TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5584-5p
miRNA Sequence: CAGGGAAAUGGGAAGAACUAGA

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr144901 827 787 131 1799 178 --
NM_000038chr542082 1642 1582 282 ------
NM_000051chr1143228 1200 769 683 ----1565
NM_000052chrX4791 744 550 99 22802 802 13320 13039
NM_000055chr31295 1423 135 --
NM_000068chr1911494 --31509 1183 1178 11518
NM_000075chr121216 --146 2232 196
NM_000084chrX146011 5858 5820 5369 5095 4442 2115 1995 1046 907 827 747 721 86 36674 4743 130 96920 6274 5874 5863 5825 5443 5411 1633 177 --
NM_000088chr1751287 997 970 370 47 --1145 --
NM_000090chr22935 162 ----1938
NM_000092chr2154242 3596 3410 3154 3114 3051 2932 2917 1532 881 702 594 498 481 117 33363 1799 158 23959 1631 14471
NM_000093chr972112 2087 1897 1634 1534 951 413 --32273 1907 1743 --
NM_000097chr31842 --1874 --
NM_000109chrX3913 847 754 --32136 2047 2026 --
NM_000125chr6114272 4022 3522 2711 1719 1629 1598 1558 1229 1160 237 33364 1575 1464 33679 1504 1494 13162
NM_000129chr64973 480 442 167 --11179 --
NM_000133chrX3539 320 75 --41355 508 322 126 --
NM_000138chr1532260 192 65 --32290 1992 1763 --
NM_000141chr1051314 1093 1035 992 308 ------
NM_000153chr1461672 1642 1621 1444 1419 42 1231 1534 --
NM_000161chr1441708 1462 1217 117 21738 1486 ----
NM_000163chr542109 1999 1941 137 --12371 --
NM_000165chr641485 650 619 298 --21143 1094 11300
NM_000167chrX31343 618 293 --1696 --
NM_000168chr773036 2430 2329 2220 2203 972 146 12301 12373 12649
NM_000173chr173418 394 115 --1396 --
NM_000176chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_000189chr232406 1969 46 11469 2755 35 --
NM_000192chr124569 530 362 320 132 21388 1338 1365
NM_000202chrX53780 3240 2614 2489 1506 11048 83971 3916 3885 2674 2637 1563 1253 233 12875
NM_000208chr1993516 3176 1888 1876 1751 1394 1369 762 50 --33948 3553 515 34676 4260 4199
NM_000210chr21232 1720 22346 712 --
NM_000212chr1761940 1899 1810 637 546 361 --1920 --
NM_000214chr2021757 674 ------
NM_000216chrX93822 3148 3093 1597 1432 985 788 618 314 2484 212 52500 799 790 762 316 12674
NM_000217chr12114967 4301 4177 3660 3592 3404 1768 1102 769 656 640 45229 4053 1998 678 53820 2076 1953 1265 216 22065 1524
NM_000218chr111863 ----1969
NM_000220chr111703 --1909 1351
NM_000223chr17169 2135 35 ----
NM_000237chr841519 754 507 448 --21444 118 --
NM_000240chrX3840 428 324 1629 21937 668 --
NM_000245chr72822 507 ------
NM_000248chr362211 1036 1007 455 356 40 --22140 95 22214 2058
NM_000252chrX31382 615 604 1411 1379 --
NM_000258chr31245 ------
NM_000259chr15125742 5541 5398 4970 4889 4160 4018 4005 1992 1932 977 905 23884 2030 66008 5041 2258 1011 907 692 --
NM_000264chr933288 2143 901 1577 43361 3131 2331 2215 1683
NM_000266chrX1251 1880 2400 208 --
NM_000267chr1773319 2589 881 766 384 80 64 1901 23456 386 --
NM_000268chr2282962 2366 1289 1089 980 255 217 128 --43474 3466 2452 198 --
NM_000276chrX52171 1712 1507 1445 646 21959 143 2797 237 --
NM_000280chr11--1690 1997 --
NM_000284chrX81933 1907 1659 1562 1500 608 282 267 11715 --2520 407
NM_000286chr171637 ----1310
NM_000289chr12----1106 1285
NM_000297chr462012 1344 822 417 387 193 11954 31966 1630 1600 --
NM_000304chr171387 1702 ----
NM_000310chr12989 361 11079 31242 1236 71 --
NM_000314chr1041059 896 281 125 --32274 344 131 --
NM_000328chrX--1297 ----
NM_000330chrX31523 1507 610 2855 401 ----
NM_000332chr6156884 6503 5950 5676 5471 4893 4884 2837 2760 2305 2296 1795 1688 661 180 1291 56371 6169 2851 608 434 --
NM_000333chr33404 393 103 --21047 166 --
NM_000337chr5136499 6468 5277 5125 4971 4161 2632 2127 1685 1257 501 411 272 --36501 6110 1687 11152
NM_000340chr321370 71 --21149 1084 --
NM_000345chr44865 747 183 95 1793 ----
NM_000346chr1751945 1590 1224 529 81 2433 146 51978 1966 1920 1579 611 --
NM_000353chr163828 388 144 --1265 --
NM_000362chr2251419 818 401 51 30 11217 43544 3423 2577 2269 22837 1426
NM_000368chr9104693 4367 4358 3587 1814 1406 1037 376 288 80 --11907 --
NM_000386chr172561 22 ------
NM_000390chrX62592 2119 1165 935 820 146 13045 --22933 149
NM_000391chr1171666 1460 1330 1147 1112 507 293 1390 21181 275 --
NM_000393chr251933 1582 740 715 598 ------
NM_000394chr213418 92 83 --1100 --
NM_000399chr102818 90 1735 ----
NM_000406chr422915 405 23053 3025 52685 530 490 284 205 --
NM_000408chr262373 1128 513 306 291 230 --22819 2375 --
NM_000411chr2122110 1217 1673 32321 1303 87 --
NM_000415chr122731 48 ------
NM_000428chr1452469 989 942 573 258 22016 75 22297 1019 --
NM_000430chr1773362 3096 2654 2522 2471 1311 757 --22531 35 --
NM_000435chr197806 275 267 260 181 105 77 --3864 280 66 1305
NM_000439chr5132011 1641 1612 1562 1029 972 813 768 734 725 417 222 134 2505 46 22384 2273 --
NM_000447chr1--1376 --1106
NM_000448chr1162707 2495 1197 1096 958 388 --22524 45 22114 1200
NM_000449chr151059 1018 535 458 238 --11023 198
NM_000451chrX3709 588 461 11860 ----
NM_000452chr1341967 1770 1686 1614 2352 194 41886 1313 1308 815 11970
NM_000460chr3299 53 192 2494 378 --
NM_000461chr374360 2966 1761 1457 1296 1153 791 --23674 1155 1938
NM_000480chr1181630 1078 550 491 357 311 258 91 --2313 270 --
NM_000484chr212432 292 ------
NM_000489chrX73064 3046 2917 2910 2479 686 292 13003 43155 3066 1097 794 11129
NM_000492chr71466 --2473 275 11120
NM_000493chr61239 2792 48 1384 --
NM_000503chr831718 1468 394 --21504 1320 --
NM_000509chr4--1198 --171
NM_000522chr731049 911 430 --2158 134 --
NM_000527chr192824 193 1552 2275 253 --
NM_000533chrX41832 1610 1380 441 --21903 1502 127
NM_000550chr92957 886 --3988 959 692 --
NM_000555chrX127885 7113 6668 6105 5931 5606 5540 5447 3085 3039 342 174 12779 96324 5656 5528 4829 2896 2307 1357 446 164 35869 2270 1529
NM_000574chr121047 328 31069 956 249 21350 501 1862
NM_000578chr231511 1440 542 21279 145 --11391
NM_000587chr531102 982 267 11185 31192 449 95 11105
NM_000599chr2104312 4164 4051 3877 3467 3246 2854 1169 1024 496 14275 33894 1412 24 11671
NM_000600chr7140 190 ----
NM_000609chr1082796 2749 2730 2077 1215 648 453 319 12838 --13140
NM_000615chr1152901 2417 1959 718 289 --22460 1219 22504 136
NM_000617chr1252331 817 764 585 446 --2696 174 1449
NM_000618chr12176346 5785 5640 5598 5284 2574 2329 2173 2026 1823 1278 1186 819 804 763 653 130 14064 15299 24307 417
NM_000618chr12176346 5785 5640 5598 5284 2574 2329 2173 2026 1823 1278 1186 819 804 763 653 130 14064 15299 24307 417
NM_000620chr1282022 1989 1893 1878 506 408 158 66 --3328 191 127 --
NM_000625chr173439 427 129 ------
NM_000627chr21892 --1679 1199
NM_000633chr1834823 3377 2105 --25228 4825 --
NM_000663chr1653101 2383 2256 907 323 --31174 1141 190 --
NM_000680chr8156 ------
NM_000685chr3----1175 --
NM_000685chr3----1175 --
NM_000719chr1296322 6277 5928 4766 2647 2347 1919 1106 790 12176 85934 4919 4421 2380 2164 2137 1909 914 1998
NM_000721chr192733 2682 2656 2308 2240 1989 1890 989 34 --42684 2115 1892 1676 12332
NM_000726chr241378 1062 1027 315 ------
NM_000756chr81356 --1403 --
NM_000794chr521060 916 1775 ----
NM_000795chr113918 906 312 --3933 895 377 --
NM_000801chr2051130 983 902 198 185 --2993 100 --
NM_000806chr511785 11548 1564 31832 1284 118
NM_000809chr4269140 8648 8562 8550 8506 8409 8106 7828 7802 7778 6966 6853 6830 6434 3669 3225 2841 2644 2230 1540 1432 1181 632 580 375 115 28613 8029 107146 6924 6855 6836 6814 6758 6334 3654 2646 469 47062 5631 3553 2528
NM_000813chr5135401 4751 4641 2129 2113 1847 1694 1632 1054 881 528 371 202 1711 23519 1855 23607 1697
NM_000814chr1593803 3397 3253 3010 1362 1312 954 560 149 --23871 1095 --
NM_000818chr10176 133 ----
NM_000824chr41274 --1385 --
NM_000826chr442590 1859 957 96 --12056 --
NM_000827chr552401 2031 1803 1683 773 --41711 424 182 146 --
NM_000831chr185641 5626 4615 4423 4034 1695 909 805 --26232 5530 --
NM_000833chr1651543 1282 1264 1124 380 1337 --1406
NM_000838chr652031 2008 1091 714 238 --22735 2187 --
NM_000840chr72520 455 ----1361
NM_000842chr111517 --1652 --
NM_000844chr331068 1055 803 1245 ----
NM_000855chr11------1340
NM_000861chr352587 1907 1029 597 572 --21897 718 --
NM_000864chr121122 954 --1145 --
NM_000868chrX2841 290 --3299 281 270 125
NM_000870chr561517 997 557 248 223 94 1633 1151 --
NM_000872chr1051417 1003 555 488 398 ----11300
NM_000875chr15165872 5840 4922 4614 4572 2678 2605 2410 1404 955 846 608 317 211 180 152 --87025 6004 5743 2157 1727 1130 811 332 12385
NM_000876chr641258 1232 892 376 --11396 --
NM_000877chr283087 2881 2695 2244 2135 1193 982 790 --22883 2185 12000
NM_000891chr1783599 3267 3257 2994 2967 994 322 262 12950 53336 1070 661 585 438 --
NM_000895chr12----134 --
NM_000898chrX4780 590 570 164 ----1329
NM_000899chr1254049 4004 2719 812 464 21706 1688 33369 1545 814 22848 1725
NM_000901chr441923 1849 169 121 --21702 39 --
NM_000902chr363081 2822 2805 2036 274 217 23180 66 11300 12079
NM_000903chr1631530 104 64 --123 --
NM_000905chr7----1124 134
NM_000919chr52245 54 1181 159 --
NM_000924chr1241353 544 416 271 --1466 --
NM_000933chr2021649 544 11445 2176 88 11704
NM_000935chr311068 11135 1818 --
NM_000944chr432373 2212 1812 --12199 1320
NM_000945chr241496 540 177 128 --51862 1388 530 524 111 21919 1402
NM_000949chr53960 624 151 2800 188 1730 1781
NM_000950chrX53547 2302 1441 1167 1034 13378 --13408
NM_000956chr143709 285 63 ------
NM_000958chr531209 853 483 11000 2973 855 --
NM_000961chr20113937 3766 3670 3538 3407 953 706 667 530 130 121 --12580 13121
NM_000962chr963015 2018 1922 927 726 554 --22301 497 --
NM_000963chr131709 761 713 ------
NM_000965chr331275 987 195 --2385 255 --
NM_000983chr161308 1258 413 372 342 130 --1491 --
NM_000990chr1133596 419 154 --33946 3761 44 11149
NM_001001323chr1222871 2108 1790 22789 2650 --
NM_001001331chr362480 2304 1906 1754 643 251 --22290 166 --
NM_001001394chr23585 87 54 ------
NM_001001395chr1242558 2235 1847 867 --1756 --
NM_001001396chr1163981 3909 3681 3673 3665 3319 3274 3255 3111 2910 1753 1584 1556 1513 862 766 --41192 1050 872 296 --
NM_001001419chr594788 4660 4304 4086 3497 1791 1651 1626 385 11082 44790 4475 670 387 13998
NM_001001420chr594788 4660 4304 4086 3497 1791 1651 1626 385 11082 44790 4475 670 387 13998
NM_001001433chr2072828 2809 2600 2388 2028 567 496 1155 32947 2556 197 1486
NM_001001436chr161121 --1192 --
NM_001001481chr873150 3086 2929 2627 868 328 125 12784 33152 2546 1238 --
NM_001001484chr1051644 844 497 296 148 --52474 871 854 358 117 11647
NM_001001502chr51110 ------
NM_001001549chr752570 2149 1904 1794 781 --12151 1712
NM_001001550chr752570 2149 1904 1794 781 --12151 1712
NM_001001555chr752570 2149 1904 1794 781 --12151 1712
NM_001001556chr1551595 594 495 181 85 --21137 409 --
NM_001001557chr842225 2180 1520 400 --1276 21660 343
NM_001001668chr1952842 2720 1220 201 43 --33183 3145 3132 1317
NM_001001709chr9180 --1928 --
NM_001001787chr1----2193 186 --
NM_001001890chr2183991 3063 2980 2877 2853 2764 626 497 --43474 2868 2823 2787 --
NM_001001936chr1031138 976 480 11093 1997 --
NM_001001938chr9133473 3350 2898 2714 2684 1640 1562 1440 1234 1212 1089 1056 129 21589 1171 33339 3189 3074 21643 120
NM_001001971chr1021167 900 --31237 1094 58 --
NM_001001974chr1032278 1914 1622 11671 21814 48 --
NM_001001995chrX51444 1334 577 548 534 --21559 550 --
NM_001002026chr351761 1717 1642 659 371 12364 1932 --
NM_001002031chr12158 ------
NM_001002233chr862124 1823 1813 1726 1585 1578 --31825 1587 1445 --
NM_001002243chr2142 154 2935 35 --
NM_001002255chr61137 ----1123
NM_001002294chr12304 281 --1310 --
NM_001002295chr101907 --2821 446 --
NM_001002296chr85964 457 365 356 97 ------
NM_001002762chr1052508 2147 939 522 379 --22635 2538 12225
NM_001002811chr121235 182 --21491 1329 --
NM_001002812chr121235 182 --21491 1329 --
NM_001002812chr121235 182 --21491 1329 --
NM_001002838chrX21902 100 --21785 102 --
NM_001002860chr1463907 3569 3188 1861 1678 1372 13545 54597 4019 1880 317 272 --
NM_001002876chr22----1407 --
NM_001002909chr1751590 1578 1490 345 55 --4769 370 333 197 11754
NM_001002926chr762737 2583 1846 1762 1033 951 12078 1462 --
NM_001003406chr2233217 2649 2258 --1551 1735
NM_001003652chr18168493 8411 8086 8040 6844 6830 6641 6315 6108 5973 5709 5699 3010 1050 741 455 27645 160 108304 8247 8173 7403 7385 6133 6127 5333 3454 528 38694 7308 1682
NM_001003665chr152903 2796 815 705 168 --31398 1393 678 --
NM_001003674chr1876559 4707 4687 1943 1147 447 147 22561 2516 12817 15194
NM_001003675chr1876559 4707 4687 1943 1147 447 147 22561 2516 12817 15194
NM_001003681chr2291782 1637 1570 1449 1388 525 366 258 77 --11909 --
NM_001003688chr41822 --21119 803 11194
NM_001003712chr1263908 3298 3153 1585 1530 1256 ----33911 2459 1533
NM_001003760chr673385 3231 2601 2524 2514 1113 525 1305 43233 1332 405 344 11274
NM_001003790chr8----2794 627 1291
NM_001003791chr8----2794 627 1291
NM_001003792chr31446 11136 2448 440 --
NM_001003793chr31446 11136 2448 440 --
NM_001003794chr382831 2772 2476 2299 1912 747 664 244 11004 ----
NM_001003800chr9103348 3288 3136 2681 1510 1329 1222 1176 1163 678 ------
NM_001003810chr43618 256 50 1586 ----
NM_001003891chr221113 185 ----
NM_001003937chr241430 663 140 111 11386 21492 502 --
NM_001003940chr1563854 2981 1429 1248 360 337 11167 42385 1010 179 136 1650
NM_001003942chr1563854 2981 1429 1248 360 337 11167 42385 1010 179 136 1650
NM_001003943chr1563858 2985 1433 1252 364 341 11171 42389 1014 183 140 1654
NM_001004065chr983982 3745 3643 3387 3349 1038 486 438 --53894 3032 2510 516 425 --
NM_001004127chr131690 --2369 126 --
NM_001004304chr1253225 2904 2429 928 683 1605 12168 --
NM_001004317chr643741 909 863 623 --127 23704 2843
NM_001004329chr1231025 379 155 1494 1347 --
NM_001004342chr1215813 5602 5353 4747 4505 4051 3747 2102 1874 846 816 793 782 770 743 731 715 669 644 315 277 14840 44200 1476 834 721 --
NM_001004346chr431007 844 166 ------
NM_001004360chr231675 753 234 --21743 1677 --
NM_001004419chr12114587 4434 4254 4235 4102 4092 4069 3452 1464 1327 521 --1847 24590 1535
NM_001004720chr22242 104 --2957 667 --
NM_001004722chr22411 273 --21126 836 --
NM_001005335chr19199 --3263 52 46 --
NM_001005366chr124884 768 621 185 2874 822 1386 1396
NM_001005368chr10125 --1141 --
NM_001005386chr21456 1206 147 --
NM_001005404chr17104261 3660 3603 3372 3189 1144 1076 971 541 223 --44433 3666 3240 3219 --
NM_001005463chr1052087 1047 652 245 228 2999 865 ----
NM_001005473chr5176497 5842 5698 5672 5641 5299 5212 5194 4999 4890 4873 4333 2600 2300 2286 1106 197 21667 318 46448 5186 2435 2302 15386
NM_001005474chr3----1184 --
NM_001005505chr341798 1393 1248 56 --21699 1693 --
NM_001005527chr3----1400 1943
NM_001005746chr241378 1062 1027 315 ------
NM_001005747chr241378 1062 1027 315 ------
NM_001005849chr173560 149 134 --1562 1120
NM_001006115chr382638 2251 2125 1815 1748 916 697 408 12463 31974 313 110 --
NM_001006605chr121177 906 --21129 1116 --
NM_001006605chr121177 906 --21129 1116 --
NM_001006610chr161632 --2859 380 --
NM_001006612chrX3380 73 63 ------
NM_001006613chrX3380 73 63 ------
NM_001006614chrX3380 73 63 ------
NM_001006617chr92940 529 --2391 334 --
NM_001006619chr92940 529 --2391 334 --
NM_001006620chr92940 529 --2391 334 --
NM_001006621chr92940 529 --2391 334 --
NM_001006656chr1941695 1219 1108 541 11185 2524 84 --
NM_001006684chrX1167 --1124 --
NM_001006946chr281392 1243 1225 525 278 218 180 61 1614 11227 --
NM_001007024chr1774280 4236 4217 3114 3091 3040 431 --43915 3734 3584 178 --
NM_001007025chr1774280 4236 4217 3114 3091 3040 431 --43915 3734 3584 178 --
NM_001007067chr82998 342 2674 243 21003 46 1257
NM_001007068chr82998 342 2674 243 21003 46 1257
NM_001007069chr82998 342 2674 243 21003 46 1257
NM_001007070chr82998 342 2674 243 21003 46 1257
NM_001007097chr9114990 4531 4098 4076 4024 3108 1958 1792 1356 323 266 1691 63872 3838 3821 3502 1829 614 14959
NM_001007099chr1----1760 3802 623 154
NM_001007100chr1----1760 3802 623 154
NM_001007102chr641466 1176 1135 357 --1617 --
NM_001007156chr1581641 737 679 326 227 200 167 85 --21883 400 --
NM_001007226chr1741261 1010 436 224 ------
NM_001007227chr1741261 1010 436 224 ------
NM_001007228chr1741261 1010 436 224 ------
NM_001007229chr1741261 1010 436 224 ------
NM_001007230chr1741261 1010 436 224 ------
NM_001007237chr132189 1937 588 1385 42736 590 403 57 --
NM_001007246chr2141533 1195 274 120 ----11536
NM_001007277chr1161118 426 303 247 181 74 --21030 183 --
NM_001007471chr9270 53 --179 --
NM_001007527chr52668 85 1217 ----
NM_001007538chr1341559 1169 105 24 --11215 --
NM_001007793chr101197 169 1101 125
NM_001007794chr13689 641 582 1514 ----
NM_001008222chrX1301 11315 21333 889 --
NM_001008225chr73577 223 72 ------
NM_001008239chr1883394 2527 2356 1006 301 139 35 21 --23716 217 --
NM_001008392chr363390 2820 2623 1278 798 303 1388 33573 991 949 --
NM_001008405chr721588 705 --31342 732 587 11803
NM_001008408chr776203 5935 5517 4131 2269 1457 222 --46177 4822 2428 829 12236
NM_001008495chr821538 868 1362 41735 1518 1512 824 1514
NM_001008539chr8105301 4420 4235 4080 3970 1680 1632 1305 1027 335 21582 1551 65065 1981 1757 1279 1099 609 24683 4423
NM_001008541chr1032257 1939 1775 --32271 1798 326 --
NM_001008541chr1032257 1939 1775 --32271 1798 326 --
NM_001008564chr132401 120 ----1123
NM_001008660chr1121440 445 1533 31413 1407 979 11443
NM_001008701chr19102902 2866 2738 2494 1198 1019 616 521 366 201 12756 52847 2830 2803 1179 602 1850
NM_001008708chr2--1198 2565 490 --
NM_001008738chr542897 1032 482 88 --190 12428
NM_001008777chr17----2610 210 --
NM_001008925chr44947 733 414 59 11150 33273 2737 239 12854
NM_001008938chr112390 173 1325 1368 --
NM_001009185chr51259 --3621 567 129 1161
NM_001009554chr454261 3951 3426 1582 174 --53974 3888 1584 454 368 24161 536
NM_001009554chr454261 3951 3426 1582 174 --53974 3888 1584 454 368 24161 536
NM_001009555chr451329 1246 1090 508 24 ------
NM_001009565chr22442 22 1431 ----
NM_001009566chr141063 1046 520 427 --21413 907 --
NM_001009571chr751597 1490 1197 1114 376 21572 1173 31735 1712 189 --
NM_001009880chr2273589 3266 1304 1217 911 888 192 1897 23918 1563 --
NM_001009899chr3115839 5393 5372 5022 4617 4407 4148 1962 1732 870 225 2690 259 25739 4726 14481
NM_001009993chr284326 4276 3767 3733 1464 1033 968 818 --42880 984 883 790 13936
NM_001010000chr1873275 1199 1106 838 786 641 192 2965 745 23250 2680 --
NM_001010852chr6----1147 --
NM_001010853chr622530 918 1457 1511 --
NM_001010854chr14--1717 1182 --
NM_001010861chr172774 2689 2663 1716 820 305 152 --22740 2114 --
NM_001010862chrX43132 2685 2150 1101 --12152 --
NM_001010867chr196181 5999 5832 5799 5771 4072 1746 627 200 --56492 6097 2455 2088 1596 --
NM_001010888chrX43739 3285 3014 1409 13799 41577 1209 388 380 11632
NM_001010891chr586934 6551 6505 6439 5918 5773 4632 2006 ----25649 5056
NM_001010895chr931447 1359 181 --21999 689 1324
NM_001010917chr1062023 793 601 471 212 154 --32067 429 230 --
NM_001010971chr12835 317 --2297 215 --
NM_001010984chr172468 2154 820 692 584 545 279 12077 2694 510 1285
NM_001010986chrX62498 1831 749 426 392 126 --11981 --
NM_001011513chr473948 3119 2703 1529 1056 923 254 13590 52864 1111 1058 347 210 13165
NM_001011515chr411133 2696 138 11069 --
NM_001011516chr411133 2696 138 11069 --
NM_001011537chr3----21887 1606 --
NM_001011553chr71686 2400 225 1756 --
NM_001011666chr7106093 5998 5864 5470 4734 4718 679 662 491 233 36361 4467 2446 76000 5044 4710 2098 1964 1790 681 15473
NM_001011708chr232019 1161 1078 --42021 1954 1126 796 --
NM_001011713chr1431383 1003 473 1343 1636 --
NM_001011720chr82292 167 1576 2385 303 --
NM_001011885chr1531323 1306 386 --11308 --
NM_001012264chr144765 735 670 84 ------
NM_001012267chr921495 1455 ----11489
NM_001012393chr11134562 4338 4185 4089 3912 3365 3130 1704 1349 955 624 292 277 --25045 1307 11398
NM_001012398chr164958 744 126 34 --1895 --
NM_001012410chr32452 184 1481 2488 460 --
NM_001012420chr1532547 1990 732 1877 1573 12638
NM_001012423chr1522547 732 1877 1573 12638
NM_001012426chr643233 1174 949 471 23421 443 23148 1047 12740
NM_001012427chr643233 1174 949 471 23421 443 23148 1047 12740
NM_001012512chr18----193 --
NM_001012513chr18----1104 --
NM_001012514chr231094 954 830 --2962 956 --
NM_001012516chr231094 954 830 --2962 956 --
NM_001012614chr4------1535
NM_001012642chr1562114 1790 1408 506 156 29 --11998 --
NM_001012732chr411093 1149 ----
NM_001012751chr1041607 777 668 425 11317 21293 712 --
NM_001012755chrX135076 4387 3791 3566 3228 2039 1141 1094 1008 983 296 283 46 34673 1123 183 --34340 4076 774
NM_001012968chrX52687 1935 461 396 328 22714 2075 52505 2235 1101 949 663 1334
NM_001012977chrX91172 986 524 485 471 320 199 175 154 --21174 896 --
NM_001012993chr961380 1317 1273 1082 431 283 1955 41187 1156 1137 834 --
NM_001013031chr1083098 2914 2621 1302 1104 817 653 249 1908 31067 481 453 1699
NM_001013406chr741727 1547 1294 56 11764 ----
NM_001013415chr411062 --11424 --
NM_001013615chr12975 817 --21147 420 1144
NM_001013620chr12148277 7761 7602 7239 5908 3402 2361 2337 1874 1735 1592 1509 859 350 38361 901 505 46289 1021 805 725 --
NM_001013622chr481161 875 378 316 254 192 131 69 ------
NM_001013624chr174970 293 227 30 178 21020 864 --
NM_001013635chr1231168 860 289 --21183 1045 --
NM_001013690chr1262122 2045 1770 1635 395 386 11790 71740 1637 1617 1541 572 461 406 22170 218
NM_001013699chr12----1462 --
NM_001014286chr13124 ------
NM_001014336chr122379 104 191 ----
NM_001014380chr13175814 5374 5242 4895 4384 4365 4315 4173 4101 2134 1878 1785 1516 1099 976 348 329 25532 4016 65018 2126 1787 1698 1518 653 25817 5319
NM_001014797chr10107740 7604 7237 5520 5198 3151 3024 2343 2101 1048 32908 2481 439 67916 7407 2183 509 500 275 --
NM_001014809chr43340 325 190 --3877 136 61 --
NM_001015045chr451560 785 570 388 358 21839 290 22461 2202 --
NM_001015048chr1493123 2934 2477 2245 1302 930 753 583 189 --23068 1195 1756
NM_001015049chr1493123 2934 2477 2245 1302 930 753 583 189 --23068 1195 1756
NM_001015053chr1731230 1119 519 --31264 270 248 --
NM_001015877chrX22050 641 12157 33077 489 384 --
NM_001017368chr1752761 1124 1002 884 781 --32338 2215 2184 --
NM_001017371chr211088 --11072 11247
NM_001017395chr363220 3077 2974 2815 2489 531 2813 27 2897 238 11299
NM_001017396chr251980 1877 1489 707 436 ------
NM_001017405chr41967 --2356 335 --
NM_001017424chr141856 1724 531 524 149 21503 268 21579 281
NM_001017425chr141856 1724 531 524 149 21503 268 21579 281
NM_001017440chr7197645 7387 6998 6252 6108 6054 5884 5757 2819 2155 2147 1917 1680 1627 1437 1425 1340 734 508 46834 2730 2495 851 97988 7559 7389 6017 5701 3176 2157 1738 1063 26571 1351
NM_001017523chr1221919 1801 11421 11896 11783
NM_001017916chr1751702 1586 1390 811 181 --21402 679 11533
NM_001017917chr1751702 1586 1390 811 181 --21402 679 11533
NM_001017923chr1431410 200 29 --131 --
NM_001017926chr821764 1408 --21730 1683 11241
NM_001017963chr142967 898 ------
NM_001017970chr1432594 2071 638 11038 22522 108 --
NM_001017973chr5173 ------
NM_001017974chr5173 ------
NM_001017977chr12260 116 --1118 1263
NM_001017992chr531337 217 33 11445 135 142
