TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5589-3p
miRNA Sequence: UGCACAUGGCAACCUAGCUCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000070chr15------1535
NM_000084chrX76115 5994 5314 5149 4582 1642 571 35256 1444 1111 ----
NM_000104chr252300 1130 1019 833 149 22958 2238 ----
NM_000138chr1532019 324 233 --1207 1826
NM_000168chr752868 2039 712 401 130 33135 2945 316 23007 453 --
NM_000176chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_000189chr232371 2148 2123 1907 11462 --
NM_000216chrX3951 750 120 53850 2970 1231 526 39 22891 2494 11269
NM_000217chr1275030 4473 4426 3429 3397 3238 1352 ------
NM_000237chr861813 1796 1423 1301 324 36 11739 21730 1336 --
NM_000259chr1576349 4715 4304 4248 2321 892 297 24736 1775 --14778
NM_000264chr953367 2704 628 618 592 ----1199
NM_000297chr431766 828 21 22039 250 11791 11779
NM_000314chr1012931 33188 2598 325 11036 --
NM_000319chr121468 11195 ----
NM_000325chr42667 533 ------
NM_000330chrX12091 ----12159
NM_000332chr652814 2562 1816 1349 388 ----12779
NM_000343chr221284 1122 --1130
NM_000353chr16128 ------
NM_000362chr2213152 12531 --12515
NM_000368chr964073 4040 3479 3143 1024 970 1939 24578 111 --
NM_000408chr243177 2999 972 909 --2464 396 --
NM_000430chr1752929 2341 1147 942 455 3904 897 430 ----
NM_000462chr1541415 1310 458 186 11829 1735 --
NM_000538chr1341276 1146 733 130 2673 134 ----
NM_000555chrX47870 6675 6051 262 21783 1699 37729 5685 1684 --
NM_000574chr13906 841 135 11324 ----
NM_000619chr121429 ------
NM_000793chr1485107 5026 4852 3612 1098 989 476 228 44836 4667 4294 1834 23853 274 14378
NM_000794chr5----11071 1716
NM_000806chr531857 483 397 ----11947
NM_000813chr544573 4054 4024 3956 13432 15069 --
NM_000814chr1583822 3578 2657 1102 853 637 402 140 1192 1803 1228
NM_000826chr421777 288 12271 --12533
NM_000831chr163799 2421 2353 2120 1970 1749 42243 2223 2084 2066 22376 1945 34601 2365 1940
NM_000842chr111577 ------
NM_000859chr51627 ------
NM_000891chr1732938 1030 197 1414 --11024
NM_000899chr1274090 3463 2732 1299 1209 865 855 34314 4299 4293 ----
NM_000912chr843536 2447 1169 510 --22815 973 --
NM_000926chr1178271 7019 5772 2784 1945 1726 1503 --38664 3303 2995 --
NM_000938chr41179 ------
NM_001001323chr1222955 2304 --22511 1960 --
NM_001001396chr154378 4025 4006 1154 1104 12823 ----
NM_001001890chr2121385 795 13767 22664 1688 --
NM_001001924chr82777 105 22044 820 21497 448 --
NM_001001925chr82777 105 22044 820 21497 448 --
NM_001001931chr82777 105 22044 820 21497 448 --
NM_001001977chr20150 ------
NM_001001995chrX--180 --11357
NM_001002257chr223133 21 23484 3059 1930 --
NM_001002860chr1434145 1516 142 ----1419
NM_001003652chr18108619 8361 8071 7717 7440 2738 2201 1704 620 389 38606 7892 306 ----
NM_001003674chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_001003675chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_001003679chr132153 220 37 1177 ----
NM_001003712chr1252611 1629 1025 246 207 21029 712 --12498
NM_001003760chr622438 536 11413 --12454
NM_001003805chr141102 ------
NM_001004317chr634157 1805 393 33735 724 227 1232 --
NM_001004329chr123386 294 280 1272 ----
NM_001004419chr1274291 3563 3148 1824 1580 1361 405 13364 ----
NM_001005207chr17----184 --
NM_001005375chrY----11356 --
NM_001005473chr575104 4494 4487 4477 2352 1982 1235 ------
NM_001005476chr21506 ------
NM_001006681chrX----128 --
NM_001006682chrX----128 --
NM_001006683chrX----128 --
NM_001006933chrX------1192
NM_001007023chr1485107 5026 4852 3612 1098 989 476 228 44836 4667 4294 1834 23853 274 14378
NM_001007246chr2151372 591 569 493 318 1585 ----
NM_001007471chr9--1280 ----
NM_001008220chr5123830 3124 2802 1565 1484 1464 1453 1414 1358 1312 1279 1236 52963 2941 1556 1524 1221 ----
NM_001008225chr71776 ----1559
NM_001008239chr1822772 865 23656 3243 --1487
NM_001008540chr21191 ------
NM_001008564chr1342206 2013 1700 329 21786 488 11791 --
NM_001008726chr14----11479 --
NM_001009554chr464725 3244 3015 1173 767 239 ------
NM_001009554chr464725 3244 3015 1173 767 239 ------
NM_001009567chr101576 ----1507
NM_001009881chr1----1446 --
NM_001009882chr1----1446 --
NM_001009899chr355561 5485 4683 1195 660 ----165
NM_001010853chr622559 226 33269 2519 366 1831 --
NM_001010888chrX44560 1439 1343 1004 --13304 12982
NM_001010891chr576086 4644 2359 2093 673 542 418 36156 5010 342 12644 --
NM_001010898chr153003 2342 727 611 543 33735 2363 1137 23630 2536 23199 1148
NM_001010942chr1211294 ----1932
NM_001010971chr1------196
NM_001010986chrX2847 573 12348 1518 --
NM_001011513chr41891 24121 3455 ----
NM_001011666chr774847 3990 2460 1954 1852 845 696 14168 ----
NM_001011885chr1511586 ----135
NM_001012329chr11648 1901 22033 2025 22077 2059
NM_001012420chr1542120 747 471 407 2670 489 1354 --
NM_001012423chr1532120 747 471 2670 489 1354 --
NM_001012979chrX183 ----1192
NM_001013406chr711264 ----1662
NM_001013438chr32639 365 1972 ----
NM_001013620chr1268320 6642 6118 5885 1645 453 22643 2408 ----
NM_001013703chr15------1460
NM_001013746chr742363 2066 2056 70 11912 ----
NM_001014286chr13190 ------
NM_001014380chr1355808 4049 3886 2113 776 11980 11335 --
NM_001014797chr1056806 6528 6184 2060 492 ----15575
NM_001017963chr14----1893 --
NM_001018065chr9105703 5528 5091 4138 925 905 884 853 707 187 24432 919 22355 739 --
NM_001018066chr9105703 5528 5091 4138 925 905 884 853 707 187 24432 919 22355 739 --
NM_001018074chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_001018075chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_001018076chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_001018077chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_001018100chr15----1835 --
NM_001024094chr563293 2780 2488 1288 269 145 33674 2590 1380 ----
NM_001024401chr1652869 2487 2479 2471 665 11118 22820 1139 --
NM_001024660chr311438 ------
NM_001024948chr133387 2237 124 22549 937 128 --
NM_001024956chr1175328 3555 1904 1892 1642 1032 772 --14704 --
NM_001025076chr1086049 5966 1697 1170 1024 930 421 209 --25624 2420 --
NM_001025077chr1087407 7324 2528 2382 2288 1779 1567 1276 1383 16982 --
NM_001025108chr274135 4031 3634 2579 1544 194 164 23657 1101 1153 13419
NM_001025201chr21565 ------
NM_001025232chr121125 ------
NM_001025356chr1232206 472 276 42155 1031 839 78 12737 --
NM_001025580chrX94238 3663 3513 3416 3184 2738 2679 1500 964 23371 423 ----
NM_001025616chr4--2219 161 11487 --
NM_001025780chr911601 ------
NM_001030001chr141433 ------
NM_001030007chr1613209 ------
NM_001030055chr1454519 1125 1003 410 178 11394 ----
NM_001031684chr21576 11428 ----
NM_001031695chr2224656 3291 --14037 15355
NM_001031709chr102325 135 ----129
NM_001031716chr2--1943 11158 123
NM_001033506chr111321 ------
NM_001033557chr241456 1281 363 348 ------
NM_001033953chr11--154 ----
NM_001034954chr1043227 2702 2200 197 ------
NM_001034955chr1043227 2702 2200 197 ------
NM_001034956chr1043227 2702 2200 197 ------
NM_001034957chr1043227 2702 2200 197 ------
NM_001035521chr2----1779 --
NM_001037131chr221096 1022 11206 ----
NM_001037132chr7--1727 ----
NM_001037133chr7--1727 ----
NM_001037164chr7--11692 ----
