TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5589-5p
miRNA Sequence: GGCUGGGUGCUCUUGUGCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr12141901 1848 1792 1600 1553 911 771 696 521 458 426 340 329 141 11981 22109 150 --
NM_000035chr9123 ------
NM_000038chr511785 11387 1509 --
NM_000052chrX52886 1298 1119 1043 804 --21163 184 12841
NM_000053chr1351790 1644 1478 694 97 ------
NM_000063chr62283 105 ------
NM_000068chr1981242 594 570 336 309 239 95 21 1429 11045 --
NM_000080chr173589 288 272 ------
NM_000084chrX126937 6911 6412 6069 4262 2532 1774 1648 1097 1017 914 821 32662 1754 1589 35892 5190 4396 --
NM_000088chr1741212 1096 500 57 2520 456 ----
NM_000090chr21312 ------
NM_000092chr243883 2783 951 886 33619 3231 2973 ----
NM_000093chr982444 1967 1865 1838 305 297 233 162 146 2648 222 --
NM_000094chr3--155 ----
NM_000098chr12556 221 187 ----
NM_000112chr594259 4020 2217 2018 1975 1811 1265 513 67 --11726 13974
NM_000114chr2011267 --1824 --
NM_000118chr912783 748 735 726 645 601 336 242 202 156 37 27 2261 122 ----
NM_000125chr6103030 1698 1540 1349 1232 1214 1149 903 348 292 11302 14240 --
NM_000127chr8167 ------
NM_000129chr641019 1008 175 108 --21045 388 --
NM_000138chr1532459 1709 1635 1307 22581 2511 --
NM_000141chr101484 --21275 48 --
NM_000161chr1411488 21554 376 ----
NM_000176chr533418 1218 853 ------
NM_000188chr104726 569 197 72 135 ----
NM_000189chr232315 1841 679 2581 397 ----
NM_000192chr12----1468 11257
NM_000208chr1954625 3933 616 522 78 34122 3788 302 21323 443 --
NM_000217chr1294494 4055 2152 1838 1254 918 667 369 74 14698 ----
NM_000232chr453005 2446 2402 1050 638 11223 ----
NM_000237chr821601 134 --188 --
NM_000244chr119687 587 283 230 194 180 169 83 36 ------
NM_000245chr751368 792 749 658 356 ----11715
NM_000259chr15126374 6264 4629 4362 2430 2402 2251 1978 1941 1580 1288 1208 24643 1074 14408 --
NM_000264chr932085 862 717 1805 --12868
NM_000278chr10172183 2177 2141 2074 1995 1771 1729 857 830 808 566 426 309 298 235 124 112 2780 706 22068 801 --
NM_000286chr172348 92 ------
NM_000291chrX2704 159 ----1354
NM_000304chr172418 356 --2825 309 --
NM_000314chr101569 ------
NM_000330chrX4911 890 840 200 2858 727 --11458
NM_000332chr686624 6515 6414 5614 4779 2569 1933 51 12328 1537 --
NM_000333chr3--1453 --168
NM_000335chr3101963 1817 1711 1529 633 624 503 474 267 125 ------
NM_000337chr556344 4464 4307 1885 1570 35469 4587 1243 --11427
NM_000346chr1721926 568 ------
NM_000362chr2293451 2939 2846 2815 2682 1428 987 700 648 13410 ----
NM_000376chr12142704 2630 2564 2193 2165 2158 1982 1243 973 817 757 415 289 210 12010 32685 2378 142 182
NM_000389chr661416 1344 1142 1110 431 159 ------
NM_000408chr22532 516 22251 735 ----
NM_000411chr2162353 2062 1317 965 549 396 22550 2033 ----
NM_000425chrX5598 542 195 132 46 2561 64 1158 --
NM_000428chr1481860 1747 1000 778 608 364 144 77 --1519 --
NM_000430chr1753260 2933 2791 1379 1314 1669 ----
NM_000434chr62336 118 ------
NM_000442chr1741223 1055 1009 278 1845 ----
NM_000445chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_000448chr1122538 246 22009 74 ----
NM_000449chr111106 1588 1141 1419
NM_000461chr383798 3192 2848 1601 1344 902 702 66 --13366 --
NM_000476chr96952 586 420 274 248 24 --1362 --
NM_000477chr4124 ------
NM_000486chr12163152 2932 2831 2731 2551 2375 1172 1054 1029 994 942 664 332 242 139 105 22216 1082 ----
NM_000489chrX43280 2335 1272 1122 23141 1029 22900 2366 --
NM_000495chrX21096 295 1174 ----
NM_000503chr83454 212 66 ----157
NM_000523chr2--2477 390 ----
NM_000525chr1181359 1252 1167 415 294 123 97 64 1167 11280 --
NM_000533chrX----1642 --
NM_000539chr351434 1216 1016 317 62 11062 11391 --
NM_000555chrX77012 5764 5214 4946 4797 2261 499 37128 5846 543 11804 --
NM_000567chr151203 901 836 333 167 1943 ----
NM_000572chr14931 861 815 776 1642 188 --
NM_000599chr2124045 3671 3300 3274 3108 2942 1761 1404 462 416 56 44 --11187 --
NM_000609chr1062752 2404 2176 1928 296 41 11123 21176 599 --
NM_000612chr1133189 682 29 12930 23469 131 1743
NM_000615chr1142187 1962 933 815 22444 2141 --12877
NM_000618chr12105541 5451 5407 5134 4231 2652 2245 2054 1055 332 --15179 12197
NM_000618chr12105541 5451 5407 5134 4231 2652 2245 2054 1055 332 --15179 12197
NM_000625chr171112 --1397 --
NM_000633chr1893867 3482 3195 1965 1827 998 930 775 647 --14463 --
NM_000635chr1961627 1203 1010 593 319 185 --1560 --
NM_000686chrX2985 227 11211 11033 11413
NM_000719chr12146335 6003 4491 4468 4462 4316 4159 2608 793 613 303 275 255 182 15903 25959 475 --
NM_000720chr31427 ------
NM_000723chr1791696 1600 1160 1111 640 498 187 162 42 21104 1085 ----
NM_000725chr125944 342 132 125 105 ------
NM_000726chr21911 --1495 --
NM_000738chr119963 949 942 887 382 200 144 78 32 2999 373 1738 --
NM_000767chr1971461 1414 1401 1146 513 335 260 ------
NM_000793chr1474888 4702 3342 1221 533 468 427 23860 3594 14333 14491
NM_000801chr2021001 873 11071 2863 160 --
NM_000809chr478509 6649 5941 3702 2788 2597 378 --11854 1216
NM_000810chr152247 41 ------
NM_000813chr562236 1908 1171 569 286 90 14177 ----
NM_000814chr1543786 3356 2920 2879 1153 24113 788 --
NM_000818chr10150 ------
NM_000827chr572170 2034 2005 1764 1594 688 47 11603 ----
NM_000829chr112194 176 12297 21955 460 12304
NM_000831chr1156013 5886 5813 5732 5611 5507 5422 5408 4360 4254 4118 3937 1417 1173 386 35499 1817 848 34928 4648 699 14086
NM_000836chr195870 861 667 375 369 --1200 1834
NM_000838chr642034 650 602 496 --11715 --
NM_000839chr35341 316 166 153 45 ------
NM_000840chr7--1459 ----
NM_000860chr411193 11476 ----
NM_000868chrX2848 545 1880 ----
NM_000870chr551445 1341 132 86 21 1165 --11037
NM_000872chr102603 462 1207 ----
NM_000875chr15144851 4309 2740 2187 2172 2032 2022 1639 1586 967 961 862 623 377 46079 5330 4843 2682 11020 --
NM_000878chr22111601 1406 1400 789 598 521 508 392 309 129 98 11384 1145 --
NM_000885chr271871 1752 1742 1552 792 221 39 1157 ----
NM_000891chr1733569 3381 311 23501 819 --11159
NM_000899chr1253134 1738 1660 1610 496 --1374 --
NM_000901chr452373 2009 1826 225 57 ------
NM_000912chr852185 825 475 411 69 11143 13412 --
NM_000924chr124996 420 258 235 1870 11108 --
NM_000945chr231736 646 188 174 ----
NM_000949chr51112 1156 ----
NM_000956chr14----1262 11054
NM_000961chr20223505 3328 3280 3253 3075 2899 2824 2503 1497 1451 1412 1260 947 861 749 721 431 396 69 61 51 40 11278 22943 1201 --
NM_000962chr963074 1263 1074 700 429 272 ------
NM_000963chr112264 11678 ----
NM_000965chr33990 454 179 134 1291 --
NM_000994chr351120 780 710 416 176 ------
NM_001001396chr1104216 3818 3611 3493 2994 2973 1720 1696 1577 245 11732 1498 23038 1677
NM_001001433chr2083018 2636 2321 2275 2236 2165 1092 866 12683 22411 839 --
NM_001001481chr8--125 ----
NM_001001484chr1022350 94 --2975 190 --
NM_001001523chr191222 1207 989 983 541 481 341 224 218 21165 547 1263 --
NM_001001549chr742550 2217 679 107 1607 2596 245 1193
NM_001001550chr742550 2217 679 107 1607 2596 245 1193
NM_001001555chr742550 2217 679 107 1607 2596 245 1193
NM_001001560chr224699 678 338 51 ----1200
NM_001001563chr196922 867 683 649 45 23 1955 1732 --
NM_001001664chr2----23425 3389 13879
NM_001001701chr442311 2095 1978 195 ------
NM_001001890chr2184280 4195 3919 1198 948 220 185 109 23003 274 --12907
NM_001001994chrX----1557 --
NM_001001995chrX--21592 377 ----
NM_001001996chrX----1557 --
NM_001002026chr342338 1654 526 374 11788 ----
NM_001002233chr831555 683 383 --1534 --
NM_001002257chr293019 2898 842 736 646 448 433 392 30 ----11198
NM_001002762chr10142762 2088 2076 1875 985 904 870 841 709 534 355 334 165 153 32045 779 384 ----
NM_001002838chrX41498 701 623 291 ------
NM_001002840chr71195 1181 ----
NM_001002909chr1781665 1656 1624 1552 708 588 571 436 --1900 --
NM_001002919chr21525 ------
NM_001003396chr67224 189 146 126 90 68 44 1551 1165 --
NM_001003397chr67224 189 146 126 90 68 44 1551 1165 --
NM_001003406chr22133315 3036 2980 2947 2834 2759 2141 1281 1194 1177 965 806 432 11105 ----
NM_001003652chr1898043 7725 7202 6921 5804 3358 2433 1176 328 28697 6299 27819 7673 15502
NM_001003665chr193423 3202 3158 3095 2592 2581 2214 526 28 42866 2526 917 172 23310 3181 --
NM_001003674chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_001003675chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_001003681chr2251640 1391 1352 744 499 11850 11921 --
NM_001003688chr411062 ------
NM_001003694chr31403 ------
NM_001003698chr651691 1661 1577 1555 1231 --11265 --
NM_001003699chr651691 1661 1577 1555 1231 --11265 --
NM_001003712chr1232970 2564 116 --1525 --
NM_001003760chr643290 2508 692 626 23452 3314 --12708
NM_001003786chr174690 248 51 29 ------
NM_001003787chr174690 248 51 29 ------
NM_001003788chr174690 248 51 29 ------
NM_001003792chr3----11015 --
NM_001003793chr3----11015 --
NM_001003794chr3142676 2629 2325 2031 2001 1893 1231 1108 1018 629 532 405 307 21 32815 1978 1176 12825 --
NM_001003799chr71584 1550 ----
NM_001003800chr9112840 2353 1410 969 962 906 665 657 583 445 219 42748 1427 842 355 1212 158
NM_001003845chr21558 131 1165 185
NM_001003940chr15163552 3539 3250 3129 3098 3088 3030 3017 2414 1186 1179 1060 1044 568 404 372 23440 623 23679 2930 21218 477
NM_001003942chr15163552 3539 3250 3129 3098 3088 3030 3017 2414 1186 1179 1060 1044 568 404 372 23440 623 23679 2930 21218 477
NM_001003943chr15163556 3543 3254 3133 3102 3092 3034 3021 2418 1190 1183 1064 1048 572 408 376 23444 627 23683 2934 21222 481
NM_001003962chr197502 480 467 441 431 400 163 --1149 --
NM_001004065chr963393 3225 530 390 239 197 1491 --1112
NM_001004106chr59979 938 748 679 655 647 404 151 134 1831 ----
NM_001004196chr331114 1035 168 --1831 --
NM_001004304chr1272620 2523 482 436 327 170 124 12727 12510 --
NM_001004342chr1165611 5586 5566 5118 5007 4881 4043 2379 2296 2277 1452 1435 1243 1021 899 243 --15538 11686
NM_001004419chr1243593 3587 1733 1147 24266 2808 ----
NM_001004720chr23412 162 57 1419 41059 380 352 192 --
NM_001004722chr24778 331 226 181 --21228 361 --
NM_001005209chr22658 104 --174 --
NM_001005271chr1781083 906 812 767 758 345 55 28 1307 ----
NM_001005273chr1781083 906 812 767 758 345 55 28 1307 ----
NM_001005290chr1171 2213 58 --142
NM_001005291chr17--123 ----
NM_001005375chrY21185 99 ----1636
NM_001005404chr1783881 3377 2909 2893 2818 2784 1677 728 21559 1294 125 --
NM_001005463chr10------133
NM_001005474chr331104 1016 211 ----11537
NM_001005502chr12165111 4972 4928 4853 4433 4061 3840 3789 3749 3476 1865 1695 1535 1450 971 653 33611 1313 441 ----
NM_001005505chr351615 1264 460 363 264 1473 31455 372 41 --
NM_001005609chrX123748 3672 3504 3467 3245 1478 809 767 611 334 142 125 --21503 1255 13301
NM_001005732chr21142 ------
NM_001005733chr21142 ------
NM_001005746chr21911 --1495 --
NM_001005747chr21911 --1495 --
NM_001005920chr164998 265 124 96 1153 1324 --
NM_001006115chr342165 788 211 198 1757 22767 2067 --
NM_001006932chr6143134 2914 2472 2302 2128 1278 996 860 796 650 398 84 61 22 23238 103 --23218 1031
NM_001007023chr1474888 4702 3342 1221 533 468 427 23860 3594 14333 14491
NM_001007073chr351120 780 710 416 176 ------
NM_001007074chr351120 780 710 416 176 ------
NM_001007097chr984909 4675 4587 4486 3669 3595 3508 3212 33517 3147 1114 14219 13606
NM_001007156chr1581836 1680 1534 1266 388 377 231 95 31861 1597 137 ----
NM_001007226chr1741448 963 949 288 ------
NM_001007227chr1741448 963 949 288 ------
NM_001007228chr1741448 963 949 288 ------
NM_001007229chr1741448 963 949 288 ------
NM_001007230chr1741448 963 949 288 ------
NM_001007466chr6105196 4429 4201 4131 3879 3156 1463 1414 233 42 24288 226 31536 803 83 --
NM_001007471chr9----2191 40 --
NM_001007559chr1841733 1685 1658 1393 158 11777 --
NM_001008220chr5133866 3488 3404 3266 3145 2809 2743 755 596 488 366 340 149 2377 238 33510 2451 573 --
NM_001008222chrX31246 313 269 21188 1092 1134 --
NM_001008239chr1842411 1244 651 474 --12852 --
NM_001008392chr363179 2274 2210 375 352 72 --1692 13491
NM_001008401chr1911076 11307 ----
NM_001008407chr7101799 1453 1338 1309 1192 559 279 244 102 42 2150 26 ----
NM_001008408chr7116059 5680 5295 4119 4088 1927 1682 1375 1255 1026 471 22409 944 15268 --
NM_001008495chr821581 907 12200 ----
NM_001008541chr1011951 11877 2696 492 --
NM_001008541chr1011951 11877 2696 492 --
NM_001008564chr1351987 756 671 299 194 1541 ----
NM_001008660chr1121458 138 169 ----
NM_001008701chr19162955 2706 2656 2553 2486 2398 1904 1127 1081 768 734 668 467 255 126 33 11215 ----
NM_001008738chr572930 2095 1917 1894 1870 1843 525 --11960 --
NM_001008801chr1941527 1500 1444 1417 11359 1564 --
NM_001008925chr433218 3042 2582 --11304 --
NM_001008938chr111327 178 ----
NM_001009552chr8------1593
NM_001009554chr443761 3645 1700 806 23955 179 ----
NM_001009554chr443761 3645 1700 806 23955 179 ----
NM_001009813chr19281 44 --124 --
NM_001009899chr3106314 5473 5449 4875 2090 2012 1907 1443 1395 1368 ----12358
NM_001009958chr7----1146 --
NM_001009993chr293459 3195 2779 1730 1700 1608 171 155 140 24202 146 ----
NM_001010861chr142704 2511 2225 2214 2230 211 ----
NM_001010867chr1236384 6153 5642 5400 5356 5253 5178 4615 4569 4530 4336 2223 2139 2096 1790 1713 1601 1585 1489 1366 1297 1037 976 24396 471 15297 --
NM_001010888chrX74497 3923 3568 705 570 527 325 ----24250 3336
NM_001010891chr5136830 5659 5638 5376 5239 5196 5121 4551 2656 2613 2538 1347 864 31623 1600 1256 15718 --
NM_001010895chr911385 1476 ----
NM_001010898chr1113275 3219 3124 3053 2411 1131 825 476 296 172 93 53188 2658 912 813 156 23669 2861 --
NM_001010917chr1082042 1785 1586 1573 1559 1446 495 305 22212 461 12126 --
NM_001010922chr184308 2768 1017 777 643 599 551 524 23859 1500 ----
NM_001010986chrX31887 1836 1629 12073 ----
NM_001011513chr482844 2612 1386 1340 775 729 690 133 21170 556 ----
NM_001011537chr332401 528 497 ------
NM_001011538chr431005 998 266 2793 719 ----
NM_001011546chr20--1332 ----
NM_001011658chrX61445 1401 409 366 111 50 ------
NM_001011666chr776135 5128 1546 1370 601 376 85 --45345 2378 1617 1234 --
NM_001011708chr222399 2306 ------
NM_001011720chr841431 1338 578 196 ------
NM_001011724chr131108 --182 --
NM_001011725chr131108 --182 --
NM_001012267chr931910 1890 449 21262 516 1353 11602
NM_001012393chr1133521 1534 166 14544 --21841 1777
NM_001012398chr161916 2900 418 ----
NM_001012415chr94577 251 40 33 ------
NM_001012420chr151879 1955 11924 --
NM_001012426chr6233348 3272 3027 2924 2794 2656 2581 2521 2398 2189 1258 1091 1078 938 911 855 831 711 502 386 144 113 54 32405 1064 342 33389 2838 873 --
NM_001012427chr6233348 3272 3027 2924 2794 2656 2581 2521 2398 2189 1258 1091 1078 938 911 855 831 711 502 386 144 113 54 32405 1064 342 33389 2838 873 --
NM_001012643chr195564 386 95 84 42 ------
NM_001012755chrX103380 3372 3116 1478 1298 1250 1222 1103 266 208 --13442 --
NM_001012756chr1972756 2495 2451 2376 810 793 728 ----13152
NM_001013031chr1052723 2672 2645 2556 396 ------
NM_001013399chr611164 ------
NM_001013690chr12182377 2321 2283 2228 2115 1858 1753 1675 1004 983 919 831 671 628 531 481 289 208 1256 185 --
NM_001013693chr1102558 2373 2303 2197 2003 1923 1133 969 930 602 11894 31983 840 778 --
NM_001013693chr1102558 2373 2303 2197 2003 1923 1133 969 930 602 11894 31983 840 778 --
NM_001013839chr17142451 2418 2134 2104 1827 1703 983 944 918 679 659 396 355 193 22212 580 --11967
NM_001014435chr161517 --1582 1485
NM_001014797chr1097893 7801 7618 6612 5400 2915 2391 1689 626 25524 1464 17596 11987
NM_001014839chr161045 960 844 372 121 26 1935 ----
NM_001014841chr161045 960 844 372 121 26 1935 ----
NM_001014987chr163379 229 111 ------
NM_001014988chr163379 229 111 ------
NM_001014989chr163379 229 111 ------
NM_001015053chr17101475 1030 1015 1007 427 312 216 170 150 109 31365 1247 580 11179 --
NM_001015877chrX1590 12296 11087 --
NM_001015881chrX41150 906 165 49 --1805 1112
NM_001017392chr1941346 1268 1261 307 21125 882 ----
NM_001017395chr343683 2985 2573 2456 33642 2276 1374 11226 --
NM_001017424chr161681 1207 759 696 573 257 --1686 --
NM_001017425chr161681 1207 759 696 573 257 --1686 --
NM_001017440chr7177918 7691 7629 7618 7463 6500 6400 5932 4987 2972 2840 2678 2521 1621 1097 739 334 57417 5602 5586 1882 325 45643 5127 980 520 --
NM_001017523chr1241791 1643 1345 317 11424 ----
NM_001017535chr12142704 2630 2564 2193 2165 2158 1982 1243 973 817 757 415 289 210 12010 32685 2378 142 182
NM_001017963chr14--1801 1592 1812
NM_001018050chr22103359 3316 3117 2741 2667 1251 1156 995 964 953 --32632 2410 2378 --
NM_001018052chr22103359 3316 3117 2741 2667 1251 1156 995 964 953 --32632 2410 2378 --
NM_001018065chr985121 4701 3988 3889 3729 2269 1220 867 42222 1528 376 283 2393 149 --
NM_001018066chr985121 4701 3988 3889 3729 2269 1220 867 42222 1528 376 283 2393 149 --
NM_001018067chr175263 4490 4170 4078 4006 3299 1749 23906 1896 ----
NM_001018068chr175263 4490 4170 4078 4006 3299 1749 23906 1896 ----
NM_001018069chr175263 4490 4170 4078 4006 3299 1749 23906 1896 ----
NM_001018072chr1241791 1643 1345 317 11424 ----
NM_001018074chr533418 1218 853 ------
NM_001018075chr533418 1218 853 ------
NM_001018076chr533418 1218 853 ------
NM_001018077chr533418 1218 853 ------
NM_001018089chr1553340 3271 1371 849 822 22487 1244 11455 --
NM_001018108chr1541398 921 838 219 32251 2098 101 ----
NM_001018111chr773878 3532 1147 994 619 567 539 53545 3240 2607 468 25 11197 11023
NM_001024094chr533418 1218 853 ------
NM_001024226chr13944 884 401 1473 1231 --
NM_001024227chr13944 884 401 1473 1231 --
NM_001024228chr13944 884 401 1473 1231 --
NM_001024401chr16192788 2774 2211 2195 2170 2115 1882 1848 1756 964 940 908 854 732 379 216 187 154 26 21006 137 ----
NM_001024455chrX61846 1705 1001 603 523 25 1569 ----
NM_001024647chr12156903 6599 5752 5384 5338 5299 2929 2890 2736 2290 2166 1715 1673 1492 1295 46051 5984 5166 2119 16796 --
NM_001024680chr221806 1721 11587 ----
NM_001024847chr332503 941 757 1605 ----
NM_001024858chr14102792 2685 2582 2386 2294 1879 918 551 233 56 22395 2149 12340 11951
NM_001024912chr1941775 1539 1279 482 157 11650 --
NM_001024948chr112857 ------
NM_001024956chr11145854 5608 5351 5095 1897 1872 1692 1676 1573 1353 1241 923 810 698 ----14037
NM_001025076chr1085700 5165 4952 4625 4550 2246 2014 1448 45006 2265 1958 81 --24963 2096
NM_001025077chr10107058 6523 6310 5983 5908 5104 4674 2806 1188 450 26364 1439 1172 16321
NM_001025081chr18133 ------
NM_001025090chr18133 ------
NM_001025092chr18133 ------
NM_001025101chr18133 ------
NM_001025108chr252930 2833 1003 712 84 1123 12877 14020
NM_001025158chr55572 433 393 107 21 1499 ----
NM_001025201chr21160 1551 ----
NM_001025266chr3124006 3828 3753 3134 1959 1870 1695 1620 1500 1224 812 573 --1675 13202
NM_001025366chr63614 523 140 11508 31476 679 655 1236
NM_001025366chr63614 523 140 11508 31476 679 655 1236
NM_001025367chr63614 523 140 11508 31476 679 655 1236
NM_001025367chr63614 523 140 11508 31476 679 655 1236
NM_001025368chr63614 523 140 11508 31476 679 655 1236
NM_001025368chr63614 523 140 11508 31476 679 655 1236
NM_001025369chr63630 539 156 11524 31492 695 671 1252
NM_001025369chr63630 539 156 11524 31492 695 671 1252
NM_001025370chr63614 523 140 11508 31476 679 655 1236
NM_001025370chr63614 523 140 11508 31476 679 655 1236
NM_001025580chrX43445 3316 2789 1364 23324 3302 --13796
NM_001025595chr411576 11601 ----
NM_001025603chr111106 1588 1141 1419
NM_001029858chr683186 2557 2377 1350 1307 1259 1232 210 ------
NM_001029863chr622272 1057 --21050 568 --
NM_001029875chr542403 2000 1879 746 12017 12334 --
NM_001029883chr282622 2607 2462 2139 1990 143 78 69 22666 2110 13006 --
NM_001030006chr1762480 2198 2160 1692 844 522 ----1113
NM_001031680chr1112070 956 721 663 622 466 320 311 228 209 135 22078 890 1998 1572
NM_001031681chr1782137 1941 1549 1503 1464 276 218 89 32172 2150 1728 2396 184 1412
NM_001031684chr231258 1039 84 ------
NM_001031685chr11251 --1845 --
NM_001031690chr783053 2162 1069 1022 808 465 168 116 2577 77 1789 --
NM_001031695chr22105418 5133 4988 4609 4251 4158 2016 1319 912 39 --15069 1806
NM_001031711chr571581 1286 1161 661 607 600 353 1671 --1503
NM_001031732chr432896 1182 921 13000 ----
NM_001031740chr181662 1616 1577 1067 590 274 206 41 11443 1679 --
NM_001031804chr1621508 1191 34290 3270 376 ----
NM_001032221chr941287 699 597 101 ----11192
NM_001032282chr8142 ------
NM_001032296chr1392535 2528 2461 2429 2397 1169 739 218 125 --22562 2166 --
NM_001032363chr1102253 2207 2175 2168 1797 1721 1470 885 878 22 22036 129 11972 --
NM_001032363chr1102253 2207 2175 2168 1797 1721 1470 885 878 22 22036 129 11972 --
NM_001032999chr20194935 4924 4647 3838 3586 3446 3425 3404 3291 2109 2102 1776 1738 1652 1520 1477 1402 1262 354 64608 3657 1963 747 466 36 ----
NM_001033044chr161840 1739 1706 740 134 72 ------
NM_001033045chr2114208 3307 3261 3222 1522 1380 1351 1299 599 521 514 33089 1223 378 ----
NM_001033056chr161840 1739 1706 740 134 72 ------
NM_001033081chr151407 1261 1173 351 282 1247 1185 11328
NM_001033082chr151407 1261 1173 351 282 1247 1185 11328
NM_001033087chr2032201 1091 140 1450 12069 --
NM_001033117chr3194594 4503 4351 4232 4123 4077 3409 3117 3050 1860 1666 1651 1581 1228 1005 819 174 85 52 24610 238 ----
NM_001033507chr131668 1623 799 1156 1620 11530
NM_001033551chr17183693 3630 3424 3414 3245 1640 1610 1454 1346 1255 991 904 617 391 359 315 282 86 21381 642 13268 --
NM_001033756chr63548 457 74 11442 31410 613 589 1170
NM_001033756chr63548 457 74 11442 31410 613 589 1170
NM_001034025chr124766 698 284 156 1353 3126 88 49 --
NM_001034841chr1664223 4057 3927 3369 2206 1855 24746 2149 14176 14720
NM_001034954chr1051307 998 430 416 346 ----12027
NM_001034955chr1051307 998 430 416 346 ----12027
NM_001034956chr1051307 998 430 416 346 ----12027
NM_001034957chr1051307 998 430 416 346 ----12027
NM_001035chr11221 --1360 --
NM_001035003chr421117 93 ------
NM_001035004chr421117 93 ------
NM_001035254chr9102553 2516 2110 1710 984 901 844 806 790 205 41606 799 704 651 21845 328 --
NM_001035534chr9101342 1331 1250 1140 1099 1041 400 377 66 55 ------
NM_001037132chr72389 154 ------
NM_001037133chr72389 154 ------
NM_001037317chr142704 2511 2225 2214 2230 211 ----
NM_001037324chr31498 1199 ----
NM_001037331chr18------1287
NM_001037334chr1842390 544 493 68 ------
NM_001037494chr12----127 --
NM_001037495chr12----127 --
NM_001037553chr21123945 3911 3550 3482 3336 1141 1124 1063 716 649 498 46 31290 484 205 13173 --
NM_001037582chr481711 1301 1109 654 623 575 318 243 --1362 --
NM_001037631chr2----1113 --
NM_001037954chr1192871 2839 2832 2730 1103 814 522 419 59 12692 ----
NM_001038640chr15--21028 22 ----
NM_001038707chr151594 886 850 252 52 1639 12056 --
NM_001038707chr151594 886 850 252 52 1639 12056 --