NM_001017995chr544552 1934 1481 1271 13378 54817 4714 3796 2974 2954 --
NM_001017999chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_001017999chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_001018000chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_001018000chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_001018001chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_001018037chr911447 --31407 537 320 --
NM_001018053chr161859 1330 677 550 206 155 --31902 1544 1259 --
NM_001018054chr111066 --21256 1229 --
NM_001018064chr942140 842 285 240 --21589 214 --
NM_001018065chr9195905 5685 5443 5038 4998 4926 4847 4829 4615 3956 3799 2260 1728 1667 1422 1375 843 544 372 1623 55854 5297 5040 424 419 34778 4553 933
NM_001018066chr9195905 5685 5443 5038 4998 4926 4847 4829 4615 3956 3799 2260 1728 1667 1422 1375 843 544 372 1623 55854 5297 5040 424 419 34778 4553 933
NM_001018072chr1221919 1801 11421 11896 11783
NM_001018074chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_001018075chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_001018076chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_001018077chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_001018100chr153694 290 90 ------
NM_001018108chr1592155 1422 905 735 337 276 155 116 76 --3859 687 587 11567
NM_001018111chr7103525 2838 2674 1435 1405 1125 1012 975 711 148 --43599 3068 553 150 --
NM_001020658chr121413 23 --11486 11367
NM_001020658chr121413 23 --11486 11367
NM_001020825chr51932 1247 ----
NM_001023567chr153933 735 575 1880 ----
NM_001023587chr341177 845 337 47 1987 1713 2873 852
NM_001024024chr142762 271 1792 1167 --
NM_001024070chr142758 267 1788 1163 --
NM_001024094chr563457 3387 3144 2472 1197 633 12772 2533 344 --
NM_001024218chr144850 562 322 85 1651 1228 --
NM_001024401chr1632677 2111 1038 12883 12071 --
NM_001024455chrX92449 2434 2140 2061 1702 1066 765 389 322 --32692 1902 835 1952
NM_001024463chr1541095 401 257 154 --1366 --
NM_001024647chr12106677 6070 6059 5070 4827 4675 1615 1057 372 109 15851 21059 297 27412 4678
NM_001024649chr552889 1834 912 894 881 --12960 1884
NM_001024680chr231521 1468 1229 ------
NM_001024808chr1262747 2361 892 862 402 308 21102 321 32206 2015 982 --
NM_001024855chr31155 --11434 --
NM_001024934chr65613 473 204 102 63 --1125 1105
NM_001024935chr65613 473 204 102 63 --1125 1105
NM_001024936chr65613 473 204 102 63 --1125 1105
NM_001024948chr163488 3293 2853 2390 1001 708 1542 21271 1156 --
NM_001025068chr331599 288 143 --2658 81 --
NM_001025069chr331599 288 143 --2658 81 --
NM_001025076chr10155923 5522 4799 4694 4657 4337 4272 4265 2443 2011 1711 1669 1529 1108 581 22387 1899 43958 2364 1531 1288 44185 4044 3944 352
NM_001025077chr10197281 6880 6157 6052 6015 5695 5630 5623 4991 3027 2887 2466 1939 1398 1389 1325 1225 1127 949 14777 45316 4993 2889 2646 55543 5402 5302 1710 1401
NM_001025079chr363489 2920 2707 2674 901 778 11172 33501 3143 698 --
NM_001025105chr53983 455 57 --21413 1020 11229
NM_001025107chr182490 882 705 686 502 300 212 100 --62535 1727 479 462 341 336 --
NM_001025107chr182490 882 705 686 502 300 212 100 --62535 1727 479 462 341 336 --
NM_001025108chr263937 2683 1191 1079 640 118 14039 11270 --
NM_001025201chr21744 1529 1516 --
NM_001025205chr31114 --1293 --
NM_001025233chr1232432 2042 626 11697 32756 1849 423 --
NM_001025248chr155958 949 504 494 228 --21285 932 --
NM_001025249chr155958 949 504 494 228 --21285 932 --
NM_001025252chr862671 1215 424 377 212 124 --2370 306 23121 1218
NM_001025253chr862671 1215 424 377 212 124 --2370 306 23121 1218
NM_001025266chr3154666 3656 3561 3410 3044 1956 1537 1391 1275 1246 490 395 358 157 74 24847 3362 34886 4310 1608 14866
NM_001025366chr611518 ------
NM_001025366chr611518 ------
NM_001025367chr611518 ------
NM_001025367chr611518 ------
NM_001025368chr611518 ------
NM_001025368chr611518 ------
NM_001025369chr611534 ------
NM_001025369chr611534 ------
NM_001025370chr611518 ------
NM_001025370chr611518 ------
NM_001025389chr1181630 1078 550 491 357 311 258 91 --2313 270 --
NM_001025390chr1181630 1078 550 491 357 311 258 91 --2313 270 --
NM_001025579chr1711176 --2863 289 --
NM_001025580chrX74120 2997 613 397 380 361 257 21704 990 74033 3740 3631 3026 463 372 353 1260
NM_001025595chr441557 1117 357 137 --2221 139 --
NM_001025603chr151059 1018 535 458 238 --11023 198
NM_001025616chr431634 1386 1206 --31910 1641 424 --
NM_001025777chr221546 515 1382 11106 11035
NM_001025780chr9----21376 32 --
NM_001029858chr652223 2119 2057 881 537 1621 22154 506 2892 512
NM_001029863chr653116 1009 990 504 432 21196 803 12628 --
NM_001029875chr592805 2615 2400 1925 1198 1184 1171 1117 987 1118 1528 --
NM_001029884chr642608 1725 336 215 11052 12492 1723
NM_001029998chr431314 549 524 31462 462 238 21005 287 1887
NM_001030006chr1772507 2347 2156 1980 878 599 538 12117 2776 618 1952
NM_001030007chr16113677 3632 2981 2622 2541 1284 1111 830 774 294 247 --43719 2715 2468 411 1138
NM_001030055chr1434728 986 832 1147 44030 1177 834 125 11460
NM_001030272chr111422 --1499 --
NM_001030273chr111422 --1499 --
NM_001030287chr1----2873 867 --
NM_001031623chr651158 667 430 324 253 ------
NM_001031677chr52483 427 --1405 --
NM_001031679chr12113479 2864 2758 2727 2526 2496 2359 1247 655 523 299 --13153 23537 558
NM_001031689chr9----149 --
NM_001031690chr782776 2339 2252 2040 1225 820 434 414 --32569 983 450 --
NM_001031695chr22175197 5076 4719 4503 4458 4214 3934 3907 3851 3642 3476 1872 1562 949 812 609 597 25329 1245 55147 4465 3917 1512 189 24722 3923
NM_001031700chr441833 1718 634 627 1895 11720 1228
NM_001031710chr71885 --21020 887 1164
NM_001031711chr551824 1340 411 313 171 11751 21238 226 --
NM_001031716chr2----1111 --
NM_001031723chr42459 313 --1315 1462
NM_001031732chr473609 3344 2782 2767 2438 493 272 23505 2446 42890 2261 543 330 --
NM_001031738chr21455 ------
NM_001031801chr222357 164 ------
NM_001031804chr1664212 4166 3520 2767 1226 558 12995 63659 3643 2858 2759 1031 1020 --
NM_001031812chr54557 474 415 298 ----1182
NM_001032221chr931441 594 80 --21657 1651 11531
NM_001032280chr621684 455 --41522 1175 636 602 11687
NM_001032281chr2------125
NM_001032282chr821342 241 --11091 --
NM_001032296chr1362802 2278 2222 965 838 706 12726 42846 753 41 33 11872
NM_001032363chr142000 1875 1488 904 --31555 479 179 1907
NM_001032363chr142000 1875 1488 904 --31555 479 179 1907
NM_001032380chr1031308 1231 443 1225 ----
NM_001032393chrX3778 167 148 --1717 --
NM_001032394chr662525 2469 2033 1116 748 539 11088 32636 2471 1021 --
NM_001032395chr662392 2336 1900 983 615 406 1955 32503 2338 888 --
NM_001032999chr20105385 4888 4799 4748 3411 1334 711 669 245 201 14515 34116 1163 801 --
NM_001033025chr121257 1216 --31232 506 359 --
NM_001033047chr462630 2174 1774 430 66 50 --52457 2275 2247 1861 590 --
NM_001033049chr2182252 1631 1586 929 920 777 558 250 1327 11515 --
NM_001033057chr352123 2040 1832 1784 1410 11751 1332 1366
NM_001033059chr662002 1550 1442 651 336 223 ------
NM_001033081chr161939 1816 720 471 226 199 ------
NM_001033082chr161939 1816 720 471 226 199 ------
NM_001033087chr2062500 2157 916 677 615 136 --42894 2693 270 201 --
NM_001033088chr151392 --1340 1395
NM_001033117chr3104925 4523 4290 3887 3571 3489 3392 1591 1319 331 1260 94695 4685 4553 3927 3658 3549 3495 1915 1086 24805 1594
NM_001033506chr11----122 --
NM_001033507chr121490 708 ------
NM_001033551chr1732876 327 254 23849 2755 1185 --
NM_001033557chr2----21300 1294 143
NM_001033561chr176899 823 797 785 720 178 ------
NM_001033566chr172945 666 ------
NM_001033568chr172945 666 ------
NM_001033576chr17112562 2516 2504 2330 2297 2203 1752 1744 822 775 144 --1763 --
NM_001033578chr852387 2169 2070 466 299 --2952 301 --
NM_001033723chr862630 2466 1992 1970 744 474 --32181 946 244 184
NM_001033756chr611452 ------
NM_001033756chr611452 ------
NM_001033925chr1052142 1754 1746 447 49 --11340 1545
NM_001034837chr52624 136 ------
NM_001034838chr52624 136 ------
NM_001034845chr44462 300 227 92 --11437 --
NM_001034850chr521302 131 1428 21054 133 --
NM_001034852chr141234 11319 22042 409 --
NM_001034915chr81549 1339 41334 976 448 438 11220
NM_001034954chr1062205 1290 1101 776 427 264 --12971 12017
NM_001034955chr1062205 1290 1101 776 427 264 --12971 12017
NM_001034956chr1062205 1290 1101 776 427 264 --12971 12017
NM_001034957chr1062205 1290 1101 776 427 264 --12971 12017
NM_001035260chr101214 1488 11508 --
NM_001035511chr1142136 2125 2110 2013 1861 1759 1446 1404 722 712 596 343 166 79 11470 22035 1406 22113 1864
NM_001035512chr1142243 2232 2217 2120 1968 1866 1553 1511 829 819 703 450 273 186 11577 22142 1513 22220 1971
NM_001035513chr1142243 2232 2217 2120 1968 1866 1553 1511 829 819 703 450 273 186 11577 22142 1513 22220 1971
NM_001035521chr24784 738 668 88 1796 ----
NM_001037131chr23978 442 404 ----1374
NM_001037132chr731477 280 229 1448 22227 2032 134
NM_001037133chr731477 280 229 1448 22227 2032 134
NM_001037164chr711784 --2658 41 --
NM_001037165chr798925 7666 6450 6054 5533 3132 2474 2427 1041 13017 77527 6523 6228 5616 1820 249 244 --
NM_001037174chr281982 1779 1758 833 614 234 197 184 --1603 --
NM_001037317chr172774 2689 2663 1716 820 305 152 --22740 2114 --
NM_001037331chr182201 46 --1358 --
NM_001037332chr582251 2172 776 768 490 299 257 194 --22197 1834 --
NM_001037333chr582251 2172 776 768 490 299 257 194 --22197 1834 --
NM_001037334chr181450 12063 2562 298 --
NM_001037339chr141804 675 629 542 --11206 --
NM_001037340chr141804 675 629 542 --11206 --
NM_001037341chr141804 675 629 542 --11206 --
NM_001037341chr141804 675 629 542 --11206 --
NM_001037494chr121257 --1242 --
NM_001037495chr121257 --1242 --
NM_001037535chrX--11437 1520 1539
NM_001037536chrX--11437 1520 1539
NM_001037540chrX--11437 1520 1539
NM_001037553chr2122077 1800 14926 45157 4880 4447 310 25077 3572
NM_001037631chr221124 876 ------
NM_001037954chr1152989 2518 2236 1185 225 33006 2640 2419 22238 719 --
NM_001038493chr221097 1041 11478 ----
NM_001038640chr152802 643 --1257 1646
NM_001038702chr542408 2182 1908 1882 --32786 1884 117 --
NM_001038707chr15821 747 682 520 117 22244 294 22211 648 1120
NM_001038707chr15821 747 682 520 117 22244 294 22211 648 1120
NM_001039029chr1231859 1488 151 ----12028
NM_001039199chr2094878 4836 3823 3785 3056 1174 845 680 364 --74007 3814 3333 3047 1788 1656 37 --
NM_001039348chr231096 906 727 1281 ----
NM_001039349chr231096 906 727 1281 ----
NM_001039350chr721226 81 --41383 691 685 65 --
NM_001039395chr932340 2278 709 22311 644 42280 952 923 440 --
NM_001039459chr741156 464 325 126 ------
NM_001039479chr1442044 1700 970 808 --2810 629 --
NM_001039538chr273314 2282 1458 1305 1297 1242 922 11333 22715 795 --
NM_001039550chr22182 86 ------
NM_001039570chr2264155 4091 3473 1309 431 80 1403 ----
NM_001039571chr2264155 4091 3473 1309 431 80 1403 ----
NM_001039577chr173522 3075 1757 1643 1333 830 148 13725 31501 1335 282 --
NM_001039582chrX1296 --148 --
NM_001039585chr173742 3538 3477 2737 1612 1422 1025 21636 203 1966 12740
NM_001039590chrX73452 3438 3221 3205 2943 2465 1166 22910 831 23837 1030 --
NM_001039591chrX73452 3438 3221 3205 2943 2465 1166 22910 831 23837 1030 --
NM_001039618chr1185014 4631 4153 3676 1510 1407 1217 1108 25070 2228 33902 2244 232 25854 1199
NM_001039690chr1691583 1516 874 334 292 256 214 169 85 21476 153 52367 2065 1896 1713 1585 --
NM_001039709chr20105385 4888 4799 4748 3411 1334 711 669 245 201 14515 34116 1163 801 --
NM_001039711chr12885 826 179 2891 205 --
NM_001039712chr12885 826 179 2891 205 --
NM_001039762chr1062312 2253 1948 681 280 67 --11557 --
NM_001039802chr141365 1311 891 424 --2893 426 --
NM_001039840chrX115947 5922 5579 5533 5066 4264 3754 3726 1666 961 848 142 22374 2340 24295 1278
NM_001039916chr1241018 471 91 58 --21020 138 --
NM_001039917chr1241018 471 91 58 --21020 138 --
NM_001039918chr1241018 471 91 58 --21020 138 --
NM_001039919chr1241018 471 91 58 --21020 138 --
NM_001039920chr1241018 471 91 58 --21020 138 --
NM_001039937chr1373874 3571 3054 2929 2911 2709 143 14165 63679 3192 2860 2545 859 288 33000 2684 842
NM_001039960chr1251749 1383 332 309 259 21568 1482 41316 1255 322 269 --
NM_001040001chr651920 1376 1324 1272 335 --11550 --
NM_001040020chr721500 1365 --1524 1227
NM_001040057chr72448 24 --1203 --
NM_001040092chr81287 ----1159
NM_001040100chr331152 1054 84 2295 117 1959 --
NM_001040102chr1072135 2089 1720 867 746 504 347 ------
NM_001040103chr1072135 2089 1720 867 746 504 347 ------
NM_001040110chr741847 1752 1364 1270 ------
NM_001040134chr1951482 1070 488 256 130 --1396 --
NM_001040135chr71784 ------
NM_001040142chr211925 --12012 1523
NM_001040143chr211925 --12012 1523
NM_001040144chr1691583 1516 874 334 292 256 214 169 85 21476 153 52367 2065 1896 1713 1585 --
NM_001040146chr1691583 1516 874 334 292 256 214 169 85 21476 153 52367 2065 1896 1713 1585 --
NM_001040147chr18----198 1708
NM_001040151chr11193934 3927 3680 3662 3629 3442 3382 3120 3090 2998 2931 2904 1640 1454 648 485 311 279 111 13027 13271 --
NM_001040152chr745078 3872 1392 344 --35095 3797 3298 --
NM_001040157chr442641 2058 2034 878 --32888 2060 248 --
NM_001040159chr411378 1202 ----
NM_001040172chr561517 997 557 248 223 94 1633 1151 --
NM_001040173chr561517 997 557 248 223 94 1633 1151 --
NM_001040181chr32732 63 --1963 --
NM_001040182chr32732 63 --1963 --
NM_001040183chr32732 63 --1963 --
NM_001040197chr1----125 --
NM_001040199chr32732 63 --1963 --
NM_001040200chr32732 63 --1963 --
NM_001040202chr451827 1668 586 556 93 --2102 95 1321
NM_001040214chr641744 620 276 257 ------
NM_001040260chr441178 834 733 389 --31180 1027 433 1392
NM_001040261chr441178 834 733 389 --31180 1027 433 1392
NM_001040272chr932341 1454 101 22136 407 1178 11914
NM_001040280chr651300 1112 1073 1064 506 --11278 --
NM_001040284chr16125760 4591 4493 4125 1093 952 933 691 603 304 130 29 35179 3924 1064 35587 2314 744 --
NM_001040402chr44965 782 179 97 12460 62798 2572 1046 1016 791 111 --
NM_001040429chr1353509 3473 2530 2259 1203 --11195 --
NM_001040441chr184138 4027 3957 3349 1596 1562 1279 1161 25121 3884 ----
NM_001040450chr1552630 2345 2125 646 378 21897 102 ----
NM_001040453chr1552630 2345 2125 646 378 21897 102 ----
NM_001040458chr56681 618 610 479 240 109 --21686 111 --
NM_001040610chr15127 ----130
NM_001040619chr111029 --31323 1317 70 195
NM_001040624chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040625chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040626chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040627chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040628chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040629chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040630chr872338 2322 2173 2066 2038 510 44 --12040 --
NM_001040647chr771783 782 697 483 371 267 57 --1553 --
NM_001040648chr771783 782 697 483 371 267 57 --1553 --
NM_001040665chr765034 4775 4249 3565 1895 1826 14580 44803 4598 1461 511 11681
NM_001040666chr73736 477 299 1282 1505 --
NM_001040708chr841030 1018 415 377 --2970 921 --
NM_001040709chr182440 2348 2281 2126 1631 972 898 550 --22456 74 --
NM_001040712chr963255 3224 3179 2738 2526 807 11136 ----
NM_001042353chr204583 549 377 369 2414 82 ----
NM_001042355chr16115197 4817 3836 3645 2143 1871 1764 1193 1161 878 590 13993 44671 4220 3923 675 14310
NM_001042361chr102995 265 1595 21524 986 --
NM_001042364chr102995 265 1595 21524 986 --
NM_001042365chr102995 265 1595 21524 986 --
NM_001042383chr3142894 2861 2637 2491 2416 2384 1375 1361 1271 1129 1053 987 959 242 11381 32390 1309 169 23354 2503
NM_001042387chr102995 265 1595 21524 986 --
NM_001042388chr185846 352 309 228 26 ----1312
NM_001042393chr102995 265 1595 21524 986 --
NM_001042396chr102995 265 1595 21524 986 --
NM_001042397chr102995 265 1595 21524 986 --
NM_001042406chr61310 11163 1901 --
NM_001042412chr16115197 4817 3836 3645 2143 1871 1764 1193 1161 878 590 13993 44671 4220 3923 675 14310
NM_001042413chr963497 2682 2573 1444 1102 1001 22888 1093 5567 529 522 210 199 --
NM_001042424chr4113092 2852 2580 2413 2288 649 633 575 369 287 269 ------
NM_001042425chr621684 455 --41522 1175 636 602 11687
NM_001042473chr1041675 1661 1408 766 11780 11907 11678
NM_001042475chr61313 ------
NM_001042481chr141446 1996 12179 12067
NM_001042486chr2031218 415 77 --3469 462 247 --
NM_001042492chr1773319 2589 881 766 384 80 64 1901 23456 386 --
NM_001042494chr1593807 3630 3416 2911 2518 1249 1004 752 208 1823 1660 12701
NM_001042495chr1593807 3630 3416 2911 2518 1249 1004 752 208 1823 1660 12701
NM_001042496chr1593807 3630 3416 2911 2518 1249 1004 752 208 1823 1660 12701
NM_001042497chr1593807 3630 3416 2911 2518 1249 1004 752 208 1823 1660 12701
NM_001042506chrX91182 986 524 485 471 320 199 175 154 --31184 1108 896 --
NM_001042510chr852110 1408 1342 589 145 21552 1522 1432 --
NM_001042511chr852110 1408 1342 589 145 21552 1522 1432 --
NM_001042517chr131749 --1847 1908
NM_001042533chr3--1893 22648 1053 196
NM_001042537chrX52025 1660 581 434 181 --72327 2172 497 490 408 303 192 --
NM_001042543chr421012 350 --1621 --
NM_001042550chr91785 --41643 1637 1424 124 --
NM_001042555chr12104773 4343 4166 4131 3517 3127 1894 1843 1175 779 24160 1493 24133 3377 33972 3803 1568
NM_001042573chr1752053 1537 637 557 381 1336 1559 --
NM_001042599chr2237688 7617 7496 6788 6442 6327 5976 5755 5738 5561 5513 5474 5040 3035 2807 2443 1581 964 894 677 538 81 49 27025 5768 77622 7574 6465 6444 5442 224 68 16189
NM_001042601chr373017 2896 2332 2306 820 343 35 1434 23295 318 1107
NM_001042603chr1284845 4697 4193 1790 1783 1562 1547 1337 1176 64776 4770 1949 1736 1200 460 --
NM_001042604chr3114566 4320 4313 4267 4144 3618 3508 3079 1148 1073 34 13758 34329 4146 467 --
NM_001042646chr341671 1385 516 106 --2761 317 --
NM_001042669chr431634 1386 1206 --31910 1641 424 --
NM_001042681chr172616 2248 2174 598 313 269 184 --72397 2386 1980 1872 1788 988 304 --
NM_001042682chr172616 2248 2174 598 313 269 184 --72397 2386 1980 1872 1788 988 304 --
NM_001042682chr172616 2248 2174 598 313 269 184 --72397 2386 1980 1872 1788 988 304 --
NM_001042683chr621729 1152 11249 --1720
NM_001042749chrX41717 1597 756 347 1627 11919 1102
NM_001042750chrX41717 1597 756 347 1627 11919 1102
NM_001042751chrX41717 1597 756 347 1627 11919 1102
NM_001043318chr14113883 3195 3165 1537 1489 1139 969 884 793 704 575 --33770 795 577 --
NM_001043351chr172195 2152 2093 777 376 142 119 --11853 --
NM_001044305chr631392 224 46 --1282 --
NM_001044385chr294070 3708 3668 2962 2934 2488 868 778 265 23083 258 12741 13041
NM_001044387chr1964072 3316 1628 1393 1322 1024 11185 24164 2583 --
NM_001044388chr1964072 3316 1628 1393 1322 1024 11185 24164 2583 --
NM_001044722chr54557 474 415 298 ----1182
NM_001044723chr54557 474 415 298 ----1182
NM_001046chr522318 221 --32809 850 253 --
NM_001048183chr183626 3474 2891 2784 1131 620 249 48 --3688 625 251 --
NM_001049chr1452227 2020 602 308 267 --2632 454 1311
NM_001078chr14671 230 105 71 --1603 --
NM_001079874chr132057 1714 307 11921 1433 --
NM_001083620chr442588 1857 956 96 --12054 --
NM_001100108chr1198238 7492 6755 6719 6686 5761 5383 5270 3006 2969 2425 2212 1839 1613 1537 1208 836 808 603 37893 5842 1429 108321 7872 7766 3109 2750 2427 1419 1098 1086 66 --
NM_001106chr3209707 9586 9044 8657 8210 8164 8100 7715 3642 3384 3301 3187 2396 2249 2202 1195 1079 1013 478 331 --98435 7297 7165 6734 3303 2804 2398 1720 341 --
NM_001109977chr42152 107 --1252 --
NM_001111chr182490 882 705 686 502 300 212 100 --62535 1727 479 462 341 336 --
NM_001113490chrX73428 3054 2480 654 580 323 54 --12952 --
NM_001117chr1842006 1617 547 58 --21848 1843 --
NM_001119chr451497 1361 1008 446 337 ------
NM_001121chr1051713 1364 630 564 352 ------
NM_001123chr101692 --1694 1104
NM_001128chr16113677 3632 2981 2622 2541 1284 1111 830 774 294 247 --43719 2715 2468 411 1138
NM_001140chr171224 1216 1200 --
NM_001144chr16----1195 1955
NM_001146chr821756 1576 --1897 --
NM_001148chr441813 1797 1677 319 11504 11696 --
NM_001160chr1242666 2465 877 167 --32668 1814 524 --
NM_001167chrX44604 2367 1501 1439 --32459 1049 770 --
NM_001172chr143613 296 143 ------
NM_001173chr1434728 986 832 1147 44030 1177 834 125 11460
NM_001174chrX31965 1578 430 12010 21967 53 --
NM_001178chr111422 --1499 --
NM_001186chr2153216 893 762 155 37 13297 52525 2160 703 135 106 --
NM_001187chr211475 ------
NM_001191chr2051213 473 441 205 42 1947 1479 --
NM_001198chr682244 2226 2190 2175 958 749 433 122 --22303 1900 --
NM_001200chr2041112 1060 401 108 2802 225 ----
NM_001202chr14--1113 ----
NM_001204chr2107347 6715 2773 2201 2113 1797 1747 1299 1044 891 22091 1326 72974 2439 2258 1349 797 682 491 14803
NM_001205chr51413 ------
NM_001206chr962866 2405 2088 1932 1032 305 --22200 147 21043 910
NM_001219chr741881 639 350 24 --21397 274 --
NM_001233chr742274 1726 841 566 22223 89 1935 1584
NM_001235chr112693 591 ------
NM_001237chr41948 ----1413
NM_001237chr41948 ----1413
NM_001241chr21168 --21620 125 --
NM_001241chr21168 --21620 125 --
NM_001256chr1752633 2501 2155 1171 747 --22333 2109 --
NM_001257chr1631536 443 222 --1224 --
NM_001259chr7145987 5947 5856 4823 4769 4696 4185 1936 1506 1024 999 923 915 900 45483 5142 4284 1299 54472 2205 1607 1599 1059 25916 1621
NM_001263chr4----1127 --
NM_001268chr133252 69 39 ------
NM_001270chr521027 846 --1856 --
NM_001271chr1582572 2520 2294 2224 1277 737 682 306 --31237 1106 765 13227
NM_001273chr122381 101 --2586 55 --
NM_001278chr102961 69 ------
NM_001282chr1772507 2347 2156 1980 878 599 538 12117 2776 618 1952
NM_001284chr51383 1376 1457 --
NM_001290chr42976 103 --1318 --
NM_001300chr10----2447 348 --
NM_001304chr1753603 2492 2349 171 140 1177 12370 1468
NM_001310chr1292997 2745 2486 2098 2059 1239 1077 534 515 --12336 --
NM_001313chr43340 325 190 --3877 136 61 --
NM_001315chr661874 1778 1543 1426 784 105 12020 22179 812 --
NM_001316chr20--140 1365 --
NM_001319chr192436 185 --11069 --
NM_001326chr11143 ------
NM_001328chr4------1535
NM_001329chr10--11231 1290 --
NM_001331chr11102188 1899 1730 1145 1032 939 502 298 226 215 12213 72067 1960 1883 1034 446 300 75 1948
NM_001332chr531139 570 80 ----11267
NM_001343chr561687 1209 642 617 595 138 ----1270
NM_001351chr31439 21448 1373 ----
NM_001358chr41353 ------
NM_001364chr11164485 4468 4371 3984 3873 3780 3758 3311 3241 3219 3112 3102 2936 1549 1088 895 24394 3235 23281 3247 23181 3115
NM_001365chr17----2633 123 --
NM_001380chr101993 ------
NM_001386chr881916 1682 1602 1580 840 736 351 75 22412 210 32023 871 780 --
NM_001387chr5103000 2923 2899 2622 1235 1036 892 788 739 140 11099 12209 --
NM_001395chrX2992 239 ------
NM_001396chr2121132 59 11038 ----
NM_001401chr931361 499 386 --1501 --
NM_001406chr1761515 1379 1164 1127 666 532 3442 392 163 41243 409 386 246 --
NM_001412chrX33651 3392 416 31437 1413 1191 13704 1289
NM_001415chrX1142 --11248 --
NM_001417chr1281960 1773 1303 1200 760 567 457 24 --41775 1356 1214 35 --
NM_001418chr11----1141 --
NM_001418chr11----1141 --
