TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5590-3p
miRNA Sequence: AAUAAAGUUCAUGUAUGGCAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr541249 1186 1146 110 11240 ----
NM_000016chr14526 222 190 75 1629 ----
NM_000024chr52471 142 ------
NM_000038chr591487 1444 1409 1357 1292 782 686 522 80 --31515 703 163 11983
NM_000043chr1041166 911 467 432 --2486 106 --
NM_000051chr11203540 3517 3477 3388 2957 2723 2380 2296 2167 1308 1152 1138 1063 923 907 687 264 82 59 51 --13240 --
NM_000052chrX163434 3350 3299 3272 3187 3131 3108 3058 2878 2636 2485 2193 2179 1337 312 188 --11365 23098 2666
NM_000081chr191724 1599 1546 1408 1163 714 404 192 35 11858 1548 --
NM_000084chrX196589 6532 6344 5983 5923 5610 5452 4997 4682 2727 2364 2353 2023 1960 1846 1340 943 782 592 56954 6291 5903 1050 663 45950 5843 5484 1954 22446 1739
NM_000088chr173992 175 128 ----1875
NM_000090chr23668 276 208 ----1903
NM_000091chr272844 2586 2453 1889 1084 1033 810 11057 22887 875 12812
NM_000092chr2154353 3703 3378 2987 1761 1724 1562 1553 1510 1268 1035 737 508 259 232 --24401 1221 1412
NM_000093chr9----22265 941 --
NM_000097chr341041 465 438 74 1971 41221 1068 471 397 1237
NM_000104chr272874 2508 1242 1153 824 710 26 11143 22935 2035 --
NM_000108chr781679 1417 1300 755 531 506 341 173 ------
NM_000109chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_000110chr121231 456 --1432 --
NM_000112chr5175499 4977 4907 4832 4758 4716 4249 4082 3618 3550 1773 1440 1280 913 814 394 102 55336 4703 3929 1130 655 11397 15202
NM_000125chr6104226 4189 4085 3618 2593 807 645 516 68 47 32607 544 222 ----
NM_000138chr1552594 2191 931 616 370 32415 2145 140 12222 --
NM_000139chr1142423 2154 503 340 32538 547 220 22043 634 --
NM_000142chr431088 572 276 11365 11079 --
NM_000151chr1731929 1557 722 11543 31895 1879 326 --
NM_000161chr1481689 1628 1401 1381 1375 1363 584 481 --52002 1940 1811 779 112 --
NM_000163chr5112353 2283 2093 1991 1923 1911 1682 827 786 438 220 1715 --1580
NM_000165chr671701 1373 1204 1185 1087 569 505 --11394 --
NM_000166chrX1632 ------
NM_000167chrX41758 1604 1552 100 1702 31668 1429 107 1716
NM_000168chr792781 2663 2344 2233 978 863 491 150 100 23375 2361 22879 67 --
NM_000176chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_000189chr262397 2245 2056 2044 2005 786 11523 1806 --
NM_000192chr1221194 186 11396 11287 --
NM_000194chrX3544 479 144 --1129 --
NM_000196chr162539 520 ------
NM_000202chrX103470 3424 3221 3016 2940 2851 1386 1375 933 186 13785 13102 --
NM_000210chr262353 2229 1868 1723 951 436 12119 ----
NM_000214chr205679 612 522 395 351 --1472 31417 1140 586
NM_000216chrX153639 3386 2797 2652 2568 2511 1589 1072 947 690 595 573 497 466 126 13290 ----
NM_000217chr12165333 5315 4807 4745 4365 4340 4113 4106 3329 2094 2013 1660 1178 525 221 104 23253 95 25150 1021 1893
NM_000222chr462092 1759 1581 1417 431 143 32020 1879 592 22036 1742 --
NM_000232chr4133092 2911 2593 2252 2172 1954 673 642 505 345 131 102 51 22132 1982 22163 183 --
NM_000237chr881867 1820 1699 1564 685 413 369 156 --31942 1707 1671 --
NM_000242chr1062624 2332 2144 2131 1871 1038 --12501 --
NM_000248chr3162698 2467 2309 1989 1071 938 891 881 826 689 517 341 312 261 187 123 31983 1048 529 3831 751 147 1463
NM_000251chr21173 270 60 --1250
NM_000252chrX21105 340 31275 1087 519 21370 1286 --
NM_000254chr162695 2351 1893 1843 451 27 --11183 22938 2252
NM_000255chr62121 42 1328 ----
NM_000259chr15186038 5922 5696 5640 5464 4567 4282 4206 2175 2156 1553 1514 1489 1389 1079 628 321 164 25454 204 ----
NM_000264chr962991 2730 2433 2293 2235 449 --12383 --
NM_000267chr1753435 3322 3309 1323 1035 1113 --1615
NM_000276chrX62236 815 736 591 479 410 1242 ----
NM_000277chr123819 694 585 ------
NM_000278chr1022023 1470 ------
NM_000280chr1141000 662 406 240 3990 761 183 ----
NM_000283chr41131 1444 ----
NM_000286chr175894 798 640 601 118 ------
NM_000291chrX5828 648 642 630 334 --1604 --
NM_000297chr482054 1839 1827 1656 1482 160 139 112 ----1151
NM_000304chr173752 287 236 ----11090
NM_000314chr1083251 2981 2811 2157 1262 994 385 288 22683 300 52509 2433 2351 2195 538 --
NM_000317chr111322 ------
NM_000321chr1381792 1711 1651 1109 551 387 344 282 1606 31458 1401 566 --
NM_000325chr42672 269 ------
NM_000328chrX3432 317 123 1327 --1335
NM_000329chr14889 321 173 82 --1799 1598
NM_000332chr6116862 6832 5761 5749 5114 2021 1577 1399 1191 621 108 34846 2233 2036 67040 5738 5227 2530 1846 1143 11674
NM_000333chr31237 ------
NM_000337chr5166220 6165 4928 4794 4524 4471 4133 4088 2649 1715 1472 1213 1053 888 513 53 1477 11086 14531
NM_000338chr154808 758 148 26 1854 170 --
NM_000340chr3101492 1412 1296 1279 1155 1104 1061 528 114 108 1279 1949 183
NM_000346chr1771711 1384 1307 1284 694 438 111 11330 --1378
NM_000362chr2263654 3631 3241 2401 1171 887 13618 12490 13567
NM_000387chr32752 579 ------
NM_000389chr651187 1155 514 475 234 --1239 --
NM_000390chrX153406 3351 3207 3129 2638 2573 1374 1278 1160 1026 417 350 341 206 32 --22079 408 22584 1076
NM_000393chr261505 1441 857 206 176 66 11351 11643 --
NM_000408chr2133279 3099 3009 2719 2660 2443 2149 1297 1057 1047 814 165 139 33081 916 574 1180 13379
NM_000411chr21113128 3111 3000 2964 2292 2190 1109 960 645 501 111 ------
NM_000416chr65540 501 394 58 25 ------
NM_000426chr62163 72 ------
NM_000430chr1793658 3426 3017 2877 2645 2614 1369 1248 481 1714 1323 --
NM_000439chr552343 2329 2283 2135 115 ------
NM_000448chr1182982 2967 2937 2370 807 642 621 472 33240 2358 466 13289 --
NM_000452chr1341651 1570 496 484 1215 22099 2065 1532
NM_000461chr3114197 3843 3683 3423 3104 3042 1067 898 516 228 88 1599 23768 1799 13753
NM_000462chr1571571 1330 673 318 232 174 67 11871 ----
NM_000480chr1181412 1183 1167 534 465 154 122 24 --11643 11437
NM_000489chrX133116 2939 2890 2651 2408 2275 2105 991 906 717 528 306 51 22164 955 23266 1257 13429
NM_000492chr731237 1173 1136 31216 1093 1078 ----
NM_000493chr61107 2951 706 --1459
NM_000495chrX41052 725 713 89 1453 ----
NM_000503chr861449 1292 644 637 520 149 --21764 1164 --
NM_000508chr44870 669 376 196 2231 130 ----
NM_000509chr41149 --142 --
NM_000521chr51105 ------
NM_000522chr73869 335 190 --2826 506 --
NM_000527chr1942327 1636 107 64 1113 --12172
NM_000533chrX41930 1654 1518 1322 ----11983
NM_000534chr2--1137 ----
NM_000536chr113551 205 73 1493 ----
NM_000550chr941055 929 877 318 1803 192 --
NM_000553chr82427 248 --162 1604
NM_000555chrX217408 7179 6742 6651 5642 5235 5083 2954 2938 2615 2600 2520 2444 2207 2181 2134 2002 1284 1269 1245 108 76966 6522 4790 1539 1006 955 930 15923 --
NM_000560chr12696 540 ------
NM_000596chr7--1121 ----
NM_000597chr21281 ------
NM_000598chr731513 1406 419 21537 1081 41577 1558 1553 345 --
NM_000599chr274598 4335 3887 1810 1792 1314 1007 ------
NM_000600chr73416 280 128 1398 ----
NM_000601chr71384 ------
NM_000602chr741524 1472 1375 79 ------
NM_000610chr1172921 2838 2819 2184 1845 1206 973 22667 2453 22155 634 --
NM_000611chr1186838 2818 1908 873 803 711 639 164 11004 11159 25858 629
NM_000615chr11113000 2948 2550 2543 1181 1104 862 846 789 750 218 1469 22528 713 2603 533
NM_000618chr12236420 6357 6291 6114 5192 5157 5027 4925 4752 4438 2638 2458 2277 2074 1919 1720 1626 1164 812 698 646 231 78 35863 4487 512 25899 628 35214 4935 4428
