TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5587-3p
miRNA Sequence: GCCCCGGGCAGUGUGAUCAUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX45595 4436 2050 1712 26647 1370 14912 --
NM_000268chr2273610 3102 1507 1246 830 347 100 23747 631 22551 1093 --
NM_000332chr642248 1035 477 312 --1503 1254
NM_000615chr1152892 2341 2116 923 632 ----11971
NM_000719chr1274922 4740 4146 1311 269 167 147 22412 520 1226 --
NM_000723chr1731454 1150 169 1386 31234 1051 327 --
NM_000738chr116708 276 263 136 123 39 --1411 1203
NM_000831chr195901 5786 4960 1989 1982 1605 956 529 502 11586 132 --
NM_000924chr124503 474 359 186 1219 --1926
NM_000964chr1761287 930 259 209 176 108 2397 120 2279 132 --
NM_001001549chr722621 910 12279 11018 1102
NM_001001550chr722621 910 12279 11018 1102
NM_001001555chr722621 910 12279 11018 1102
NM_001003794chr362918 2043 1120 1092 1086 34 ------
NM_001004106chr52194 183 --2331 236 1111
NM_001004304chr1292838 2816 2687 2630 2563 2436 2407 1008 227 --13042 1206
NM_001005609chrX81514 1472 1104 921 877 437 378 40 22728 995 23647 781 --
NM_001006115chr382562 2254 2002 1072 1022 966 620 374 ----12591
NM_001006617chr921001 155 21134 180 195 1144
NM_001006619chr921001 155 21134 180 195 1144
NM_001006620chr921001 155 21134 180 195 1144
NM_001006621chr921001 155 21134 180 195 1144
NM_001008220chr593715 3592 3207 3160 2894 2556 731 539 479 13684 23842 2668 --
NM_001008701chr19112611 2387 2039 1963 1233 1092 1012 1002 834 369 53 1792 1166 22032 822
NM_001010867chr1115961 4620 4538 4302 2104 950 513 436 430 339 41 --56412 6120 1200 1116 48 --
NM_001012426chr671342 819 700 577 524 129 28 23265 121 43223 1355 1265 1211 --
NM_001012427chr671342 819 700 577 524 129 28 23265 121 43223 1355 1265 1211 --
NM_001013622chr49942 454 393 331 269 207 146 84 22 --7484 422 361 299 175 114 52 --
NM_001013693chr1112396 2387 2189 2036 2025 1138 1076 1065 789 309 130 --1345 12693
NM_001013693chr1112396 2387 2189 2036 2025 1138 1076 1065 789 309 130 --1345 12693
NM_001014435chr161172 1105 2232 94 1194
NM_001017395chr363381 2890 2862 2399 1241 482 ------
NM_001017440chr777453 6374 5196 4992 2079 648 159 17872 11838 --
NM_001017916chr1761321 1279 766 555 368 148 --2347 21 --
NM_001017917chr1761321 1279 766 555 368 148 --2347 21 --
NM_001017995chr543384 179 169 116 ----11296
NM_001018050chr22103371 2650 2356 2309 2092 1252 1175 1145 1078 770 --33112 1191 990 1897
NM_001018052chr22103371 2650 2356 2309 2092 1252 1175 1145 1078 770 --33112 1191 990 1897
NM_001018108chr1522078 183 1298 2765 195 --
NM_001024809chr1761287 930 259 209 176 108 2397 120 2279 132 --
NM_001030007chr1623419 297 --12646 12759
NM_001031690chr782548 2471 2442 2014 848 259 212 198 --12207 13080
NM_001033045chr253312 3230 1470 1420 1281 ------
NM_001035534chr951147 1113 983 549 274 174 --1926
NM_001039550chr22123 117 ----2766 208
NM_001039690chr1682170 2024 963 949 727 613 493 88 --12069 --
NM_001040144chr1682170 2024 963 949 727 613 493 88 --12069 --
NM_001040146chr1682170 2024 963 949 727 613 493 88 --12069 --