NM_001039140chr202463 34 ------
NM_001039199chr20105031 3715 3669 3630 1639 1507 1461 1422 531 236 11290 --1731
NM_001039350chr741434 1210 349 243 --11276 --
NM_001039459chr74765 425 302 166 --146 --
NM_001039479chr1452326 2253 1780 1765 319 ----11605
NM_001039538chr233437 3368 2763 12938 ----
NM_001039547chr3167579 7540 7318 7286 7279 6515 6378 5729 5683 5644 5146 2771 2728 2653 2217 1819 77989 7407 5510 5368 3168 2987 2088 21907 1081 --
NM_001039577chr174421 3770 3581 3288 3143 1473 66 21804 1450 ----
NM_001039590chrX93628 3562 3441 3224 1157 1045 765 743 42 ------
NM_001039591chrX93628 3562 3441 3224 1157 1045 765 743 42 ------
NM_001039619chr14----1250 --
NM_001039690chr16111925 1808 956 732 693 618 414 372 366 259 217 --11507 1248
NM_001039709chr20194935 4924 4647 3838 3586 3446 3425 3404 3291 2109 2102 1776 1738 1652 1520 1477 1402 1262 354 64608 3657 1963 747 466 36 ----
NM_001039711chr121122 1028 11130 ----
NM_001039712chr121122 1028 11130 ----
NM_001039716chr14442 214 167 26 --1137 --
NM_001039771chr1481088 891 466 415 399 332 221 209 1929 132 --
NM_001039775chr1123 ------
NM_001039840chrX55735 5253 4040 1880 1703 ------
NM_001039847chr19----146 --
NM_001039960chr1241653 1359 1297 538 --2297 178 --
NM_001040002chr1761238 1164 1156 299 186 91 1145 1575 --
NM_001040031chr19188 ------
NM_001040056chr167746 547 281 261 170 146 47 ------
NM_001040108chr1482988 2965 2854 2736 2211 2121 678 106 12956 ----
NM_001040110chr761468 1367 1290 709 578 538 21819 630 2493 451 --
NM_001040142chr252002 1894 690 266 179 21661 885 ----
NM_001040143chr252002 1894 690 266 179 21661 885 ----
NM_001040144chr16111925 1808 956 732 693 618 414 372 366 259 217 --11507 1248
NM_001040146chr16111925 1808 956 732 693 618 414 372 366 259 217 --11507 1248
NM_001040151chr11124224 4044 3937 3654 3584 3486 3252 2877 1745 1248 1038 955 --12852 --
NM_001040152chr7114854 4359 3632 2014 1441 839 653 594 510 329 255 --1991 1971
NM_001040153chr13----162 --
NM_001040159chr41469 11382 ----
NM_001040172chr551445 1341 132 86 21 1165 --11037
NM_001040173chr551445 1341 132 86 21 1165 --11037
NM_001040179chr61236 1950 --1722
NM_001040202chr422318 870 1887 ----
NM_001040214chr62595 355 21726 702 ----
NM_001040272chr9122211 2156 1891 1828 1626 1571 954 706 581 543 532 314 ----12289
NM_001040284chr1644285 2058 1455 134 34879 3886 695 ----
NM_001040402chr443135 2767 968 307 ----11105
NM_001040436chr124621 575 536 127 1402 ----
NM_001040439chr16121206 1129 1075 961 590 531 515 491 295 260 145 63 1351 ----
NM_001040450chr1542850 2811 1984 1818 12677 ----
NM_001040453chr1542850 2811 1984 1818 12677 ----
NM_001040624chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040625chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040626chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040627chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040628chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040629chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040630chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_001040665chr744368 4293 3175 1971 11389 ----
NM_001040708chr8144 1794 ----
NM_001040712chr933345 2452 2395 13286 ----
NM_001040715chr1631172 1065 241 1359 ----
NM_001042371chr1671980 1867 714 676 657 644 463 1494 1375 11303
NM_001042413chr963969 1018 948 716 312 30 ------
NM_001042424chr492814 2478 2440 2367 1084 420 245 209 28 31103 1040 170 22716 96 --
NM_001042437chr21814 2883 684 ----
NM_001042479chrX41326 842 803 130 1672 123 --
NM_001042480chrX41326 842 803 130 1672 123 --
NM_001042486chr2071468 1168 545 522 419 295 175 --1975 --
NM_001042494chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_001042495chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_001042496chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_001042497chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_001042533chr343275 2869 2708 246 ----1599
NM_001042537chrX32487 418 80 ------
NM_001042539chr163958 952 154 ------
NM_001042555chr1242987 2908 1282 1239 21217 442 ----
NM_001042599chr287795 2847 2006 1602 1259 1070 528 116 2558 543 ----
NM_001042601chr322649 2056 --12050 --
NM_001042603chr12105181 5118 4865 4677 4044 1802 1379 797 568 350 14668 --11766
NM_001042604chr344151 3511 2969 1751 21767 1152 13264 --
NM_001042632chr20102071 2005 1865 1631 1043 889 620 372 350 35 ------
NM_001042633chr20102071 2005 1865 1631 1043 889 620 372 350 35 ------
NM_001042681chr1102593 2070 1682 1675 829 763 601 332 258 38 ------
NM_001042682chr1102593 2070 1682 1675 829 763 601 332 258 38 ------
NM_001042682chr1102593 2070 1682 1675 829 763 601 332 258 38 ------
NM_001042683chr631600 1215 520 ----187
NM_001043318chr1493590 3323 3238 2720 2645 1351 1142 481 121 23285 1398 52764 1450 1430 660 287 --
NM_001043351chr141646 1509 476 44 --21690 189 --
NM_001044385chr292884 2712 2460 1585 1263 942 840 755 586 13601 --135
NM_001046chr532044 1916 1090 ------
NM_001079874chr1--31924 540 443 1495 --
NM_001087chr21124 ------
NM_001092chr17112014 1991 1569 708 497 377 309 191 184 64 48 42314 2295 2240 354 --22182 102
NM_001095chr12131728 1508 1357 1304 1232 744 540 489 470 371 288 281 65 ------
NM_001099678chr3115886 5735 4985 4939 4907 4900 4671 4505 4000 2180 1749 ----1701
NM_001100108chr1177919 7837 6296 6250 6214 5937 5931 5661 5640 5615 5576 2541 2174 2033 1125 710 362 46083 5765 5443 340 22555 1032 --
NM_001106chr3168062 7338 7307 7175 6908 6673 6498 6216 3499 2840 2638 2155 2051 421 301 31 57105 6756 6696 3781 3664 27968 6521 --
NM_001113490chrX33036 2808 583 ------
NM_001117chr184993 686 582 550 --12301 11674
NM_001124chr111588 ------
NM_001140chr173516 473 441 --1149 --
NM_001144chr1641203 1026 957 21 --1376 --
NM_001146chr8--1111 ----
NM_001148chr43769 181 107 1120 ----
NM_001149chr1021400 1099 ------
NM_001163chr93967 927 258 2978 106 1405 --
NM_001167chrX146261 6176 5898 5634 5548 5426 4719 4268 4222 4183 2148 1967 1892 1257 26044 4668 1967 12641
NM_001174chrX92305 807 775 769 663 516 361 137 102 ------
NM_001189chr42757 128 --1122 --
NM_001191chr2061487 1426 1165 1058 135 66 ------
NM_001198chr642011 755 331 88 ------
NM_001200chr20189 1276 1991 --
NM_001204chr297037 6502 6395 6330 5912 5075 5026 4987 1962 14855 --15252
NM_001206chr9--22168 626 ----
NM_001222chr1051778 1650 1636 593 32 ------
NM_001226chr44665 263 224 52 2435 85 ----
NM_001233chr722322 91 ------
NM_001259chr775443 5213 1827 1744 1245 337 114 75486 5145 4773 2453 1131 609 69 15336 --
NM_001268chr131166 ----1404
NM_001271chr1562969 2796 2260 310 224 174 12977 ----
NM_001273chr122138 64 --1468 --
NM_001282chr1762480 2198 2160 1692 844 522 ----1113
NM_001293chr112554 446 ------
NM_001300chr10181 --1111 --
NM_001304chr1783619 3105 2919 2763 2674 2498 1025 379 127 1915 --
NM_001310chr1222987 465 22749 552 ----
NM_001319chr1981005 952 888 794 740 405 358 94 ----1853
NM_001343chr541545 1234 108 29 ------
NM_001346chr322104 864 21866 523 ----
NM_001351chr321622 1154 ----1541
NM_001364chr1174665 3923 3507 2940 1691 1654 1252 34305 3627 304 13458 --
NM_001386chr841608 845 387 302 --1573 --
NM_001387chr562940 2774 2599 2436 1126 164 --12066 --
NM_001390chr1852305 2253 2229 1242 618 ----33237 2720 164
NM_001396chr212546 264 ----11941
NM_001397chr1122262 2030 1998 1984 1904 1629 1006 754 688 581 99 83 32487 2157 1978 21801 64 --
NM_001399chrX123748 3672 3504 3467 3245 1478 809 767 611 334 142 125 --21503 1255 13301
NM_001401chr921164 632 --11562 --
NM_001404chr11----122 --
NM_001406chr17121641 1521 1317 1131 700 678 635 317 290 268 130 112 21257 445 133 --
NM_001407chr371662 1566 1359 649 397 124 109 ------
NM_001408chr141117 533 396 47 21504 1234 1646 --
NM_001412chrX63345 3208 3066 1000 678 407 ------
NM_001417chr12177 1738 11559 --
NM_001419chr19104812 4493 4478 3358 3293 3058 1815 658 572 523 11276 33459 3418 3229 11006
NM_001420chr1992925 2462 1219 1114 1074 894 748 498 402 1414 12794 --
NM_001431chr6194 ------
NM_001438chr113392 23527 2883 12404 --
NM_001458chr77702 664 149 92 41 28 22 ------
NM_001460chr153648 3333 2765 1030 57 --13381 --
NM_001465chr542041 1865 816 197 ------
NM_001493chrX6665 517 507 497 132 32 162 ----
NM_001508chr26785 740 372 357 340 42 ----1622
NM_001520chr164580 554 504 30 ------
NM_001543chr5164765 4352 4183 3582 3509 3425 3061 1925 1213 1107 824 813 673 542 243 154 43394 3220 3131 3086 ----
NM_001566chr2160 ------
NM_001606chr95588 269 144 89 46 --2610 213 --
NM_001609chr1064292 4046 730 472 333 306 ------
NM_001610chr118757 682 548 302 295 149 126 79 ----1176
NM_001616chr252633 2361 1364 1115 861 --12182 --
NM_001620chr113578 562 211 2766 106 ----
NM_001621chr732221 2145 2138 22431 2006 ----
NM_001621chr732221 2145 2138 22431 2006 ----
NM_001650chr1831370 650 130 --12669 --
NM_001654chrX2300 34 1357 ----
NM_001655chr1192011 1636 645 602 558 468 420 393 287 ------
NM_001658chr13944 884 401 1473 1231 --
NM_001659chr1262549 1848 1651 968 651 66 32370 1689 130 ----
NM_001660chr3------1634
NM_001665chr112368 74 --1522 --
NM_001678chr1741337 1277 1152 1133 11612 1156 --
NM_001682chr12----1235 --
NM_001684chr193933 3535 3328 3210 2711 2690 1437 1413 1294 11449 1215 22755 1394
NM_001706chr3131 ------
NM_001709chr1142135 1977 1844 1161 ----12450
NM_001714chr12----174 --
NM_001717chr154537 465 324 296 --11457 --
NM_001742chr751461 1184 655 299 233 11219 1694 --
NM_001749chr197502 480 467 441 431 400 163 --1149 --
NM_001754chr2184280 4195 3919 1198 948 220 185 109 23003 274 --12907
NM_001759chr1274552 4425 3552 1072 829 554 121 14860 11744 --
NM_001774chr19188 ------
NM_001800chr19--122 ----
NM_001810chr206775 760 752 744 557 31 ------
NM_001822chr21160 1551 ----
NM_001830chrX62950 2699 2513 1121 897 591 1865 12930 11464
NM_001839chr1--1733 1570 --
NM_001845chr132856 504 21134 530 ----
NM_001858chr634158 798 243 25164 898 --24567 637
NM_001859chr9113813 3767 3728 3530 1105 814 761 715 683 676 472 23319 541 12657 --
NM_001874chr12165111 4972 4928 4853 4433 4061 3840 3789 3749 3476 1865 1695 1535 1450 971 653 33611 1313 441 ----
NM_001893chr171294 --1136 --
NM_001894chr223799 463 297 1188 --1119
NM_001896chr16--1340 ----
NM_001901chr62425 399 ------
NM_001918chr1228682 8636 8600 6780 6686 6647 6521 6262 5682 2858 2840 2605 1996 1964 1957 1872 1787 1511 545 460 341 57 59303 6076 3048 1645 326 12561 17900
NM_001920chr121637 ------
NM_001923chr111231 ------
NM_001936chr741434 1210 349 243 --11276 --
NM_001939chrX103569 1492 1336 1229 1109 1014 580 457 276 66 1760 --23287 413
NM_001949chr622135 1189 1589 ----
NM_001954chr63569 156 40 --2800 245 --
NM_001955chr62685 373 1252 ----
NM_001967chr3--2562 531 ----
NM_001970chr17----1184 --
NM_001978chr85976 953 899 858 61 2688 151 1420 --
NM_001980chr126714 615 476 428 401 38 --1520 1105
NM_001987chr12133811 3386 2980 2862 1703 1609 1552 1291 748 458 116 38 23 31658 1026 792 23777 3148 1184
NM_001999chr5122 137 1564 11379
NM_002006chr485116 4981 2163 1986 1409 767 239 131 2582 160 1226 --
NM_002009chr15--21972 33 ----
NM_002015chr1322894 2771 ------
NM_002017chr11--1239 ----
NM_002025chrX128590 6474 5682 5642 3613 2866 2849 2229 1731 1469 1025 432 11925 --25886 1877
NM_002035chr1843384 3338 3306 2804 13158 12558 --
NM_002054chr2----1438 --
NM_002061chr171949 1865 1587 1474 1428 1389 731 21732 1258 ----
NM_002063chrX11205 --1908 --
NM_002065chr161840 1739 1706 740 134 72 ------
NM_002077chr982157 1797 1499 1356 551 265 259 231 1406 ----
NM_002080chr161884 ----1136
NM_002082chr58942 901 711 642 618 367 114 97 1794 ----
NM_002084chr51123 1841 ----
NM_002086chr1771969 1670 876 792 546 533 327 1664 1720 --
NM_002092chr4104770 4682 4639 4564 4241 4217 4189 3630 1225 190 --14444 14929
NM_002093chr3------160
NM_002114chr61161 ------
NM_002130chr521084 471 ------
NM_002134chr164529 523 488 65 1565 ----
NM_002136chr121108 --182 --
NM_002139chrX132 ----1524
NM_002146chr172924 109 21018 266 11314 --
NM_002189chr106587 540 485 238 231 21 1131 ----
NM_002193chr251738 639 568 383 63 ------
NM_002199chr42184 175 ------
NM_002202chr5--1438 190 1233
NM_002203chr571464 1377 1008 886 750 268 42 11438 --13338
NM_002205chr1213965 815 736 693 683 664 658 404 377 264 248 242 124 --21009 629 --
NM_002228chr12952 163 ------
NM_002233chr11--135 ----
NM_002247chr10154 --12309 --
NM_002253chr41210 ------
NM_002254chr252330 1984 1863 1618 298 --11497 --
NM_002270chr523751 77 14065 ----
NM_002271chr1362036 1767 683 584 577 560 --1350 1449
NM_002282chr121215 ------
NM_002285chr252930 2833 1003 712 84 1123 12877 14020
NM_002290chr621184 977 ------
NM_002296chr1142 11474 ----
NM_002298chr1321487 1461 152 11133 --
NM_002309chr2272859 2799 2357 2347 839 372 88 22937 394 32943 2790 2450 --
NM_002332chr124680 638 511 78 ------
NM_002336chr1234489 3432 1502 2867 751 1294 --
NM_002350chr84830 800 200 142 1225 ----
NM_002356chr642427 2389 838 613 ------
NM_002359chr17103926 3811 3775 3251 3194 1625 587 572 457 377 23796 468 --13118
NM_002373chr1551337 1275 1195 464 40 2910 274 ----
NM_002374chr233437 3368 2763 12938 ----
NM_002375chr352261 1983 1753 745 353 ------
NM_002382chr1441043 1027 389 349 --11100 --
NM_002383chr162781 775 ------
NM_002384chr183669 239 167 2640 384 ----
NM_002385chr18133 ------
NM_002387chr554038 3917 1498 1038 193 34539 463 259 11821 --
NM_002390chr1761955 1902 1597 623 410 238 --2348 72 --
NM_002399chr15--11323 1200 --
NM_002401chr17122371 2160 1891 1780 868 694 511 334 240 216 203 119 12108 1754 --
NM_002419chr115494 464 339 211 30 ------
NM_002429chr1251531 1265 1212 237 187 11493 ----
NM_002430chr2272116 986 918 854 776 694 576 ------
NM_002442chr1291348 1311 1299 614 289 246 155 84 30 11334 ----
NM_002473chr2251237 928 279 251 201 ------
NM_002480chr12--1295 149 --
NM_002481chr1207537 7367 7247 7030 6413 6363 6182 5899 5772 5630 5359 2297 2251 2219 2212 1757 1374 1357 314 284 26981 2079 36201 642 397 21796 597
NM_002489chr7--1410 ----
NM_002501chr19174018 3637 3442 3328 3211 3052 2943 1488 1399 947 848 623 610 373 225 191 124 23181 2998 1175 --
NM_002508chr14380 321 286 109 11591 21599 116 --
NM_002509chr204809 318 49 36 --1200 --
NM_002515chr1421599 1532 11513 ----
NM_002522chr1753151 2480 1480 913 791 21132 967 11077 --
NM_002524chr12962 136 ------
NM_002539chr21244 ------
NM_002545chr1133521 1534 166 14544 --21841 1777
NM_002547chrX94180 3923 2872 2807 1707 1623 1199 985 119 --1971 --
NM_002553chr7--1132 163 --
NM_002558chr1791140 1134 1103 1057 285 225 219 111 68 --21075 874 --
NM_002569chr15121437 1390 1362 1109 470 386 333 276 270 264 171 98 21502 213 11379 --
NM_002581chr9105515 3967 3873 2180 1429 1233 1170 622 445 145 11382 --11779
NM_002586chr631410 1130 607 ------
NM_002588chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_002594chr203786 606 40 --1663 183
NM_002596chr161374 1300 1062 1017 976 933 1186 ----
NM_002599chr1141044 965 151 28 1832 ----
NM_002609chr5111783 1574 1544 673 656 536 512 480 458 303 260 21352 1225 --21552 55
NM_002616chr179516 505 439 432 422 207 157 109 73 ------
NM_002628chr3------125
NM_002645chr11----1453 --
NM_002646chr131506 572 114 ----124
NM_002655chr824700 4237 13918 24672 974 --
NM_002657chr2073517 3060 2970 2878 2798 2737 1497 22534 569 ----
NM_002660chr2041000 870 333 197 1129 ----
NM_002668chrX1151 188 ----
NM_002698chr1982871 2612 2576 1027 812 805 672 630 62724 1079 695 170 136 107 ----
NM_002709chr253325 2679 2609 626 290 --184 12692
NM_002714chr64976 793 429 102 --1250 --
NM_002715chr51520 ----1362
NM_002716chr1193540 3481 3391 2972 2949 1255 1248 889 354 22748 875 13121 --
NM_002719chr1441642 553 243 146 ------
NM_002725chr1194440 4161 3976 3382 3294 3148 3048 2963 1611 1527 1355 1312 1256 1091 1061 928 186 103 53 32829 1388 517 44426 457 217 202 --
NM_002730chr1991135 979 968 384 344 278 269 261 160 1915 ----
NM_002731chr182562 2349 2158 1096 766 617 97 34 --12825 --
NM_002733chr121224 ------
NM_002734chr17--1306 1792 --
NM_002737chr17185946 5865 5752 5116 5081 4969 4793 4718 4095 2518 2310 2256 2167 1997 1171 824 39 32 21914 604 25307 4837 --
NM_002742chr141601 1709 1587 --
NM_002745chr2294572 3470 1775 1539 1299 654 443 89 63 11789 14383 21492 708
NM_002748chr151143 --1788 --
NM_002776chr19101991 1962 1531 1390 1284 591 91 59 51 28 --21334 273 --
NM_002811chr16----1505 --
NM_002814chrX148 ------
NM_002822chr1221750 46 11774 ----
NM_002829chr941114 1011 794 127 1352 1967 --
NM_002833chr1521340 1078 31384 223 125 ----
NM_002834chr1262685 1265 890 668 493 455 ------
NM_002839chr933345 2452 2395 13286 ----
NM_002841chr31218 --198 --
NM_002843chr1142990 1008 752 555 12467 ----
NM_002845chr182617 575 1176 ----
NM_002850chr1961192 383 365 188 179 87 --2881 438 --
NM_002855chr11183559 3532 3406 3008 2642 2434 2358 1457 1440 1288 856 750 685 576 462 155 109 42 43625 3348 2533 2366 --22943 2838
NM_002857chr151895 1777 1669 247 32 12435 2883 697 12198
NM_002859chr1261633 1379 275 77 64 35 1642 1458 --
NM_002865chr8173 ------
NM_002867chr12116 83 2680 178 148 1192
NM_002868chr1272316 1803 1758 942 936 738 445 175 22023 1896 --
NM_002869chr11----1437 --
NM_002874chr952012 1773 1734 390 317 21600 897 ----
NM_002885chr15869 810 343 236 79 2925 696 1821 --
NM_002886chr384784 4609 4303 3325 1944 1134 1069 130 11026 24166 1060 --
NM_002890chr5----1334 --
NM_002892chr1421467 526 126 1372 --
NM_002895chr204930 914 889 801 ------
NM_002906chr11--12316 ----
NM_002912chr61308 ------
NM_002918chr1981033 701 413 309 295 239 96 90 --1260 --
NM_002938chr461692 772 724 422 340 188 --1432 11434
NM_002941chr311417 1253 ----
NM_002955chr651691 1661 1577 1555 1231 --11265 --
NM_002957chr9203173 3009 2728 2713 2680 2659 2619 2500 1570 1347 1265 1176 810 799 543 463 333 250 195 70 12692 21499 1231 --
NM_002959chr1103970 3674 3631 3430 3379 3313 3236 3160 2832 877 13666 1107 125
NM_002996chr1681541 1330 784 477 452 316 285 228 --11592 --
NM_002998chr822247 2011 1740 ----
NM_003009chr191269 149 138 --
NM_003010chr174737 581 158 97 11972 ----
NM_003012chr842579 527 124 74 21185 874 ----
NM_003013chr44578 113 98 72 1157 ----
NM_003022chrX11303 11025 ----
NM_003028chr9113639 3575 3112 1537 914 833 827 590 367 215 76 22896 841 11044 11564
NM_003030chr31550 --21446 45 --
NM_003038chr271913 1685 778 766 495 172 124 --31897 1641 57 12683
NM_003043chr393691 3390 3361 3034 3015 1358 1325 1205 571 63943 3433 3305 3063 1039 950 33418 1597 866 22851 1267
NM_003045chr13114448 4207 4095 3572 3491 3294 1777 911 430 293 155 34415 3783 486 14261 1445
NM_003047chr171017 983 552 387 372 266 91 1150 ----
NM_003048chr252605 1938 761 478 37 12692 ----
NM_003051chr131771 1647 42 1538 ----
NM_003062chr5138 ------
NM_003070chr9----165 --
NM_003074chr332015 1835 188 ------
NM_003076chr1251070 578 409 374 197 --11620 --
NM_003077chr173650 124 25 ------
NM_003081chr20--1826 ----
NM_003088chr771169 901 895 868 725 416 402 1843 ----
NM_003091chr201195 ------
NM_003101chr111013 --11415 --
NM_003108chr265544 2723 2519 2346 1829 311 --16475 --
NM_003128chr212303 154 ----
NM_003131chr682222 1868 1852 1726 1520 681 195 153 --11987 --
NM_003136chr14258 29 ------
NM_003139chr117935 693 637 371 275 245 223 ------
NM_003144chr64795 758 591 362 ------
NM_003145chr13151 60 38 --1428 --
NM_003149chr351529 563 499 363 190 31229 1067 507 1101 --
NM_003150chr1772210 2023 1875 1773 1730 1480 754 31928 625 328 --11702
NM_003155chr852507 1986 1054 1040 326 22219 373 --11894
NM_003156chr113329 289 282 1405 ----
NM_003161chr1733131 2251 1037 1445 1735 --
NM_003173chrX41257 1107 457 197 --1322 --
NM_003174chr101295 ------
NM_003175chr1129 ------
NM_003178chr342204 1670 1570 735 --1880 --
NM_003181chr6--1179 186 --
NM_003189chr163314 2533 2434 2360 2203 492 23209 2234 42621 1092 631 513 1375
NM_003202chr581599 1560 1325 1247 560 519 278 128 21426 220 ----
NM_003211chr1271179 1083 614 524 497 350 229 ------
NM_003214chr6111384 1275 1113 926 903 568 491 264 212 124 117 31143 316 148 21324 1063 --
NM_003216chr2283217 3156 1159 790 628 352 273 145 --1245 --
NM_003221chr6103082 2786 2587 2568 1640 1594 824 650 642 613 ------
NM_003242chr332503 941 757 1605 ----
NM_003250chr171428 2153 106 ----
NM_003253chr211400 ------
NM_003254chrX------198
NM_003255chr17112008 1677 939 842 763 701 695 679 343 287 65 1540 ----
NM_003257chr1511206 1392 ----
NM_003262chr375121 4523 4474 4447 3469 3322 1749 1645 14567 14138
NM_003275chr941437 1398 521 307 1281 --11150
NM_003289chr9127 ------
NM_003298chr385462 5154 4530 4505 3986 2357 2271 1555 25003 874 23823 692 11256
NM_003305chr4--1360 ----
NM_003317chr144709 702 570 23 1547 ----
NM_003322chr62291 158 181 ----
NM_003326chr162526 1862 1775 655 226 100 --1941 --
NM_003329chr9----195 --
NM_003335chr3----125 --
NM_003338chr10--1617 ----
NM_003339chr51256 1212 ----
NM_003340chr42246 181 ----11119
NM_003342chr1752342 2334 2107 2031 767 13128 ----
NM_003344chr711224 --11400 --
NM_003347chr2262226 1997 1858 912 625 505 124 ----
NM_003350chr81106 ------
NM_003363chr32547 167 ----1616
NM_003369chr1122650 154 --11915 22785 643
NM_003371chr982070 1310 651 429 243 109 86 52 11550 1442 11528
NM_003373chr1051564 755 413 406 78 31616 1419 578 ----
NM_003374chr52695 643 ------
NM_003376chr63614 523 140 11508 31476 679 655 1236
NM_003376chr63614 523 140 11508 31476 679 655 1236
NM_003380chr10--1274 ----
NM_003381chr63775 738 42 ------
NM_003387chr252546 2261 2137 683 291 --1174 1892
NM_003390chr11173 --1403 --
NM_003392chr364200 3601 3527 1348 934 328 1521 122 --
NM_003404chr2031512 182 129 11919 ----
NM_003409chr18--2345 235 ----
NM_003410chrX62756 2256 2217 1217 1043 991 ------
NM_003445chr195767 744 520 328 184 ------
NM_003458chr3103263 3188 2751 1228 1185 1124 799 781 726 536 33215 2873 1037 ----
NM_003459chr26167 161 155 149 143 43 158 ----
NM_003463chr632716 2701 2492 ----1363
NM_003466chr262066 814 508 490 443 288 32479 971 118 21789 46 --
NM_003468chr264102 3980 3325 1639 565 185 ------
NM_003472chr611418 --1998 --
NM_003473chr10193 ------
NM_003482chr12112660 2459 2323 1083 1020 961 620 311 237 124 100 ------
NM_003483chr1212197 22540 31 ----
NM_003489chr212942 453 13241 ----
NM_003557chr121368 516 175 ----
NM_003563chr1741448 963 949 288 ------
NM_003565chr1281312 1262 1086 637 623 422 392 252 1266 1458 --
NM_003566chr1243352 1322 1279 1219 12431 ----
NM_003575chr751559 1519 1373 181 82 11039 1202 11404
NM_003576chr1392535 2528 2461 2429 2397 1169 739 218 125 --22562 2166 --
NM_003581chr23412 162 57 1419 41059 380 352 192 --
NM_003583chr1231047 954 595 12449 13613 --
NM_003590chr223329 448 ------
NM_003602chr74454 305 299 74 ------
NM_003603chr41345 ------
NM_003607chr183798 3453 3366 3104 1413 1324 403 175 33927 3660 1352 ----
NM_003612chr155492 474 155 66 42 --1126 --
NM_003615chr313600 13177 ----