NM_000618chr12236420 6357 6291 6114 5192 5157 5027 4925 4752 4438 2638 2458 2277 2074 1919 1720 1626 1164 812 698 646 231 78 35863 4487 512 25899 628 35214 4935 4428
NM_000627chr23885 627 271 ----2603 359
NM_000633chr18115128 3944 3437 2010 1911 1806 1751 1512 1399 1389 752 --15186 14401
NM_000663chr1642830 2565 2421 2268 ------
NM_000684chr1041185 1175 1119 525 11110 ----
NM_000685chr33866 328 278 --1883 --
NM_000685chr33866 328 278 --1883 --
NM_000686chrX81498 1294 1176 1090 613 480 349 142 1338 11311 --
NM_000688chr3198 ------
NM_000693chr1531251 609 117 11646 11515 --
NM_000701chr12231 68 ----1291
NM_000702chr162259 2185 2151 2097 1874 715 ------
NM_000706chr122616 311 1289 2784 91 --
NM_000718chr9163 ------
NM_000719chr12106672 6242 4931 4550 1743 1538 1466 1111 779 31 14981 11981 15297
NM_000724chr1041300 1265 677 644 11376 ----
NM_000726chr241219 1159 1140 556 11417 1126 --
NM_000739chr7----1519 1101
NM_000740chr11165 ------
NM_000756chr8--1108 ----
NM_000780chr891222 1139 1054 1039 937 837 815 514 307 --1312 --
NM_000783chr102481 208 ----177
NM_000788chr481418 1407 1338 1012 986 507 401 51 --11004 --
NM_000793chr14115145 5135 4935 4662 4251 3891 3731 3654 3447 1519 1387 --21858 1853 24711 3221
NM_000801chr2051116 1095 816 711 430 --2404 254 1121
NM_000806chr5111519 1453 1289 754 694 615 524 464 447 394 83 ------
NM_000808chrX1820 --1292 --
NM_000809chr4319213 9077 8974 8574 8453 8372 8191 7847 6866 6498 6261 6142 6024 5921 5757 5718 3679 3519 3464 3148 3066 2944 2928 2892 2563 1823 1320 956 779 332 203 58117 6840 5957 2741 1650 48855 8777 2777 2064 17821
NM_000810chr152572 380 ------
NM_000812chr41143 ------
NM_000813chr595166 4956 4935 4137 3635 3513 1935 1738 1148 35300 4452 924 24009 1099 --
NM_000814chr1563633 3587 3363 2666 1197 1099 174 34089 3675 1644 12714
NM_000816chr54636 494 455 187 ----1141
NM_000817chr22904 315 ------
NM_000820chr131252 ------
NM_000824chr44960 935 925 856 --1940 --
NM_000826chr472327 1888 1848 1658 857 769 666 32118 520 417 12561 12337
NM_000827chr542469 1781 503 335 ------
NM_000829chr1142092 697 557 366 1713 --1202
NM_000836chr191985 ------
NM_000838chr6132361 2246 2213 2201 1996 1969 1814 1784 1768 1737 825 718 292 --12548 --
NM_000839chr32491 374 1382 ----
NM_000844chr361114 946 849 760 406 163 --1182 --
NM_000845chr7--2477 192 ----
NM_000857chr41425 ------
NM_000866chr321882 141 1393 41914 1383 1226 1221 11448
NM_000868chrX62608 2530 1035 639 454 145 12381 ----
NM_000872chr1021565 1262 ------
NM_000875chr15136682 6286 6023 5816 5508 5466 1678 1298 1117 572 505 394 206 42641 1461 1374 1217 16313 15687
NM_000876chr651420 396 369 361 327 ------
NM_000879chr5151 ------
NM_000882chr33315 60 44 136 ----
NM_000885chr271940 1924 852 779 725 519 508 21413 676 21904 1580 11610
NM_000891chr17133232 3165 2824 2733 1458 1422 935 809 692 595 452 242 33 13671 33689 3226 472 23368 2472
NM_000895chr123130 111 23 ------
NM_000899chr12183798 3692 3616 3576 3113 2919 2908 2833 2822 2812 1587 1452 1172 1070 378 248 123 80 34352 1325 568 34417 4395 3513 23833 149
NM_000901chr4102576 2513 2318 2299 2117 1772 994 869 673 25 22211 1590 ----
NM_000902chr3103255 3195 3014 2986 2419 2043 1164 929 579 451 1752 12171 --
NM_000908chr53731 131 109 --1716 --
NM_000909chr461293 1234 1088 1035 439 68 1275 21311 423 --
NM_000910chr481963 1951 1761 1643 1497 1248 760 95 --21503 1481 --
NM_000917chr101713 --1162 1265
NM_000922chr113740 436 396 --1280 --
NM_000926chr11319372 8795 8735 8112 7932 6750 6192 5990 5945 5930 5740 3693 3680 3470 3450 3406 3287 2601 2463 2313 2244 2176 1942 1921 1887 1831 1522 1392 1212 978 402 57262 6100 3125 171 84 66205 3227 2223 1500 1448 1370 --
NM_000927chr72455 242 ----1221
NM_000933chr2051324 1144 1088 319 91 1673 ----
NM_000935chr381273 1125 1015 968 812 371 253 126 1153 11040 1919
NM_000937chr171311 --1396 --
NM_000941chr71334 ------
NM_000944chr442177 1817 363 262 12062 22056 389 11507
NM_000945chr261841 1654 1631 455 377 200 41393 1370 471 294 1624 1789
NM_000950chrX123597 3553 3502 3115 2726 2589 2521 2344 2252 881 135 66 43052 3013 1061 990 33534 2715 98 --
NM_000956chr143765 696 355 --1952 1910
NM_000962chr9103033 2933 2822 2671 2416 2385 2292 2044 136 38 ------
NM_000964chr171519 ------
NM_001001132chr2141443 955 355 175 ------
NM_001001323chr1273152 3135 2919 2794 2456 963 588 12848 157 --
NM_001001330chr1041145 811 355 150 1464 ----
NM_001001331chr342703 2691 924 766 1620 11671 --
NM_001001344chrX52485 2307 2109 1965 1016 12417 ----
NM_001001389chr1172921 2838 2819 2184 1845 1206 973 22667 2453 22155 634 --
NM_001001390chr1172921 2838 2819 2184 1845 1206 973 22667 2453 22155 634 --
NM_001001391chr1172921 2838 2819 2184 1845 1206 973 22667 2453 22155 634 --
NM_001001392chr1162967 2884 2865 2230 1891 1019 22713 2499 22201 680 --
NM_001001395chr12122564 2462 1960 1763 881 802 737 658 566 443 336 48 1371 1991 1702
NM_001001396chr163250 1002 890 848 773 315 22836 2735 ----
NM_001001419chr5235236 4933 4841 4751 4397 4284 3982 3845 3821 3815 3689 1887 1775 1333 1284 1091 857 844 517 433 303 62 51 13657 35204 1969 284 23347 748
NM_001001420chr5235236 4933 4841 4751 4397 4284 3982 3845 3821 3815 3689 1887 1775 1333 1284 1091 857 844 517 433 303 62 51 13657 35204 1969 284 23347 748
NM_001001433chr2053012 2119 1284 1266 965 11983 ----
NM_001001436chr164818 598 573 567 ------
NM_001001481chr8163164 2987 2707 2219 2207 1395 1274 1168 1028 781 487 266 260 202 80 58 --12921 --
NM_001001484chr1062394 2299 2025 1981 848 212 32171 2156 2089 --1568
NM_001001556chr1541572 1375 1238 276 ------
NM_001001567chr21----1176 --
NM_001001568chr21----1176 --
NM_001001571chr21----1176 --
NM_001001572chr21----1176 --
NM_001001573chr21----1176 --
NM_001001574chr21----1176 --
NM_001001575chr21----1176 --
NM_001001576chr21----1176 --
NM_001001577chr21----1176 --
NM_001001579chr21----1176 --
NM_001001580chr21----1176 --
NM_001001581chr21----1176 --
NM_001001582chr21----1176 --
NM_001001584chr21----1176 --
NM_001001585chr21----1176 --
NM_001001664chr2123706 3638 3085 2788 2652 1349 1343 1328 1067 262 250 178 23653 3362 23808 3676 1393
NM_001001668chr1983867 2813 1390 1313 978 597 510 375 1987 13908 13902
NM_001001787chr12359 134 1166 --1372
NM_001001872chr144624 603 208 54 ------
NM_001001890chr21103669 3662 3530 3343 3267 3251 1618 1467 642 545 34256 3301 552 23654 1604 1373
NM_001001933chr13170 126 94 ----1430
NM_001001938chr9134053 3676 3330 3271 3100 3088 1341 1317 1111 1096 960 637 359 33355 1555 371 1896 21431 595
NM_001001971chr1031266 387 108 --1291 31258 1034 883
NM_001001974chr10122248 2191 2078 2017 1954 1892 1855 1769 1576 1524 703 355 42359 2163 1563 133 ----
NM_001001995chrX101873 1721 1651 1392 1220 710 498 255 232 217 --11208 21344 695
NM_001002233chr872044 1942 1612 742 410 326 204 --32114 2109 249 --
NM_001002244chr171118 ------
NM_001002245chr171153 ------
NM_001002246chr171153 ------
NM_001002247chr171153 ------
NM_001002248chr171153 ------
NM_001002249chr171153 ------
NM_001002257chr2103432 2936 2850 2605 1426 1033 692 680 672 524 13121 ----
NM_001002258chr262007 1954 1902 1878 280 143 1295 ----
NM_001002296chr861373 1325 1298 1249 389 275 --1196 --
