr6156390 6328 6270 6224 6146 5183 5087 5071 4045 2446 2034 2021 1609 957 41 14725 14699 --
NM_020135chr61310 ------
NM_020141chr151959 971 580 410 54 1660 --1375
NM_020144chr72583 43 1631 21323 208 1466
NM_020152chr213881 338 232 ------
NM_020177chr573144 3078 2322 2242 943 864 674 --1489 11043
NM_020198chr17----1203 --
NM_020245chr674339 4054 3793 3602 3592 3340 1404 11900 23533 1880 11566
NM_020297chr1292752 2561 733 679 522 477 429 374 228 --12391 --
NM_020300chr121367 --3359 302 43 --
NM_020307chr3----1271 1162
NM_020336chr2022356 674 31381 1003 43 23206 108 12726
NM_020337chr442224 2028 665 109 ----12171
NM_020341chr203578 346 59 11813 31540 597 273 21381 687
NM_020346chr1131241 632 534 --11297 --
NM_020347chr341722 1596 804 250 1136 ----
NM_020348chr1092450 2040 982 812 772 666 533 377 44 --31812 1068 521 12523
NM_020390chr353700 3350 1567 1281 740 14694 ----
NM_020420chrY61522 1239 1224 593 563 331 ------
NM_020425chr651889 1870 1670 638 584 --11431 --
NM_020443chr1136171 6131 5501 4887 4770 2565 1930 1101 650 629 211 174 115 26411 6231 --26251 1822
NM_020445chr7--1679 ----
NM_020449chrX2726 37 187 ----
NM_020455chr661872 1821 986 913 480 285 12788 ----
NM_020466chr6104700 4599 4515 1979 1669 1490 1482 1272 1196 1161 13646 1834 --
NM_020474chr1851856 1576 416 321 275 1548 32028 1539 458 --
NM_020640chr321755 1672 22211 685 11805 1376
NM_020662chr651775 1630 1372 168 149 --21576 346 --
NM_020666chr51920 ----1815
NM_020673chr20137267 7119 6772 6766 6291 2964 2900 2786 1963 1741 510 257 203 11556 66985 6407 5585 5450 4972 2428 --
NM_020699chr1114617 4333 4315 4140 3298 2078 1618 1018 715 702 621 --24565 3493 11784
NM_020711chr242560 2322 1832 1016 22418 1880 22618 2392 --
NM_020718chr16126513 5757 5197 5084 4957 4633 4386 1646 1278 1208 418 308 35503 5117 4688 15207 14659
NM_020727chr21104026 3702 3207 2669 2631 1293 1142 1084 219 96 --1825 23122 991
NM_020739chr15114074 3741 3656 3248 3151 1578 1319 1078 1005 217 93 --53780 3761 3585 1090 377 --
NM_020747chr5--1961 ----
NM_020748chr172754 150 2454 162 11782 --
NM_020749chr861971 1939 271 166 73 57 --32129 1467 655 --
NM_020752chr1072740 2592 1882 936 869 164 66 12220 1419 22613 1125
NM_020760chr22133 62 11372 31923 1769 1324 --
NM_020772chr17158432 7536 7379 6026 6014 5875 5710 5646 3315 2793 2712 2563 1255 771 103 37646 7326 6611 37402 5898 3011 --
NM_020774chr1855433 4423 2082 1957 639 35536 3867 2225 22407 2271 25448 4772
NM_020782chr12104788 4598 4466 4357 3707 3026 3015 1836 1133 1008 14836 23752 1922 13595
NM_020792chr352265 2169 872 550 398 1287 42608 1927 567 293 --
NM_020794chr131507 1089 468 11237 1409 --
NM_020796chr5----42191 2065 738 512 --
NM_020809chr1161828 1640 786 576 486 30 12321 137 11657
NM_020810chr14123504 3343 2948 2564 1378 1356 1190 1082 783 583 524 54 --12224 --
NM_020813chr1942384 1813 1136 145 --11779 12792
NM_020825chr1653385 761 548 138 124 23250 1198 13785 1739
NM_020830chr241300 275 168 33 11044 32726 2120 472 --
NM_020841chr1274089 3739 3578 3106 1577 1518 645 12830 14020 1177
NM_020844chr897675 6678 6290 4692 2886 2750 2556 1248 751 25199 5063 46495 6246 5977 572 11174
NM_020856chr1951455 1104 1043 559 231 1999 21122 24 --
NM_020865chr3----1402 --
NM_020866chr135871 847 102 75 69 ------
NM_020871chrX42232 952 661 79 1929 --11593
NM_020899chr1752444 2142 2091 2085 1899 --1881 --
NM_020918chr1063471 3160 2963 2575 657 364 11423 11366 33547 621 322
NM_020921chr1482573 2407 1231 1018 625 566 270 246 --31174 955 898 --
NM_020922chrX21623 1384 143 ----
NM_020927chr16112335 2235 2142 1931 1914 1870 1855 1800 1609 445 391 --12259 --
NM_020935chr274577 4233 4168 1760 1740 968 82 --11337 --
NM_020940chr1082597 2429 1102 910 812 584 458 140 135 1257 --
NM_020948chr143317 2425 1199 971 ----13681
NM_021005chr15----1135 --
NM_021007chr282320 2200 2168 1975 277 245 176 77 ----11703
NM_021032chr361977 1843 1388 580 373 262 --11354 --
NM_021033chr1393297 2513 2411 1059 678 459 131 111 79 42927 1183 739 606 22346 354 13227
NM_021038chr363229 2868 1360 258 65 40 ----23150 2858
NM_021061chr874219 3631 3443 2804 367 316 247 11411 24452 3324 --
NM_021069chr411516 --11412 --
NM_021072chr541722 1667 602 547 32084 849 477 1784 --
NM_021090chr22114234 4140 3959 3624 3452 3260 2011 1902 1286 509 458 23735 1445 ----
NM_021116chr7198326 8293 8067 7979 7092 6921 6435 6158 5747 3263 2788 2049 1040 683 614 580 504 373 342 28830 7894 37872 7455 3358 --
NM_021120chrX82977 2897 2864 2693 2463 2164 337 89 1763 23163 2853 --
NM_021156chr20124 ----21124 1055
NM_021163chr783786 3125 2769 2441 2422 860 165 155 13170 13002 --
NM_021191chr1272441 983 921 753 740 661 471 12216 12174 --
NM_021240chr92498 251 --1699 1565
NM_021255chr14103804 3568 3394 3254 3183 3059 2973 1196 881 758 ----22948 2580
NM_021622chr1041968 1749 636 151 22089 1712 ----
NM_021629chr374682 4222 3784 3093 520 399 203 33374 1242 818 ----
NM_021645chr1372114 1774 1712 1662 624 516 172 --11731 --
NM_021647chr4104501 4429 4370 4346 3680 3227 1458 1105 337 213 --14269 --
NM_021648chr632681 2080 369 --12442 1808
NM_021813chr694746 4294 4257 4217 3957 3841 1366 1231 100 25075 587 25695 4067 --
NM_021911chr564766 4715 2221 1919 973 70 25473 4663 --25540 30
NM_021912chr1583574 3360 3122 3064 2937 2757 1264 1180 --23780 1626 --
NM_021949chrX42876 1118 454 133 11106 32233 617 303 1998
NM_021960chr1102219 2089 1866 800 540 408 354 318 264 154 32153 2002 446 12105 --
NM_021961chr11177242 6178 5891 5739 5632 5602 5224 5144 4632 4559 2322 2219 2205 1627 1573 541 493 --12952 --