NM_003617chr143779 1868 435 348 34249 3624 1124 ----
NM_003624chr1971286 1205 1030 937 474 439 345 11294 11339 --
NM_003626chr1161201 1059 963 493 267 83 ------
NM_003629chr143161 3055 2341 1192 13202 22667 193 --
NM_003632chr175789 306 110 48 30 ------
NM_003633chr522141 1931 11872 ----
NM_003644chr17226459 6088 5885 5449 5226 4697 4668 4593 4469 4436 4297 4065 2086 1334 790 742 548 477 359 186 157 147 16029 25305 841 --
NM_003646chr117585 387 216 168 156 150 105 --1439 --
NM_003651chr12--1217 ----
NM_003659chr21357 1960 ----
NM_003663chr343077 2585 1189 210 1501 ----
NM_003664chr51409 ------
NM_003670chr341104 899 448 307 ------
NM_003671chr983167 2933 2733 2236 687 281 207 194 12678 ----
NM_003679chr183222 2463 1227 924 876 832 368 220 12501 ----
NM_003680chr13473 239 170 --1579 --
NM_003684chr1--1718 1310 --
NM_003686chr1136 ------
NM_003704chr4------1566
NM_003709chr2------1287
NM_003712chr19369 55 41 ------
NM_003735chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_003736chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_003743chr262171 1944 1804 1742 1576 400 ------
NM_003746chr12----127 --
NM_003748chr181177 901 560 527 441 286 75 26 ------
NM_003759chr473926 3890 3874 3618 3226 2711 2629 ------
NM_003760chr12776 555 ------
NM_003763chr2083018 2636 2321 2275 2236 2165 1092 866 12683 22411 839 --
NM_003768chr141860 1446 739 420 1568 ----
NM_003774chr1262667 2365 1235 1133 819 173 11060 --22615 107
NM_003787chr1821087 215 --1335 --
NM_003792chr93127 106 31 ------
NM_003800chr642214 1991 698 435 --1235 --
NM_003822chr143197 2547 2503 2280 1510 1567 --
NM_003829chr9136 ------
NM_003861chr1442721 2362 2013 1014 12349 12052 12884
NM_003872chr252065 2040 648 513 114 2608 40 ----
NM_003873chr1032093 1665 419 --1413 --
NM_003884chr311610 ------
NM_003887chr261825 933 917 432 354 141 --1503 --
NM_003888chr1571565 1405 1354 1337 268 69 28 ------
NM_003893chr102482 173 --124 --
NM_003896chr21814 2883 684 ----
NM_003899chr13102494 2384 2095 1861 1626 710 664 418 187 81 ------
NM_003902chr1--1247 ----
NM_003913chr623641 2685 24002 100 11427 --
NM_003922chr15----1321 --
NM_003927chr181370 ----1705
NM_003939chr10144109 3923 3913 3381 1533 1217 1119 522 471 464 304 183 111 31 33322 2617 1586 11605 31404 1000 199
NM_003941chr722318 1971 12014 ----
NM_003949chr17101847 1773 1566 1497 1436 582 461 394 244 44 --11543 --
NM_003955chr1741500 1034 291 220 11060 ----
NM_003958chr693697 3310 3245 3123 2917 2745 1190 966 486 --22478 1058 --
NM_003966chr5127508 6181 5859 5389 4757 2943 1908 1743 1192 1142 565 37 17664 11240 --
NM_003971chr171422 ------
NM_003972chr1011244 ----11354
NM_003980chr621311 1083 --1564 --
NM_003983chr1694057 4003 3961 3900 3477 3142 2766 985 168 22906 800 11625 --
NM_003987chr10172183 2177 2141 2074 1995 1771 1729 857 830 808 566 426 309 298 235 124 112 2780 706 22068 801 --
NM_003988chr10172260 2254 2218 2151 2072 1848 1806 934 907 885 643 503 386 375 312 201 189 2857 783 22145 878 --
NM_003989chr10172119 2113 2077 2010 1931 1707 1665 793 766 744 502 362 245 234 171 60 48 2716 642 22004 737 --
NM_003990chr10172119 2113 2077 2010 1931 1707 1665 793 766 744 502 362 245 234 171 60 48 2716 642 22004 737 --
NM_003994chr1253134 1738 1660 1610 496 --1374 --
NM_004028chr1831370 650 130 --12669 --
NM_004035chr1784419 4345 3624 3432 3237 1878 1603 723 1273 25050 3794 11672
NM_004040chr231231 201 184 ------
NM_004056chr811087 --1143 --
NM_004077chr1211167 1498 11268 --
NM_004081chrY21185 99 ----1636
NM_004082chr2276 37 ------
NM_004089chrX41150 906 165 49 --1805 1112
NM_004090chr1752859 2764 2704 2639 212 1103 22207 1132 --
NM_004093chr1352867 601 517 296 165 --11127 --
NM_004100chr641726 445 420 382 ------
NM_004102chr13618 469 139 --1236 157
NM_004104chr175775 617 562 493 115 --1572 --
NM_004112chr1791759 1707 1446 1296 586 534 347 71 39 11202 ----
NM_004116chr2153 ------
NM_004117chr691910 1744 1410 892 632 543 266 68 29 1877 11869 --
NM_004123chr17158 ------
NM_004124chr14------1456
NM_004136chr1532128 1310 63 22068 98 32604 2005 604 --
NM_004156chr8------1593
NM_004157chr31879 1710 1249 1641
NM_004162chr3--184 ----
NM_004170chr93510 472 394 --1641 --
NM_004171chr11178460 7728 7369 7031 6899 6865 6160 6011 5909 3588 2872 2714 2521 2233 2056 2003 40 48337 6600 6407 2841 17214 --
NM_004176chr17--123 ----
NM_004200chr11122343 2310 2136 1039 438 408 391 193 122 78 37 21 1839 ----
NM_004227chr792715 2656 2314 2117 1988 317 231 138 22 32042 1255 43 ----
NM_004272chr5----1180 --
NM_004296chr14143819 3722 2935 2769 1591 1373 1142 1112 1094 936 878 710 524 290 12473 23694 1572 1435
NM_004298chr5----152 --
NM_004302chr1282531 2240 1081 895 546 291 245 97 21034 843 --12180
NM_004311chr1072338 2089 1177 852 698 492 109 22033 159 12534 --
NM_004319chr192896 2314 2202 1253 1237 1131 867 622 375 ------
NM_004321chr2123129 2798 2681 2604 2596 2522 2490 2307 1316 839 80 34 23185 180 12191 --
NM_004323chr962451 1664 1026 570 440 270 2969 224 1685 --
NM_004338chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_004342chr7--1132 ----
NM_004349chr821015 960 --1844 --
NM_004350chr1112070 956 721 663 622 466 320 311 228 209 135 22078 890 1998 1572
NM_004364chr1951203 1193 833 480 49 2981 260 ----
NM_004370chr661689 1524 1475 1462 1350 697 ------
NM_004371chr181141 1095 1057 521 475 436 234 129 1302 ----
NM_004379chr251762 1715 1683 1676 387 11542 ----
NM_004380chr1632449 2303 61 21824 522 ----
NM_004385chr52579 228 ------
NM_004392chr1321053 404 --1312 --
NM_004393chr372152 1861 1841 1674 1516 800 697 12108 --1119
NM_004397chr1134084 1217 624 13138 --23280 613
NM_004405chr23873 427 84 1906 ----
NM_004417chr51258 ----1187
NM_004420chr1162410 2297 1515 782 735 289 --32268 2186 2076 --
NM_004423chr3122659 1947 1905 1873 1866 928 866 852 615 209 122 41 21732 335 12095 --
NM_004426chr1261997 1693 563 473 328 299 --11360 --
NM_004429chrX41296 1163 1090 986 11044 11072 --
NM_004437chr1123502 3495 2935 2926 2601 2276 1415 1150 796 779 745 303 12382 ----
NM_004438chr233261 2200 1311 --1460 --
NM_004441chr31103 --2511 296 --
NM_004444chr75887 797 280 188 78 ------
NM_004459chr17----1470 --
NM_004463chrX3587 414 84 --2497 400 1514
NM_004468chr12170 43 2520 143 182 --
NM_004469chrX2452 127 ------
NM_004474chr14713 78 69 41 ------
NM_004475chr1751113 1089 1041 983 482 2423 51 138 --
NM_004480chr14249 34 1130 ----
NM_004484chrX1121 ------
NM_004485chr1133958 3846 3498 3127 1696 1409 1362 1081 895 668 620 593 107 13373 53062 2882 1588 846 712 14202
NM_004500chr1421331 47 11428 ----
NM_004501chr134150 2842 797 23377 210 --13786
NM_004514chr1782774 2588 2362 2270 2062 1898 979 745 1114 1134 --
NM_004527chr1761238 1164 1156 299 186 91 1145 1575 --
NM_004540chr211785 ------
NM_004544chr2122 ------
NM_004549chr1141347 1304 1137 1072 ------
NM_004569chr142478 166 ----1639
NM_004584chr116293 210 143 78 53 26 --1634 --
NM_004586chrX93984 3546 3536 3470 1733 1655 1648 740 107 33638 1513 1398 ----
NM_004588chr11113387 3190 2905 2823 1280 945 739 608 471 350 101 22862 1160 ----
NM_004598chr533223 762 398 12319 ----
NM_004606chrX144 ------
NM_004634chr31403 ------
NM_004637chr31221 --2511 116 --
NM_004656chr381076 976 959 857 789 462 421 105 21059 87 1932 --
NM_004671chr18--1215 ----
NM_004684chr4--132 ----
NM_004687chr1751642 497 265 229 223 1569 ----
NM_004703chr1722383 193 22501 345 22421 2229 --
NM_004710chr176911 742 344 333 274 186 --1624 --
NM_004711chr22213655 3557 3368 3307 2863 2749 2634 2581 2523 2363 1434 1128 1026 795 743 627 595 585 412 88 74 21137 953 158 --
NM_004714chr19--1350 1107 --
NM_004716chr111201 ------
NM_004723chr12953 862 1932 ----
NM_004726chrX104472 4418 3932 2186 2122 1988 1944 1869 728 719 --25565 930 --
NM_004729chrX62096 1892 408 330 122 73 --11665 --
NM_004730chr53724 476 261 143 1170 --
NM_004734chr1372677 2628 1300 1191 930 771 134 22488 2430 ----
NM_004736chr12380 86 --1468 --
NM_004742chr31585 ------
NM_004745chr8166695 6278 6157 6031 5959 5584 5063 5036 4829 4738 4285 2610 1639 1587 1487 1203 16079 2685 328 25226 853
NM_004748chr1521602 1178 11297 13999 14044
NM_004755chr1411105 149 --1222
NM_004763chr26857 797 741 405 349 293 ------
NM_004774chr1742951 2092 1971 163 11063 1993 12247
NM_004779chr52414 176 1921 ----
NM_004788chr1132625 2215 1791 11810 12272 --
NM_004796chr1442116 872 220 197 --1949 --
NM_004801chr2----11045 --
NM_004807chr2112506 2240 2225 1058 945 847 771 596 528 459 201 11972 11989 --
NM_004822chr17153960 3775 3538 3326 3305 3074 2839 2479 1605 1381 824 788 635 533 73 32660 2580 1049 32813 2802 1545 --
NM_004834chr252600 2129 879 691 312 --12796 --
NM_004838chr191152 ------
NM_004840chrX71691 1632 1582 1550 1543 699 72 1860 1570 --
NM_004842chr621698 249 ------
NM_004845chrX63789 3257 3078 1533 514 424 21282 112 13122 --
NM_004850chr231758 1712 1673 11540 ----
NM_004854chr241113 852 426 69 31126 1011 297 11107 --
NM_004856chr154396 146 126 101 ------
NM_004863chr14144988 4971 4962 4908 4822 4297 4210 3594 1720 1422 455 300 119 41 34553 1546 342 ----
NM_004869chr181461 1637 --1259
NM_004870chr175626 501 465 436 167 ------
NM_004874chr81114 ------
NM_004884chr1561599 1353 1139 503 461 174 2450 110 11153 --
NM_004887chr51418 11052 ----
NM_004898chr462919 2531 2356 2155 294 62 194 ----
NM_004904chr776135 5128 1546 1370 601 376 85 --45345 2378 1617 1234 --
NM_004906chr61602 1459 ----
NM_004911chr74657 629 578 556 ------
NM_004924chr192382 336 ----1821
NM_004932chr541564 1447 644 210 ------
NM_004934chr5--163 ----
NM_004936chr941062 549 477 372 ------
NM_004937chr17102502 2306 1914 1868 1829 1753 641 583 454 199 42537 2515 2093 1695 4761 549 64 25 1777
NM_004938chr91451 ------
NM_004943chr19131149 1115 1076 1051 895 837 811 403 391 380 198 48 40 1276 ----
NM_004947chr3121822 1622 1018 948 837 759 631 558 370 356 114 80 ------
NM_004948chr1841441 1397 1365 1358 --11229 --
NM_004956chr784627 3658 3572 3383 3201 3044 1797 1660 --14212 --
NM_004959chr991484 1332 1270 1185 984 974 594 292 121 ------
NM_004960chr16--1261 149 --
NM_004966chr101854 ----1638
NM_004969chr101372 ------
NM_004976chr11324991 4985 4870 4275 4234 4086 4052 3933 3869 3764 3703 3333 3295 3188 2062 2013 1838 1819 1699 1668 1660 1336 1291 1261 1164 856 552 334 321 117 89 41 34557 3745 499 13423 14707
NM_004977chr192590 390 --1530 --
NM_004985chr1234382 4350 1071 11686 --23827 728
NM_004992chrX208167 8098 7439 7354 7319 6716 6676 6298 5916 5754 5340 3267 2995 2549 1792 1699 871 723 645 433 25216 1141 16543 --
NM_004992chrX208167 8098 7439 7354 7319 6716 6676 6298 5916 5754 5340 3267 2995 2549 1792 1699 871 723 645 433 25216 1141 16543 --
NM_004995chr1461201 1086 583 434 284 241 1183 21400 1325 --
NM_004999chr674260 4205 3383 3006 2848 1336 1248 24228 3861 --1642
NM_005010chr72389 154 ------
NM_005011chr761468 1367 1290 709 578 538 21819 630 2493 451 --
NM_005028chr1051443 768 703 342 82 31818 646 186 ----
NM_005056chr12115425 5362 5109 4921 4288 2046 1623 1041 812 594 173 24912 181 --12010
NM_005057chr131545 1460 117 21327 737 1340 --
NM_005060chr191222 1207 989 983 541 481 341 224 218 21165 547 1263 --
NM_005063chr1052867 2427 2408 475 316 ------
NM_005072chr161389 185 1129 --
NM_005080chr222357 104 --1209 --
NM_005093chr20194935 4924 4647 3838 3586 3446 3425 3404 3291 2109 2102 1776 1738 1652 1520 1477 1402 1262 354 64608 3657 1963 747 466 36 ----
NM_005095chr151995 1942 1768 667 469 --163 --
NM_005096chrX4394 228 212 76 1454 1407 --
NM_005109chr372209 2188 1931 457 332 284 111 11618 --197
NM_005110chr51620 ------
NM_005116chr2084005 3880 3368 1706 1631 1186 572 329 23744 496 13779 --
NM_005121chr1743390 2938 2707 1125 --1305 --
NM_005124chr62878 280 ----1242
NM_005135chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_005137chr2292405 2310 2274 2137 1021 896 693 559 92 1741 1396 --
NM_005144chr871181 1065 1003 990 405 303 54 ----1941
NM_005151chr1842390 544 493 68 ------
NM_005154chr152485 478 144 ----
NM_005155chr61599 ------
NM_005156chr974605 3382 1903 1846 1791 1018 678 --13904 --
NM_005169chr111505 ------
NM_005180chr1011460 ------
NM_005182chr161517 --1582 1485
NM_005184chr1961393 1359 1191 1040 588 314 1500 21473 1432 --
NM_005187chr1681951 1667 1628 1543 1376 1360 493 215 --31973 585 52 --
NM_005190chr611164 ------
NM_005197chr14135495 5451 4586 4550 4429 4389 4213 4180 3790 2140 2094 383 310 --1239 12277
NM_005206chr1741457 1434 1349 1322 11216 --1969
NM_005214chr2----176 --
NM_005216chr12508 423 ------
NM_005219chr5101440 1404 1390 1274 700 642 341 325 299 32 ------
NM_005220chr1771445 1407 1104 318 250 74 67 ------
NM_005229chrX61154 999 508 414 222 58 ------
NM_005235chr287795 2847 2006 1602 1259 1070 528 116 2558 543 ----
NM_005250chr1671901 1830 1751 1610 1247 635 30 1193 ----
NM_005257chr1841397 502 401 217 ------
NM_005275chr6--133 ----
NM_005276chr1291741 1727 1628 1576 1375 288 148 70 41 21419 592 ----
NM_005276chr1291741 1727 1628 1576 1375 288 148 70 41 21419 592 ----
NM_005277chr4----1221 --
NM_005278chrX----1557 --
NM_005281chr18968 850 839 808 234 216 169 84 --1105 --
NM_005311chr742550 2217 679 107 1607 2596 245 1193
NM_005312chr982632 2260 2238 2183 2175 1871 133 102 12043 ----
NM_005334chrX41500 1378 1147 501 190 ----
NM_005336chr2101847 1668 1549 916 881 674 479 260 143 29 1497 179 1277
NM_005338chr7194063 3944 3693 3647 3608 2879 2829 2686 2514 1376 1212 1107 976 905 754 739 319 232 69 13474 33895 809 124 --
NM_005347chr991686 1502 1494 1340 1327 1281 643 553 44 21333 1128 ----
NM_005348chr14--1801 1592 1812
NM_005359chr18116293 5294 4060 3995 3970 2555 2194 2146 2119 2034 365 35494 3984 148 11278 --
NM_005370chr192494 32 1802 173 --
NM_005374chr17112378 2352 2346 1840 1529 767 608 375 270 208 43 1133 --12170
NM_005378chr21747 1352 ----
NM_005382chr8----1321 --
NM_005387chr111610 ------
NM_005388chr9--1564 1518 --
NM_005397chr773878 3532 1147 994 619 567 539 53545 3240 2607 468 25 11197 11023
NM_005400chr252653 1988 1206 943 112 1983 --22531 77
NM_005407chr1481539 1366 608 516 430 397 362 268 11214 ----
NM_005413chr22174 66 ----1385
NM_005417chr20101984 1957 1789 1366 1323 746 342 336 224 170 ------
NM_005426chr11251 --1845 --
NM_005436chr1023572 310 13548 --11073
NM_005438chr114542 410 71 38 1105 ----
NM_005443chr41499 ------
NM_005455chr13447 137 41 --1665 --
NM_005458chr951522 527 505 354 143 32071 868 822 ----
NM_005461chr2041931 537 103 36 1458 ----
NM_005465chr121548 77 ------
NM_005474chr17101475 1030 1015 1007 427 312 216 170 150 109 31365 1247 580 11179 --
NM_005475chr1262628 2208 1237 512 411 273 12742 --12174
NM_005477chr1542621 2024 826 675 1504 12530 2693 212
NM_005477chr1542621 2024 826 675 1504 12530 2693 212
NM_005479chr1041414 1226 326 76 11130 ----
NM_005487chr2251640 1391 1352 744 499 11850 11921 --
NM_005493chr61531 1586 ----
NM_005497chr17215937 5717 5671 5427 5376 5291 4988 4735 4395 4388 2325 2190 2043 1912 1869 1825 1726 1678 1651 932 802 35157 4255 2240 ----
NM_005501chr1751211 1116 1110 307 34 --1925 --
NM_005504chr1256227 4396 722 303 228 14498 36017 4613 2294 --
NM_005505chr129808 691 623 373 209 130 108 93 60 ------
NM_005512chr11152013 2005 1862 1796 1587 1484 805 778 695 509 479 425 351 189 121 2701 673 11873 --
NM_005520chr5--1277 ----
NM_005552chr14125 1485 ----
NM_005558chr14825 306 257 184 1395 2247 169 1817
NM_005563chr14650 598 139 133 ------
NM_005596chr914585 --36361 693 671 --
NM_005598chr161570 1484 1190 381 231 176 11314 ----
NM_005603chr185821 810 589 456 295 2537 238 ----
NM_005611chr161493 11122 191 --
NM_005629chrX51265 943 839 232 226 ------
NM_005632chr1691083 824 800 773 724 702 138 130 114 3900 860 747 ----
NM_005637chr1841733 1685 1658 1393 158 11777 --
NM_005639chr122642 95 1458 ----
NM_005644chr1----163 --
NM_005647chrX42682 2614 1150 301 22953 2722 ----
NM_005650chr22--1919 ----
NM_005654chr5143 ----1155
NM_005655chr8142 ------
NM_005665chr143021 746 610 535 11835 1790 --
NM_005667chr2--2368 278 ----
NM_005668chr553941 772 724 697 374 ------
NM_005700chr111125 ------
NM_005707chr1561141 1095 1055 509 44 28 ------
NM_005715chr662645 2431 591 545 374 310 11944 ----
NM_005716chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_005717chr12393 107 ------
NM_005719chr12--152 ----
NM_005725chr121880 68 11759 ----
NM_005730chr1293166 3015 2256 1122 1039 576 510 279 188 21433 34 33158 2407 694 --
NM_005734chr111522 ------
NM_005737chr242109 1036 336 240 ----12037
NM_005742chr2186 161 ----
NM_005748chr1273443 3176 2740 2525 2140 1211 905 22705 2631 ----
NM_005759chr2104658 4384 4154 3934 1469 1462 1376 752 437 424 31803 565 145 13425 --
NM_005768chr124460 283 235 124 ------
NM_005776chr141192 ----172
NM_005785chr1251687 1253 720 185 165 21216 58 ----
NM_005789chr1741497 1435 822 768 11807 22035 1757 --
NM_005808chr363179 2274 2210 375 352 72 --1692 13491
NM_005811chr12152 ------
NM_005813chr242022 1002 899 387 1853 ----
NM_005819chr182647 2521 2444 2410 2236 2141 1312 168 --12808 --
NM_005822chr651525 725 585 445 347 22251 2225 21824 543 --
NM_005828chr1794603 3281 3205 3120 1324 805 345 207 185 13863 14411 --
NM_005834chrX3231 197 79 ------
NM_005840chrX117576 7312 7275 6809 6118 2674 2626 2400 1488 229 22 ------
NM_005842chr13----1186 --
NM_005851chr112275 22 2325 286 ----
NM_005852chr1781083 906 812 767 758 345 55 28 1307 ----
NM_005864chr141289 1613 ----
NM_005876chr22792 530 1231 1800 --
NM_005880chr1621260 90 162 169 --
NM_005885chr541685 1077 90 79 2422 131 ----
NM_005892chr171402 1351 ----
NM_005895chr1283151 3107 2899 2677 842 798 663 588 33643 3221 2984 1854 --
NM_005898chr1132421 2306 245 11233 ----
NM_005900chr411062 ------
NM_005901chr1898043 7725 7202 6921 5804 3358 2433 1176 328 28697 6299 27819 7673 15502
NM_005904chr181569 2540 441 11460 --
NM_005909chr564297 4175 4065 3411 455 239 34039 1270 818 11687 --
NM_005910chr17103579 2827 2758 2594 1648 1607 1459 1345 1234 98 12871 178 12680
NM_005911chr22594 582 11218 ----
NM_005920chr1113278 3245 3023 2628 2568 2507 2441 1527 1157 839 25 ------
NM_005924chr71119 --1822 --
NM_005933chr1142846 2665 2403 662 52325 2189 558 276 76 22652 2183 --
NM_005937chr17174094 4041 3999 3863 2767 2546 1453 1437 1340 902 836 608 524 467 111 89 66 1276 23643 602 --
NM_005938chrX31370 1294 1270 ----1912
NM_005941chr83733 136 86 1276 ----
NM_005943chr691105 591 546 468 286 250 223 111 95 31249 428 170 ----
NM_005944chr331114 1035 168 --1831 --
NM_005955chr184907 4841 4285 1958 1831 1170 1106 1016 23846 2217 ----
NM_005957chr1174856 4824 4817 4121 4114 4013 3704 3597 3396 3229 3197 1647 1610 807 363 199 109 34683 3283 1766 21772 1498 --
NM_005962chr1011951 11877 2696 492 --
NM_005962chr1011951 11877 2696 492 --
NM_005964chr175435 403 363 133 54 ------
NM_005969chr11--2804 294 144 --
NM_005990chr572126 1742 1696 740 547 167 78 1921 52526 2255 1910 943 120 --
NM_006007chr943895 3742 3694 3667 ----11005
NM_006011chr1593861 3449 3157 3094 3064 3045 2639 443 23 13000 53643 3467 3419 2699 462 --
NM_006015chr14919 358 121 101 11058 ----
NM_006030chr351615 1264 460 363 264 1473 31455 372 41 --
NM_006035chr1441164 927 452 48 21155 318 1382 --
NM_006037chr294020 3339 1959 1862 879 562 160 114 55 --1125 --
NM_006038chr2041620 536 170 21 11799 ----
NM_006041chr172376 135 ------
NM_006047chr2033200 2985 58 ----13506
NM_006054chr1131458 214 88 --1370 --
NM_006055chr221132 861 12118 ----
NM_006060chr794141 4047 3591 2933 2902 1557 1018 532 224 63860 3325 3050 1697 1665 1187 ----
NM_006064chrX--1377 ----
NM_006077chr10--137 ----
NM_006085chr141302 1118 267 182 151 ----
NM_006095chr463734 3382 2759 1205 577 413 13962 11060 --
NM_006096chr871499 1136 1114 1075 1037 435 61 ------
NM_006106chr1152531 2165 790 354 318 1123 ----
NM_006108chr1142408 1909 1828 206 1128 --12178
NM_006109chr14----1250 --
NM_006113chr1--31924 540 443 1495 --
NM_006121chr123316 143 88 142 ----
NM_006133chr1182204 2088 1651 969 822 726 164 30 11809 1278 --
NM_006135chr11329 ------
NM_006139chr231068 983 89 1857 --12359
NM_006153chr3----1150 --
NM_006157chr11----1373 --
NM_006161chr52199 64 ------
NM_006162chr1851230 657 365 145 68 130 --11671
NM_006166chr1212282 12065 1483 --
NM_006186chr22134 100 ------
NM_006191chr123134 91 21 --1377 --
NM_006201chrX61008 940 870 752 388 369 122 ----
NM_006203chr575210 4212 3795 3548 1024 147 141 14203 --11075
NM_006218chr3--165 ----
NM_006224chr1742171 1988 758 610 31552 1019 562 --2897 57
NM_006228chr8283 23 ------
NM_006238chr6102027 1945 1917 1749 1677 1447 1342 835 737 185 21330 725 41839 1431 753 97 --
NM_006246chr14--11011 ----
NM_006251chr54741 700 608 533 23027 457 2785 652 --
NM_006256chr131113 879 331 11070 ----
NM_006275chr2021546 617 21798 852 --11866
NM_006279chr14709 609 84 31 3250 241 156 1182 --
NM_006282chr20134219 3965 3926 3655 3599 3194 3149 3074 795 240 125 36 27 1837 ----
NM_006283chr8124628 4610 4594 4550 3247 3157 3078 3018 1304 761 641 76 --13114 --
NM_006293chr159993 951 715 415 403 335 256 168 82 --1642 --
NM_006298chr653084 1254 700 596 163 31084 707 625 1786 --
NM_006306chrX114772 4659 4505 4352 3695 1978 1882 1359 1270 1065 481 14404 --14096
NM_006312chr122219 41 ----1739
NM_006336chr991446 1437 1390 1355 943 555 392 384 70 11270 1297 --
NM_006341chr11208 ------
NM_006352chr11565 ------
NM_006359chrX32487 418 80 ------
NM_006371chr3144847 4739 4670 3927 3912 3486 3260 3221 820 504 370 278 251 74 ------
NM_006380chr1793645 3555 3538 3479 3062 3013 1461 535 237 --12761 --
NM_006386chr223833 794 208 2761 28 ----
NM_006409chr7------127
NM_006420chr2033170 1359 1036 11120 1203 --
NM_006424chr481886 1734 1433 1369 1336 356 294 204 11451 ----
NM_006434chr1051307 998 430 416 346 ----12027
NM_006451chr52917 873 ------
NM_006454chr4213041 2811 2603 2587 2581 2548 2435 2312 2305 2254 2233 2211 2078 1972 1196 676 611 577 225 191 123 22247 991 11239 1835
NM_006457chr482844 2612 1386 1340 775 729 690 133 21170 556 ----
NM_006469chr1--1552 ----
NM_006471chr181116 ------
NM_006478chr221288 1258 ----
NM_006482chr1231047 954 595 12449 13613 --
NM_006483chr19--1350 1107 --
NM_006484chr19--1350 1107 --
NM_006489chr1421599 1532 11513 ----
NM_006500chr117869 823 497 399 252 68 45 1489 ----
NM_006516chr141628 1061 130 24 21590 36 1370 --
NM_006517chrX51769 1458 719 686 33 2920 62 1321 --
NM_006521chrX81079 535 481 370 314 208 105 37 11109 21230 566 --
NM_006527chr41246 ------
NM_006532chr1981670 1287 1280 740 654 631 579 440 1612 ----
NM_006537chr15--1194 ----
NM_006538chr263873 3117 1433 1334 1085 766 --34049 3306 1098 23158 66
NM_006540chr81214 11083 1562 --
NM_006544chr1425394 3948 ------
NM_006546chr17176326 6072 5967 5506 5384 5150 4991 4730 4228 2174 2028 1987 1972 1956 1084 1027 175 31660 843 70 ----
NM_006547chr7188 21748 1434 2203 115 --