NM_001002759chr102526 511 ------
NM_001002800chr32804 126 --1689 --
NM_001002838chrX71690 1494 1483 1419 1267 280 119 --11881 --
NM_001002843chr1561169 1092 483 371 229 128 ------
NM_001002860chr1484537 3379 3333 3220 2871 1817 394 266 --44681 3816 350 50 34477 1612 331
NM_001002909chr1732156 1743 358 --12214 --
NM_001003407chr1095142 5085 4808 4725 4363 4263 4212 3972 308 --24049 1587 --
NM_001003408chr1095142 5085 4808 4725 4363 4263 4212 3972 308 --24049 1587 --
NM_001003652chr18238514 8445 8423 8417 8368 7740 6934 6677 6441 6277 6160 6142 3471 3254 3245 3142 2887 2870 1735 1290 1062 871 230 98592 7124 6899 6712 6467 6222 3167 2102 419 35537 2777 2341 18265
NM_001003674chr18236749 6702 6614 6589 6182 6154 5973 5378 5369 5307 5128 5087 4978 4921 4524 2737 2693 1556 742 555 467 343 135 35448 1657 376 25576 1054 --
NM_001003675chr18236749 6702 6614 6589 6182 6154 5973 5378 5369 5307 5128 5087 4978 4921 4524 2737 2693 1556 742 555 467 343 135 35448 1657 376 25576 1054 --
NM_001003679chr1112225 2129 1894 1870 1811 1613 1469 893 497 477 421 1509 1584 --
NM_001003681chr2252047 2008 858 340 176 32035 530 112 1192 --
NM_001003688chr481234 1170 1113 990 790 462 409 354 --1267 --
NM_001003712chr1292705 1108 1022 969 913 907 435 155 80 42938 2899 2675 322 33429 2642 1010 --
NM_001003760chr6103540 3399 3071 2949 2789 2612 2605 1204 651 151 21340 1024 73141 2879 2800 1354 1006 805 453 --
NM_001003790chr84765 740 656 185 ----2273 167
NM_001003791chr84765 740 656 185 ----2273 167
NM_001003792chr36971 963 947 822 476 167 --3778 481 296 11175
NM_001003793chr36971 963 947 822 476 167 --3778 481 296 11175
NM_001003800chr943533 2327 1048 171 ----12570
NM_001003810chr43716 246 207 ------
NM_001003891chr222865 121 ------
NM_001004019chr31394 ----198
NM_001004023chr1143 1222 ----
NM_001004065chr9134012 3817 3753 3726 3210 3051 2715 1578 1430 827 717 619 77 13083 ----
NM_001004106chr511038 ------
NM_001004125chr951093 903 783 492 295 ------
NM_001004303chr12676 625 --1528 --
NM_001004303chr12676 625 --1528 --
NM_001004304chr1233048 2226 596 13173 ----
NM_001004308chrX71512 1488 1481 1249 1067 422 276 --11213 1106
NM_001004317chr6134240 3794 3536 3520 3178 2933 2742 1260 1022 838 313 185 103 64449 4217 3344 457 320 279 --33974 3617 1249
NM_001004328chr1282429 2062 553 535 499 431 285 145 --11650 --
NM_001004329chr1281529 1210 1065 535 449 383 132 107 ----11048
NM_001004346chr441198 1139 222 157 170 1422 --
NM_001004356chr4----11480 --
NM_001004358chr4----11480 --
NM_001004360chr2121967 1928 1903 1815 1761 1567 1386 1264 1217 774 423 325 2436 207 21839 510 --
NM_001004419chr1284113 4105 3298 3107 1740 818 676 134 24449 1512 14274 --
NM_001005207chr171239 ------
NM_001005209chr2--1709 ----
NM_001005242chr1271450 1420 1192 1088 543 341 233 --2531 158 --
NM_001005366chr125950 903 896 629 362 ------
NM_001005367chr191347 ------
NM_001005375chrY81742 1537 1517 704 612 380 233 57 --21572 697 --
NM_001005377chr19------1284
NM_001005386chr2132079 1895 1752 668 614 495 376 352 298 245 155 131 51 1975 1655 12073
NM_001005404chr1764382 4055 3619 3328 3263 3213 23084 194 ----
NM_001005463chr1092607 2561 2529 2340 2291 2177 1723 993 638 --62363 1733 349 212 152 139 1609
NM_001005473chr5116524 5873 5329 4675 4217 4134 2349 2318 2152 1152 743 1279 44203 2627 1628 258 12512
NM_001005474chr351305 1199 1136 643 297 11281 ----
NM_001005526chr2--1113 ----
NM_001005527chr321095 868 --21262 185 31239 1151 537
NM_001005732chr212250 173 ------
NM_001005733chr211173 ------
NM_001005739chr22814 581 1782 --1337
NM_001005743chr1461337 1162 1153 1101 932 372 1977 180 --
NM_001005744chr1461337 1162 1153 1101 932 372 1977 180 --
NM_001005745chr1461337 1162 1153 1101 932 372 1977 180 --
NM_001005746chr241219 1159 1140 556 11417 1126 --
NM_001005747chr241219 1159 1140 556 11417 1126 --
NM_001005753chr262305 1903 1727 550 352 336 --155 1907
NM_001005781chr22458 120 --1236 --
NM_001005782chr22907 43 --2788 685 --
NM_001005845chr851906 1755 1535 1292 73 1370 ----
NM_001005849chr172425 152 ----1467
NM_001005861chr35855 363 265 200 139 21017 76 1775 --
NM_001006600chr5162431 2360 2148 2064 2005 1883 1843 1833 1608 1590 1544 924 627 405 391 348 51826 1623 887 668 86 12295 12322
NM_001006605chr131165 259 26 1475 ----
NM_001006605chr131165 259 26 1475 ----
NM_001006610chr162891 661 21013 830 ----
NM_001006612chrX276 52 1455 ----
NM_001006613chrX276 52 1455 ----
NM_001006614chrX276 52 1455 ----
NM_001006618chr91246 ------
NM_001006623chr272457 2328 1937 687 365 162 138 12502 12353 1996
NM_001006626chr7----1519 1101
NM_001006627chr7----1519 1101
NM_001006628chr7----1519 1101
NM_001006629chr7----1519 1101
NM_001006630chr7----1519 1101
NM_001006631chr7----1519 1101
NM_001006632chr7----1519 1101
NM_001006635chr22326 83 ------
NM_001006641chr921467 1162 11117 ----
NM_001006642chr921467 1162 11117 ----
NM_001006643chr921467 1162 11117 ----
NM_001006657chr2103202 3018 2794 2733 2390 2346 586 534 502 165 1408 33246 1015 962 --
NM_001006684chrX2559 82 --1395 --
NM_001006944chr112703 174 1157 1517 --
NM_001006945chr15607 574 255 204 136 ----2589 239
NM_001007023chr14115145 5135 4935 4662 4251 3891 3731 3654 3447 1519 1387 --21858 1853 24711 3221
NM_001007024chr1764139 4026 3440 3193 1746 1619 --24334 3128 14294
NM_001007025chr1764139 4026 3440 3193 1746 1619 --24334 3128 14294
NM_001007067chr841111 960 376 320 1279 11042 --
NM_001007068chr841111 960 376 320 1279 11042 --
NM_001007069chr841111 960 376 320 1279 11042 --
NM_001007070chr841111 960 376 320 1279 11042 --
NM_001007088chrX266 55 ------
NM_001007097chr9135033 5022 4791 4782 4733 3969 3842 1524 1362 1249 882 580 476 21269 1154 --11668
NM_001007098chr14854 808 655 153 ------
NM_001007102chr681612 1450 1369 1225 1194 529 53 38 2404 247 ----
NM_001007156chr1561869 1777 621 615 606 333 --11969 --
NM_001007189chr5150 --1111 --
NM_001007226chr1721265 489 --1917 --
NM_001007227chr1721265 489 --1917 --
NM_001007228chr1721265 489 --1917 --
NM_001007229chr1721265 489 --1917 --
NM_001007230chr1721265 489 --1917 --
NM_001007237chr142558 2365 2105 1861 1338 1471 32866 2153 618
NM_001007245chr72641 82 --2633 614 --
NM_001007246chr2171669 1486 1337 784 671 382 252 --21822 148 --
NM_001007257chr141341 1231 1022 613 --21247 1074 11521
NM_001007278chr13165191 5161 5080 5026 4910 4624 4341 4301 4029 3985 3736 3679 3639 3617 3337 934 --55115 5044 4742 4008 3372 24989 3884
NM_001007466chr675132 4540 4520 3952 3647 289 279 12005 34499 3322 1694 --
NM_001007467chr22194 ------
NM_001007468chr221247 ------
NM_001007553chr171108 1059 460 301 258 249 190 21166 898 --1972
NM_001007559chr1841620 632 177 155 31415 723 323 22046 775 --
NM_001007565chr32117 70 ------
NM_001007794chr12128 121 --2648 632 --
NM_001008226chr1571755 1699 1690 1673 249 181 171 2108 71 11730 --
NM_001008239chr18123840 3406 3336 3021 3014 2961 2719 2372 623 546 317 57 13137 33366 259 246 --
NM_001008388chr44234 136 45 30 ------
NM_001008392chr3103350 3136 2401 2379 1228 729 475 419 218 175 ----1751
NM_001008393chr4122818 2590 2484 2348 2205 1822 733 665 463 397 357 242 11137 2947 214 --
NM_001008405chr771561 1500 1459 1302 1268 496 392 ------
NM_001008408chr7156258 5930 5334 5089 4951 4896 4883 4791 4373 4058 4002 2562 1885 1263 302 21447 1276 24512 1967 --