NM_001042603chr1253507 3449 3391 3333 629 1887 ----
NM_001043318chr1493613 3171 1492 732 632 488 252 243 220 12983 11366 --
NM_001049chr1462130 970 963 902 523 31 --1956 --
NM_001095chr1231233 395 106 21418 582 --190
NM_001106chr3107995 7930 3647 3083 2178 2144 1813 1082 688 654 33277 2915 1113 12193 13840
NM_001128chr1623419 297 --12646 12759
NM_001397chr182447 2397 2031 1722 1697 588 543 270 --1101 12571
NM_001399chrX81514 1472 1104 921 877 437 378 40 22728 995 23647 781 --
NM_001407chr361647 1594 1484 1418 529 523 --2388 281 --
NM_001420chr1952850 935 728 165 35 1643 32891 2677 432 1203
NM_001497chr962430 2403 2306 1792 1711 1068 12389 --11057
NM_001498chr61387 ----1957
NM_001543chr5114657 3853 1560 1369 1231 992 984 712 682 427 144 24700 590 24489 1180 23967 255
NM_001789chr361334 1125 672 396 296 118 ------
NM_001915chr1761321 1279 766 555 368 148 --2347 21 --
NM_001937chr11150 144 --2948 886
NM_001941chr183927 712 664 2979 908 --11158
NM_002025chrX36357 6296 3058 190 28664 771 --
NM_002061chr161954 1904 1706 1479 1429 1229 ------
NM_002082chr52157 146 --2294 199 174
NM_002204chr174917 902 173 98 ----1353
NM_002309chr2272671 2626 915 879 738 653 83 1252 22349 2123 12862
NM_002319chr7101000 966 960 919 900 892 800 673 402 168 ------
NM_002359chr17114252 4091 4048 4037 3630 2763 1486 1316 1310 554 538 --13170 --
NM_002375chr381808 1687 1496 358 229 208 200 121 --22017 313 --
NM_002390chr1762024 2018 1983 1528 1453 483 --32071 474 305 --
NM_002403chr14262 52 44 36 --1132 --
NM_002486chr941906 1856 666 625 ----1389
NM_002501chr1983731 3705 3025 2976 2622 1462 1020 853 23266 383 33675 2991 784 1198
NM_002522chr17113195 2888 2857 2849 1467 951 862 771 653 574 350 ------
NM_002613chr16105176 4486 2142 1834 1814 1764 1710 1663 757 70 --24304 1790 --
NM_002698chr19102690 2613 2517 2020 1041 858 844 818 353 25 ----147
NM_002725chr193543 1449 945 831 779 548 466 326 48 23667 1567 11116 1409
NM_002779chr107497 491 158 152 135 79 68 --1367 --
NM_002957chr993294 3073 1389 1200 1194 1098 884 693 508 --23698 2845 22675 554
NM_003045chr13104306 3799 3594 1339 1333 1004 988 773 220 186 --24280 645 24057 371
NM_003108chr2142861 2757 2663 2607 2562 2532 2520 2464 2455 2377 1986 1971 1949 1914 22678 1927 52873 2818 2692 2277 2064 12726
NM_003131chr662210 2126 1808 1782 623 257 1489 2889 574 2865 827
NM_003200chr19102210 2046 1915 1788 1733 1661 1523 956 309 78 11623 1195 --
NM_003216chr22123141 2898 2891 2679 2351 1087 1055 1000 606 587 357 316 --21077 55 --
NM_003388chr742060 1968 1378 383 21641 414 --1241
NM_003458chr383716 3592 3560 1327 513 505 207 78 23086 1113 --1849
NM_003466chr251968 784 776 360 51 22461 1815 ----
NM_003470chr1651831 1504 1285 534 294 --2558 359 --
NM_003644chr17126055 5732 5718 5692 4785 2038 1811 960 902 162 99 22 25550 36 35864 5490 4797 1756
NM_003988chr10101891 1855 1477 774 671 623 531 510 435 297 --21529 34 --
NM_004200chr1142573 1225 656 524 1201 12662 22176 411
NM_004227chr782484 2247 780 769 690 264 179 172 --31240 750 430 12131