NM_021964chr3105580 4747 2152 2047 1431 1066 838 667 525 98 15149 46081 5321 4643 1923 --
NM_021977chr6113382 3211 3083 2970 1322 1254 1237 1099 692 667 356 --12644 --
NM_021980chr1021029 327 ----11082
NM_021998chrX21337 578 --2571 191 --
NM_021999chr131689 ----1263
NM_022037chr2----1714 1780
NM_022048chr1565013 4104 1022 876 485 223 26282 1856 46146 4142 2224 316 --
NM_022051chr11283 ------
NM_022080chr2072756 2698 2269 2216 1979 1747 1020 ----12183
NM_022114chr1144729 4610 4572 4248 4148 3685 2899 1799 1533 1232 434 221 80 55 ------
NM_022123chr142524 512 ------
NM_022130chr5----11124 --
NM_022131chr361508 1398 1379 1304 1198 213 1524 --11363
NM_022133chr841640 112 106 77 --2593 85 --
NM_022170chr781684 1629 1516 1467 1123 1101 1092 707 ------
NM_022173chr2----1714 1780
NM_022336chr272045 1820 895 401 351 310 91 --21483 710 1187
NM_022351chr823664 3403 32991 2517 1001 13093 --
NM_022456chr12116563 5644 2450 2415 2034 1819 1585 1500 1449 1098 565 35677 5664 5552 35577 1980 204 --
NM_022459chr1386119 5815 5051 3954 3930 2521 1423 353 --46181 4291 4113 875 --
NM_022465chr1242774 2091 2040 1910 ----32300 2209 614
NM_022473chr15104338 4283 3769 3039 2892 2746 1152 581 561 223 13904 12718 13112
NM_022488chr3------153
NM_022494chr101405 ----172
NM_022497chr393373 3157 3055 2714 1397 1373 1282 947 397 --1132 11364
NM_022648chr294373 3985 3949 2988 1681 1548 1328 337 95 --31518 503 221 --
NM_022720chr221577 1592 ----
NM_022726chr6188 21611 1284 21363 625 11738
NM_022763chr312329 1862 1875 --
NM_022777chr741695 1405 491 234 --11174 --
NM_022802chr103283 273 82 11650 11617 1152
NM_022828chr551380 1342 580 473 28 21121 134 11643 --
NM_022841chr154522 334 276 203 1494 --12198
NM_022893chr232012 975 158 --12801 1823
NM_022912chr262906 1991 1099 967 933 621 12039 --1120
NM_022915chr21568 ------
NM_022977chrX62596 2478 1779 808 619 63 ------
NM_023015chr11688 ------
NM_023018chr111477 ------
NM_023076chr1652985 2454 2348 921 762 1931 11938 --
NM_023923chr163803 2614 1361 677 101 74 ------
NM_023929chr862842 2765 2518 2009 1757 712 22777 182 32711 621 314 --
NM_023934chrX1291 1854 21458 411 11662
NM_024007chr583082 2728 2707 2155 898 831 407 84 --12241 22895 1251
NM_024047chr42288 71 ------
NM_024089chr131184 --166 --
NM_024312chr1211493 21420 1102 31582 620 233 --
NM_024345chr9106116 4443 4326 3817 2206 2037 1368 1172 871 430 13787 35570 5113 26 --
NM_024408chr173654 3572 2908 1199 995 736 57 12814 23565 2510 11456
NM_024423chr1863968 3099 2832 1712 913 840 --22637 679 14273
NM_024430chr18--21255 578 --1227
NM_024491chr31111 --2665 633 --
NM_024496chr141110 1316 ----
NM_024512chr382951 2708 2565 1037 683 188 99 82 ----1292
NM_024513chr3143377 3213 3023 2963 2944 2806 2594 2337 1404 1021 757 733 606 149 22550 875 22556 918 23706 1194
NM_024524chr383127 2911 2818 2377 2162 1965 947 255 --1516 11982
NM_024539chrX41131 1109 1005 45 11060 ----
NM_024548chr341525 706 368 120 ------
NM_024563chr571897 1272 715 507 459 452 152 21759 1609 ----
NM_024570chr13--1243 ----
NM_024582chr41440 11146 2812 329 --
NM_024590chr451803 714 655 486 328 21621 1461 21748 1712 --
NM_024604chr121164 ------
NM_024607chr894463 4164 4155 3908 3776 3705 3106 1249 100 --24349 941 --
NM_024639chr6122519 1803 1045 859 671 360 347 309 158 100 93 53 12649 ----
NM_024645chr861490 999 627 465 59 27 --21269 597 --
NM_024686chr1177 ----1194
NM_024740chr1153601 1252 1015 315 25 2576 405 63717 1394 1337 886 626 338 --
NM_024744chr292438 2291 954 820 811 801 691 350 22 --1436 --
NM_024749chr142100 2055 1735 650 --41583 1557 96 76 --
NM_024761chr9115171 4210 3250 1814 1802 1774 1445 1408 855 232 107 24949 4656 45067 4416 2119 1910 --
NM_024766chr21323 ------
NM_024770chr2156522 5304 4520 4246 4231 2630 2558 2491 2238 1869 1787 764 551 103 36 --35542 5388 4405 153
NM_024798chr1582796 2778 2528 2473 2232 183 150 100 --22293 2043 --
NM_024824chr142672 75 ----21376 241
NM_024884chr14134484 4451 4373 4018 3951 3595 3169 3114 1763 1694 409 267 52 12828 24176 3803 --
NM_024930chr572517 2150 2052 1998 1990 1983 204 --1105 --
NM_024947chr3159254 8987 7757 7649 6966 3848 3692 3163 3139 2938 2062 1577 1069 622 325 23400 1435 47250 7131 6226 606 26860 844
NM_024949chr4124507 4121 4050 1766 1591 1225 1110 903 730 656 650 638 11883 21501 128 24848 3386
NM_024953chr1262285 2118 1750 540 260 101 21080 763 1125 --
NM_024989chr2117849 5966 5622 5058 4964 3149 1816 1688 1162 574 262 26932 5320 12026 12598
NM_024991chr1063278 2074 890 676 399 357 --1212 --
NM_025040chr1951639 1597 1567 911 893 11632 ----
NM_025054chr884155 3577 3053 2725 1517 1314 816 731 13641 24116 1694 24104 2715
NM_025073chr194673 4443 4300 3414 1737 1482 878 575 138 34204 1195 462 44268 3658 1448 532 23509 1330
NM_025074chr4102869 2811 2748 2091 2069 2039 654 331 181 171 12583 --12338
NM_025080chr1121129 89 --11078 --
NM_025133chr2------11126
NM_025134chr1612324 22295 1000 1903 12359
NM_025146chr342477 1863 733 232 12597 1168 12708
NM_025151chr831875 716 424 --2757 68 1734
NM_025152chr1461822 1774 1637 599 310 125 21679 339 1236 --
NM_025154chr731446 1293 599 11300 1379 11117
NM_025160chr1104282 4069 3451 3058 2726 1358 1218 904 838 123 14266 74206 3358 2912 1115 947 452 251 --
NM_025179chr1174158 4114 3827 3663 3378 1742 1401 1191 708 699 611 353 233 223 141 100 73 --24032 737 --
NM_025180chr353290 1344 1260 549 216 12605 32627 362 191 1863
NM_025191chr133198 1020 175 --12833 --
NM_025208chr1171894 927 862 808 328 201 37 11518 ----
NM_025211chr92198 187 ------
NM_025222chr373058 2878 2444 574 220 108 66 --42757 2001 998 193 --