NM_001037165chr798904 8157 7608 3583 2991 2870 2571 2080 332 13052 17941 --
NM_001037174chr221866 1392 12102 11928 --
NM_001037494chr121284 ------
NM_001037495chr121284 ------
NM_001039590chrX63901 3705 3043 3002 1328 977 1226 ----
NM_001039591chrX63901 3705 3043 3002 1328 977 1226 ----
NM_001039618chr1165551 5420 4511 3827 505 188 24540 4202 ----
NM_001039693chr263809 3415 2946 2655 1271 287 --13796 13761
NM_001039762chr10----1578 11730
NM_001039840chrX65274 4841 4677 3799 1755 1637 35129 1736 234 --12226
NM_001039888chr11819 --2146 105 --
NM_001040020chr71573 3293 113 76 --11476
NM_001040101chr441316 1262 1190 28 11392 21507 1406 --
NM_001040110chr751502 651 295 285 270 1321 11481 --
NM_001040142chr25802 706 456 327 61 --1403 --
NM_001040143chr25802 706 456 327 61 --1403 --
NM_001040152chr711223 1565 13335 23535 664
NM_001040284chr1644377 2223 1798 1075 22004 1546 11084 --
NM_001040429chr1373102 2710 2657 2416 2365 1301 1000 21366 978 ----
NM_001040441chr155486 4759 3588 1098 189 ------
NM_001040450chr1512454 12271 ----
NM_001040453chr1512454 12271 ----
NM_001040709chr121974 533 --1583 11579
NM_001040712chr943329 2326 1385 377 32692 2319 1275 ----
NM_001042355chr1664463 3533 3433 1965 1651 362 11155 ----
NM_001042412chr1664463 3533 3433 1965 1651 362 11155 ----
NM_001042414chr131218 ------
NM_001042517chr13----2674 306 --
NM_001042537chrX42280 1707 371 44 2842 99 ----
NM_001042555chr1274386 3669 3348 3137 947 597 432 33245 1922 1823 --1133
NM_001042603chr1245290 3856 3839 316 34965 4951 4071 23645 3266 --
NM_001042604chr364654 3352 1098 1091 958 515 31615 200 110 ----
NM_001042669chr4--2219 161 11487 --
NM_001042749chrX11990 11620 --11347
NM_001042750chrX11990 11620 --11347
NM_001042751chrX11990 11620 --11347
NM_001044385chr213272 13885 --22835 87
NM_001046chr542381 2219 626 497 22276 2016 ----
NM_001071775chr1321649 191 2373 321 ----
NM_001083620chr421775 287 12269 --12531
NM_001100108chr148056 5311 1044 117 38098 5968 1772 --1267
NM_001101662chr1--136 ----
NM_001106chr3139380 9195 8947 7011 6559 6350 6254 3394 3203 2685 2160 1383 560 --13112 --
NM_001113490chrX63566 423 362 302 225 163 23253 1229 23498 2399 13282
NM_001126chr1--1787 ----
NM_001128chr1613209 ------
NM_001148chr4--12221 ----
NM_001150chr15----150 --
NM_001167chrX56608 5472 5328 1382 54 25485 274 ----
NM_001173chr1454519 1125 1003 410 178 11394 ----
NM_001198chr642263 1839 666 611 22405 670 ----
NM_001204chr246875 6238 1382 266 25895 512 11858 --
NM_001277chr113957 426 385 1708 --1131
NM_001278chr10163 ------
NM_001315chr642068 2012 770 126 1157 3745 162 136 --
NM_001379chr19----196 --
NM_001427chr731670 1367 1307 11694 --11977
NM_001444chr81199 ------
NM_001482chr15--3949 849 252 ----
NM_001483chr741053 955 669 21 11009 ----
NM_001514chr1--1483 ----
NM_001521chr2----1779 --
NM_001616chr252775 2769 2152 906 504 ----12543
NM_001621chr732814 1165 800 22793 1068 ----
NM_001621chr732814 1165 800 22793 1068 ----
NM_001635chr7----1148 --
NM_001684chr154095 3742 3723 871 821 12540 ----
NM_001695chr843240 860 439 46 1221 11463 --
NM_001706chr3--3779 385 240 ----
NM_001729chr4175 --1370 --
NM_001754chr2121385 795 13767 22664 1688 --
NM_001792chr181241 ----1764
NM_001798chr1211148 ----11010
NM_001822chr21565 ------
NM_001827chr9--150 ----
NM_001830chrX63428 3403 3305 2936 301 258 23533 1435 23349 2471 13636
NM_001858chr631843 1549 360 21911 1031 ----
NM_001880chr2--1256 ----
NM_001946chr12132 --1327 1246
NM_001966chr341490 1289 309 171 11532 ----
NM_001968chr41257 1950 ----
NM_002006chr445758 3898 2066 750 32243 296 90 11685 --
NM_002025chrX119119 8290 8271 7895 7080 6460 5668 3671 3301 2713 2396 39077 2627 784 19067 18308
NM_002033chr1114069 ------
NM_002040chr2132661 2562 2028 31079 292 195 1462 --
NM_002069chr751680 1660 1388 1311 596 ------
NM_002077chr911415 ------
NM_002078chr3----134 --
NM_002111chr452795 1511 628 263 154 1448 23521 2896 12347
NM_002126chr1793956 3931 3667 2669 1271 969 196 164 153 1138 33941 203 179 --
NM_002136chr12------2675 149
NM_002139chrX1228 ------
NM_002158chr233042 518 234 13275 --1893
NM_002160chr91409 ------
NM_002214chr735031 408 199 --1592 13836
NM_002253chr421231 193 ------
NM_002254chr242124 1950 1933 1925 1120 4111 105 95 89 --
NM_002264chr343622 1744 1508 640 ------
NM_002270chr555432 4762 2120 2050 1223 ----11675
NM_002271chr1322245 360 ------
NM_002285chr274135 4031 3634 2579 1544 194 164 23657 1101 1153 13419
NM_002310chr576184 5597 5095 4114 2566 2352 904 24825 4058 36268 4090 154 1366
NM_002336chr1243734 3461 1414 1316 1664 14036 11681
NM_002375chr3--12203 --21846 1671
NM_002395chr611456 ------
NM_002397chr552090 771 101 94 52 ----12041
NM_002438chr101576 ----1507
NM_002515chr1422055 159 1142 ----
NM_002518chr2--11133 ----
NM_002522chr1763436 1439 1194 787 333 306 11403 1320 --
NM_002525chr1--136 ----
NM_002572chr11--1260 ----
NM_002577chr343850 1406 620 387 --23090 278 --
NM_002581chr945370 4974 3777 322 1246 --11809
NM_002591chr20--2438 405 1412 --
NM_002594chr2031927 1804 226 31936 1877 1808 21864 1813 --
NM_002595chr1241632 713 614 394 ----11495
NM_002643chr2--160 ----
NM_002646chr112067 --11537 1710
NM_002655chr835293 4050 3976 23313 39 --14622
NM_002687chr1441297 877 375 202 ----11055
NM_002698chr191991 --11004 --
NM_002709chr253040 2285 1127 820 169 167 ----
NM_002713chr1--11030 194 --
NM_002729chr102817 554 1777 ----
NM_002736chr742025 504 335 69 12198 12113 --
NM_002748chr1531151 163 44 11008 1483 --
NM_002750chr10148 ------
NM_002752chr5--1480 ----
NM_002833chr1541357 580 558 208 31501 538 528 --1135
NM_002836chr201162 ------
NM_002839chr943329 2326 1385 377 32692 2319 1275 ----
NM_002845chr18--1493 1632 --
NM_002851chr71163 ------
NM_002880chr3------1777
NM_002890chr51121 1977 ----
NM_002899chr3144 ------
NM_002912chr61892 2846 264 ----
NM_002951chr20--1271 ----
NM_002959chr174390 4262 4139 3867 3146 979 826 --34214 4097 673 --
NM_002967chr191167 ------
NM_002968chr161785 ------
NM_002970chrX--1288 ----
NM_003010chr173802 693 576 12276 --1109
NM_003030chr341923 1518 1235 593 ------
NM_003034chr1297854 7037 6001 3070 2516 2421 1580 1251 56 --17620 --
NM_003038chr252661 2494 2205 1770 1727 12455 22197 2178 --
NM_003043chr363601 3138 1519 178 157 145 13647 --13275
NM_003112chr712889 33137 2720 942 1295 --
NM_003113chr21161 ------
NM_003150chr1721902 228 12301 ----
NM_003178chr342058 715 632 461 22265 802 21912 887 --
NM_003182chr71510 --1172 --
NM_003182chr71510 --1172 --
NM_003184chr81191 --1998 1320
NM_003199chr1875512 5197 4861 4571 4457 4384 1976 21194 253 14165 1965
NM_003216chr2253259 3102 2036 800 624 ----12625
NM_003236chr243418 1286 703 94 23512 287 1314 --
NM_003247chr631936 1687 252 1351 11904 21357 667
NM_003253chr212509 29 1437 ----
NM_003262chr325249 1854 24816 427 25243 3442 --
NM_003269chr6--1112 ----
NM_003275chr92354 39 --11132 --
NM_003298chr376038 4884 3955 2045 1545 1321 350 54103 1245 593 442 87 24057 1724 --
NM_003299chr12------1240
NM_003336chrX2434 53 ------
NM_003338chr1041655 1556 349 134 1714 ----
NM_003340chr441320 1133 1065 284 ----1277
NM_003373chr1021801 191 11537 ----
NM_003385chr22972 296 1245 --1167
NM_003392chr3----12960 --