NM_006549chr1252759 2664 1949 1907 1066 --22086 1095 196
NM_006557chr93683 502 460 11243 ----
NM_006561chr1085700 5165 4952 4625 4550 2246 2014 1448 45006 2265 1958 81 --24963 2096
NM_006562chr10138 ------
NM_006572chr1732488 1163 262 ------
NM_006589chr11428 171 133 --
NM_006599chr16127697 6407 6200 5645 5517 5109 3309 2646 2583 2521 330 251 --22300 825 32721 2608 965
NM_006609chr232479 1972 974 --133 12081
NM_006614chr331203 588 116 12688 ----
NM_006618chr1--175 ----
NM_006621chr131405 1288 246 11348 --1444
NM_006626chr9------21070 293
NM_006628chr1583728 3592 3549 3474 3408 1849 1775 1103 12888 --14202
NM_006646chr1352629 2605 2355 961 517 12325 ----
NM_006650chr5133866 3488 3404 3266 3145 2809 2743 755 596 488 366 340 149 2377 238 33510 2451 573 --
NM_006651chr451399 1235 507 364 187 ----2273 157
NM_006653chr6----144 --
NM_006654chr1242987 2908 1282 1239 21217 442 ----
NM_006686chr9--133 ----
NM_006690chr20102289 2278 2171 2161 2127 1884 1453 833 643 604 1844 2665 210 1366
NM_006705chr9------1307
NM_006706chr5--1301 ----
NM_006709chr6147 128 ----
NM_006713chr51218 --1336 --
NM_006726chr41301 --11128 --
NM_006738chr15204645 4480 4215 3794 3527 3517 3385 2847 1754 1686 1335 1019 900 780 529 474 252 223 190 109 1804 --1559
NM_006741chr1241070 1017 1009 767 --11130 --
NM_006743chrX3612 359 50 --2870 678 --
NM_006763chr13650 471 436 --1292 --
NM_006765chr8147 ------
NM_006766chr831868 1805 1034 1482 31838 944 837 1759
NM_006772chr651709 1666 604 597 187 1543 21341 1228 --
NM_006775chr632319 1977 1241 22014 1251 22143 184 --
NM_006788chr1831790 679 65 21597 667 11921 12056
NM_006809chr204678 266 177 43 ----189
NM_006819chr112353 340 ------
NM_006823chr82434 298 1520 --1420
NM_006827chr1462734 2599 2551 2524 274 38 1360 12778 --
NM_006832chr142987 332 ------
NM_006838chr1231538 1314 357 ----11614
NM_006846chr5144 ----1289
NM_006851chr1232597 2547 906 --12050 11803
NM_006852chr1752846 2119 478 330 234 12459 ----
NM_006856chr123846 199 28 --11098 --
NM_006861chr1271998 1863 1294 719 391 225 47 --1311 --
NM_006868chr1832531 2151 543 --13072 --
NM_006870chr20--1332 ----
NM_006874chr4--1915 ----
NM_006884chr31550 --21446 45 --
NM_006885chr1633179 3049 958 33170 999 385 ----
NM_006892chr206984 505 377 322 97 51 ----1564
NM_006892chr206984 505 377 322 97 51 ----1564
NM_006896chr741141 1105 815 177 --2356 136 2417 312
NM_006897chr122586 470 126 1222 --
NM_006898chr22823 142 --1528 --
NM_006906chr116666 616 399 306 61 38 1158 1724 --
NM_006912chr142402 1927 1820 285 --21629 186 11653
NM_006913chr6129 ------
NM_006915chrX42135 1960 1825 478 ------
NM_006918chr11145854 5608 5351 5095 1897 1872 1692 1676 1573 1353 1241 923 810 698 ----14037
NM_006920chr21541 --1702 --
NM_006922chr221638 256 1875 ----
NM_006927chr16102022 1937 1614 848 760 540 468 199 101 65 22098 1786 22104 1485 --
NM_006930chr541775 1658 1500 1310 --11322 --
NM_006939chr1421200 905 ------
NM_006941chr2261120 1000 463 179 46 32 2917 188 ----
NM_006943chr20133285 3233 3061 2952 2865 2693 2661 2366 1064 674 575 386 148 23226 2905 --1892
NM_006946chr114614 532 514 216 ------
NM_006948chr212358 109 ------
NM_006981chr921879 823 3720 310 40 ----
NM_006988chr21--1990 186 --
NM_006991chr34771 391 312 305 1172 ----
NM_006999chr51510 11559 ----
NM_007007chr1234219 3283 705 21105 71 ----
NM_007008chr21591 ------
NM_007010chr1731775 1749 385 21184 51 1314 11524
NM_007011chr15135762 5681 5631 5585 5546 4572 4218 4197 2403 1895 1115 1058 484 35413 4673 28 ----
NM_007017chr51141 ----1205
NM_007024chr34556 509 152 60 1391 ----
NM_007030chr5174482 4309 3198 1785 1566 1401 1131 1102 1045 985 884 691 650 248 211 140 100 23948 180 23309 3256 --
NM_007040chr195718 385 377 246 132 11108 ----
NM_007042chr361904 1063 723 464 398 138 ------
NM_007045chr6----182 --
NM_007050chr20217304 7209 6854 5274 5268 5211 4907 3118 2896 2827 2813 2800 2522 2484 2466 2166 2088 1834 1677 622 209 26953 643 24897 2297 36206 3093 1175
NM_007067chr1711006 2251 35 --11019
NM_007078chr1042931 2775 2692 2355 22557 942 12902 --
NM_007084chr131424 ------
NM_007106chr1342481 902 756 643 12620 12348 1463
NM_007125chrY1368 --1185 --
NM_007137chrX145398 5369 5165 4780 4296 4126 3857 3575 2042 1750 1627 1100 1072 1058 --24399 4207 15484
NM_007144chr173970 92 28 ------
NM_007150chrX21778 64 21534 796 ----
NM_007159chr3------11585
NM_007166chr1121458 138 169 ----
NM_007170chr11143 ----1231
NM_007172chr2263279 3107 3081 2507 559 439 12051 ----
NM_007174chr1291707 1584 1472 810 796 736 126 117 101 1878 1283 --
NM_007185chr14727 425 409 68 --2718 323 --
NM_007189chr7101510 1466 1433 1210 1164 1025 399 313 252 123 ------
NM_007192chr14139 ------
NM_007200chr15204645 4480 4215 3794 3527 3517 3385 2847 1754 1686 1335 1019 900 780 529 474 252 223 190 109 1804 --1559
NM_007203chr963393 3225 530 390 239 197 1491 --1112
NM_007213chrX9567 459 430 228 217 197 67 50 21 2647 82 2252 184 --
NM_007232chr205868 833 813 40 25 1370 182 --
NM_007236chr1551768 1589 1514 380 287 ------
NM_007245chr162601 184 1695 1739 1158
NM_007246chr4--1115 ----
NM_007249chr13169418 9093 8860 8823 8378 7992 6175 5865 2336 1645 1434 962 935 835 549 204 11102 ----
NM_007260chr15662 559 313 293 31 ----148
NM_007275chr341154 398 349 88 140 ----
NM_007276chr73783 701 318 ------
NM_007278chr172273 146 1330 ----
NM_007282chr341031 752 398 300 --1374 1360
NM_007283chr3142676 2629 2325 2031 2001 1893 1231 1108 1018 629 532 405 307 21 32815 1978 1176 12825 --
NM_007292chr1784419 4345 3624 3432 3237 1878 1603 723 1273 25050 3794 11672
NM_007331chr442670 1063 437 141 --12595 --
NM_007347chr1582625 2522 2478 2341 2266 1217 707 189 --12385 --
NM_007349chr71102 ------
NM_007350chr1244147 2896 1258 1199 23194 1524 ----
NM_007353chr7123026 2273 2251 1994 1987 1033 731 666 535 521 507 482 1758 ----
NM_007358chr111660 --11901 --
NM_007365chr131712 191 65 21534 381 32102 1995 1609 --
NM_012062chr12--1213 ----
NM_012081chr523639 340 23715 1469 --12437
NM_012095chr1043201 3162 1334 947 13028 13397 1348
NM_012098chr9--21470 1330 ----
NM_012102chr1102593 2070 1682 1675 829 763 601 332 258 38 ------
NM_012115chr62535 140 ------
NM_012118chr41162 1392 ----
NM_012120chr642088 1829 1050 606 11899 ----
NM_012134chr171864 1640 1616 1489 1233 364 329 ------
NM_012137chr152813 2752 785 771 224 31014 657 269 ----
NM_012156chr2073005 2934 2226 2205 1330 1074 103 1467 ----
NM_012157chr32958 291 ----1323
NM_012168chr1127 ----1257
NM_012174chr12122824 2735 2479 2452 2377 942 381 353 347 264 166 115 --1245 --
NM_012193chr11104999 4173 4084 3966 3799 3780 3612 2013 1429 659 21508 160 ----
NM_012199chr1124357 3931 3582 3472 3138 2868 1104 897 607 562 516 73 24589 4462 1689 --
NM_012214chr2136327 5477 5204 2575 2507 2010 1703 1684 1575 1508 1462 1423 826 32322 1290 1210 24336 4313 --
NM_012218chr1982894 2689 2157 1207 945 734 695 308 12286 13022 --
NM_012229chr1031242 1196 1164 11021 ----
NM_012233chr22861 428 1152 ----
NM_012238chr1011241 --11423 --
NM_012244chr1471511 1499 1371 1154 544 307 243 11584 2710 685 --
NM_012249chr273337 1116 1067 955 440 351 73 ------
NM_012259chr611387 ----1291
NM_012261chr20----1561 --
NM_012264chr2291795 1534 1382 833 606 546 309 210 65 ------
NM_012264chr2291795 1534 1382 833 606 546 309 210 65 ------
NM_012266chr97963 878 870 437 353 254 215 --173 --
NM_012281chr71724 11912 ----
NM_012287chr3103691 2982 1694 1349 1301 1274 727 369 359 187 --21527 502 --
NM_012288chr6174955 4793 4621 4611 4547 4478 4369 4157 4066 4050 1605 1559 1520 877 855 659 62 31867 1389 869 ----
NM_012293chr271861 1574 906 589 228 127 97 21586 1439 ----
NM_012294chr733346 3270 284 12810 ----
NM_012296chr11223712 3584 3351 3253 3242 3170 3031 2866 2684 2646 2518 2417 1474 1462 852 728 600 452 387 210 119 24 33399 1501 566 --12970
NM_012302chr121227 306 ------
NM_012304chr572337 2222 2095 1927 1014 775 610 32410 2302 671 ----
NM_012306chr12143522 3458 2843 2676 2247 1231 1067 978 772 533 450 422 335 135 32335 346 307 31199 1137 107 --
NM_012308chr1182259 1686 1582 1023 1004 959 650 474 2612 369 ----
NM_012309chr1194090 3160 1564 1265 1091 886 682 340 264 43828 1492 431 277 11239 --
NM_012311chr101596 ------
NM_012316chr1175328 5138 5099 4861 4815 4776 4582 4413 4364 3816 3770 3663 1700 1494 720 290 282 24957 4644 23704 640 --
NM_012323chr22101525 1469 1423 1384 1081 999 618 83 44 24 11251 1524 --
NM_012329chr17----11518 --
NM_012330chr101361 --21628 1133 --
NM_012334chr5104277 4238 3762 3395 3087 1708 1591 1516 106 81 24106 3571 11752 12922
NM_012384chr20102261 2232 2180 2093 2024 1775 645 626 578 51 --22064 426 --
NM_012398chr19102850 2049 1922 1097 962 827 699 526 85 23 1189 22692 1110 2808 617
NM_012399chr2251948 1877 1668 1355 246 11631 --1806
NM_012402chr1141388 1341 1302 182 21268 1160 1529 --
NM_012408chr202140 48 --1743 1172
NM_012416chr911220 --11123 --
NM_012425chr1072573 2437 2391 2352 1985 937 504 132 ----
NM_012426chr162473 147 ------
NM_012479chr732651 1790 692 ----11741
NM_012482chr11663 ------
NM_013233chr241255 1055 382 341 1114 ----
NM_013235chr5----168 --
NM_013245chr164560 497 103 55 --1673 --
NM_013247chr2------1189
NM_013250chr11----1402 --
NM_013255chr778754 8057 7452 5877 2593 1701 1341 22411 1577 --15952
NM_013261chr443487 2886 457 227 ------
NM_013269chr1243520 3514 1660 1074 14193 ----
NM_013272chr15194 1162 ----
NM_013279chr11122211 2200 2129 2102 1983 1529 799 727 704 597 171 46 12032 1446 --
NM_013281chr202992 530 11489 ----
NM_013309chr1542280 1974 1058 142 12115 1426 12047
NM_013316chr72110 62 ----1209
NM_013336chr331933 1735 1589 21448 1240 11630 21548 1540
NM_013341chr222399 2306 ------
NM_013361chr191648 1144 ----
NM_013365chr224699 678 338 51 ----1200
NM_013372chr153284 113 93 1691 12905 123
NM_013381chr1241847 429 86 34 1380 ----
NM_013382chr1442334 2001 641 21 11635 2583 133 1164
NM_013423chrX31267 133 49 ------
NM_013427chrX31267 133 49 ------
NM_013433chr1971900 1886 1512 1287 764 737 131 ------
NM_013434chr281772 1762 1516 1506 1442 1431 1241 238 11977 ----
NM_013434chr281772 1762 1516 1506 1442 1431 1241 238 11977 ----
NM_013443chr95851 470 146 112 55 1423 ----
NM_013444chrX1994 ------
NM_013449chr1282925 2897 2172 2119 823 782 766 574 1361 ----
NM_013951chr262066 814 508 490 443 288 32479 971 118 21789 46 --
NM_013952chr262143 891 585 567 520 365 22556 195 21866 123 --
NM_013953chr262143 891 585 567 520 365 22556 195 21866 123 --
NM_013960chr82628 48 2243 128 --1598
NM_013989chr1474888 4702 3342 1221 533 468 427 23860 3594 14333 14491
NM_013992chr262143 891 585 567 520 365 22556 195 21866 123 --
NM_013993chr63569 156 40 --2800 245 --
NM_013994chr63569 156 40 --2800 245 --
NM_013995chrX2956 100 11033 ----
NM_013999chr1761275 1201 1193 336 223 128 1182 1612 --
NM_014000chr1051564 755 413 406 78 31616 1419 578 ----
NM_014016chr3----1342 --
NM_014030chr171286 1313 1961 --
NM_014042chr111102 ------
NM_014045chr141397 ------
NM_014048chr1644212 3697 3408 1043 25287 1636 ----
NM_014056chr351888 1734 1475 527 393 11557 ----
NM_014057chr921326 1077 11587 ----
NM_014089chr1351987 756 671 299 194 1541 ----
NM_014106chr1542132 941 684 667 ----11856
NM_014112chr854459 3973 1615 702 559 11227 1636 --
NM_014117chr162725 627 22300 209 12228 --
NM_014155chr1196934 6915 5210 2886 1456 1362 1287 971 122 36713 4777 2464 ----
NM_014216chr1451520 1443 1357 1192 97 ----11044
NM_014217chr161681 1207 759 696 573 257 --1686 --
NM_014223chr13649 553 103 1167 193 --
NM_014230chr174557 494 407 88 166 ----
NM_014231chr1271807 1417 1359 832 446 347 106 --1825 --
NM_014232chr1761668 1613 1362 1247 72 53 1587 ----
NM_014232chr1761668 1613 1362 1247 72 53 1587 ----
NM_014238chr1731555 1312 103 ----156
NM_014240chr3113838 3467 3373 3325 3298 1677 1611 1286 1232 386 234 33705 1664 249 22833 2724 --
NM_014246chr22102297 2124 2058 807 763 360 351 298 134 89 1639 ----
NM_014250chr2251640 1391 1352 744 499 11850 11921 --
NM_014268chr18----1400 --
NM_014275chr54841 813 612 262 --1252 --
NM_014280chr12635 283 ----1623
NM_014284chr161045 960 844 372 121 26 1935 ----
NM_014289chrX41348 1055 910 421 31227 451 195 --1466
NM_014292chr2271605 1532 1284 1179 599 133 84 ------
NM_014299chr1951587 1503 716 258 220 2167 56 11463 --
NM_014309chr22105408 5123 4978 4599 4241 4148 2006 1309 902 29 --15059 1796
NM_014331chr4106998 6977 6708 5102 4759 1594 1548 1509 639 555 27469 1377 17184 --
NM_014368chr992179 1866 1827 1721 1689 1667 622 66 53 11695 --1798
NM_014372chr11664 ------
NM_014381chr1482988 2965 2854 2736 2211 2121 678 106 12956 ----
NM_014388chr1115669 4957 4846 4480 4393 4318 2313 2165 1954 1227 488 --22432 853 --
NM_014390chr74397 346 110 26 ------
NM_014405chr17122133 2122 2061 2031 1864 1633 1546 1495 732 670 180 28 21878 1757 ----
NM_014409chr12396 161 --1153 --
NM_014415chr311388 ------
NM_014417chr197853 752 621 348 164 158 118 ----1248
NM_014423chr534609 4590 84 --14545 --
NM_014437chr15879 798 377 198 68 --1341 1639
NM_014445chr312285 --11557 --
NM_014447chr411575 11600 ----
NM_014449chr12125 1183 1166 --
NM_014454chr6--1805 ----
NM_014480chr193601 594 33 1568 ----
NM_014491chr7123 1419 ----
NM_014494chr1642034 960 681 449 11940 ----
NM_014504chr711816 1154 ----
NM_014515chr12--158 ----
NM_014517chr321888 1372 --1229 --
NM_014520chr17124 ------
NM_014554chr1271955 848 751 535 305 296 89 21592 1434 ----
NM_014563chrX61445 1401 409 366 111 50 ------
NM_014571chr1112700 2623 2051 1952 1168 988 822 404 283 180 125 42719 1215 653 626 32154 716 193 13014
NM_014572chr1311753 ----1186
NM_014603chr1791615 1599 1355 1229 1220 629 603 278 269 --11161 --
NM_014607chr251531 1505 820 420 160 32055 1732 623 ----
NM_014613chr562781 2279 1150 980 322 33 ------
NM_014614chr2------1280
NM_014629chr82971 54 11224 ----
NM_014632chr11172 ------
NM_014634chr22163300 3252 3229 3127 3115 3065 2804 2731 2692 2668 2362 1125 494 434 374 257 32431 414 124 ----
NM_014636chr963598 3126 1103 193 123 46 24145 854 1300 --
NM_014637chr8----11093 --
NM_014646chr1872165 1314 1097 595 446 186 99 --12081 --
NM_014647chr1642016 1498 1478 406 --1443 --
NM_014663chr15996 266 222 36 29 ------
NM_014665chr8143362 3203 2904 2695 2603 2540 2376 2327 2289 1344 1045 903 880 834 53102 2760 2718 2474 1002 2643 481 22991 627
NM_014686chr1971813 1689 1643 1604 874 697 44 22359 2222 --1669
NM_014690chr783053 2162 1069 1022 808 465 168 116 2577 77 1789 --
NM_014693chr31498 1199 ----
NM_014701chr1522475 30 --1986 --
NM_014702chr623518 534 22570 847 ----
NM_014705chr7----1101 --
NM_014706chr124913 794 231 47 ----167
NM_014707chr721415 349 ------
NM_014711chr1621741 254 1629 11542 --
NM_014712chr164524 437 139 72 288 62 ----
NM_014721chr6117185 7142 4595 4580 1857 1787 1594 926 624 220 172 12950 32559 1908 137 --
NM_014726chr1731163 938 488 --2873 174 --
NM_014730chr12174900 4786 4547 4330 4268 4025 3859 3569 3480 3353 1514 1270 1025 580 325 304 230 1657 11541 1967
NM_014730chr12174900 4786 4547 4330 4268 4025 3859 3569 3480 3353 1514 1270 1025 580 325 304 230 1657 11541 1967
NM_014731chr2081425 1321 1176 598 567 337 165 58 31167 680 172 11706 --
NM_014732chr16175653 4403 4133 4126 3873 3781 3737 3662 1940 1894 1667 1073 528 494 110 67 59 24172 4025 55077 3949 1433 485 401 --
NM_014742chr2061474 1343 614 580 517 343 ------
NM_014743chr452983 2497 2455 918 197 12632 1500 --
NM_014747chr1145071 5037 4936 3737 3702 3667 2303 1768 1471 1448 1438 670 488 138 44487 3908 1636 1154 1632 --
NM_014752chr11------1296
NM_014755chr274184 3505 2903 2840 1500 1097 32 12865 11196 --
NM_014756chr111327 178 ----
NM_014757chr562061 1750 1655 533 383 207 1706 ----
NM_014758chr1192250 2202 2061 1962 1707 1640 462 445 183 11672 ----
NM_014761chr162825 397 ----1125
NM_014762chr1102082 2064 1768 1760 825 789 776 770 700 167 ------
NM_014765chr142482 2457 1706 176 22175 1775 1318 --
NM_014766chr773787 3517 3356 3197 1375 924 844 21012 992 ----
NM_014767chr10153335 3293 3192 3075 2945 2653 2478 1336 1321 1195 813 648 409 396 81 23316 857 33638 3543 2694 --
NM_014770chr12101154 1138 1044 985 835 518 401 357 292 207 --11163 --
NM_014772chr18153603 3359 3274 3202 2938 2917 2773 2407 1448 1281 1188 1170 941 894 200 --1816 --
NM_014774chr171047 1018 980 956 731 603 401 ------
NM_014779chr3------11091
NM_014787chr132540 1736 940 --11053 1279
NM_014797chr6103283 3157 2773 2734 2446 2336 1072 622 353 157 12602 11191 --
NM_014798chr17151610 1535 1334 1315 729 714 680 504 483 466 296 164 79 59 50 1620 21435 575 11299
NM_014800chr74765 425 302 166 --146 --
NM_014806chr97506 445 391 309 202 178 51 ------
NM_014810chr153558 2771 1329 829 810 --12517 --
NM_014824chr1131909 1280 233 --11728 11925
NM_014826chr183798 3453 3366 3104 1413 1324 403 175 33927 3660 1352 ----
NM_014828chr1452521 1730 979 952 518 --1363 --
NM_014830chr12103253 3044 2900 2817 2663 2526 1400 509 307 81 1517 --11533
NM_014832chr13--122 21578 719 --
NM_014840chr1263323 2974 2633 2369 342 290 --12335 --
NM_014841chr6----11360 --
NM_014844chr14134168 3257 3211 3172 2841 2650 1517 1511 378 308 248 224 35 23612 2811 11587 --
NM_014847chr13138 118 49 ------
NM_014848chr1562636 2340 912 370 247 173 --22802 2304 --
NM_014850chr3194594 4503 4351 4232 4123 4077 3409 3117 3050 1860 1666 1651 1581 1228 1005 819 174 85 52 24610 238 ----
NM_014858chr141084 805 301 40 1121 1926 --
NM_014860chr232468 2169 178 ----11727
NM_014873chr194889 1909 1843 1495 1316 1268 1241 857 428 ------
NM_014876chr227685 611 455 359 287 172 31 31730 1534 497 --1864
NM_014877chr1787040 6996 6061 6018 5994 5469 4751 2074 25291 2560 14700 15802
NM_014891chr741621 1487 1401 635 11268 ----
NM_014893chrY41814 857 482 351 2151 46 ----
NM_014897chr1793262 3216 3137 2710 2621 2577 2225 400 270 ------
NM_014901chr5111908 1893 1440 911 628 599 519 423 146 91 66 ------
NM_014902chr2071468 1168 545 522 419 295 175 --1975 --
NM_014904chr1043567 3056 295 258 13161 ----
NM_014905chr231587 679 500 11516 ----
NM_014909chr14163966 3499 3476 3352 2944 2934 2647 2459 1107 1086 805 743 682 497 415 134 12663 11133 --
NM_014920chr663614 1454 998 945 446 57 --13007 --
NM_014921chr19162955 2706 2656 2553 2486 2398 1904 1127 1081 768 734 668 467 255 126 33 11215 ----
NM_014925chr123374 343 301 ------
NM_014926chr31211 195 ----
NM_014935chr1153868 3284 3230 3005 2877 2687 2406 2374 1475 1354 887 526 517 315 213 12969 21138 546 --
NM_014939chr1821580 400 --11452 --
NM_014945chr541913 1708 1228 602 ------
NM_014947chr1102533 2516 2490 2093 1251 1210 1162 1027 952 75 --1521 --
NM_014949chr11338 ------
NM_014952chr1521763 216 1483 1698 21775 1402
NM_014961chr431850 1379 430 --1348 --
NM_014962chr2012725 ------
NM_014970chr1131 ------
NM_014974chr1031649 1516 1479 --11383 --
NM_014982chr1434765 4376 1584 --24021 3705 23674 1512
NM_014990chr1431055 159 35 1191 149 --
NM_014991chr441273 733 615 63 --12180 --
NM_014997chr742997 2604 2127 493 1628 ----
NM_015002chr1242299 1667 1417 172 --11975 --
NM_015008chr343683 2985 2573 2456 33642 2276 1374 11226 --
NM_015015chr1991756 1507 1422 736 670 579 238 179 29 --11983 --
NM_015017chr15519 381 337 289 262 ------
NM_015020chr1683750 2783 1368 1121 400 388 264 220 21224 948 12419 --
NM_015023chr191732 1657 1444 1246 1180 1172 441 209 23 11404 ----
NM_015024chr83978 260 52 ----11103
NM_015026chr1221222 993 --11293 --
NM_015027chr1631914 1683 535 ------
NM_015033chr9102556 1206 1115 1071 1054 743 417 328 175 74 22391 145 12829 --
NM_015035chr20145516 5470 5438 5431 4777 4470 4128 4116 2157 1637 1136 645 151 105 35848 5297 2504 44074 2678 2366 2195 25859 4726
NM_015039chr163994 3566 3523 3007 1638 1314 84021 2685 619 442 403 364 325 286 13034 1650
NM_015040chr243431 2433 1321 590 ------
NM_015042chr15174112 4090 4069 3818 3745 3707 3666 3316 3291 3276 2677 1623 1301 1012 966 315 244 23785 1667 1646 11038
NM_015044chr1673194 2848 2393 2378 2270 2137 731 12341 ----
NM_015051chr943365 2889 1185 1084 --13077 --
NM_015055chr1141949 681 343 258 1121 1408 12957
NM_015059chr15123904 3795 3296 2922 2816 2704 1003 797 633 608 538 502 13352 ----
NM_015063chr19111353 1308 880 532 526 505 492 485 289 240 180 2316 173 1359 --
NM_015064chr12123644 3572 3565 3244 3087 2678 2627 2219 1455 1383 402 221 42712 2454 1288 509 21012 48 --
NM_015068chr773706 3211 2484 1419 1158 866 293 ------
NM_015071chr5135733 5540 5232 4856 4743 4440 4007 3961 2488 2441 614 419 178 ------
NM_015074chr194592 4237 4091 4006 3339 1703 1321 1275 1236 23872 134 13636 11464
NM_015075chrX112042 1990 1611 907 752 713 624 516 467 423 392 4615 372 345 297 22080 2068 11844
NM_015076chr644395 3209 2851 29 51696 718 267 205 50 13030 --
NM_015077chr17234212 3969 3904 3860 3816 3724 3586 3300 1580 1501 1419 1285 1279 859 838 831 823 809 621 547 482 441 399 13422 24127 1302 14740
NM_015086chr1251344 1329 1248 1187 1174 1450 ----
NM_015090chr1215914 5726 5718 5597 4787 4697 4678 4627 4367 4344 4012 3858 1988 1924 1377 1308 1287 1156 978 608 241 34614 1408 877 35297 3782 1593 --
NM_015092chr1691764 1718 1679 1442 1037 403 381 179 130 11544 162 --
NM_015094chr22184601 4352 4111 4086 3900 3565 3007 1885 1610 1472 1404 1284 1243 744 240 231 206 146 23466 2836 ----
NM_015097chr321686 113 ------
NM_015100chr121723 713 11611 ----
NM_015107chrX72175 1802 1676 467 422 385 243 11638 11926 --
NM_015113chr1792122 2065 2055 525 501 442 432 405 100 21708 421 ----
NM_015115chr443135 2767 968 307 ----11105
NM_015132chr711476 1304 ----
NM_015133chr16121206 1129 1075 961 590 531 515 491 295 260 145 63 1351 ----
NM_015136chr31118 ------
NM_015138chr1532471 2179 845 11146 1219 1996
NM_015144chr1633266 2787 825 23412 932 13163 --
NM_015150chr33313 292 268 --1217 1703
NM_015154chr15153175 3129 3097 3090 2898 2831 2825 2785 2767 2742 2143 2132 1099 477 58 32964 2511 2281 ----
NM_015155chr1052959 2508 2184 819 67 22777 856 ----
NM_015156chr1443465 3394 2895 326 --177 --
NM_015170chr841550 752 522 269 2689 570 ----
NM_015176chr111313 --2611 334 --
NM_015180chr142875 157 157 --1138
NM_015185chrX52639 2474 2344 1923 1907 22584 2120 ----
NM_015191chr1172501 2258 2178 1830 708 310 65 ------
NM_015193chr891116 598 386 329 312 287 157 106 22 31102 1011 454 2177 40 --
NM_015194chr17111873 1857 1823 1596 1449 1417 561 507 232 56 31 --1454 21373 599
NM_015200chr4152 22013 848 ----
NM_015202chr16131536 1521 1421 1393 1209 1097 1083 1054 444 374 321 239 62 31409 1268 1158 1360 1276
NM_015206chr1522604 2402 13743 ----
NM_015208chr1864055 3970 3721 2897 1611 1356 13834 ----
NM_015215chr11285 --13104 --
NM_015219chr17142451 2418 2134 2104 1827 1703 983 944 918 679 659 396 355 193 22212 580 --11967
NM_015221chr1071308 1253 975 504 420 401 303 1541 123 --
NM_015225chr952897 2308 2286 2167 2102 --1750 --
NM_015245chr672721 2460 2345 2281 2233 1707 101 ------