NM_025233chr17--1291 ----
NM_025235chr101471 21823 329 3727 663 413 --
NM_025238chr1521576 447 --1213 --
NM_030627chr573653 3529 3160 897 569 378 138 2854 718 ----
NM_030647chr796331 6012 4223 3923 1628 1046 439 124 110 25292 5244 21852 794 54488 3823 2093 1253 323
NM_030661chr721517 681 --21439 613 --
NM_030674chr12165798 5511 5396 4916 4598 4542 4358 3912 3844 3668 3651 1579 1477 1452 427 315 --31314 1215 1108 --
NM_030777chr2072326 2310 2278 1523 320 276 30 11834 --12436
NM_030791chr1411555 21483 86 11693 --
NM_030806chr1139194 9088 8455 8156 7617 6927 6838 6787 6636 5954 3031 2976 894 --79009 7216 7014 6811 6072 5817 3606 37801 2030 656
NM_030809chr1282264 2002 1895 1856 1810 1714 351 343 --1734 1275
NM_030816chr153633 3187 2615 2472 1325 23317 3049 43370 2791 1276 164 --
NM_030817chr1253460 3075 1213 447 62 12851 33020 975 463 --
NM_030820chr61985 ------
NM_030918chr1134687 4315 3968 3891 3880 3711 3584 1501 458 424 404 350 281 35394 3543 1151 11412 --
NM_030945chr5102590 2568 1821 1663 930 773 444 364 179 70 --1323 --
NM_030962chr1131381 1344 1306 --21389 38 --
NM_030979chr131401 --1304 --
NM_031262chr91809 ----1756
NM_031263chr91866 --172 1813
NM_031268chr16144881 4720 4603 4569 3973 3638 3611 3529 1735 1223 1120 998 458 181 --15026 --
NM_031271chr821388 603 1202 21273 370 --
NM_031291chr4----1148 --
NM_031365chr292965 2080 2057 912 627 598 549 106 84 11997 11003 --
NM_031366chr292965 2080 2057 912 627 598 549 106 84 11997 11003 --
NM_031371chr111470 ----11564
NM_031371chr111470 ----11564
NM_031427chr14115837 5739 5038 4557 4519 4325 4039 1375 1152 322 47 --25347 5327 15115
NM_031453chr10102280 2007 1996 1977 1710 547 493 279 108 42 22082 826 12568 --
NM_031468chr7218057 7940 7652 7038 6943 6511 6349 6124 5873 5433 5103 3118 3041 2690 2620 2360 1832 1292 644 629 137 --46840 6688 6462 5513 --
NM_031469chr654125 3786 3235 1453 164 1648 11525 11463
NM_031483chr2042798 2571 2448 1131 2918 912 135 --
NM_031844chr153497 3483 3340 2561 203 21595 614 33828 1055 340 1430
NM_031858chr1731585 1237 180 --11114 1416
NM_031862chr1731585 1237 180 --11114 1416
NM_031889chr411791 21461 1288 --11936
NM_031922chr6------1449
NM_031938chr1161041 902 799 367 268 84 ----1788
NM_031992chr781684 1629 1516 1467 1123 1101 1092 707 ------
NM_032012chr9135170 4810 4797 4232 4011 3621 3543 3489 3258 877 848 373 162 24505 3856 1348 14346
NM_032042chr511006 12239 31919 1137 1122 --
NM_032102chr1152899 2355 2280 707 37 12776 22890 529 --
NM_032105chr1137739 7605 7222 7176 6612 6500 6361 5624 5351 5211 1880 243 60 --36171 3049 700 --
NM_032116chr1361187 710 536 498 446 143 --15032 14133
NM_032145chr621656 209 ----1256
NM_032154chr104994 874 782 51 1801 11055 1138
NM_032160chr1853339 3265 3137 2669 998 1553 12942 --
NM_032199chr1083745 3537 3303 3092 2696 1342 859 45 --2922 300 --
NM_032208chr2113233 3089 3083 2988 2976 2820 2432 1230 1049 832 443 12516 --13471
NM_032217chr41919 ------
NM_032228chr1162896 1413 975 916 754 291 --22555 1111 --
NM_032233chr14----2677 308 --
NM_032239chr431492 391 358 --11044 1104
NM_032256chr121939 --2997 818 21079 1051
NM_032281chr1993074 2428 2212 2164 1935 1078 632 442 310 ------
NM_032288chr351760 1651 774 491 182 21914 1787 11710 31576 889 865
NM_032291chr131513 1390 44 21895 1540 ----
NM_032312chr21202 --1622 --
NM_032315chr1253 29 ------
NM_032373chr1085671 4626 4324 4226 3853 2176 1781 93 11086 34508 1893 560 15636
NM_032436chr132299 143 1347 1861 1390
NM_032437chr1------135
NM_032438chr681627 1461 1279 1154 589 465 111 68 --1325 11364
NM_032440chr1072553 2516 919 764 523 260 241 --12166 --
NM_032441chrX5907 261 222 203 71 1914 1212 --
NM_032446chr5133280 3166 3027 2951 2637 2471 2460 1519 1034 508 460 291 44 42619 963 649 233 12679 --
NM_032486chr1672703 2302 2173 2069 2052 1976 138 1887 32283 172 84 --
NM_032505chr352615 2454 922 413 318 12395 1572 12224
NM_032509chr851718 909 753 43 29 --11971 1969
NM_032510chr1881885 1860 1740 1583 869 184 171 47 12174 ----
NM_032557chr41120 --2949 368 --
NM_032590chr121783 1472 ----
NM_032632chr141607 1401 21276 448 22002 351
NM_032663chr1261494 756 555 533 128 26 --2676 280 1416
NM_032682chr363262 2883 955 415 376 166 --12241 --
NM_032689chr191215 21054 576 --11587
NM_032765chr51839 ----1244
NM_032778chr382756 2693 2491 2403 2239 716 287 183 12845 32780 1230 341 --
NM_032828chr1944705 3619 1046 595 --11095 11964
NM_032839chr3171 ------
NM_032857chr152169 85 ------
NM_032859chr1383132 2994 2594 2420 1106 812 746 56 1891 32607 2445 121 --
NM_032864chr161451 1198 1000 510 372 96 31591 1581 1162 21559 1354 11219
NM_032866chr1542590 2334 359 184 --22473 945 12921
NM_032873chr1154477 3801 2858 399 236 33900 3424 1087 1776 13176
NM_032900chr10123673 3443 3328 3172 3102 2952 2794 2697 1541 1249 683 37 --1602 --
NM_032961chr441205 1105 982 202 ------
NM_032968chrX53751 3280 1192 1138 646 --11152 --
NM_032969chrX53751 3280 1192 1138 646 --11152 --
NM_032973chrY53743 3275 1192 1138 646 --11152 --
NM_032975chr1863296 2817 2309 1313 783 150 --22506 594 11268
NM_032980chr1863296 2817 2309 1313 783 150 --22506 594 11268
NM_033036chr1171662 1501 1487 1310 1159 1153 282 11184 11734 --
NM_033083chr31133 23121 245 12141 1236
NM_033132chr1342312 1443 414 400 ----11652
NM_033133chr17113805 3482 3466 3371 3321 3312 3228 1319 1006 353 231 1451 13270 --
NM_033135chr1171894 927 862 808 328 201 37 11518 ----
NM_033143chr484520 3794 1389 705 668 597 204 67 --24189 1116 --
NM_033181chr673986 3681 3090 2950 714 518 295 33147 2681 1546 2686 35 --
NM_033211chr561790 1537 1375 1312 823 450 --21894 1487 --