NM_003400chr23635 130 60 ----1548
NM_003403chr14--1821 ----
NM_003405chr22----1709 --
NM_003423chr1941671 1040 1030 224 12432 ----
NM_003458chr363954 3677 3659 3317 2775 613 13635 13652 13586
NM_003463chr673326 3162 2145 1352 1175 433 231 11131 ----
NM_003467chr21191 ------
NM_003469chr2--1191 ----
NM_003472chr61153 11053 --1533
NM_003474chr1022180 347 ------
NM_003478chr1113220 ------
NM_003528chr111099 11760 11745 --
NM_003590chr253696 3563 3257 370 246 1727 11184 --
NM_003591chr101303 ------
NM_003592chr71421 ------
NM_003597chr211603 ----12284
NM_003615chr363334 3189 3171 2921 101 50 ------
NM_003628chr21506 ------
NM_003629chr163386 3256 3206 2936 2175 1039 22209 1367 32981 2908 1238 --
NM_003631chr1011020 1102 --1151
NM_003657chr203790 284 47 ------
NM_003672chr121758 1748 --11806 --
NM_003677chr1241992 1867 1852 1414 11707 1155 --
NM_003746chr121284 ------
NM_003762chr111200 21038 82 ----
NM_003794chr32925 839 2994 815 ----
NM_003799chr182979 401 21174 112 --1184
NM_003822chr111959 --11136 12362
NM_003829chr93928 876 868 --11097 --
NM_003831chr1861825 1814 497 352 271 152 --1143 --
NM_003885chr1742594 2469 2407 82 22575 2074 11817 --
NM_003887chr211535 ------
NM_003895chr2122110 1748 4469 157 138 83 ----
NM_003909chr843040 2820 1226 31 ----12926
NM_003913chr633972 3689 1218 33201 513 411 1634 11705
NM_003924chr421615 373 ----11662
NM_003927chr18------1711
NM_003947chr321365 529 ------
NM_003948chr422404 2393 42019 630 437 304 ----
NM_003953chr11648 1145 12286 --
NM_003955chr171185 ------
NM_003966chr597833 6098 3060 1631 1521 1379 1055 707 304 17678 17228 --
NM_003971chr171112 ------
NM_003994chr1274090 3463 2732 1299 1209 865 855 34314 4299 4293 ----
NM_004061chr5--1235 ----
NM_004081chrY----11356 --
NM_004093chr1332226 2218 2018 2932 468 1283 12253
NM_004113chr31434 ------
NM_004124chr1443115 2933 2709 783 1908 ----
NM_004171chr1157600 7474 2847 2560 882 28905 2626 19064 --
NM_004232chr1811089 2244 120 --1351
NM_004236chr152488 97 ------
NM_004263chr231714 1551 396 11440 --1575
NM_004272chr521868 1706 11579 ----
NM_004274chr144836 743 203 170 ------
NM_004326chr1----1312 --
NM_004329chr1031006 519 467 ----11089
NM_004338chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_004349chr811138 ------
NM_004367chr611774 --130 --
NM_004411chr72503 159 ----1559
NM_004428chr11781 ----1643
NM_004430chr862380 571 554 531 521 508 1888 ----
NM_004438chr242478 1318 998 919 22852 2811 12638 --
NM_004440chr631719 1334 395 ------
NM_004449chr2111008 --21439 532 --
NM_004458chrX21844 1806 11668 ----
NM_004459chr17------1583
NM_004464chr4114331 4239 4113 4065 4048 3957 3131 2955 1184 722 528 24335 700 34340 4074 3944 --
NM_004491chr1964347 4022 4003 3053 2742 1066 11060 11038 --
NM_004503chr121102 ------
NM_004504chr231961 352 38 2911 157 --12081
NM_004512chr9----2252 242 --
NM_004523chr10--11217 ----
NM_004529chr9--1322 ----
NM_004612chr941361 1065 842 182 21220 233 11893 --
NM_004615chrX--1650 ----
NM_004673chr111279 1197 ----
NM_004684chr4------1349
NM_004719chr1212178 2511 247 ----
NM_004726chrX45536 4621 1431 1071 13927 13965 12204
NM_004730chr532037 1998 504 11650 ----
NM_004734chr1323165 2407 --13091 11249
NM_004736chr142277 1888 1550 438 ------
NM_004738chr2042583 2229 856 583 11926 22029 1978 179
NM_004748chr1574126 3916 3076 2558 1563 649 520 12735 ----
NM_004776chr2032041 1306 1159 32970 2755 2542 43300 2835 2770 929 --
NM_004779chr51969 ------
NM_004796chr1452304 2028 1987 802 568 ----12293
NM_004798chr2032499 1400 1391 23657 1458 ----
NM_004834chr22829 522 1118 1130 2798 729
NM_004874chr81375 ----1447
NM_004898chr41799 11836 --1671
NM_004904chr774847 3990 2460 1954 1852 845 696 14168 ----
NM_004912chr711264 ----1662
NM_004938chr9--1412 ----
NM_004953chr31119 ------
NM_004992chrX107700 7547 7394 6904 6501 5952 2445 2169 1973 349 17554 26958 6111 --
NM_004992chrX107700 7547 7394 6904 6501 5952 2445 2169 1973 349 17554 26958 6111 --
NM_005010chr7--1727 ----
NM_005011chr751502 651 295 285 270 1321 11481 --
NM_005045chr73217 43 37 ------
NM_005056chr1245534 4100 4083 560 35209 5195 4315 23889 3510 --
NM_005097chr10--1238 --1314
NM_005114chr4------1568
NM_005126chr341670 825 745 83 22083 72 ----
NM_005156chr944068 1768 1065 1053 13730 13694 --
NM_005160chr2246381 5418 4467 993 24509 781 --11822
NM_005188chr1198080 7040 3302 3275 2539 2382 976 395 367 16708 16243 1569
NM_005192chr14------1113
NM_005197chr1485227 5181 5062 4366 4038 3980 3759 1958 24823 1687 15687 --
NM_005221chr7------1117
NM_005225chr202254 236 3315 273 213 3365 347 266 --
NM_005238chr1142954 2186 823 296 12231 12236 --
NM_005257chr1821206 949 --2412 345 11363
NM_005261chr82361 246 --1263 --
NM_005279chr2141 ----1797
NM_005284chr61442 ----1201
NM_005295chr7------1217
NM_005308chr10----1441 --
NM_005316chr11----1836 1276
NM_005348chr14----1893 --
NM_005359chr18106232 5741 5207 4344 4331 2436 1624 471 465 128 ----11491
NM_005387chr111671 ------
NM_005398chr1031476 1337 364 11221 11330 --
NM_005400chr211243 23069 2883 12055 12232
NM_005402chr711456 --21620 679 11676
NM_005436chr1032956 805 643 33637 1340 293 24114 3642 --
NM_005494chr71649 ------
NM_005497chr1746122 5995 1220 614 36002 4566 531 25030 1757 --
NM_005504chr1244673 2589 2018 130 15784 14405 --
NM_005509chr531526 1180 591 1208 1671 --
NM_005519chr10------1121
NM_005522chr7----1497 --
NM_005527chr6----1378 --
NM_005569chr2241469 1383 1303 572 ----11164
NM_005578chr334947 4093 3442 --23999 3306 --
NM_005596chr923899 1644 24837 1384 11045 --
NM_005613chr12529 434 31906 623 456 22160 134 --
NM_005638chrX31372 642 63 21688 365 11356 --
NM_005660chrX1243 ------
NM_005665chr134857 636 307 2977 236 1995 11281
NM_005668chr533966 3758 3528 14033 14003 --
NM_005725chr132299 2128 2043 --2702 212 --
NM_005734chr111160 ------
NM_005738chr7--11692 ----
NM_005751chr7--1324 ----
NM_005752chr1611157 ----1219
NM_005756chrX11162 --1425 --
NM_005759chr264704 3985 3191 1035 783 709 14183 ----
NM_005776chr141702 ------
NM_005779chr553625 3116 3007 2665 494 22848 2789 ----
NM_005789chr1721721 164 31725 638 265 11526 12000
NM_005802chr9--1570 ----
NM_005828chr1764426 4197 1478 1430 1403 275 --24484 1838 --
NM_005832chr32918 900 31467 1015 965 ----
NM_005839chr1173 1629 ----
NM_005840chrX137135 7019 6153 5636 4872 2877 2866 2467 2066 1967 832 824 423 11958 15891 14854
NM_005863chr1011172 153 ----
NM_005871chr101720 11054 ----
NM_005885chr511530 31066 261 212 1630 --
NM_005895chr1294144 3980 3531 3431 3392 3368 2649 1471 1402 1507 23513 1583 --
NM_005898chr1152819 2566 2406 1182 1048 12173 ----
NM_005901chr18108619 8361 8071 7717 7440 2738 2201 1704 620 389 38606 7892 306 ----
NM_005905chr13------1100
NM_005924chr751150 1101 392 268 235 ----1405
NM_005935chr475198 5129 4658 4102 1876 1695 998 15016 24679 1363 --
NM_005940chr221696 ------
NM_005941chr843917 3156 1610 1190 ----12893
NM_005955chr184947 4795 3879 3761 3518 1117 426 276 34730 3737 719 --1305
NM_005985chr201658 ------
NM_006036chr242182 1747 473 124 11594 ----
NM_006047chr2031339 935 861 22667 2628 ----
NM_006060chr754420 3961 2778 1177 485 --11278 13492