NM_001008491chr292061 2024 1774 1631 1416 513 373 161 120 1635 1583 --
NM_001008492chr292061 2024 1774 1631 1416 513 373 161 120 1635 1583 --
NM_001008495chr8102029 1774 1602 1471 746 478 324 265 245 212 21522 831 --12101
NM_001008539chr8185410 5360 5266 5129 5094 4627 4445 4245 4135 3848 3531 3469 3461 3343 1565 1338 1093 449 --24397 1788 --
NM_001008540chr2199 127 ----
NM_001008541chr10122332 2232 1697 1684 1585 1553 1525 1479 893 824 536 397 --11590 11472
NM_001008541chr10122332 2232 1697 1684 1585 1553 1525 1479 893 824 536 397 --11590 11472
NM_001008564chr1352230 2147 1848 1408 546 32133 1676 1430 ----
NM_001008660chr1141419 1172 638 566 11503 ----
NM_001008707chr1431847 1776 1183 11897 21914 1521 --
NM_001008708chr23613 179 109 --1205 --
NM_001008712chr8179 ------
NM_001008723chr101384 ------
NM_001008727chr191220 --10268 263 258 253 248 243 238 233 228 94 --
NM_001008738chr582790 2672 2654 2462 2183 2119 1971 497 11107 --1776
NM_001008779chr21242 --1278 --
NM_001008783chr63663 625 88 1690 --145
NM_001008925chr4163440 3394 3278 3225 3205 3160 3148 3051 2830 2713 1415 1338 1312 1102 633 498 22866 720 --13335
NM_001009185chr51188 --2182 113 --
NM_001009552chr83611 528 419 127 1424 --
NM_001009554chr4184754 4579 4452 4286 4124 3805 3618 3575 3443 3433 1572 1483 1394 1036 751 733 559 130 23127 459 23491 1122 13088
NM_001009554chr4184754 4579 4452 4286 4124 3805 3618 3575 3443 3433 1572 1483 1394 1036 751 733 559 130 23127 459 23491 1122 13088
NM_001009555chr461701 1664 1315 1307 590 369 11658 11458 --
NM_001009567chr103583 467 225 --1494 --
NM_001009881chr12630 156 ----1410
NM_001009882chr12630 156 ----1410
NM_001009894chr1231143 463 183 21421 592 2620 160 --
NM_001009899chr3186542 6479 6460 6183 6070 5232 4399 4332 4237 4005 2593 1824 1218 1048 981 547 332 220 23975 2145 46524 4940 2005 616 --
NM_001009909chr1173698 3679 3632 3328 3262 2992 2901 23705 2550 22885 114 1125
NM_001009955chr12199 167 ------
NM_001009955chr12199 167 ------
NM_001009958chr73427 420 247 --1617 1570
NM_001009959chr272027 1636 835 824 756 659 196 12239 ----
NM_001009960chr7102577 2238 2200 2118 993 862 817 773 631 554 22397 1021 1965 --
NM_001009993chr294478 4469 3821 3444 3022 945 848 547 391 21784 839 11119 11827
NM_001010000chr1883446 2960 2844 2707 2632 2268 924 347 3865 395 210 33531 3226 2359 --
NM_001010844chr6--258 49 ----
NM_001010846chr1154646 4461 4453 4371 3543 3514 3502 3471 3321 1776 1732 1411 1177 1080 573 31675 1615 1230 21821 476 14568
NM_001010853chr632625 1088 1043 43084 3064 2952 321 ----
NM_001010861chr1112743 2619 2585 2491 1924 1073 969 468 448 298 125 21081 119 21027 528 22657 994
NM_001010862chrX92249 2214 2116 2100 2038 812 594 587 264 ------
NM_001010876chr6172 --156 --
NM_001010888chrX104345 3408 2957 2902 1727 1220 1108 945 414 99 94534 4394 4239 3839 3402 3172 1029 173 26 44013 4003 1656 869 13961
NM_001010891chr5216825 6706 6239 5796 5066 5015 4347 4297 2457 2285 2205 2186 2172 2145 1914 1897 1890 1153 1127 522 470 56749 4803 4197 1307 745 26528 1673 15043
NM_001010895chr972028 1299 1275 447 252 109 32 1548 --2708 514
NM_001010897chr131376 ------
NM_001010908chr10--1283 ----
NM_001010927chr65416 391 231 160 39 ------
NM_001010932chr71384 ------
NM_001010934chr7--2911 142 11089 --
NM_001010942chr1251164 1050 997 386 323 11074 179 1342
NM_001010971chr14996 874 745 707 2825 309 --175
NM_001010984chr1122593 2352 2304 2062 2041 1921 806 780 230 206 200 149 1814 12315 22448 1895
NM_001010986chrX102537 2478 2288 1997 892 873 762 631 225 159 22175 837 32356 844 275 --
NM_001010989chr164531 509 225 211 ----1423
NM_001010990chr164531 509 225 211 ----1423
NM_001011513chr4113514 3125 2766 2759 1175 881 817 561 469 305 137 33766 2793 240 62925 2713 2603 484 402 219 --
NM_001011537chr3122294 2140 2120 2037 2010 1941 1803 1771 581 311 125 85 --1361 --
NM_001011546chr204744 321 265 182 --1342 --
NM_001011553chr74876 280 241 98 --1778 --
NM_001011663chr1091104 774 689 675 437 320 262 244 96 11048 1707 1972
NM_001011666chr7196276 5811 5754 5394 4965 4957 4818 4684 4535 4262 2553 2536 2382 2283 2255 2052 1908 1508 671 86301 4703 2033 1928 1024 950 159 132 --25739 4058
NM_001011708chr2102932 2903 2852 2504 2166 2052 924 915 509 133 12748 ----
NM_001011713chr1461622 1288 1111 1101 452 158 --21117 305 --
NM_001011724chr131204 ------
NM_001011725chr131204 ------
NM_001011885chr1531793 1280 403 11268 --31464 701 198
NM_001012329chr16842 753 359 282 276 244 12219 ----
NM_001012337chr3122 ------
NM_001012393chr11115025 4960 4510 3931 3431 3377 2068 1341 738 159 54 --14995 --
NM_001012420chr1592833 2804 2725 2664 2220 2036 2003 1147 904 --12647 1506
NM_001012423chr1592833 2804 2725 2664 2220 2036 2003 1147 904 --12647 1506
NM_001012425chr1----1132 --
NM_001012478chr191643 ------
NM_001012732chr441208 1156 1114 198 ------
NM_001012751chr1051782 1537 1529 727 122 11655 31640 1249 253 --
NM_001012754chr1361943 1846 865 748 204 180 22006 1959 52173 1953 1856 1711 1606 --
NM_001012755chrX124926 4904 4874 4819 4211 4130 3844 3583 1629 1558 652 29 34101 3631 3200 13641 --
NM_001012761chr542697 2569 50 27 41989 1879 281 236 1273 --
NM_001012968chrX112769 2665 2626 2468 2436 1816 1721 715 670 657 178 12152 52787 2357 1930 1084 122 12186
NM_001012985chr11197 ------
NM_001013031chr10133546 3207 3060 2657 2170 1379 1176 1059 969 586 360 212 145 13148 11411 --
NM_001013398chr731513 1406 419 21537 1081 41577 1558 1553 345 --
NM_001013399chr63774 439 316 1806 1131 --
NM_001013406chr751607 1178 1144 1086 125 41379 1185 578 483 ----
NM_001013415chr461498 1453 1250 1162 1035 303 --11580 --
NM_001013437chr182411 332 --1293 --
NM_001013620chr12248513 8476 8258 8139 7889 7376 7343 7197 7140 7052 5506 5458 5315 5245 3305 3252 2305 2240 1786 1268 1219 728 528 145 68446 7937 7367 5492 3221 1530 47500 5749 5434 2291 25276 2111
NM_001013659chr19124569 4272 3558 3473 3399 3384 2162 2080 1244 1036 403 378 --54966 2061 1117 408 70 --
NM_001013699chr12150 ----1529
NM_001013838chr16----134 --
NM_001014286chr131100 ----1125
NM_001014380chr13215837 5383 5074 4939 4887 4810 4775 4700 4409 4242 2229 2120 2089 1702 1358 1323 1091 1015 596 294 205 24032 2169 75551 3932 3653 2244 2239 2234 1660 --
NM_001014434chr12587 47 --173 --
NM_001014797chr10176925 6768 5009 3208 3041 2433 1505 1369 1221 1201 1114 793 616 586 388 376 279 --17371 33186 3062 991
NM_001014831chr19------1659
NM_001014832chr19------1659
NM_001014834chr19------1659
NM_001014835chr19------1659
NM_001014972chr2--1179 ----
NM_001015045chr421827 746 12207 2818 423 --
NM_001015048chr1473203 3016 2940 2745 2449 2209 292 --22950 2784 --
NM_001015049chr1473203 3016 2940 2745 2449 2209 292 --22950 2784 --
NM_001015877chrX143081 3042 2662 2630 2423 2413 2007 1195 1175 1048 964 943 497 158 --22708 953 11957
NM_001015880chr1061716 1275 505 305 102 58 2112 74 31304 1205 598 --
NM_001015882chr9166 2268 200 1324 1168
NM_001015887chr341845 1685 1230 385 21763 750 21880 1321 11728
NM_001017368chr1762749 2394 2315 1119 565 460 12826 ----
NM_001017369chr461093 995 943 722 421 168 --11066 --
NM_001017371chr291160 1139 1002 553 526 486 431 236 86 139 --1154
NM_001017395chr3123480 2921 2364 2220 1394 1102 1024 890 836 691 436 222 1730 1182 13054