NM_015250chr93655 552 448 --2540 31 --
NM_015254chr8112610 2461 2050 881 821 524 491 472 440 185 39 22757 2562 ----
NM_015267chr1251949 1779 1736 1349 369 --11663 11609
NM_015268chr3159 ------
NM_015270chr1282132 2039 1582 1545 886 681 521 258 2493 133 12253 --
NM_015271chr472987 2941 1580 1245 556 437 423 12928 ----
NM_015272chr161711 --12072 --
NM_015275chr123808 692 278 ------
NM_015278chr673457 2911 2890 2722 2102 1296 103 1703 ----
NM_015282chr282158 2078 2071 658 591 144 87 30 ------
NM_015284chr181972 1784 1742 1631 471 359 216 164 41983 1539 1517 796 ----
NM_015285chr1872310 2265 2043 770 351 118 109 12280 ----
NM_015288chr5133828 3785 2995 2646 2591 2584 2410 1023 791 728 670 324 54 12542 1488 --
NM_015291chr163189 2641 2244 727 420 163 ------
NM_015299chr14143484 3449 3423 3247 3151 3107 2974 2831 539 210 185 96 51 41 23201 2898 --13005
NM_015305chr1471266 756 734 660 411 230 201 11256 21577 282 --
NM_015313chr1154419 3804 1841 652 151 24147 4098 ----
NM_015314chr71483 11655 --11000
NM_015315chr592839 2746 2657 2299 2115 1320 675 232 70 1458 12828 12216
NM_015317chr232684 2498 2160 1960 ----
NM_015319chr123168 94 85 150 1344 --
NM_015326chr152679 2485 2458 1088 206 12083 32275 650 380 --
NM_015327chr171311 1209 1178 1118 266 156 129 11199 ----
NM_015328chr782556 2512 1932 1085 608 408 261 180 22013 301 2722 571 --
NM_015331chr11558 132 ----
NM_015335chr122909 524 22358 141 --1800
NM_015336chr1242240 2003 928 781 12425 12335 --
NM_015344chr831574 1353 531 11398 ----
NM_015349chr662607 2537 2286 731 553 112 12101 ----
NM_015356chr8--152 ----
NM_015359chr822885 452 ------
NM_015361chr2------1152
NM_015365chrX43445 3316 2789 1364 23324 3302 --13796
NM_015375chr1154660 4596 4366 4320 4288 4281 3936 3183 1984 1938 1899 941 863 544 424 23151 723 ----
NM_015384chr5----1174 --
NM_015385chr1051307 998 430 416 346 ----12027
NM_015393chr463543 3217 2953 951 738 59 ------
NM_015397chr941663 1499 1478 568 --1723 --
NM_015404chr97577 558 411 236 138 49 35 ------
NM_015436chr443037 2861 2401 1337 --11123 --
NM_015443chr173996 582 553 ------
NM_015455chr543571 1198 895 374 --13887 13528
NM_015457chr1151071 1003 854 773 254 ------
NM_015458chr8104455 4154 4108 4076 4069 3840 2041 1956 1865 1518 13936 ----
NM_015464chr7------1132
NM_015475chr21372 2832 268 ----
NM_015481chr1251052 983 69 52 42 187 1307 1327
NM_015484chr1193 ----2736 124
NM_015488chr251168 481 434 387 23 21763 1751 ----
NM_015493chr1982052 1996 1602 874 652 619 605 179 1740 ----
NM_015496chr81307 ------
NM_015508chr321085 220 ----146
NM_015520chr332013 1834 413 ------
NM_015526chr1941379 1202 201 104 194 --11460
NM_015527chr163245 218 46 183 1546 --
NM_015537chr971086 977 863 414 282 241 21 3834 428 420 1925 1772
NM_015542chr10--31047 97 66 ----
NM_015550chr743474 3324 2798 883 ------
NM_015553chr6104534 4224 4177 4149 4074 3889 3385 3350 1869 841 11844 1101 --
NM_015557chr1163530 3515 3500 3407 3401 3255 2507 1187 970 801 744 625 194 173 143 42 2940 590 21164 467 --
NM_015567chr131131 11300 11129 --
NM_015568chr20274288 4246 3986 3964 3738 3459 3298 3282 2966 2828 1575 1462 1439 1368 1325 1314 1242 1120 1109 1094 724 472 284 144 137 129 52 11069 ----
NM_015569chr153129 1827 1509 1144 187 ------
NM_015571chr632302 707 93 1201 11906 --
NM_015576chr352695 2549 2046 1940 1921 --1816 --
NM_015578chr1921771 1524 11809 ----
NM_015609chr192687 2672 2580 2492 2452 1985 1147 674 293 11094 12754 1284
NM_015630chr2156 ------
NM_015640chr175263 4490 4170 4078 4006 3299 1749 23906 1896 ----
NM_015642chr31219 ------
NM_015651chr981870 1757 1677 1498 654 329 314 69 22130 1935 11785 --
NM_015678chr1321181 382 ----1126
NM_015686chrX52144 2106 590 211 48 11845 32393 742 351 --
NM_015711chr194705 674 548 71 ------
NM_015719chr194774 556 311 195 ------
NM_015726chr131576 1528 178 31854 1707 502 ----
NM_015844chr183669 239 167 2640 384 ----
NM_015846chr183669 239 167 2640 384 ----
NM_015847chr183669 239 167 2640 384 ----
NM_015896chr33102 84 50 --1198 --
NM_015898chr19102447 2425 2357 2340 1894 1687 1667 839 593 232 ----1348
NM_015902chr81232 --1788 --
NM_015906chr131646 1213 72 13199 13766 23452 593
NM_015912chr842171 1891 576 421 ----1815
NM_015913chr1----1190 --
NM_015926chr32274 70 159 ----
NM_015938chr3------1857
NM_015980chr521187 576 11548 11168 --
NM_015981chr5112761 2457 2119 2047 2025 1995 1989 1117 704 291 285 32886 2039 1262 22234 1017 --
NM_015982chr174350 266 150 27 ----181
NM_015995chr15205421 5184 4940 3912 3814 3693 2201 1803 1796 1789 1721 1620 1532 1479 1466 1229 1211 923 502 393 55063 4433 3883 1432 826 31756 1310 515 14851
NM_015999chr11190 1233 1530 --
NM_016016chr173317 249 120 185 165 --
NM_016018chr822164 939 1469 1480 --
NM_016019chr721000 96 --1110 --
NM_016021chr632220 991 849 12335 ----
NM_016025chr1631252 763 229 1545 1715 --
NM_016026chr145465 420 301 151 120 ------
NM_016032chrX31246 313 269 21188 1092 1134 --
NM_016057chr1241113 963 894 835 31198 412 216 ----
NM_016059chr62189 42 ------
NM_016062chr16248 22 ------
NM_016070chr171225 ------
NM_016073chr153437 356 123 ------
NM_016076chr132988 670 122 --12633 12002
NM_016081chr421653 87 --138 1212
NM_016089chr391855 1847 1755 1693 1522 1423 1408 789 223 --11657 --
NM_016115chr2--1185 ----
NM_016120chrX1439 ----11195
NM_016131chr21246 ------
NM_016147chr117989 950 933 737 405 211 98 1326 ----
NM_016152chr33990 454 179 134 1291 --
NM_016169chr10111208 1021 974 869 733 689 419 185 140 50 38 32432 1223 370 12720 --
NM_016174chr93370 167 52 3461 393 358 1319 --
NM_016201chr352215 760 475 109 64 ----12188
NM_016205chr421141 29 --11099 --
NM_016206chr3128881 8055 7501 7333 2818 2793 2740 2648 2549 2474 2268 1852 16929 --17227
NM_016224chr631904 1755 695 --1387 --
NM_016230chr61414 --1110 --
NM_016231chr171218 ----1678
NM_016235chr161133 1415 --1965
NM_016242chr42162 28 1148 ----
NM_016248chr1334004 3329 1103 1989 ----
NM_016250chr143532 218 180 --132 --
NM_016257chr1102782 2550 2489 1263 681 624 609 475 469 99 22709 999 1121 --
NM_016260chr265616 2928 2801 2556 1878 1576 --11968 --
NM_016264chr191365 1140 ----
NM_016272chr2262105 1838 1795 1712 724 560 31801 1773 518 2485 137 11896
NM_016277chr611334 --21035 61 --
NM_016281chr12--1762 ----
NM_016284chr162644 102 ------
NM_016298chr342763 1311 928 899 22048 2039 ----
NM_016319chr12140 1273 ----
NM_016340chr531192 1089 288 ------
NM_016356chr652517 2023 2016 775 683 11025 1709 --
NM_016377chr621698 249 ------
NM_016383chrX1180 1649 1250 --
NM_016395chr152432 250 2608 138 1767 --
NM_016396chr1532610 2037 988 --12483 --
NM_016418chr22213660 3558 3391 3294 2944 2869 2651 2329 1451 1376 1228 1094 1046 1010 988 592 533 474 401 208 192 22755 1185 2930 73 --
NM_016424chr171211 ------
NM_016436chr2022398 2313 12179 --184
NM_016441chr21392 1720 1487 11751
NM_016463chr5--2187 61 ----
NM_016484chrX2451 242 --1227 --
NM_016506chr112182 123 ------
NM_016507chr1721234 54 --22805 746 --
NM_016513chr663614 1454 998 945 446 57 --13007 --
NM_016525chr96838 802 658 613 377 317 1716 ----
NM_016529chr1351158 995 957 793 422 --155 --
NM_016530chr1563504 3074 1150 156 95 33 1170 21245 74 --
NM_016531chr454050 1654 1644 380 23 1970 23945 840 14029
NM_016577chr362893 1399 1153 1093 932 448 54250 4036 2866 2858 666 --34513 3868 894
NM_016586chr141136 --1515 --
NM_016587chr73783 701 318 ------
NM_016588chr61236 ------
NM_016604chr541158 1047 135 102 ------
NM_016605chr582570 2558 2547 2399 1834 1817 310 122 41063 1039 993 150 ----
NM_016621chr11134371 3951 3909 3810 3750 3577 3163 3109 940 708 524 518 35 34434 4327 2829 12940 --
NM_016628chr10----1316 --
NM_016644chr51527 ------
NM_016656chrX--1377 ----
NM_016734chr961991 793 581 343 309 288 1106 21960 62 --
NM_016823chr1741327 1304 1219 1192 11086 --1839
NM_016829chr34657 281 170 159 --1530 --
NM_016834chr17103579 2827 2758 2594 1648 1607 1459 1345 1234 98 12871 178 12680
NM_016835chr17103579 2827 2758 2594 1648 1607 1459 1345 1234 98 12871 178 12680
NM_016841chr17103579 2827 2758 2594 1648 1607 1459 1345 1234 98 12871 178 12680
NM_016929chr684216 4016 2984 2926 1459 1067 145 62 43267 1589 1119 257 24294 1395 13166
NM_016931chr11----168 --
NM_016936chr1661779 1533 1352 543 486 127 21455 1393 ----
NM_016946chr173264 3221 2384 1292 888 852 44 11272 13398 12953
NM_016950chr41469 11382 ----
NM_016952chr1184057 4051 3264 2678 2649 596 552 477 21639 1245 ----
NM_016953chr2125088 4882 4439 4364 4001 3698 2328 2243 1657 1588 1381 585 22107 62 24483 1842 --
NM_017409chr122646 534 1602 ----
NM_017413chrX71871 1763 704 516 161 133 38 1408 22324 262 --
NM_017415chr584094 3485 1733 1700 1021 990 730 679 24014 3457 13818 13298
NM_017420chr1422757 2513 13430 ----
NM_017423chr441382 787 643 329 ------
NM_017437chr1442412 2149 2029 554 12107 11895 11517
NM_017450chr1761348 1110 1045 555 232 78 ------
NM_017488chr211390 21407 144 184 --
NM_017515chr1151399 606 312 121 88 ------
NM_017519chr6----182 --
NM_017525chr114219 213 182 110 ------
NM_017544chrX1363 ----1179
NM_017549chr7153 11147 ----
NM_017550chr198828 815 434 375 341 330 238 31 3864 692 227 1210 --
NM_017551chr1062566 1976 1820 1083 587 475 ------
NM_017553chr1521168 919 1124 ----
NM_017558chr161410 ------
NM_017575chr17121543 1517 1403 1247 1084 1028 1010 509 493 294 107 61 --11583 --
NM_017580chr1022428 1509 21917 360 ----
NM_017582chr111415 --21321 301 --
NM_017583chr1131490 607 297 197 ----
NM_017590chr2292511 914 799 597 534 298 285 177 123 42443 835 758 376 1688 --
NM_017592chr19232653 2558 2471 2417 2188 2167 1807 1722 1032 991 985 897 881 847 790 718 680 635 616 605 505 329 205 22126 811 11071 22261 1098
NM_017594chr952691 2561 611 605 374 140 32802 1328 928 1231
NM_017599chr1232049 1790 470 ------
NM_017617chr961427 1347 1010 533 489 25 1991 ----
NM_017622chr172541 277 146 ----
NM_017628chr475237 4398 4235 4056 3562 1724 1001 --11181 --
NM_017629chr121556 1523 11775 ----
NM_017633chr623057 648 --23131 89 --
NM_017637chr976377 6028 3139 2786 2601 1731 343 --28946 614 18646
NM_017643chr1752192 2158 2001 969 457 --167 --
NM_017644chr3114703 3944 3777 3732 3705 3443 3200 1050 978 933 493 11056 13821 1903
NM_017651chr631569 1318 422 1509 11331 1324
NM_017686chr13969 930 97 1781 ----
NM_017694chr241989 770 73 47 ------
NM_017700chr4--145 ----
NM_017703chr19132 ------
NM_017705chr15123738 3517 3434 3359 2974 2935 1500 1453 1389 1245 988 559 23188 2800 13607 --
NM_017709chr123592 2823 1422 1109 --
NM_017719chr351606 1006 494 323 194 ------
NM_017724chr33524 284 47 ------
NM_017730chr31200 ------
NM_017736chr1662815 2384 1996 1117 730 373 11950 12034 --
NM_017737chr131566 717 354 1570 ----
NM_017741chr4102797 2422 2317 1024 918 781 623 444 421 375 1202 ----
NM_017744chr171687 1578 1558 1550 947 454 341 22046 884 1794 --
NM_017753chr911022 ------
NM_017763chr1751171 928 920 239 187 1938 ----
NM_017772chr681291 713 473 453 219 130 87 24 11145 ----
NM_017778chr82560 236 11280 11226 --
NM_017780chr82795 86 ------
NM_017789chr22780 251 2157 123 1133 --
NM_017811chr942426 2259 1035 668 22182 87 ----
NM_017813chr825546 2055 15536 12099 14054
NM_017830chr41896 2678 85 2851 41 --
NM_017847chr161856 1434 793 608 562 32 12091 21636 1584 --
NM_017848chrX33514 1748 1722 --14130 --
NM_017849chr292433 2390 2342 2313 1239 990 719 636 65 41181 916 290 85 23131 1208 --
NM_017851chr1551095 993 807 171 83 --11055 --
NM_017856chrX41326 842 803 130 1672 123 --
NM_017873chr9113085 3003 2658 2325 2269 2011 1195 1120 651 642 216 42687 2448 1938 337 ----
NM_017880chr21420 --1344 --
NM_017902chr10165371 5353 5255 4506 4443 4305 4278 3774 2009 1238 1177 812 436 407 274 132 53833 3591 1985 1652 219 12052 --
NM_017909chr65342 321 243 236 73 1101 ----
NM_017911chr2251527 1070 560 517 441 ----11256
NM_017915chr121784 1398 ----
NM_017919chr9115542 5520 5186 5040 4855 1894 1754 1620 1275 1221 1215 22038 1960 11025 --
NM_017921chr1782337 2173 2144 2076 2046 1563 651 35 21599 161 1356 --
NM_017938chrX42172 2114 1554 449 2372 244 1595 --
NM_017944chr1122761 2327 1644 1105 1543
NM_017946chr741440 1394 1355 898 11222 ----
NM_017952chr263943 3381 3209 1823 1378 299 11695 11040 --
NM_017966chr1161376 970 387 332 128 58 1262 1349 --
NM_017994chr752550 2506 2488 1909 119 --22196 65 --
NM_018008chr32326 285 ------
NM_018014chr241191 1136 149 45 --11335 --
NM_018017chr1021166 1137 21028 468 ----
NM_018027chr1072984 2048 508 484 179 116 46 1216 ----
NM_018045chr1142639 2625 2415 2346 2308 2205 1908 1222 1170 944 907 733 701 558 --12730 --
NM_018068chr84540 494 462 455 --153 --
NM_018071chr143676 294 181 2831 44 --1821
NM_018092chr16--175 1565 --
NM_018095chr112182 123 ------
NM_018113chr12--2409 210 ----
NM_018120chr821276 1123 ------
NM_018137chr11928 --11059 --
NM_018150chr13244 193 51 133 2771 313 --
NM_018154chr194816 341 108 55 126 1124 --
NM_018157chr1221113 767 62885 2485 801 479 387 325 1498 1140
NM_018159chrX21418 591 --155 --
NM_018171chr121876 ----1995
NM_018172chr1131427 1218 1005 --21546 1049 11293
NM_018176chr451674 1521 1159 517 497 11186 --2665 474
NM_018178chr131685 1586 332 --1282 --
NM_018179chr12----1164 --
NM_018182chr1762090 1713 706 392 278 221 1183 1511 --
NM_018184chr332003 1870 1432 ------
NM_018189chr33553 420 345 1158 1462 --
NM_018205chr1092146 2024 1941 1898 1871 1441 780 527 249 1859 12161 126
NM_018206chr16141 --1608 1142
NM_018207chr1101629 1501 1448 1276 1218 468 330 131 85 61 21702 186 ----
NM_018227chr433086 2417 1143 --13031 --
NM_018231chr168987 975 703 330 262 196 176 146 ------
NM_018237chr101182 ------
NM_018239chr1092146 2024 1941 1898 1871 1441 780 527 249 1859 12161 126
NM_018240chr16847 779 667 584 371 189 1681 ----
NM_018243chr453611 2737 2568 1389 865 22603 367 11093 --
NM_018252chr11505 ------
NM_018254chr121956 698 ------
NM_018263chr252386 2062 1893 1053 536 21940 820 12449 --
NM_018266chr34945 839 358 30 ------
NM_018299chr8--125 ----
NM_018302chr442301 2079 1688 519 31975 962 565 --1131
NM_018320chr1151111 995 465 393 119 ------
NM_018325chr9--1110 ----
NM_018340chr16115042 3966 3873 3798 1779 1733 1695 1161 1109 479 103 21561 1047 14054 --
NM_018348chr161364 151 ----
NM_018362chr1183980 3461 3327 3283 3203 2773 2527 574 ------
NM_018367chr113942 617 427 12034 1454 --
NM_018371chr8----1203 --
NM_018373chr14116452 6330 5531 5483 4322 4093 3929 1917 1533 1449 1442 65541 5133 4398 1310 1112 756 1958 --
NM_018374chr744974 4675 1518 240 --1993 --
NM_018381chr191156 2619 361 1355 --
NM_018400chr11124224 4044 3937 3654 3584 3486 3252 2877 1745 1248 1038 955 --12852 --
NM_018403chr3133921 3410 2952 2913 2832 2499 1060 642 618 404 385 319 35 ------
NM_018440chr8148563 7784 6390 6312 5772 2682 1610 1311 847 773 563 358 276 149 48162 6168 6019 2599 15614 12258
NM_018441chr23619 573 33 ------
NM_018444chr841582 768 503 194 ------
NM_018469chr171253 1976 ----
NM_018471chr2177 139 ----
NM_018482chr822248 2191 1333 22165 202 --
NM_018490chr1121874 484 --11346 --
NM_018509chr1771660 1488 1306 625 563 452 30 ------
NM_018566chr154672 2038 972 582 45 33715 3195 1572 --2417 310
NM_018569chr41394 1461 ----
NM_018638chr121964 15249 14731 --
NM_018644chr1162173 1861 1543 1426 282 143 3743 440 260 42075 634 461 213 --
NM_018653chr171251 1104 ----
NM_018655chr1263 56 1270 ----
NM_018660chr8113013 2668 2658 2559 2459 2451 2075 1934 977 673 485 180 12409 --
NM_018667chr1682747 2481 2097 1877 1127 741 592 213 22420 2276 ----
NM_018682chr71222 ------
NM_018712chr113964 245 192 1519 ----
NM_018715chr162164 1944 1855 1769 1471 415 ------
NM_018717chr492727 1826 896 807 433 372 250 228 146 2322 297 ----
NM_018718chr741488 822 499 333 31807 554 522 11795 1535
NM_018719chr731309 1097 893 11041 ----
NM_018841chr153362 1086 987 936 118 13782 12518 --
NM_018844chr731540 1444 196 ------
NM_018847chr931727 1591 1318 ------
NM_018896chr17152 ------
NM_018898chr531682 1500 288 ------
NM_018899chr531682 1500 288 ------
NM_018900chr531682 1500 288 ------
NM_018901chr531682 1500 288 ------
NM_018902chr531682 1500 288 ------
NM_018903chr531682 1500 288 ------
NM_018904chr531682 1500 288 ------
NM_018905chr531682 1500 288 ------
NM_018906chr531682 1500 288 ------
NM_018907chr531682 1500 288 ------
NM_018908chr531682 1500 288 ------
NM_018909chr531682 1500 288 ------
NM_018910chr531682 1500 288 ------
NM_018911chr531682 1500 288 ------
NM_018912chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018913chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018914chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018915chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018916chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018917chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018918chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018919chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018920chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018921chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018922chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018923chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018924chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018925chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018926chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018927chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018928chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018929chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_018945chr653023 2945 2938 1063 88 22806 195 ----
NM_018957chr221101 132 ----
NM_018958chr1583914 2966 2642 1320 955 702 291 131 13803 ----
NM_018963chr2151273 518 150 135 77 ------
NM_018970chr7--12435 12385 --
NM_018976chr12126 11003 ----
NM_018979chr122882 268 32527 1013 1005 1514 --
NM_018991chr71195 1181 ----
NM_018993chr202268 22 11415 ----
NM_018999chr1021943 329 14127 --14432
NM_019001chr344151 3511 2969 1751 21767 1152 13264 --
NM_019009chr1192299 2213 1738 1697 1674 916 592 509 233 --153 --
NM_019022chr1832710 2670 590 ------
NM_019032chr17697 662 654 596 553 96 86 1103 ----
NM_019046chr107901 837 778 700 693 332 151 ------
NM_019049chr11256 ------
NM_019063chr232114 1672 749 ------
NM_019067chrX134720 4613 4058 3968 3925 3156 3110 3071 1741 1488 421 325 159 1192 ----
NM_019084chr1062237 1754 1598 934 718 28 ----11943
NM_019106chr22103338 2522 2461 2404 2323 2300 2252 1068 868 325 ----12973
NM_019114chr932120 896 113 ----22529 2219
NM_019116chr1673218 3141 988 912 868 762 23 11152 ----
NM_019555chr351225 1171 604 373 124 ------
NM_019556chrX2400 215 ------
NM_019557chr12820 24 1182 ----
NM_019593chr2033089 2963 2883 ------
NM_019594chr971374 1169 601 416 382 71 43 ----1551
NM_019596chr2142663 719 679 589 1456 ----
NM_019600chr153557 249 31 ------
NM_019606chr73495 390 157 --1377 --
NM_019610chr1132 1314 --1532
NM_019624chr129889 846 690 309 267 230 93 77 40 1696 1702 --
NM_019625chr129889 846 690 309 267 230 93 77 40 1696 1702 --
NM_019845chr24769 600 203 57 ----1218
NM_019858chr12125 1183 1166 --
NM_019885chr2102571 1980 1118 937 837 448 237 211 200 22 1645 22049 904 --
NM_019896chr2170 ------
NM_020039chr12131728 1508 1357 1304 1232 744 540 489 470 371 288 281 65 ------
NM_020116chr411356 ----1203
NM_020117chr52996 911 1778 ----
NM_020119chr7113929 3631 3611 2966 1253 977 548 460 410 367 188 23936 3512 ----
NM_020122chr295651 5513 5477 4945 4899 3743 3655 1907 666 25213 4732 --15097
NM_020123chr10------11444
NM_020132chr21123945 3911 3550 3482 3336 1141 1124 1063 716 649 498 46 31290 484 205 13173 --
NM_020141chr11840 --176 --
NM_020143chr22713 128 ------
NM_020148chr1862466 2401 969 655 497 453 ------
NM_020156chr7191 ------
NM_020160chr19281 44 --124 --
NM_020163chr352152 1696 1548 341 310 21999 59 2212 76 --
NM_020177chr542949 2325 1242 1003 1901 1815 --
NM_020178chr17164 ----11271
NM_020180chr181395 ------
NM_020182chr2083095 2640 2630 2617 2577 2411 2333 885 ------
NM_020184chr282038 1654 703 429 415 195 134 47 --1751 --
NM_020194chr21640 --1186 --
NM_020200chr101340 ----2246 103
NM_020205chr133265 1138 294 11043 12481 --
NM_020235chr33373 131 46 ----1324
NM_020239chr151594 886 850 252 52 1639 12056 --
NM_020245chr685102 4335 4107 4037 3785 1369 1320 139 24194 132 21442 709 --
NM_020309chr1921034 134 --1392 --
NM_020310chr17162268 2259 1951 859 852 845 606 587 570 484 404 395 252 96 87 27 22050 1824 32175 1093 679 --
NM_020319chr71673 2642 276 ----
NM_020336chr2041188 785 670 489 13484 1513 --
NM_020337chr41977 22855 660 ----
NM_020338chr1092436 2338 1219 1209 1172 1152 785 644 252 42689 2410 2376 470 12738 --
NM_020340chr682240 2201 1631 1588 1401 568 433 283 22063 689 1736 --
NM_020341chr2031758 304 276 ----1260
NM_020342chr211985 11927 11789 --
NM_020348chr1092547 2420 2256 2050 1822 916 651 185 140 42382 2330 1037 629 1553 --
NM_020360chr171502 2415 220 ----
NM_020369chr7----1123 --
NM_020381chr631460 646 571 1276 11383 --
NM_020382chr1241154 1124 1108 402 11183 11056 1300
NM_020390chr341607 1170 1076 1033 --11214 --
NM_020405chr17144436 4360 4008 3089 2818 1542 1473 1363 1294 1209 1131 1124 768 340 2992 92 14138 11772
NM_020416chr441859 1677 760 168 --32000 1691 32 --
NM_020420chrY21185 99 ----1636
NM_020429chr783098 2546 2503 2485 2087 1167 1122 650 1500 22461 57 --
NM_020432chr73450 254 100 1331 1410 --
NM_020443chr1105892 5849 5774 4625 4566 2732 2508 1327 510 101 46982 5450 2660 1651 45691 5586 2238 1106 14958
NM_020444chr53353 307 268 2535 135 ----
NM_020456chr1351878 1745 1670 1495 1449 --11922 --
NM_020457chr161240 --2564 44 --
NM_020463chr211241 1266 ----
NM_020466chr684493 4371 4179 3385 1724 502 463 83 2328 204 ----
NM_020474chr18--21877 54 ----
NM_020526chr181528 1519 1424 1416 1320 664 514 21 2536 404 1724 --
NM_020532chr21591 ------
NM_020630chr104498 492 486 123 1200 --1456
NM_020647chr81105 1343 11658 --
NM_020651chr211592 --1516 --
NM_020654chr31388 ------
NM_020659chr192524 516 1558 182 --
NM_020689chr2041193 255 147 27 --21390 58 --
NM_020693chr112428 391 --1528 1358
NM_020697chr861270 487 281 138 102 67 1335 ----
NM_020699chr174549 4224 4144 3591 1955 1833 527 33911 3733 1609 ----
NM_020708chr2091993 1708 1577 848 696 422 252 38 21 11547 11604 --
NM_020713chr2082965 2602 2566 2166 1010 705 499 333 32452 491 225 11928 --
NM_020717chrX144847 4189 4001 3796 3778 3711 3564 3397 1347 1296 1075 952 112 35 54714 1147 620 151 82 44403 1582 1527 1382 --
NM_020718chr16135977 5592 5469 5268 5149 5025 4992 4985 4715 4236 4105 1204 266 25304 2006 21866 584 --
NM_020727chr2143756 3542 3530 2453 12962 ----
NM_020728chr7113080 2860 2814 2775 2365 2152 1116 1029 908 268 52 22636 1133 --12350
NM_020732chr6----182 --
NM_020734chr1213149 ------
NM_020739chr1521602 1178 11297 13999 14044
NM_020742chrX41880 1831 921 500 3482 169 46 1369 --