NM_006080chr762773 2658 2505 1127 764 101 ----12387
NM_006094chr82466 414 1244 ----
NM_006133chr111555 --1589 --
NM_006154chr1531877 698 186 12075 1412 12186
NM_006166chr1212497 ------
NM_006194chr14--1388 --1350
NM_006203chr575534 5035 4227 2111 1299 1002 985 --13679 1952
NM_006206chr412845 1693 ----
NM_006212chr195400 5390 4554 4412 4355 4291 815 451 162 15370 ----
NM_006256chr122262 1774 22187 976 ----
NM_006265chr831366 1258 1112 1272 --163
NM_006267chr21156 ------
NM_006281chr81899 21170 834 ----
NM_006281chr81899 21170 834 ----
NM_006287chr232467 2001 511 --2966 611 11053
NM_006298chr632964 2395 2336 22140 537 --12154
NM_006300chr191349 22252 45 ----
NM_006306chrX85558 5019 4441 3929 2182 2073 1596 333 14540 1356 --
NM_006313chr1211186 11702 --1422
NM_006315chr463641 3300 3106 2785 755 92 14162 23813 1027 --
NM_006320chr421097 1087 ------
NM_006343chr2--1198 ----
NM_006359chrX42280 1707 371 44 2842 99 ----
NM_006380chr1733733 1497 410 13395 12828 1209
NM_006407chr331287 445 231 2880 522 1410 --
NM_006420chr2032522 2108 675 13225 11114 --
NM_006434chr1043227 2702 2200 197 ------
NM_006451chr5--1192 ----
NM_006457chr41891 24121 3455 ----
NM_006460chr173615 439 191 ----174
NM_006467chr522261 270 11472 1818 --
NM_006489chr1422055 159 1142 ----
NM_006504chr1042634 2557 513 326 12772 12585 --
NM_006527chr4--1693 176 --
NM_006544chr1455822 5639 2237 2231 956 15832 15837 15923
NM_006546chr1756172 1623 1598 1494 59 --35131 4876 1035 --
NM_006557chr9--21705 1379 --1424
NM_006559chr1------11170
NM_006561chr1086049 5966 1697 1170 1024 930 421 209 --25624 2420 --
NM_006595chr111743 1708 --11517
NM_006599chr1687830 5344 2885 1939 1719 1495 1480 1446 26170 564 ----
NM_006601chr1211118 ------
NM_006603chrX11990 11620 --11347
NM_006628chr154794 588 155 132 --13715 1686
NM_006650chr5123830 3124 2802 1565 1484 1464 1453 1414 1358 1312 1279 1236 52963 2941 1556 1524 1221 ----
NM_006654chr1274386 3669 3348 3137 947 597 432 33245 1922 1823 --1133
NM_006667chrX31178 280 178 1343 ----
NM_006696chr51294 1214 ----
NM_006699chr132312 963 230 22662 210 ----
NM_006717chr952933 2578 2569 1250 414 33416 3287 3184 12389 --
NM_006729chrX1217 71826 1117 1107 350 241 143 74 ----
NM_006734chr62545 403 --11506 11489
NM_006738chr1534442 4324 3736 43645 1346 705 687 --22946 1096
NM_006750chr1667799 7714 7297 5048 2783 856 28050 1628 26149 2566 --
NM_006761chr17--1776 ----
NM_006769chr1----168 --
NM_006805chr5--1629 ----
NM_006807chr17----21293 400 --
NM_006813chr63688 305 21 1192 ----
NM_006827chr1453191 2455 2129 1202 701 1660 --1691
NM_006852chr1762192 1929 1799 1767 1043 767 ----12180
NM_006873chr241344 1223 628 230 --21371 185 --
NM_006884chr341923 1518 1235 593 ------
NM_006886chr20150 ------
NM_006898chr2--1508 ----
NM_006908chr7----11137 --
NM_006914chr92490 63 ----1433
NM_006918chr1175328 3555 1904 1892 1642 1032 772 --14704 --
NM_006920chr221399 442 12055 1430 --
NM_006924chr1754222 3472 1574 801 778 33286 3067 1299 1354 --
NM_006931chr1222008 1893 31479 1443 548 1538 --
NM_006996chr121776 61 21809 101 ----
NM_007007chr12--51506 846 785 441 292 11267 --
NM_007008chr2----1182 1642
NM_007034chr11786 199 ----
NM_007036chr53804 237 196 ------
NM_007038chr2186059 5386 4699 1930 1614 1591 1331 794 1169 --25106 4110
NM_007040chr1911045 ------
NM_007064chr311438 ------
NM_007078chr1012915 23090 3007 13027 1892
NM_007175chr843500 869 549 447 1873 2939 527 --
NM_007191chr12----164 --
NM_007200chr1534442 4324 3736 43645 1346 705 687 --22946 1096
NM_007214chr6--11148 ----
NM_007217chr31262 ------
NM_007246chr42724 346 --1984 --
NM_007249chr1358881 8665 8187 6440 2033 28309 3049 16354 17488
NM_007358chr142035 777 626 614 ----1586
NM_012081chr573355 2501 1298 1281 765 751 365 53449 1045 769 545 392 ----
NM_012092chr241556 1409 1298 254 11634 --11620
NM_012096chr333654 3631 2724 22761 494 11318 --
NM_012097chr221866 1392 12102 11928 --
NM_012098chr931456 583 387 1349 --1322
NM_012111chr14--1192 ----
NM_012164chr957435 6996 5712 4853 4838 26041 879 --16944
NM_012197chr9170 ------
NM_012199chr154394 4371 3035 1660 308 --14406 13803
NM_012214chr245754 5355 2452 1749 1805 --16389
NM_012234chr32659 251 --12929 13674
NM_012262chr165228 4149 3680 3350 1363 920 ------
NM_012287chr354276 2926 546 487 426 1739 ----
NM_012325chr2021400 1320 --151 --
NM_012330chr10----11309 --
NM_012342chr101188 ------
NM_012382chr533841 3036 513 23288 554 --14421
NM_013232chr52428 144 --2383 286 --
NM_013261chr4103534 3418 2705 1037 373 361 340 326 310 293 23749 302 12723 --
NM_013262chr611294 ------
NM_013269chr1274218 3490 3075 1751 1507 1288 332 13291 ----
NM_013330chr1170 ------
NM_013348chr1911283 ------
NM_013368chr19----1156 --
NM_013447chr1963748 3559 3227 2771 488 201 1723 --11269
NM_013448chr14----1271 --
NM_013958chr82427 71 ------
NM_013959chr82427 71 ------
NM_013961chr82427 71 ------
NM_013962chr82427 71 ------
NM_013989chr1485107 5026 4852 3612 1098 989 476 228 44836 4667 4294 1834 23853 274 14378
NM_013996chr71510 --1172 --
NM_013996chr71510 --1172 --
NM_013997chr71510 --1172 --
NM_013997chr71510 --1172 --
NM_013998chr71510 --1172 --
NM_013998chr71510 --1172 --
NM_014000chr1021801 191 11537 ----
NM_014011chr222374 2208 22074 769 --147
NM_014034chr61204 ------
NM_014043chr341605 1371 589 434 41297 1165 1115 236 ----
NM_014048chr1625212 1259 15216 23784 1703 --
NM_014071chr20136 ------
NM_014089chr1342206 2013 1700 329 21786 488 11791 --
NM_014110chr1--11030 194 --
NM_014112chr814947 11701 14585 13722
NM_014154chr31361 11560 1217 --
NM_014155chr1135776 2128 1170 15245 --17286
NM_014176chr1133 ------
NM_014231chr1232171 1767 463 11985 1712 11971
NM_014264chr4--1406 ----
NM_014282chr9--1262 ----
NM_014292chr2211855 ------
NM_014293chr2264076 3486 3274 2520 1130 1000 --14043 --
NM_014309chr2224646 3281 --14027 15345
NM_014313chr131573 1035 368 ------
NM_014317chr101254 ----186
NM_014319chr1261600 1502 1326 703 695 678 31903 1656 541 ----
NM_014325chr1232017 1823 254 11580 1845 --
NM_014331chr487498 7491 6860 6415 2360 1665 1655 289 15687 27666 5231 --
NM_014352chr11--11535 ----
NM_014363chr13138 ------
NM_014372chr132028 770 719 --11338 --
NM_014382chr321747 1253 --21136 522 --
NM_014392chr441316 1262 1190 28 11392 21507 1406 --
NM_014423chr564635 3572 1419 1079 702 663 35496 5355 3683 1131 --
NM_014445chr32901 293 --1136 11836
NM_014500chrX------190
NM_014577chr22--1375 ----
NM_014615chr162872 114 --11233 11247
NM_014644chr11872 11005 ----
NM_014670chr2----165 --
NM_014682chr832132 1818 1500 22145 1444 --11461
NM_014686chr1922449 2114 12041 32440 2430 1006 1785
NM_014701chr1522776 511 22980 2545 ----
NM_014702chr61367 21171 291 2318 302 --
NM_014705chr731822 1595 336 11494 12047 --
NM_014706chr1241237 923 818 97 2858 801 1388 --
NM_014720chr1021712 1179 --11555 --
NM_014721chr646862 6523 1006 94 ------
NM_014730chr1231716 1647 472 --1637 --
NM_014730chr1231716 1647 472 --1637 --
NM_014732chr1665532 4552 3961 1711 1545 666 --2203 42 15844
NM_014735chrX21526 398 --11605 11586
NM_014736chr15176 ------
NM_014738chr171740 ------
NM_014746chr22693 104 1565 12686 13756
NM_014751chr812142 ------