NM_033224chr7248000 7889 7722 7700 7497 6449 6354 5945 5939 5044 2783 2652 2612 2219 2063 2008 1949 1454 1349 1210 706 621 163 58 --36458 1246 206 --
NM_033225chr863018 2810 2677 2487 2159 22 --12936 --
NM_033284chrY----136 --
NM_033290chrX63056 2820 1382 1282 738 729 --23007 2728 --
NM_033331chr9123443 3252 2705 2618 2564 2431 2221 1179 1130 582 41 22 --2761 355 --
NM_033380chrX4978 949 722 463 1915 --2379 267
NM_033381chrX4978 949 722 463 1915 --2379 267
NM_033407chr15594 586 453 118 35 ----1478
NM_033429chr1583165 3131 3115 2921 909 808 777 708 --12588 --
NM_033430chr4114189 4071 3565 3497 3417 2840 1503 1223 633 618 377 1172 ----
NM_033437chr4114189 4071 3565 3497 3417 2840 1503 1223 633 618 377 1172 ----
NM_033480chr6102913 2583 2245 936 883 618 476 191 157 60 ------
NM_033481chr6102913 2583 2245 936 883 618 476 191 157 60 ------
NM_033495chrX21028 845 --1766 --
NM_033505chr2116461 6437 5846 5734 4819 4440 2320 2110 1855 653 392 21698 558 26316 1887 --
NM_033512chr882923 2253 2083 966 876 799 491 126 --1809 12694
NM_033515chr641318 1285 895 87 1171 --1956
NM_033542chr2091712 1350 1336 817 705 619 261 189 98 ------
NM_033637chr1083998 3617 3585 3081 2853 2645 595 262 ----1397
NM_033656chr2165498 5346 5015 3746 2233 1776 32086 1754 1737 14204 --
NM_052839chr22--1973 ----
NM_052851chr1342103 410 230 104 --3173 163 97 --
NM_052862chr111548 --1264 11282
NM_052879chr12103669 3458 3228 3219 3082 2800 1042 1000 545 462 --23011 1529 --
NM_052885chr12104956 3845 3755 3460 3412 3299 1217 1170 185 52 ----11456
NM_052888chr171125 ------
NM_052911chr182678 107 --1655 2306 76
NM_052917chr282939 2534 2069 984 902 883 713 200 --12143 --
NM_052927chr552226 1867 1800 62 45 --31926 1659 267 --
NM_052934chr1132208 2146 2084 1923 1865 1721 1659 1637 1567 485 369 325 115 1694 ----
NM_052937chr872516 2225 965 779 759 661 171 184 ----
NM_052954chr2122272 553 1423 31421 790 85 --
NM_053016chr9117447 5617 5336 4968 2904 1624 1296 1289 752 632 624 --24984 207 37385 5360 2445
NM_053023chr1152856 2438 1111 473 61 --11172 --
NM_053043chr796309 5689 5317 4607 4388 3953 1130 390 349 24597 1311 35125 1488 239 --
NM_053064chr1482765 2604 2403 1228 1128 572 110 24 13012 12187 --
NM_057164chr2----1604 --
NM_057165chr2----1604 --
NM_057166chr2----1604 --
NM_057167chr2----1604 --
NM_057169chr1272892 2829 2780 2328 2293 840 71 --21008 508 --
NM_057170chr1272892 2829 2780 2328 2293 840 71 --21008 508 --
NM_057175chr482112 1930 1848 1048 886 880 782 677 12189 12470 1719
NM_057178chr1762816 2661 988 291 280 208 12549 11061 22678 2274
NM_058191chr214845 331 308 73 ------
NM_058237chr141679 ------
NM_058241chr242155 2054 875 258 21968 1900 12146 11889
NM_058241chr242155 2054 875 258 21968 1900 12146 11889
NM_078467chr6--1176 ----
NM_078470chr1082571 2563 2045 1737 1648 374 168 46 12211 22547 66 --
NM_080546chr942251 2018 1810 166 22007 1464 11753 --
NM_080629chr131416 481 473 --11463 --
NM_080630chr131416 481 473 --11463 --
NM_080683chr41477 ------
NM_080684chr41477 ------
NM_080685chr41477 ------
NM_080725chr2091815 1751 1700 764 556 299 268 249 35 --32021 1758 1353 --
NM_080743chr642558 1694 765 655 22428 286 ----
NM_080759chr1342617 1015 441 101 2761 417 32564 565 40 --
NM_080760chr1342617 1015 441 101 2761 417 32564 565 40 --
NM_080867chr1484883 4682 4153 3532 3377 3323 3275 1985 11130 --1761
NM_080872chr854034 2721 2672 1484 529 --23298 3270 --
NM_080927chr353282 1159 1008 802 615 11318 12242 12776
NM_130391chr952997 2913 2314 662 301 12667 1175 --
NM_130392chr952997 2913 2314 662 301 12667 1175 --
NM_130393chr952997 2913 2314 662 301 12667 1175 --
NM_130395chr61310 ------
NM_130434chr154907 844 777 81 ----1245
NM_130798chr1541320 1137 1001 392 ----11224
NM_130838chr1521601 670 1402 1497 11161
NM_130839chr1521601 670 1402 1497 11161
NM_130847chr11105756 5499 5464 4761 3767 3683 2151 1838 751 136 15232 15915 --
NM_130902chr4128 ------
NM_133170chr2096914 6500 6344 2692 1921 1891 1647 740 730 32922 2440 1390 16225 --
NM_133264chr17103474 3386 3274 2843 1404 1351 1171 436 264 92 1698 11080 --
NM_133329chr271231 712 540 471 366 197 178 11173 1702 --
NM_133372chr512303 12611 ----
NM_133445chr993673 3355 3085 3004 1304 635 579 493 218 --13204 12532
NM_133446chr10171 ------
NM_133493chr674523 4239 4165 3818 3170 251 76 13391 21830 1367 24543 3425
NM_133496chr174300 3846 3600 3573 3302 1798 1549 --34426 3619 373 --
NM_133647chr1543661 2977 970 775 1273 33716 442 165 --
NM_134325chr191743 1681 1619 1458 1400 1256 1194 1172 573 1229 ----
NM_134442chr221703 138 1380 1533 --
NM_138270chrX63121 1069 682 580 361 81 --22840 2509 --
NM_138394chr2123 ------
NM_138423chr1521859 364 2596 124 ----
NM_138455chr8----1352 --
NM_138459chr663546 2788 2504 444 367 48 --33442 3296 293 --
NM_138473chr1263792 3686 1658 1594 1308 127 ----1965
NM_138479chr181907 1660 745 607 456 448 173 37 1544 3524 341 128 --
NM_138555chr153456 96 26 1470 --1596
NM_138571chr62664 469 ------
NM_138621chr2103972 3420 2983 1614 1259 601 496 397 285 189 --12533 --
NM_138694chr6143622 3556 3286 3279 3178 3025 2769 2411 1148 1055 684 588 506 80 12564 23502 1385 1797
NM_138713chr16136360 6132 5971 5843 5770 5310 5192 5166 2360 1853 1327 1306 148 66233 5227 2526 899 262 71 --37008 6954 1282
NM_138714chr16136360 6132 5971 5843 5770 5310 5192 5166 2360 1853 1327 1306 148 66233 5227 2526 899 262 71 --37008 6954 1282
NM_138720chr63379 246 80 ------
NM_138731chr1454021 3838 3082 1381 1037 32998 1525 1457 1931 1562
NM_138771chr761316 1088 546 387 232 146 ------
NM_138811chr751014 422 164 108 62 1229 1361 --