NM_001419chr19144582 4393 4030 3941 3842 3351 3032 1864 1088 921 842 833 485 433 --33166 1750 222 --
NM_001421chrX41637 1396 1367 554 2547 358 ----
NM_001422chr1141377 1168 129 92 --11098 1267
NM_001423chr1232080 1902 1565 1163 11593 21662 768
NM_001426chr21648 1230 2569 534 --
NM_001427chr731540 822 805 --1734 --
NM_001429chr221405 --3415 109 43 1408
NM_001430chr221815 659 11710 2297 251 1644
NM_001431chr621254 810 --21135 444 1167
NM_001432chr442908 1139 759 237 1627 11232 13101
NM_001438chr182676 2466 800 526 373 248 210 194 1832 10488 483 477 471 465 458 448 443 236 230 --
NM_001439chr121257 1216 --31232 506 359 --
NM_001448chrX51442 501 336 311 158 11651 ----
NM_001449chrX4511 275 131 102 --11080 --
NM_001451chr16----11235 21292 978
NM_001453chr641670 611 386 352 ----11195
NM_001461chr15619 594 462 216 167 --1142 2597 149
NM_001463chr23814 175 168 --1150 --
NM_001465chr521617 686 1474 ----
NM_001482chr151612 --2719 373 --
NM_001491chr632760 2542 808 --2670 481 --
NM_001493chrX--1186 1689 --
NM_001495chr871033 922 894 800 285 157 116 1944 31045 930 300 --
NM_001497chr962684 2085 1925 1892 983 642 1858 32427 2422 1964 12382
NM_001498chr621109 923 --4455 442 429 412 1985
NM_001521chr24784 738 668 88 1796 ----
NM_001527chr664744 4426 1848 1613 302 201 13612 24804 1148 11187
NM_001530chr1431099 211 23 ------
NM_001533chr19199 --3263 52 46 --
NM_001542chr132189 1937 588 1385 42736 590 403 57 --
NM_001543chr564654 4039 3578 3422 1603 733 14443 44719 3289 3264 449 --
NM_001546chr621193 223 --31481 1244 486 --
NM_001555chrX2102 28 ------
NM_001584chr1141103 874 229 76 ------
NM_001587chrX52171 1712 1507 1445 646 21959 143 2797 237 --
NM_001604chr11--1690 1997 --
NM_001609chr1053673 3658 3635 3019 238 --23660 166 --
NM_001614chr17----1480 --
NM_001614chr17----1480 --
NM_001616chr232976 2535 823 1359 13138 --
NM_001621chr721173 524 2658 333 12832 1441
NM_001621chr721173 524 2658 333 12832 1441
NM_001622chr31261 1366 ----
NM_001634chr662002 1550 1442 651 336 223 ------
NM_001642chr112859 460 --31233 1226 1198 --
NM_001650chr1853847 3626 1619 1523 554 33472 2699 354 157 23019 2979
NM_001655chr1151580 1531 1498 131 77 --41883 1603 1477 728 --
NM_001656chr541861 1792 1654 614 ----11912
NM_001659chr12112222 2169 2141 2083 2044 2017 1728 1019 1006 746 316 12670 82540 2263 2096 1997 733 402 363 166 22233 2156
NM_001660chr32647 512 ------
NM_001662chr72152 92 --2284 104 --
NM_001663chr141701 1553 6866 398 190 179 164 95 2417 382
NM_001665chr112151 120 1548 1136 --
NM_001668chr141970 694 594 102 11527 41918 1789 1521 134 1260
NM_001674chr1----2873 867 --
NM_001677chr1121 --2831 824 --
NM_001678chr1771731 1700 1405 635 580 495 192 --51751 1410 1361 637 139 11709
NM_001682chr1222585 1822 1504 32503 2364 1124 --
NM_001683chr362480 2304 1906 1754 643 251 --22290 166 --
NM_001684chr1163698 3626 3398 3390 3382 3036 2991 2972 2828 2627 1470 1301 1273 1230 579 483 11554 3909 767 589 --
NM_001690chr382460 2223 2102 1652 314 214 180 73 --52499 142 64 36 31 --
NM_001693chr82443 61 11141 11192 --
NM_001695chr844218 3582 2963 1095 2284 120 11015 --
NM_001703chr12193 186 ------
NM_001704chr6----1555 1532
NM_001709chr1142704 2352 859 228 ------
NM_001714chr121362 --2468 200 --
NM_001717chr1561123 609 443 283 261 135 ------
NM_001718chr6--11313 21378 960 --
NM_001720chr13795 637 142 21729 1665 2870 797 --
NM_001730chr1311513 21543 444 11515 --
NM_001730chr1311513 21543 444 11515 --
NM_001731chr123921 775 274 --2748 341 --
NM_001740chr16----2499 468 --
NM_001746chr552889 1834 912 894 881 --12960 1884
NM_001753chr73466 226 140 --3681 53 41 1229
NM_001754chr2183991 3063 2980 2877 2853 2764 626 497 --43474 2868 2823 2787 --
NM_001755chr1632104 1815 165 --21940 523 1420
NM_001759chr1275047 4886 3999 3701 3522 1338 1045 --34117 3418 1950 --
NM_001760chr62306 243 1918 1728 --
NM_001761chr1621761 513 --2725 704 --
NM_001768chr251059 450 80 68 46 ------
NM_001773chr121322 1098 ------
NM_001777chr363489 2920 2707 2674 901 778 11172 33501 3143 698 --
NM_001788chr71686 2400 225 1756 --
NM_001791chr141365 1311 891 424 --2893 426 --
NM_001798chr122243 235 --2785 730 --
NM_001800chr194482 186 173 86 --175 --
NM_001806chr1922724 549 12151 21115 929 12928
NM_001810chr204772 662 221 206 --1567 --
NM_001822chr21744 1529 1516 --
NM_001829chr42620 226 --2870 97 --
NM_001830chrX43204 2910 1366 1101 1228 33155 1346 978 1672
NM_001839chr14729 562 168 145 --1151 --
NM_001843chr12174 ------
NM_001854chr111224 --11106 1261
NM_001855chr93887 858 547 ----1550
NM_001858chr664989 4155 1722 1094 830 193 25009 1307 2408 40 33565 3191 833
NM_001873chr41192 --1651 2213 139
NM_001881chr10------2407 203
NM_001891chr4270 23 --2340 25 --
NM_001892chr53983 455 57 --21413 1020 11229
NM_001895chr2041020 778 275 226 --21002 780 --
NM_001903chr55917 727 670 308 147 --1663 --
NM_001904chr3--1429 2872 307 --
NM_001914chr18------1361
NM_001915chr1751702 1586 1390 811 181 --21402 679 11533
NM_001921chr411093 1149 ----
NM_001923chr112472 198 ----1105
NM_001935chr241001 923 357 306 ------
NM_001936chr721226 81 --41383 691 685 65 --
NM_001938chr131794 359 43 --145 --
NM_001945chr511049 --11101 11121
NM_001946chr121185 --51000 787 772 356 54 --
NM_001948chr155958 949 504 494 228 --21285 932 --
NM_001949chr683044 2477 2323 2303 2179 2150 2097 2088 23199 402 22057 705 23008 1271
NM_001954chr62856 218 1620 ----
NM_001955chr621119 793 1980 1891 11122
NM_001962chr51236 1549 ----
NM_001968chr4--1750 1587 --
NM_001969chr142962 666 --21085 48 --
NM_001977chr451404 666 376 215 45 ------
NM_001981chr122320 504 --12205 1618
NM_001982chr126367 246 227 202 107 79 ----1230
NM_001987chr1274274 3492 1601 1215 1073 631 137 --64153 4106 1474 611 509 244 1396
NM_001994chr1--152 ----
NM_001995chr431151 974 439 ----1331
NM_001999chr521270 117 --2541 326 --
NM_002006chr4165485 5435 5187 4875 4678 4586 4155 2209 1945 1845 1751 1184 1127 557 465 445 25708 477 35497 4632 1753 22212 1436
NM_002009chr1512293 --31752 1060 86 21962 894
NM_002013chr14--1203 1241 --
NM_002015chr1322190 1321 11180 42594 2481 181 148 --
NM_002017chr1111409 --21261 1239 1858
NM_002024chrX31684 695 468 129 21433 308 1698
NM_002025chrX209202 8988 8785 8434 7817 7566 7558 7440 7389 6973 5878 3405 3223 2364 2262 1381 777 645 238 99 27956 654 109256 8351 8040 7448 6990 6170 1157 1151 1136 1099 --
NM_002026chr241023 1015 192 180 --11035 --
NM_002028chr1451277 1135 914 465 123 ------
NM_002037chr61398 --1320 --
NM_002039chr43579 339 315 ------
NM_002040chr21132825 2746 2557 2268 2171 2144 2090 1046 1028 906 850 447 394 11214 31269 1058 773 --
NM_002044chr1551595 594 495 181 85 --21137 409 --
NM_002051chr101907 --2821 446 --
NM_002056chr22579 183 --1813 --
NM_002061chr111580 --3455 265 35 21641 206
NM_002062chr641575 1517 509 210 --2550 149 --
NM_002069chr721194 1173 11653 11175 1677
NM_002071chr181682 1638 --1649
NM_002072chr94786 406 222 34 --2936 361 --
NM_002074chr13506 348 229 --31615 489 145 --
NM_002076chr1262843 2519 2405 1025 786 225 12201 ----
NM_002077chr941916 1377 867 153 --21936 1690 --
NM_002086chr1762059 2035 1835 1791 374 249 --22065 282 --
NM_002091chr18----193 --
NM_002092chr454968 4919 4808 3930 1268 11472 ----
NM_002103chr192932 754 --1205 --
NM_002111chr453199 2786 1019 541 282 --12709 12448
NM_002114chr6------172
NM_002126chr17113592 3392 2662 1250 1080 1034 993 789 548 212 50 1865 34183 3198 645 21188 792
NM_002128chr1321629 1010 12435 11631 --
NM_002129chr41142 ------
NM_002131chr64847 397 215 43 11308 1948 --
NM_002135chr12----1487 --
NM_002137chr72380 317 11726 31892 961 438 --
NM_002138chr43618 256 50 1586 ----
NM_002139chrX1120 --2608 579 --
NM_002140chr921039 960 1206 11079 --
NM_002145chr17----1295 --
NM_002146chr1761405 1366 1199 512 500 145 --1437 11408
NM_002147chr173944 922 306 --2726 225 --
NM_002157chr2----1150 --
NM_002158chr282914 2873 2856 2792 2564 739 434 369 12501 12519 13610
NM_002161chr9--138 2403 105 --
NM_002188chr5--1129 1694 --
NM_002192chr71619 1452 ----
NM_002199chr42884 166 --2992 77 --
NM_002202chr52771 27 --2815 29 --
NM_002203chr574057 3005 2835 2595 851 596 378 33546 2633 1558 53877 1534 1003 828 823 --
NM_002207chr32203 121 ------
NM_002210chr223035 995 --32501 2494 977 1998
NM_002214chr795729 4669 3548 3528 1836 1805 1517 1073 643 13574 33965 3465 2243 15071
NM_002223chr1253919 3860 3434 2751 650 --13942 --
NM_002228chr111198 1882 ----
NM_002232chr141268 908 213 198 21254 383 21392 215 --
NM_002235chr1241468 1304 1111 60 1371 ----
NM_002240chr21265 26 --151 --
NM_002241chr172937 942 934 857 650 619 605 1971 43146 817 607 41 --
NM_002245chr1----1639 --
NM_002247chr1052240 688 663 89 50 --31573 430 82 --
NM_002249chr1----1453 --
NM_002252chr2137 --2172 26 --
NM_002254chr241742 881 784 470 --22061 2052 --
NM_002264chr3124571 4218 4134 3427 1120 1018 901 764 712 568 352 103 23336 1217 54211 4136 3771 3703 3403 --
NM_002266chr17--1206 --165
NM_002267chr1342153 262 253 26 1206 32230 1786 255 12074
NM_002270chr585404 4255 4038 3441 2176 1409 1028 491 12003 45123 4914 3728 1665 34954 3907 1611
NM_002271chr1341518 780 536 298 --2794 58 --
NM_002274chr173346 303 255 1313 ----
NM_002285chr263937 2683 1191 1079 640 118 14039 11270 --
NM_002293chr152617 2410 2228 1734 499 11712 42632 2619 2380 249 --
NM_002298chr1361574 1447 1277 662 367 271 11666 ----
NM_002309chr2233011 728 711 --53003 2876 2591 2056 1132 --
NM_002312chr13------1770
NM_002317chr52301 292 ------
NM_002332chr123745 180 90 ------
NM_002333chr1921224 254 11184 ----
NM_002334chr1151589 768 407 316 35 1800 ----
NM_002336chr1264962 4819 1691 1663 1280 1230 --24821 933 31233 721 548
NM_002345chr12----1557 --
NM_002349chr231597 1554 161 --1269 --
NM_002350chr821156 292 1823 1917 --
NM_002355chr123909 167 66 2879 177 --1195
NM_002356chr631006 174 39 12360 32608 1981 270 --
NM_002358chr43506 265 152 --151 1509
NM_002359chr17103468 3046 2843 2760 1602 1252 740 384 125 118 12915 181 --
NM_002374chr273314 2282 1458 1305 1297 1242 922 11333 22715 795 --
NM_002375chr382140 1828 1607 1515 293 226 183 75 ------
NM_002382chr143839 228 215 11065 2517 111 11177
NM_002387chr5134618 4568 3590 3427 3132 2078 1267 750 690 423 414 360 211 44846 4178 3444 1347 ----
NM_002397chr522096 779 --22067 1936 --
NM_002402chr75935 426 343 110 21 ------
NM_002403chr1295 78 1356 ----
NM_002409chr2282880 2520 2363 2162 2135 968 909 753 --23159 723 1141
NM_002430chr2272194 2113 2057 1934 1728 722 706 1655 82600 1750 995 824 436 353 293 58 1138
NM_002442chr1261749 1726 1568 1126 1112 436 11485 1454 --
NM_002444chrX51437 1361 753 641 178 --2225 40 --
NM_002451chr993916 3321 3296 3239 2939 2887 2839 2730 271 1327 23371 490 --
NM_002460chr683665 2520 1442 1320 1079 825 766 594 12373 2811 32 --
NM_002472chr17----187 --
NM_002480chr12--11019 1499 --
NM_002481chr1207228 6745 6708 6699 6570 6556 6453 5355 5341 3093 3025 2687 2641 2387 1923 982 711 685 650 63 25927 1959 147559 7453 6572 5581 5481 5198 4972 2964 2855 1504 996 713 690 162 --
NM_002486chr94925 705 269 243 --12275 11624
NM_002492chr3134 ------
NM_002499chr1542045 916 693 216 --12244 11550
NM_002501chr19104053 3929 3208 3196 2552 1214 1148 869 572 183 --42599 2554 1602 1249 --
NM_002505chr641511 1339 1311 41 --11450 --
NM_002508chr151983 1681 361 303 142 2479 180 31579 144 23 --
NM_002509chr204728 696 681 608 --1701 --
NM_002514chr831122 806 237 1457 --21186 122
NM_002515chr1411729 21842 212 11640 --
NM_002518chr211164 --3975 399 203 --
NM_002519chr1161367 1302 1219 1104 972 387 --11058 1551
NM_002520chr5135 ----1106
NM_002522chr1752732 512 206 88 79 --43135 2957 1366 385 --
NM_002545chr11134562 4338 4185 4089 3912 3365 3130 1704 1349 955 624 292 277 --25045 1307 11398
NM_002546chr84236 99 67 27 --1238 --
NM_002547chrX53561 2898 1289 741 341 11645 23081 2900 --
NM_002553chr7------1442
NM_002556chr11142137 1986 1969 1839 1785 1624 1527 1340 864 821 433 300 130 97 11662 11357 --
NM_002563chr32199 71 --2749 256 1343
NM_002568chr81308 1438 ----
NM_002576chr112224 112 ------
NM_002577chr3133793 3714 3604 3120 2949 1067 905 897 808 794 466 136 32 13727 41525 1512 431 409 --
NM_002578chrX1308 ----1149
NM_002579chr1951482 1070 488 256 130 --1396 --
NM_002581chr975568 3870 3765 1426 1026 951 434 13627 35583 1475 848 24294 3685
NM_002586chr661644 1569 1298 303 288 223 --51646 396 374 317 234 --
NM_002594chr2051592 1538 762 309 21 21642 1622 --1908
NM_002595chr1241642 469 410 217 --11278 --
NM_002600chr141804 675 629 542 --11206 --
NM_002601chr22180 111 --171 1413
NM_002605chr1541201 468 355 38 1991 ----
NM_002607chr73888 245 46 1864 ----
NM_002608chr2241539 1510 1243 264 --21581 95 11113
NM_002610chr223076 2364 22234 2088 12313 12459
NM_002612chr731358 280 88 --1409 --
NM_002613chr16115334 4897 4669 4393 4129 3605 3352 3292 1415 1260 1104 14972 35379 3621 1292 23258 344
NM_002623chr20----166 --
NM_002628chr34448 442 431 387 --11144 --
NM_002633chr15472 411 401 380 223 --1385 --
NM_002636chr6--1391 1436 --
NM_002641chrX21641 526 ----11644
NM_002645chr1131962 751 639 --42307 1123 665 363 22690 1984
NM_002646chr142179 2044 1808 497 21378 800 1787 21966 500
NM_002648chr63981 973 929 --1328 --
NM_002649chr741183 1140 226 145 2452 282 --1130
NM_002651chr14895 868 836 213 1635 1838 --
NM_002655chr844489 4079 837 253 --41736 1490 1235 1154 --
NM_002657chr20153231 3041 2464 1396 1368 1339 1271 1163 980 949 924 800 778 514 315 13582 22866 2511 33186 2553 1274
NM_002669chr4----121 --
NM_002670chr331619 1331 1242 --21541 1462 --
NM_002674chr12----1162 --
NM_002687chr1431208 495 332 --173 --
NM_002693chr151149 --1303 --
NM_002698chr1962832 2583 2350 2245 1140 888 --22591 1966 --
NM_002699chr1101507 1461 1255 1240 1079 1068 1045 536 529 498 ------
NM_002706chr2----2583 577 --
NM_002709chr243573 2394 506 442 13237 43202 3108 1030 508 21287 445
NM_002710chr123225 218 123 ------
NM_002711chr7----3734 331 106 --
NM_002716chr11103697 3509 3502 3345 3148 1431 848 722 376 195 13488 63450 2834 2776 2515 1449 505 --
NM_002718chr362692 2570 2324 2199 889 103 1307 12694 --
NM_002719chr1442351 618 374 44 ----12122
NM_002720chr16----1238 --
NM_002725chr184357 4260 3636 3411 3245 1760 300 98 --31126 252 81 --
NM_002730chr19101249 1174 975 924 908 461 308 247 234 104 --21192 236 --
NM_002731chr192961 2797 2573 773 655 278 254 238 103 23101 843 1661 2908 302
NM_002734chr1771537 1484 589 439 239 73 28 ----176
NM_002736chr731892 752 709 --2711 113 11895
NM_002737chr17155851 5591 4997 4493 4452 4397 4317 4074 4043 2663 2188 2148 1785 818 507 25504 1070 66495 5801 4133 1778 1431 1060 15000
NM_002745chr2252946 1692 1536 606 505 --33422 3102 1043 13028
NM_002748chr151274 ----1372
NM_002763chr13560 511 173 --1155 1514
NM_002764chrX4889 682 214 54 1806 ----
NM_002772chr213526 388 40 --1478 --
NM_002776chr1971647 1452 773 706 686 375 194 --1641 --
NM_002806chr14----1332 --
NM_002819chr1941108 1022 547 328 ------
NM_002833chr1541161 412 367 323 2373 40 1154 --
NM_002839chr963255 3224 3179 2738 2526 807 11136 ----
NM_002840chr141263 666 372 284 --21216 384 --
NM_002843chr1193267 3131 2545 2424 916 758 739 305 254 --23325 746 --
NM_002847chr731505 1491 1289 --21001 458 --
NM_002855chr1173048 3005 1358 1032 828 256 189 --43506 1024 653 624 12711
NM_002858chr121179 554 --2433 357 --
NM_002866chr193231 31 22 1619 2509 453 --
NM_002868chr12142313 2265 2235 2105 1989 1981 1927 1750 911 773 744 564 412 310 --22092 537 --
NM_002869chr1141763 856 392 97 1417 21485 99 --
NM_002874chr952354 2002 1880 892 884 --22481 698 1286
NM_002880chr32605 76 ----2762 729
NM_002882chr22----341 36 26 --
NM_002886chr3114913 4821 4669 3659 3567 1871 1865 581 549 269 242 --65032 3301 1873 1254 1140 541 --
NM_002906chr113442 427 410 --32044 1611 374 --
NM_002911chr1941452 1402 322 94 1601 2552 346 --
NM_002912chr6----1358 1795
NM_002924chr14590 517 236 204 ------
NM_002941chr3----11174 11240
NM_002945chr173591 131 58 --1857 --
NM_002956chr1221270 926 --2941 884 --
NM_002957chr9113738 3693 3228 2938 2922 1470 1129 862 624 210 95 --21002 740 13239
NM_002959chr1144241 4126 3996 3491 3326 2860 1584 1432 1251 963 613 501 248 90 1897 33334 1112 615 --
NM_002968chr16198 1907 ----
NM_002971chr341021 743 364 75 --1178 --
NM_002977chr21343 21205 141 1924 12288
NM_002979chr1----1760 3802 623 154
NM_002994chr431516 124 34 1373 --2605 520
NM_002995chr12794 115 1197 ----
NM_002996chr1691948 1876 1387 1291 1220 779 629 552 269 ------
NM_002997chr281392 1243 1225 525 278 218 180 61 1614 11227 --
NM_002998chr841852 1797 1452 787 --11718 1303
NM_003001chr1142243 2232 2217 2120 1968 1866 1553 1511 829 819 703 450 273 186 11577 22142 1513 22220 1971
NM_003010chr173934 702 591 --22230 1945 11810
NM_003011chr94659 96 45 30 --4473 388 379 98 1139
NM_003012chr882969 2803 2781 2408 1930 1218 613 160 12493 41236 1141 1115 942 --
NM_003014chr7--21185 39 11408 --
NM_003016chr1772042 1848 1686 1678 1578 713 275 11419 11850 --
NM_003026chr931080 466 382 --1954 --
NM_003028chr972710 2655 2604 2358 1552 1534 406 --42712 2606 2514 988 --
NM_003029chr131100 1032 254 21021 58 11130 --
NM_003030chr331406 1373 1359 ----1230
NM_003031chr161631 --2859 380 --
NM_003034chr1297694 7634 7276 6549 6019 5086 3212 2084 1031 17033 77044 6324 5968 5285 5269 5088 722 28103 1492
NM_003042chr341733 535 411 363 --41767 1571 856 416 --
NM_003043chr354203 3812 2668 1180 34 --44330 4228 3752 475 --
NM_003045chr13104669 4566 4523 4390 3696 3059 1919 888 337 261 --23175 1529 12021
NM_003046chr8105301 4420 4235 4080 3970 1680 1632 1305 1027 335 21582 1551 65065 1981 1757 1279 1099 609 24683 4423
NM_003051chr141950 1704 1697 1513 ----1535
NM_003060chr551202 1070 875 473 400 21036 922 1815 --
NM_003069chrX--1763 --1669
NM_003070chr92539 39 1859 121 --
NM_003074chr372199 1917 1884 1606 1464 1391 856 3849 735 642 1290 11609
NM_003077chr172586 157 1685 ----
NM_003085chr51110 ------
NM_003099chr15126106 6054 5619 5469 5075 2460 1976 1376 1306 795 530 208 22600 777 45922 756 702 553 21959 499
NM_003100chr51454 ------
NM_003101chr12586 523 ----2610 589
NM_003104chr152985 327 11186 190 --
NM_003107chr651861 1797 1731 1058 672 --1661 --
NM_003108chr2176785 6665 6552 6368 6300 5461 5253 5102 4969 4438 2000 1419 1039 854 333 281 52 16073 105683 4784 2264 1842 1805 1762 1059 371 252 27 --
NM_003111chr211088 --11072 11247
NM_003112chr772759 2361 1151 1015 994 649 215 13219 11044 31154 468 414
NM_003114chr81800 ----1142
NM_003128chr242874 400 354 30 --41893 1742 909 880 --
NM_003131chr641766 822 791 648 --22108 1880 --
NM_003133chr141045 891 769 755 --1279 --
NM_003137chr672021 906 736 617 506 97 75 --3524 276 68 --
NM_003144chr62350 327 --1841 --
NM_003150chr1742045 942 324 233 11852 ----
NM_003152chr1721174 23 ------
NM_003155chr862806 2530 2419 2325 2119 273 --32254 2228 859 --
NM_003156chr1161146 995 278 73 64 41 --11217 --
NM_003161chr1793461 3220 2926 2879 2395 1405 1198 637 441 11145 11157 --
NM_003165chr941540 1214 693 179 --21756 1750 11630
NM_003174chr102555 335 ------
NM_003178chr362157 1873 1801 1591 1479 596 --2449 212 1138
NM_003184chr83992 740 230 --125 --
NM_003185chr2031106 826 465 ------
NM_003189chr193045 2844 2295 2153 673 257 250 179 122 1336 12155 --
NM_003199chr1895097 4674 4640 4515 4468 3710 1783 922 714 2588 51 21494 810 --
NM_003201chr101717 1677 2763 719 1336
NM_003204chr1731332 1284 244 --11735 --
NM_003211chr1231612 1261 505 ----21639 1342
NM_003216chr2283208 3138 2113 2085 775 656 636 507 --32715 1337 658 --
NM_003217chr1281699 1655 616 441 385 325 132 21 12032 157 --
NM_003220chr621684 455 --41522 1175 636 602 11687
NM_003221chr6153762 3460 3381 3371 3243 1624 1483 995 985 957 800 507 311 304 248 23892 3639 63540 3517 3430 2952 1485 1345 12897
NM_003234chr331685 481 277 11555 1680 --
NM_003236chr263442 3158 2786 2590 1296 1118 --32788 2395 1224 23573 3445
NM_003243chr131195 934 119 ------
NM_003246chr1531760 1473 108 --21318 250 --
NM_003247chr621526 86 --11633 --
NM_003253chr2131669 1289 469 --21513 559 --
NM_003255chr1742042 1649 1014 281 1840 12055 --
NM_003257chr1511060 11215 ----
NM_003262chr3115037 4175 3704 3670 3461 3390 1578 1349 1232 789 584 24351 1069 ----
NM_003274chr2142024 1191 431 204 --11836 12773
NM_003285chr12550 543 --1518 --
NM_003286chr2061140 1108 1097 784 438 333 ------
NM_003288chr2041584 1538 1134 404 ----11541
NM_003290chr1951021 465 234 184 77 1275 157 1237
NM_003292chr131709 713 591 ------
NM_003297chr121207 ------
NM_003298chr3145819 5262 5197 5089 4945 4607 3834 3815 2237 1405 735 180 126 114 24795 4361 55361 4917 4251 4148 1524 --
NM_003300chr14--1332 ----
NM_003309chr641751 1645 508 148 --31647 583 131 11683
NM_003320chr1194061 3890 3570 3329 1598 1404 1243 1017 680 44241 4133 3584 3576 43545 3013 2776 2771 24379 3992
NM_003336chrX3929 886 130 ----1144
NM_003337chr51240 ----21444 450
NM_003338chr10----2752 484 --
NM_003339chr531496 1406 1198 ----11511
NM_003340chr421160 63 --11192 --
NM_003342chr1782716 2569 2536 2478 1017 851 825 431 32789 1215 397 4985 853 485 71 --
NM_003344chr721090 180 141 21341 1092 11762
NM_003345chr162497 198 ------
NM_003359chr4----2937 914 --
NM_003372chrX4324 196 187 32 --1326 --
NM_003373chr1081808 1495 1439 1415 634 602 497 354 1340 41581 1385 370 364 --
NM_003374chr51580 ------
NM_003375chr102320 86 ------
NM_003376chr611518 ------
NM_003376chr611518 ------
NM_003378chr7----2422 417 --
NM_003384chr142313 55 --284 27 --
NM_003387chr2112798 2421 2188 1853 1811 1150 949 942 380 371 86 --22800 928 --
NM_003390chr1121061 90 --3888 732 312 --
NM_003392chr353610 2690 459 357 101 22710 1182 64057 3935 3313 3152 1522 134 12697
NM_003394chr121638 --2664 78 --
NM_003400chr2----3668 341 29 --
NM_003404chr2021442 829 1704 ----
NM_003405chr22263 29 ------
NM_003406chr841810 1595 540 139 11758 11622 --
NM_003407chr193579 563 126 ------
NM_003409chr181326 1383 ----
NM_003410chrX53078 2431 1238 411 398 --33025 2592 2078 12254
NM_003411chrY2583 366 11503 1674 --
NM_003412chr322676 1116 --1188 --
NM_003413chrX1181 --2794 454 --
NM_003418chr31313 --155 --
NM_003420chr32576 240 2650 262 --1579
NM_003431chr13180 105 95 ------
NM_003445chr192732 701 ------
NM_003458chr3103812 3735 3393 2510 2493 1304 1014 953 469 191 --63843 3782 2920 946 932 525 --
NM_003462chr171398 1372 1116 462 372 321 110 21136 444 --21660 465
NM_003463chr663230 2651 2634 918 444 259 23134 2359 1981 12654
NM_003470chr1671898 1724 1618 1580 1437 503 157 --21331 421 --
NM_003472chr62522 230 --21130 86 --
NM_003473chr103829 743 230 ----1864
NM_003474chr1042238 1640 780 266 ----11565
NM_003478chr1143122 2374 1209 183 --2347 339 --
NM_003481chr123509 499 481 --1106 --
NM_003482chr1282626 2472 2123 1777 988 922 580 53 --41119 573 538 530 --
NM_003483chr1242785 2775 2494 2127 --32066 1040 540 12878
NM_003487chr173178 75 21 ------
NM_003489chr2142630 1171 1116 793 1929 --12783
NM_003498chr1631094 1047 1025 1961 22063 1018 --
NM_003505chr741638 775 614 102 --1384 11214
NM_003506chr841276 951 825 266 11127 11176 11209
NM_003557chr151216 633 395 359 171 11301 1441 --
NM_003559chr1783193 2904 2502 1596 996 442 279 245 --73116 2411 2406 1288 989 928 609 --