NM_001017396chr231824 1463 300 2811 741 11829 --
NM_001017415chr1--2796 130 --1578
NM_001017416chr1--2796 130 --1578
NM_001017420chr831456 1352 1125 2358 304 21390 1257 21462 272
NM_001017424chr141814 1506 1282 59 11785 --11426
NM_001017425chr141814 1506 1282 59 11785 --11426
NM_001017434chr15753 717 623 257 157 ------
NM_001017440chr767673 6271 5028 1453 1083 217 38064 1430 1031 25843 2860 --
NM_001017923chr1471702 1370 1129 652 386 268 65 61042 595 260 214 194 156 31572 325 228 --
NM_001017926chr891620 1429 1370 1352 1190 712 440 427 250 31743 1577 1342 1610 --
NM_001017928chr3------1212
NM_001017930chrX81536 1474 1323 1211 1091 978 169 50 ------
NM_001017962chr101713 --1162 1265
NM_001017979chr45631 205 190 115 81 1277 ----
NM_001017992chr5101454 1178 1145 1010 984 969 622 445 334 68 1463 21513 1043 11519
NM_001017995chr574798 4468 4439 3423 3171 465 47 1942 ----
NM_001017999chr172347 2086 2039 1625 762 604 395 ------
NM_001017999chr172347 2086 2039 1625 762 604 395 ------
NM_001018000chr172347 2086 2039 1625 762 604 395 ------
NM_001018000chr172347 2086 2039 1625 762 604 395 ------
NM_001018001chr172347 2086 2039 1625 762 604 395 ------
NM_001018008chr154679 655 535 213 ------
NM_001018038chr93437 136 46 3456 208 156 ----
NM_001018054chr151275 1259 1211 512 430 21450 223 ----
NM_001018065chr9215977 5603 5507 5473 5144 5129 5055 4696 4462 4217 1963 1774 1586 1560 1499 1385 1365 1185 1032 567 224 --15848 --
NM_001018066chr9215977 5603 5507 5473 5144 5129 5055 4696 4462 4217 1963 1774 1586 1560 1499 1385 1365 1185 1032 567 224 --15848 --
NM_001018067chr1195389 5216 5168 5110 5056 4500 4381 4323 4311 4130 1618 1554 1363 1115 1084 760 530 483 33 55256 3326 1877 848 616 32075 499 142 34945 1725 1122
NM_001018068chr1195389 5216 5168 5110 5056 4500 4381 4323 4311 4130 1618 1554 1363 1115 1084 760 530 483 33 55256 3326 1877 848 616 32075 499 142 34945 1725 1122
NM_001018069chr1195389 5216 5168 5110 5056 4500 4381 4323 4311 4130 1618 1554 1363 1115 1084 760 530 483 33 55256 3326 1877 848 616 32075 499 142 34945 1725 1122
NM_001018074chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_001018075chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_001018076chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_001018077chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_001018089chr1543804 2835 1097 315 1459 23101 432 --
NM_001018090chr1592805 2549 2169 2075 1072 1015 941 311 254 22460 1779 12387 1106
NM_001018091chr1592915 2659 2279 2185 1182 1125 1051 421 364 22570 1889 12497 1216
NM_001018100chr153810 700 318 1260 1305 1719
NM_001018102chr1592805 2549 2169 2075 1072 1015 941 311 254 22460 1779 12387 1106
NM_001018111chr763213 3025 3010 2923 2892 1501 13676 --1272
NM_001018136chr17--1105 ----
NM_001018137chr17--1105 ----
NM_001018138chr17--1105 ----
NM_001018139chr17--1105 ----
NM_001020658chr161698 1677 1213 1081 456 368 21169 172 1185 --
NM_001020658chr161698 1677 1213 1081 456 368 21169 172 1185 --
NM_001023567chr1562225 2197 2112 2086 2046 912 11791 12376 1509
NM_001023587chr32954 733 11146 ----
NM_001024024chr145743 682 417 226 170 --31056 994 865 --
NM_001024070chr145739 678 413 222 166 --31052 990 861 --
NM_001024094chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_001024372chr852306 2009 1988 1758 547 22077 1703 11834 --
NM_001024647chr12176889 6839 6814 6435 5758 5499 5171 4830 2124 1527 1101 911 573 536 454 447 62 25041 667 46734 1542 617 489 --
NM_001024649chr5152968 2710 2677 2658 2619 2609 2429 2137 1936 1108 1100 994 311 285 155 1412 ----
NM_001024660chr361652 1471 1359 1243 377 292 ----1646
NM_001024680chr291592 670 473 464 359 187 166 148 81 1223 --1612
NM_001024688chr851800 1452 195 150 114 31936 1722 1546 1846 11928
NM_001024809chr171519 ------
NM_001024847chr382437 2347 2339 1768 1609 986 521 417 22410 314 21934 276 --
NM_001024916chr92108 85 --1397 --
NM_001024934chr63697 509 49 1519 ----
NM_001024935chr63697 509 49 1519 ----
NM_001024936chr63697 509 49 1519 ----
NM_001024948chr1173095 2841 2821 2809 2439 2414 2402 2383 2260 2233 1211 885 772 534 360 231 183 ----12535
NM_001024956chr11125125 4783 4716 4348 4154 3812 3552 1745 1294 641 292 198 44590 4520 2351 1164 44942 4579 3679 1522 --
NM_001025068chr351263 667 337 268 253 21304 510 21806 547 --
NM_001025069chr351263 667 337 268 253 21304 510 21806 547 --
NM_001025076chr10106255 6227 5296 4561 3783 2069 836 565 495 33 11478 31859 1570 1164 1737
NM_001025077chr10167613 7585 6654 5919 5141 5112 5054 4973 4712 2194 1923 1853 1045 658 251 33 34828 2836 867 52928 2522 840 585 202 12095
NM_001025079chr3133984 3918 3610 3403 3359 3322 3264 2665 1599 1394 703 680 167 23849 3296 23274 2611 13941
NM_001025105chr521110 76 ------
NM_001025108chr274063 3316 3231 3215 2892 1302 232 ------
NM_001025201chr22584 495 153 ----
NM_001025233chr12102382 2359 2265 2121 1899 942 789 328 315 137 12164 ----
NM_001025248chr1581274 406 384 375 260 198 149 113 1962 1222 --
NM_001025249chr1581274 406 384 375 260 198 149 113 1962 1222 --
NM_001025266chr3154902 4808 4712 4368 4087 4014 3701 3374 3193 3091 3005 1437 1169 186 55 14951 14256 --
NM_001025356chr12163016 2988 2946 2728 2672 2570 990 942 886 796 682 370 254 93 43 27 33001 2959 2544 12816 --
NM_001025366chr641800 1719 316 184 21653 1222 1269 1408
NM_001025366chr641800 1719 316 184 21653 1222 1269 1408
NM_001025367chr641800 1719 316 184 21653 1222 1269 1408
NM_001025367chr641800 1719 316 184 21653 1222 1269 1408
NM_001025368chr641800 1719 316 184 21653 1222 1269 1408
NM_001025368chr641800 1719 316 184 21653 1222 1269 1408
NM_001025369chr641816 1735 332 200 21669 1238 1285 1424
NM_001025369chr641816 1735 332 200 21669 1238 1285 1424
NM_001025370chr641800 1719 316 184 21653 1222 1269 1408
NM_001025370chr641800 1719 316 184 21653 1222 1269 1408
NM_001025389chr1181412 1183 1167 534 465 154 122 24 --11643 11437
NM_001025390chr1181412 1183 1167 534 465 154 122 24 --11643 11437
NM_001025579chr1721080 1013 11072 ----
NM_001025580chrX164191 3944 3914 3780 3750 3635 3525 3048 2754 2711 1126 637 563 439 207 200 23924 3721 41491 950 826 101 44174 2644 1066 749
NM_001025595chr431546 152 129 11043 31591 1432 591 1401
NM_001025616chr451552 1257 1228 673 418 21612 571 3537 507 280 1403
NM_001025780chr941488 1210 607 267 11317 1528 --
NM_001029858chr6153411 3207 2861 2762 2535 2472 2304 2271 2204 2105 1093 999 872 652 590 1663 1443 12462
NM_001029860chr82281 270 --1262 --
NM_001029863chr6103074 2559 2366 2331 1110 890 860 787 350 191 --32766 971 634 1344
NM_001029875chr5102871 2382 1104 1084 1059 961 915 233 159 128 12238 ----
NM_001029882chr11452 ------
NM_001029882chr11452 ------
NM_001029884chr6112666 2580 2387 2314 1731 926 559 533 405 364 77 12634 ----
NM_001030001chr141442 ------
NM_001030007chr16153722 3657 3556 3517 3339 3236 3098 2931 2921 2679 1411 1067 905 223 27 --21199 367 13297
NM_001030055chr14194707 4701 4692 4445 4186 4052 3968 3641 3192 3078 3049 1812 1757 1516 1058 1000 823 814 712 32994 1823 210 34752 4747 4503 1481
NM_001030272chr111102 1318 ----
NM_001030273chr111102 1318 ----
NM_001031623chr6101746 1740 1202 1180 687 587 556 483 264 152 11121 2540 350 --
NM_001031679chr1293578 3390 2877 2827 711 640 488 224 204 33467 2273 1236 2650 645 --