NM_004308chr1151672 1611 624 551 42 11782 21666 656 11454
NM_004311chr1022403 2171 22612 1117 22428 2163 12959
NM_004321chr283357 2899 2560 2430 857 626 592 246 --13192 1148
NM_004494chr141052 438 311 305 162 ----
NM_004501chr113435 ----12962
NM_004566chr1042495 2084 715 497 1332 1890 --
NM_004588chr1152818 2532 1376 1320 860 --2263 122 1226
NM_004762chr1751803 1757 724 707 565 2511 185 1539 --
NM_004863chr1474356 4215 4165 3779 1876 1771 1179 15258 ----
NM_004924chr197904 881 420 318 144 115 52 21064 931 ----
NM_004976chr11145063 4745 4383 4284 4035 4029 3876 3233 3224 1796 1511 926 791 184 --34522 4021 111 --
NM_004992chrX87011 6548 6484 6461 5898 5389 2825 1784 27572 6733 26026 822 --
NM_004992chrX87011 6548 6484 6461 5898 5389 2825 1784 27572 6733 26026 822 --
NM_005027chr195891 411 391 274 37 --2441 339 --
NM_005056chr1253751 3693 3635 3577 873 11131 ----
NM_005099chr14863 290 179 36 --1404 1367
NM_005137chr2262094 1791 958 884 855 809 1817 22330 607 168
NM_005182chr161172 1105 2232 94 1194
NM_005188chr1197959 7410 6763 6458 5540 3167 2836 2493 348 ----1280
NM_005311chr722621 910 12279 11018 1102
NM_005312chr942510 2418 1051 986 12570 3865 514 443 1753
NM_005338chr733698 3284 2776 13617 23649 701 --
NM_005354chr191445 --1210 2154 101
NM_005417chr2051434 1372 315 309 42 --31936 1908 64 --
NM_005477chr1542172 2086 899 294 --1436 1449
NM_005477chr1542172 2086 899 294 --1436 1449
NM_005730chr1271184 945 874 846 739 665 632 --11462 --
NM_005736chr1051344 479 344 158 150 --1209 --
NM_005877chr2221604 759 ----22145 1643
NM_005910chr1783911 3815 1062 988 702 383 365 165 --12772 --
NM_005920chr183710 3476 3016 2992 956 696 259 76 --53718 3699 3421 1061 983 12916
NM_005934chr19121928 1886 1697 854 833 777 525 389 294 228 41 34 12297 3913 786 195 21664 1642
NM_005937chr1773353 2791 1426 1006 950 472 398 --13219 13674
NM_006034chr116841 789 181 155 53 36 1210 --11987
NM_006133chr11142285 2182 2081 2059 1956 1691 1574 1003 991 936 842 719 251 144 --21630 485 --
NM_006148chr1762890 2345 445 369 253 57 --1533 12018
NM_006212chr173350 2159 1789 1012 859 793 407 12077 ----
NM_006237chr134777 322 253 197 1521 --1401
NM_006306chrX33721 2228 1258 1817 --14030
NM_006336chr931361 571 486 --11490 21498 1184
NM_006373chr1751456 1244 1214 470 274 ----1896
NM_006454chr482978 2876 2755 1957 887 881 786 721 1747 52518 2314 930 593 529 --
NM_006459chr1051934 1539 743 440 134 ----1365
NM_006521chrX41338 1068 383 23 --2488 116 1271
NM_006532chr1981698 1675 1478 1376 748 460 259 38 11560 ----
NM_006546chr1754867 4672 2087 105 96 16087 35431 5250 220 15298
NM_006650chr593715 3592 3207 3160 2894 2556 731 539 479 13684 23842 2668 --
NM_006690chr20102263 1876 1813 1690 1581 878 533 409 230 115 --12295 --
NM_006736chr231495 651 41 1679 11525 21776 1218
NM_006763chr12540 22 1837 1394 178
NM_006772chr6101521 1500 1479 1346 628 533 489 333 288 122 --1359 --
NM_006841chr35720 655 545 305 87 ----1625
NM_006861chr1261664 1603 1492 1340 777 548 1611 31854 1751 73 --
NM_006927chr1682027 773 639 385 266 138 59 47 ----1874