NM_003563chr1741261 1010 436 224 ------
NM_003566chr12113240 3185 2690 2648 2542 2126 1260 489 454 360 210 --32274 973 503 --
NM_003574chr1895133 4749 4186 4123 3982 1978 1772 1214 437 --53923 3497 694 473 42 --
NM_003576chr1362802 2278 2222 965 838 706 12726 42846 753 41 33 11872
NM_003580chr82375 182 ----1596
NM_003581chr22242 104 --2957 667 --
NM_003583chr1273208 2398 1341 1043 854 793 401 --42400 784 544 403 --
NM_003587chr6----141 --
NM_003590chr293375 2709 1616 1499 1112 655 632 445 342 23704 2869 23688 1526 --
NM_003597chr241951 1722 1703 164 --12299 1472
NM_003607chr194083 3883 3363 3029 2783 2662 1610 733 72 13303 21645 1587 23853 917
NM_003615chr352568 926 885 817 374 22712 477 1980 --
NM_003617chr1154641 4501 4245 3918 3635 3515 3436 1625 1519 1478 1130 554 197 64 42 23272 1552 44522 3644 3637 658 11628
NM_003620chr172717 27 --21107 804 --
NM_003629chr142986 2290 1101 29 22490 184 31328 1092 828 23190 911
NM_003633chr531652 943 328 --42613 1756 637 330 --
NM_003637chr161534 491 418 360 347 234 --11140 --
NM_003656chr33166 137 66 ------
NM_003660chr19161 --1259 1266
NM_003663chr373511 2524 2201 2141 1110 339 272 12583 1848 1925
NM_003670chr321091 299 --31477 1174 34 11356
NM_003671chr9103090 3078 2994 2924 1203 947 924 850 734 111 --33468 949 816 --
NM_003672chr141737 678 502 34 1684 1422 --
NM_003677chr12----3743 737 421 --
NM_003685chr19149 1951 1802 --
NM_003701chr132920 31 1679 ----
NM_003705chr2--1719 2856 795 --
NM_003714chr552683 2456 2367 1220 30 --22274 1003 --
NM_003716chr32716 185 --1829 --
NM_003722chr352126 2096 660 483 287 ------
NM_003728chr41650 --1249 --
NM_003743chr252168 1937 1613 1600 869 1519 2921 871 --
NM_003746chr121257 --1242 --
NM_003749chr131653 --32015 346 190 --
NM_003750chr102812 726 1818 ----
NM_003758chr1521497 69 31616 1018 1009 21358 74 11526
NM_003758chr1521497 69 31616 1018 1009 21358 74 11526
NM_003759chr484174 4048 3799 3387 1485 1268 1102 280 33855 3074 321 33053 1104 917 1752
NM_003762chr13950 461 234 ------
NM_003763chr2072828 2809 2600 2388 2028 567 496 1155 32947 2556 197 1486
NM_003768chr14594 527 310 244 --21744 1561 1369
NM_003774chr1232358 1187 739 22803 786 43340 3310 2417 2175 --
NM_003778chr3--1678 1126 --
NM_003784chr18----198 1708
NM_003787chr182600 67 11514 11701 --
NM_003794chr31365 --2431 21 1368
NM_003796chr193607 461 208 ------
NM_003799chr18104345 4104 3915 3354 1506 1249 1235 961 803 754 --184 --
NM_003800chr642397 1531 917 181 1481 32054 1846 421 --
NM_003812chr21270 ----1273
NM_003822chr122620 496 --12021 12843
NM_003825chr152210 193 --21394 1142 --
NM_003829chr91144 ----1164
NM_003831chr183611 452 125 --1419 --
NM_003840chr872118 2069 1751 1511 785 46 31 ------
NM_003861chr1482901 2718 2166 1953 1052 859 574 368 12743 32709 2653 2026 1603
NM_003864chr4--1169 ----
NM_003872chr272677 2002 1877 873 835 392 242 --42222 875 434 74 --
NM_003873chr1041835 1001 604 127 --1210 --
NM_003877chr122318 207 --2695 689 --
NM_003884chr321136 292 ----1716
NM_003885chr1752655 2016 1991 767 115 --32308 1902 716 --
NM_003887chr281838 1631 907 703 488 446 347 231 2884 113 ----
NM_003888chr1531304 364 341 --41309 1097 380 58 --
NM_003895chr2131580 1351 773 22067 1845 1215 --
NM_003902chr12831 535 --3669 592 124 --
NM_003908chr202453 445 --11340 --
NM_003909chr842977 2401 1192 1018 11118 42403 1885 969 921 1120
NM_003913chr674125 3533 2690 1570 626 464 95 14053 33925 1579 1380 23111 397
NM_003916chrX21327 949 --1262 --
NM_003921chr121292 487 --3722 336 225 --
NM_003922chr15130 1431 ----
NM_003924chr431673 650 231 --21547 1404 --
NM_003927chr184777 367 321 34 --1723 --
NM_003931chr65613 473 204 102 63 --1125 1105
NM_003932chr2221806 698 11862 11367 1211
NM_003936chr25784 450 443 297 269 1962 2360 332 --
NM_003939chr10113895 3280 3146 1383 1194 1052 962 890 635 555 312 14026 3691 405 118 --
NM_003941chr732009 1968 534 11899 ----
NM_003947chr351342 1232 415 240 102 1208 11083 --
NM_003948chr422424 1055 --42622 2327 1975 112 --
NM_003953chr152635 2612 2200 575 306 --32614 2515 876 12151
NM_003954chr171279 ----11176
NM_003958chr693740 3088 3070 1496 875 512 452 282 70 --73894 3102 3030 2639 867 745 684 --
NM_003971chr173637 417 57 --2126 59 --
NM_003980chr631369 239 64 --11371 --
NM_003983chr16104395 4272 4145 4047 3690 2874 1300 981 495 474 14252 44457 3839 3178 402 34121 3545 2790
NM_003986chr111127 ----1105
NM_003994chr1254049 4004 2719 812 464 21706 1688 33369 1545 814 22848 1725
NM_003998chr42579 157 --1497 --
NM_004006chrX3913 847 754 --32136 2047 2026 --
NM_004007chrX3913 847 754 --32136 2047 2026 --
NM_004009chrX3913 847 754 --32136 2047 2026 --
NM_004010chrX3913 847 754 --32136 2047 2026 --
NM_004011chrX3913 847 754 --32136 2047 2026 --
NM_004012chrX3913 847 754 --32136 2047 2026 --
NM_004013chrX3913 847 754 --32136 2047 2026 --
NM_004014chrX3913 847 754 --32136 2047 2026 --
NM_004015chrX3913 847 754 --32136 2047 2026 --
NM_004016chrX3827 761 668 --32050 1961 1940 --
NM_004017chrX3913 847 754 --32136 2047 2026 --
NM_004018chrX3827 761 668 --32050 1961 1940 --
NM_004020chrX3913 847 754 --32136 2047 2026 --
NM_004021chrX3827 761 668 --32050 1961 1940 --
NM_004022chrX3827 761 668 --32050 1961 1940 --
NM_004023chrX3827 761 668 --32050 1961 1940 --
NM_004028chr1853847 3626 1619 1523 554 33472 2699 354 157 23019 2979
NM_004035chr1795186 4980 4634 4411 3209 667 601 414 250 --23938 1076 --
NM_004037chr11102 1869 ----
NM_004040chr221213 1130 11145 21166 1027 --
NM_004050chr1472332 2001 762 745 612 585 553 11788 1965 --
NM_004055chr1162209 1632 1431 553 415 101 1525 1208 21721 286
NM_004061chr52533 145 ------
NM_004063chr83920 747 112 --1749 --
NM_004067chr741416 372 114 93 --11255 --
NM_004068chr31114 --1293 --
NM_004077chr1221233 374 1181 21109 1099 --
NM_004080chr71603 --31483 441 298 --
NM_004086chr14----1638 --
NM_004087chr341397 616 463 67 2790 284 41510 1337 573 24 --
NM_004093chr1342569 2183 415 30 ----13287
NM_004094chr1442843 1088 437 79 ------
NM_004098chr102932 518 21182 938 ----
NM_004103chr84805 741 722 117 --4768 743 732 713 --
NM_004105chr231096 906 727 1281 ----
NM_004112chr1741765 1637 1212 28 --2556 288 21640 442
NM_004113chr33152 46 24 --21721 70 11827
NM_004114chrX2985 257 --2987 795 --
NM_004117chr661695 1406 837 821 409 59 1417 21664 1608 1759
NM_004124chr1493456 2723 2186 1368 688 629 529 232 111 --22725 2299 23046 200
NM_004130chr32646 540 ------
NM_004134chr51651 1586 --1130
NM_004136chr1543023 2190 1001 615 ------
NM_004161chr261597 461 279 261 169 22 1992 --11364
NM_004162chr351126 809 466 325 265 --11002 --
NM_004170chr921902 327 --1419 --
NM_004171chr11249451 9281 9096 9031 8769 8249 8240 7816 7366 6514 6452 6424 5848 3522 3175 2804 2464 2440 1705 1645 329 298 292 217 28885 407 49198 8210 6579 6192 37396 2519 1477
NM_004185chr12625 223 1166 1635 --
NM_004187chrX41339 1329 362 214 --31301 1008 431 --
NM_004199chr5173 ------
NM_004200chr1183229 3195 2585 2225 2096 1094 922 831 --22884 225 --
NM_004210chr1052127 586 573 314 88 11563 1111 --
NM_004215chr81500 --1368 --
NM_004227chr732584 949 514 --32101 951 300 --
NM_004229chrX21837 1615 --11839 22173 1909
NM_004232chr1842899 1515 1178 980 ------
NM_004233chr651300 1112 1073 1064 506 --11278 --
NM_004235chr92749 346 ------
NM_004236chr152425 374 1479 ----
NM_004239chr14----1124 --
NM_004252chr171155 --3527 509 62 --
NM_004255chr15----1109 --
NM_004262chr431323 365 181 --11066 --
NM_004263chr251411 1348 693 148 107 --21637 517 --
NM_004268chr1151226 1013 939 362 300 ------
NM_004272chr53678 589 471 1649 31814 1753 298 --
NM_004274chr1473047 2988 2225 337 216 176 160 --1319 13191
NM_004277chr61168 ----1553
NM_004279chr751978 1938 1737 736 179 --11897 --
NM_004290chr551119 877 521 397 39 21035 412 --31255 1161 42
NM_004293chr943793 2701 2688 2357 12677 13462 12461
NM_004295chr1721069 399 ----1441
NM_004296chr1463970 3431 3225 1509 1183 841 ----33331 2889 86
NM_004301chr3129 ----1238
NM_004302chr1232187 764 476 --32286 751 389 --
NM_004304chr2124 1288 1377 --
NM_004308chr1161894 1809 636 559 299 31 --2309 189 1324
NM_004311chr10132976 2756 2729 2551 2525 2320 2257 2137 1256 848 425 223 90 --42951 2946 2940 339 --
NM_004316chr121873 --11183 1876
NM_004319chr172990 2927 2725 2549 2524 849 292 1652 32439 1085 294 12767
NM_004323chr992570 2343 2017 1965 818 649 616 266 194 --32169 2029 865 1125
NM_004326chr151140 1012 976 835 325 --4992 847 799 760 --
NM_004331chr82456 267 1223 --31739 905 481
NM_004338chr1876559 4707 4687 1943 1147 447 147 22561 2516 12817 15194
NM_004342chr742308 2287 2132 2106 ------
NM_004349chr821113 1078 ----11267
NM_004352chr16--1119 --1177
NM_004354chr42237 72 --1866 --
NM_004371chr12962 623 --1142 --
NM_004380chr1642220 1014 243 24 --2647 26 --
NM_004384chr54557 474 415 298 ----1182
NM_004385chr51678 2279 67 1530 --
NM_004391chr361824 1695 1421 806 669 186 22092 2037 21631 1447 --
NM_004392chr1342255 1645 555 169 --32653 2257 346 21897 1875
NM_004395chr53713 275 228 1149 1181 --
NM_004397chr1174016 2999 2852 1670 1558 939 601 --34169 3597 3225 --
NM_004398chr11--1495 ----
NM_004405chr24815 403 287 75 --1929 --
NM_004414chr2131177 624 491 --1483 --
NM_004423chr3102716 2520 2242 2180 2141 1696 707 378 370 218 --32248 1095 783 --
NM_004426chr1251574 1408 1317 1286 538 1791 31771 1613 196 --
NM_004427chr13424 407 311 --1779 --
NM_004429chrX41168 940 556 146 --1148 --
NM_004430chr871842 1065 1045 999 811 380 29 --22233 2185 1896
NM_004432chr922051 392 12198 22164 406 11569
NM_004437chr182662 2417 2298 1406 1048 632 573 489 --33267 2272 1232 12590
NM_004438chr243204 2548 352 225 12066 ----
NM_004440chr641724 1567 412 384 --11621 1387
NM_004441chr341272 1206 414 170 --21195 466 --
NM_004442chr141559 1447 1153 634 --31588 1449 357 --
NM_004447chr121456 ----1254
NM_004458chrX52044 1817 1798 1653 467 --42436 1655 845 219 12311
NM_004459chr1721659 1546 11971 31527 1514 1336 --
NM_004474chr141033 924 391 286 --4695 690 653 288 --
NM_004480chr141701 --1530 --
NM_004481chr152553 2456 1818 735 258 22413 640 --1984
NM_004482chr24697 355 269 42 1660 1757 --
NM_004484chrX1333 --1305 --
NM_004487chr371241 1113 1070 953 426 110 49 ------
NM_004491chr1973795 3445 2914 1573 922 667 272 13339 ----
NM_004494chr161081 1066 290 271 134 99 --1813 --
NM_004496chr1461163 407 318 311 290 152 --21153 240 --
NM_004500chr1431904 1424 186 1369 31906 1291 629 --
NM_004501chr183299 2894 2651 1251 720 357 119 34 --22653 1623 --
NM_004504chr232758 2641 2484 --22672 498 --
NM_004505chr17----32028 427 356 --
NM_004514chr1752086 1927 1134 866 806 --1586 --
NM_004515chr1------123
NM_004519chr81192 ------
NM_004520chr51536 ------
NM_004525chr221316 111 2983 412 1113 --
NM_004529chr931110 564 235 ------
NM_004535chr2051581 1492 1478 1436 346 11781 11438 --
NM_004537chr1251495 1088 1035 580 56 --11232 --
NM_004554chr143634 146 117 1596 21498 62 --
NM_004561chr11----1688 --
NM_004566chr1052460 2211 1803 854 791 1254 11665 --
NM_004573chr152812 49 1779 1773 --
NM_004575chr431461 190 35 --31258 578 52 --
NM_004576chr5----1288 1105
NM_004578chr13924 770 611 --1240 --
NM_004586chrX125138 4453 4149 3813 3378 2170 1947 1873 1242 847 671 152 34912 3656 1940 45153 2172 1850 194 1850
NM_004588chr1173674 3609 3178 2693 2644 736 405 23071 2735 23452 2799 13059
NM_004595chrX1396 1103 1113 --
NM_004598chr5123243 3105 2920 1105 939 870 759 634 484 422 283 267 21127 1056 12785 12942
NM_004600chr131552 540 228 11333 ----
NM_004603chr73344 304 139 ------
NM_004606chrX4307 258 64 34 --1309 --
NM_004612chr984806 4550 4341 4200 1468 828 216 113 --1443 34809 3247 1357
NM_004630chr1141103 1056 1039 959 --31131 1045 256 --
NM_004631chr111066 --21256 1229 --
NM_004635chr331141 1041 759 --1803 --
NM_004637chr361292 1161 999 906 888 443 --11154 --
NM_004643chr141739 --4741 726 536 290 --
NM_004645chr174745 547 278 242 ------
NM_004654chrY3954 479 24 --164 1894
NM_004655chr173992 875 392 --11208 --
NM_004656chr34955 152 82 63 --1395 --
NM_004663chr1581279 1244 1204 616 490 413 121 45 ------
NM_004673chr131493 992 570 --11156 --
NM_004686chr831560 635 310 --3614 567 352 1680
NM_004687chr1741736 1383 274 77 ----11386
NM_004690chr63808 716 667 ----1136
NM_004694chr171776 ------
NM_004697chr9----41062 795 789 55 --
NM_004703chr1732345 1830 294 --2527 282 1324
NM_004709chrX51570 1297 491 219 179 --1231 --
NM_004715chr18----2691 607 --
NM_004717chr731383 434 372 --21385 374 --
NM_004718chr22444 54 --1246 --
NM_004725chr1041418 1076 521 476 11290 11322 11246
NM_004726chrX105169 4629 4257 3837 1785 1666 1571 1359 1086 442 44435 3806 3641 569 33542 3485 144 11502
NM_004730chr512003 12122 1528 --
NM_004733chr31605 ------
NM_004734chr1383117 2899 2717 2426 2375 1057 1045 165 --32289 2279 265 12159
NM_004736chr162129 1893 1419 622 119 55 11429 1458 138
NM_004739chr11172 1480 2538 454 1439
NM_004742chr351567 1413 655 327 43 21259 623 1360 --
NM_004744chr473803 3591 3089 2688 1577 1059 316 --2707 624 --
NM_004745chr8176672 6632 6491 6178 5999 4625 4430 4397 4282 1944 1780 1481 1391 1152 1102 277 42 --24868 2244 16962
NM_004755chr1441020 313 90 44 11243 ----
NM_004760chr772488 2210 1641 1611 742 710 267 --1626 12434
NM_004764chr121212 1165 ----
NM_004768chr12851 51 --1737 --
NM_004772chr511046 --1506 --
NM_004774chr1753129 2322 1954 429 348 --42846 2147 1118 896 --
NM_004775chr1831535 1476 166 --2680 106 --
NM_004779chr52529 492 1890 2914 497 1906
NM_004788chr113719 290 86 --41929 911 351 67 1296
NM_004789chr9----2375 361 --
NM_004796chr1432249 2197 330 32300 1616 765 11657 --
NM_004797chr3133606 3219 3203 3190 3004 2876 2717 2603 2459 1343 741 487 459 --53273 3248 3232 2339 662 22756 2606
NM_004798chr20133534 3428 3216 3181 3008 2579 1324 1262 929 820 691 680 289 --33109 1326 333 --
NM_004801chr231161 419 175 1222 181 11447
NM_004805chr221413 114 ------
NM_004815chr1114377 4136 4059 3989 3900 3760 3691 1570 886 856 283 24037 3894 --24100 3243
NM_004821chr51614 --4657 622 594 586 --
NM_004822chr1763710 1602 963 527 304 104 12788 23913 925 --
NM_004824chr62486 395 --1383 --
NM_004831chr194925 777 696 170 --2779 754 --
NM_004834chr293416 3103 2865 2806 2530 325 307 140 66 --22730 1347 13419
NM_004835chr3----1175 --
NM_004835chr3----1175 --
NM_004839chr152617 180 ------
NM_004841chr14878 743 715 191 11030 2801 321 --
NM_004845chrX113321 3266 2922 2885 2795 1632 1118 876 697 367 159 1280 63936 3717 2913 2874 2841 2831 --
NM_004849chr631679 1339 194 2524 359 11350 1510
NM_004850chr231131 254 151 1704 2153 105 --
NM_004857chr1464697 3583 1397 1225 1012 542 1602 43663 3306 1919 365 --
NM_004859chr1752405 2154 1939 768 609 ------
NM_004863chr14135094 4620 3924 3743 3734 3687 3679 3629 3577 3325 1136 652 190 35021 1249 935 14014 --
NM_004866chr584016 3542 3470 816 403 153 114 47 --21894 1007 23545 411
NM_004869chr18--11495 21213 158 --
NM_004871chr1774280 4236 4217 3114 3091 3040 431 --43915 3734 3584 178 --
NM_004873chr1493123 2934 2477 2245 1302 930 753 583 189 --23068 1195 1756
NM_004874chr81526 --1121 --
NM_004879chr115996 304 181 125 59 --2908 61 --
NM_004884chr1541652 1572 418 223 11417 --11521
NM_004887chr521003 123 --2887 298 --
NM_004896chr101129 1403 11423 --
NM_004897chr102639 77 --2928 144 1792
NM_004898chr462754 2548 2167 1950 731 650 2630 537 42743 2626 2588 694 --
NM_004902chr203625 212 122 ------
NM_004904chr7106093 5998 5864 5470 4734 4718 679 662 491 233 36361 4467 2446 76000 5044 4710 2098 1964 1790 681 15473
NM_004912chr741727 1547 1294 56 11764 ----
NM_004922chr103844 663 206 --21004 226 --
NM_004926chr1451687 1324 517 305 130 --31780 1495 1316 --
NM_004929chr81471 --11413 1293
NM_004930chr14219 93 81 49 ------
NM_004932chr541226 660 91 22 --1532 11415
NM_004936chr921915 52 12610 11131 12163
NM_004938chr94845 773 447 72 --1152 --
NM_004947chr372598 2589 2580 2094 2081 428 208 --52083 1605 688 256 246 12097
NM_004956chr7104024 3461 3074 3015 2889 2855 1809 1135 630 440 --33145 137 40 11840
NM_004961chrX41297 1058 551 379 --2572 115 --
NM_004964chr1----2523 83 --
NM_004972chr91466 1210 21077 744 11013
NM_004973chr621557 1160 1589 31601 1067 551 --
NM_004976chr1184447 3645 3540 1504 1473 1357 1311 911 157 75195 4841 4188 3692 3593 3568 3560 --
NM_004978chr171347 1116 501 477 366 222 180 ------
NM_004985chr1224359 1339 --64203 2964 710 665 175 105 --
NM_004992chrX187687 7075 7047 6984 6786 6536 6354 5774 5720 3098 3088 3069 2292 1815 1537 1510 1306 342 12237 77523 5698 3060 3006 1817 1269 1216 12457
NM_004992chrX187687 7075 7047 6984 6786 6536 6354 5774 5720 3098 3088 3069 2292 1815 1537 1510 1306 342 12237 77523 5698 3060 3006 1817 1269 1216 12457
NM_004993chr1461244 1016 991 592 460 346 11347 1553 --
NM_004999chr6124257 3695 3654 3221 3171 1593 1384 1333 1298 1242 1228 268 2314 235 24436 532 44472 3174 1663 1301
NM_005010chr731477 280 229 1448 22227 2032 134
NM_005011chr741847 1752 1364 1270 ------
NM_005020chr74598 555 528 162 --1565 --
NM_005021chr62142 105 1277 1149 1108
NM_005028chr1051902 1680 1475 826 181 1777 32250 2035 1904 --
NM_005030chr16----1271 --
NM_005044chrX43675 3242 3031 1568 --23724 124 --
NM_005045chr71154 --1729 --
NM_005056chr1295089 4941 4437 2034 2027 1806 1791 1581 195 1420 65020 5014 2193 1980 1444 704 --
NM_005063chr10113761 3275 3243 3086 1421 1389 1197 954 672 202 23 --63763 3432 1131 677 386 268 --
NM_005065chr14105343 5236 5114 4883 3758 3685 1902 1644 1449 1194 14875 22030 2000 35239 3725 898
NM_005067chr331007 855 390 ------
NM_005068chr631299 1145 215 ----11148
NM_005076chr164231 2685 2669 2641 1190 1152 11639 24159 3611 --
NM_005077chr92407 346 ------
NM_005079chr862671 1215 424 377 212 124 --2370 306 23121 1218
NM_005080chr224944 653 353 274 --3914 832 737 1656
NM_005086chr1241291 611 494 339 1323 21513 496 --
NM_005093chr20105385 4888 4799 4748 3411 1334 711 669 245 201 14515 34116 1163 801 --
NM_005095chr172239 2211 2129 1833 894 807 245 ------
NM_005096chrX51104 1013 417 347 135 2441 145 11085 --
NM_005099chr131311 515 171 ------
NM_005105chr172226 1981 1912 1533 683 178 28 --12062 --
NM_005110chr52557 528 --1182 --
NM_005112chr41859 --21036 776 176
NM_005114chr41527 132 ----
NM_005116chr2093442 3388 3239 983 950 685 317 304 54 1343 44315 968 406 375 --
NM_005121chr1763257 2389 1522 1338 440 263 ----1510
NM_005126chr3----11535 11925
NM_005128chr211640 --1653 1661
NM_005134chr185846 352 309 228 26 ----1312
NM_005135chr1593807 3630 3416 2911 2518 1249 1004 752 208 1823 1660 12701
NM_005146chr111219 --168 --
NM_005151chr181450 12063 2562 298 --
NM_005156chr994729 4575 4557 3700 3349 1930 1510 1417 197 1281 43797 3643 1151 199 25355 4321
NM_005157chr941924 1748 1582 602 --1370 --
NM_005160chr22126265 6093 5963 4771 4269 4246 2715 2637 2571 1973 1149 880 --24773 1111 24750 4272
NM_005176chr12158 ------
NM_005180chr1021219 544 --1241 --
NM_005184chr1991606 1279 1159 1148 348 215 183 173 34 --11380 --
NM_005188chr11227987 7878 7869 7751 7366 6911 5931 5692 5491 5459 5446 3076 2922 2789 2782 2260 2241 1642 1362 1291 616 85 25552 1920 107128 6033 5972 3141 2833 2464 2309 1381 1371 1226 13284
NM_005197chr1486156 5339 4948 4530 3821 3786 1715 1261 1757 84992 4806 4380 4374 1738 1492 1470 139 15379
NM_005202chr162141 1584 1574 888 200 146 11805 1479 --
NM_005214chr221087 839 ------
NM_005215chr183508 169 33 1216 --1511
NM_005219chr551348 1122 491 365 338 --41750 625 413 131 --
NM_005222chr76761 271 258 201 188 142 1632 3390 218 213 --
NM_005224chr193699 458 245 --1578 --
NM_005230chr121391 ------
NM_005233chr362184 2002 1780 971 510 170 21801 589 1829 --
NM_005235chr2237688 7617 7496 6788 6442 6327 5976 5755 5738 5561 5513 5474 5040 3035 2807 2443 1581 964 894 677 538 81 49 27025 5768 77622 7574 6465 6444 5442 224 68 16189
NM_005238chr1183291 2865 2805 2657 2572 2434 1181 100 --42961 2578 2175 1398 --
NM_005240chr15804 665 597 561 192 ----1668
NM_005241chr32957 389 --1981 --
NM_005243chr221116 ------
NM_005254chr154978 494 452 328 --11085 --
NM_005257chr1851269 1172 552 393 142 ----1886
NM_005264chr104952 579 68 61 --1144 --
NM_005268chr1----1224 --
NM_005269chr121179 139 ----
NM_005277chr441602 1418 240 170 --2664 639 --
NM_005296chrX137 ----152
NM_005302chr7176 ----179
NM_005308chr102190 161 ----1348
NM_005311chr752570 2149 1904 1794 781 --12151 1712
NM_005313chr151336 1363 --1149
NM_005316chr111942 ----2959 440
NM_005318chr223815 169 62 --31164 858 73 1172
NM_005324chr1711587 --21456 462 --
NM_005328chr82592 247 1556 1699 1250
NM_005329chr1642067 1746 1578 1470 --22241 1719 --
NM_005333chrX4921 770 356 64 --2249 125 --
NM_005336chr231737 1459 406 12003 42151 2027 1728 433 --
NM_005339chr464350 4306 3942 1678 1166 244 24069 1616 2813 664 --
NM_005348chr142967 898 ------
NM_005359chr18156460 6356 6345 6026 5826 5236 5102 4613 4483 4370 4306 4049 2385 1444 744 25349 1953 45056 1446 828 183 --
NM_005370chr192882 525 --21165 223 --
NM_005374chr1792400 2370 2105 2082 1919 1787 700 690 659 21911 1606 22426 1789 --
NM_005375chr61390 --2804 332 --
NM_005378chr21323 ----1745
NM_005381chr2----122 1282
NM_005385chr372421 2151 2104 1985 1936 898 353 --11072 12712
NM_005386chr203733 589 107 --2735 698 --
NM_005387chr114639 261 236 183 ------
NM_005388chr93476 72 28 11669 31602 1434 1342 --
NM_005392chr941818 1726 490 205 --41670 1361 1191 1179 --
NM_005397chr7103525 2838 2674 1435 1405 1125 1012 975 711 148 --43599 3068 553 150 --
NM_005398chr103482 267 259 ------
NM_005399chr194425 3782 2789 2767 1585 1427 902 866 579 21086 487 12800 1335
NM_005400chr252761 1962 956 418 144 12363 52970 2802 2675 2669 420 --
NM_005401chr11188 ----1232
NM_005402chr741867 1745 1602 1426 --11371 --
NM_005407chr1461274 1257 274 249 238 203 11211 21581 317 21277 101
NM_005409chr4------11078
NM_005410chr51251 ----1598
NM_005413chr22430 91 ------
NM_005415chr2----1236 1268
NM_005430chr125862 850 821 813 405 --2996 898 --
NM_005433chr1842492 2192 319 158 12375 1308 --
NM_005436chr1072507 888 703 375 244 204 74 --33118 2809 2667 --
NM_005438chr111248 --1195 1610
NM_005439chr121509 1498 2182 72 1173
NM_005440chr1783266 2935 2846 2792 826 644 385 167 11307 33283 2488 391 --
NM_005442chr3--2546 137 ----
NM_005443chr43466 206 123 ----1126
NM_005445chr10--1269 ----
NM_005455chr131510 1327 1157 1623 31435 1223 741 --
NM_005458chr972417 2344 2231 2187 1882 1704 949 1250 ----
NM_005465chr151633 1596 795 355 281 --2819 357 --
NM_005474chr1731230 1119 519 --31264 270 248 --
NM_005475chr1273016 2995 2755 2199 2030 339 204 --22051 85 --
NM_005476chr92167 29 --11443 --
NM_005477chr1542108 743 54 47 22430 868 138 --
NM_005477chr1542108 743 54 47 22430 868 138 --
NM_005479chr1041206 1185 302 54 --11589 --
NM_005487chr2291782 1637 1570 1449 1388 525 366 258 77 --11909 --
NM_005502chr962834 2495 2178 2139 641 455 --22423 53 --
NM_005504chr12176180 5977 5804 5690 5365 5223 4866 4494 4370 4282 1810 1707 1683 865 603 487 418 15819 85692 4754 2444 1766 1664 1625 1544 267 25368 5192
NM_005509chr53431 400 297 178 ----
NM_005512chr1151554 1522 1293 1285 1266 --31556 1299 134 --
NM_005513chr361388 1229 1142 561 204 169 --11464 21391 29