NM_014755chr224025 2857 33867 2984 718 21393 923 23129 338
NM_014758chr11----2585 360 11834
NM_014765chr172567 2306 836 707 596 514 506 --12238 --
NM_014766chr743649 3547 652 106 ----13445
NM_014767chr1053500 2928 1155 242 210 23365 137 53506 2800 203 191 147 --
NM_014781chr81900 ------
NM_014786chr111244 1412 1114 1329
NM_014819chr532303 699 658 1980 --21621 69
NM_014841chr6--1141 ----
NM_014847chr11525 ------
NM_014873chr154694 1919 1849 1067 609 161 12994 177
NM_014877chr1787704 6416 6284 5720 4991 1963 588 196 ----1879
NM_014888chr71573 3293 113 76 --11476
NM_014901chr512091 12169 ----
NM_014903chr1232086 1811 620 12437 ----
NM_014904chr1043770 2566 983 606 13418 1536 --
NM_014905chr232052 2017 620 ----171
NM_014906chr1752653 794 395 229 90 12951 21479 1187 --
NM_014914chr221096 1022 11206 ----
NM_014918chr1521438 1087 11224 11372 --
NM_014920chr622897 426 42467 787 454 86 13015 --
NM_014947chr152915 1942 1931 1914 887 32892 2300 358 12777 --
NM_014970chr1------123
NM_014974chr1041632 1123 573 430 --11139 --
NM_014988chr452674 2428 2179 1043 303 ----12020
NM_014990chr14------11224
NM_014992chr144237 150 134 125 ------
NM_014996chr31293 1249 1141 --
NM_014997chr74889 707 522 78 11147 --12422
NM_014999chr1211621 ------
NM_015001chr12760 661 ------
NM_015017chr111058 1167 145 --
NM_015020chr1653844 3132 2792 1498 1228 13136 12975 --
NM_015026chr1264172 1367 1113 741 645 315 ------
NM_015071chr5116497 6484 5807 5795 5016 4460 4271 2274 2221 1939 1483 ------
NM_015076chr643721 3593 675 646 --1223 --
NM_015093chr611746 1609 --11248
NM_015094chr2271087 1077 1065 1057 1043 1034 939 24654 407 1414 11256
NM_015120chr21268 ----1111
NM_015149chr121596 1390 1138 12223 21407 293
NM_015170chr842235 2182 1985 923 1938 11436 --
NM_015192chr2053005 2502 738 227 186 12458 32652 1073 180 --
NM_015198chr721118 218 11137 1205 --
NM_015215chr132264 537 363 11205 --1827
NM_015216chr521431 76 ----1244
NM_015239chr92417 152 ------
NM_015247chr1664463 3533 3433 1965 1651 362 11155 ----
NM_015267chr121667 ------
NM_015268chr3--1704 ----
NM_015269chr1----1446 --
NM_015271chr41990 ----14297
NM_015272chr161505 ------
NM_015310chr886737 6212 5727 2129 931 922 915 442 26632 3218 1802 26307 548
NM_015313chr1154859 4151 3964 647 636 ----13603
NM_015326chr1------1533
NM_015336chr1241758 1001 572 508 22164 111 ----
NM_015347chr1232890 2279 1106 12947 22921 979 12953
NM_015361chr22928 108 ------
NM_015365chrX94238 3663 3513 3416 3184 2738 2679 1500 964 23371 423 ----
NM_015385chr1043227 2702 2200 197 ------
NM_015387chr2--1526 ----
NM_015393chr453177 3050 2591 1541 659 23521 2502 ----
NM_015454chr42248 96 ------
NM_015455chr562968 2669 1614 1215 1184 307 --24096 563 --
NM_015458chr841943 1051 783 190 34835 920 694 ----
NM_015461chr18----1156 --
NM_015554chr1532713 428 298 22821 1143 ----
NM_015569chr184248 4241 4138 3377 3308 3056 1335 633 33236 3155 1792 23104 95 --
NM_015576chr372792 2771 2638 2118 1934 1173 1062 ----12941
NM_015578chr192738 446 ----11676
NM_015646chr1211294 ----1932
NM_015678chr1321698 293 ------
NM_015726chr111761 ------
NM_015878chr811951 3781 632 458 ----
NM_015879chr18118575 8137 7771 6557 5663 5525 3183 2114 1813 1599 604 36996 3271 1155 ----
NM_015888chr143108 3101 1234 1123 23068 528 ----
NM_015906chr174771 4223 4047 3395 1447 775 315 33171 1045 945 ----
NM_016009chr154879 3815 3271 810 96 11336 --14527
NM_016010chr81156 1173 ----
NM_016018chr831779 711 225 --11945 --
NM_016073chr15--21094 873 ----
NM_016083chr662980 1564 1505 1096 1089 465 2553 451 1899 --
NM_016131chr23519 430 402 ----1569
NM_016132chr1532746 2216 911 12654 ----
NM_016133chr281647 1331 1320 1295 1283 676 334 124 21490 1287 ----
NM_016201chr321697 696 12254 --11544
NM_016206chr379001 8866 7989 7304 6303 5872 3321 28324 391 ----
NM_016220chr742363 2066 2056 70 11912 ----
NM_016231chr171596 ------
NM_016260chr297436 7376 6891 6756 6492 5115 2317 1547 447 27395 2697 27417 6172 11526
NM_016272chr2252522 2065 925 874 392 1756 ----
NM_016275chr341842 599 591 265 12445 ----
NM_016315chr2138 --193 --
NM_016322chr942965 2942 995 778 --22848 2463 12398
NM_016333chr16----1206 --
NM_016376chr1763611 2763 1661 1584 1376 1204 11478 22775 1170 --
NM_016436chr20--22465 2138 1917 --
NM_016505chr11732 ------
NM_016512chr81225 ------
NM_016513chr622897 426 42467 787 454 86 13015 --
NM_016531chr443791 2912 2856 2677 2804 666 --14146
NM_016544chr232938 2549 25 --23354 117 --
NM_016577chr353783 1819 954 626 340 24206 3696 --2861 289
NM_016604chr51365 --1919 --
NM_016620chr121145 198 1541 ----
NM_016623chr81591 ----1417
NM_016626chr18--11221 ----
NM_016628chr101575 --1804 1263
NM_016648chr42248 96 ------
NM_016652chr20--21324 339 11714 --
NM_016733chr2241469 1383 1303 572 ----11164
NM_016929chr611240 14067 13966 13852
NM_016946chr172990 1127 1083 1008 986 161 139 --13252 --
NM_016953chr255755 5661 1354 1120 630 24469 3903 ----
NM_017412chr81309 ------
NM_017519chr6----125 --
NM_017572chr19----166 --
NM_017582chr1--21777 407 ----
NM_017594chr953217 3081 682 592 357 23234 1214 --1658
NM_017599chr121508 --1583 --
NM_017633chr662999 2875 1035 717 303 106 13259 --22917 1014
NM_017635chr11--11461 ----
NM_017637chr978075 6082 3547 3300 3038 1188 73 79172 2963 2716 1803 848 331 117 11481 18634
NM_017644chr374616 4482 3614 3588 1991 314 273 ----12051
NM_017645chr932469 2405 609 1504 22517 2311 --
NM_017650chr754792 4591 4539 1327 490 14757 14116 --
NM_017658chr14--14249 ----
NM_017693chr1311393 ------
NM_017714chr205926 324 246 217 208 1231 ----
NM_017719chr362528 2437 2305 1920 1752 1678 ------
NM_017740chr1621707 596 21801 625 31582 630 612 --
NM_017768chr11248 ------
NM_017769chr1413290 12373 1638 --
NM_017772chr641622 1404 1192 174 1630 1611 --
NM_017811chr941113 842 625 377 22866 526 11057 --
NM_017813chr865576 5463 4210 3729 1326 650 22279 1487 14955 --
NM_017816chr4--171 ----
NM_017902chr10125236 5146 4903 2202 2032 1719 1337 951 933 924 877 328 33914 1731 341 13510 --
NM_017925chr911202 31364 763 743 ----
NM_017958chr211078 247 23 12296 12592
NM_018015chrX11030 ------
NM_018084chr232537 2519 26 --1556 1852
NM_018098chr311143 ----1489
NM_018120chr81327 1296 11520 1290
NM_018155chr343361 3291 1239 1174 23407 3278 ----
NM_018184chr381950 1913 1828 1771 1421 1349 534 488 12062 --2248 136
NM_018206chr161131 ----1510
NM_018243chr413834 --169 --
NM_018247chr61295 21044 368 --2491 35
NM_018254chr132132 2034 1914 11849 11521 --
NM_018257chr2052211 2005 1648 600 69 12306 12524 --
NM_018290chr441144 346 292 111 ------
NM_018318chr12182 ------
NM_018321chr5--160 ----
NM_018374chr764861 4545 4128 1935 1878 140 11995 13675 --
NM_018394chr311377 --21577 1040 11024
NM_018433chr2--1170 ----
NM_018440chr888178 7717 7670 7376 6023 5895 2968 200 1957 16292 12046
NM_018448chr12--1188 ----
NM_018469chr1731477 460 48 1454 11159 --
NM_018482chr842561 1751 991 143 --12530 --
NM_018566chr155058 3741 1867 633 187 31738 1302 172 13475 --
NM_018638chr1275533 4822 4095 3799 284 218 201 11887 15063 --
NM_018650chr152216 2176 2124 1829 1492 11640 11980 --
NM_018691chr51779 --1418 --
NM_018890chr7----11137 --
NM_018963chr21----1172 11243