NM_006943chr2082610 1339 1027 991 652 635 602 518 2954 556 23132 463 --
NM_007011chr1586421 6173 5636 5554 5018 1644 1100 167 ----1688
NM_007249chr1348054 7508 211 205 27427 3041 ----
NM_007283chr362918 2043 1120 1092 1086 34 ------
NM_012099chr198778 486 281 223 170 151 126 52 ------
NM_012199chr144084 3362 3153 1196 11592 23531 3312 --
NM_012232chr172627 563 --2404 308 11975
NM_012264chr2281649 1394 668 629 499 435 284 225 11463 ----
NM_012264chr2281649 1394 668 629 499 435 284 225 11463 ----
NM_012296chr1183541 3213 2717 1199 1022 758 342 163 --32998 2921 205 --
NM_012308chr1132504 1939 1862 ----12397
NM_012316chr155491 5179 3847 1344 657 1672 14523 13892
NM_012384chr2051758 852 326 94 25 --22208 927 22045 440
NM_012402chr1171393 1342 1310 1089 381 307 127 ----1930
NM_012405chr122735 50 13430 23412 756 1280
NM_013279chr1172286 1690 1632 861 668 616 548 11872 22025 521 11834
NM_013399chr1681452 1389 1254 669 523 493 357 298 ----11626
NM_013443chr951201 1035 1007 969 364 ----1163
NM_013951chr251968 784 776 360 51 22461 1815 ----
NM_013952chr262045 1575 861 853 437 128 22538 1892 ----
NM_013953chr262045 1575 861 853 437 128 22538 1892 ----
NM_013992chr262045 1575 861 853 437 128 22538 1892 ----
NM_014240chr363928 3878 3487 2943 2700 45 11566 176 --
NM_014564chr941028 159 72 49 --163 --
NM_014634chr2252650 1196 1167 629 402 13024 2365 274 12879
NM_014661chr10133736 3706 3469 3463 3313 3268 3055 2970 2874 2718 919 655 28 1456 63818 3699 1214 609 390 158 --
NM_014665chr872239 1380 1374 1063 504 394 286 13255 23301 227 --
NM_014690chr782548 2471 2442 2014 848 259 212 198 --12207 13080
NM_014730chr1254202 3337 2057 1750 457 25159 4583 11980 11966
NM_014730chr1254202 3337 2057 1750 457 25159 4583 11980 11966
NM_014743chr422288 491 12725 --11130
NM_014747chr145695 4702 1220 854 --33695 1663 396 1654
NM_014762chr161752 835 781 681 558 280 1938 12084 --
NM_014767chr1072985 2880 2356 2286 1133 1076 26 --43231 2256 886 115 23201 2296
NM_014772chr1853179 1396 506 379 40 11105 13529 23344 1325
NM_014798chr1731190 248 34 11244 31732 1406 746 11666
NM_014849chr161068 829 803 497 465 407 ------
NM_014877chr1756831 6152 5920 5604 1114 11414 ----
NM_014891chr771492 465 419 299 289 185 35 129 1130 --
NM_014921chr19112611 2387 2039 1963 1233 1092 1012 1002 834 369 53 1792 1166 22032 822
NM_014935chr1112983 2955 2839 2796 2423 1308 1021 572 331 249 153 --23171 1071 13264
NM_014952chr1551366 1346 459 249 22 1181 21333 49 --
NM_015008chr363381 2890 2862 2399 1241 482 ------
NM_015033chr9102514 2501 2274 1047 601 329 312 230 181 24 ----1716
NM_015035chr2086457 5896 5521 5471 2175 2149 1536 120 36221 4787 452 ----
NM_015063chr193986 199 111 --2450 39 2329 274
NM_015074chr174096 4046 3735 3230 1644 1326 736 ------
NM_015075chrX62222 2168 1932 1829 698 102 --1250 11857
NM_015077chr17134199 3836 3768 3700 3509 1782 1027 999 723 436 410 101 86 13382 ----
NM_015080chr115886 332 268 51 41 --1210 189
NM_015092chr1673568 3531 3493 1769 1687 421 109 ------