NM_005520chr5----1725 --
NM_005522chr741033 313 284 110 ------
NM_005524chr32327 52 ------
NM_005530chr151195 --41447 1174 484 313 --
NM_005536chr82103 37 --2968 384 --
NM_005537chr131129 ------
NM_005541chr231190 1025 811 ----11062
NM_005544chr21954 1756 1788 --
NM_005552chr142166 83 ----1536
NM_005562chr1----21467 1457 --
NM_005563chr14838 578 82 24 --184 --
NM_005565chr51469 --2530 136 --
NM_005570chr181820 --21040 335 --
NM_005573chr51603 --2144 100 1664
NM_005578chr3145111 4801 4787 4672 3742 3594 3415 1974 1952 1920 991 811 487 460 24826 3485 24368 363 21604 954
NM_005581chr194131 106 99 92 ------
NM_005584chr132537 112 1245 ----
NM_005585chr15--1314 1295 --
NM_005587chr151276 ------
NM_005593chr12----1438 --
NM_005595chr11177 ----1306
NM_005596chr995811 4106 2509 2463 993 847 811 678 273 26420 4961 25918 91 --
NM_005599chr151362 1311 1037 241 154 --1528 11274
NM_005602chr331145 227 166 --41157 960 854 229 --
NM_005604chr682174 1966 1902 1743 820 123 80 64 --1576 --
NM_005607chr83868 790 148 149 1714 --
NM_005611chr164922 535 203 81 ----2206 84
NM_005618chr62645 629 --134 --
NM_005625chr82998 342 2674 243 21003 46 1257
NM_005626chr1--1421 1206 --
NM_005627chr62943 214 ----1396
NM_005638chrX51720 1510 1299 687 507 11559 11655 --
NM_005639chr1241706 1551 1494 92 1337 ----
NM_005644chr12418 365 --2367 348 --
NM_005647chrX93317 3223 2264 1144 868 822 764 640 432 13304 1843 1435
NM_005650chr22--1172 ----
NM_005653chr12138 ------
NM_005655chr81241 --11091 --
NM_005665chr124948 4336 34453 1512 1476 1602 11489
NM_005668chr544354 3848 3011 1006 12847 ----
NM_005669chr552232 2063 1965 1756 830 --1350 --
NM_005686chr131546 1451 1426 11308 ----
NM_005688chr33402 100 49 1486 11019 --
NM_005697chr151182 --2220 34 --
NM_005707chr151318 1441 1141 --
NM_005711chr531092 1046 261 2672 32 1250 140
NM_005717chr1--1391 2477 103 --
NM_005722chr21456 1206 147 --
NM_005725chr13883 524 389 21919 643 11585 --
NM_005730chr1293458 3286 3202 1356 980 791 729 423 46 12209 33064 1151 1071 13259
NM_005731chr24355 285 271 265 ------
NM_005734chr111708 --1643 1711
NM_005737chr282897 2879 2818 2718 1833 1794 1065 466 --32859 2056 715 --
NM_005738chr711784 --2658 41 --
NM_005739chr1551650 1524 897 452 284 2328 53 31805 868 175 --
NM_005742chr22605 57 179 1275 --
NM_005746chr752696 2661 2523 2073 143 --12525 --
NM_005748chr1243350 3244 2627 1072 22915 318 42548 2298 2221 1256 --
NM_005749chr171513 ------
NM_005751chr7----146 --
NM_005754chr531187 323 174 --1269 --
NM_005756chrX31378 1028 484 ------
NM_005759chr2134698 4169 3954 3800 3634 3270 3025 1892 1798 1271 560 356 327 --43517 1900 939 532 23403 1723
NM_005776chr143850 584 536 --1538 --
NM_005779chr52847 26 --43147 3039 432 319 --
NM_005786chr1821267 190 --3990 890 92 --
NM_005789chr1792165 1944 1916 1801 1539 1531 1518 465 436 --21324 205 --
NM_005801chr171752 --259 39 --
NM_005802chr9----1528 1631
NM_005808chr363390 2820 2623 1278 798 303 1388 33573 991 949 --
NM_005813chr232476 1997 991 12461 21999 312 --
NM_005819chr193230 2997 2480 1274 1089 1036 597 468 129 12624 23457 3194 11092
NM_005822chr64371 275 116 52 --21696 820 12168
NM_005828chr17144588 4029 3966 3766 3730 2024 1969 1784 1680 938 579 444 242 45 24989 3272 64751 3968 3751 3744 1505 234 --
NM_005832chr331272 1065 257 3992 470 108 ----
NM_005839chr12297 250 ------
NM_005840chrX226898 6277 5608 5094 4761 3057 2687 2495 2448 2406 1713 1436 1096 1077 922 914 707 583 526 481 180 32 14717 77207 6562 6522 6188 1830 621 566 31353 722 682
NM_005841chr44733 114 105 96 --3927 152 98 --
NM_005843chr261938 1587 1538 512 457 88 --31771 1325 90 1266
NM_005850chr13146 53 33 ------
NM_005857chr12602 572 --11440 11361
NM_005859chr51523 1303 21487 183 1344
NM_005863chr10168 --31423 492 283 --
NM_005864chr145711 282 226 118 111 ------
NM_005866chr92864 677 ------
NM_005871chr103687 207 185 --2883 671 --
NM_005882chr41967 --2356 335 --
NM_005885chr561562 1262 1072 226 75 59 1608 11264 11565
NM_005895chr1274037 3745 3519 1298 431 402 394 34158 2826 1601 32642 2577 1070 --
NM_005898chr1153167 2919 2795 2228 481 1832 21066 953 21244 419
NM_005900chr41822 --21119 803 11194
NM_005901chr18168493 8411 8086 8040 6844 6830 6641 6315 6108 5973 5709 5699 3010 1050 741 455 27645 160 108304 8247 8173 7403 7385 6133 6127 5333 3454 528 38694 7308 1682
NM_005902chr1594588 3694 3262 2887 1432 1102 1081 1072 113 11568 ----
NM_005903chr594788 4660 4304 4086 3497 1791 1651 1626 385 11082 44790 4475 670 387 13998
NM_005906chr621068 56 ----11311
NM_005907chr631283 60 35 1176 31627 439 349 --
NM_005909chr5133906 3526 3407 3350 3284 3255 2926 2830 1321 1293 565 524 161 --23528 2712 24012 2807
NM_005910chr1793687 3572 3548 1508 1415 1011 908 296 283 --23885 3527 --
NM_005911chr231199 1032 343 1547 21182 93 --
NM_005920chr193586 3319 3156 2905 2717 1268 979 103 68 --12972 1848
NM_005923chr61525 1170 ----
NM_005927chr55913 469 355 199 106 --3924 295 174 1202
NM_005933chr11152760 2353 2246 2132 1080 845 758 730 709 697 503 380 341 223 72 --52480 2071 1952 1947 1855 22914 506
NM_005934chr1972578 2347 1968 1834 1826 545 146 --11724 --
NM_005935chr4115217 4876 4138 3924 3852 3719 2097 1756 1527 881 815 34352 1564 800 35279 4070 3998 22100 1588
NM_005941chr864192 3761 3606 3546 649 255 184 22944 352 11647
NM_005943chr641713 1153 107 59 --31396 1139 1119 --
NM_005955chr1155086 4838 4649 4562 4345 4149 4103 3984 3873 3785 3394 2036 1815 1630 1196 34493 4267 1592 95092 4978 4966 3986 3490 1490 1379 812 771 --
NM_005962chr1032257 1939 1775 --32271 1798 326 --
NM_005962chr1032257 1939 1775 --32271 1798 326 --
NM_005964chr1741390 1053 247 98 --21041 495 --
NM_005966chr242315 1871 1654 24 1954 --12046
NM_005969chr113989 477 333 --2345 219 1228
NM_005990chr5102751 2680 2191 2062 1966 1954 1080 439 90 61 --32682 2639 92 --
NM_005996chr1231535 1357 104 21255 1199 21048 374 --
NM_005997chr1132 --1122 --
NM_006007chr954148 4135 3572 3318 520 --22794 1591 --
NM_006011chr1594158 4049 3928 3679 3195 2873 1528 1353 38 33886 2966 1211 33968 3825 3184 --
NM_006015chr12355 206 --21256 155 --
NM_006016chr632066 1895 268 ----1271
NM_006024chr7--1257 1785 1708
NM_006030chr341798 1393 1248 56 --21699 1693 --
NM_006032chr141189 ------
NM_006033chr1842277 2025 1737 314 1587 ----
NM_006034chr1142490 467 145 66 --1266 --
NM_006036chr21177 ----12293
NM_006037chr2134770 4475 4199 3522 3127 3079 1917 1829 1354 779 644 69 25 13656 44697 4096 1646 1597 --
NM_006038chr2041888 1826 1642 1456 --21400 319 --
NM_006040chr1621392 533 ----11108
NM_006047chr2073363 2721 2574 2529 1404 918 632 --12743 31318 635 70
NM_006048chr121211 420 --41213 1204 1115 500 --
NM_006051chr52230 103 --1213 --
NM_006054chr1141113 1011 452 139 --1152 --
NM_006055chr242449 1216 409 155 12821 32418 964 423 43089 3059 755 464
NM_006064chrX2373 307 4397 328 113 43 ----
NM_006067chr16--1936 21022 887 --
NM_006079chr62300 71 --2291 185 --
NM_006080chr722986 2803 2256 172 1888 1189
NM_006089chrX21425 488 11783 5588 574 444 166 73 --
NM_006090chr13689 641 582 1514 ----
NM_006094chr862219 2106 931 668 420 320 11914 1933 --
NM_006095chr474358 3644 3520 3183 2803 1618 1177 --31655 1524 913 --
NM_006106chr1162506 1243 873 421 310 155 --53475 2633 2400 996 558 --
NM_006108chr1132306 1703 729 11846 1731 --
NM_006113chr132057 1714 307 11921 1433 --
NM_006134chr2111376 --21344 26 --
NM_006136chr721173 368 ----1864
NM_006139chr26688 654 405 317 197 134 --22149 558 --
NM_006141chr16--12452 --11081
NM_006147chr12495 23 --1475 1100
NM_006148chr1792954 2650 2596 2069 780 763 623 507 314 12445 21952 222 --
NM_006153chr32672 243 1200 1245 --
NM_006154chr152819 71 --1746 --
NM_006158chr831582 572 170 ------
NM_006159chr12----2646 565 --
NM_006160chr175625 394 326 228 210 --2633 627 --
NM_006166chr1262589 2552 1894 1642 917 843 ------
NM_006167chr882170 970 943 887 853 616 606 282 12327 22029 855 --
NM_006178chr1731497 526 254 31398 162 109 11038 --
NM_006180chr942140 842 285 240 --21589 214 --
NM_006186chr22910 820 1189 ----
NM_006190chr22949 103 ----1952
NM_006191chr122766 715 --1694 --
NM_006194chr1411313 --1183 --
NM_006195chr921360 579 --31267 991 21 --
NM_006197chr841765 245 215 137 --21833 1582 12042
NM_006198chr21----2246 215 --
NM_006201chrX3853 439 81 --1821 --
NM_006202chr1941649 1243 163 155 --1799 --
NM_006203chr545119 3792 1270 344 21972 1620 13742 11110
NM_006206chr42449 23 12474 22427 714 1804
NM_006209chr81287 ----1159
NM_006224chr1752139 1916 1800 1015 872 1136 2914 500 11751
NM_006226chr23440 357 52 ------
NM_006237chr1392145 2113 854 736 696 546 155 142 66 --42133 1423 698 164 --
NM_006241chr362420 2390 1585 786 618 598 1823 32422 2175 904 --
NM_006245chr62862 344 --1833 --
NM_006246chr14--1322 --1447
NM_006251chr543350 3170 2853 2420 --13186 11285
NM_006256chr111809 --22733 2382 --
NM_006257chr10177 ------
NM_006264chr41481 --136 --
NM_006265chr841387 1036 971 142 --1127 --
NM_006267chr231696 1244 329 31616 585 522 41842 1788 750 660 --
NM_006268chr112982 354 --4390 244 78 45 --
NM_006275chr2052274 1908 1794 1667 527 143 ----
NM_006278chr11------1583
NM_006281chr82941 224 11111 ----
NM_006281chr82941 224 11111 ----
NM_006283chr8154966 4466 4415 4372 3411 3085 1497 1368 1345 1074 553 322 258 242 47 --44892 1883 602 555 11490
NM_006288chr1131108 268 62 ------
NM_006300chr1962341 2314 2284 1806 285 216 11659 1611 --
NM_006301chr122508 462 1255 ----
NM_006306chrX44611 3949 1529 908 25917 4582 25924 4780 24990 4366
NM_006310chr1721278 1153 ----11166
NM_006313chr1231222 1051 36 --31224 594 296 --
NM_006315chr453699 3369 1507 1375 575 1844 53429 3362 3193 1249 858 --
NM_006320chr4----4322 310 301 290 --
NM_006323chr4----1488 --
NM_006325chr122314 232 ------
NM_006327chr10179 --1264 --
NM_006328chr114626 232 185 97 1426 1628 --
NM_006330chr851345 615 571 256 64 --2648 617 --
NM_006335chr11330 --1882 --
NM_006336chr961425 1334 1233 403 274 146 --11239 1149
NM_006345chr42515 71 --1329 1493
NM_006352chr151948 1556 387 334 94 --52006 1924 1558 1497 216 --
NM_006354chr3163 ------
NM_006357chr2----1469 --
NM_006358chr2231162 358 49 1947 2450 364 --
NM_006359chrX52025 1660 581 434 181 --72327 2172 497 490 408 303 192 --
NM_006364chr141817 1374 2905 62 --
NM_006367chr171043 962 823 784 217 111 81 --3964 825 675 --
NM_006369chr13360 311 135 --3127 119 99 --
NM_006375chrX41478 1402 390 100 ----1618
NM_006378chr931280 1013 69 --31030 182 154 --
NM_006379chr742194 1888 814 343 1823 11776 1625
NM_006380chr1743973 3279 2745 32 11696 --23282 2770
NM_006386chr2281986 1980 1675 1650 827 544 458 126 --51510 613 98 74 64 --
NM_006389chr116519 501 396 382 173 111 1238 21217 897 --
NM_006393chr1074108 3981 3202 1236 607 386 118 32920 1333 581 3924 573 254 23224 749
NM_006401chr91164 ------
NM_006405chr14273 31 ------
NM_006407chr331120 558 474 1896 11111 --
NM_006420chr2063342 2691 2475 2360 1336 762 --32768 2693 2585 --
NM_006421chr81257 173 2828 92 --
NM_006434chr1062205 1290 1101 776 427 264 --12971 12017
NM_006439chr4----2448 354 --
NM_006449chr242040 1734 1545 1529 --121 --
NM_006451chr541104 1033 914 724 1176 ----
NM_006457chr473948 3119 2703 1529 1056 923 254 13590 52864 1111 1058 347 210 13165
NM_006459chr1061942 1615 1534 1245 756 225 --21310 577 1322
NM_006460chr172239 172 11407 2538 221 1242
NM_006463chr2----2600 454 --
NM_006464chr2144492 4423 3770 2990 2967 1875 1779 1759 1606 1491 963 936 589 261 32944 2918 1553 74477 4055 3859 3240 3037 1612 449 --
NM_006465chr1572003 1909 1699 802 777 722 483 --2378 357 --
NM_006469chr141406 1292 1206 334 --11442 --
NM_006471chr18298 31 --163 --
NM_006482chr1273208 2398 1341 1043 854 793 401 --42400 784 544 403 --
NM_006489chr1411729 21842 212 11640 --
NM_006496chr141890 1309 690 329 --11247 11893
NM_006497chr172653 564 1775 ----
NM_006500chr113371 64 27 --11286 --
NM_006510chr631020 858 668 1148 2867 161 --
NM_006517chrX102073 1969 1684 1496 626 612 582 215 203 30 --1598 --
NM_006519chr64312 92 85 27 ------
NM_006520chrX1344 1644 ----
NM_006526chr201459 --31888 1596 821 21934 466
NM_006534chr2073209 3079 2807 2390 2128 560 196 --23202 1172 1411
NM_006538chr293471 2766 2619 2575 1295 1016 729 310 109 1537 34078 2712 1359 --
NM_006544chr1486120 6001 5342 3945 2014 388 209 36 1262 36122 4279 2210 --
NM_006546chr17166621 6224 5949 5793 5779 5751 5651 5217 4389 4153 2658 2643 2184 2150 747 410 14666 75121 4645 4596 4558 2287 1671 333 --
NM_006547chr772110 1869 1851 1682 1670 605 276 ----11673
NM_006548chr321707 1198 --11349 --
NM_006549chr1292970 2950 2563 2453 2441 2021 1986 698 653 11171 22862 142 --
NM_006555chr731962 1723 341 --21545 778 11607
NM_006561chr10155923 5522 4799 4694 4657 4337 4272 4265 2443 2011 1711 1669 1529 1108 581 22387 1899 43958 2364 1531 1288 44185 4044 3944 352
NM_006565chr164829 437 70 33 --1439 1271
NM_006566chr1831012 391 74 --1359 --
NM_006578chr1551785 1550 1287 1264 389 --21332 700 --
NM_006587chr421264 409 11356 21141 192 --
NM_006591chr113627 501 373 ------
NM_006593chr22745 315 --5664 647 628 622 299 1241
NM_006595chr1161912 1888 1860 1353 650 440 11918 22064 433 --
NM_006599chr16248152 7564 7403 7070 7063 6834 5864 5730 5585 5153 5141 5122 3267 2541 2504 2242 1759 1745 1703 1079 1041 843 671 393 13154 107849 7569 7411 5382 2560 1787 1737 1676 1435 1081 47293 6583 295 280
NM_006601chr122235 47 --1776 --
NM_006602chr203549 275 43 ------
NM_006603chrX41717 1597 756 347 1627 11919 1102
NM_006609chr252158 2087 340 198 58 --42386 2354 200 131 --
NM_006614chr373069 2674 2420 2256 1294 849 361 --22922 2422 23223 2563
NM_006618chr151482 1154 1111 209 146 1131 31380 1318 507 21458 212
NM_006621chr161666 1596 1493 505 335 93 --51697 1605 1598 786 481 1109
NM_006622chr52485 39 --1218 --
NM_006628chr1553976 3773 1288 1174 45 14095 53992 1808 1308 1277 79 --
NM_006629chr1822339 1049 12512 12445 32184 1855 1099
NM_006633chr51776 ------
NM_006640chr1721906 96 --11779 --
NM_006644chr13125 --1569 --
NM_006646chr1372550 2480 2321 1186 915 647 263 --42589 1869 742 442 --
NM_006654chr12104773 4343 4166 4131 3517 3127 1894 1843 1175 779 24160 1493 24133 3377 33972 3803 1568
NM_006670chr62159 142 ------
NM_006682chr7155 ------
NM_006698chr2031254 955 392 --4564 459 445 435 --
NM_006699chr152725 2080 874 454 397 --32741 2446 655 --
NM_006700chr123781 576 104 ------
NM_006708chr66977 828 305 258 151 129 1994 11270 11197
NM_006717chr9113305 3298 3155 3127 2833 2745 2534 2441 2285 2275 304 --11162 --
NM_006721chr101692 --1694 1104
NM_006722chr362211 1036 1007 455 356 40 --22140 95 22214 2058
NM_006726chr45916 826 429 326 64 11137 11082 11118
NM_006727chr52159 116 --191 --
NM_006729chrX135029 4987 4850 4450 4436 4335 3903 3436 2198 2017 1553 1343 924 13492 34470 3930 3667 --
NM_006732chr1972060 1796 1545 1374 662 501 177 11527 ----
NM_006734chr6137 --1348 --
NM_006738chr15124670 4558 3748 3208 3154 3075 2903 1791 1331 1294 800 629 --23870 581 --
NM_006746chrX--11437 1520 1539
NM_006749chr81439 --21109 888 --
NM_006750chr16117725 7519 6998 6735 6255 6071 5238 3175 3162 759 681 --67818 7521 7330 4904 3184 2679 35192 1353 975
NM_006751chr22826 332 1172 1334 --
NM_006756chr821306 389 21173 149 186 --
NM_006763chr161936 1627 1487 1445 1436 862 ------
NM_006766chr892651 2402 2107 1757 1645 445 370 164 89 1469 22506 1844 --
NM_006772chr681699 1639 1578 1447 1407 1207 519 26 --31720 1105 201 --
NM_006775chr6----21167 204 --
NM_006777chrX62873 2689 2437 776 354 272 --31053 814 163 --
NM_006783chr132250 80 ------
NM_006788chr1861518 546 512 361 223 113 1831 ----
NM_006790chr5----1380 --
NM_006795chr1171572 1384 1115 564 463 111 80 11107 ----
NM_006803chr862089 1852 1370 843 681 126 11784 21613 683 21527 129
NM_006814chr2072440 2133 971 878 828 400 33 --22011 488 --
NM_006815chr1231027 390 79 --21019 299 --
NM_006818chr17648 382 249 94 76 62 46 1365 1177 --
NM_006823chr83993 534 180 ----1183
NM_006825chr126960 719 212 188 70 43 ------
NM_006826chr261105 841 470 450 408 162 280 62 2432 30 --
NM_006827chr14103394 3198 3036 2869 2236 1304 1063 968 924 309 12848 2469 445 --
NM_006832chr14--1217 ----
NM_006851chr1262804 2773 2508 751 646 380 22752 153 32200 937 382 22776 2709
NM_006852chr17122864 2765 2566 2479 2352 2224 1920 942 724 690 590 137 ------
NM_006854chr721838 1558 --11279 --
NM_006856chr1261138 1035 965 765 362 354 1403 ----
NM_006861chr123570 493 112 1203 11384 11375
NM_006873chr252999 2676 815 728 442 13065 42867 1130 709 444 11284
NM_006884chr331406 1373 1359 ----1230
NM_006885chr16104241 3510 3440 3112 2818 2759 2573 1513 1040 155 12698 52820 1363 1100 1094 1067 --
NM_006887chr22462 196 ------
NM_006888chr1453297 3128 2901 870 25 --21196 998 --
NM_006894chr12304 281 --1310 --
NM_006896chr72831 231 1889 ----
NM_006908chr721307 146 ----11104
NM_006914chr921430 1165 --21094 349 --
NM_006915chrX51905 1651 991 349 40 --32472 1653 250 --
NM_006920chr221962 1874 ----11965
NM_006924chr1743755 3527 575 161 12849 22965 49 34046 1624 578
NM_006930chr551879 1868 1850 1781 547 1643 11917 --
NM_006931chr1242096 1663 193 115 --41581 1529 866 289 --
NM_006937chr173560 149 134 --1562 1120
NM_006939chr14------1917
NM_006940chr1261599 1404 1248 637 553 88 --51301 759 543 487 470 11855
NM_006941chr222809 64 --21044 393 --
NM_006947chr441677 1449 1280 320 --11179 --
NM_006951chr102832 518 ------
NM_006955chr1023416 814 12733 11241 --
NM_006965chr185978 937 379 237 96 --1459 199
NM_006973chr10125 --1141 --
NM_006979chr61553 ------
NM_006981chr982902 2171 1903 741 520 502 158 89 2906 100 22913 513 1161
NM_006987chr1761228 1126 1054 321 174 29 --11308 --
NM_006988chr2141125 1056 783 348 1792 ----
NM_006990chr181965 1877 1795 450 331 298 238 182 --3246 129 38 --
NM_006993chr10285 51 ------
NM_006997chr10--1452 1123 --
NM_006999chr56748 596 398 349 325 244 21654 532 ----
NM_007007chr1254328 3543 3249 3174 1045 --44730 2951 2945 1772 --
NM_007010chr1751469 1212 1180 707 463 1632 2465 195 --
NM_007011chr1585846 4530 1997 1889 1438 532 356 206 15494 76476 5881 2651 1999 1921 1558 358 55361 4670 1909 580 305
NM_007013chr84413 187 128 105 ------
NM_007023chr2----21023 779 --
NM_007034chr13823 750 219 ----1885
NM_007038chr21135803 4862 4329 4211 4197 3841 3829 2329 2187 2057 1875 1280 505 --44871 2238 909 835 26055 4200
NM_007039chr1442027 1680 1621 82 1304 21561 1555 --
NM_007042chr352314 2297 2087 1943 445 --32543 2491 1969 --
NM_007045chr6167 --1542 --
NM_007050chr20138048 6330 5764 5301 5131 3135 3113 2375 1737 1730 882 745 217 86619 6488 5348 3232 3155 1529 1453 542 55750 5047 2717 2347 1012 18122
NM_007054chr543189 3026 901 704 53702 3635 3325 642 87 33580 3433 3196 --
NM_007067chr1761588 1208 1161 1056 604 304 --41360 1219 1130 75 --
NM_007073chr683784 3773 3367 3276 1129 926 332 234 13805 1352 11452
NM_007078chr1051974 1147 787 493 303 ------
NM_007084chr132602 401 --21235 1197 --
NM_007106chr1342725 2371 871 150 12117 42652 2167 674 386 --
NM_007107chr362309 2183 916 812 523 369 --32083 756 285 22154 516
NM_007114chr333193 2994 2202 --32071 538 248 --
NM_007124chr671768 1729 1441 765 408 220 29 --1751 --
NM_007125chrY1345 1366 --2348 291
NM_007145chr1931257 1150 951 ------
NM_007146chr1752636 2084 1096 219 140 1560 12638 --
NM_007147chr191251 1936 11072 --
NM_007166chr1121440 445 1533 31413 1407 979 11443
NM_007170chr14915 785 341 86 --1604 --
NM_007172chr2273067 2661 2292 2031 425 318 81 12285 --12039
NM_007174chr123925 629 482 --3782 420 406 --
NM_007175chr863303 2782 2751 2445 2302 92 --1357 13256
NM_007185chr14807 681 219 198 21100 974 1794 --
NM_007189chr74561 417 247 195 11381 ----
NM_007191chr121158 ------
NM_007192chr1441112 1043 1015 275 --183 --
NM_007195chr1873436 3195 3132 2993 2571 1495 898 1821 73197 2950 2892 2839 2542 2488 367 --
NM_007200chr15124670 4558 3748 3208 3154 3075 2903 1791 1331 1294 800 629 --23870 581 --
NM_007202chr173681 266 55 --2773 57 --
NM_007203chr983982 3745 3643 3387 3349 1038 486 438 --53894 3032 2510 516 425 --
NM_007207chr11274 --4809 795 600 285 --
NM_007212chr181619 829 807 625 614 416 255 152 1910 52293 627 350 214 172 --
NM_007217chr3--1281 ----
NM_007221chr13428 404 320 --1322 --
NM_007222chr821764 1408 --21730 1683 11241
NM_007236chr1552392 950 658 437 375 --12132 --
NM_007249chr13239174 8982 8971 8945 7964 7881 7548 7458 7408 7359 6951 6880 6805 6628 6210 5820 5757 2820 2671 2595 1642 1353 253 69291 8085 6309 5770 3751 1030 69105 8613 5935 2597 2425 2080 --
NM_007250chrX143 --2371 76 --
NM_007269chr11436 ------
NM_007270chr721122 570 --21438 1191 --
NM_007275chr33452 438 310 --1443 --
NM_007276chr741141 694 260 219 1796 --1781
NM_007278chr172341 297 --1141 --
NM_007283chr382831 2772 2476 2299 1912 747 664 244 11004 ----
NM_007285chr161502 ----1155
NM_007286chr572006 1941 855 747 608 234 214 11394 2817 333 --
NM_007287chr363081 2822 2805 2036 274 217 23180 66 11300 12079
NM_007288chr363081 2822 2805 2036 274 217 23180 66 11300 12079
NM_007289chr363081 2822 2805 2036 274 217 23180 66 11300 12079
NM_007292chr1795186 4980 4634 4411 3209 667 601 414 250 --23938 1076 --
NM_007294chr17--21279 402 11152 1388
NM_007295chr17--21279 402 11152 1388
NM_007296chr17--21279 402 11152 1388
NM_007297chr17--21279 402 11152 1388
NM_007298chr17--21279 402 11152 1388
NM_007299chr17--21279 402 11152 1388
NM_007300chr17--21279 402 11152 1388
NM_007302chr17--21279 402 11152 1388
NM_007303chr17--21279 402 11152 1388
NM_007304chr17--21279 402 11152 1388
NM_007305chr17--21279 402 11152 1388
NM_007313chr941924 1748 1582 602 --1370 --
NM_007320chr192313 236 ------
NM_007331chr452508 2253 1933 828 750 11901 ----
NM_007345chr1872169 2083 1576 587 483 248 201 --41675 894 495 381 --
NM_007349chr73111 99 81 ------
NM_007350chr1294085 3257 3233 2822 1732 1520 1481 483 375 13440 43644 3617 3553 3416 --
NM_007353chr731099 431 100 1603 22140 957 12784
NM_007357chr14424 203 154 87 ------
NM_007358chr141949 1818 1684 1654 --11266 --
NM_007362chr331477 1253 1078 --31255 1198 1089 --
NM_007363chrX294 23 --1753 --
NM_007365chr172087 1916 868 821 801 727 655 1525 1555 --
NM_007372chr171883 ------
NM_007373chr1051777 1502 1153 682 379 --31594 1220 326 --
NM_007375chr162361 2150 1128 631 414 289 ----1417
NM_009585chr3----1175 --
NM_009585chr3----1175 --
NM_012062chr122772 209 --1811 --
NM_012064chr1221173 208 1911 21106 151 --
NM_012069chrX3946 893 624 --42523 231 226 132 --
NM_012074chr145954 822 274 128 107 --3813 130 109 --
NM_012081chr533636 161 143 12967 23161 288 --
NM_012083chr1051089 903 836 540 240 --1854 --
NM_012095chr1063435 2441 1065 1045 248 37 32501 2289 2197 22673 1414 --
NM_012096chr342566 2402 284 184 ----21236 606
NM_012097chr281982 1779 1758 833 614 234 197 184 --1603 --
NM_012098chr931476 1192 134 --1199 --
NM_012102chr172616 2248 2174 598 313 269 184 --72397 2386 1980 1872 1788 988 304 --
NM_012104chr1183366 3225 3163 2689 2463 1426 1021 310 11382 23083 433 --
NM_012104chr1183366 3225 3163 2689 2463 1426 1021 310 11382 23083 433 --
NM_012120chr672877 2112 1940 1835 948 916 428 21021 604 ----
NM_012129chr761910 1841 1694 981 835 720 12085 41912 1834 1005 90 12165