NM_138959chr176235 5369 5048 4504 4413 2453 2283 --46306 4650 2615 2145 --
NM_138966chr18------2129 24
NM_138970chr143856 157 93 31554 907 103 ----
NM_139048chr33422 263 149 1196 ----
NM_139182chr441530 1158 607 492 --198 --
NM_139283chr1282520 2143 2024 1811 1676 904 874 164 --12326 --
NM_139312chr1021002 43 ----1229
NM_139321chr2094154 4100 3612 3300 3078 2705 1142 1035 955 44164 3541 543 290 44203 1301 1108 939 11682
NM_144571chr4116872 6772 5343 5047 4770 4604 4590 4463 4382 2786 1062 15881 16207 16436
NM_144578chr1495361 5203 4275 3375 1797 1658 1583 284 112 --34403 3544 784 --
NM_144595chr131254 2677 286 ----
NM_144599chr1594284 4271 3996 3805 1870 1593 1429 1417 104 24264 1749 ----
NM_144600chr1611611 11058 21258 1131 --
NM_144610chr17----182 --
NM_144618chr161396 1151 542 265 217 210 --1509 --
NM_144632chr251538 423 402 392 215 12061 ----
NM_144643chr44388 358 291 27 ------
NM_144684chr1982809 2740 2531 2271 1025 956 153 104 1829 22194 33 --
NM_144689chr191487 --160 --
NM_144778chr1332210 94 30 12553 12660 --
NM_144949chr272041 1931 999 943 654 465 326 1196 1307 12200
NM_144963chr872360 2336 2028 1920 1766 749 414 1860 ----
NM_144973chr12115208 4830 4786 4775 4421 4316 3998 3531 1557 1390 673 --23417 835 --
NM_144988chr1127 2310 114 ----
NM_145036chr171316 ------
NM_145055chr1833552 1041 850 23639 1435 1205 --
NM_145207chr474473 3819 3743 3617 2146 1600 125 13705 ----
NM_145234chrX2936 753 ------
NM_145243chr12154 35 ------
NM_145251chr14----1267 --
NM_145259chr2197122 6874 6751 6540 6463 6186 5808 5623 5405 5175 4681 4364 2337 2289 2216 1237 717 468 335 15843 35888 4742 4665 11128
NM_145290chr4----1110 --
NM_145291chr41408 ------
NM_145307chr1084169 4158 1472 1156 1127 1084 877 389 11329 43899 3357 1485 1311 11258
NM_145320chr752362 2350 1078 782 527 --2716 401 --
NM_145321chr752362 2350 1078 782 527 --2716 401 --
NM_145322chr752362 2350 1078 782 527 --2716 401 --
NM_145341chr1041623 1159 621 331 11218 1479 --
NM_145686chr2103024 2960 2517 2394 2324 2198 1319 819 321 54 12211 21105 688 --
NM_145687chr2103024 2960 2517 2394 2324 2198 1319 819 321 54 12211 21105 688 --
NM_145698chr1072119 1646 683 516 422 272 37 ----1189
NM_145764chr121367 --3359 302 43 --
NM_145791chr121367 --3359 302 43 --
NM_145792chr121367 --3359 302 43 --
NM_145859chr3----2289 247 --
NM_145860chr3----2289 247 --
NM_147150chr9153736 3655 3587 3357 2795 2778 1420 1389 1115 1026 764 584 352 323 278 --1217 --
NM_147223chr272368 1735 1540 892 517 156 108 ----12147
NM_148170chr11145609 5275 4889 4539 4362 3608 2000 1843 1700 1336 893 517 509 336 --74312 4198 3933 2038 1439 1194 1068 11925
NM_148955chr15146418 5905 5670 5441 5280 5122 4945 4223 4193 4162 2241 1964 1038 748 26081 1997 65328 5202 4517 1815 971 317 --
NM_152261chr1262557 1904 1641 908 855 760 22339 1609 ----
NM_152263chr1106036 5886 5336 4601 4342 4331 3982 2355 1548 690 ----1277
NM_152267chr22102148 2027 1956 1915 1863 864 795 670 156 148 12408 ----
NM_152271chr82776 410 1938 2276 188 --
NM_152280chr173345 2867 2188 1194 1073 757 139 13041 23227 2891 11302
NM_152282chr321427 1132 --21210 403 --
NM_152330chr1422302 840 12339 --1194
NM_152332chr1421027 970 1787 32150 1012 30 --
NM_152347chr171118 ------
NM_152376chr171960 1825 1790 1745 1698 1571 591 ----1452
NM_152388chr263946 3473 3453 3187 1493 1220 23508 923 23347 2599 --
NM_152414chr841667 1588 1375 1169 11276 1131 --
NM_152440chr12--2427 112 --1434
NM_152446chr142857 245 --3935 653 614 --
NM_152529chr264267 3633 3485 1603 1345 289 13782 22789 1113 --
NM_152581chrX51476 1123 526 454 22 1403 ----
NM_152609chr15999 893 349 117 110 1289 1156 --
NM_152622chr563028 2779 2533 1089 729 22 31343 214 134 32971 2556 656 --
NM_152624chr5107022 6985 6165 4821 4522 2827 2816 2021 1555 612 11583 1434 --
NM_152629chr964001 3179 969 306 232 148 1162 --13635
NM_152630chrX1360 --11569 11507
NM_152641chr1282883 2428 2290 1052 1041 907 841 302 12505 1222 --
NM_152678chr322272 414 --12583 --
NM_152705chr131296 ------
NM_152707chr103421 164 113 1273 11085 --
NM_152734chr6135453 4846 4810 4723 3805 3561 3478 1894 1663 1554 1535 233 23 11367 13508 --
NM_152754chr783279 3240 2482 1440 1054 907 426 193 11241 32906 495 28 23025 223
NM_152756chr5124193 3592 3023 2714 1551 1489 1209 959 582 508 265 153 --1841 --
NM_152774chr752594 2320 2178 2052 704 ----165
NM_152787chrX53268 1428 1309 1204 259 --43773 3286 2545 281 23524 627
NM_152793chr7105203 4629 4124 3900 3682 3529 1840 1412 846 333 23408 306 13815 --
NM_152826chr15146418 5905 5670 5441 5280 5122 4945 4223 4193 4162 2241 1964 1038 748 26081 1997 65328 5202 4517 1815 971 317 --
NM_152835chr1180 --12888 1265
NM_152836chr841640 112 106 77 --2593 85 --
NM_152837chr841640 112 106 77 --2593 85 --
NM_152838chr2083270 3112 2380 2288 613 405 350 215 12315 13331 12539
NM_152902chr131839 1281 620 2683 83 ----
NM_152924chr15135573 5369 4690 4498 4434 4201 2593 2383 2136 2115 1079 480 364 21517 1507 25108 428 --
NM_152991chr11--1587 ----
NM_152996chr141698 1378 437 330 --1467 --
NM_153028chr16----1677 --
NM_153035chr182858 2707 2682 2535 835 527 451 310 --32600 1015 613 --
NM_153050chr22114234 4140 3959 3624 3452 3260 2011 1902 1286 509 458 23735 1445 ----
NM_153051chr22114234 4140 3959 3624 3452 3260 2011 1902 1286 509 458 23735 1445 ----
NM_153181chr18------2129 24
NM_153182chr382756 2693 2491 2403 2239 716 287 183 12845 32780 1230 341 --
NM_153184chr381913 1850 1745 1585 1395 1259 441 424 ------
NM_153188chr574948 3537 3474 1062 423 388 353 ----1531