NM_020753chr172753 499 3223 122 55 1141 --
NM_020755chr6--11330 ----
NM_020766chrX53978 3315 1775 1285 835 ------
NM_020768chr552936 2600 2394 698 153 1624 1911 --
NM_020772chr1798604 8399 8105 7835 6172 5238 3025 2437 461 26732 1023 ----
NM_020774chr1855894 4691 1971 1713 953 14349 14583 --
NM_020778chr15224486 3989 3762 3495 3074 1858 1846 1826 1732 1668 1642 1575 1151 794 711 568 537 514 461 358 271 222 1369 13225 21188 32
NM_020783chr1842299 920 846 576 ------
NM_020791chr172967 557 ------
NM_020792chr332753 831 353 11719 ----
NM_020795chr1771938 1693 1323 574 179 45 30 1817 --1116
NM_020796chr552860 2765 2635 532 58 164 ----
NM_020802chr1182936 2462 2424 2194 1256 858 819 128 22293 696 2946 253 --
NM_020804chr6122682 2452 2292 2117 2106 1955 1928 1683 772 719 695 535 32584 2082 822 ----
NM_020805chr1851665 1581 1339 252 188 ------
NM_020807chr1671606 1383 1321 1215 688 647 73 155 21122 110 --
NM_020813chr1972513 1963 800 541 337 208 168 41105 1017 826 639 ----
NM_020826chr1173043 2857 1006 744 567 417 90 ----1477
NM_020830chr242649 1039 870 625 --1823 --
NM_020834chr1461711 1260 771 723 696 558 ----11599
NM_020841chr1232970 2564 116 --1525 --
NM_020843chr151399 ------
NM_020845chr12152383 2016 1960 1950 1899 1843 1772 914 697 679 554 539 416 331 255 21654 990 --1897
NM_020850chr1693067 3004 2615 2474 2314 2076 1246 799 591 22226 511 12919 --
NM_020858chr1532068 2017 304 ------
NM_020870chr441410 690 540 154 1141 ----
NM_020886chr1141066 927 879 852 --11107 --
NM_020899chr17102478 999 769 725 588 539 464 430 365 268 21629 442 ----
NM_020918chr1041012 569 219 171 ----12883
NM_020920chr141313 ------
NM_020922chrX41498 701 623 291 ------
NM_020927chr1632042 381 79 --21918 54 --
NM_020940chr1062432 2225 2119 704 239 64 --175 --
NM_020947chr1651919 1547 839 593 279 --1830 --
NM_020948chr122260 883 ------
NM_020951chr1942411 1791 1748 1575 --11619 --
NM_020952chr9----2191 40 --
NM_020956chr19234557 4521 4258 4200 3866 3799 3526 3264 3196 1418 1150 1078 1065 1041 963 824 773 747 595 542 232 177 129 1985 --1490
NM_020959chr19--1105 ----
NM_020962chr1592422 978 936 680 522 447 388 360 292 21625 698 ----
NM_020964chr18124053 3915 3620 3526 3482 3410 3123 1538 959 802 401 302 --23567 630 --
NM_020972chr46873 772 232 138 121 32 1222 ----
NM_020977chr43769 181 107 1120 ----
NM_020983chr1282132 2039 1582 1545 886 681 521 258 2493 133 12253 --
NM_020987chr1021400 1099 ------
NM_021005chr15----1734 --
NM_021007chr252002 1894 690 266 179 21661 885 ----
NM_021012chr17153030 2352 2324 2257 2094 2068 2045 1963 1127 327 311 197 113 92 36 ----11951
NM_021013chr17190 ------
NM_021019chr12158 1135 ----
NM_021020chr8153144 3119 3029 3020 2562 2450 2309 2254 1253 982 884 685 549 176 123 43365 593 556 77 ----
NM_021033chr132641 537 --22461 828 --
NM_021038chr353173 3099 1218 312 122 --13161 --
NM_021045chr1042514 2311 2101 874 12390 --1755
NM_021064chr641447 1312 1269 1194 1434 --11726
NM_021069chr41345 ------
NM_021079chr1772564 2282 2169 2139 2074 1032 415 22338 2212 32763 2555 541 --
NM_021090chr22134826 4801 4769 4033 3080 3054 1624 1586 945 939 921 866 731 24190 3178 ----
NM_021096chr22133315 3036 2980 2947 2834 2759 2141 1281 1194 1177 965 806 432 11105 ----
NM_021097chr252486 2468 2039 1969 809 1799 1117 --
NM_021120chrX32306 1983 687 12991 ----
NM_021132chr1031279 903 135 --1498 --
NM_021135chr6143134 2914 2472 2302 2128 1278 996 860 796 650 398 84 61 22 23238 103 --23218 1031
NM_021140chrX2889 384 --156 --
NM_021148chr742016 948 900 873 ------
NM_021155chr1962964 2879 1847 684 458 441 12368 1728 12185
NM_021159chr41515 --159 --
NM_021177chr62227 60 1235 ----
NM_021183chrX2366 45 22222 2149 ----
NM_021184chr6------1680
NM_021188chr14----1363 --
NM_021189chr15987 671 218 116 68 31044 967 841 ----
NM_021191chr1211667 22556 1772 ----
NM_021202chr20102882 2706 2628 2555 2260 2010 1905 1886 1231 495 32650 2590 461 --1219
NM_021218chr93996 918 911 2776 302 ----
NM_021222chr1--1288 11109 11157
NM_021229chr121329 ------
NM_021238chr1251815 1591 685 192 117 --1236 --
NM_021242chrX3901 760 713 126 ----
NM_021249chr1481605 1571 1559 1434 1366 1341 244 164 ------
NM_021255chr1412687 23624 1048 ----
NM_021259chr1661027 939 394 223 100 78 ------
NM_021625chr126385 379 368 193 49 21 ------
NM_021637chrX11017 2883 462 ----
NM_021638chr4134380 3902 3812 3584 1862 1800 1137 1048 828 408 98 86 22 11381 1330 --
NM_021639chr1------2262 35
NM_021643chr2--11447 1456 --
NM_021647chr443761 3645 1700 806 23955 179 ----
NM_021738chr101295 ------
NM_021783chrX52169 1668 823 262 40 1641 --1374
NM_021813chr6124493 4204 3601 1881 1779 1736 1398 1278 985 212 43 22 13592 --11236
NM_021818chr1421450 1225 1568 1535 --
NM_021911chr562236 1908 1171 569 286 90 14177 ----
NM_021912chr1543786 3356 2920 2879 1153 24113 788 --
NM_021914chr1421857 50 ------
NM_021943chr691933 1867 1745 1721 1693 1669 1428 1403 1383 1459 --11507
NM_021945chr663256 3175 2496 1174 406 103 42768 2735 2361 814 ----
NM_021959chr66864 380 359 247 184 69 --1166 --
NM_021961chr11105640 5262 5023 2603 2366 2241 1591 1505 1407 1273 --15288 --
NM_021962chr17112014 1991 1569 708 497 377 309 191 184 64 48 42314 2295 2240 354 --22182 102
NM_021964chr356560 6363 5411 4332 1132 --12398 --
NM_021967chr581123 512 469 463 394 345 302 254 ------
NM_021970chr4------161
NM_021977chr663191 2801 772 437 143 36 33204 2624 659 ----
NM_021998chrX--1489 ----
NM_022036chr171251 1104 ----
NM_022042chr481126 1103 983 865 819 377 269 196 41065 905 737 718 ----
NM_022048chr15126149 6129 5895 5057 4188 4068 2260 1791 968 927 558 390 75520 4745 2434 1626 1447 1012 380 25435 1073 --
NM_022059chr175880 754 651 324 45 1727 1132 --
NM_022060chr1461364 1185 1100 533 465 277 ------
NM_022073chr1441655 629 602 481 21596 1068 ----
NM_022075chr12341 285 --1148 1799
NM_022090chr51513 ------
NM_022091chr611818 1607 12258 --
NM_022117chrX170 ------
NM_022130chr531111 333 299 11068 ----
NM_022156chr17176 1196 ----
NM_022166chr16135356 3990 3890 2341 2200 1497 1445 770 564 539 470 446 78 25568 690 13911 12470
NM_022167chr173813 96 33 1655 1239 --
NM_022169chr1191345 1234 1034 206 188 161 54 48 26 ------
NM_022170chr721663 1279 21455 282 11380 --
NM_022334chr26857 797 741 405 349 293 ------
NM_022340chr3122835 2828 1444 1417 1023 977 938 717 609 335 107 31 22694 621 ----
NM_022351chr853766 2926 2605 2497 1224 ------
NM_022361chr62373 58 ------
NM_022450chr16--136 ----
NM_022456chr12156903 6599 5752 5384 5338 5299 2929 2890 2736 2290 2166 1715 1673 1492 1295 46051 5984 5166 2119 16796 --
NM_022458chr742819 976 826 113 ------
NM_022459chr13146233 5280 5124 5075 4625 4394 4324 2507 2149 2120 1928 1768 1210 504 25850 4211 21089 770 14546
NM_022462chr19183637 3511 3473 3400 3301 3120 2911 2823 2749 2574 1133 1042 923 713 656 573 201 149 --11177 --
NM_022463chr1761388 1271 1114 244 156 117 --285 39 11401
NM_022465chr1242494 2458 2260 495 31140 380 239 ----
NM_022469chr162048 947 931 387 40 24 1117 --1286
NM_022473chr1583417 1666 1605 1521 1475 1436 1267 1239 34292 1308 135 21570 318 --
NM_022474chr1432589 2428 2364 ------
NM_022476chr161916 2900 418 ----
NM_022477chr2061583 1388 1344 1209 1134 74 --11253 --
NM_022480chr1551546 652 640 594 21 ----11469
NM_022482chr2071990 1657 1637 966 945 298 208 1655 ----
NM_022485chr3139 ------
NM_022497chr3132641 2595 2563 2556 1212 1127 1031 725 663 618 594 566 75 33749 2867 994 11313 --
NM_022557chr171171 ------
NM_022572chr251168 481 434 387 23 21763 1751 ----
NM_022574chr782020 1996 1988 1848 1729 858 694 70 1123 11363 --
NM_022648chr2104464 4092 4072 4062 3123 3060 1412 1169 1065 85 54007 3027 1323 1003 842 --14447
NM_022650chr5----1334 --
NM_022658chr1231288 1111 993 11153 ----
NM_022719chr22153889 3872 3422 3350 3327 3176 2921 1090 672 641 555 304 253 91 76 1659 --32938 995 64
NM_022730chr27938 783 429 306 254 209 191 --1757 --
NM_022735chr141691 1535 1507 534 --2323 213 --
NM_022737chr1991149 1046 921 858 426 341 330 125 31 ------
NM_022744chr1661105 992 963 402 375 27 --21088 855 --
NM_022745chr162998 2162 1957 1925 1188 27 31108 210 87 137 --
NM_022748chr752823 2669 436 371 140 22746 1107 ----
NM_022751chr18------1239
NM_022755chr972331 2071 1714 1643 1035 570 448 11704 ----
NM_022758chr692907 2649 2568 2450 2209 2082 2021 1277 173 23009 2218 12695 --
NM_022781chr952775 2595 2193 686 90 --12702 --
NM_022784chr152391 175 ------
NM_022817chr221430 888 124 42247 1474 907 855 --
NM_022821chr1----1382 --
NM_022822chr117716 681 623 280 189 155 58 1216 1707 --
NM_022831chr151654 1526 1421 111 45 1169 ----
NM_022832chr432074 963 87 12248 2636 59 --
NM_022833chr9101342 1331 1250 1140 1099 1041 400 377 66 55 ------
NM_022841chr1522670 337 11962 1264 --
NM_022842chr383189 2767 2732 2520 2488 2372 1189 797 43223 3212 2045 754 1490 1290
NM_022893chr221156 77 12675 ----
NM_022896chr2051435 1123 389 312 35 21265 1062 ----
NM_022898chr1463958 1853 1455 1275 352 119 --34441 4208 801 11817
NM_022970chr101484 --21275 48 --
NM_022978chr581123 512 469 463 394 345 302 254 ------
NM_023000chr1421467 526 126 1372 --
NM_023001chr1421467 526 126 1372 --
NM_023008chr194330 252 245 168 2563 130 ----
NM_023010chrX4809 709 562 67 ------
NM_023015chr16659 294 230 208 181 29 ------
NM_023019chr2276 37 ------
NM_023033chr122494 108 ------
NM_023035chr19127 191 1312 --
NM_023071chr126967 944 898 866 859 209 1727 ----
NM_023075chr181703 1340 ----
NM_023076chr1672884 2330 1201 1116 737 599 45 22627 989 ----
NM_023079chr1731365 1319 263 143 --1638
NM_023112chr1432901 1807 243 22990 822 1889 --
NM_023929chr832471 409 232 ------
NM_023931chr1671371 1296 1057 1013 537 528 51 ------
NM_024003chrX5598 542 195 132 46 2561 64 1158 --
NM_024017chr1791274 1188 377 337 323 280 144 31 21 1405 1690 --
NM_024019chr4158 ------
NM_024034chr2081067 967 840 826 788 419 381 356 ------
NM_024046chr381121 1058 900 816 429 305 217 125 1802 1808 --
NM_024050chr191509 --1521 1227
NM_024052chr1752634 2198 726 363 329 1451 ----
NM_024061chr7----1146 --
NM_024072chr1281327 1308 1233 1224 1115 633 451 435 11291 1268 --
NM_024076chr19112411 2300 2117 2047 2028 1878 1702 1536 618 78 48 1908 --1828
NM_024085chr23422 274 30 2829 286 1956 --
NM_024087chrX--1607 --193
NM_024103chr1981310 1239 1178 627 550 521 333 47 31514 164 106 ----
NM_024106chr193346 300 261 1128 ----
NM_024294chr692907 2649 2568 2450 2209 2082 2021 1277 173 23009 2218 12695 --
NM_024297chr17170 ------
NM_024306chr163833 262 31 ------
NM_024312chr1241231 1186 1159 121 133 21411 58 --
NM_024332chrX41398 222 195 37 ----11289
NM_024345chr9106002 5762 5216 4912 4610 1790 1744 1712 1705 443 11573 14840 1165
NM_024408chr143010 2591 2271 307 23372 641 22304 1227 33102 1344 1112
NM_024411chr203241 134 103 1109 ----
NM_024416chr921326 1077 11587 ----
NM_024430chr1881753 1593 1413 1365 554 246 239 60 ------
NM_024511chr4113531 3497 3458 2932 2458 2383 2158 1288 607 563 430 13327 1474 --
NM_024513chr351425 1349 1121 884 282 31414 584 161 3696 235 110 1611
NM_024522chr191756 1678 1641 1480 1217 643 317 281 24 11405 1739 1343
NM_024541chr1051826 761 713 670 594 ------
NM_024548chr341656 1620 1538 671 ------
NM_024551chr1252170 1854 1769 721 134 42327 1925 1739 879 ----
NM_024551chr1252170 1854 1769 721 134 42327 1925 1739 879 ----
NM_024554chr141440 1416 1256 83 21201 489 21368 1352 --
NM_024561chr1331395 923 456 1441 ----
NM_024567chr84517 495 236 161 1196 ----
NM_024582chr41343 1740 1878 --
NM_024607chr893188 2956 2910 1784 1393 1115 384 345 48 2981 700 31745 378 167 --
NM_024611chr1553340 3271 1371 849 822 22487 1244 11455 --
NM_024612chr1721132 963 ----21104 976
NM_024626chr131542 516 83 11188 ----
NM_024639chr65956 900 326 211 152 32362 2093 454 ----
NM_024646chr194005 3749 2982 2904 2897 2641 2480 2434 698 22765 1578 ----
NM_024665chr344610 4418 2853 1574 ------
NM_024666chr151518 1357 165 --
NM_024674chr172876 2680 2595 2432 2202 2129 286 12462 12243 --
NM_024689chrX41189 1150 295 236 31831 1299 33 ----
NM_024698chr1181281 1245 466 447 353 100 71 24 ------
NM_024700chr12997 62 188 ----
NM_024721chr83357 308 124 ------
NM_024742chr16131902 1884 1844 1518 1238 626 619 580 548 501 445 208 37 2516 56 ----
NM_024744chr232294 1976 1663 22635 557 --1904
NM_024749chr11872 2527 456 --161
NM_024750chr33607 530 523 1388 ----
NM_024753chr2--1126 2689 555 --
NM_024770chr2196704 6697 6642 6618 6400 6260 5300 2644 2531 2164 2118 2079 1810 1715 1573 1482 1455 815 808 46675 5009 1945 674 12375 --
NM_024780chr1641067 982 271 96 2848 434 ----
NM_024784chr119993 969 834 723 444 257 225 182 110 --1791 --
NM_024785chr25430 285 208 148 54 --1942 1962
NM_024786chr53830 323 32 1194 ----
NM_024798chr1592707 1858 827 619 575 500 419 118 96 32192 1119 283 22338 112 --
NM_024811chr1151792 668 532 437 133 21519 453 11223 --
NM_024817chr15185023 4934 4783 4711 4466 2265 1892 1794 1435 1214 1158 849 745 719 481 303 162 101 1887 45243 4308 763 433 --
NM_024845chr1671652 1487 1245 1162 1143 643 133 11104 21297 321 --
NM_024852chr12654 97 ------
NM_024874chr14338 317 148 46 3543 91 35 1289 --
NM_024875chr1041656 1610 496 42 1630 --11180
NM_024877chr1981261 1221 1145 965 785 480 349 159 ------
NM_024881chr19143335 3269 3228 3049 3001 1293 1214 1049 702 696 645 566 549 44 11082 23419 95 --
NM_024884chr14143986 1267 1217 1173 1020 962 794 710 519 480 397 291 212 205 13910 22848 625 --
NM_024887chr12368 230 21971 1350 2670 401 2795 607
NM_024900chr492300 2195 1940 1712 844 764 431 328 42 2775 523 12184 --
NM_024900chr492300 2195 1940 1712 844 764 431 328 42 2775 523 12184 --
NM_024922chr1681609 1531 1322 806 783 729 562 534 163 1656 --
NM_024923chr381213 1132 1075 1060 1026 312 113 34 21010 925 1881 --
NM_024930chr551952 1827 1783 1708 1067 ------
NM_024942chr1031368 1211 168 ------
NM_024943chr43748 129 83 1616 ----
NM_024947chr3129024 8678 8345 8301 8090 7415 7367 7340 6549 3742 3361 3173 12249 16460 17262
NM_024949chr4114583 4456 4223 4213 4197 4112 3988 3780 3111 1726 1243 44437 3977 3960 255 1791 --
NM_024953chr123653 499 97 12255 12087 --
NM_024971chr9----2191 40 --
NM_024989chr277805 7760 2469 2292 1475 1408 1249 16232 22740 1266 --
NM_024991chr1051307 998 430 416 346 ----12027
NM_025040chr192460 63 --11586 12314
NM_025047chr31375 ------
NM_025052chr2126 --1113 --
NM_025061chr195717 369 329 230 147 ------
NM_025073chr173976 3686 1558 1190 1128 1087 632 33591 1384 916 ----
NM_025083chr1581975 1772 1745 1521 1333 640 536 246 21994 1764 11957 --
NM_025113chr1321044 351 --11160 --
NM_025130chr101761 --1547 --
NM_025134chr1642219 1751 592 74 ----1404
NM_025140chr12161 ------
NM_025141chr151463 ------
NM_025151chr831555 683 383 --1534 --
NM_025160chr143805 1493 558 283 ------
NM_025164chr1151955 1817 1407 674 450 22010 1663 1782 --
NM_025179chr1134387 4198 4041 3978 3653 3488 3192 1868 1521 1124 817 237 184 23595 680 23620 3074 13944
NM_025182chr93893 865 717 --1942 --
NM_025191chr123214 2267 13153 --1837
NM_025208chr1131719 1626 140 --12039 --
NM_025211chr9--1193 ----
NM_025221chr421117 93 ------
NM_025222chr362456 2417 1205 983 425 58 22685 2284 1224 --
NM_025224chr20142285 2081 2057 2050 1887 1859 1757 1658 822 684 535 435 425 382 3462 272 179 ----
NM_025235chr10--1430 ----
NM_025248chr17103023 2892 2800 2273 2129 2116 1995 341 276 147 --11185 --
NM_025251chr881173 1109 1051 436 376 140 95 43 174 ----
NM_025256chr6147 128 ----
NM_030576chr1792586 2485 2456 2155 2032 1710 737 562 292 1322 11959 11694
NM_030581chr162573 104 ------
NM_030625chr101280 11621 ----
NM_030627chr5--11634 --1879
NM_030634chr151836 1585 1535 983 163 --12178 --
NM_030647chr765239 5148 4417 4340 2474 683 ----44138 1615 744 171
NM_030648chr4104722 4520 4322 4314 3748 3474 1766 1721 1512 565 24701 4260 ----
NM_030650chr274257 4179 4172 2992 2896 2728 133 24039 1665 ----
NM_030661chr741496 1252 1212 1141 21573 1506 11640 --
NM_030664chr1022350 94 --2975 190 --
NM_030665chr1761172 1134 501 418 315 106 11189 ----
NM_030674chr1293764 3558 2013 1649 1473 676 649 624 359 2946 251 24008 1928 13813
NM_030751chr102299 224 --11637 --
NM_030751chr102299 224 --11637 --
NM_030758chr2281139 402 333 283 270 200 105 94 --11188 --
NM_030761chr1152616 2448 2372 2337 2230 2165 2077 1932 1843 760 720 674 277 42 34 1454 1664 --
NM_030766chr121820 ----1326
NM_030795chr8--292 47 1430 --
NM_030806chr1179212 8164 8139 7921 7332 6726 6496 6459 6363 5934 3460 3223 3013 3000 2355 366 58 29256 1081 57171 6842 6641 2783 796 --
NM_030813chr116888 865 757 720 597 155 --1108 --
NM_030816chr133686 3661 2390 1846 ----
NM_030817chr1292471 2395 2343 970 647 631 568 521 474 21049 914 12515 --
NM_030881chr223833 794 208 2761 28 ----
NM_030884chr352261 1983 1753 745 353 ------
NM_030914chr92609 365 2233 218 ----
NM_030918chr1144933 4584 4328 4223 4214 4171 4155 4145 2154 2078 2034 1864 680 541 55080 4859 4235 3915 44 23929 817 14629
NM_030927chr10101228 1158 1101 1090 1055 1007 577 372 312 228 ------
NM_030949chr61319 1526 1408 --
NM_030963chr6----1228 --
NM_030964chr5123230 3171 2904 2684 2595 2556 1434 912 809 348 134 22 32581 1272 566 --12720
NM_031157chr121108 --182 --
NM_031283chr24879 651 565 359 ------
NM_031284chr155717 697 246 230 127 ------
NM_031292chr121352 11206 11430 --
NM_031306chr16959 912 854 689 362 355 1230 ----
NM_031309chr8101910 1840 1822 1503 668 429 380 271 239 21 61982 534 513 458 251 38 ----
NM_031314chr1421331 47 11428 ----
NM_031411chr531682 1500 288 ------
NM_031417chr1982313 1929 1800 1129 1003 499 466 177 21840 441 ----
NM_031419chr331104 1016 211 ----11537
NM_031426chr992708 2612 2394 2290 1728 530 498 300 23 12092 ----
NM_031427chr1495560 4631 4383 4337 4298 3704 3616 1773 1727 24163 1554 15238 --
NM_031431chr1321510 1335 1627 ----
NM_031432chr961084 916 751 165 152 138 2925 38 ----
NM_031435chr1242965 1159 1113 1074 --1726 12891
NM_031439chr871441 1272 1262 273 249 198 76 1752 ----
NM_031442chrX1662 12356 --12670
NM_031444chr22132402 2170 2148 1943 997 783 760 671 498 259 121 78 50 --11805 1585
NM_031445chr242883 2466 959 213 22424 2339 ----
NM_031468chr7177918 7691 7629 7618 7463 6500 6400 5932 4987 2972 2840 2678 2521 1621 1097 739 334 57417 5602 5586 1882 325 45643 5127 980 520 --
NM_031469chr611168 23460 1487 23259 868 156
NM_031476chr1672345 2210 2021 1878 869 585 198 22450 2000 12649 --
NM_031477chr162288 31 ------
NM_031483chr2083479 3330 2165 1426 1168 808 734 154 1770 1168 --
NM_031492chr111227 ------
NM_031844chr134150 2842 797 23377 210 --13786
NM_031845chr233437 3368 2763 12938 ----
NM_031847chr233437 3368 2763 12938 ----
NM_031849chr531682 1500 288 ------
NM_031857chr531682 1500 288 ------
NM_031860chr531682 1500 288 ------
NM_031886chr19102118 2033 1944 1802 1781 1705 1627 1620 1022 380 11899 ----
NM_031890chr22122643 2538 2527 2255 968 883 851 710 677 646 412 74 ----11876
NM_031892chrX3783 283 65 ------
NM_031918chr19121941 1787 1685 1572 1558 1426 1387 788 725 525 90 48 --21655 1552 --
NM_031992chr721663 1279 21455 282 11380 --
NM_032012chr9103686 3485 3429 1679 1601 1489 1240 107 84 62 21451 95 --14963
NM_032013chr2061583 1388 1344 1209 1134 74 --11253 --
NM_032017chr1101749 1636 1628 1339 625 494 346 137 50 44 21818 1589 --11531
NM_032041chr892415 2377 2182 1833 610 493 338 194 185 1542 --11997
NM_032052chr2241409 1007 931 196 1273 ----
NM_032088chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_032092chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_032102chr1182633 2351 2265 2181 1896 761 586 62 12047 ----
NM_032109chr591307 518 288 280 231 175 108 85 77 2473 34 1256 --
NM_032146chr3--126 ----
NM_032153chr321880 401 12191 12209 --
NM_032193chr1161890 1820 1623 1587 563 499 ------
NM_032199chr10113672 3617 2493 1314 610 504 292 233 138 125 60 --1941 --
NM_032204chr222247 119 ------
NM_032208chr273450 2804 2489 2381 1314 1246 1155 12465 13289 --
NM_032211chr107767 346 245 161 87 50 23 --1274 --
NM_032214chr203290 94 44 1977 21139 929 --
NM_032217chr421304 943 ------
NM_032221chr2041694 1635 237 202 1249 --12045
NM_032227chrX----169 --
NM_032233chr143769 324 29 ------
NM_032242chr3133266 3224 2925 2573 2249 1263 1257 948 426 292 163 151 128 52687 2065 1175 972 567 --123
NM_032246chr152119 71 ----1919
NM_032272chr84332 147 86 23 1375 133 --
NM_032281chr1992925 2462 1219 1114 1074 894 748 498 402 1414 12794 --
NM_032283chr1121738 1521 1449 1295 1281 1248 1173 737 653 261 218 185 --11398 --
NM_032287chr22113018 2930 1450 973 890 792 523 415 342 258 38 --23455 1197 --
NM_032288chr332401 528 497 ------
NM_032307chr93392 346 307 2399 175 ----
NM_032312chr21942 ------
NM_032319chr24331 318 58 23 ------
NM_032325chr1151907 1689 1510 1374 560 ------
NM_032353chr17----169 --
NM_032380chr5----139 --
NM_032403chr581423 1367 1327 1318 1220 156 72 51 11131 11431 --
NM_032410chr8----181 --
NM_032431chr115757 704 216 114 23 ----1692
NM_032434chr21121 ------
NM_032440chr1042234 1071 828 653 11806 12033 --
NM_032445chr151100 --1211 --
NM_032449chr1102728 2682 2643 2434 2172 1870 1780 792 356 87 --22122 1914 --
NM_032457chr463640 3587 2825 1216 977 629 ------
NM_032458chrX1920 12626 ----
NM_032471chr6--1829 ----
NM_032491chr1211235 --1833 --
NM_032499chr152498 366 ----1460
NM_032503chr61236 1950 --1722
NM_032510chr185980 737 691 651 27 62149 1912 1835 1638 519 398 ----
NM_032512chrX61001 770 763 53 32 26 --1340 --
NM_032521chr2092298 1275 1155 987 912 769 601 430 351 ------
NM_032538chr6232753 2589 2523 2480 2351 2311 2274 2114 2022 1969 1905 1793 1068 982 852 620 601 531 512 453 316 122 42 42445 1869 400 82 12154 12125
NM_032547chr41554 --1981 --
NM_032552chr9111863 1789 1770 1606 1341 504 338 245 191 180 173 --21754 1476 --
NM_032557chr41128 --1968 --
NM_032560chr142362 219 ------
NM_032575chr1681694 1616 1601 1287 333 263 168 114 41812 366 46 36 21571 477 --
NM_032578chr1021195 167 21535 986 11453 11209
NM_032581chr7130 --1632 --
NM_032582chr172758 690 --1740 1711
NM_032623chr41288 ------
NM_032638chr371306 1188 1151 553 466 209 103 3140 114 67 ----
NM_032689chr1951431 1411 1081 1063 203 1355 ----
NM_032711chr17103926 3811 3775 3251 3194 1625 587 572 457 377 23796 468 --13118
NM_032737chr19162554 2406 2378 2255 1930 1789 1701 1041 898 480 431 273 260 170 143 37 --12288 --
NM_032778chr343275 2869 2708 246 ----1599
NM_032781chr116666 616 399 306 61 38 1158 1724 --
NM_032786chr121527 --173 --
NM_032804chr1051646 1622 936 662 76 1642 1447 --
NM_032833chr171753 1709 1635 774 632 158 22 1980 --12095
NM_032840chr124910 857 771 348 --161 194
NM_032859chr1313382 1970 1643 --
NM_032871chr1181928 1778 1343 1300 1219 781 579 162 31280 441 113 31906 1462 671 11857
NM_032873chr1194592 4161 3518 3409 2839 1474 724 373 216 13009 --13716
NM_032876chr1431985 562 343 --1498 --
NM_032883chr204883 321 315 309 --1303 --