NM_012137chr122742 1910 12056 82796 2377 2162 2135 936 541 445 79 --
NM_012141chr1373874 3571 3054 2929 2911 2709 143 14165 63679 3192 2860 2545 859 288 33000 2684 842
NM_012153chr1182453 2374 2360 1789 1038 926 871 686 --195 --
NM_012156chr20123356 3348 3329 3173 3065 2906 2837 2823 2330 888 559 356 --53162 3147 2894 2887 272 --
NM_012158chr13--1350 11671 1191
NM_012160chr62470 197 --1490 --
NM_012161chr43452 389 349 --2465 176 --
NM_012164chr9106508 6481 6282 5956 5395 5283 4731 1792 807 447 26164 2862 37037 6675 1192 37146 5356 2751
NM_012175chr113798 85 57 1251 2866 221 --
NM_012177chr63511 475 130 ----1514
NM_012180chr41536 --2541 167 1200
NM_012188chr531042 932 856 ------
NM_012192chr111776 --21488 135 --
NM_012193chr11104900 4728 4370 4344 3475 3347 1815 1532 675 331 11266 74694 4419 3573 3457 1879 1866 1556 --
NM_012199chr1174609 4341 4053 3955 3637 3237 2952 2935 2923 2899 1869 1647 1375 1151 1074 783 751 13600 104521 3302 3269 2957 2928 1821 1801 1639 1523 130 --
NM_012210chr931225 351 46 11132 3965 423 387 11013
NM_012214chr2106436 6211 5910 5235 4519 4074 2419 1781 1082 857 22391 702 86367 4926 2525 2295 2003 890 529 29 16214
NM_012215chr1071883 1674 1335 1297 376 338 227 --21664 728 --
NM_012219chr393035 2947 2767 2393 1144 953 916 566 186 --22866 389 1739
NM_012223chr241309 1207 249 37 ------
NM_012234chr351429 1275 1064 954 303 --23710 1179 23338 227
NM_012238chr1041707 1539 1238 521 ----11474
NM_012242chr10----2529 286 --
NM_012244chr1471640 1632 1425 1160 511 497 345 --11318 --
NM_012247chr10----2173 51 --
NM_012248chr161499 --1256 --
NM_012249chr243224 2228 1365 1112 1163 21288 39 --
NM_012250chr1131155 224 51 --157 --
NM_012252chr7134860 4723 4500 3744 3725 3611 3350 1519 1003 861 574 460 398 --44502 3958 729 252 13573
NM_012259chr64951 343 262 164 --1175 11296
NM_012262chr1144877 4545 4400 4294 4250 3611 3342 2060 2036 1938 1285 1074 774 652 13182 54287 4252 2006 1681 204 24403 865
NM_012279chr561874 743 518 326 278 270 --11362 --
NM_012281chr721908 651 --1380 1517
NM_012287chr373074 2991 1691 1549 1246 551 443 12756 34093 3791 342 --
NM_012288chr6155675 4923 4680 4537 4520 4189 3966 3492 2041 2030 2017 2008 1256 1241 864 11887 65384 5069 3739 345 219 158 --
NM_012290chr211467 11710 ----
NM_012294chr774076 3890 3816 1558 1398 191 77 12928 11475 23055 3026
NM_012297chr452082 1835 871 551 165 --1820 --
NM_012298chr33560 306 263 1220 1706 --
NM_012300chr552083 1814 683 590 167 --2552 244 --
NM_012301chr772253 1884 1770 1548 876 609 215 ----1809
NM_012302chr131095 801 119 ------
NM_012304chr572475 2332 1696 921 898 277 153 11709 3329 235 145 --
NM_012307chr183839 683 78 ------
NM_012308chr1151924 872 838 642 585 --12299 --
NM_012309chr11144956 4489 4193 3800 3369 3208 3132 1982 1399 1167 908 597 496 444 --23741 1607 34254 3631 582
NM_012311chr101583 --1224 --
NM_012316chr1105471 3879 3793 3487 1675 1642 976 942 377 155 2849 246 44274 1917 1677 1314 --
NM_012325chr2031605 1293 163 11251 11545 --
NM_012327chr1841582 1093 584 574 --1257 --
NM_012328chr741442 1324 1233 949 11292 1200 1254
NM_012329chr173664 392 360 11322 21197 1046 11086
NM_012330chr1051693 1159 688 375 243 --2377 192 --
NM_012333chr151524 1295 1244 613 335 1404 31539 1190 570 11247
NM_012334chr584056 3567 3463 3392 531 439 404 359 --33420 1408 772 12886
NM_012345chr1351887 1858 1460 1444 85 1502 1154 11890
NM_012382chr544438 3457 2845 201 34201 3855 3050 53459 3395 2885 582 386 21687 1459
NM_012384chr2052374 2220 1784 248 217 --21861 1551 --
NM_012392chr1143 --188 --
NM_012395chr763116 3056 2809 1165 818 525 13165 53193 2371 2286 311 176 --
NM_012399chr2231528 307 129 --31363 1343 498 --
NM_012414chr1----1113 1842
NM_012416chr951170 818 247 133 96 1894 ----
NM_012417chr171110 1164 ----
NM_012420chr1082273 2157 1751 773 714 598 309 35 --137 --
NM_012428chr15185 --1248 --
NM_012433chr21275 ------
NM_012448chr1772160 2042 1020 674 542 239 86 --22058 913 --
NM_012463chr121401 --1336 --
NM_012464chr432903 2362 2015 --21026 902 --
NM_012465chr1063234 2984 2787 659 624 110 --42869 2844 2797 477 --
NM_012471chrX81839 1799 1387 1240 395 318 304 84 1658 152 --
NM_012479chr772705 2648 2575 791 544 443 59 1987 42368 2019 1971 647 32665 1931 1753
NM_012481chr172216 161 1573 1779 --
NM_012486chr1--1376 --1106
NM_013229chr1242666 2465 877 167 --32668 1814 524 --
NM_013230chrY31614 587 565 --1283 --
NM_013231chr1484288 3864 3434 1531 1426 1198 701 317 --13210 23624 320
NM_013233chr23395 270 86 31253 210 111 ----
NM_013248chr20----1209 --
NM_013255chr7167965 7823 7164 6527 6258 5937 5484 3370 2575 2145 2120 2061 1162 430 155 47 66973 6926 3270 2004 1574 527 67825 7149 6868 6405 5835 432 32619 2076 2064
NM_013257chr852387 2169 2070 466 299 --2952 301 --
NM_013261chr453674 1517 1447 1064 99 32729 846 66 52921 2284 786 678 268 --
NM_013262chr621117 239 1382 ----
NM_013269chr12114514 4361 4181 4162 4029 4019 3996 3379 1391 1254 448 --1774 24517 1462
NM_013275chr161323 1198 2637 613 --
NM_013279chr1142054 903 815 517 11603 ----
NM_013280chr113857 316 120 --2733 574 1664
NM_013281chr2011150 --21188 262 --
NM_013293chr73611 160 74 --137 --
NM_013296chr12164 63 --2479 25 166
NM_013309chr1532431 602 212 12680 ----
NM_013313chr2253412 3069 2525 882 291 11157 ----
NM_013336chr36600 537 443 357 340 155 --2539 517 --
NM_013341chr232019 1161 1078 --42021 1954 1126 796 --
NM_013351chr172714 113 ------
NM_013352chr62748 93 --2655 95 2913 751
NM_013354chr82317 100 --2359 319 1326
NM_013363chr3161 ------
NM_013364chrX41962 1674 1662 1423 128 41993 1945 1642 1367 --
NM_013372chr1542805 2279 1081 470 12964 32823 2141 1039 1771
NM_013374chr342628 1018 943 847 --22034 387 11021
NM_013381chr1231822 852 270 --22111 1501 1200
NM_013390chr931388 1162 103 --1688 --
NM_013396chr2131501 1045 307 1971 ----
NM_013400chr711028 2994 970 1842 --
NM_013411chr182480 2321 1986 1848 1812 1716 1093 601 ------
NM_013417chr9--138 2403 105 --
NM_013423chrX1927 1972 1929 --
NM_013427chrX1927 1972 1929 --
NM_013433chr1921331 476 --41931 1783 1342 1333 --
NM_013437chr8----1556 --
NM_013438chr951605 1436 1418 1352 1297 1601 ----
NM_013444chrX5988 344 211 185 172 1258 41139 275 265 249 1203
NM_013446chr771443 1348 1296 1255 1191 184 84 1496 2186 165 --
NM_013448chr14--2650 605 1688 --
NM_013449chr12132718 2438 2375 2261 2004 1989 1130 1101 656 556 533 182 174 --52299 1186 658 639 589 12135
NM_013450chr22918 113 11014 31048 356 29 1116
NM_013937chr62899 103 --2826 287 --
NM_013943chr162631 2562 1233 1146 1104 704 --12241 157
NM_013979chr51413 ------
NM_013986chr221116 ------
NM_013993chr62856 218 1620 ----
NM_013994chr62856 218 1620 ----
NM_013995chrX31927 355 184 12392 2871 357 --
NM_014000chr1081808 1495 1439 1415 634 602 497 354 1340 41581 1385 370 364 --
NM_014005chr572932 2231 1210 940 903 823 654 22411 312 41212 1043 615 321 --
NM_014011chr21482 --21755 570 --
NM_014021chr172953 2221 1206 915 644 280 130 --23347 3257 22956 918
NM_014028chr6----33265 2751 161 23038 517
NM_014031chr51236 ----2239 119
NM_014034chr631041 978 527 11330 159 1198
NM_014043chr32550 252 2283 136 11488 --
NM_014044chr2--1164 ----
NM_014048chr1634185 1632 255 --34923 4780 4079 --
NM_014057chr951495 1318 604 435 366 1478 21524 501 11321
NM_014059chr132345 273 --1256 --
NM_014071chr20------1126
NM_014089chr132401 120 ----1123
NM_014106chr1552128 2038 2017 957 936 1334 21906 1895 --
NM_014112chr894763 4737 4590 4379 4326 3512 3323 530 130 15151 13334 --
NM_014117chr1692529 2270 2263 2240 2184 1783 845 374 95 --32364 2322 2242 1767
NM_014141chr764935 3633 1146 1009 428 208 --74199 3495 3454 1531 821 497 210 --
NM_014155chr11147555 5975 5718 5509 5372 2779 2283 2182 2115 1096 1072 868 545 142 46879 4690 2157 1222 35676 404 144 25787 444
NM_014169chr141212 152 ----
NM_014181chr21825 1859 22196 876 --
NM_014183chr201262 132 ----
NM_014186chr1142244 603 575 509 1731 32119 1813 203 21804 1521
NM_014189chr451497 1361 1008 446 337 ------
NM_014190chr441849 1713 1360 689 ------
NM_014216chr143481 443 138 11609 1490 --
NM_014217chr141856 1724 531 524 149 21503 268 21579 281
NM_014223chr13637 599 201 --1194 1214
NM_014231chr1281954 1907 1613 1604 1584 1486 1479 602 --31589 736 474 12110
NM_014232chr177654 411 400 361 275 251 218 1500 2351 285 --
NM_014232chr177654 411 400 361 275 251 218 1500 2351 285 --
NM_014240chr352664 658 634 446 192 --94085 2876 1141 1050 805 411 222 206 148 --
NM_014243chr422092 1954 --11539 11928
NM_014246chr2252321 2269 2027 1766 579 22160 1669 ----
NM_014250chr2291782 1637 1570 1449 1388 525 366 258 77 --11909 --
NM_014253chrX4812 633 539 455 1332 ----
NM_014258chr20143 ------
NM_014267chr114869 785 676 240 --2337 324 --
NM_014268chr1831139 563 305 11234 21315 1141 --
NM_014270chr19172 ------
NM_014271chrX1591 --1343 --
NM_014278chr41322 ------
NM_014280chr13263 73 32 --2711 205 --
NM_014282chr971225 1130 887 494 190 108 59 ------
NM_014283chr131370 995 325 1290 ----
NM_014289chrX31396 1182 50 11259 11078 11153
NM_014292chr2251781 1757 1567 550 342 1614 31861 1230 410 --
NM_014293chr2293998 3163 2747 1109 655 578 132 98 68 ----12778
NM_014299chr195712 651 433 273 49 --1383 --
NM_014309chr22175187 5066 4709 4493 4448 4204 3924 3897 3841 3632 3466 1862 1552 939 802 599 587 25319 1235 55137 4455 3907 1502 179 24712 3913
NM_014319chr122444 71 --11377 --
NM_014323chr22--2702 394 ----
NM_014325chr121491 --42145 750 744 445 1494
NM_014329chr162279 270 ------
NM_014331chr4167536 6458 6199 6120 5854 5842 5310 5159 5039 4937 3090 3041 2744 2625 2467 2231 36170 2104 300 55388 5161 2504 2424 2273 56123 5845 5716 4929 3044
NM_014332chrX2315 156 ------
NM_014333chr11102660 2359 1004 895 857 580 385 357 334 326 1425 32662 1101 437 --
NM_014335chr15----31103 989 283 --
NM_014338chr223987 220 39 ------
NM_014342chr1151479 1385 1323 1265 158 --1271 --
NM_014344chr113840 362 225 --1174 --
NM_014345chr65953 936 907 426 273 --2173 167 --
NM_014351chr2221092 81 ------
NM_014361chr111445 --2447 178 --
NM_014368chr941915 400 370 268 --21795 164 --
NM_014372chr12507 375 1766 --31630 354 116
NM_014374chr711028 2994 970 1842 --
NM_014376chr582251 2172 776 768 490 299 257 194 --22197 1834 --
NM_014382chr321656 199 --1487 --
NM_014393chr821714 730 --42310 752 228 174 --
NM_014397chr951436 1423 1322 506 63 11079 ----
NM_014400chr193343 113 39 1459 124 --
NM_014410chr181346 ------
NM_014411chr752051 1547 1420 1260 111 11307 31994 1480 1328 --
NM_014417chr19----2952 90 --
NM_014418chr1462009 1890 1415 1307 692 116 ------
NM_014421chr432138 809 737 11912 1345 --
NM_014423chr5105414 4061 3803 3689 2107 2017 1133 1001 114 33 12131 11955 --
NM_014432chr63393 98 31 ----21308 140
NM_014445chr342137 1938 1820 1550 22152 121 21694 1583 --
NM_014447chr441556 1116 357 137 --2221 139 --
NM_014452chr651000 381 297 184 177 ------
NM_014454chr621099 126 ------
NM_014478chr771783 782 697 483 371 267 57 --1553 --
NM_014494chr1662233 412 389 132 120 109 --3391 346 304 --
NM_014496chrX2277 253 ----163
NM_014504chr751836 1503 1494 769 250 --32033 771 252 2266 151
NM_014505chr12180 --1380 --
NM_014506chr911231 ----11663
NM_014515chr1231050 116 32 --1254 1217
NM_014517chr351733 1629 1233 1225 778 --21631 1615 --
NM_014521chr221690 1665 31764 1472 1440 11741 --
NM_014552chr25597 575 563 236 128 ------
NM_014554chr1252294 2251 1971 1785 1447 1566 51682 1676 1662 1449 165 --
NM_014570chr223208 185 26 ------
NM_014572chr1331743 1166 515 11377 11501 --
NM_014574chr141483 --1320 --
NM_014575chr32536 492 ------
NM_014584chr1411038 --11355 --
NM_014586chr21144553 4449 4136 3907 3794 3611 3565 3399 1578 1205 687 618 445 239 24243 1686 23285 1529 --
NM_014587chr161431 --11416 11371
NM_014588chr202252 59 1207 3752 738 601 --
NM_014591chr104892 374 76 28 21080 902 ----
NM_014592chr52624 136 ------
NM_014603chr1761687 1265 650 526 480 148 ------
NM_014604chr171148 --2635 194 --
NM_014607chr271952 1666 826 617 514 445 95 --2828 39 --
NM_014613chr572695 2675 2021 1934 1886 993 493 --42304 1225 887 586 --
NM_014615chr1643348 2505 588 527 --43163 3092 900 590 --
NM_014616chr323429 1063 23520 44 23075 875 --
NM_014618chr9----2403 29 --
NM_014630chr15123767 3673 3201 3132 3072 2908 2721 2469 973 752 554 543 32678 1097 1043 31219 556 400 --
NM_014634chr22112752 2727 2662 2415 1071 916 698 643 439 119 50 13581 22264 738 --
NM_014636chr994391 4140 4102 4003 3300 1728 1353 1144 1137 ----14180
NM_014637chr821371 559 1913 ----
NM_014647chr1652156 1570 713 196 152 ------
NM_014659chr1541095 401 257 154 --1366 --
NM_014660chr71849 --1367 1253
NM_014661chr1063752 1549 1396 825 552 503 13297 1298 --
NM_014666chr52419 219 --1363 --
NM_014667chr352384 2351 1894 749 324 11902 42400 1896 683 374 --
NM_014671chr761612 1541 577 509 146 45 ------
NM_014674chr3113844 3669 3507 3464 3291 3176 3163 2768 1601 1502 941 1951 43325 2925 1087 175 --
NM_014676chr121413 23 --11486 11367
NM_014677chr861165 1056 1017 1010 913 342 ------
NM_014679chr1111143 ----1992
NM_014682chr842270 897 399 140 ------
NM_014683chr171807 11658 32195 1358 210 --
NM_014689chr21538 ------
NM_014690chr782776 2339 2252 2040 1225 820 434 414 --32569 983 450 --
NM_014701chr151871 21214 1184 22536 2359 --
NM_014702chr652564 1008 524 215 89 32955 2464 861 33107 2333 992 22567 1011
NM_014705chr741904 1374 766 223 1782 21918 1913 --
NM_014707chr752290 1855 1778 1690 476 144 12261 162
NM_014711chr1621501 35 --3430 158 37 --
NM_014715chr112161 153 ----1939
NM_014720chr1021346 735 --1125 --
NM_014721chr6116942 6311 5957 5763 5336 5032 2174 1956 1939 1345 1281 37228 7070 778 67164 6826 6313 5360 4708 2793 31959 1284 884
NM_014729chr82329 217 --11969 --
NM_014730chr12175050 4822 4769 4221 4062 3947 3744 3733 3678 3591 3232 1511 1475 1443 877 342 237 23380 553 65191 4852 4159 3646 3514 3417 43542 3521 1330 786
NM_014730chr12175050 4822 4769 4221 4062 3947 3744 3733 3678 3591 3232 1511 1475 1443 877 342 237 23380 553 65191 4852 4159 3646 3514 3417 43542 3521 1330 786
NM_014731chr2021225 279 1121 11797 --
NM_014732chr1685708 5032 4399 2308 2234 2193 1130 454 35631 3552 1500 35625 4266 1454 --
NM_014733chr51634 --41932 807 798 636 --
NM_014735chrX112090 1708 1665 1506 1490 1343 766 730 515 439 122 11776 11448 --
NM_014739chr684011 3339 2882 2730 1537 1094 720 328 --33288 2732 1141 13896
NM_014742chr2051658 1644 1513 1186 257 --2568 318 11647
NM_014743chr493204 2461 2423 2304 1113 1055 609 193 99 --3592 317 141 --
NM_014746chr274378 3979 3775 2815 1637 823 502 11576 54063 1549 781 716 286 11640
NM_014747chr1115757 5354 5285 5121 4930 4538 4396 3959 1302 1235 1227 25676 5473 55384 5020 4439 3979 2030 1701
NM_014751chr83860 762 394 --1244 --
NM_014752chr1151941 1378 1246 606 27 --31943 447 404 --
NM_014755chr294123 3155 3067 3045 2876 1525 1452 1283 992 13251 43368 1527 1300 1107 11289
NM_014756chr112390 173 1325 1368 --
NM_014757chr541760 1645 1619 1542 11637 42364 916 851 542 1620
NM_014761chr166989 746 282 259 184 69 --1748 --
NM_014764chr121513 --3461 275 264 --
NM_014765chr142499 2075 540 172 --21862 720 --
NM_014767chr1053555 2619 2248 1351 1332 11374 2954 319 --
NM_014772chr1883435 3310 3128 3012 2996 2840 2733 955 11458 1248 --
NM_014774chr183121 2839 2797 2079 1279 838 774 727 22561 212 63299 2081 1077 840 282 276 11141
NM_014776chr1272483 1057 969 950 448 418 308 11112 32962 2450 2229 --
NM_014787chr162101 2024 2008 1800 174 143 1949 1739 --
NM_014793chr154565 112 98 49 --1114 --
NM_014795chr251346 1193 503 423 37 11001 1483 --
NM_014800chr741156 464 325 126 ------
NM_014803chr1062300 786 604 439 354 297 12010 ----
NM_014810chr1103439 3157 2927 2815 2638 2604 2584 1200 888 659 --13390 --
NM_014819chr52774 53 --11665 22212 1728
NM_014826chr194083 3883 3363 3029 2783 2662 1610 733 72 13303 21645 1587 23853 917
NM_014827chr131227 254 158 --11077 --
NM_014829chr512066 32390 717 386 2763 670 --
NM_014830chr1283840 3540 3431 3010 2622 2400 1572 733 --22402 727 23543 3369
NM_014832chr1352093 1750 1319 603 448 --1349 11763
NM_014836chr1031308 1231 443 1225 ----
NM_014838chr2252741 2468 1945 1083 624 12734 22702 1863 --
NM_014839chr162457 2319 959 603 530 383 32015 1982 1972 11784 1386
NM_014840chr1272730 2317 1260 1146 1011 838 417 --22438 2199 1330
NM_014848chr1542809 953 588 501 --22585 1933 1310
NM_014849chr161172 889 355 308 232 59 ------
NM_014850chr3104925 4523 4290 3887 3571 3489 3392 1591 1319 331 1260 94695 4685 4553 3927 3658 3549 3495 1915 1086 24805 1594
NM_014859chr1741264 199 108 94 --2988 394 --
NM_014860chr21193 21796 641 21648 737 2123 78
NM_014862chr1522598 1363 14140 44078 4005 1470 1272 13056
NM_014871chr121201 ------
NM_014872chr952171 1932 1674 603 224 1357 11553 1734
NM_014873chr164849 4154 1838 924 665 561 23753 402 24629 475 1668
NM_014876chr2272203 2124 1601 1528 763 296 114 --32051 1800 298 --
NM_014877chr17107194 6993 6837 6318 6290 2833 2049 902 865 96 12453 31866 1329 956 --
NM_014881chr102131 37 ------
NM_014883chr451560 785 570 388 358 21839 290 22461 2202 --
NM_014887chr132718 204 --1850 --
NM_014888chr721500 1365 --1524 1227
NM_014897chr1773078 3071 2257 2079 1101 1093 986 12045 23101 366 182
NM_014898chr194836 530 371 21 ------
NM_014900chr21283 1315 ----
NM_014901chr552101 2026 1998 1814 470 1567 1292 --
NM_014902chr2031218 415 77 --3469 462 247 --
NM_014903chr1242161 375 366 324 1806 32113 2073 955 --
NM_014904chr1043053 2499 2452 375 1246 23301 748 --
NM_014905chr231444 1375 765 21698 1627 2717 655 --
NM_014906chr1763920 3688 3370 3156 1016 799 43953 1338 1004 677 33938 2930 630 --
NM_014909chr1463942 3902 2751 2569 463 374 13657 23748 3452 --
NM_014912chr1023253 2728 --32883 2605 611 --
NM_014913chr1831180 287 194 --2421 240 11076
NM_014914chr23978 442 404 ----1374
NM_014918chr1531298 1066 528 11322 11281 --
NM_014920chr653816 3548 3223 2542 2418 --2335 53 13242
NM_014921chr19102902 2866 2738 2494 1198 1019 616 521 366 201 12756 52847 2830 2803 1179 602 1850
NM_014926chr31742 21153 119 11032 --
NM_014932chr3164 --21576 1465 --
NM_014934chr1323123 106 13843 22530 695 --
NM_014935chr163460 2752 2437 1433 860 359 --12833 --
NM_014936chr642796 2772 920 718 --1146 12132
NM_014939chr181609 1465 21352 442 --
NM_014944chr141063 1046 520 427 --21413 907 --
NM_014945chr592008 1890 1863 1336 1237 1224 692 484 331 1300 1178 --
NM_014946chr232390 1082 417 --13017 1534
NM_014947chr132397 511 445 --12047 --
NM_014949chr11321 21022 154 ----
NM_014950chr1421775 604 ------
NM_014951chr1052550 2493 2485 2461 990 1908 22487 971 --
NM_014952chr1562026 1983 1374 584 503 277 1473 2830 575 --
NM_014959chr19112819 2183 1441 1407 1324 1313 1283 1148 606 233 220 12336 32371 351 187 --
NM_014962chr2052541 949 874 520 275 --1341 --
NM_014969chr12819 322 ------
NM_014978chr1031376 1322 412 21295 567 1287 --
NM_014982chr14164322 3752 3519 2141 2127 1782 1373 1169 1134 895 806 665 596 524 449 33 --75194 4096 4032 2082 1784 1375 35 31659 672 290
NM_014988chr462499 2328 2185 2065 859 311 --22585 171 --
NM_014989chr631715 573 563 --31294 1277 396 --
NM_014991chr412374 --22503 603 --
NM_014992chr143876 680 291 1354 1105 --
NM_014994chr154784 765 515 199 --32154 661 179 --
NM_014996chr34869 208 185 75 1417 1915 --
NM_014997chr7112891 2582 1946 1130 1107 1083 653 317 252 191 179 22977 2862 21109 1031 --
NM_015000chr1262588 2410 2260 2221 2122 1892 --21138 1039 12397
NM_015008chr363220 3077 2974 2815 2489 531 2813 27 2897 238 11299
NM_015020chr1673676 3506 3238 2386 1384 1190 690 33353 1416 791 23724 608 11221
NM_015023chr141672 1433 678 115 ----11569
NM_015024chr831335 1246 104 --11371 --
NM_015025chr242197 2032 1964 1006 --1854 --
NM_015026chr12124619 4587 4576 4541 4479 4469 4444 3526 3294 3129 1714 955 33757 3168 1220 14554 34603 4287 1717
NM_015027chr1641783 630 388 227 11241 --1230
NM_015032chr133896 518 426 --22799 25 11935
NM_015039chr173234 3136 950 856 195 104 79 43551 2833 1010 165 44113 3429 902 61 21507 107
NM_015040chr232784 1015 638 22766 2530 32466 2460 2175 23324 777
NM_015042chr15124278 3916 3638 3607 3472 3443 2984 2828 917 880 850 240 11245 104286 4280 4251 4245 3719 3653 2875 2843 1335 852 --
NM_015044chr1652675 2650 2065 806 267 13100 22624 2491 --
NM_015045chr1052165 2069 1507 553 459 ------
NM_015049chr243094 995 877 496 22953 2052 1608 11221
NM_015051chr963376 979 971 412 345 142 --11121 --
NM_015052chr741125 506 196 69 --71098 1092 508 490 77 71 29 --
NM_015055chr1172885 2728 2033 965 853 782 434 --31019 731 714 22731 923
NM_015056chr2122104 933 1883 2815 656 32297 1972 669
NM_015068chr743930 2724 1477 244 11246 33947 2649 1586 --
NM_015069chr16----1492 --
NM_015070chr1321150 526 --1144 --
NM_015071chr5156550 5165 4320 4151 2474 2315 2166 1599 1583 1270 1069 901 789 653 267 --22287 79 --
NM_015074chr193797 3417 3386 3151 1911 1822 1669 559 357 14290 83786 3715 3540 3419 1744 893 457 65 --
NM_015076chr684475 4450 910 318 304 240 215 200 23635 959 23662 3151 --
NM_015077chr17124004 3418 1757 1674 1537 1327 1253 1137 662 594 325 171 ------
NM_015080chr112393 118 --2933 372 --
NM_015082chr542396 2167 1050 679 1147 11809 --
NM_015086chr1251588 1457 1047 89 80 --31370 557 95 --
NM_015087chr1382671 2655 2637 2275 2252 2052 793 231 ----12485
NM_015090chr175970 5910 5892 2354 2226 2097 582 24724 4621 46036 4718 773 417 --
NM_015092chr1664470 3945 3816 3620 1839 989 23196 650 54361 3542 3013 1841 991 22984 1377
NM_015093chr62525 320 125 1747 1634
NM_015094chr2284374 4322 3942 3603 3393 1590 1311 816 --51805 1313 1228 1118 863 --
NM_015097chr342305 1474 914 110 --12292 11511
NM_015100chr171715 1564 804 749 610 362 155 --2736 626 --
NM_015107chrX72373 2037 1882 1539 1494 463 172 12450 21884 1518 11559
NM_015110chr932351 895 411 ----11758
NM_015115chr44965 782 179 97 12460 62798 2572 1046 1016 791 111 --
NM_015116chr1321461 155 1599 21541 392 --
NM_015129chrX61685 1589 1442 1191 719 323 --21463 77 11710
NM_015130chr421265 1087 --11230 --
NM_015132chr711575 11228 1727 --
NM_015137chr822301 658 --11712 12461
NM_015138chr1562671 2583 988 822 476 59 --2492 68 --
NM_015144chr1611076 --22565 655 1125
NM_015149chr152107 1346 794 530 214 --11679 --
NM_015151chr2121033 308 ------
NM_015153chr61741 1305 ----
NM_015155chr1052929 2330 1188 974 257 --13307 --
NM_015156chr1453517 3428 3153 2624 1063 --43360 1620 1470 773 1578
NM_015157chr1121005 415 --2449 275 --
NM_015158chr92770 751 ------
NM_015176chr121308 635 --21417 157 11168
NM_015185chrX132739 2731 2470 2450 2321 2195 911 845 590 556 513 317 293 --12631 --
NM_015186chr9------1124
NM_015192chr20------12528
NM_015194chr1752082 2031 1817 1689 1548 --1142 --
NM_015199chr362578 2313 2290 1985 1973 1067 22174 859 32705 1960 1954 --
NM_015200chr451910 1610 709 593 155 11772 22267 516 --
NM_015202chr1651389 1365 1172 1154 556 --11706 --
NM_015206chr1583050 2653 2611 1221 832 618 505 434 13617 22887 2443 1240
NM_015208chr1863717 3262 2894 1362 941 507 --11254 --
NM_015209chr172291 2275 2152 2094 868 376 367 --22096 1890 22024 1695
NM_015215chr123211 2127 --2550 332 --
NM_015225chr962985 2867 2706 2649 438 94 1191 3945 661 379 --