NM_153207chr1284098 3645 3374 2617 2526 1434 1313 561 31576 1376 704 13833 13310
NM_153262chr193225 2245 2135 820 353 302 195 148 102 1751 23075 88 --
NM_153332chr843305 3014 1071 449 ----1572
NM_153333chrX----1556 1470
NM_153347chr1192539 2298 2097 2024 1100 622 266 205 171 1198 22675 656 --
NM_153456chr13116290 5876 5751 5654 5615 5218 4342 4334 2378 1021 334 15054 45718 1752 1334 1028 --
NM_153607chr532460 503 223 2753 402 --1133
NM_153619chr1573130 3113 2454 1390 1345 735 386 ----1260
NM_153631chr721517 681 --21439 613 --
NM_153632chr721517 681 --21439 613 --
NM_153645chr2242671 2205 1191 605 125 53137 2170 291 199 101 --
NM_153689chr2139 21538 210 ----
NM_153809chr91516 ------
NM_153810chr10104555 4238 4225 3318 1820 1744 1671 1341 562 337 24425 941 34584 1960 346 --
NM_170587chr82713 697 --2836 44 --
NM_170675chr1551075 931 797 383 163 ----1268
NM_170676chr1551075 931 797 383 163 ----1268
NM_170706chr183898 3494 3446 3289 2744 1074 520 151 13656 23589 1411 13582
NM_170709chr842375 2358 2106 2019 --21901 180 --
NM_170731chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_170732chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_170733chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_170734chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_170735chr1152891 1990 1823 995 830 12192 32162 627 263 --
NM_170740chr6133482 3450 2605 2559 2475 2113 1124 951 941 733 558 222 116 22377 100 43046 2932 1165 657 --
NM_170743chr162734 2006 1030 791 385 81 --32944 2535 1790 155
NM_170751chr661308 1280 1231 330 128 49 ----11034
NM_170752chr661308 1280 1231 330 128 49 ----11034
NM_171998chrX72312 2258 1677 1000 858 545 87 1656 11902 --
NM_172058chr831852 296 93 11219 1727 11619
NM_172059chr831852 296 93 11219 1727 11619
NM_172060chr831852 296 93 11219 1727 11619
NM_172070chr262020 1708 802 529 447 197 ------
NM_172071chr1137176 7046 6680 6533 6255 5750 5528 5401 943 570 494 97 66 22830 706 26178 5575 1813
NM_172103chr662534 2448 2228 1030 790 458 --2299 144 --
NM_172105chr662534 2448 2228 1030 790 458 --2299 144 --
NM_172127chr431378 610 421 --12097 1373
NM_172128chr431334 566 377 --12053 1329
NM_172159chr34686 541 355 273 --22355 1536 --
NM_172160chr34686 541 355 273 --22355 1536 --
NM_172169chr10101892 1743 1519 685 632 587 579 547 514 438 --1427 --
NM_172170chr10101892 1743 1519 685 632 587 579 547 514 438 --1427 --
NM_172171chr10101892 1743 1519 685 632 587 579 547 514 438 --1427 --
NM_172173chr10101892 1743 1519 685 632 587 579 547 514 438 --1427 --
NM_172218chr83814 589 229 1537 2824 548 --
NM_172240chr1241074 561 547 516 --21308 988 2204 175
NM_172344chr271231 712 540 471 366 197 178 11173 1702 --
NM_172373chr133339 209 194 1502 --1375
NM_173064chr162734 2006 1030 791 385 81 --32944 2535 1790 155
NM_173065chr173431 2703 1082 778 404 194 97 --63641 3232 2487 453 434 27 1752
NM_173214chr16136360 6132 5971 5843 5770 5310 5192 5166 2360 1853 1327 1306 148 66233 5227 2526 899 262 71 --37008 6954 1282
NM_173359chr351665 1635 1363 455 146 --21723 1485 --
NM_173468chr4135715 5640 5593 4552 4495 4352 4064 3917 1610 860 562 427 187 55772 5582 4943 1949 1825 22314 1123 14585
NM_173482chr19--1128 ----
NM_173495chrX82450 2407 1847 1839 765 449 211 148 ------
NM_173511chr2113961 3772 3766 3671 3507 3476 2696 2598 2561 842 399 22575 2440 11257 --
NM_173519chr831987 1457 544 11515 21682 335 11883
NM_173552chr342512 945 933 798 --11746 12212
NM_173576chr1052187 849 531 378 68 22254 723 ----
NM_173582chr11166253 6120 6007 5663 5517 4721 4711 4553 2251 2195 1900 1427 1163 1066 918 57 11677 --14129
NM_173591chr1211009 2739 51 ----
NM_173602chr12113599 3057 2798 1161 1118 922 653 569 318 69 39 2503 443 42610 2596 989 600 --
NM_173642chr1269209 9199 9110 8935 8752 8695 8497 8394 8062 8011 7953 7723 7671 7462 7090 6629 6603 6581 6439 3610 2876 2470 2084 1568 1348 203 26657 6503 38033 6083 2541 --
NM_173654chr352168 2153 1828 1494 794 163 --11920
NM_173683chr821748 417 --11150 1158
NM_173694chrX31787 282 272 ----32074 1679 250
NM_173797chr52351 43 ----11189
NM_173808chr194341 4224 4104 3243 3145 2937 2825 795 137 ------
NM_173826chr361737 1376 1148 575 433 100 --143 --
NM_173829chr5156081 6000 5934 5739 5562 5271 4605 4496 2105 1620 1130 1101 871 647 566 --24441 1094 --
NM_173851chr8133315 3296 3282 3276 3043 2765 1480 1319 744 712 478 326 87 13125 ----
NM_173854chr182339 2195 1903 1855 1764 871 449 106 22356 1520 1181 --
NM_174911chr872971 2743 2462 1285 402 35 22 13443 13196 23713 3460
NM_174938chr91366 ------
NM_175061chr722132 528 ----1110
NM_175607chr321378 303 --11086 11253
NM_175612chr321378 303 --11086 11253
NM_175623chr12116563 5644 2450 2415 2034 1819 1585 1500 1449 1098 565 35677 5664 5552 35577 1980 204 --
NM_175624chr12116658 5739 2545 2510 2129 1914 1680 1595 1544 1193 660 35772 5759 5647 45672 2075 299 91 --
NM_175625chr12116658 5739 2545 2510 2129 1914 1680 1595 1544 1193 660 35772 5759 5647 45672 2075 299 91 --
NM_175736chr12187578 7306 6603 6305 5967 5806 5762 5736 5439 5189 5091 2220 2021 1611 1466 1027 1011 601 27280 1952 26570 1425 --
NM_175854chr13102541 2210 2159 2020 1838 1709 594 425 372 164 --42363 1781 1026 220 32803 1900 185
NM_175856chr52525 323 ------
NM_175866chr1--21420 74 21322 562 11066
NM_175876chr152484 2262 2149 448 43 --1769 1958
NM_175884chr721095 422 11105 ----
NM_176081chr10105953 5823 4888 4795 4642 4289 1691 642 536 306 22364 1184 35623 4624 1231 --
NM_176083chr10105953 5823 4888 4795 4642 4289 1691 642 536 306 22364 1184 35623 4624 1231 --
NM_176823chr1153181 3086 2929 2829 2678 2365 1553 1458 1358 1314 838 711 218 140 38 --23121 825 13841