NM_001031684chr251470 1135 1125 413 207 --11273 --
NM_001031689chr91115 ------
NM_001031690chr7--22628 1005 22709 164 --
NM_001031695chr22115323 5179 4577 4485 3947 3790 3670 3336 2110 1231 865 35386 1813 156 --21330 1187
NM_001031710chr771092 1035 978 853 696 183 58 1152 ----
NM_001031711chr521690 1295 1494 ----
NM_001031712chr61161 1167 --1112
NM_001031715chr15----1181 --
NM_001031716chr251032 926 797 100 68 4303 152 116 32 ----
NM_001031722chr61173 ------
NM_001031723chr44488 375 193 39 ------
NM_001031725chr1397 88 31 ------
NM_001031732chr4133386 2991 2539 2355 1425 1158 1112 902 868 822 536 225 143 32323 1336 1300 12704 11096
NM_001031804chr16114190 4027 3915 3745 3523 1413 1407 1319 1090 523 495 11494 2947 908 11419
NM_001031812chr5102251 2157 2075 1973 1821 1697 1475 811 205 195 1374 1764 11567
NM_001032221chr911696 ------
NM_001032280chr661726 1441 1389 1372 1340 529 --31731 1706 1097 --
NM_001032282chr871096 947 921 491 320 236 34 --1814 11317
NM_001032283chr1261021 767 685 395 254 185 --1207 --
NM_001032284chr1261021 767 685 395 254 185 --1207 --
NM_001032288chr2021610 1587 ------
NM_001032293chr173597 150 102 ------
NM_001032296chr1372740 1121 817 619 575 375 259 12839 3239 234 229 11005
NM_001032380chr1072008 1828 1471 1465 559 270 153 3729 353 295 1400 --
NM_001032393chrX4660 639 257 156 ------
NM_001032394chr6112824 2663 2567 2224 2064 1771 1076 796 703 696 487 --12719 --
NM_001032395chr6102691 2530 2434 2091 1931 943 663 570 563 354 --12586 --
NM_001032730chr14689 625 618 47 ----1137
NM_001032999chr2075254 5247 4207 1968 1215 916 688 ----14214
NM_001033002chr17182 --1229 --
NM_001033044chr151568 1329 1270 1133 153 21305 663 ----
NM_001033045chr2144402 4046 3871 3430 3403 3094 2952 2920 1387 1228 1116 866 383 172 14325 43800 2838 1782 1704 11083
NM_001033047chr462513 2460 2012 941 574 83 1997 --1533
NM_001033049chr2162179 1636 1529 868 451 437 --1354 --
NM_001033056chr151568 1329 1270 1133 153 21305 663 ----
NM_001033057chr362109 1965 1759 1688 1429 487 21923 622 1135 --
NM_001033059chr671910 1645 1451 805 608 442 284 --11781 11489
NM_001033081chr151898 1254 671 554 384 31739 1695 583 ----
NM_001033082chr151898 1254 671 554 384 31739 1695 583 ----
NM_001033085chr2278 72 ------
NM_001033087chr2082982 2844 2436 2341 2335 2298 431 280 12196 12107 --
NM_001033117chr394374 3870 3645 3484 3300 3018 1472 1162 501 ------
NM_001033503chr52387 356 ------
NM_001033504chr173607 594 588 ------
NM_001033506chr112332 115 ------
NM_001033507chr12429 72 1560 2568 488 --
NM_001033518chr742905 549 216 81 --2116 60 --
NM_001033519chr742905 549 216 81 --2116 60 --
NM_001033520chr742905 549 216 81 --2116 60 --
NM_001033557chr281311 1252 1235 1150 1091 251 172 51 11121 ----
NM_001033561chr171886 --1609 --
NM_001033566chr173143 62 43 --1110 1687
NM_001033568chr173143 62 43 --1110 1687
NM_001033578chr872185 2005 1904 1871 1785 1599 632 2386 109 2938 566 --
NM_001033602chr1321882 432 1409 ----
NM_001033659chr1751681 1559 1542 491 80 21397 1184 11039 --
NM_001033678chr11128 ------
NM_001033723chr872278 1824 1728 1122 1116 1020 331 11108 ----
NM_001033756chr641734 1653 250 118 21587 1156 1203 1342
NM_001033756chr641734 1653 250 118 21587 1156 1203 1342
NM_001033910chr132106 2070 170 31719 435 231 1380 --
NM_001033925chr1071832 1694 694 347 328 220 103 --12007 21954 1710
NM_001034837chr52124 85 ----1783
NM_001034838chr52124 85 ----1783
NM_001034841chr16105538 5491 4855 3648 3629 2154 2112 511 483 135 25027 3878 45258 5018 3884 1920 22017 682
NM_001034845chr481401 1142 1093 1057 911 551 545 52 ------
NM_001034850chr581565 1522 1458 1360 1162 126 114 102 --21637 1316 1230
NM_001034954chr1052834 2780 2536 1159 31 --13270 12742
NM_001034955chr1052834 2780 2536 1159 31 --13270 12742
NM_001034956chr1052834 2780 2536 1159 31 --13270 12742
NM_001034957chr1052834 2780 2536 1159 31 --13270 12742
NM_001035chr161303 1280 531 522 368 183 ------
NM_001035003chr461040 565 482 325 275 128 ------
NM_001035004chr461040 565 482 325 275 128 ------
NM_001035260chr1071543 1428 1403 1303 1076 345 217 --31342 311 241 --
NM_001035511chr141854 1776 1454 1386 --52119 1517 1476 648 588 --
NM_001035512chr141961 1883 1561 1493 --52226 1624 1583 755 695 --
NM_001035513chr141961 1883 1561 1493 --52226 1624 1583 755 695 --
NM_001037163chr74903 777 206 35 --1965 --
NM_001037164chr7102068 1651 1644 1404 1355 1334 1290 609 312 119 21976 391 ----
NM_001037165chr7128884 8871 8505 8094 7829 7379 5632 1903 1280 659 581 377 ------
NM_001037172chr321370 1213 31252 1240 964 1232 --
NM_001037174chr282253 1904 1664 1577 414 315 306 52 11672 --22110 595
NM_001037277chr151610 1446 542 332 39 --11676 --
NM_001037278chr151610 1446 542 332 39 --11676 --
NM_001037317chr1112743 2619 2585 2491 1924 1073 969 468 448 298 125 21081 119 21027 528 22657 994
NM_001037334chr18132186 2093 2042 1880 1865 1752 1652 1578 916 659 569 260 75 1672 21911 1780 --
NM_001037339chr151486 1239 622 569 385 21869 1575 11786 --
NM_001037340chr151486 1239 622 569 385 21869 1575 11786 --
NM_001037341chr151486 1239 622 569 385 21869 1575 11786 --
NM_001037341chr151486 1239 622 569 385 21869 1575 11786 --
NM_001037533chr12209 199 ------
NM_001037535chrX81561 1388 1177 1139 971 591 549 252 1230 21247 456 --
NM_001037536chrX81561 1388 1177 1139 971 591 549 252 1230 21247 456 --
NM_001037540chrX81561 1388 1177 1139 971 591 549 252 1230 21247 456 --
NM_001037631chr22458 122 --2449 24 --
NM_001037637chr52276 268 ----158
NM_001037872chr26742 718 666 241 194 102 196 ----
NM_001037954chr1193189 3034 2697 2142 934 874 862 737 383 33162 1408 895 12788 --
NM_001038493chr241399 1204 1182 486 21525 1498 --11546
NM_001038603chr52389 30 --340 35 22 --
NM_001038640chr152979 290 ------
NM_001038702chr5102462 2277 1898 983 857 841 600 449 401 263 22650 2191 22547 307 12065
NM_001039199chr20125016 4252 3977 3500 3350 3315 1730 1708 1295 744 351 175 23827 1097 1600 --
NM_001039348chr231055 955 189 1423 171 11025
NM_001039349chr231055 955 189 1423 171 11025
NM_001039372chr73631 439 52 --2476 423 --
NM_001039457chr1136 ------
NM_001039468chr111292 ------
NM_001039469chr111332 ------
NM_001039538chr2113476 3304 2724 2489 1403 1226 964 889 845 278 215 32470 2304 91 13158 --
NM_001039569chr2103240 2926 2825 2669 2171 1304 1168 770 545 125 13291 ----
NM_001039570chr22114550 4521 4490 4475 4104 1389 1145 1113 726 442 375 ------
NM_001039571chr22114550 4521 4490 4475 4104 1389 1145 1113 726 442 375 ------
NM_001039573chr171501 1145 ----
NM_001039577chr163676 1466 1204 1050 526 451 ------
NM_001039580chr4154988 4798 4751 4642 4240 4195 3930 3604 3361 3326 3301 923 562 144 100 21681 858 54130 1769 689 603 247 25077 641
NM_001039590chrX113886 3466 3426 3027 2915 2836 2506 1416 1133 626 602 ----24048 1422
NM_001039591chrX113886 3466 3426 3027 2915 2836 2506 1416 1133 626 602 ----24048 1422
NM_001039618chr11235782 4854 4710 4568 4457 4314 4119 4008 2309 1904 1554 1477 1413 1346 1290 1136 1015 994 844 689 341 333 22 45882 5111 3975 1992 24998 4180 12346
NM_001039693chr294116 4094 3731 3337 2821 2505 1314 786 35 13996 --1820
NM_001039709chr2075254 5247 4207 1968 1215 916 688 ----14214
NM_001039716chr141022 745 718 358 ------