NM_015226chr1683454 1369 1240 1170 826 628 591 179 23277 2392 23286 881 --
NM_015230chr441594 1263 1213 655 --11799 --
NM_015234chr651310 1144 1022 272 197 ------
NM_015235chr1031987 1877 787 21997 827 2161 108 --
NM_015238chr5----121 1459
NM_015245chr621116 961 12066 12576 --
NM_015247chr16115197 4817 3836 3645 2143 1871 1764 1193 1161 878 590 13993 44671 4220 3923 675 14310
NM_015250chr951650 1590 1438 254 62 1379 ----
NM_015252chr22605 324 --4738 337 228 152 --
NM_015254chr873219 2785 2764 2492 722 496 406 12984 22909 662 --
NM_015256chr51259 --3621 567 129 1161
NM_015260chr1931553 1514 1235 --11580 --
NM_015263chr15----21130 984 --
NM_015264chr2273589 3266 1304 1217 911 888 192 1897 23918 1563 --
NM_015265chr222597 2497 --22466 1963 --
NM_015267chr1241758 1726 557 47 --11449 --
NM_015268chr33257 119 93 ------
NM_015270chr1282245 2009 1659 1640 1541 393 351 243 --41721 1673 405 395 --
NM_015271chr494349 2921 2859 1680 1332 1265 862 609 60 --12788 23097 152
NM_015272chr1621853 186 ----1180
NM_015277chr1841830 1465 633 192 ------
NM_015278chr633252 2206 209 --12963 13415
NM_015282chr252558 2037 1108 929 64 --12688 --
NM_015285chr1872598 2276 1802 1608 902 662 247 31824 564 39 2644 249 --
NM_015286chr1561574 999 831 687 258 244 22481 2395 2246 149 --
NM_015288chr5103661 3615 3390 3001 2687 2629 2598 853 204 174 1941 33200 2720 978 --
NM_015291chr153055 1028 874 278 229 --33155 212 145 --
NM_015296chr132403 43 ------
NM_015299chr1473812 3779 3730 3495 3286 1571 1360 12528 12815 11080
NM_015305chr14121979 1956 1820 1749 1675 386 269 175 155 138 132 29 --41892 1554 1289 388 --
NM_015310chr8177789 7704 7341 6988 6813 6678 6641 6441 2799 2732 2638 2492 2112 1712 1232 985 275 11425 87465 6871 5887 5465 2675 2619 1515 288 25813 1534
NM_015313chr1193448 3431 3342 3189 2944 1624 711 603 217 13463 74410 4051 3656 3384 3239 3121 1469 --
NM_015314chr752173 2144 1860 1651 709 --11922 32176 757 175
NM_015315chr573219 3149 2946 2938 997 862 547 --92769 2436 2241 2185 2176 2109 1035 962 737 13152
NM_015317chr242372 2340 2125 2086 --21115 457 22870 2232
NM_015320chr241013 385 358 173 --1175 --
NM_015321chr1954306 4069 3988 438 407 13865 24292 919 --
NM_015323chr661309 662 330 299 213 39 11138 ----
NM_015326chr162070 2026 1910 936 890 855 --62556 2166 1988 1014 907 728 11139
NM_015328chr7142817 2685 2322 2286 2009 1190 1136 1022 928 779 670 405 366 54 --1316 22782 2431
NM_015329chr1962105 971 924 531 424 93 12940 22563 542 --
NM_015335chr1251846 196 134 36 21 11916 32447 2440 2159 --
NM_015336chr1232446 915 68 ------
NM_015338chr2061853 1687 1573 1558 1351 192 1691 11560 --
NM_015339chr2021008 193 --21010 301 --
NM_015344chr832119 1916 1616 11928 3403 280 193 --
NM_015346chr1451611 591 391 100 79 --51733 1722 1564 1430 523 1192
NM_015347chr1242841 2133 714 507 1245 --1510
NM_015349chr632072 1952 1918 22260 651 11961 11921
NM_015354chr91347 --1257 --
NM_015355chr1731516 588 404 11292 ----
NM_015358chr2141290 1065 1038 842 ----2919 374
NM_015359chr862708 2495 2169 1919 1836 527 12049 52840 2208 2171 291 237 --
NM_015365chrX74120 2997 613 397 380 361 257 21704 990 74033 3740 3631 3026 463 372 353 1260
NM_015375chr154122 3532 3512 1425 1409 --21547 40 --
NM_015382chr142516 115 1586 ----
NM_015385chr1062205 1290 1101 776 427 264 --12971 12017
NM_015387chr252081 1926 1743 682 460 --1721 12084
NM_015394chr1262084 1952 1581 1546 889 835 1797 11636 1747
NM_015396chr351485 1279 458 189 79 --1268 --
NM_015397chr931515 1349 193 --153 178
NM_015401chr122782 50 11025 ----
NM_015428chr1941695 1219 1108 541 11185 2524 84 --
NM_015435chr821340 1178 ----11343
NM_015436chr43766 552 233 1969 33092 2556 58 12673
NM_015443chr1711030 --21384 572 --
NM_015446chr121575 1455 ----1345
NM_015455chr572556 1531 1310 1288 1243 1078 323 --1606 33733 1246 257
NM_015457chr112229 69 --1351 1708
NM_015458chr895135 4869 4584 4352 3583 1822 1222 141 56 1973 1314 --
NM_015460chr332083 1323 290 --21870 292 --
NM_015461chr183758 648 610 --1612 1651
NM_015464chr7192 --1176 1758
NM_015465chr52659 487 --1661 --
NM_015483chr72974 324 ------
NM_015497chr152242 119 --1466 --
NM_015508chr351556 1548 1119 1011 450 ------
NM_015509chr1281530 1416 1364 1355 1281 535 439 91 --21156 1151 --
NM_015511chr2041149 1061 312 139 --11135 --
NM_015514chr143533 398 149 1231 3535 429 381 --
NM_015520chr352821 2738 2530 2482 2108 12449 11030 11064
NM_015534chr13785 96 88 --2886 216 --
NM_015535chr274129 3598 2879 1339 1279 1208 43 --24053 208 13415
NM_015541chr331159 1002 577 ------
NM_015548chr63879 792 29 --1363 --
NM_015550chr7112910 2672 2635 2275 2260 2243 1412 813 769 305 37 11140 23298 150 --
NM_015554chr1542634 2432 1916 949 --32698 1966 500 11016
NM_015555chr651158 667 430 324 253 ------
NM_015559chr181110 --1688 --
NM_015564chr542341 739 448 107 --22639 1052 13523
NM_015565chr2121703 120 11514 11588 --
NM_015567chr135516 500 494 413 128 --2220 168 --
NM_015568chr2074349 3185 2875 2745 1735 1007 870 --23205 783 --
NM_015569chr184669 3397 1931 1918 1492 559 493 400 34549 4404 1942 24599 3684 --
NM_015570chr731148 695 238 --2732 697 --
NM_015571chr621925 197 12504 --1767
NM_015575chr252697 2346 2260 803 396 --31264 653 352 --
NM_015576chr342279 2260 2240 232 --32375 1035 211 --
NM_015578chr1962091 2008 1767 1370 781 144 --21922 460 --
NM_015601chr10----1839 --
NM_015602chr171538 1362 1171 428 415 370 358 2456 249 1693 --
NM_015605chr102995 265 1595 21524 986 --
NM_015607chr11158 ------
NM_015609chr132577 1903 1174 22319 895 22334 1924 --
NM_015635chr92336 173 --42199 621 346 193 --
NM_015638chr201670 --3580 500 238 --
NM_015651chr971745 1735 1592 720 532 270 75 12014 1521 --
NM_015652chr103485 224 183 ------
NM_015670chr172108 77 ------
NM_015676chr14----1329 123
NM_015678chr1331455 1296 1150 21647 540 ----
NM_015680chr22604 549 1480 1574 --
NM_015686chrX51776 1764 443 418 402 12361 ----
NM_015691chrX12454 --32905 366 193 --
NM_015694chr7----1252 --
NM_015695chr63739 546 131 --42152 1839 558 532 --
NM_015719chr194524 243 179 145 --1548 --
NM_015723chr72706 679 ----1527
NM_015726chr171848 1702 1362 646 594 455 65 --2575 528 --
NM_015833chr2182252 1631 1586 929 920 777 558 250 1327 11515 --
NM_015840chr182490 882 705 686 502 300 212 100 --62535 1727 479 462 341 336 --
NM_015841chr182490 882 705 686 502 300 212 100 --62535 1727 479 462 341 336 --
NM_015865chr1811064 11020 1154 --
NM_015878chr821684 96 11771 --11367
NM_015879chr18188297 8277 8270 8183 7971 6652 6233 6216 5614 3113 2718 2342 1924 1215 1140 939 676 503 13307 77426 7179 5624 5218 2811 1545 134 27061 6236
NM_015886chr855193 4786 4558 4548 129 24536 4449 22059 116 25264 1514
NM_015888chr122745 2498 ------
NM_015889chr221113 185 ----
NM_015892chr1082317 2294 2146 846 610 437 429 234 11678 42164 2148 1905 158 --
NM_015901chr101855 ----2726 295
NM_015902chr82142 59 ------
NM_015905chr7------1146
NM_015906chr1114480 4270 4032 3643 1868 1741 1472 884 874 542 279 14612 13645 --
NM_015912chr862530 2490 2028 1884 1673 527 11855 ----
NM_015941chr83256 121 103 ------
NM_015948chr61399 ------
NM_015955chr21132 1161 ----
NM_015957chr112374 352 ------
NM_015959chr11193 1446 4724 616 253 95 --
NM_015960chr10190 165 ----
NM_015980chr521192 196 --11464 --
NM_015981chr562496 2200 1191 1078 638 585 22105 1212 22521 2501 --
NM_015995chr15135380 5242 5129 4754 4573 4200 4046 3973 1493 1242 1187 1143 249 --44756 4284 1265 58 13450
NM_016002chr1--153 --1731
NM_016009chr144223 3320 527 222 13115 21734 662 --
NM_016019chr71881 --1160 --
NM_016021chr662166 1904 1895 259 212 114 32685 465 301 ----
NM_016025chr1652004 1979 1831 1811 1490 11898 ----
NM_016026chr1411221 --1279 11066
NM_016032chrX1301 11315 21333 889 --
NM_016061chr261545 1108 666 555 179 27 ------
NM_016072chr1242324 1932 866 283 ------
NM_016073chr151419 --1326 --
NM_016075chr1362955 2644 2595 844 726 140 --32817 2414 565 12149
NM_016076chr143018 2229 1134 828 22262 2187 12967 --
NM_016081chr421468 267 11714 ----
NM_016083chr623251 2793 --13670 --
NM_016090chr1111079 ------
NM_016096chr852110 1408 1342 589 145 21552 1522 1432 --
NM_016099chr85964 457 365 356 97 ------
NM_016107chr51236 1992 ----
NM_016115chr2----2522 38 --
NM_016120chrX2348 150 --21040 285 --
NM_016125chr171572 ------
NM_016127chr81721 --160 --
NM_016131chr252326 1976 1888 760 107 --2543 46 --
NM_016132chr1563334 2808 2477 1267 349 305 --32525 1249 508 1882
NM_016133chr241205 1132 1065 108 11345 1461 --
NM_016141chr31810 --165 --
NM_016146chr111257 --1169 --
NM_016147chr114873 452 382 180 --2454 236 --
NM_016152chr331275 987 195 --2385 255 --
NM_016156chr1152251 2218 1969 1743 462 --31971 1585 936 --
NM_016169chr1073014 2315 1001 890 834 615 343 22333 501 53247 2986 2808 2639 2478 --
NM_016173chr3123780 3316 3251 2993 2828 2808 1736 1630 1484 521 114 96 23257 1564 33214 684 340 23192 1134
NM_016194chr1551785 1550 1287 1264 389 --21332 700 --
NM_016201chr372305 2173 2001 653 456 105 35 --21450 835 --
NM_016206chr3188633 8110 7716 7180 7147 6463 3359 2972 2285 2233 2177 1944 1593 1251 873 784 210 76 15675 68072 7209 1746 1605 1044 609 16839
NM_016217chr632929 1269 394 13402 22902 93 13045
NM_016224chr651347 755 287 75 39 --1741 --
NM_016226chr121132 --1350 --
NM_016227chr131370 995 325 1290 ----
NM_016231chr171668 ----1671
NM_016235chr1651527 1267 1216 1164 946 --134 --
NM_016248chr13113579 3446 3248 2444 1247 1138 1084 756 624 552 487 11169 12842 12758
NM_016255chr673157 2908 1107 1089 660 595 560 --12264 21286 974
NM_016260chr296310 6063 5972 5559 5073 2874 1875 700 81 --45937 2463 2213 1049 --
NM_016269chr43733 481 320 ----1950
NM_016272chr2292562 2529 2458 2433 2424 2002 1908 884 714 12554 21861 772 --
NM_016277chr641636 1596 1549 1227 --1379 --
NM_016287chr152064 2048 1652 1604 665 2688 235 51798 518 267 196 105 --
NM_016298chr332174 2165 2034 1174 22680 219 12329
NM_016302chr33537 516 327 --1614 --
NM_016303chrX3380 73 63 ------
NM_016308chr111770 1721 ----
NM_016315chr271820 1422 355 328 220 145 132 11169 11892 11425
NM_016319chr12--1157 1555 1262
NM_016320chr114835 311 91 57 1362 21092 246 --
NM_016322chr93580 500 240 --21011 634 --
NM_016338chr521252 280 1977 ----
NM_016340chr541189 198 167 127 1824 ----
NM_016357chr121139 --1918 --
NM_016374chr141304 568 392 355 --1188 --
NM_016374chr141304 568 392 355 --1188 --
NM_016376chr1784221 3490 3262 3004 2869 2687 710 323 13849 ----
NM_016396chr15112983 2883 2489 2384 2305 2171 2141 2063 2048 957 527 21197 651 3605 461 364 --
NM_016410chr93558 201 146 --1103 --
NM_016418chr2283022 2426 1349 1149 1040 315 277 188 --43534 3526 2512 258 --
NM_016422chr1152818 2267 730 692 106 13055 1676 63141 3013 2821 2019 881 219
NM_016424chr1731520 1477 51 ----1729
NM_016436chr2051001 927 813 557 535 12017 1453 --
NM_016441chr232298 2001 960 --1186 3963 636 409
NM_016442chr542312 2203 2185 2147 ------
NM_016448chr111373 1297 1686 --
NM_016453chr3123 --1617 1655
NM_016475chr1431245 1190 254 --21123 865 --
NM_016487chr6192 ------
NM_016506chr115522 276 219 131 39 1230 141 --
NM_016507chr17113219 3094 2340 2269 2196 969 626 595 553 139 60 22220 37 63099 2271 857 791 756 455 12812
NM_016513chr653816 3548 3223 2542 2418 --2335 53 13242
NM_016519chr41551 ----1365
NM_016530chr15123922 3856 3420 3384 3290 1606 1326 746 718 624 54 46 11025 43426 3229 720 245 1316
NM_016531chr433629 3230 1077 21370 174 ----
NM_016544chr263618 1427 1158 1152 580 256 1483 31216 719 83 22927 53
NM_016559chr331448 1396 1017 ----11076
NM_016569chr1231535 1357 104 21255 1199 21048 374 --
NM_016574chr113918 906 312 --3933 895 377 --
NM_016577chr394380 4301 3581 2927 2734 757 704 408 383 --43808 3286 710 120 --
NM_016578chr112216 200 ----187
NM_016587chr741141 694 260 219 1796 --1781
NM_016588chr63727 149 101 --1729 --
NM_016592chr2031322 1241 335 --21243 1208 --
NM_016596chr122782 50 11025 ----
NM_016603chr551909 747 483 361 46 --21774 1658 1492
NM_016604chr53973 832 287 --1338 --
NM_016607chrX31483 484 54 ------
NM_016617chr1331949 1920 712 11476 ----
NM_016618chr21418 --3399 227 176 --
NM_016620chr121256 1217 11441 ----
NM_016621chr11103962 3849 3836 3768 3153 3138 1689 1534 719 457 23485 1365 23604 976 --
NM_016628chr101570 --1588 --
NM_016645chr151392 --1340 1395
NM_016649chr201140 --1404 141
NM_016654chr154978 494 452 328 --11085 --
NM_016656chrX2373 307 4397 328 113 43 ----
NM_016824chr1051713 1364 630 564 352 ------
NM_016830chr12------1472
NM_016834chr1793687 3572 3548 1508 1415 1011 908 296 283 --23885 3527 --
NM_016835chr1793687 3572 3548 1508 1415 1011 908 296 283 --23885 3527 --
NM_016841chr1793687 3572 3548 1508 1415 1011 908 296 283 --23885 3527 --
NM_016936chr1641799 1763 1498 572 11602 32068 1936 1804 --
NM_016946chr153212 2934 1386 949 290 42873 2580 2517 196 23489 403 --
NM_016950chr411378 1202 ----
NM_016952chr1194020 3381 2996 2902 2717 1613 1371 1062 205 14042 23773 1361 13384
NM_016953chr2106024 5939 5867 4922 4431 4135 948 713 671 229 13723 35068 4997 1932 31228 951 232
NM_017409chr121587 1786 185 --
NM_017413chrX102161 2043 1822 1814 1009 969 647 353 201 73 --1424 --
NM_017415chr5114563 4523 4436 3504 3145 3136 1810 1227 951 667 551 13498 21286 693 2349 339
NM_017420chr1432468 2420 78 --32788 706 216 --
NM_017423chr451813 1361 876 556 494 ------
NM_017440chr121451 ----192
NM_017447chr2163982 3145 1755 548 453 215 --23834 1620 --
NM_017449chr141559 1447 1153 634 --31588 1449 357 --
NM_017450chr171114 --51446 1441 1433 436 71 --
NM_017455chr15185 --1248 --
NM_017459chr1295 78 1356 ----
NM_017491chr41859 --21036 776 176
NM_017514chrX2886 620 --1934 --
NM_017519chr61311 1434 21284 232 --
NM_017522chr111066 --21256 1229 --
NM_017540chr553171 2783 2563 2425 550 12071 22915 879 --
NM_017548chr321914 1901 11447 11903 11521
NM_017551chr1052200 2087 1996 964 832 22540 1837 ----
NM_017553chr1531287 430 24 --21225 413 --
NM_017558chr162400 99 ----128
NM_017563chr3106124 5394 5053 4851 4815 4673 1798 1529 1258 1224 --56126 6004 5094 4344 1376 --
NM_017569chr13161 ------
NM_017575chr1741536 425 365 301 11222 11184 11625
NM_017580chr1072359 2041 1961 1496 908 404 356 12074 3786 249 134 11753
NM_017582chr141823 1504 639 95 --2358 109 --
NM_017590chr2262681 2508 1781 1645 1638 391 --31783 606 541 --
NM_017596chr1124242 3863 3436 2917 1792 1190 1141 894 743 191 123 64 --41299 128 55 49 --
NM_017602chrX4770 140 123 84 --1125 --
NM_017610chr1521867 252 1485 2748 644 22023 724
NM_017617chr93458 364 31 ----1280
NM_017628chr4175285 5143 4928 4319 4053 3613 3559 3275 3245 2121 2100 1217 917 630 497 152 117 --43332 936 445 154 24819 505
NM_017629chr161520 1378 1260 759 661 369 11551 21292 1207 --
NM_017633chr61202 --33169 2975 204 --
NM_017637chr9199057 8823 8816 8706 8463 8231 8219 7967 7506 7097 6288 6193 6181 3540 3179 2608 2157 1573 211 13611 78511 6532 3471 3017 2506 1843 161 --
NM_017640chr64595 266 112 96 ------
NM_017643chr17103024 3004 2969 2754 2422 1185 1160 839 661 252 12217 52534 2482 850 795 540 --
NM_017644chr364835 3506 1671 1350 1103 134 54891 4564 4496 363 176 24837 1043 14376
NM_017645chr952324 2214 2100 2013 1946 --33013 2190 187 21949 1235
NM_017650chr785872 5071 3867 1369 1132 1120 1012 928 55932 5899 5544 4663 263 ----
NM_017657chr2142 154 2935 35 --
NM_017658chr1463946 3691 3059 565 362 260 23555 3499 23948 1539 14116
NM_017666chrX51765 1695 396 219 81 --2812 257 --
NM_017672chr15165 --31158 442 67 --
NM_017694chr211793 --2375 285 --
NM_017697chr81549 1339 2448 438 --
NM_017709chr1103527 1626 1587 1578 1431 1093 1075 552 456 374 11316 32877 867 139 --
NM_017712chr19176138 5730 5710 4882 4251 3951 2332 2211 2115 2012 1744 1705 670 625 563 350 205 1157 35397 2229 215 --
NM_017719chr331848 818 191 --32501 1871 643 --
NM_017730chr3----2691 223 --
NM_017736chr1673087 2812 2455 2138 2117 1945 31 23212 1112 11937 --
NM_017737chr152197 2002 1562 502 348 ------
NM_017738chr951045 984 960 897 866 --21047 264 --
NM_017739chr13525 206 63 ------
NM_017742chr1821364 414 21245 104 21969 137 --
NM_017747chr5--1153 196 --
NM_017748chr176781 311 280 160 66 38 --2715 29 --
NM_017754chr6144737 4390 3968 3614 1460 1138 1028 945 920 864 719 643 628 352 --24084 1151 13236
NM_017757chr1841112 1087 359 72 1475 2983 345 --
NM_017758chr1721473 1415 --4953 947 432 139 --
NM_017762chr1532389 1801 1782 --21784 49 1288
NM_017763chr1731143 834 179 --21145 376 --
NM_017769chr1433216 2747 215 12567 22433 1192 1376
NM_017770chr672857 2532 1142 541 469 330 235 --42964 2890 2522 2104 1721
NM_017772chr661792 1606 1580 1563 1119 436 1451 1586 --
NM_017776chrX1619 11147 ----
NM_017778chr821164 1002 --2502 133 11179
NM_017779chr142726 2560 2278 497 11808 ----
NM_017784chr321153 886 --1903 --
NM_017785chr5------1353
NM_017787chr1052858 2451 820 790 114 11999 32319 150 129 1727
NM_017791chr1421161 312 21189 600 3565 320 48 11264
NM_017798chr201344 --21237 901 --
NM_017799chr1441970 1541 1239 423 12013 168 --
NM_017801chr342205 1592 1030 516 1952 --1519
NM_017811chr952605 2498 2114 1165 798 --22779 566 12818
NM_017812chr71538 ----164
NM_017813chr8155837 5413 5254 5067 4728 4654 3627 2136 1431 1374 1122 1113 848 734 148 --85726 5256 5069 1730 1273 766 736 150 --
NM_017816chr4147 ------
NM_017824chr1062451 927 415 378 276 30 --12195 --
NM_017848chrX84476 3948 3803 3757 1131 153 145 105 23686 1246 54449 4383 3805 1813 704 21396 472
NM_017849chr2123100 3093 3084 2943 2870 2224 948 936 844 469 284 80 --62872 2207 2046 2040 322 216 --
NM_017880chr22323 98 --1469 --
NM_017895chr20284 50 ----1158
NM_017896chr2093559 3352 3077 2343 2260 545 465 424 107 --42974 2968 710 547 1427
NM_017902chr10115642 5450 4551 4402 4133 1792 1574 1019 376 369 227 24193 825 55203 4474 2218 1392 759 14534
NM_017906chr63283 104 76 --178 --
NM_017910chr2----1325 --
NM_017919chr9105694 5409 4104 3902 1173 1087 965 809 583 261 35047 4902 1824 24307 1586 --
NM_017921chr1751692 730 484 363 79 --11839 --
NM_017922chr141112 1188 ----
NM_017934chr6181 ------
NM_017938chrX31373 554 446 1218 --1414
NM_017943chr142835 813 ----1268
NM_017944chr1132996 2346 22 --4961 935 628 24 --
NM_017949chr17122 ------
NM_017954chr751597 1490 1197 1114 376 21572 1173 31735 1712 189 --
NM_017958chr272963 2931 2848 2671 2485 2036 114 --32883 2438 1903 13009
NM_017964chr23851 360 216 --1998 --
NM_017987chr1052123 1896 1591 544 353 --3695 651 167 --
NM_017988chr121801 --2731 204 --
NM_017994chr752978 1971 991 721 522 --52830 2737 2731 1867 593 --
NM_017998chr921427 87 --2943 885 --
NM_018003chr1522106 1877 --1919 11947
NM_018008chr32157 23 ------
NM_018014chr221379 1159 21074 502 ----
NM_018026chr1171309 1092 330 306 217 165 100 --51248 1074 1007 347 26 --
NM_018027chr10102289 2243 2044 1105 868 591 366 244 227 26 --11057 --
NM_018036chr1473786 3427 3405 2907 1631 1106 749 34345 3945 1352 33348 1445 879 14355
NM_018037chr12480 263 ------
NM_018043chr1131352 1270 1175 21049 378 41359 534 174 150 --
NM_018045chr122337 2272 --22990 74 --
NM_018047chr51623 1155 182 --
NM_018048chr1262045 1859 807 782 774 289 42060 1812 1803 620 1433 --
NM_018061chr151374 1185 289 128 60 --1711 --
NM_018063chr101309 1469 2311 55 --
NM_018064chr6137 ------
NM_018078chr43657 408 211 1326 1213 --
NM_018079chr23498 127 37 --4500 192 186 140 --
NM_018084chr273276 2284 989 689 294 191 60 --13132 12398
NM_018085chr1117997 7865 7316 6732 5881 5374 959 694 553 247 204 28158 1101 57867 7172 6716 6489 821 16431
NM_018086chr221812 1628 11620 21801 1427 --
NM_018092chr1651640 1222 400 154 90 1640 21330 411 1418
NM_018095chr115522 276 219 131 39 1230 141 --
NM_018097chr152279 263 --1165 --
NM_018115chr43771 760 525 ------
NM_018120chr821114 51 --11406 --
NM_018121chr1043214 2003 1162 447 13012 43128 3061 565 449 --
NM_018133chr321758 449 11950 12143 --
NM_018155chr373185 3041 2316 1127 913 733 693 12149 1460 22319 260
NM_018157chr1243272 2498 1150 620 1684 33165 2239 50 176
NM_018159chrX31716 297 150 11689 --1300
NM_018164chr122278 242 ------
NM_018176chr441633 1452 1050 502 ------
NM_018178chr17801 653 633 550 255 189 27 --41896 1645 560 104 --
NM_018179chr12--1605 2187 24 --
NM_018181chr1871718 1218 750 689 637 137 120 ------
NM_018182chr1762039 908 797 748 533 451 11454 41825 1610 320 231 --
NM_018184chr331553 806 129 --21892 1597 --
NM_018195chr1141777 1364 552 22 --31857 613 554 --
NM_018198chr141498 968 591 240 --21339 46 --
NM_018200chr1572338 2181 1962 1940 1820 1763 1036 1640 41909 1790 718 456 11783
NM_018201chr952493 2137 1816 727 628 1941 11637 --
NM_018206chr163519 483 111 --169 1522
NM_018211chr161836 352 274 197 115 36 --11849 2448 410
NM_018214chr621299 369 1828 ----
NM_018225chr985352 4675 4132 4076 3409 1871 1846 492 14817 13572 15234
NM_018227chr443080 2281 1966 913 --42824 1247 1232 102 --
NM_018241chr4--1188 --11039
NM_018243chr493368 3301 3264 1564 1423 1364 1099 962 464 --43446 1452 1396 1183 --
NM_018244chr2051149 1052 478 310 151 ------
NM_018247chr621923 1056 41231 1129 999 154 1743 11093
NM_018254chr151767 1683 1661 818 599 11538 --21770 461
NM_018257chr2022060 234 --21903 800 11924
NM_018263chr262544 1927 1780 1035 1022 282 2718 400 32268 2251 1028 --
NM_018286chr172867 815 --1849 --
NM_018287chr1031359 911 333 --1335 --
NM_018293chr352858 1937 1909 1191 219 --22426 87 11194
NM_018299chr873150 3086 2929 2627 868 328 125 12784 33152 2546 1238 --
NM_018307chr172945 666 ------
NM_018312chr1111627 --31502 1355 451 --
NM_018313chr3--12039 21888 231 --
NM_018315chr411062 --11424 --
NM_018320chr112863 414 ------
NM_018322chr661114 1050 840 422 385 267 --1141 --
NM_018325chr921651 1386 1612 --21105 199
NM_018327chr2051889 1675 1638 436 83 --2643 637 --
NM_018330chr1011755 ----1450
NM_018351chr12104519 4433 4320 4114 3980 3682 3586 3371 2867 834 11655 74524 4435 4141 4070 4065 2869 1628 11070
NM_018360chrX1351 --2262 52 --
NM_018361chr8113870 3613 3309 1424 1258 1026 949 770 730 237 79 1256 12711 --
NM_018362chr1143730 1407 860 449 12860 153 --
NM_018364chr173739 3070 2934 2630 1634 330 290 22842 1608 44106 3844 1312 1196 23243 1444
NM_018368chr6----1255 --
NM_018371chr841026 641 548 386 --3643 143 41 --
NM_018373chr1456256 6198 4670 4043 399 --46170 5858 5035 82 --
NM_018374chr783977 1812 1768 1746 1622 1525 1386 809 275 49 31408 439 233 13466
NM_018375chr1431916 1835 742 --31661 1177 265 --
NM_018386chr131308 ----1102
NM_018387chr9--2167 131 ----
NM_018388chrX41356 1275 1253 1142 ------
NM_018394chr351558 1332 203 196 91 --41587 1351 238 93 --
NM_018400chr11193934 3927 3680 3662 3629 3442 3382 3120 3090 2998 2931 2904 1640 1454 648 485 311 279 111 13027 13271 --
NM_018403chr383712 3262 2618 1057 908 851 529 144 23820 1386 43800 3144 913 826 1854
NM_018409chr483093 2398 2340 2269 2195 1088 858 724 12186 --13126
NM_018416chr12102290 2032 1955 1866 1034 963 568 199 192 177 2774 615 82497 2050 1943 1889 1665 906 390 128 1213
NM_018423chr1251200 336 138 126 81 ------
NM_018424chr941789 599 448 428 ----1403
NM_018439chr1832654 1049 971 --11852 --
NM_018440chr8188457 8220 8205 7215 7155 7132 6866 5534 5469 2452 1906 1102 963 859 809 768 671 441 17685 77346 7065 5471 2125 1829 413 407 11741