NM_177553chr11------1961
NM_177966chr32670 647 --11746 --
NM_177968chr211576 --32088 1705 403 --
NM_177974chr1521859 364 2596 124 ----
NM_177990chr203578 346 59 11813 31540 597 273 21381 687
NM_178006chr1342103 410 230 104 --3173 163 97 --
NM_178007chr1342103 410 230 104 --3173 163 97 --
NM_178011chr1073164 3134 1240 1101 566 251 52 --21191 471 12239
NM_178037chr12103433 3002 1233 1178 1160 788 645 430 271 61 1422 33332 2507 618 --
NM_178038chr12103433 3002 1233 1178 1160 788 645 430 271 61 1422 33332 2507 618 --
NM_178123chr221059 663 --1804 2977 223
NM_178151chrX167698 7152 6951 6815 5322 2999 2257 2240 2115 1924 1080 893 647 480 459 420 --37794 7405 1369 --
NM_178152chrX167698 7152 6951 6815 5322 2999 2257 2240 2115 1924 1080 893 647 480 459 420 --37794 7405 1369 --
NM_178153chrX167698 7152 6951 6815 5322 2999 2257 2240 2115 1924 1080 893 647 480 459 420 --37794 7405 1369 --
NM_178424chr5186 ------
NM_178505chr1033589 1317 107 --23219 173 --
NM_178509chr17104109 3954 3938 3857 3846 3364 3337 3272 1167 214 12703 14147 --
NM_178539chr1251630 1441 725 645 467 --1248 --
NM_178554chr372847 2633 967 768 716 585 390 --23279 1082 13212
NM_178578chr2082022 1986 947 643 622 383 364 333 --22087 1750 --
NM_178585chr442327 1108 854 210 21068 333 1460 13160
NM_178812chr871559 1345 1253 1082 401 260 243 --11045 --
NM_178815chr1031774 766 487 1380 ----
NM_178868chr3188 ------
NM_181354chr831195 614 247 ------
NM_181443chr2042309 933 844 401 12599 1622 1206
NM_181457chr241098 952 461 375 --11025 11191
NM_181458chr251231 1085 594 508 66 --11158 11324
NM_181459chr24997 851 360 274 --2924 467 11090
NM_181460chr241044 898 407 321 --2971 514 11137
NM_181481chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_181482chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_181483chr18216494 6069 5985 5800 5690 5106 4882 4503 4299 4269 2684 2251 1662 1503 1476 1299 1230 617 462 427 269 24752 2050 26434 1461 --
NM_181504chr543665 681 411 135 1996 11247 --
NM_181523chr543665 681 411 135 1996 11247 --
NM_181524chr543665 681 411 135 1996 11247 --
NM_181532chrX1312 ------
NM_181581chr7------1823
NM_181659chr2093234 2238 1323 733 433 381 370 158 106 11294 23361 616 1820
NM_181659chr2093234 2238 1323 733 433 381 370 158 106 11294 23361 616 1820
NM_181671chr173922 375 22 ------
NM_181672chrX21276 219 31610 65 23 11535 --
NM_181673chrX21276 219 31610 65 23 11535 --
NM_181674chr5--1131 ----
NM_181675chr5--1131 ----
NM_181676chr5--1131 ----
NM_181677chr5--1131 ----
NM_181678chr5--1131 ----
NM_181702chr81306 1763 1322 --
NM_181705chr565800 5309 4705 4079 2032 175 31971 708 169 1879 --
NM_181706chr1172297 2089 1944 1825 1797 1611 251 --31832 1624 291 --
NM_181714chr651988 1232 679 440 185 11823 11284 --
NM_181787chr863139 3020 775 618 572 399 23806 3722 11477 --
NM_181886chr43507 250 229 11032 ----
NM_181887chr43507 250 229 11032 ----
NM_181888chr43507 250 229 11032 ----
NM_181889chr43507 250 229 11032 ----
NM_181890chr43507 250 229 11032 ----
NM_181891chr43507 250 229 11032 ----
NM_181892chr43554 297 276 11079 ----
NM_181893chr43507 250 229 11032 ----
NM_182472chr41140 ------
NM_182485chr453547 2289 1466 1258 1088 1779 11111 --
NM_182493chr1685412 3492 1414 1306 1100 721 404 185 --34250 395 335 --
NM_182505chr91495 ----1514
NM_182515chr1974806 2478 1403 1105 514 263 182 --14191 --
NM_182565chr17----1137 --
NM_182641chr17139 --21965 1842 --
NM_182643chr841992 942 72 52 --32278 2251 1497 --
NM_182646chr453547 2289 1466 1258 1088 1779 11111 --
NM_182734chr2083280 2792 2352 2288 549 536 463 44 --2405 231 --
NM_182762chr7136120 5570 5438 5345 4714 4253 2494 2353 2347 1968 1782 603 157 15943 24819 3785 54133 4087 4045 4002 3962
NM_182763chr1102208 2078 1855 789 529 397 343 307 253 143 32142 1991 435 12094 --
NM_182765chr1041958 1431 885 323 ----11451
NM_182789chr51772 ------
NM_182830chr1411595 2562 496 21982 455 1329
NM_182898chr7156071 6058 5949 5780 5734 5157 4928 4913 4053 4014 2170 1981 1899 1298 467 179 25038 34 --
NM_182899chr7156071 6058 5949 5780 5734 5157 4928 4913 4053 4014 2170 1981 1899 1298 467 179 25038 34 --
NM_182972chr152582 2532 2168 1742 1102 --22188 1922 --
NM_183234chr1561779 1451 1409 1156 486 282 1755 ----
NM_183235chr1561779 1451 1409 1156 486 282 1755 ----
NM_183236chr1561779 1451 1409 1156 486 282 1755 ----
NM_183323chr51772 ------
NM_183416chr132102 527 394 1409 1226 --
NM_194247chr263580 3118 1332 890 191 130 --24368 106 --
NM_194282chr452598 2309 871 627 30 12299 --2481 264
NM_194283chr5184152 4122 4067 3966 3922 3884 3637 3606 3523 3481 3104 2775 2705 955 894 758 568 522 1300 ----
NM_194285chr1173005 2996 2574 2122 517 496 33 --11252 --
NM_194286chr12115903 5038 4845 4814 4223 4159 3985 2453 1909 1347 236 14984 15834 --
NM_194291chr842391 2346 2260 632 22980 2074 1888 --
NM_194298chr1031627 1329 1237 --1524 --
NM_194314chr185038 4427 2219 2114 1163 871 638 510 15487 ----
NM_194434chr18165448 5415 5299 5261 4978 4499 4305 3906 3653 2008 1972 1908 1459 1400 650 504 12015 35595 310 273 --
NM_194463chrX41131 1109 1005 45 11060 ----
NM_198066chr141709 32551 2090 1908 --1991
NM_198077chr12254 156 --1141 --
NM_198081chr662913 2591 1999 931 358 305 --52507 1936 1852 841 167 --
NM_198128chr1832084 1935 750 12226 ----
NM_198158chr372781 2599 1197 1136 981 388 157 ------
NM_198159chr372781 2599 1197 1136 981 388 157 ------
NM_198177chr372781 2599 1197 1136 981 388 157 ------
NM_198178chr372781 2599 1197 1136 981 388 157 ------
NM_198181chr1572870 2521 2241 2188 2180 1085 720 ------