NM_015094chr22154224 4047 3792 3726 2938 1360 1002 971 964 692 680 468 114 96 44 14006 54343 3648 3259 2932 1623 11571
NM_015185chrX62860 2536 2050 2044 1929 839 12033 ----
NM_015194chr1751980 1802 633 241 49 ----1448
NM_015254chr8162603 2548 2496 2435 2158 1263 1239 1125 987 572 513 277 254 186 154 30 --21957 320 1898
NM_015260chr1991540 1438 1431 1417 1306 1078 639 443 71 11085 1219 --
NM_015284chr181959 1485 1464 1448 527 458 299 266 --11814 --
NM_015288chr563723 1550 1284 1048 866 424 --11018 --
NM_015374chr2261071 414 388 337 318 243 --11273 1599
NM_015375chr164371 1989 1939 946 896 628 14645 23853 3434 --
NM_015401chr124792 746 173 82 --1935 1773
NM_015537chr951102 1023 881 869 83 --3847 202 59 --
NM_015557chr193470 2911 2792 2460 2275 2212 1456 999 849 1478 42600 2269 1094 1047 --
NM_015609chr172790 2714 2549 2236 2165 958 49 ----1810
NM_015686chrX41586 1542 583 521 31897 1754 828 ----
NM_015726chr161611 1397 531 353 53 30 ------
NM_015872chr161799 1612 1366 1312 549 94 21658 41 21667 666 1283
NM_015898chr1981980 711 422 411 385 379 339 280 --32320 743 360 --
NM_015995chr15115177 5047 3893 3662 2171 1715 1684 1404 1385 862 788 24666 360 13463 --
NM_016022chr13416 187 74 --1423 1244
NM_016169chr10103201 3055 2909 2143 1294 1012 966 911 809 647 --23185 754 --
NM_016206chr357477 2688 2620 2531 1947 28077 7748 ----
NM_016255chr6169 ----1434
NM_016272chr222946 530 1935 --12613
NM_016418chr2263670 3162 1306 890 407 160 23807 691 22611 1153 --
NM_016422chr1133083 1196 1117 ----1699
NM_016564chr114970 378 324 219 1259 --1826
NM_016596chr124792 746 173 82 --1935 1773
NM_016605chr5292 80 --21925 23 1317
NM_016621chr1174208 4187 4143 3972 3464 3046 790 11239 11737 --
NM_016834chr1783911 3815 1062 988 702 383 365 165 --12772 --
NM_016835chr1783911 3815 1062 988 702 383 365 165 --12772 --
NM_016841chr1783911 3815 1062 988 702 383 365 165 --12772 --
NM_017436chr222247 84 ----2558 64
NM_017456chr1751803 1757 724 707 565 2511 185 1539 --
NM_017459chr14262 52 44 36 --1132 --
NM_017590chr2242254 872 527 219 2902 347 4894 428 355 33 --
NM_017592chr19101812 1762 1730 903 852 803 561 551 277 71 1919 --1872
NM_017650chr744274 4190 4061 1284 ----1938
NM_017709chr153916 3533 3175 1211 387 14201 13065 --
NM_017873chr932901 2489 574 32369 835 697 1400 12589
NM_017919chr955351 1049 776 201 166 --24172 969 11224
NM_018067chr12104 22 1466 1113 1414
NM_018208chr151034 774 744 367 296 --11123 1447
NM_018440chr856395 6345 5597 2645 22 ----1606
NM_018553chr1741830 1361 722 491 ----1599
NM_018667chr16112334 2055 1798 1780 1077 791 780 512 453 134 56 --22226 2113 11024
NM_019596chr213724 684 627 --22858 1901 --
NM_020039chr1231233 395 106 21418 582 --190
NM_020182chr2053150 2233 1315 1084 25 ------
NM_020184chr232077 632 388 ----12250
NM_020208chr352924 2851 2727 2354 2137 --12890 --
NM_020438chr961135 987 528 519 513 291 --3332 214 198 --
NM_020443chr175625 4606 2709 2110 1629 416 313 1324 16261 --
NM_020699chr154992 3941 3844 1594 1193 43671 2025 1439 1432 24380 3978 2722 299