NM_018442chr12260 116 --1118 1263
NM_018444chr811898 1618 11685 --
NM_018448chr1231082 874 376 21253 962 21140 121 --
NM_018452chr6_random43727 2641 194 90 23423 245 --11205
NM_018453chr142369 65 --1113 --
NM_018462chr3185 --1333 2604 352
NM_018471chr22392 161 1101 1573 --
NM_018482chr872337 2155 2135 2064 940 560 434 ------
NM_018489chr11442 --32243 1852 1492 12391
NM_018509chr1761627 1506 1193 686 672 178 1165 1688 --
NM_018553chr1761842 1684 1563 593 410 223 --21699 1651 --
NM_018557chr23633 369 287 --21176 118 --
NM_018566chr1104642 4284 4056 3292 2054 1269 969 904 149 62 13281 14714 --
NM_018569chr411152 --21176 1096 21155 1037
NM_018571chr2143 1604 1475 --
NM_018584chr141224 1164 1038 895 --21147 975 1873
NM_018593chr62684 512 --263 58 --
NM_018638chr1234065 3463 2210 24890 976 64375 4356 4186 1218 827 330 25082 655
NM_018639chr1231316 1202 456 --2538 170 --
NM_018640chr1242558 2235 1847 867 --1756 --
NM_018644chr1172084 2066 1668 1394 899 724 204 ------
NM_018649chr10----2446 221 --
NM_018650chr132018 1985 358 --22232 576 --
NM_018652chr152802 643 --1257 1646
NM_018657chr31575 ----1526
NM_018658chr1751662 1647 1627 1615 767 --31664 1469 696 1647
NM_018660chr8112238 1902 1027 997 788 778 619 551 293 209 157 --23009 2116 --
NM_018682chr73578 162 139 ------
NM_018684chrX41126 1059 400 232 1304 21227 957 --
NM_018685chr711029 ----1253
NM_018693chr2132 --1102 135
NM_018711chr1261500 1277 552 502 429 209 ------
NM_018712chr11----1285 1324
NM_018713chr14977 839 743 436 ------
NM_018717chr422668 729 12324 22471 1987 11069
NM_018718chr7112117 1963 1928 1801 1786 1683 1609 1546 667 134 63 11519 11869 --
NM_018837chr202742 343 --1332 --
NM_018841chr1153696 3421 3359 3187 3068 2562 2534 1565 1296 1043 1028 595 537 214 151 1863 33983 1305 167 12940
NM_018846chr71885 --1887 1164
NM_018890chr721307 146 ----11104
NM_018898chr542374 834 136 74 1762 31548 256 208 188
NM_018899chr542374 834 136 74 1762 31548 256 208 188
NM_018900chr542374 834 136 74 1762 31548 256 208 188
NM_018901chr542374 834 136 74 1762 31548 256 208 188
NM_018902chr542374 834 136 74 1762 31548 256 208 188
NM_018903chr542374 834 136 74 1762 31548 256 208 188
NM_018904chr542374 834 136 74 1762 31548 256 208 188
NM_018905chr542374 834 136 74 1762 31548 256 208 188
NM_018906chr542374 834 136 74 1762 31548 256 208 188
NM_018907chr542374 834 136 74 1762 31548 256 208 188
NM_018908chr542374 834 136 74 1762 31548 256 208 188
NM_018909chr542374 834 136 74 1762 31548 256 208 188
NM_018910chr542374 834 136 74 1762 31548 256 208 188
NM_018911chr542374 834 136 74 1762 31548 256 208 188
NM_018945chr6103552 3487 3385 3291 1477 1368 1175 1060 1027 725 1687 --11480
NM_018948chr141256 1014 543 57 ------
NM_018951chr71351 --11028 --
NM_018952chr171229 ------
NM_018953chr122701 74 --2147 62 --
NM_018959chr194719 690 576 286 --1307 1186
NM_018963chr2131206 464 267 2530 302 ----
NM_018970chr773116 2994 2735 954 709 638 45 --1946 --
NM_018976chr123777 694 99 ----12079
NM_018979chr1282523 2458 2424 2106 1983 879 639 252 11967 1800 12461
NM_018992chr1671669 1101 1060 670 642 258 42 --1496 --
NM_018994chr13502 494 50 --122 --
NM_018999chr1094839 4738 4551 4326 4201 4139 1392 1336 243 13098 54528 3209 3174 1881 1294 33259 3200 3165
NM_019000chr521302 131 1428 21054 133 --
NM_019001chr3114566 4320 4313 4267 4144 3618 3508 3079 1148 1073 34 13758 34329 4146 467 --
NM_019002chr2--1326 181 1344
NM_019004chr772125 1980 1801 1649 488 212 141 --52167 2086 580 383 188 --
NM_019006chr15------170
NM_019008chr2273728 3294 2777 1442 1404 1203 887 11283 31470 1406 386 1890
NM_019022chr1882729 2667 2494 2472 2280 2055 703 478 --2835 396 22201 274
NM_019030chr51178 ------
NM_019035chr421963 670 --21852 731 2506 276
NM_019036chr61310 11163 1901 --
NM_019063chr242333 1751 1470 904 --31713 431 29 --
NM_019064chr173803 695 130 ------
NM_019072chr51836 23093 424 1375 --
NM_019074chr153792 316 52 ------
NM_019080chr1331478 1272 25 --11309 --
NM_019083chr151475 1254 486 452 352 --11477 1455
NM_019084chr1022146 670 --11823 21670 673
NM_019087chr551162 647 260 222 57 --2380 111 --
NM_019091chr2186 --188 2830 200
NM_019094chr123374 276 64 23640 3491 2839 642 --
NM_019096chr63904 858 807 1958 31041 986 760 --
NM_019098chr831655 298 281 --51575 712 351 268 263 --
NM_019102chr72456 91 ------
NM_019102chr72456 91 ------
NM_019106chr22103371 1380 1370 1268 1247 1233 818 764 747 389 12598 3781 756 292 32842 1373 1363
NM_019114chr931857 902 267 22340 894 ----
NM_019116chr1673543 2816 1496 1241 632 554 202 --93621 3433 3158 2818 2599 2546 1342 542 457 12573
NM_019117chrX33131 2876 1395 43029 2762 2725 518 33180 2963 91 --
NM_019557chr11164 --2689 288 1843
NM_019590chr1041378 1241 958 506 --21467 443 --
NM_019592chr96849 563 294 243 122 75 ------
NM_019593chr2033079 2837 566 --12146 --
NM_019597chrX3778 167 148 --1717 --
NM_019600chr155761 702 299 274 104 1678 1633 2705 302
NM_019606chr72480 358 --2113 89 --
NM_019610chr13616 309 125 --22117 588 --
NM_019613chr1731260 1228 498 1150 ----
NM_019845chr22713 153 --1116 1875
NM_019854chr122692 538 ------
NM_019857chrX51777 492 476 257 204 --1206 --
NM_019859chr1051448 1034 586 519 429 ----11331
NM_019860chr1051496 1082 634 567 477 ----11379
NM_019885chr262179 1857 1095 347 338 206 21850 529 12034 --
NM_019891chr121306 1022 --11024 11309
NM_019895chr32732 63 --1963 --
NM_019903chr1051713 1364 630 564 352 ------
NM_020066chr11644 --1366 --
NM_020116chr421704 1157 --1364 --
NM_020120chr221546 515 1382 11106 11035
NM_020122chr285786 5298 4202 3905 1419 1382 1210 475 --45061 2007 1435 1389 --
NM_020123chr1031271 538 191 --1455 --
NM_020132chr2122077 1800 14926 45157 4880 4447 310 25077 3572
NM_020141chr132430 1744 207 --12432 12164
NM_020144chr752125 1786 1694 668 364 2588 127 21676 670 --
NM_020148chr1853072 2543 2494 2331 632 2702 282 11098 --
NM_020150chr1041918 1859 831 37 --21833 815 11395
NM_020152chr214922 894 239 102 ------
NM_020156chr7--1117 ----
NM_020157chr204842 730 398 187 --1732 1817
NM_020159chr44703 690 639 128 ------
NM_020168chr1521017 101 11331 ----
NM_020177chr5102377 2369 2165 1313 1276 451 399 386 310 163 1530 63262 1350 1344 1338 1322 1304 2752 454
NM_020178chr173901 100 87 1848 21147 371 --
NM_020182chr20153453 3170 3002 2846 2780 2759 1449 1429 1407 1321 1018 964 873 781 665 1853 21250 1006 23224 2960
NM_020184chr232049 1959 1546 11747 12051 1353
NM_020189chr82147 74 ----1150
NM_020198chr1731324 212 82 21534 1001 ----
NM_020205chr183330 3257 2556 1371 1351 1098 1074 807 33154 2488 1379 73482 3332 1360 1076 731 665 647 --
NM_020228chr111926 21638 597 21928 306 --
NM_020231chr34665 563 511 126 ----1129
NM_020232chr18--1204 ----
NM_020239chr15821 747 682 520 117 22244 294 22211 648 1120
NM_020240chr542408 2182 1908 1882 --32786 1884 117 --
NM_020309chr1931030 871 231 --2350 155 --
NM_020310chr1762581 2477 2413 2183 429 410 21741 657 11748 --
NM_020319chr72824 669 1172 ----
NM_020336chr2093551 3513 3380 3190 2586 1452 1341 1014 598 13159 53282 2829 2789 2668 2548 12651
NM_020337chr472893 2792 1195 971 655 374 275 12572 12895 --
NM_020338chr10102906 2718 2646 2445 2393 1395 1087 1072 1019 67 --23069 999 --
NM_020340chr651825 1627 624 280 77 2686 132 ----
NM_020342chr252426 2224 2058 167 62 --1169 1891
NM_020348chr10102810 2326 1936 1090 609 525 391 250 161 120 --1163 --
NM_020354chr105844 714 316 171 150 ------
NM_020357chr31497 --31547 1273 58 1500
NM_020360chr172583 89 ------
NM_020362chr12622 279 2731 212 ----
NM_020369chr7------1117
NM_020374chr1261687 1569 1392 602 464 236 --3604 399 223 --
NM_020379chr12316 219 --1145 1361
NM_020383chr10178 199 291 86 --
NM_020384chrX71699 1472 1426 715 693 489 284 --21474 227 --
NM_020390chr394165 4077 3554 3354 3232 3120 913 857 775 41967 1674 1286 216 13958 24168 1330
NM_020405chr1784386 3249 3097 2954 1550 1330 584 251 1937 42784 1700 703 78 --
NM_020416chr462693 2510 2424 1935 911 659 22192 175 ----
NM_020423chr12110 39 1595 --1456
NM_020432chr751693 1517 883 340 34 --21728 463 --
NM_020440chr183247 2944 2863 2408 642 631 281 235 11260 12251 12638
NM_020443chr1216919 6596 6539 6159 5658 5159 5143 5133 4821 4261 2771 1484 1121 1111 971 950 917 910 902 855 443 25231 4829 46161 2702 885 282 26374 4255
NM_020445chr71784 ------
NM_020452chr142035 1694 1651 97 21636 835 ----
NM_020455chr662525 2469 2033 1116 748 539 11088 32636 2471 1021 --
NM_020465chr1631372 534 70 --1598 --
NM_020466chr665040 4155 3746 3211 1201 1008 ------
NM_020473chrX21641 526 ----11644
NM_020474chr1831635 255 103 1152 61764 1442 1337 741 682 406 11301
NM_020475chr841903 1853 768 366 ------
NM_020476chr841903 1853 768 366 ------
NM_020477chr841903 1853 768 366 ------
NM_020480chr841903 1853 768 366 ------
NM_020526chr121593 239 --11270 --
NM_020530chr224925 868 697 357 ------
NM_020638chr1261599 1406 567 260 224 127 --31852 1315 305 --
NM_020640chr321874 1777 --1537 11631
NM_020644chr11------1226
NM_020647chr832264 1604 57 ------
NM_020651chr231560 1240 273 11193 21380 707 --
NM_020654chr311155 134 --11602
NM_020655chr1611003 11158 21402 453 --
NM_020661chr122439 82 --31948 1830 441 --
NM_020673chr20117259 3116 2447 2402 2389 2291 2107 1676 1369 1337 1102 --76457 1683 1371 1328 1296 1093 398 --
NM_020682chr1021004 69 1873 ----
NM_020686chr1653101 2383 2256 907 323 --31174 1141 190 --
NM_020689chr2061756 1749 1506 550 252 209 --11508 --
NM_020696chr3----1215 170
NM_020699chr1155141 4981 4912 4853 4111 3393 3362 3356 3339 2020 1888 1668 448 232 50 --45200 4034 1123 438 13346
NM_020708chr202799 720 --42442 1671 832 655 --
NM_020715chr1451993 1418 807 754 225 11448 1900 --
NM_020718chr16136099 5394 4810 4196 2380 2318 1636 1418 1357 1018 966 657 569 56381 6025 5575 5558 4542 44878 4426 945 821 --
NM_020732chr61311 1434 21284 232 --
NM_020734chr1273207 3098 2942 2557 937 829 560 --21331 939 1480
NM_020742chrX52647 2056 944 809 192 12120 11672 --
NM_020747chr5----2923 386 --
NM_020748chr1721587 246 ------
NM_020750chr651164 935 550 487 266 --31341 429 53 --
NM_020752chr1072931 2692 2441 2208 2086 1909 214 11023 1700 --
NM_020755chr631228 1137 258 ------
NM_020760chr261333 1236 436 256 127 98 --11335 --
NM_020766chrX54562 4555 3206 1096 1002 12847 44582 4538 3208 814 1119
NM_020769chrX2923 169 3952 934 739 ----
NM_020771chr661226 1218 1118 1054 356 160 --3176 162 153 --
NM_020772chr17158536 8450 7943 7069 7034 6247 5981 5774 5291 3452 2854 2644 2576 1019 479 27458 2878 98452 8270 7058 6181 5394 3016 2659 2520 957 17037
NM_020773chr442226 1803 1642 463 21971 1929 ----
NM_020774chr18116003 4592 4345 3985 2347 2293 1446 1283 1000 978 406 --84549 3987 2073 1863 1857 1448 616 303 21984 1414
NM_020777chr472490 2242 2219 2195 2174 1558 316 1931 22502 675 --
NM_020778chr1584726 4616 4289 3986 3384 1757 1687 854 11785 14389 --
NM_020794chr141370 1248 1159 1083 --11265 --
NM_020795chr17121790 1744 789 728 674 314 295 274 226 189 163 88 --1750 --
NM_020796chr582773 2759 2543 2475 1997 724 235 221 12449 12912 22487 727
NM_020800chr311336 11421 11041 --
NM_020801chr542636 2322 1847 987 --52545 2536 2139 304 216 12624
NM_020804chr651962 501 427 382 102 21831 396 ----
NM_020805chr1821799 1607 ----21768 1610
NM_020806chr144850 562 322 85 1651 1228 --
NM_020807chr1631526 1469 250 --11640 --
NM_020809chr1131995 883 147 --21801 1418 21542 507
NM_020810chr1453204 3125 738 498 179 --43481 3206 3077 262 --
NM_020819chr6--1818 11064 --
NM_020825chr1683691 3576 2602 2544 1483 1185 886 835 11379 33044 788 335 --
NM_020826chr1173613 3006 2320 2255 628 578 75 12293 13528 --
NM_020830chr263315 2293 789 711 445 215 11098 22368 618 33122 1256 496
NM_020841chr1263908 3298 3153 1585 1530 1256 ----33911 2459 1533
NM_020844chr8147280 6856 6484 6454 6357 5655 5516 5242 5034 4995 4902 2306 1670 49 35612 3060 2645 46521 4904 2354 1726 --
NM_020845chr1242287 2046 843 442 --12422 --
NM_020850chr1662986 2766 913 888 314 132 12755 43131 3112 164 147 --
NM_020853chr1272647 2092 1046 909 659 537 403 --32628 961 523 32650 2532 651
NM_020854chr1841354 999 89 58 --11001 --
NM_020858chr1542133 1556 913 706 11515 1937 --
NM_020859chr493901 3790 3650 3434 2952 2631 1621 359 137 33571 2568 786 63494 3071 2524 1530 158 40 23254 3034
NM_020860chr41467 1792 ----
NM_020861chr651159 133 114 61 52 --1349 --
NM_020868chr231675 753 234 --21743 1677 --
NM_020870chr462037 1991 1563 1439 652 471 1546 11606 1726
NM_020871chrX42038 1961 993 229 --1767 --
NM_020873chr3----1593 --
NM_020888chr152006 1731 1524 1473 201 1593 21797 1737 11317
NM_020899chr1762376 2366 941 914 722 170 11756 2930 565 1417
NM_020909chr283955 3917 3833 3015 2789 1588 1498 157 22806 892 43044 916 444 286 13734
NM_020918chr1093090 2919 2726 2604 2296 1371 955 439 48 --13147 1911
NM_020922chrX21902 100 --21785 102 --
NM_020925chr11138 --1970 --
NM_020927chr16102273 2197 1849 1764 1549 957 915 900 707 580 --1535 --
NM_020935chr274362 3220 924 581 481 220 66 --54621 4349 4327 3711 3467 2766 522
NM_020944chr95246 208 196 116 58 ------
NM_020948chr1103560 3479 3366 3255 2721 2708 1305 1132 659 472 --43631 3030 434 91 --
NM_020952chr9270 53 --179 --
NM_020956chr1974629 3402 1293 1136 688 420 303 --21404 284 14635
NM_020962chr1562520 2436 2334 2162 2093 647 1834 41583 754 735 627 --
NM_020967chr203896 285 91 1173 11248 --
NM_020975chr1042022 1702 247 187 --2252 189 1620
NM_020977chr441813 1797 1677 319 11504 11696 --
NM_020980chr1561620 1479 1462 1194 242 43 31747 1494 180 ----
NM_020981chr22788 70 ------
NM_020983chr1282245 2009 1659 1640 1541 393 351 243 --41721 1673 405 395 --
NM_020993chr1262747 2361 892 862 402 308 21102 321 32206 2015 982 --
NM_021003chr141618 ------
NM_021005chr152940 377 --2942 74 --
NM_021007chr211925 --12012 1523
NM_021009chr12----144 --
NM_021020chr8113547 3014 2853 2714 2614 2266 2244 1271 1069 951 231 --103419 3230 2303 1367 1311 1031 953 478 385 157 --
NM_021025chr52493 486 ------
NM_021032chr33152 46 24 --21721 70 11827
NM_021033chr1343349 3055 2909 980 --11174 1424
NM_021035chr2041227 1138 971 535 21292 1244 11307 --
NM_021038chr323404 174 22801 323 ----
NM_021047chr191240 1673 ----
NM_021061chr854468 4139 1241 1183 451 --33750 1031 198 --
NM_021064chr63667 633 608 182 ----
NM_021072chr51237 --12453 1330
NM_021079chr1782889 2704 1260 1175 862 664 483 220 ------
NM_021083chrX113662 3596 2998 2982 2941 2702 2274 1367 811 353 131 2630 346 33228 1127 946 --
NM_021088chr251980 1877 1489 707 436 ------
NM_021090chr22164947 4098 4058 3349 3239 1939 1698 1597 1516 1242 1079 1070 995 772 197 169 43552 3458 1766 1200 33577 1886 235 --
NM_021096chr2233217 2649 2258 --1551 1735
NM_021097chr233048 3041 915 12944 ----
NM_021116chr7178764 8654 8075 7549 7026 6136 3503 3406 3237 2428 2374 2070 1522 1472 1003 886 268 15484 56663 5830 5536 983 888 --
NM_021120chrX112808 2799 2379 1945 1219 970 754 422 255 55 23 --1960 --
NM_021136chr144472 307 158 94 --2674 287 --
NM_021140chrX21007 344 --1361 1306
NM_021144chr94446 435 207 116 ------
NM_021149chr162236 166 --41141 427 339 328 --
NM_021153chr18----2494 127 --
NM_021155chr19112510 2321 2276 2252 2160 1111 764 507 254 145 34 --43038 2553 2326 1116 --
NM_021156chr203976 108 53 --21026 90 --
NM_021159chr461638 1559 1143 562 223 41 2490 82 1571 --
NM_021167chr742114 1045 228 106 1147 ----
NM_021183chrX62508 2217 2041 1757 489 336 11836 32064 1716 786 --
NM_021190chr13437 148 130 --1280 --
NM_021191chr1282100 2085 1870 1757 811 312 160 46 1727 32541 2078 140 12553
NM_021192chr23384 126 106 ------
NM_021201chr1131812 178 68 11450 1163 --
NM_021202chr2072607 840 584 443 268 147 126 22189 469 12865 --
NM_021213chr1731046 979 224 --1891 --
NM_021215chr2052328 2192 462 274 238 --12292 --
NM_021222chr161228 1027 975 940 188 179 --21476 1014 11238
NM_021227chr41505 --1212 --
NM_021229chr121434 --31190 983 505 --
NM_021238chr1231962 656 376 --21711 658 --
NM_021239chr142562 200 ----1565
NM_021249chr1421209 40 1313 11302 --
NM_021252chr1021288 737 ----21812 1777
NM_021255chr1493928 3838 3191 2925 2534 1537 1365 1027 682 --22851 951 11540
NM_021622chr1032278 1914 1622 11671 21814 48 --
NM_021627chr31282 --1949 1285
NM_021629chr364211 3685 1333 1120 892 562 11126 34172 1321 797 14795
NM_021633chr161330 1114 471 451 278 90 --31372 1340 1332 11117
NM_021637chrX2980 443 1487 21372 1230 --
NM_021638chr4125045 4962 4954 4847 4748 3736 3378 3366 1777 1521 1442 1134 1727 14198 24708 4125
NM_021639chr11177 --181 1882
NM_021645chr1342362 1744 1685 49 ----1265
NM_021647chr454261 3951 3426 1582 174 --53974 3888 1584 454 368 24161 536
NM_021648chr641922 1708 988 981 --102686 2338 2333 2244 2174 1725 1092 676 121 97 22187 38
NM_021705chr641511 1339 1311 41 --11450 --
NM_021738chr102555 335 ------
NM_021809chr2082348 2277 2020 988 507 315 204 64 --42279 1789 990 509 --
NM_021813chr6125682 5636 5409 4084 3748 1752 1535 1392 685 534 508 318 14113 43911 1703 1543 820 35027 4655 1098
NM_021871chr4----151 --
NM_021905chr681939 1873 1651 1518 1487 1440 643 473 11801 21837 93 --
NM_021911chr5135401 4751 4641 2129 2113 1847 1694 1632 1054 881 528 371 202 1711 23519 1855 23607 1697
NM_021912chr1593803 3397 3253 3010 1362 1312 954 560 149 --23871 1095 --
NM_021914chr1462000 1730 991 658 98 46 12070 1874 --
NM_021935chr32812 355 --1236 1815
NM_021939chr17--1226 2779 203 1619
NM_021940chr631392 224 46 --1282 --
NM_021942chr42940 869 1700 --1190
NM_021943chr622200 1372 --21516 122 --
NM_021945chr673451 3390 2805 2643 1299 548 272 --2633 550 --
NM_021946chrX51366 1302 589 69 30 11148 11043 --
NM_021949chrX22344 1884 12865 1251 --
NM_021950chr1141935 325 283 149 32200 1804 269 22215 27 21985 646
NM_021954chr1383664 3479 3282 2961 2860 2488 1209 812 12514 ----
NM_021956chr63312 69 44 --1611 --
NM_021960chr132614 1122 505 1962 52788 1896 1778 486 309 22772 1886
NM_021961chr11206931 6464 6372 6107 6048 5407 5361 4792 3011 2864 2771 2613 2572 2555 2110 1934 1753 1689 414 407 --86300 6148 6099 4592 2924 2574 2287 1549 22123 246
NM_021964chr395070 4329 4248 2657 2650 2525 1883 1840 954 46551 5102 707 305 45363 4942 4127 2082 --
NM_021965chr921193 1097 ------
NM_021970chr41118 --2621 514 --
NM_021973chr41538 --1149 --
NM_021976chr661047 1031 894 680 329 270 ------
NM_021977chr683291 2863 2725 2619 2381 787 547 279 --53817 2787 1541 1435 1425 --
NM_021984chrX41297 1058 551 379 --2572 115 --
NM_021987chrX41297 1058 551 379 --2572 115 --
NM_021990chrX41297 1058 551 379 --2572 115 --
NM_021998chrX11346 ------
NM_022003chr1151258 1017 863 345 109 11318 ----
NM_022037chr24718 656 324 235 --1948 --
NM_022048chr15206344 6003 5054 4950 4876 4842 4812 4563 4528 4287 4092 2298 2006 1621 1175 690 588 581 525 72 16078 12350 14770
NM_022049chr14725 617 495 71 --21871 1838 --
NM_022051chr1--1610 ----
NM_022060chr1461220 1112 859 504 373 84 ----11037
NM_022062chr1161587 1384 1336 462 207 164 --11765 --
NM_022067chr144932 608 223 36 ------
NM_022068chr18----2210 111 --
NM_022073chr142598 56 --31531 1383 1325 11236
NM_022075chr14972 691 684 119 1320 2665 235 --
NM_022079chr10----1839 --
NM_022080chr2082689 2640 2310 1859 1718 1055 1035 845 --3946 733 380 --
NM_022085chr63574 264 150 --1288 1195
NM_022087chr71120 --1455 --
NM_022107chr62146 27 ------
NM_022114chr153394 1459 1385 971 146 --11387 14677
NM_022121chr621235 67 --11086 1246
NM_022123chr143533 481 113 ------
NM_022124chr104666 645 609 548 ------
NM_022130chr53344 233 92 11435 132 --
NM_022131chr341267 1049 605 554 --1306 --
NM_022137chr141234 11319 22042 409 --
NM_022138chr611022 --148 1342
NM_022154chr441239 1031 1009 529 1974 ----
NM_022166chr16165110 4929 4721 2398 2264 1881 1705 1695 1440 1373 1113 816 649 595 433 269 --66081 5168 2366 1746 1740 1269 35605 5316 1884
NM_022170chr761499 1481 429 417 277 261 --4408 371 360 246 11429
NM_022173chr24718 656 324 235 --1948 --
NM_022340chr383389 2571 2386 2346 1337 1115 672 435 23106 397 53391 2517 2429 2366 233 --
NM_022351chr853361 2745 1292 1207 1154 --23520 1199 --
NM_022371chr1----1774 --
NM_022374chr21360 ----125
NM_022456chr12106677 6070 6059 5070 4827 4675 1615 1057 372 109 15851 21059 297 27412 4678
NM_022458chr742650 2602 2438 752 1228 --1543
NM_022459chr1385959 4253 4103 4036 1925 1906 1833 398 14050 41680 748 611 320 14322
NM_022463chr1721476 64 ----11178
NM_022465chr12102948 2941 2639 1901 1882 980 620 229 155 77 --82844 2713 2580 2115 1220 845 364 216 --
NM_022473chr15124253 4168 3097 2791 1717 1199 1101 972 828 460 234 80 ----14049
NM_022474chr1472631 2536 2396 1877 781 732 161 2508 195 12776 --
NM_022475chr41108 1255 ----
NM_022476chr164958 744 126 34 --1895 --
NM_022477chr2041090 490 266 150 ------
NM_022482chr2032376 497 421 --42145 1005 180 128 11763
NM_022484chr721136 436 --2976 487 11434
NM_022491chr12123058 3036 2993 2662 2472 2424 1385 1312 1118 789 70 21 11107 32664 451 271 --
NM_022494chr101356 --2363 109 --
NM_022496chr122336 53 ----1339
NM_022497chr352972 2500 852 842 473 23824 2911 13563 --
NM_022652chr121185 --51000 787 772 356 54 --
NM_022658chr1221205 377 ------
NM_022716chr152225 1025 579 536 462 --12081 1867
NM_022726chr631748 1585 1084 --11118 --
NM_022728chr71743 --2195 189 --
NM_022733chr171182 1087 1042 985 977 314 31 11204 --190
NM_022735chr111422 --1156 --
NM_022739chr1721228 177 ----1275
NM_022749chr811115 ------
NM_022751chr181102 ------
NM_022753chr142781 2308 2282 1060 32366 2116 670 32783 1861 791 --
NM_022756chr14520 352 275 48 --21343 455 --
NM_022758chr693224 2857 2481 2214 2169 1026 718 405 396 --83097 3088 1057 1049 840 626 614 398 13227
NM_022763chr352839 2721 2530 1264 1194 12351 23061 267 --
NM_022766chr2272637 2486 2077 1763 1718 1038 457 1939 ----
NM_022771chr12--1862 1200 --
NM_022778chr14997 916 497 79 --31420 1010 921 --
NM_022780chr21412 --21878 552 --
NM_022781chr993119 2666 2305 1243 740 714 680 606 260 11314 2944 608 --
NM_022802chr10--11231 1290 --
NM_022824chr541584 1431 784 506 --31608 1433 262 --
NM_022825chrX2286 279 ------
NM_022828chr5----21579 1394 21557 1155
NM_022831chr121757 1595 1617 21751 564 --
NM_022832chr492492 2346 2305 2296 2096 2070 429 386 77 2930 312 22298 1726 --
NM_022840chr183463 53 41 --21069 55 --
NM_022841chr1562737 2666 2168 1756 861 438 --1961 --
NM_022843chr1331395 1087 602 ------
NM_022845chr1632058 1769 119 --21894 477 1374
NM_022893chr232573 2327 849 --62654 2579 908 316 238 222 --
NM_022894chr261754 582 532 450 209 184 1699 11561 --
NM_022898chr14154743 4715 4707 3856 3540 3520 3426 2969 1446 1231 1164 1123 1051 527 301 43945 3932 3817 3170 --34746 3107 1309
NM_022910chr1631372 534 70 --1598 --
NM_022912chr272938 1005 975 873 321 228 106 --42380 2350 679 194 --
NM_022918chr11----11738 --
NM_022970chr1051314 1093 1035 992 308 ------
NM_022977chrX52044 1817 1798 1653 467 --42436 1655 845 219 12311
NM_023009chr14706 626 279 140 ------
NM_023012chr12------1682
NM_023015chr12190 142 --1709 --
NM_023034chr83544 388 219 --1550 --
NM_023037chr132989 328 --2457 414 --
NM_023071chr1251041 1032 385 206 158 --1195 --
NM_023074chr193899 463 297 --31100 1094 509 --
NM_023076chr163853 615 180 --2696 232 --
NM_023079chr17