NM_018993chr201573 1305 21499 996 --
NM_019001chr364654 3352 1098 1091 958 515 31615 200 110 ----
NM_019003chrX----128 --
NM_019050chr412252 2240 232 ----
NM_019063chr232246 119 42 31690 670 491 11892 --
NM_019072chr52941 114 13964 13390 --
NM_019084chr10--12431 ----
NM_019094chr1233304 3052 204 --12612 133
NM_019600chr15------1513
NM_019859chr1011080 ------
NM_020066chr1--1940 --1271
NM_020122chr245003 4695 742 548 11142 15869 15016
NM_020123chr1031301 1103 1037 ------
NM_020130chr811042 ----11294
NM_020133chr646501 6333 6247 2132 24382 1791 1198 26442 1721
NM_020134chr21200 ------
NM_020156chr71186 ------
NM_020159chr41373 --31505 1235 391 --
NM_020178chr1721253 799 ------
NM_020189chr81157 ------
NM_020193chr111401 ------
NM_020248chr11648 1901 22033 2025 22077 2059
NM_020337chr431087 213 150 1334 32531 856 339 11136
NM_020420chrY----11356 --
NM_020431chr1422704 2210 1480 --21983 741
NM_020432chr721698 1473 1716 12297 --
NM_020465chr1642039 1596 804 478 --31642 1460 793 --
NM_020532chr2----1182 1642
NM_020640chr3----1553 --
NM_020699chr123633 321 24845 4597 ----
NM_020708chr201565 12242 --12078
NM_020718chr1656445 1828 1470 638 146 ----1732
NM_020727chr2173560 3045 2955 2895 2691 1350 64 1272 13184 --
NM_020728chr732530 448 292 11072 --12083
NM_020732chr6----125 --
NM_020734chr1222428 774 52718 1106 1096 729 273 --22285 1120
NM_020739chr1574126 3916 3076 2558 1563 649 520 12735 ----
NM_020749chr82777 105 22044 820 21497 448 --
NM_020768chr522970 497 --1254 12885
NM_020769chrX----2966 351 --
NM_020770chr11514 --1974 1332
NM_020772chr1766761 6445 6333 3144 1943 948 47818 7805 3192 1343 ----
NM_020783chr181685 31780 888 167 --1490
NM_020786chr1621448 1383 --11722 --
NM_020791chr1721148 298 1251 --11282
NM_020839chr321604 603 ----1185
NM_020841chr1252611 1629 1025 246 207 21029 712 --12498
NM_020858chr1562098 2073 790 572 359 25 22372 255 1530 --
NM_020860chr4--1934 ----
NM_020865chr3--1147 --1107
NM_020896chr1131044 906 170 1684 2899 893 --
NM_020917chr1953607 3373 2920 1373 68 ------
NM_020926chrX--2365 40 ----
NM_020935chr264295 4076 3313 2877 439 281 14303 24032 2967 --
NM_020952chr9--1280 ----
NM_020962chr153229 201 194 1236 2243 84 --
NM_020977chr4--12221 ----
NM_021005chr151797 ------
NM_021007chr25802 706 456 327 61 --1403 --
NM_021032chr31434 ------
NM_021038chr353237 3009 1258 587 47 22379 1344 ----
NM_021083chrX23541 2725 --12708 --
NM_021097chr232200 2117 675 --21049 933 --
NM_021111chr921124 196 1852 1933 --
NM_021132chr10----21178 176 11372
NM_021140chrX--1783 ----
NM_021161chr14--2440 397 2472 79 --
NM_021180chr1--1727 ----
NM_021215chr2042158 2040 1778 867 ----1322
NM_021229chr1211044 ----1491
NM_021237chr3--1103 ----
NM_021239chr1421194 529 1546 ----
NM_021240chr9------1598
NM_021260chr14--1272 ----
NM_021647chr464725 3244 3015 1173 767 239 ------
NM_021648chr622274 876 11811 22731 1889 12404
NM_021728chr14------1278
NM_021814chr651656 1643 1277 1181 363 11552 ----
NM_021815chr213032 22646 628 12673 12144
NM_021905chr611494 --31716 1683 1616 21768 1638
NM_021911chr544573 4054 4024 3956 13432 15069 --
NM_021912chr1583822 3578 2657 1102 853 637 402 140 1192 1803 1228
NM_021914chr1452439 1698 899 708 289 11957 1981 --
NM_021956chr61522 --11232 11278
NM_021960chr111831 1876 ----
NM_021961chr1167303 6822 6711 5581 5251 1311 67235 1208 1198 897 263 53 1179 11634
NM_021964chr366241 6149 5261 4882 4535 2594 ----1780
NM_022048chr1596055 5805 5797 5398 5381 4680 2465 1210 507 15412 25458 1718 --
NM_022080chr2032582 1083 415 12297 --22828 556
NM_022114chr1134802 4478 4109 3990 1855 1588 1565 1545 827 814 481 384 96 ------
NM_022166chr1665915 5835 2053 2024 1506 311 ------
NM_022368chrX1311 ------
NM_022459chr1375256 4822 1959 1629 1544 1532 1324 21946 274 14867 --
NM_022648chr254300 3915 3887 995 576 34324 1774 929 1671 13899
NM_022650chr51121 1977 ----
NM_022652chr12132 --1327 1246
NM_022726chr621094 116 1457 --11499
NM_022731chr1--1206 ----
NM_022745chr152700 2112 2096 680 124 22668 2510 ----
NM_022753chr1--12212 ----
NM_022763chr382946 2764 2680 2588 2173 2021 942 418 1575 ----
NM_022780chr221602 1588 --1329 11182
NM_022826chr21836 ------
NM_022838chrX--1282 ----
NM_022841chr1532595 2071 233 22244 2136 ----
NM_022843chr1311288 1177 ----
NM_022898chr141899 --14774 2466 263
NM_022910chr1642039 1596 804 478 --31642 1460 793 --
NM_022912chr252874 2760 2437 634 157 1169 12785 11146
NM_022977chrX21844 1806 11668 ----
NM_023012chr12----1731 --
NM_023016chr232669 2489 2074 1590 12697 --
NM_023033chr12--1588 ----
NM_024007chr5--12742 --12695
NM_024050chr19------172
NM_024344chr15------1535
NM_024345chr945054 4485 4224 934 15726 14349 --
NM_024529chr11303 ------
NM_024539chrX----1399 --
NM_024548chr3------11745
NM_024551chr1232222 2200 779 12164 12209 12262
NM_024551chr1232222 2200 779 12164 12209 12262
NM_024563chr521925 625 11863 ----
NM_024567chr8----179 --
NM_024569chr11725 1222 12363 --
NM_024582chr41239 1355 1190 --
NM_024645chr8--11561 ----
NM_024646chr142625 1507 1029 150 21015 136 ----
NM_024721chr831869 917 821 12117 1641 --
NM_024761chr945333 3746 1486 165 24837 458 --13500
NM_024817chr1555801 5227 5161 2022 491 14172 15924 --
NM_024824chr141179 ----11296
NM_024841chr1152029 1814 628 540 397 22017 902 ----
NM_024947chr359525 7213 3713 3528 275 17351 --39336 6831 3001
NM_024949chr453351 3061 1209 1114 259 24964 1889 --1319
NM_024971chr9--1280 ----
NM_024989chr258014 7740 6777 5474 36 48151 7964 2665 1290 11977 --
NM_024991chr1043227 2702 2200 197 ------
NM_025090chr176255 226 122 107 78 68 --4392 348 321 145 --
NM_025133chr2--11013 ----
NM_025147chr211116 ------
NM_025160chr164129 4062 3955 3845 3023 2898 --12767 --
NM_025248chr1792836 2701 2691 2660 2595 2363 2337 2147 117 32652 2550 2391 12435 12539
NM_030637chr14160 ------
NM_030647chr745922 4130 2317 484 1788 45933 4451 2436 625 --
NM_030648chr464496 4065 3984 3587 1989 414 ----11222
NM_030650chr253966 1659 1432 1228 1192 12581 ----
NM_030674chr1224272 1507 22205 1547 12237 1992
NM_030790chr161250 ------
NM_030806chr166778 6411 3571 3396 2316 1338 38889 2893 1619 38258 6385 6353 19405
NM_030884chr3--12203 --21846 1671
NM_030906chr11--1407 2493 133 --
NM_030980chr11582 ------
NM_031157chr12------2675 149
NM_031216chr18----11500 --
NM_031305chr4--2219 161 11487 --
NM_031365chr21522 31903 931 45 --12543
NM_031366chr21522 31903 931 45 --12543
NM_031409chr611774 --130 --
NM_031418chr1122636 1832 32580 1063 356 ----
NM_031442chrX63206 2763 2543 2336 785 641 --1628 --
NM_032017chr1----11942 --
NM_032102chr1163071 2594 2432 1168 521 179 12386 --1363
NM_032116chr1355808 4049 3886 2113 776 11980 11335 --
NM_032121chrX62261 2211 1995 520 511 60 42624 786 471 154 1918 --
NM_032145chr631660 194 61 1275 --1635
NM_032160chr1843945 1570 1400 117 24342 105 ----
NM_032181chr21621 ------
NM_032186chr121145 198 1541 ----
NM_032189chr1343403 3169 1758 313 --24297 3630 23347 3106
NM_032208chr212661 2704 684 22780 1107 --
NM_032229chr13--1457 ----
NM_032239chr41463 1149 ----
NM_032246chr151435 1843 ----
NM_032291chr111921 ------
NM_032352chr1411476 1118 ----