NM_020713chr20142853 2846 2787 2572 2440 2234 2221 2031 1943 971 909 276 198 72 --2898 789 --
NM_020717chrX54937 4855 4250 1555 732 --11784 1182
NM_020772chr1728317 621 26627 6085 11531 --
NM_020795chr1761903 1847 1664 681 518 215 21451 636 ----
NM_020804chr682088 2050 1880 1751 700 658 199 191 1930 --21791 516
NM_020813chr1952034 918 700 469 303 2606 322 ----
NM_020845chr1271796 1757 1015 266 174 100 76 --11940 --
NM_020939chr651239 360 117 35 29 --11167 21274 547
NM_020946chr9111669 1588 1565 1523 1503 1484 1438 1321 616 511 201 1628 --1179
NM_020956chr19134331 4320 4311 4060 3958 3357 3116 1151 711 643 423 291 106 24245 3150 44380 3457 3025 635 11249
NM_020972chr471028 842 331 316 283 182 33 --2759 720 --
NM_021020chr873287 3149 2987 2617 889 794 111 129 1680 --
NM_021945chr662660 2428 1079 467 311 36 1377 121 --
NM_021977chr663284 3055 2806 628 519 260 ------
NM_022153chr10153603 3328 3219 3167 2912 2577 2510 2466 1378 1330 1210 883 603 506 41 12428 23116 2887 --
NM_022405chr352924 2851 2727 2354 2137 --12890 --
NM_022497chr372646 1425 1217 1051 750 558 25 ------
NM_022574chr772035 1701 837 622 530 184 25 --22064 1604 11459
NM_022719chr2283541 2949 2905 1095 488 266 151 98 --2316 86 --
NM_022833chr951147 1113 983 549 274 174 --1926
NM_023076chr1672337 1206 1156 1124 724 370 298 12353 22515 2500 --
NM_024086chr1763447 2864 2816 2784 1458 1177 1568 1833 --
NM_024117chr921001 155 21134 180 195 1144
NM_024423chr1831141 926 878 21193 1122 --11372
NM_024522chr161471 1435 452 298 63 37 21260 419 ----
NM_024541chr1041691 1322 1302 646 11269 21832 449 --
NM_024698chr1191298 1220 1068 1033 886 530 326 320 311 --21259 174 --
NM_024742chr16101845 1707 1550 1507 1462 1418 1315 1206 415 151 --11334 --
NM_024798chr1572465 2406 1183 1172 832 551 427 12377 12158 --
NM_024884chr1484193 1013 799 749 630 417 349 296 13206 ----
NM_024963chr7275521 5413 5394 5100 5058 4966 4847 4797 4517 3785 3742 3601 2354 2307 2228 1861 1749 1710 1565 1458 1300 1121 762 597 412 285 57 --55746 5566 315 229 135 25481 786
NM_025179chr154014 3835 3640 1953 24 21728 283 24008 239 21023 129
NM_025248chr1732263 1041 733 1822 23012 2867 21268 716
NM_030674chr1234424 4099 607 35389 3739 815 ----
NM_030884chr381808 1687 1496 358 229 208 200 121 --22017 313 --
NM_030964chr562969 2898 2691 1029 795 432 11304 22860 723 --
NM_031268chr16105176 4486 2142 1834 1814 1764 1710 1663 757 70 --24304 1790 --
NM_031309chr8102377 2091 1850 845 771 681 604 592 469 75 1560 2897 827 --
NM_031468chr777453 6374 5196 4992 2079 648 159 17872 11838 --
NM_031478chr166710 701 695 642 74 61 --1590 1155
NM_031483chr2053209 3000 2957 2353 828 1452 ----
NM_031844chr113435 ----12962
NM_031886chr1962303 2123 2073 2041 1710 77 ------
NM_031890chr2262801 2211 2204 2198 888 636 1544 1149 --
NM_032052chr222240 212 1424 2232 221 --
NM_032271chr1661377 1300 1178 1028 504 390 11508 21333 84 --
NM_032281chr1952850 935 728 165 35 1643 32891 2677 432 1203
NM_032294chr1731684 1362 399 3605 530 102 2596 323 --
NM_032421chr742060 1968 1378 383 21641 414 --1241
NM_032434chr2----1326 11593