NM_001039840chrX215826 5630 5574 5561 5555 5547 4453 4410 4372 3775 3686 2432 2238 1919 1228 842 715 655 644 506 210 65208 1790 1354 1184 774 108 36053 3937 2273 11633
NM_001039937chr13163905 3555 2677 2621 2572 2560 1577 1083 1041 863 823 795 597 525 348 152 13683 43257 3114 1434 1382 2771 374
NM_001040001chr621523 681 1732 3725 405 171 21966 25
NM_001040020chr781607 1532 1347 475 394 369 267 85 11425 1384 11046
NM_001040033chr12696 540 ------
NM_001040057chr751481 1347 1267 464 439 21357 1195 ----
NM_001040092chr82353 105 151 ----
NM_001040108chr1492587 2490 2349 2324 2085 2074 1996 780 583 22135 1185 12028 1766
NM_001040110chr741755 1737 1708 97 21611 1587 ----
NM_001040142chr272403 2242 1903 1732 751 550 311 12102 32067 1574 1569 --
NM_001040143chr272403 2242 1903 1732 751 550 311 12102 32067 1574 1569 --
NM_001040151chr11113590 3345 3281 3035 2830 1771 1704 1680 1457 860 519 --11304 1335
NM_001040152chr7104666 4638 4592 4584 4527 3888 3181 1567 1232 831 --15065 --
NM_001040153chr133868 837 386 --1809 --
NM_001040157chr4132923 2479 2398 2317 2079 2008 1853 861 665 193 79 58 33 22160 71 12443 --
NM_001040159chr451463 1210 1005 601 434 1195 1160 1293
NM_001040179chr66955 892 879 865 824 175 ------
NM_001040181chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040182chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040183chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040199chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040200chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040202chr4132399 2392 2351 2324 2227 1813 1794 751 601 579 458 297 175 22287 126 11702 --
NM_001040214chr652388 2100 2047 1579 753 31830 960 817 1935 --
NM_001040284chr16215962 5577 5542 5311 5264 4884 4666 4651 4616 4544 4338 4069 4026 1913 1881 1777 1306 1156 1048 314 267 45205 1701 1638 1591 64414 3745 1895 921 787 493 15880
NM_001040402chr472917 2875 2847 2814 2095 2058 2010 12746 21236 390 12390
NM_001040409chr23758 682 368 --2648 287 --
NM_001040429chr1392897 2872 2319 2191 1387 898 776 114 84 12845 43391 3119 1093 1023 12611
NM_001040437chr6291 65 ------
NM_001040438chr6291 65 ------
NM_001040440chr54676 556 532 158 1538 ----
NM_001040441chr1145070 5043 4814 4490 3631 3434 2118 1669 1477 1255 815 603 347 109 --3374 277 174 45443 5431 4891 4846
NM_001040446chr5112687 2617 2447 2266 2221 2012 1067 963 622 440 360 22642 2186 12508 --
NM_001040450chr15112682 2520 2197 1838 906 748 577 559 552 419 185 21848 833 --1712
NM_001040453chr15112682 2520 2197 1838 906 748 577 559 552 419 185 21848 833 --1712
NM_001040619chr121399 416 11018 --1503
NM_001040633chr72228 215 --2907 166 --
NM_001040653chr382102 2023 2006 1752 1658 697 395 313 12526 12083 22556 530
NM_001040665chr7164672 4235 3970 3619 3481 3199 3066 1805 1510 1016 951 857 677 403 349 56 --21908 670 1269
NM_001040708chr82958 160 --1271 1304
NM_001040712chr993515 3212 3201 3000 2755 769 628 598 456 13019 22917 246 1915
NM_001040875chr85502 473 455 178 131 21675 444 --12523
NM_001040876chr451729 1380 1211 662 417 --188 --
NM_001042355chr16195422 5233 5227 5073 5067 4981 4850 4076 3960 3638 1893 1694 1345 912 443 371 309 262 108 34885 1463 1378 1770 24183 1259
NM_001042361chr1031136 570 25 --31517 1124 366 1411
NM_001042364chr1031136 570 25 --31517 1124 366 1411
NM_001042365chr1031136 570 25 --31517 1124 366 1411
NM_001042387chr1031136 570 25 --31517 1124 366 1411
NM_001042388chr182362 211 ------
NM_001042393chr1031136 570 25 --31517 1124 366 1411
NM_001042396chr1031136 570 25 --31517 1124 366 1411
NM_001042397chr1031136 570 25 --31517 1124 366 1411
NM_001042403chr123386 249 70 1242 1845 3811 319 121
NM_001042404chr171911 1760 1449 1365 1252 1229 249 --2580 133 11509
NM_001042406chr63963 906 877 1811 11100 --
NM_001042410chr21182 ------
NM_001042412chr16195422 5233 5227 5073 5067 4981 4850 4076 3960 3638 1893 1694 1345 912 443 371 309 262 108 34885 1463 1378 1770 24183 1259
NM_001042413chr994110 3973 3738 3586 3470 3089 1048 650 623 24138 591 23280 3253 --
NM_001042414chr132229 89 156 ----
NM_001042424chr483278 2484 2336 2276 2157 1290 951 850 12872 12243 1806
NM_001042425chr661726 1441 1389 1372 1340 529 --31731 1706 1097 --
NM_001042440chr542059 1892 1390 227 1268 ----
NM_001042441chr542059 1892 1390 227 1268 ----
NM_001042442chr542059 1892 1390 227 1268 ----
NM_001042443chr542059 1892 1390 227 1268 ----
NM_001042444chr542059 1892 1390 227 1268 ----
NM_001042445chr542059 1892 1390 227 1268 ----
NM_001042446chr542059 1892 1390 227 1268 ----
NM_001042453chrX31652 1438 681 ----1170
NM_001042473chr1062108 2047 1701 1625 743 182 1770 1533 22030 466
NM_001042481chr14102367 2165 1868 1857 1803 820 780 351 259 168 32540 982 122 ----
NM_001042486chr203195 179 29 ------
NM_001042492chr1753435 3322 3309 1323 1035 1113 --1615
NM_001042493chr682005 1947 1884 735 564 457 333 30 1526 21371 588 --
NM_001042510chr871905 1583 1502 1487 1370 306 135 11782 21516 500 --
NM_001042511chr871905 1583 1502 1487 1370 306 135 11782 21516 500 --
NM_001042533chr3102972 2850 2797 2629 2558 903 665 427 390 310 2731 405 1482 134
NM_001042537chrX92436 2309 2111 1835 1578 929 470 437 266 1946 41974 1862 911 667 --
NM_001042539chr1611098 ------
NM_001042543chr481455 1399 1176 1075 1026 574 341 281 1145 ----
NM_001042548chr23700 608 320 1157 1776 --
NM_001042550chr931526 677 568 2257 129 1216 --
NM_001042555chr12154730 4609 4428 4154 4042 3929 3733 2955 1755 1556 1222 730 464 283 33 53953 3871 2962 349 97 33721 3467 1810 23832 3706
NM_001042573chr17----12015 --
NM_001042599chr2207665 7296 7127 6977 6702 6622 6346 6305 6286 6151 5918 4927 3075 2970 2074 1960 794 769 705 338 47219 4988 2890 681 35605 1540 1102 22906 1572
NM_001042601chr382951 1285 1259 757 671 595 533 304 43215 3126 2238 854 1544 --
NM_001042603chr1285370 4419 3627 1974 1688 1434 1316 772 33876 1344 649 ----
NM_001042604chr3224877 4815 4678 4651 4400 4305 3720 3407 3345 3160 3123 1727 1645 1566 1129 1041 858 632 604 535 190 96 21268 53 64902 4624 3811 1510 878 461 14578
NM_001042618chr14----184 --
NM_001042646chr381772 1758 1616 1365 1339 1243 754 538 --21993 1831 1172
NM_001042669chr451552 1257 1228 673 418 21612 571 3537 507 280 1403
NM_001042681chr162405 2149 1896 549 469 291 1119 ----
NM_001042682chr162405 2149 1896 549 469 291 1119 ----
NM_001042682chr162405 2149 1896 549 469 291 1119 ----
NM_001042683chr671871 1835 1708 513 457 213 29 31430 1401 361 ----
NM_001042749chrX61765 1742 1694 1394 597 59 11791 31547 521 237 --
NM_001042750chrX61765 1742 1694 1394 597 59 11791 31547 521 237 --
NM_001042751chrX61765 1742 1694 1394 597 59 11791 31547 521 237 --
NM_001042762chr77939 795 717 339 248 135 47 2849 697 ----
NM_001042784chr4191 ------
NM_001043318chr1494157 3887 3857 3797 2512 1468 870 799 616 24055 3694 24036 3033 --
NM_001043351chr142056 1732 639 604 31811 1565 909 ----
NM_001044385chr274042 3690 2999 2516 1511 847 673 170 23162 2663 --
NM_001044722chr5102251 2157 2075 1973 1821 1697 1475 811 205 195 1374 1764 11567
NM_001044723chr5102251 2157 2075 1973 1821 1697 1475 811 205 195 1374 1764 11567
NM_001046chr572800 2614 2588 1142 436 416 399 43005 2825 976 376 ----
NM_001048183chr183798 3598 2594 1202 762 648 138 77 --1200 22760 1512
NM_001049chr1432031 2004 1829 1816 12219 --