NM_032373chr1054997 2231 1484 1474 678 41057 760 541 240 ----
NM_032379chr11--1195 2339 148 --
NM_032408chr71502 ------
NM_032436chr132785 181 11008 ----
NM_032439chr1011434 ------
NM_032440chr1042523 2481 2383 926 31010 678 152 --1188
NM_032457chr413491 13166 --11325
NM_032505chr331698 864 525 12732 12312 1744
NM_032539chrX2655 612 ------
NM_032560chr14--1886 --1787
NM_032561chr22----1254 --
NM_032632chr141175 ----11460
NM_032682chr353428 3415 3287 3025 143 12541 --12664
NM_032731chr1721464 524 --1115 --
NM_032784chr63733 333 217 --2890 783 --
NM_032790chr12----1362 --
NM_032802chr15126 ------
NM_032810chr1051353 1148 1011 377 356 21551 392 11325 --
NM_032826chr795244 4405 4228 4179 3586 1954 1694 1514 1393 24598 1300 ----
NM_032871chr1151922 1707 1691 1388 421 --1765 11732
NM_032873chr1164363 3724 3488 2814 369 194 14200 13596 --
NM_032926chrX------1192
NM_032943chr11--1195 2339 148 --
NM_032961chr421287 250 1197 --1107
NM_032968chrX13767 33938 1419 195 13850 1310
NM_032969chrX13767 33938 1419 195 13850 1310
NM_032973chrY13759 33930 1419 195 13842 1310
NM_033020chr174771 4223 4047 3395 1447 775 315 33171 1045 945 ----
NM_033143chr4124662 4570 4444 4396 4379 4288 3462 3286 1515 1053 859 94 24666 1031 34671 4405 4275 --
NM_033181chr662980 1564 1505 1096 1089 465 2553 451 1899 --
NM_033224chr737405 5054 2797 18018 26739 6558 --
NM_033254chr3--1481 ----
NM_033285chr844178 4045 3969 58 23757 1775 14165 --
NM_033296chr41611 ------
NM_033389chr1731529 823 159 34852 3680 2961 --12967
NM_033495chrX147 ------
NM_033505chr266175 6158 6031 5501 781 204 12342 25164 4415 --
NM_033512chr852683 1921 914 247 199 12330 42437 925 669 652 --
NM_033626chrX--11851 ----
NM_052827chr1211148 ----11010
NM_052832chr832697 435 230 12648 ----
NM_052864chr472127 2062 1989 1483 1420 852 699 11637 11386 --
NM_052875chr1112097 ------
NM_052898chr811178 --2619 569 --
NM_052923chr6--1187 ----
NM_052926chrX1891 ------
NM_052978chr1451479 723 419 246 125 --21400 318 --
NM_053016chr945965 5478 2843 2583 --1184 --
NM_053023chr111346 23153 2787 1819 --
NM_053024chr3--1321 ----
NM_053064chr1433081 2073 361 13051 --1681
NM_054016chr111663 ------
NM_054016chr111663 ------
NM_054016chr111663 ------
NM_058207chr8159 ------
NM_080390chrX------1149
NM_080666chr14----11479 --
NM_080677chr17------1145
NM_080678chr21209 ------
NM_080840chr201162 ------
NM_080841chr201162 ------
NM_080927chr313313 1793 ----
NM_100264chr101575 --1804 1263
NM_100486chr101575 --1804 1263
NM_130391chr943329 2326 1385 377 32692 2319 1275 ----
NM_130392chr943329 2326 1385 377 32692 2319 1275 ----
NM_130393chr943329 2326 1385 377 32692 2319 1275 ----
NM_130435chr1042634 2557 513 326 12772 12585 --
NM_130773chr21898 1878 1276 --
NM_130808chr3------1165
NM_130838chr1541415 1310 458 186 11829 1735 --
NM_130839chr1541415 1310 458 186 11829 1735 --
NM_130847chr1165614 5323 5070 4718 4406 4078 ----14588
NM_133265chrX63566 423 362 302 225 163 23253 1229 23498 2399 13282
NM_133334chr466231 5969 5588 4953 826 93 25471 5004 26268 1778 --
NM_133446chr101274 ------
NM_134428chr9------1359
NM_138317chr14--2440 397 2472 79 --
NM_138318chr14--2440 397 2472 79 --
NM_138357chr10188 ----11794
NM_138395chr2142 ----11039
NM_138423chr1552166 1625 908 340 166 11472 ----
NM_138426chr762468 2282 2199 816 765 206 ----1810
NM_138459chr632819 2245 169 23104 2695 --2192 176
NM_138468chr276082 5349 4926 4846 386 234 210 --11695 --
NM_138473chr1244486 1843 1830 1183 --21324 1085 --
NM_138558chr1--11030 194 --
NM_138576chr141899 --14774 2466 263
NM_138638chr1452439 1698 899 708 289 11957 1981 --
NM_138713chr1687830 5344 2885 1939 1719 1495 1480 1446 26170 564 ----
NM_138714chr1687830 5344 2885 1939 1719 1495 1480 1446 26170 564 ----
NM_138731chr1423444 1635 24054 684 --12769
NM_138775chr11----1693 --
NM_138782chr55820 793 758 626 497 ------
NM_138927chr21--1817 --1976
NM_138931chr3--3779 385 240 ----
NM_138970chr1452304 2028 1987 802 568 ----12293
NM_139012chr642068 2012 770 126 1157 3745 162 136 --
NM_139014chr642148 2092 850 206 1237 3825 242 216 --
NM_139046chr10148 ------
NM_139070chr5--1480 ----
NM_139131chr111671 ------
NM_139168chr52438 261 11226 11718 --
NM_139211chr4--1197 ----
NM_139212chr4--1197 ----
NM_139276chr1721902 228 12301 ----
NM_139283chr1232600 2288 1033 --157 1455
NM_139316chr7----1148 --
NM_144568chr14--1525 ----
NM_144571chr456760 1498 1014 994 123 25797 4333 --12630
NM_144574chr141411 ------
NM_144599chr1575518 4948 1851 1575 1194 969 432 23586 705 25400 1659 --
NM_144658chrX----1127 --
NM_144665chr11------133
NM_144720chr4------128
NM_144732chr1911045 ------
NM_144767chr1534442 4324 3736 43645 1346 705 687 --22946 1096
NM_144949chr222374 2208 22074 769 --147
NM_144973chr1243430 1575 696 218 14263 23842 209 --
NM_144975chr173678 291 259 11407 1313 --
NM_145011chr1042170 809 772 765 1872 ----
NM_145055chr1822772 865 23656 3243 --1487
NM_145259chr277147 6088 5798 4484 2223 2196 63 --1563 --
NM_145284chrX41723 1606 1003 829 1331 ----
NM_145307chr1044414 3021 604 357 33587 215 78 ----
NM_145638chr1131044 906 170 1684 2899 893 --
NM_145686chr22829 522 1118 1130 2798 729
NM_145687chr22829 522 1118 1130 2798 729
NM_145859chr31262 ------
NM_145860chr31262 ------
NM_145891chr1611668 11699 --11545
NM_145892chr1611668 11699 --11545
NM_145893chr1611790 11821 --11667
NM_147171chr7--1324 ----
NM_147185chr7--1324 ----
NM_147189chr852345 1652 1613 412 298 --11833 --
NM_148174chr811951 3781 632 458 ----
NM_152222chr1151922 1707 1691 1388 421 --1765 11732
NM_152264chr116906 180 165 152 142 73 1159 ----
NM_152281chr1--1958 ----
NM_152388chr213272 13885 --22835 87
NM_152414chr8--21650 1582 ----
NM_152424chrX54343 3751 1803 702 43 --13853 13408
NM_152450chr1551898 1658 616 403 128 12048 1116 --
NM_152451chr15----1835 --
NM_152621chr41367 ------
NM_152624chr576801 5133 2216 1877 1299 1278 1066 1580 ----
NM_152638chr1211213 2953 164 ----
NM_152665chr11428 11030 --1864
NM_152688chr6------1644
NM_152695chrX72066 2016 1642 749 489 445 437 --1690 --
NM_152734chr675447 5402 4364 3693 3458 1018 940 21820 1136 22015 132 --
NM_152745chr71100 ------
NM_152756chr52673 480 34295 2969 1634 ----
NM_152758chr832487 1202 1047 1714 ----
NM_152774chr762750 2529 2349 725 714 626 22673 2635 ----
NM_152835chr162241 1985 921 442 435 67 1192 ----
NM_152838chr2031339 935 861 22667 2628 ----
NM_152903chr1372889 2519 2499 2485 2312 1975 460 2993 857 ----
NM_152919chr1963748 3559 3227 2771 488 201 1723 --11269
NM_153035chr132792 2628 181 ----12853
NM_153042chr611647 11309 11522 --
NM_153184chr3------1641
NM_153188chr555432 4762 2120 2050 1223 ----11675
NM_153207chr1222774 1449 22861 1031 1394 --
NM_153257chr191911 1337 1394 --
NM_153267chr91759 ------
NM_153426chr42667 533 ------
NM_153427chr42667 533 ------
NM_153453chr6--1410 ----
NM_153456chr1386121 5608 4596 4153 2461 2023 1276 110 11477 35964 4119 3900 --
NM_153616chr1562098 2073 790 572 359 25 22372 255 1530 --
NM_153617chr1562098 2073 790 572 359 25 22372 255 1530 --
NM_153618chr1562098 2073 790 572 359 25 22372 255 1530 --
NM_153619chr1563336 3311 2504 2448 1263 1251 13610 ----
NM_153690chr3--1849 ----
NM_153693chr121102 ------