NM_032538chr652689 1977 1738 837 760 21063 347 --1307
NM_032595chr1771394 569 429 418 390 365 193 --1519 199
NM_032711chr17114252 4091 4048 4037 3630 2763 1486 1316 1310 554 538 --13170 --
NM_032737chr1972602 2451 2333 2151 2003 1741 579 --32515 2295 455 1711
NM_032777chr851542 1215 1088 351 169 11488 3608 222 61 --
NM_032932chr17106297 5554 5339 4970 2119 1964 1842 1012 985 39 35267 1455 356 25810 2041 26434 5143
NM_033025chr193739 335 208 ----1216
NM_033290chrX32854 1455 954 23284 32 ----
NM_033420chr1981037 1015 396 289 215 181 133 92 --2467 198 21145 1109
NM_033449chr591885 1602 1583 1482 1378 738 496 370 271 1382 11397 --
NM_033626chrX31745 1475 577 1596 1626 1535
NM_052828chr641436 1219 1052 34 --1619 --
NM_052845chr1262969 2180 2124 1135 223 74 ----12863
NM_052906chr22194868 4543 3776 3764 3605 3421 3345 3188 1930 1888 1534 1425 905 816 361 352 304 289 44 24337 3663 42028 1492 787 94 34346 1865 1151
NM_053016chr946845 3195 3163 347 16164 27775 5226 --
NM_053279chr882720 1960 1151 851 773 270 175 114 ------
NM_054027chr552264 2214 2146 1972 1726 11540 1672 --
NM_080491chr1183541 3213 2717 1199 1022 758 342 163 --32998 2921 205 --
NM_080600chr194188 169 59 29 --1489 1106
NM_080607chr204368 279 262 230 174 3837 418 286 --
NM_080669chr1754023 3431 1870 1793 1294 23362 3354 44031 3679 3621 3142 1957
NM_130830chr373588 1109 1063 341 258 79 50 23771 27 21274 883 1237
NM_133444chr1951590 1463 1320 1270 708 163 ----
NM_138338chr22103371 2650 2356 2309 2092 1252 1175 1145 1078 770 --33112 1191 990 1897
NM_138370chr25659 606 313 295 98 --1642 1514
NM_138415chr2261766 1499 1186 584 282 244 11205 4554 535 273 63 --
NM_138444chr1354216 3151 480 445 354 ------
NM_138457chr671342 819 700 577 524 129 28 23265 121 43223 1355 1265 1211 --
NM_138732chr115886 332 268 51 41 --1210 189
NM_138734chr115886 332 268 51 41 --1210 189
NM_138795chr13643 546 272 1128 11577 11195
NM_138967chr1562358 2222 831 813 474 33 --12325 12260
NM_139279chr252948 2381 1277 1113 141 22204 337 ----
NM_144499chr351190 969 765 386 93 21161 864 1359 --
NM_144579chr252775 887 509 123 114 143 12494 --
NM_144588chr1061400 1272 1183 375 341 263 11344 11027 11452
NM_144671chr12111940 1927 1867 1803 1739 1666 1525 640 490 473 77 1571 1627 11550
NM_145175chr251216 902 571 140 134 11053 ----
NM_145185chr1981924 1250 806 518 489 295 164 97 1815 21812 196 --
NM_145296chr195599 291 42 36 30 --1673 1709
NM_145313chr1081325 1298 1208 1063 505 483 430 406 ----11283
NM_145349chr1771841 1578 654 381 316 211 34 --21466 766 1865
NM_145351chr17112333 2070 1736 1728 873 808 703 526 164 155 135 1219 21958 1686 --
NM_145804chr1141101 1060 389 63 1946 2398 276 --
NM_148960chr141921 1889 1345 1296 1510 31519 754 168 --
NM_152237chr22101342 1305 1224 1169 1096 467 294 237 178 101 21438 510 21403 695 11193
NM_152253chr22113755 3586 3430 3381 3157 3130 3109 1349 598 289 114 ----12773
NM_152263chr1165820 5650 5149 4778 4390 4263 4213 3828 3735 2226 1669 1538 1215 1165 1133 1006 ----151
NM_152529chr253312 3230 1470 1420 1281 ------