NM_032892chr151239 165 150 --
NM_032898chr34475 397 390 314 ------
NM_032900chr1083948 3412 3400 2922 1556 1334 1313 383 ------
NM_032906chr4----1169 --
NM_032951chr71496 1215 129 --
NM_032953chr71496 1215 129 --
NM_032961chr4194 1170 ----
NM_032975chr1852305 2253 2229 1242 618 ----33237 2720 164
NM_032980chr1852305 2253 2229 1242 618 ----33237 2720 164
NM_032983chr7132797 2770 2724 2704 2493 2254 2163 2119 2071 1153 409 332 23 23249 61 ----
NM_032992chr44665 263 224 52 2435 85 ----
NM_032995chr261537 1314 1216 1118 593 310 31514 566 553 1542 --
NM_032998chr121122 1028 11130 ----
NM_033014chr921326 1077 11587 ----
NM_033018chrX61008 940 870 752 388 369 122 ----
NM_033020chr131646 1213 72 13199 13766 23452 593
NM_033030chr22138 25 11278 171 --
NM_033036chr1181533 1062 617 474 370 348 239 54 11470 1214 --
NM_033058chr8136 1793 ----
NM_033083chr323201 2094 22435 356 22642 508 --
NM_033102chr191213 1168 977 843 388 357 315 200 49 ------
NM_033102chr191213 1168 977 843 388 357 315 200 49 ------
NM_033103chr1951085 949 901 874 392 1986 ----
NM_033129chr20121817 1806 1483 743 737 731 380 277 196 131 90 83 12025 ----
NM_033133chr1772465 2327 1285 1252 349 327 321 33049 2352 1210 1935 --
NM_033135chr1131719 1626 140 --12039 --
NM_033138chr7--1132 ----
NM_033139chr7--1132 ----
NM_033140chr7--1132 ----
NM_033141chr1472213 2128 1991 1899 560 469 345 --2315 99 11562
NM_033143chr464589 4496 1502 1458 1010 299 2153 55 1247 14314
NM_033157chr7--1132 ----
NM_033201chr164785 426 358 232 1485 ----
NM_033222chr911055 21151 1008 1553 --
NM_033224chr7227137 6888 6844 6751 6708 6660 6548 6315 6139 5570 5551 5324 5278 5239 3199 2423 1579 1318 366 339 264 80 25119 1216 21440 533 --
NM_033240chr1591364 1343 1266 1130 1086 667 638 487 60 ------
NM_033244chr158884 863 786 467 452 187 158 21 ------
NM_033274chr5113461 3030 2633 2553 2324 1092 640 525 297 185 157 32372 1028 859 11266 --
NM_033290chrX73047 2871 2731 2588 2581 1378 476 ------
NM_033315chr17112051 1974 1640 1544 1426 706 457 409 250 181 109 1674 11504 --
NM_033331chr983167 2933 2733 2236 687 281 207 194 12678 ----
NM_033360chr1244503 4471 2822 1192 11807 --23948 849
NM_033375chr1771506 1480 1450 1125 942 99 65 1391 11014 --
NM_033380chrX21096 295 1174 ----
NM_033381chrX21096 295 1174 ----
NM_033387chr9132546 2451 2338 2331 2121 2051 1875 963 923 388 157 112 62 22584 866 22092 1669 --
NM_033407chr1------1493
NM_033425chr1192871 2839 2832 2730 1103 814 522 419 59 12692 ----
NM_033449chr5111976 1820 1753 1620 1575 1507 733 688 574 78 26 ------
NM_033496chr104726 569 197 72 135 ----
NM_033497chr104726 569 197 72 135 ----
NM_033498chr104726 569 197 72 135 ----
NM_033500chr104726 569 197 72 135 ----
NM_033503chr15163552 3539 3250 3129 3098 3088 3030 3017 2414 1186 1179 1060 1044 568 404 372 23440 623 23679 2930 21218 477
NM_033515chr62880 408 ------
NM_033516chr941453 995 287 102 ------
NM_033542chr2051448 711 697 487 81 --1775 --
NM_033551chr592839 2746 2657 2299 2115 1320 675 232 70 1458 12828 12216
NM_033624chr1242299 1667 1417 172 --11975 --
NM_033626chrX91534 1451 1298 1270 1182 1154 699 525 40 --11667 --
NM_033631chr183532 3351 3187 2759 1129 692 202 45 32615 897 307 --1869
NM_033637chr10144109 3923 3913 3381 1533 1217 1119 522 471 464 304 183 111 31 33322 2617 1586 11605 31404 1000 199
NM_033656chr2125740 3968 ------
NM_048368chr18--4540 163 42 30 ----
NM_052832chr811156 ----13002
NM_052834chr1872310 2265 2043 770 351 118 109 12280 ----
NM_052845chr1283248 3220 3129 3025 2925 2406 129 100 1792 --12150
NM_052851chr1362078 2064 1910 1647 442 28 1759 ----
NM_052875chr1131761 710 582 1829 1725 139
NM_052876chr1981969 1887 1821 1789 836 452 271 124 ------
NM_052882chr193742 515 508 ----1164
NM_052885chr1244817 4616 3390 3100 14525 1286 --
NM_052896chr151880 867 568 149 98 31782 935 49 22025 724 12118
NM_052898chr8133 11642 11287 --
NM_052899chr57949 926 878 702 618 255 146 1299 1217 --
NM_052904chr641324 1065 570 71 ----1475
NM_052906chr22234354 3997 3920 3544 1979 1936 1723 1692 1677 1603 1404 1357 1347 1193 1148 1137 972 966 815 596 532 275 106 34724 4290 1647 ----
NM_052910chr1311406 31844 1739 270 ----
NM_052925chr193682 400 44 --1346 1431
NM_052928chr1771231 619 573 445 321 275 236 2400 101 ----
NM_052934chr1122142 1783 1773 1586 1447 899 891 731 563 539 504 340 21689 189 11944 --
NM_052936chrX2343 263 ------
NM_052996chr1641393 588 494 191 ----11533
NM_053016chr9147486 7335 7060 6840 6794 6755 6651 6403 6247 3155 2043 1571 1042 628 36613 4896 1345 15604 --
NM_053023chr1122577 286 21054 636 ----
NM_053024chr3154 1226 --1347
NM_053025chr331128 382 99 2465 457 --1165
NM_053026chr331128 382 99 2465 457 --1165
NM_053027chr331128 382 99 2465 457 --1165
NM_053028chr331128 382 99 2465 457 --1165
NM_053031chr331128 382 99 2465 457 --1165
NM_053032chr331128 382 99 2465 457 --1165
NM_053042chr422871 1264 ------
NM_053043chr7116059 5680 5295 4119 4088 1927 1682 1375 1255 1026 471 22409 944 15268 --
NM_053046chr191416 ------
NM_053056chr112753 738 23140 3112 12248 12732
NM_054013chr54841 813 612 262 --1252 --
NM_054016chr15736 658 651 486 358 1519 12002 --
NM_054016chr15736 658 651 486 358 1519 12002 --
NM_054016chr15736 658 651 486 358 1519 12002 --
NM_054025chr1162173 1861 1543 1426 282 143 3743 440 260 42075 634 461 213 --
NM_054027chr552259 2180 2173 457 190 --11734 --
NM_054033chr21182 ------
NM_057159chr921164 632 --11562 --
NM_057175chr412108 1939 12616 --
NM_057749chr82299 108 --11129 --
NM_058240chr1421325 656 123 1414 --
NM_058241chr242060 936 521 233 ------
NM_058241chr242060 936 521 233 ------
NM_078467chr661416 1344 1142 1110 431 159 ------
NM_078469chr1071418 1306 1107 1080 882 525 340 ------
NM_078470chr1072008 1868 1048 897 720 670 643 ------
NM_078471chr1731074 778 328 ------
NM_078474chr151463 ------
NM_078476chr641501 323 299 227 11143 11376 --
NM_079421chr19--122 ----
NM_080491chr11223712 3584 3351 3253 3242 3170 3031 2866 2684 2646 2518 2417 1474 1462 852 728 600 452 387 210 119 24 33399 1501 566 --12970
NM_080546chr912200 --1810 --
NM_080591chr963074 1263 1074 700 429 272 ------
NM_080599chr10--31047 97 66 ----
NM_080604chr64528 443 107 79 ------
NM_080607chr2051054 869 795 377 93 1161 ----
NM_080621chr2031017 981 23 3522 441 32 1417 --
NM_080632chrX4809 709 562 67 ------
NM_080645chr661689 1524 1475 1462 1350 697 ------
NM_080669chr17124469 4132 3936 3850 3281 3270 1504 1289 1084 675 376 79 --31907 1054 179 --
NM_080671chr261677 1634 1559 909 849 160 --21813 554 --
NM_080676chr2032201 1091 140 1450 12069 --
NM_080717chr12----1468 11257
NM_080732chr191416 ------
NM_080744chr74523 252 196 133 ------
NM_080759chr1321053 404 --1312 --
NM_080760chr1321053 404 --1312 --
NM_080764chr2261246 548 504 407 360 333 --1452 --
NM_080792chr2071966 1814 1577 755 715 548 124 21760 171 41894 1770 1524 86 --
NM_080867chr1494395 3854 3810 3719 3677 3602 3473 1467 307 13661 ----
NM_080872chr853726 3217 1488 1000 81 13474 ----
NM_080927chr353259 2931 1313 1215 969 ------
NM_100264chr10----1316 --
NM_100486chr10----1316 --
NM_130385chr1182657 2560 2397 2108 1125 280 218 42 21949 1095 ----
NM_130391chr933345 2452 2395 13286 ----
NM_130392chr933345 2452 2395 13286 ----
NM_130393chr933345 2452 2395 13286 ----
NM_130436chr212546 264 ----11941
NM_130438chr2142145 1123 841 338 ----12518
NM_130439chr1011951 11877 2696 492 --
NM_130439chr1011951 11877 2696 492 --
NM_130442chr74765 425 302 166 --146 --
NM_130443chr111125 ------
NM_130446chr3134240 3685 3652 3331 3308 1224 1149 694 687 549 422 387 40 13613 --1886
NM_130459chr961457 1361 1261 1050 503 159 2669 23 11680 --
NM_130797chr741434 1210 349 243 --11276 --
NM_130799chr119687 587 283 230 194 180 169 83 36 ------
NM_130800chr119687 587 283 230 194 180 169 83 36 ------
NM_130801chr119687 587 283 230 194 180 169 83 36 ------
NM_130802chr119687 587 283 230 194 180 169 83 36 ------
NM_130803chr119687 587 283 230 194 180 169 83 36 ------
NM_130804chr119687 587 283 230 194 180 169 83 36 ------
NM_130807chr1982322 2223 2093 1496 1452 861 820 590 12216 2754 434 --
NM_130809chr562900 2306 2131 2122 2077 100 ------
NM_130811chr20--1826 ----
NM_130830chr3123902 3626 3594 3550 2666 2621 2566 1036 1030 735 356 329 23107 722 --1482
NM_133170chr20217304 7209 6854 5274 5268 5211 4907 3118 2896 2827 2813 2800 2522 2484 2466 2166 2088 1834 1677 622 209 26953 643 24897 2297 36206 3093 1175
NM_133264chr17123703 3481 3420 3331 3290 3278 2993 2945 2496 2454 1375 146 22556 240 ----
NM_133265chrX33036 2808 583 ------
NM_133266chr1141004 808 324 200 3354 221 60 1937 --
NM_133329chr22228 135 21549 564 11543 --
NM_133330chr492814 2478 2440 2367 1084 420 245 209 28 31103 1040 170 22716 96 --
NM_133331chr492814 2478 2440 2367 1084 420 245 209 28 31103 1040 170 22716 96 --
NM_133334chr475109 5056 4585 3986 1682 1132 56 44773 4659 3970 869 --11748
NM_133335chr492814 2478 2440 2367 1084 420 245 209 28 31103 1040 170 22716 96 --
NM_133368chr16145 ------
NM_133369chr59948 760 740 698 650 264 230 190 121 ------
NM_133370chr432896 1182 921 13000 ----
NM_133372chr572930 2095 1917 1894 1870 1843 525 --11960 --
NM_133433chr5------1348
NM_133445chr983722 3532 3434 3221 2317 1155 1008 274 11223 ----
NM_133452chr1991186 1103 1007 978 836 760 493 471 249 ------
NM_133457chr771249 1190 1130 998 541 474 233 11124 144 --
NM_133478chr272172 2087 1741 977 931 892 66 1758 199 --
NM_133496chr1134526 3678 3195 3060 3016 2968 2941 967 923 833 790 742 362 11085 176 --
NM_133503chr121637 ------
NM_133504chr121637 ------
NM_133505chr121637 ------
NM_133506chr121637 ------
NM_133625chr331169 1013 154 --41059 1040 368 26 1196
NM_133631chr311417 1253 ----
NM_133638chr53915 354 233 ------
NM_133646chr2114688 4137 4096 4036 3990 3951 3715 1728 1110 1089 492 35496 3817 1040 --1601
NM_133647chr1553674 2819 2621 2546 2498 21524 1389 12665 --
NM_134268chr173930 345 205 --21191 269 --
NM_134325chr1131677 1318 1308 1121 708 611 489 434 426 266 98 74 39 11224 11479 --
NM_134428chr9126 ------
NM_134442chr251762 1715 1683 1676 387 11542 ----
NM_138270chrX43280 2335 1272 1122 23141 1029 22900 2366 --
NM_138300chr171472 1356 1331 1142 400 277 223 ------
NM_138316chr10--1929 ----
NM_138338chr22103359 3316 3117 2741 2667 1251 1156 995 964 953 --32632 2410 2378 --
NM_138340chr18155 ------
NM_138357chr1031597 1440 659 1519 1484 --
NM_138360chr14372 53 25 ------
NM_138370chr23742 560 196 2590 41 ----
NM_138376chr143182 75 66 ------
NM_138381chr362047 1863 1834 1675 1551 45 ----1575
NM_138385chr441317 1086 998 973 11276 ----
NM_138396chr124318 310 294 228 ------
NM_138426chr741877 532 501 407 --12349 --
NM_138430chr13--1369 ----
NM_138444chr134697 231 34 28 11406 --21513 1267
NM_138457chr6233348 3272 3027 2924 2794 2656 2581 2521 2398 2189 1258 1091 1078 938 911 855 831 711 502 386 144 113 54 32405 1064 342 33389 2838 873 --
NM_138459chr653348 2390 1091 323 99 ------
NM_138468chr2235301 5204 4803 4747 4568 4455 3968 3923 3884 2435 2389 2357 2350 2035 1918 1607 1561 1522 1320 1006 908 750 543 34940 2216 1389 15668 --
NM_138473chr12144662 4639 4386 4320 4239 3206 1941 1609 1558 1434 846 312 284 259 2818 165 14558 --
NM_138479chr1121703 1511 1491 1414 1330 817 784 736 466 404 134 59 ------
NM_138555chr154396 146 126 101 ------
NM_138559chr241181 1126 139 35 --11325 --
NM_138576chr1463958 1853 1455 1275 352 119 --34441 4208 801 11817
NM_138578chr2061487 1426 1165 1058 135 66 ------
NM_138621chr263873 3117 1433 1334 1085 766 --34049 3306 1098 23158 66
NM_138633chr621698 249 ------
NM_138638chr1421857 50 ------
NM_138713chr16127697 6407 6200 5645 5517 5109 3309 2646 2583 2521 330 251 --22300 825 32721 2608 965
NM_138714chr16127697 6407 6200 5645 5517 5109 3309 2646 2583 2521 330 251 --22300 825 32721 2608 965
NM_138717chr61599 ------
NM_138727chr171687 1578 1558 1550 947 454 341 22046 884 1794 --
NM_138728chr171687 1578 1558 1550 947 454 341 22046 884 1794 --
NM_138735chr2----11045 --
NM_138779chr13--166 ----
NM_138782chr51471 ----12196
NM_138795chr161516 1438 1425 1349 1293 303 1264 2246 107 --
NM_138799chr242079 1994 1767 1379 31860 1666 247 ----
NM_138923chrX144 ------
NM_138931chr3131 ------
NM_138959chr165451 5051 4508 2179 894 679 56333 4975 2116 823 790 24676 4300 --
NM_138967chr15112431 2365 2345 2205 1970 1819 1002 725 698 380 171 12083 32070 1564 205 --
NM_138970chr1442116 872 220 197 --1949 --
NM_139015chr1271563 1537 1383 620 450 247 90 ------
NM_139045chr9----165 --
NM_139053chr12123 99 1203 ----
NM_139057chr1582684 2431 2387 2205 2178 1020 948 37 12263 194 --
NM_139058chrX2458 446 ----157
NM_139062chr171376 ------
NM_139071chr1251070 578 409 374 197 --11620 --
NM_139131chr111610 ------
NM_139135chr14919 358 121 101 11058 ----
NM_139155chr1081540 1180 1081 561 517 334 229 61 1216 ----
NM_139159chr1971062 1050 425 376 318 116 95 2527 394 --1864
NM_139167chr8--1366 ----
NM_139168chr511516 11393 ----
NM_139207chr1222079 594 ----1164
NM_139239chr19----1317 --
NM_139244chr6--1122 ----
NM_139276chr1772210 2023 1875 1773 1730 1480 754 31928 625 328 --11702
NM_139283chr1221986 1021 --12247 --
NM_139321chr2063717 3192 2771 2596 1238 304 1186 ----
NM_139323chr2031512 182 129 11919 ----
NM_144499chr371212 893 875 268 230 187 50 2413 393 --31231 1111 316
NM_144567chr182774 1877 1834 1759 996 906 862 786 1722 ----
NM_144568chr141607 ------
NM_144571chr416722 12754 14886 1607
NM_144579chr2112878 2846 2823 2330 2203 1118 1048 938 773 591 496 32218 1179 106 --22427 264
NM_144582chr272628 2348 2335 1974 1907 1829 161 22550 2253 ----
NM_144584chr1135 ------
NM_144586chr231259 1144 42 ----1918
NM_144590chr1082394 1986 543 475 417 332 293 176 ------
NM_144595chr13----162 --
NM_144599chr15104485 4478 3685 3677 3400 1558 1278 918 894 172 21741 155 23512 3375 --
NM_144604chr164354 340 177 131 ------
NM_144610chr17394 62 55 --1139 --
NM_144628chr20103010 2891 2741 2519 2509 2390 1927 1125 656 229 13001 ----
NM_144641chr351133 824 305 205 133 ------
NM_144645chr45193 157 92 86 72 ----137
NM_144664chr1122264 224 ----1578
NM_144710chr22949 230 1483 1505 --
NM_144721chr482809 2411 2265 2210 2129 1811 1765 1726 12570 --12189
NM_144732chr195718 385 377 246 132 11108 ----
NM_144767chr15204645 4480 4215 3794 3527 3517 3385 2847 1754 1686 1335 1019 900 780 529 474 252 223 190 109 1804 --1559
NM_144775chr17134326 4249 4068 3807 3729 3143 1675 1490 1205 1087 979 484 39 13737 14128 --
NM_144778chr133939 899 356 --1830 --
NM_144963chr81476 --11798 --
NM_144973chr12114923 3369 3354 3315 2113 2048 1869 1408 1396 1159 428 21663 1385 1388 --
NM_145055chr1842411 1244 651 474 --12852 --
NM_145065chr118897 771 445 343 246 189 65 43 --1378 --
NM_145071chr36939 715 338 285 131 62 1781 133 --
NM_145074chr2------1189
NM_145112chr1441043 1027 389 349 --11100 --
NM_145113chr1441315 1299 621 212 --11372 --
NM_145117chr1152434 2050 1211 1197 98 32221 2043 452 ----
NM_145165chr1462439 2090 1809 863 735 286 22007 1866 12764 --
NM_145166chr392864 2698 2667 2648 1964 1905 1080 939 708 22437 425 1532 --
NM_145174chr2241505 943 367 284 ------
NM_145185chr1951833 562 494 355 115 --21645 75 --
NM_145206chr1062988 2194 1260 302 290 213 32297 649 466 ----
NM_145207chr4144883 4652 4610 4507 4165 3621 2134 2013 1970 1926 1758 1243 1164 266 14798 24667 1834 --
NM_145245chr1981236 1118 990 876 843 831 323 139 2334 209 ----
NM_145259chr256888 5979 5706 5671 4550 ----14394
NM_145307chr1034154 3195 1468 24584 208 ----
NM_145313chr1021173 386 --1344 --
NM_145320chr743474 3324 2798 883 ------
NM_145321chr743474 3324 2798 883 ------
NM_145322chr743474 3324 2798 883 ------
NM_145349chr17121865 1567 1537 816 734 644 554 405 362 105 60 40 ------
NM_145351chr17122357 2059 2029 1766 1046 897 854 597 552 532 176 50 ------
NM_145659chr161112 ------
NM_145686chr252600 2129 879 691 312 --12796 --
NM_145687chr252600 2129 879 691 312 --12796 --
NM_145714chr16166 2160 48 ----
NM_145733chr2271127 311 250 193 112 89 41 ----1762
NM_145754chr85616 544 452 145 43 ------
NM_145798chr174632 590 218 165 ------
NM_145799chrX93043 2325 2033 1119 584 471 281 260 34 1273 22606 1945 --
NM_145808chr71322 --12659 --
NM_145863chr2--1185 ----
NM_145888chr19101991 1962 1531 1390 1284 591 91 59 51 28 --21334 273 --
NM_145891chr1621261 302 --11676 1673
NM_145892chr1621261 302 --11676 1673
NM_145912chr22214620 4581 4506 4201 4074 3971 3750 3692 3631 3341 3268 3114 2975 1402 1141 1051 891 622 377 312 215 34133 4033 427 34290 977 494 --
NM_147150chr963393 3225 530 390 239 197 1491 --1112
NM_147161chr141182 350 284 242 2463 367 21053 962 --
NM_147181chr421117 93 ------
NM_147182chr421117 93 ------
NM_147183chr421117 93 ------
NM_147193chr11129 ----287 32
NM_147202chr9152603 2150 1954 1745 915 893 856 803 449 412 406 380 216 97 78 2884 472 12620 1273
NM_147204chr126385 379 368 193 49 21 ------
NM_147223chr262354 2127 1987 1925 1759 583 1149 11545 --
NM_147233chr262171 1944 1804 1742 1576 400 ------
NM_148415chr16189 2183 71 ----
NM_148416chr16166 2160 48 ----
NM_148898chr7123 1419 ----
NM_148899chr7123 1419 ----
NM_148977chr10--1929 ----
NM_148978chr10--1929 ----
NM_152221chr223799 463 297 1188 --1119
NM_152222chr1181928 1778 1343 1300 1219 781 579 162 31280 441 113 31906 1462 671 11857
NM_152233chr1481605 1571 1559 1434 1366 1341 244 164 ------
NM_152236chr221288 1258 ----
NM_152237chr22111782 1508 1459 1248 1161 1112 627 538 525 259 211 11752 21091 601 --
NM_152253chr22134180 4116 4054 3879 3733 3637 2951 2766 1413 934 802 605 94 33850 1439 54 ----
NM_152264chr117961 824 747 685 378 242 223 1425 1970 --
NM_152265chr12646 636 21059 376 ----
NM_152277chr532056 824 751 1667 ----
NM_152280chr152277 2140 519 384 340 --11162 --
NM_152287chr1662362 2316 2277 946 579 488 21929 1734 ----
NM_152289chr1951591 1568 1339 604 299 11211 ----
NM_152300chr1731775 1749 385 21184 51 1314 11524
NM_152305chr32592 144 ----11823
NM_152344chr1741201 1089 1075 997 129 135 --
NM_152350chr173493 449 40 1179 ----
NM_152352chr1872766 2692 2400 2239 1202 562 352 23100 939 21246 201 --
NM_152371chr141860 685 646 452 21660 412 ----
NM_152374chr121640 583 --21713 532 1317
NM_152384chr2181971 1697 1660 1619 1570 1521 1484 1443 1395 1308 788 740 689 598 492 343 320 305 ------
NM_152388chr292884 2712 2460 1585 1263 942 840 755 586 13601 --135
NM_152398chr4133 ------
NM_152399chr4151 ----11205
NM_152409chr531146 1100 175 12504 --1927
NM_152424chrX154633 4556 4221 3744 3715 3353 3341 3260 3155 3124 3048 1848 1307 669 205 ------
NM_152433chr1131314 499 217 ------
NM_152437chr1272308 1946 1844 863 816 310 229 2258 106 ----
NM_152449chr1571546 1295 1258 1123 220 57 26 --1173 --
NM_152450chr1531928 1368 681 21712 438 ----
NM_152470chr18133492 3221 1495 1464 1304 1162 972 938 924 902 293 277 251 43297 3150 3098 860 23434 2776 --
NM_152478chr191625 2551 539 ----
NM_152493chr171673 1312 1280 1081 1012 68 50 --128 --
NM_152495chr131130 1106 419 ----1120
NM_152519chr221952 693 ------
NM_152520chr2----1129 --
NM_152529chr2114208 3307 3261 3222 1522 1380 1351 1299 599 521 514 33089 1223 378 ----
NM_152542chr43853 807 767 1610 11653 --
NM_152557chr761306 1203 1001 582 483 463 11281 ----
NM_152563chr1131427 1218 1005 --21546 1049 11293
NM_152599chr17----164 135
NM_152622chr563326 3146 2193 2162 1177 808 ------
NM_152624chr524568 2912 11749 1599 1747
NM_152629chr963969 1018 948 716 312 30 ------
NM_152636chr1152762 2471 1912 657 445 12339 12802 --
NM_152641chr1212860 12421 ----
NM_152678chr352454 1025 940 370 21 1806 ----
NM_152682chr431108 383 367 11720 ----
NM_152686chr552334 1757 845 747 485 31939 1623 946 --1967
NM_152699chr393657 3602 3060 2841 2797 2722 1351 474 162 13074 33354 1298 1255 --
NM_152716chr1121452 258 --11465 --
NM_152724chr1072573 2437 2391 2352 1985 937 504 132 ----
NM_152739chr72912 101 ------
NM_152749chr731148 786 286 194 1758 --
NM_152758chr852099 2045 964 951 275 12422 12609 12020
NM_152787chrX2930 495 --189 --
NM_152835chr1--12247 ----
NM_152838chr2033200 2985 58 ----13506
NM_152855chr222280 103 --1357 1377
NM_152857chr63390 139 96 ------
NM_152858chr63390 139 96 ------
NM_152860chr122385 174 ------
NM_152878chr22101525 1469 1423 1384 1081 999 618 83 44 24 11251 1524 --
NM_152890chr131150 1112 227 ------
NM_152896chr91243 ------
NM_152903chr1351813 774 728 696 689 21806 558 ----
NM_152924chr15135762 5681 5631 5585 5546 4572 4218 4197 2403 1895 1115 1058 484 35413 4673 28 ----
NM_152995chr42124 30 ------
NM_152999chr744368 4293 3175 1971 11389 ----
NM_153000chr183569 201 144 ------
NM_153013chr531946 1770 1697 11913 1959 --
NM_153029chr16173919 3793 3630 3595 2929 2821 2773 2635 2593 1631 1445 1338 784 708 588 470 107 24130 3263 22722 1562 13248
NM_153035chr153243 3158 3023 2711 2441 12171 12043 --
NM_153038chr25737 676 542 536 267 ------
NM_153050chr22134826 4801 4769 4033 3080 3054 1624 1586 945 939 921 866 731 24190 3178 ----
NM_153051chr22134826 4801 4769 4033 3080 3054 1624 1586 945 939 921 866 731 24190 3178 ----
NM_153182chr343275 2869 2708 246 ----1599
NM_153188chr523751 77 14065 ----
NM_153207chr121129 --13014 --
NM_153223chr5------11285
NM_153228chr17164 ------
NM_153235chr641957 1649 908 421 --11881 --
NM_153257chr1951103 1056 1033 983 788 11189 ----
NM_153260chr1521121 1082 2950 619 ----
NM_153261chr1611519 1605 ----
NM_153262chr122365 1067 13044 ----
NM_153267chr91161 ----1743
NM_153273chr342165 788 211 198 1757 22767 2067 --
NM_153321chr172418 356 --2825 309 --
NM_153322chr172418 356 --2825 309 --
NM_153343chr461656 1610 1571 420 270 217 1777 1525 --
NM_153348chr12122824 2735 2479 2452 2377 942 381 353 347 264 166 115 --1245 --
NM_153350chr1681493 1207 1115 605 493 453 183 114 --3705 635 34 --
NM_153360chr2061067 927 860 560 365 216 ------
NM_153365chr4--12224 --12529
NM_153367chr10133865 3834 3690 1466 1254 1187 1068 823 810 630 567 422 22 23592 839 ----
NM_153371chr1371565 946 715 624 581 533 506 --1759 --
NM_153450chr111778 --1351 --
NM_153453chr6--159 ----
NM_153456chr13136222 5833 5662 4514 4431 4269 3837 2447 2091 2064 1565 1175 693 34313 1650 1158 1156 15733
NM_153485chr5----152 --
NM_153487chr6194858 4752 4623 4599 4512 4432 4408 3468 3225 3055 1542 1278 1072 823 816 810 419 328 95 21928 40 21887 1253 23043 717
NM_153499chr1262857 2762 2047 2005 1164 44 --22184 1193 1194
NM_153500chr1262857 2762 2047 2005 1164 44 --22184 1193 1194
NM_153607chr5------22011 462
NM_153613chr15163 ------
NM_153616chr1532068 2017 304 ------
NM_153617chr1532068 2017 304 ------
NM_153618chr1532068 2017 304 ------
NM_153619chr1593306 3255 2672 988 719 610 494 393 131 ------
NM_153620chr751469 594 420 403 328 --11118 --
NM_153631chr741496 1252 1212 1141 21573 1506 11640 --
NM_153632chr741496 1252 1212 1141 21573 1506 11640 --
NM_153634chr1221389 1021 2652 619 ----