NM_153713chr1--1122 ----
NM_153828chr2----1182 1642
NM_170665chr1263981 2841 1484 1112 1102 365 24382 3994 13890 --
NM_170710chr422875 2814 32779 784 440 ----
NM_170720chr1911283 ------
NM_172037chr811402 11317 1337 --
NM_172071chr1--47265 5611 547 137 11234 --
NM_172193chr14--21262 270 ----
NM_172337chr14------1278
NM_173054chr73217 43 37 ------
NM_173078chrX1149 ------
NM_173082chr6--2375 32 ----
NM_173087chr15------1535
NM_173088chr15------1535
NM_173089chr15------1535
NM_173090chr15------1535
NM_173214chr1687830 5344 2885 1939 1719 1495 1480 1446 26170 564 ----
NM_173495chrX1586 --12269 12019
NM_173510chr2222550 1993 42600 1885 418 281 ----
NM_173511chr283270 1372 1357 782 688 522 120 98 --13072 --
NM_173517chr7--1337 ----
NM_173560chr6--1443 ----
NM_173582chr11--34726 2219 2190 ----
NM_173645chr21159 ------
NM_173694chrX31601 913 639 12414 1584 --
NM_173797chr5--1346 1237 --
NM_173825chr313126 ------
NM_173829chr586207 6142 5491 5233 4275 4160 793 169 ------
NM_173848chr81222 ------
NM_173851chr824003 2928 2990 232 22512 2476 --
NM_174916chr1542054 575 533 220 22416 963 11609 --
NM_175056chr34839 458 353 51 12117 ----
NM_175624chr1286359 6233 2608 1995 1312 820 766 379 17647 ----
NM_175625chr1286359 6233 2608 1995 1312 820 766 379 17647 ----
NM_175634chr811138 ------
NM_175635chr811138 ------
NM_175636chr811138 ------
NM_175736chr1267589 7506 6759 4832 1495 655 17857 37320 5246 1103 --
NM_175854chr13--12778 ----
NM_175863chr6----125 --
NM_175876chr112752 22112 24 11764 --
NM_175910chr19--12357 12383 12348
NM_176863chr1721721 164 31725 638 265 11526 12000
NM_177967chr1321089 268 11003 ----
NM_177974chr1552166 1625 908 340 166 11472 ----
NM_177985chr221866 1392 12102 11928 --
NM_178123chr2------1741
NM_178151chrX47870 6675 6051 262 21783 1699 37729 5685 1684 --
NM_178152chrX47870 6675 6051 262 21783 1699 37729 5685 1684 --
NM_178153chrX47870 6675 6051 262 21783 1699 37729 5685 1684 --
NM_178313chr272167 2151 2101 2029 1662 1641 1587 ------
NM_178424chr51523 ------
NM_178441chr14--1272 ----
NM_178505chr1021047 823 33672 3542 2708 12436 --
NM_178539chr121401 ------
NM_178548chr1----1224 --
NM_178812chr821334 1120 --128 --
NM_180989chr1342144 774 741 253 ----12250
NM_181265chr422875 2814 32779 784 440 ----
NM_181302chr141411 ------
NM_181308chr141411 ------
NM_181358chr173951 3798 3609 3175 1459 1375 1019 23167 1338 12795 --
NM_181361chr32918 900 31467 1015 965 ----
NM_181481chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_181482chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_181483chr18116620 5744 5122 2585 2393 1828 1730 1237 1109 570 508 ------
NM_181504chr564107 3835 3769 3349 3342 2966 33859 3155 3041 12986 --
NM_181523chr564107 3835 3769 3349 3342 2966 33859 3155 3041 12986 --
NM_181524chr564107 3835 3769 3349 3342 2966 33859 3155 3041 12986 --
NM_181702chr82361 246 --1263 --
NM_181762chrX2434 53 ------
NM_181777chrX2434 53 ------
NM_181782chr682258 2047 1452 884 723 703 555 529 ------
NM_181836chr5--22541 2069 1376 --
NM_181886chr441320 1133 1065 284 ----1277
NM_181887chr441320 1133 1065 284 ----1277
NM_181888chr441320 1133 1065 284 ----1277
NM_181889chr441320 1133 1065 284 ----1277
NM_181890chr441320 1133 1065 284 ----1277
NM_181891chr441320 1133 1065 284 ----1277
NM_181892chr451367 1180 1112 331 46 ----1324
NM_181893chr441320 1133 1065 284 ----1277
NM_182485chr433284 1386 48 22941 621 --21064 924
NM_182515chr1946192 5804 1657 186 15989 1591 --
NM_182551chr223133 21 23484 3059 1930 --
NM_182641chr17------1583
NM_182643chr82466 414 1244 ----
NM_182645chr6--1410 ----
NM_182646chr433284 1386 48 22941 621 --21064 924
NM_182648chr14----1271 --
NM_182685chr11781 ----1643
NM_182757chr672460 2264 1110 952 550 348 32 ------
NM_182789chr5--1192 ----
NM_182898chr774847 3990 2460 1954 1852 845 696 14168 ----
NM_182899chr774847 3990 2460 1954 1852 845 696 14168 ----
NM_182907chr642263 1839 666 611 22405 670 ----
NM_182917chr31119 ------
NM_182918chr2111008 --21439 532 --
NM_182920chr341432 553 185 134 ----184
NM_182975chr12954 798 11118 --11159
NM_182976chr1--1288 ----
NM_183323chr5--1192 ----
NM_183397chr2054684 3823 1664 1423 1192 15184 ----
NM_184085chr8149 --1750 1289
NM_184086chr8149 --1750 1289
NM_184087chr8149 --1750 1289
NM_194247chr284498 4466 4141 1783 1610 1511 646 612 14286 11128 --
NM_194283chr564090 3430 3147 1396 403 276 ------
NM_194301chr14--1472 --11052
NM_194314chr144819 3923 742 144 ------
NM_194317chr272662 2309 2073 1976 1824 902 96 12648 42453 2444 2117 21 --
NM_194454chr711264 ----1662
NM_194455chr711264 ----1662
NM_194456chr711264 ----1662
NM_194463chrX----1399 --
NM_197972chr1170 ------
NM_198173chr1--1727 ----
NM_198174chr1--1727 ----
NM_198241chr31119 ------
NM_198242chr31119 ------
NM_198244chr31119 ------
NM_198261chr12----1731 --
NM_198262chr12----1731 --
NM_198268chr173951 3798 3609 3175 1459 1375 1019 23167 1338 12795 --
NM_198269chr173951 3798 3609 3175 1459 1375 1019 23167 1338 12795 --
NM_198270chrX32444 510 146 21247 479 11404 --
NM_198273chr522003 235 12976 32409 2385 502 23098 39
NM_198400chr1531877 698 186 12075 1412 12186
NM_198465chrX12895 22930 704 --22700 1069
NM_198467chr71395 ------
NM_198484chr355878 5469 5297 3894 1498 --21480 401 --
NM_198503chr11397 11795 ----
NM_198715chr1116240 5986 5449 5306 4996 4599 4551 4194 259 247 159 ----25539 26
NM_198829chr7----11137 --
NM_198900chr1267589 7506 6759 4832 1495 655 17857 37320 5246 1103 --
NM_199040chr1233304 3052 204 --12612 133
NM_199245chr1232577 2173 869 12391 --12377
NM_199324chr423509 367 13758 --11412
NM_199454chr1134802 4478 4109 3990 1855 1588 1565 1545 827 814 481 384 96 ------
NM_199482chr2--1526 ----
NM_201269chr121145 198 1541 ----
NM_201435chr12156 ----1239
NM_201624chr111058 1167 145 --
NM_203344chr19----1156 --
NM_203446chr2122920 2558 3967 948 893 ----
NM_203458chr153846 1265 645 83 21 ------
NM_203463chr264774 3723 3647 3086 1480 385 --1150 14195
NM_205860chr111959 --11136 12362
NM_206827chr13------1128
NM_206876chr253040 2285 1127 820 169 167 ----
NM_206886chr1122 ------
NM_206909chr886737 6212 5727 2129 931 922 915 442 26632 3218 1802 26307 548
NM_206927chr11--1195 2339 148 --
NM_206928chr11--1195 2339 148 --
NM_206929chr11--1195 2339 148 --
NM_206930chr11--1195 2339 148 --
NM_206944chr9--1280 ----
NM_206945chr9--1280 ----
NM_206946chr9--1280 ----
NM_206947chr9--1280 ----
NM_207292chr353237 3009 1258 587 47 22379 1344 ----
NM_207293chr353237 3009 1258 587 47 22379 1344 ----
NM_207294chr353237 3009 1258 587 47 22379 1344 ----
NM_207295chr353237 3009 1258 587 47 22379 1344 ----
NM_207296chr353237 3009 1258 587 47 22379 1344 ----
NM_207297chr353262 3034 1283 612 72 22404 1369 ----
NM_207311chr12--11169 ----
NM_207343chr111134 ------
NM_207371chr10189 ------
NM_207481chr2--11226 ----
NM_207520chr2----1182 1642
NM_207521chr2----1182 1642
NM_207660chr141179 ----11296
NM_207661chr141179 ----11296
NM_207662chr141179 ----11296
NM_212460chr7--11692 ----
NM_212465chr15------1535
NM_212469chr113957 426 385 1708 --1131
NM_213589chr285332 1835 969 760 669 458 341 312 3209 203 130 --21362 404
NM_213654chr31361 11560 1217 --