NM_198195chr32495 164 ------
NM_198243chr151325 ------
NM_198270chrX53385 2904 322 75 62 33159 2617 1117 --1441
NM_198273chr52673 91 1925 12667 --
NM_198320chr1294616 3322 1791 1204 1151 914 803 340 183 --15141 15249
NM_198321chr5123259 3056 3012 2713 2707 1984 1037 1029 920 758 319 198 --11048 --
NM_198392chr6122249 2206 1994 1744 1735 1614 1606 760 339 274 232 30 ------
NM_198400chr1552732 2632 2142 2098 1158 180 1815 1874
NM_198401chr851566 1330 1186 429 75 11306 --11243
NM_198465chrX32178 759 441 --1363 1965
NM_198468chr673769 3665 3340 1239 1105 834 204 --33685 990 164 --
NM_198503chr162244 1730 1666 595 511 199 11872 --11677
NM_198549chr143004 2919 399 91 --12659 --
NM_198569chr661739 1688 853 780 347 152 12655 11062 --
NM_198578chr1231397 1252 951 2944 375 --1190
NM_198581chr276982 4561 2843 2788 1528 996 430 15271 25985 2958 17423
NM_198686chr1492391 1925 1862 1822 1786 937 897 698 82 --11758 12271
NM_198793chr354099 3695 2956 2684 290 23647 2966 ----
NM_198794chr1421218 144 --1568 --
NM_198859chr3134875 4342 3843 3746 3624 1801 1430 1153 1024 740 624 490 43 11981 21275 1233 14829
NM_198889chr41919 ------
NM_198900chr12187578 7306 6603 6305 5967 5806 5762 5736 5439 5189 5091 2220 2021 1611 1466 1027 1011 601 27280 1952 26570 1425 --
NM_198902chr151327 1279 --1652
NM_198935chr2042866 2365 2322 613 ----11307
NM_199000chr731719 410 136 --21858 792 --
NM_199005chr9101040 854 671 360 347 309 158 100 93 53 ------
NM_199040chr1263860 3647 3387 2849 2776 1128 --13635 11093
NM_199072chr782706 2507 1207 1099 1048 969 933 612 --33267 2878 2194 --
NM_199132chr1941409 668 584 315 ------
NM_199188chr12103669 3458 3228 3219 3082 2800 1042 1000 545 462 --23011 1529 --
NM_199190chr12103669 3458 3228 3219 3082 2800 1042 1000 545 462 --23011 1529 --
NM_199235chr21265 ------
NM_199280chr2------1124
NM_199320chr482914 2392 2013 762 623 577 440 60 --1897 --
NM_199320chr482914 2392 2013 762 623 577 440 60 --1897 --
NM_199324chr463504 2574 2501 837 710 98 23441 1031 22286 750 --
NM_199421chr1484883 4682 4153 3532 3377 3323 3275 1985 11130 --1761
NM_199436chr272931 2885 2751 1923 369 344 103 32426 1989 991 12101 42862 2213 924 847
NM_199454chr1144729 4610 4572 4248 4148 3685 2899 1799 1533 1232 434 221 80 55 ------
NM_199462chr1134461 4308 3749 3709 3583 3467 3351 3256 1242 771 421 109 70 1566 --14740
NM_199482chr232101 1436 339 --21336 252 --
NM_201413chr212694 386 --2767 257 --
NM_201414chr212694 386 --2767 257 --
NM_201428chr1171431 1076 615 595 324 227 211 ----1201
NM_201429chr1171431 1076 615 595 324 227 211 ----1201
NM_201430chr1171357 1002 541 521 250 153 137 ----1127
NM_201437chr8----11375 --
NM_203341chr111071 --145 --
NM_203342chr173499 3395 2879 2867 2680 1058 222 12553 53231 3070 2333 380 197 --
NM_203343chr173499 3395 2879 2867 2680 1058 222 12553 53231 3070 2333 380 197 --
NM_203354chr141651 --1316 --
NM_203355chr141651 --1316 --
NM_203356chr141651 --1316 --
NM_203372chr251698 1513 1348 1162 250 --21116 388 --
NM_203391chrX31204 180 54 11266 21339 312 --
NM_203403chr92914 267 ------
NM_203446chr2172034 1120 868 477 391 358 318 1860 22906 1212 --
NM_203451chr1352292 2091 2057 1546 218 2935 825 12179 --
NM_203458chr183491 3247 1437 996 950 660 459 244 23347 2560 33768 3114 520 --
NM_203463chr274334 3466 1873 1642 1291 831 603 --23452 1888 1175
NM_203464chr1--11264 ----
NM_203504chr432236 695 277 1220 1226 --
NM_203505chr432236 695 277 1220 1226 --
NM_205860chr172256 2232 2208 1256 546 458 70 --13141 1371
NM_206594chr183362 2841 2800 2224 1308 990 941 672 11475 12946 --
NM_206595chr183362 2841 2800 2224 1308 990 941 672 11475 12946 --
NM_206853chr663924 3908 3627 3616 1370 486 13660 1323 --
NM_206854chr6125185 5169 4888 4877 3282 1747 1273 1022 571 431 247 169 24921 419 21584 1266 --
NM_206855chr6126150 6134 5853 5842 4247 4119 2238 1987 1536 1396 1212 1134 25886 1384 32549 2231 513 1984
NM_206860chr101175 ------
NM_206861chr101175 ------
NM_206862chr101175 ------
NM_206866chr2172537 2122 940 864 797 509 256 22697 2211 ----
NM_206876chr263467 2901 2878 2549 1365 42 --22781 477 --
NM_206907chr563240 3102 2593 2368 890 387 1628 22866 979 --
NM_206909chr8248075 8037 7619 7589 7532 7197 7148 7056 6964 6850 6778 6655 6381 6137 5485 5096 3338 2481 1883 1575 1412 623 499 471 36889 1691 1486 35408 2107 361 25897 5210
NM_207015chr362070 970 604 347 233 162 1373 2734 457 1242
NM_207292chr363229 2868 1360 258 65 40 ----23150 2858
NM_207293chr363229 2868 1360 258 65 40 ----23150 2858
NM_207294chr363229 2868 1360 258 65 40 ----23150 2858
NM_207295chr363229 2868 1360 258 65 40 ----23150 2858
NM_207296chr363229 2868 1360 258 65 40 ----23150 2858
NM_207297chr363254 2893 283 90 65 29 ----23175 2883
NM_207299chr94899 390 259 215 1936 ----
NM_207303chr10104177 4061 3460 1046 897 853 787 703 373 159 --23943 2731 14050
NM_207304chr1312097 12440 12547 --
NM_207325chr191743 1260 ----
NM_207361chr13196114 6083 5386 5350 5058 4661 4373 4195 2513 2256 1986 1779 1573 1478 1075 1016 751 681 181 1514 45311 4927 1325 875 --
NM_207366chr71415 --2870 823 11816
NM_207404chr332250 1678 48 42240 2068 2008 1718 1718 11710
NM_207406chr4126103 5961 5865 5808 5723 5504 4456 4415 1682 1543 1004 548 --14696 --
NM_207422chrX41326 1137 571 175 1546 --1526
NM_207578chr15532 180 154 120 109 192 164 --
NM_207660chr142672 75 ----21376 241
NM_207661chr142672 75 ----21376 241
NM_207662chr142672 75 ----21376 241
NM_212471chr1722195 2085 --1836 --
NM_212472chr1722195 2085 --1836 --
NM_213589chr262089 1854 1128 1122 547 224 24662 3725 15194 14031
NM_213593chr1--11069 ----