NM_153645chr2263279 3107 3081 2507 559 439 12051 ----
NM_153649chr141646 1509 476 44 --21690 189 --
NM_153756chr1101663 1645 1429 1408 598 518 458 360 287 239 127 1295 --
NM_153810chr1054209 3185 1816 1124 94 14945 ----
NM_153812chr14703 518 396 90 ------
NM_153828chr21591 ------
NM_170606chr7123 1238 ----
NM_170607chr1741186 1047 309 142 --21213 234 --
NM_170672chr231662 347 334 11394 ----
NM_170674chr15--11323 1200 --
NM_170675chr151418 1999 ----
NM_170676chr151418 1999 ----
NM_170677chr15--11323 1200 --
NM_170679chr531080 963 480 ------
NM_170696chr1571565 1405 1354 1337 268 69 28 ------
NM_170697chr1571565 1405 1354 1337 268 69 28 ------
NM_170706chr163994 3566 3523 3007 1638 1314 84021 2685 619 442 403 364 325 286 13034 1650
NM_170726chr1126 ------
NM_170731chr1142135 1977 1844 1161 ----12450
NM_170732chr1142135 1977 1844 1161 ----12450
NM_170733chr1142135 1977 1844 1161 ----12450
NM_170734chr1142135 1977 1844 1161 ----12450
NM_170735chr1142135 1977 1844 1161 ----12450
NM_170750chrX2583 194 ------
NM_170754chr123168 94 85 150 1344 --
NM_171825chr5112761 2457 2119 2047 2025 1995 1989 1117 704 291 285 32886 2039 1262 22234 1017 --
NM_172058chr83454 212 66 ----157
NM_172059chr83454 212 66 ----157
NM_172060chr83454 212 66 ----157
NM_172071chr1105833 5788 4704 2570 2353 2309 2234 1625 301 113 --27333 400 --
NM_172103chr641726 445 420 382 ------
NM_172105chr641726 445 420 382 ------
NM_172169chr1051778 1650 1636 593 32 ------
NM_172170chr1051778 1650 1636 593 32 ------
NM_172171chr1051778 1650 1636 593 32 ------
NM_172173chr1051778 1650 1636 593 32 ------
NM_172200chr106587 540 485 238 231 21 1131 ----
NM_172216chr1252759 2664 1949 1907 1066 --22086 1095 196
NM_172226chr1262857 2762 2047 2005 1164 44 --22184 1193 1194
NM_172230chr115757 704 216 114 23 ----1692
NM_172315chr15--11323 1200 --
NM_172316chr15--11323 1200 --
NM_172344chr22228 135 21549 564 11543 --
NM_172375chr1421077 742 165 2734 84 --
NM_172388chr1851230 657 365 145 68 130 --11671
NM_172389chr1851230 657 365 145 68 130 --11671
NM_173156chr141598 1588 308 259 31986 1626 690 21995 1876 --
NM_173171chr22134 100 ------
NM_173172chr22442 408 ------
NM_173173chr22134 100 ------
NM_173198chr921879 823 3720 310 40 ----
NM_173200chr921879 823 3720 310 40 ----
NM_173214chr16127697 6407 6200 5645 5517 5109 3309 2646 2583 2521 330 251 --22300 825 32721 2608 965
NM_173359chr351646 1543 1359 1296 391 ------
NM_173465chr57919 850 814 761 715 407 330 21000 987 2679 140 --
NM_173468chr485008 4236 3717 1954 1599 1466 536 464 ------
NM_173472chr3183 1221 ----
NM_173473chr10152523 2308 2262 2230 2223 1961 1929 1922 1864 1709 1673 1010 935 457 81 22086 1788 11054 --
NM_173475chr1621534 659 ------
NM_173476chr16122269 2195 1860 1835 1812 1773 1656 1402 905 326 155 54 32207 1530 317 22293 384 11676
NM_173491chr531436 138 75 ------
NM_173495chrX61722 1700 1017 923 850 640 1755 1510 --
NM_173511chr262879 1516 1441 1109 534 104 1580 21560 881 --
NM_173536chr454766 1644 1066 609 209 ----13424
NM_173546chr32646 234 1573 ----
NM_173557chr18170 --1485 --
NM_173570chr362140 1987 1712 1397 866 747 ------
NM_173576chr1012174 ------
NM_173595chr12195066 4489 4376 3874 3829 3809 3683 3598 3568 3368 3274 3223 1536 1467 1437 1188 1151 1079 737 11233 13626 --
NM_173602chr1243355 2659 1282 947 23130 2975 1449 --
NM_173642chr1269086 8760 8462 8173 7901 5857 5832 5821 3449 3284 3064 2934 2849 2564 2418 2375 2272 2210 2037 1083 1042 851 774 739 523 161 12737 --1126
NM_173654chr36603 512 485 394 319 52 1259 ----
NM_173681chr7161885 1827 1725 1674 1481 1392 802 726 519 395 344 248 119 77 68 22 ------
NM_173694chrX31953 1902 1695 12139 ----
NM_173807chr1146 ------
NM_173808chr153697 3470 3259 1163 814 21725 955 ----
NM_173822chr222195 1864 ----11752
NM_173829chr5115983 5889 4811 4644 4533 4446 4405 3831 3785 3746 1527 14423 --1352
NM_173833chr831056 313 276 31674 463 113 1599 --
NM_173851chr883870 3705 3631 3601 3197 1066 730 348 ----22658 1546
NM_174911chr843757 2480 1487 504 ------
NM_174921chr441171 1125 1093 1086 1951 ----
NM_174963chr14709 609 84 31 3250 241 156 1182 --
NM_174964chr14709 609 84 31 3250 241 156 1182 --
NM_174965chr14728 628 103 50 4269 260 175 31 1201 --
NM_174966chr14709 609 84 31 3250 241 156 1182 --
NM_174967chr14728 628 103 50 4269 260 175 31 1201 --
NM_174968chr14709 609 84 31 3250 241 156 1182 --
NM_174969chr14709 609 84 31 3250 241 156 1182 --
NM_174970chr14728 628 103 50 4269 260 175 31 1201 --
NM_174971chr14709 609 84 31 3250 241 156 1182 --
NM_174975chr224682 616 565 284 ------
NM_175063chr1961157 847 476 187 149 119 21022 891 ----
NM_175077chr204393 197 147 55 11080 21242 1032 --
NM_175607chr321660 1642 ----173
NM_175610chr1511206 1392 ----
NM_175612chr321660 1642 ----173
NM_175623chr12156903 6599 5752 5384 5338 5299 2929 2890 2736 2290 2166 1715 1673 1492 1295 46051 5984 5166 2119 16796 --
NM_175624chr12156998 6694 5847 5479 5433 5394 3024 2985 2831 2385 2261 1810 1768 1587 1390 46146 6079 5261 2214 16891 --
NM_175625chr12156998 6694 5847 5479 5433 5394 3024 2985 2831 2385 2261 1810 1768 1587 1390 46146 6079 5261 2214 16891 --
NM_175634chr821015 960 --1844 --
NM_175635chr821015 960 --1844 --
NM_175636chr821015 960 --1844 --
NM_175733chr11112162 2114 1971 1820 1493 1368 724 429 181 118 92 ----184
NM_175736chr12217415 6965 6355 6289 5809 5607 3121 2682 2588 2392 2326 2263 1711 1674 1576 1301 1115 680 321 277 122 36443 3147 1126 57446 6435 2765 1689 1641 16583
NM_175737chr4144 ------
NM_175848chr206984 505 377 322 97 51 ----1564
NM_175848chr206984 505 377 322 97 51 ----1564
NM_175849chr206984 505 377 322 97 51 ----1564
NM_175849chr206984 505 377 322 97 51 ----1564
NM_175850chr206984 505 377 322 97 51 ----1564
NM_175850chr206984 505 377 322 97 51 ----1564
NM_175852chr1142977 2964 2842 2830 2766 2574 2360 2180 2140 1937 1107 470 411 44 ------
NM_175854chr13------11006
NM_175863chr6----182 --
NM_175866chr11195 ------
NM_175898chr1571419 1286 518 472 420 330 256 1214 1667 --
NM_175900chr16111603 1515 1381 1354 1173 693 634 436 272 200 94 1185 11310 21259 72
NM_175907chr1842744 2657 2638 2265 12880 ----
NM_175931chr1681951 1667 1628 1543 1376 1360 493 215 --31973 585 52 --
NM_176792chr1041218 1177 199 43 1956 ----
NM_176814chr711318 2575 202 ----
NM_176863chr1741497 1435 822 768 11807 22035 1757 --
NM_177398chr131668 1623 799 1156 1620 11530
NM_177399chr131668 1623 799 1156 1620 11530
NM_177422chr12654 97 ------
NM_177452chr1452294 1959 1709 938 780 ------
NM_177968chr232146 2100 2061 21929 1642 ----
NM_177976chr3--126 ----
NM_177977chr17101847 1773 1566 1497 1436 582 461 394 244 44 --11543 --
NM_177990chr2031758 304 276 ----1260
NM_177996chr2073005 2934 2226 2205 1330 1074 103 1467 ----
NM_177999chr9163648 3566 3221 2888 2832 2574 2449 2301 1214 1205 779 374 321 231 69 59 43250 3011 2501 900 ----
NM_178006chr1362078 2064 1910 1647 442 28 1759 ----
NM_178007chr1362078 2064 1910 1647 442 28 1759 ----
NM_178011chr102496 458 12743 --12874
NM_178037chr12123644 3572 3565 3244 3087 2678 2627 2219 1455 1383 402 221 42712 2454 1288 509 21012 48 --
NM_178038chr12123644 3572 3565 3244 3087 2678 2627 2219 1455 1383 402 221 42712 2454 1288 509 21012 48 --
NM_178126chr175875 801 590 547 472 --187 --
NM_178135chr451188 1011 963 936 509 --11055 --
NM_178151chrX77012 5764 5214 4946 4797 2261 499 37128 5846 543 11804 --
NM_178152chrX77012 5764 5214 4946 4797 2261 499 37128 5846 543 11804 --
NM_178153chrX77012 5764 5214 4946 4797 2261 499 37128 5846 543 11804 --
NM_178154chr14249 34 1130 ----
NM_178155chr14249 34 1130 ----
NM_178156chr14249 34 1130 ----
NM_178157chr14249 34 1130 ----
NM_178229chr16356 214 206 138 116 92 ------
NM_178270chrX2343 263 ------
NM_178423chr731219 784 498 2256 64 ----
NM_178425chr731219 784 498 2256 64 ----
NM_178502chr12------153
NM_178539chr1211611 12079 ----
NM_178554chr3163304 3060 3034 2912 2694 2532 1414 1405 1249 1242 1087 1048 801 357 280 184 22263 1262 --12242
NM_178565chr811377 4449 260 122 109 ----
NM_178566chr911656 --11313 --
NM_178568chr1791686 1597 1546 1383 1364 1311 595 221 208 ----21425 25
NM_178584chr22949 230 1483 1505 --
NM_178585chr441273 733 615 63 --12180 --
NM_178586chr1441642 553 243 146 ------
NM_178812chr821208 200 ------
NM_178860chr176979 921 873 781 114 42 162 ----
NM_180989chr1332183 1646 333 ------
NM_181077chr1521942 882 ------
NM_181332chrX41880 1831 921 500 3482 169 46 1369 --
NM_181349chr783098 2546 2503 2485 2087 1167 1122 650 1500 22461 57 --
NM_181351chr1142187 1962 933 815 22444 2141 --12877
NM_181356chr65806 374 335 298 159 ------
NM_181443chr2012725 ------
NM_181481chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_181482chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_181483chr1866882 6523 6220 5390 4351 950 44378 1201 981 865 11218 14533
NM_181486chr12----1468 11257
NM_181491chr992810 2766 2696 2542 2275 1988 931 511 467 32921 1043 815 1563 11058
NM_181504chr553733 1683 880 476 437 --12854 1651
NM_181521chr1696450 5519 5437 2025 1865 1129 232 196 153 14393 1459 15196
NM_181523chr553733 1683 880 476 437 --12854 1651
NM_181524chr553733 1683 880 476 437 --12854 1651
NM_181571chr101848 ----1362
NM_181670chr12--1299 187 --
NM_181671chr172818 38 193 --1270
NM_181672chrX21509 1400 ------
NM_181673chrX21509 1400 ------
NM_181706chr1162158 1854 781 738 732 421 ------
NM_181714chr631984 1668 262 ------
NM_181746chr12341 285 --1148 1799
NM_181782chr642211 2173 210 84 ------
NM_181784chr272287 2061 1938 1689 520 151 122 --11743 --
NM_181794chr6--1829 ----
NM_181795chr6--1829 ----
NM_181828chr22213660 3558 3391 3294 2944 2869 2651 2329 1451 1376 1228 1094 1046 1010 988 592 533 474 401 208 192 22755 1185 2930 73 --
NM_181829chr22213660 3558 3391 3294 2944 2869 2651 2329 1451 1376 1228 1094 1046 1010 988 592 533 474 401 208 192 22755 1185 2930 73 --
NM_181830chr22213660 3558 3391 3294 2944 2869 2651 2329 1451 1376 1228 1094 1046 1010 988 592 533 474 401 208 192 22755 1185 2930 73 --
NM_181832chr22223675 3573 3406 3309 2959 2884 2666 2344 1466 1391 1243 1109 1061 1025 1003 607 548 489 416 223 207 25 22770 1200 2945 88 --
NM_181838chr51256 1212 ----
NM_181839chr82434 298 1520 --1420
NM_181876chr441859 1677 760 168 --32000 1691 32 --
NM_181886chr42246 181 ----11119
NM_181887chr42246 181 ----11119
NM_181888chr42246 181 ----11119
NM_181889chr42246 181 ----11119
NM_181890chr42246 181 ----11119
NM_181891chr42246 181 ----11119
NM_181892chr43293 228 32 ----11166
NM_181893chr42246 181 ----11119
NM_182485chr433391 3099 115 1387 ----
NM_182487chr9113097 3078 2791 2702 1345 1264 995 867 622 465 106 41587 1116 236 154 53915 677 443 160 77 --
NM_182503chr694603 4145 2216 1797 1095 1062 998 343 298 13818 15037 11649
NM_182507chr1262101 1788 1568 890 875 711 42168 723 677 330 1849 --
NM_182509chr1471631 1463 1198 1132 607 580 58 41671 1499 1417 247 --1464
NM_182515chr19156701 6571 5321 5142 4794 4748 4709 4203 4171 4163 4105 1872 1829 957 92 36663 4576 826 ----
NM_182526chr14163024 2982 2957 2905 2750 2516 2437 2150 2111 1250 1011 939 769 761 243 115 22369 2041 --22300 1134
NM_182527chr22121852 1834 1660 1498 881 832 807 776 584 433 276 221 --41363 410 328 133 --
NM_182551chr293019 2898 842 736 646 448 433 392 30 ----11198
NM_182553chr117573 510 483 119 86 58 29 1426 ----
NM_182557chr11102096 1907 1776 1736 1663 1442 1400 852 719 390 1876 ----
NM_182580chr1112395 2373 2111 2059 1815 1759 849 733 600 568 340 12496 ----
NM_182623chr14501 488 232 62 3443 191 24 ----
NM_182641chr17----1470 --
NM_182645chr6--159 ----
NM_182646chr433391 3099 115 1387 ----
NM_182688chr2191951 1905 1866 914 868 836 829 695 377 41735 435 59 46 ----
NM_182691chr7--146 ----
NM_182692chr7--146 ----
NM_182697chr711224 --11400 --
NM_182700chr751999 640 594 389 83 ------
NM_182703chr15--1531 ----
NM_182706chr8--152 ----
NM_182718chr101848 ----1362
NM_182719chr101848 ----1362
NM_182724chr101848 ----1362
NM_182725chr101848 ----1362
NM_182728chr1471511 1499 1371 1154 544 307 243 11584 2710 685 --
NM_182757chr663405 2784 2618 614 304 215 43147 1266 662 509 ----
NM_182760chr3124 ------
NM_182762chr785430 5123 2228 2182 2150 2143 846 590 12010 ----
NM_182763chr122566 2287 2498 96 1103 --
NM_182765chr10--1530 1349 --
NM_182769chr101848 ----1362
NM_182770chr101848 ----1362
NM_182771chr101848 ----1362
NM_182772chr101848 ----1362
NM_182789chr52917 873 ------
NM_182811chr2041000 870 333 197 1129 ----
NM_182830chr1441556 856 682 557 ------
NM_182850chr101848 ----1362
NM_182898chr776135 5128 1546 1370 601 376 85 --45345 2378 1617 1234 --
NM_182899chr776135 5128 1546 1370 601 376 85 --45345 2378 1617 1234 --
NM_182907chr642011 755 331 88 ------
NM_182910chr142875 157 157 --1138
NM_182913chr142875 157 157 --1138
NM_182914chr142875 157 157 --1138
NM_182925chr561341 1196 224 215 142 72 246 25 --21044 1024
NM_182931chr71222 ------
NM_182936chr1421325 656 123 1414 --
NM_182948chr182562 2349 2158 1096 766 617 97 34 --12825 --
NM_182964chr1152434 2050 1211 1197 98 32221 2043 452 ----
NM_182970chr20164216 4065 3870 3683 3662 3240 2987 2818 1692 1299 1277 1169 1056 505 357 72 23021 1145 54032 3219 2765 377 48 --
NM_183002chr1421325 656 123 1414 --
NM_183006chr2071468 1168 545 522 419 295 175 --1975 --
NM_183047chr202140 48 --1743 1172
NM_183048chr202140 48 --1743 1172
NM_183060chr101848 ----1362
NM_183078chr693603 3216 3151 3029 2823 2651 1096 872 392 --22384 964 --
NM_183227chr611334 --21035 61 --
NM_183323chr52917 873 ------
NM_183353chrX1439 ----11195
NM_183373chr64714 384 95 30 2603 206 ----
NM_183381chr341031 752 398 300 --1374 1360
NM_183383chr341031 752 398 300 --1374 1360
NM_183384chr341031 752 398 300 --1374 1360
NM_183397chr20144985 4731 4232 3857 3722 1959 1874 1619 1551 988 915 446 381 40 34950 4271 1740 1863 11182
NM_183425chr2071554 1392 386 229 112 55 40 1124 ----
NM_194247chr253369 3299 3075 1475 813 13169 ----
NM_194278chr1493590 3323 3238 2720 2645 1351 1142 481 121 23285 1398 52764 1450 1430 660 287 --
NM_194282chr472892 2847 2699 1101 1057 1007 980 12642 12609 --
NM_194286chr12216120 6023 4900 4860 4532 3967 2488 2435 2365 1913 1905 1767 1505 1147 1005 945 919 863 839 726 210 46095 2067 717 694 45681 2406 1741 1032 15909
NM_194313chr961669 1592 1306 663 166 139 11766 11363 --
NM_194314chr164413 1476 1079 957 653 362 --13885 --
NM_194318chr1342355 920 508 24 ------
NM_194328chr952775 2595 2193 686 90 --12702 --
NM_194329chr952775 2595 2193 686 90 --12702 --
NM_194330chr952775 2595 2193 686 90 --12702 --
NM_194332chr952775 2595 2193 686 90 --12702 --
NM_194356chr126837 738 599 551 524 161 2125 108 1643 1228
NM_194358chr1251687 1253 720 185 165 21216 58 ----
NM_194359chr1251687 1253 720 185 165 21216 58 ----
NM_194429chr6----182 --
NM_194435chr63775 738 42 ------
NM_194442chr1142 11474 ----
NM_194452chr1151111 995 465 393 119 ------
NM_194453chr1151111 995 465 393 119 ------
NM_194460chr1910473 445 405 373 361 214 153 146 88 51 ------
NM_197941chr562884 2154 937 728 139 71 12347 ----
NM_197956chr981723 1707 1680 1575 1391 1345 739 218 22019 1978 41916 853 360 298 --
NM_197970chr22138 25 11278 171 --
NM_198056chr3101963 1817 1711 1529 633 624 503 474 267 125 ------
NM_198057chrX41150 906 165 49 --1805 1112
NM_198086chr1431985 562 343 --1498 --
NM_198089chr195767 744 520 328 184 ------
NM_198147chr172320 101 1192 --11131
NM_198204chr1741186 1047 309 142 --21213 234 --
NM_198205chr1741186 1047 309 142 --21213 234 --
NM_198212chr722284 53 ------
NM_198216chr20122 ------
NM_198256chr231728 1502 783 1765 ----
NM_198264chr11428 171 133 --
NM_198291chr20101984 1957 1789 1366 1323 746 342 336 224 170 ------
NM_198316chr123168 94 85 150 1344 --
NM_198320chr12165111 4972 4928 4853 4433 4061 3840 3789 3749 3476 1865 1695 1535 1450 971 653 33611 1313 441 ----
NM_198324chr1211167 1498 11268 --
NM_198376chr17152 ------
NM_198377chr17152 ------
NM_198378chr17152 ------
NM_198379chr17152 ------
NM_198380chr17152 ------
NM_198382chr17152 ------
NM_198383chr17152 ------
NM_198384chr17152 ------
NM_198385chr17152 ------
NM_198386chr17152 ------
NM_198387chr17152 ------
NM_198388chr17152 ------
NM_198391chr202992 530 11489 ----
NM_198392chr682083 1999 1923 1553 1543 1528 456 432 ------
NM_198396chr17152 ------
NM_198439chr1131314 499 217 ------
NM_198468chr664236 3071 2993 2869 2825 922 23895 1671 23502 1032 --
NM_198513chr831889 1798 262 ------
NM_198560chr3133472 3196 3086 2614 1491 1160 1116 815 732 651 573 338 40 33538 1459 23 ----
NM_198581chr2177191 7022 7007 6978 6523 6465 5800 5716 5674 5580 5506 5436 5132 4879 4627 2924 2746 --56567 5295 4998 1017 871 17431
NM_198595chr4134380 3902 3812 3584 1862 1800 1137 1048 828 408 98 86 22 11381 1330 --
NM_198679chr982632 2260 2238 2183 2175 1871 133 102 12043 ----
NM_198686chr1492458 2250 1796 798 691 660 375 333 114 --12532 --
NM_198834chr1741788 1668 534 187 4813 501 384 357 --1102
NM_198836chr1741788 1668 534 187 4813 501 384 357 --1102
NM_198837chr1741788 1668 534 187 4813 501 384 357 --1102
NM_198838chr1741788 1668 534 187 4813 501 384 357 --1102
NM_198839chr1741788 1668 534 187 4813 501 384 357 --1102
NM_198859chr344759 4195 1339 493 14330 ----
NM_198880chr31200 ------
NM_198889chr421304 943 ------
NM_198896chr11----1437 --
NM_198900chr12217415 6965 6355 6289 5809 5607 3121 2682 2588 2392 2326 2263 1711 1674 1576 1301 1115 680 321 277 122 36443 3147 1126 57446 6435 2765 1689 1641 16583
NM_198956chr751999 640 594 389 83 ------
NM_198990chr761312 1251 747 701 556 104 11259 ----
NM_198993chr1771753 1181 520 351 307 284 274 11649 ----
NM_199003chr841111 1102 1088 121 ------
NM_199054chr196606 450 372 240 130 86 ------
NM_199129chr209982 500 482 381 213 135 125 72 40 ------
NM_199131chr10113062 2991 1431 1298 1264 1219 841 657 587 320 270 ------
NM_199132chr1941527 1500 1444 1417 11359 1564 --
NM_199160chr972120 1807 1768 1662 1630 1608 563 11636 --1739
NM_199169chr2083095 2640 2630 2617 2577 2411 2333 885 ------
NM_199170chr2083095 2640 2630 2617 2577 2411 2333 885 ------
NM_199171chr2083095 2640 2630 2617 2577 2411 2333 885 ------
NM_199245chr1262213 1823 1765 852 753 512 ------
NM_199262chr1741733 1503 692 340 11701 1634 --
NM_199320chr412718 ------
NM_199320chr412718 ------
NM_199324chr432634 508 114 --11423 --
NM_199355chr161399 11408 ----
NM_199421chr1494395 3854 3810 3719 3677 3602 3473 1467 307 13661 ----
NM_199461chr1092575 2488 2467 2403 1011 638 232 98 24 12276 --13405
NM_199462chr1154660 4596 4366 4320 4288 4281 3936 3183 1984 1938 1899 941 863 544 424 23151 723 ----
NM_199478chrX----1642 --
NM_201266chr252065 2040 648 513 114 2608 40 ----
NM_201279chr252065 2040 648 513 114 2608 40 ----
NM_201348chr1194440 4161 3976 3382 3294 3148 3048 2963 1611 1527 1355 1312 1256 1091 1061 928 186 103 53 32829 1388 517 44426 457 217 202 --
NM_201378chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201379chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201380chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201381chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201382chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201383chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201384chr89801 786 729 672 645 333 289 192 37 1858 2845 652 --
NM_201428chr1131458 214 88 --1370 --
NM_201429chr1131458 214 88 --1370 --
NM_201430chr1121384 140 --1296 --
NM_201432chr17226459 6088 5885 5449 5226 4697 4668 4593 4469 4436 4297 4065 2086 1334 790 742 548 477 359 186 157 147 16029 25305 841 --
NM_201433chr17226459 6088 5885 5449 5226 4697 4668 4593 4469 4436 4297 4065 2086 1334 790 742 548 477 359 186 157 147 16029 25305 841 --
NM_201520chr1791801 1630 1375 1314 1277 1202 442 324 247 182 1719 --
NM_201532chr117585 387 216 168 156 150 105 --1439 --
NM_201533chr117585 387 216 168 156 150 105 --1439 --
NM_201535chr143532 218 180 --132 --
NM_201536chr143532 218 180 --132 --
NM_201537chr143532 218 180 --132 --
NM_201538chr143532 218 180 --132 --
NM_201539chr143532 218 180 --132 --
NM_201540chr143532 218 180 --132 --
NM_201541chr143532 218 180 --132 --
NM_201568chr141598 1588 308 259 31986 1626 690 21995 1876 --
NM_201569chr141598 1588 308 259 31986 1626 690 21995 1876 --
NM_201591chr4----1221 --
NM_201592chr4----1221 --
NM_201599chrX4394 228 212 76 1454 1407 --
NM_201624chr15519 381 337 289 262 ------
NM_201628chr1133047 2926 2742 2075 1105 1059 660 436 430 276 239 167 40 ------
NM_201632chr581599 1560 1325 1247 560 519 278 128 21426 220 ----
NM_201634chr5111698 1659 1424 1346 659 618 377 227 118 71 52 21525 319 ----
NM_201998chr11--125 ----
NM_201999chr4--1915 ----
NM_202467chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_202468chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_202469chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_202470chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_202494chr197572 239 207 189 101 90 32 3429 107 58 ----
NM_203301chr1411281 11364 ----
NM_203305chr9102553 2516 2110 1710 984 901 844 806 790 205 41606 799 704 651 21845 328 --
NM_203307chr1981741 1656 1456 1413 1323 1279 1231 648 21521 1289 ----
NM_203318chr1731074 778 328 ------
NM_203327chr2084005 3880 3368 1706 1631 1186 572 329 23744 496 13779 --
NM_203342chr1123502 3495 2935 2926 2601 2276 1415 1150 796 779 745 303 12382 ----
NM_203343chr1123502 3495 2935 2926 2601 2276 1415 1150 796 779 745 303 12382 ----
NM_203346chr2101847 1668 1549 916 881 674 479 260 143 29 1497 179 1277
NM_203350chr12342 32 --1560 --
NM_203351chr17122371 2160 1891 1780 868 694 511 334 240 216 203 119 12108 1754 --
NM_203382chr551518 1170 1047 350 249 11197 ----
NM_203399chr14650 598 139 133 ------
NM_203401chr14650 598 139 133 ------
NM_203444chr129889 846 690 309 267 230 93 77 40 1696 1702 --
NM_203446chr2132699 230 106 1736 11874 --
NM_203454chr11914 ----1896
NM_203506chr1771969 1670 876 792 546 533 327 1664 1720 --
NM_205768chr11565 ------
NM_205833chrX3830 159 30 --1619 --
NM_205848chr162725 2443 2263 2113 1032 420 32496 2418 498 --1158
NM_205860chr143197 2547 2503 2280 1510 1567 --
NM_205861chr12368 230 21971 1350 2670 401 2795 607
NM_206538chr1951046 736 365 76 38 2911 780 ----
NM_206594chr113392 23527 2883 12404 --
NM_206595chr113392 23527 2883 12404 --
NM_206853chr623010 289 296 66 22730 1544 --
NM_206854chr664271 3550 3351 1550 1026 333 41357 1327 667 199 13991 --
NM_206855chr675236 4515 4316 2515 1991 1298 598 42322 2292 1632 1164 14956 --
NM_206876chr253325 2679 2609 626 290 --184 12692
NM_206907chr54741 700 608 533 23027 457 2785 652 --
NM_206914chr127903 884 827 650 308 70 28 1285 ----
NM_206944chr9----2191 40 --
NM_206945chr9----2191 40 --
NM_206946chr9----2191 40 --
NM_206947chr9----2191 40 --
NM_206967chr164328 121 48 40 --1165 --
NM_207012chr1043201 3162 1334 947 13028 1