NM_152722chr117667 595 566 425 131 79 65 195 2113 54 1612
NM_152733chr6166304 5909 5899 5728 5476 4905 4111 2499 2221 2105 1793 1682 1533 1235 1159 38 21031 901 14422 --
NM_152734chr655303 4357 889 268 94 35268 5211 4882 --25180 872
NM_152742chr72461 133 --1219 174
NM_152793chr753793 3151 1323 607 70 11206 ----
NM_152924chr1586421 6173 5636 5554 5018 1644 1100 167 ----1688
NM_153273chr382562 2254 2002 1072 1022 966 620 374 ----12591
NM_172206chr1731684 1362 399 3605 530 102 2596 323 --
NM_173476chr16151982 1924 1792 1768 1554 1548 911 887 837 711 515 479 335 278 59 --21589 1442 --
NM_173595chr12105148 5022 4510 3984 1260 1211 1145 640 555 492 --44683 4607 3704 1803 34155 341 135
NM_173642chr198096 7914 6607 6537 6415 6298 6244 6090 2939 28304 7015 18120 --
NM_173832chr862704 2609 2533 2331 512 24 22430 2304 53283 2448 2321 807 550 1127
NM_174934chr1163292 1043 822 585 285 128 --21149 478 12894
NM_176792chr1011035 1448 --2523 158
NM_176871chr883255 3093 2766 2113 1043 634 254 92 1176 2335 53 --
NM_177999chr933464 3052 1137 32932 1398 1260 1963 13152
NM_178138chr941028 159 72 49 --163 --
NM_178539chr1221624 408 --11836 11560
NM_178568chr1781680 1619 1584 1463 1353 672 610 336 --1548 11557
NM_181351chr1152892 2341 2116 923 632 ----11971
NM_181712chr172021 1983 1955 1642 1592 1524 1333 ------
NM_181828chr2263670 3162 1306 890 407 160 23807 691 22611 1153 --
NM_181829chr2263670 3162 1306 890 407 160 23807 691 22611 1153 --
NM_181830chr2263670 3162 1306 890 407 160 23807 691 22611 1153 --
NM_181833chr2273610 3102 1507 1246 830 347 100 23747 631 22551 1093 --
NM_182526chr1442882 2861 2584 606 --12270 32808 869 27
NM_182970chr20174243 4157 4143 3755 3586 3285 3194 3187 3131 2823 2607 1464 1408 1267 1153 673 59 1981 33365 1361 1185 13529
NM_194278chr1493613 3171 1492 732 632 488 252 243 220 12983 11366 --
NM_194286chr1276102 5815 5525 1841 1722 1272 222 --46183 2356 2058 205 11863
NM_198291chr2051434 1372 315 309 42 --31936 1908 64 --
NM_198490chr393052 3044 2510 2381 2169 1318 398 90 26 --42883 2725 566 419 --
NM_198560chr363279 2863 2856 737 636 540 13191 42942 2536 1439 172 11422
NM_198679chr942510 2418 1051 986 12570 3865 514 443 1753
NM_198993chr1741707 1513 1315 624 1159 --2328 315
NM_199169chr2053150 2233 1315 1084 25 ------
NM_199170chr2053150 2233 1315 1084 25 ------
NM_199171chr2053150 2233 1315 1084 25 ------
NM_199262chr1751687 414 271 265 175 --51857 1638 536 374 36 --
NM_199462chr164371 1989 1939 946 896 628 14645 23853 3434 --
NM_201348chr193543 1449 945 831 779 548 466 326 48 23667 1567 11116 1409
NM_201432chr17126055 5732 5718 5692 4785 2038 1811 960 902 162 99 22 25550 36 35864 5490 4797 1756
NM_201433chr17126055 5732 5718 5692 4785 2038 1811 960 902 162 99 22 25550 36 35864 5490 4797 1756
NM_201520chr1781779 1729 733 645 530 410 194 71 ------
NM_201567chr361334 1125 672 396 296 118 ------
NM_203434chr97443 412 383 373 345 117 44 --3877 106 28 --
NM_207306chr144148 3275 1587 180 ----153
NM_207380chr1583402 3122 2587 1364 1153 570 430 283 123 --134