NM_001050chr1751250 1165 1091 1067 927 1355 ----
NM_001068chr33255 121 92 ------
NM_001071775chr13101443 1354 1248 1215 686 670 502 411 289 115 2782 149 21362 1338 11745
NM_001078chr11702 2516 508 ----
NM_001079874chr131971 1850 372 21622 679 42068 1989 1778 782 22126 1655
NM_001083620chr472325 1886 1846 1657 856 768 665 32116 519 416 12559 12335
NM_001083621chr194735 4727 4289 4073 3512 3307 1479 1385 1056 --24636 3240 --
NM_001094chr173773 722 701 --1763 --
NM_001099678chr3146255 6056 5873 4771 4619 4344 4098 2393 1584 1321 1310 1179 637 196 46382 6120 5501 997 14520 --
NM_001100108chr1217924 7339 7214 7139 6990 6800 6088 5448 3351 3329 3241 3082 3054 3012 2856 1603 1550 1308 1281 990 839 15274 38381 7978 1608 --
NM_001101662chr1141 ------
NM_001102566chr13930 912 76 1121 ----
NM_001106chr3299774 9604 9581 8835 8242 8145 7837 7346 7217 7211 7070 7037 7018 6991 6791 6435 6055 5905 3772 2757 2646 2474 1969 1532 907 525 345 134 120 47673 7081 6008 5990 11744 18688
NM_001109977chr44769 679 539 98 1858 ----
NM_001112808chr1193 ------
NM_001113490chrX113683 3190 3131 2846 2717 2327 1024 985 344 130 63 --13646 --
NM_001116chr1623039 366 --12702 --
NM_001117chr1882479 2286 2239 2147 2059 1754 657 427 21651 343 1199 --
NM_001121chr1071941 636 454 392 347 204 122 --2582 545 1179
NM_001122679chr541249 1186 1146 110 11240 ----
NM_001123chr103571 269 169 ----1290
NM_001124chr112570 540 ------
NM_001126chr161014 928 818 802 704 169 --11049 --
NM_001128chr16153722 3657 3556 3517 3339 3236 3098 2931 2921 2679 1411 1067 905 223 27 --21199 367 13297
NM_001128144chr2--1137 ----
NM_001140chr173660 531 161 ------
NM_001144chr1681422 1242 1173 1109 1065 932 897 221 1171 ----
NM_001146chr842181 1617 1520 248 11831 11561 --
NM_001149chr1051287 1068 1010 180 144 --1905 --
NM_001151chr41193 ------
NM_001152chrX1206 ------
NM_001156chr101427 --1178 --
NM_001160chr1272808 2037 1962 1781 607 484 342 186 22250 2193 --
NM_001167chrX156561 6436 6357 4732 2592 2310 2025 1811 1264 1249 1234 1056 971 333 71 2868 815 46652 5913 1848 1040 14933
NM_001173chr14194707 4701 4692 4445 4186 4052 3968 3641 3192 3078 3049 1812 1757 1516 1058 1000 823 814 712 32994 1823 210 34752 4747 4503 1481
NM_001174chrX32128 1877 203 42260 2050 1836 1558 22197 2098 --
NM_001177chr1262378 2143 1550 588 489 466 ----22281 580
NM_001178chr111102 1318 ----
NM_001186chr21123161 2980 2970 2810 2413 2341 2250 2054 1178 580 554 419 13098 22595 2096 --
NM_001195chr20166 ------
NM_001197chr22--2153 110 ----
NM_001198chr692446 2348 2295 2067 1876 1650 978 790 765 22208 479 11830 11940
NM_001200chr204974 206 99 46 --1122 1259
NM_001201chr4153920 3670 3558 3058 2976 2621 2520 2455 2409 1353 1241 879 700 650 52 1625 13070 --
NM_001202chr142288 193 ------
NM_001204chr2237725 6774 6246 6099 5686 5384 5230 4860 3023 2567 2512 2362 2178 2143 2083 2001 1985 1727 957 445 421 135 87 46351 5427 2650 2505 67467 6255 5582 1166 903 898 36768 5591 5395
NM_001206chr9153033 2839 2717 2455 2448 2016 2004 1116 1015 891 799 599 459 382 312 32588 2254 763 ----
NM_001207chr52276 268 ----158
NM_001219chr761673 1656 1521 1505 369 362 32253 2232 1815 11533 1233
NM_001233chr792353 2328 2263 864 675 614 346 267 49 12057 11985 32025 289 208
NM_001237chr44784 270 205 83 11030 ----
NM_001237chr44784 270 205 83 11030 ----
NM_001238chr191170 ------
NM_001241chr262135 1885 1715 719 277 233 21819 1748 52439 2287 1903 671 666 --
NM_001241chr262135 1885 1715 719 277 233 21819 1748 52439 2287 1903 671 666 --
NM_001248chr32958 766 1273 11106 1422
NM_001253chr62281 127 ------
NM_001254chr1761053 926 824 130 74 66 1776 ----
NM_001256chr17132899 2811 2533 2392 2296 1819 1808 716 659 639 390 312 278 11875 12102 --
NM_001257chr1651442 1316 1268 336 134 ------
NM_001261chr91454 --1105 --
NM_001269chr1--2977 772 ----
NM_001270chr541081 1035 367 327 2814 177 2827 445 --
NM_001278chr105964 938 826 426 161 11187 11209 --
NM_001284chr52525 190 --1582 --
NM_001286chr132839 1836 1795 --11899 --
NM_001288chr61188 ------
NM_001289chrX81681 1317 1285 658 601 207 174 45 ------
NM_001290chr441062 908 815 323 1859 11052 1959
NM_001298chr231275 828 312 ----11068
NM_001304chr17113862 3739 3562 3130 2973 2780 2461 677 424 356 342 23823 3477 32724 1306 699 --
NM_001310chr12112551 2278 2036 1950 1911 690 491 471 387 327 175 1599 32658 1940 768 --
NM_001315chr671940 1572 1397 909 378 221 176 --22222 1982 11596
NM_001326chr115469 425 319 172 82 --1358 --
NM_001331chr1172684 2435 2290 2203 1074 466 42 12115 ----
NM_001332chr531321 398 157 1276 31277 1099 1052 --
NM_001333chr92281 194 --156 --
NM_001349chr23627 465 126 1227 ----
NM_001351chr381715 1511 1491 1160 710 514 278 145 --2601 111 --
NM_001356chrX82498 2399 2302 2245 1787 1576 336 323 --22463 1643 11598
NM_001363chrX4804 718 136 124 ------
NM_001364chr11114764 4060 3789 3435 1555 1416 1027 640 422 353 82 --24800 1136 24794 431
NM_001379chr192219 207 1281 1269 --
NM_001380chr1021084 1010 ----1971
NM_001385chr83396 388 265 ----1430
NM_001387chr572344 1961 1086 979 604 183 168 --11268 --
NM_001389chr211239 ------
NM_001390chr1883183 3168 3091 2371 1085 1013 505 408 ------
NM_001391chr1851227 1206 884 430 241 2458 157 --1754
NM_001396chr2152451 1796 1012 345 247 42596 2096 2023 40 ----
NM_001400chr141347 1138 389 355 --11051 1502
NM_001401chr931126 1110 393 11054 11541 --
NM_001407chr341213 1170 1101 494 2234 217 21185 1152 --
NM_001412chrX123552 2937 2902 2859 2834 2694 2530 2302 1319 1176 906 832 2878 514 63628 3042 2456 1324 1112 202 --
NM_001415chrX81971 1661 1624 1553 802 776 609 302 --1793 --
NM_001416chr171162 ------
NM_001418chr113514 500 200 ----1727
NM_001418chr113514 500 200 ----1727
NM_001419chr19124708 4675 4547 4414 4229 3988 3494 1228 961 888 308 113 34623 4191 141 14236 --
NM_001422chr112480 473 --2260 28 --
NM_001427chr762135 1982 1952 1771 383 328 --31491 452 235 --
NM_001429chr2241052 858 330 242 --1423 --
NM_001430chr261847 1738 1507 682 388 377 --1177 21989 770
NM_001432chr4183874 3691 3631 3545 3312 3257 2898 2868 2760 2401 1030 1010 944 721 397 151 140 117 32717 880 224 21364 67 13396
NM_001438chr1103286 3085 3079 2958 2367 1066 908 409 312 240 --23330 2359 13560
NM_001444chr81133 ------
NM_001448chrX51581 1552 513 443 80 11659 31778 279 152 --
NM_001451chr163463 456 429 11131 11035 --
NM_001452chr64648 637 615 602 ------
NM_001453chr661776 1593 1356 593 469 225 21213 262 1414 --
NM_001465chr572101 1806 1783 1636 1398 824 59 1842 ----
NM_001480chr187798 448 417 403 367 256 154 --1204 11179
NM_001482chr155956 929 707 102 76 ----1874
NM_001483chr74808 759 707 65 1382 ----
NM_001491chr682621 2280 2172 1787 914 610 219 209 1406 22411 1730 --
NM_001497chr952810 2143 869 728 560 11905 ----
NM_001498chr64949 458 446 219 ----11277
NM_001511chr42543 193 --1581 --
NM_001527chr6204889 4569 4538 4460 3772 3370 1736 1607 1601 1591 1485 1432 1341 1278 1038 896 323 213 162 101 --21410 1350 193
NM_001530chr1481110 1031 1017 754 417 274 256 86 --2966 957 --
NM_001542chr142558 2365 2105 1861 1338 1471 32866 2153 618
NM_001543chr544600 4508 3590 939 ------
NM_001546chr651118 1081 580 396 348 21386 951 1362 --
NM_001550chr72641 82 --2633 614 --
NM_001553chr41234 ------
NM_001554chr13597 530 215 --1624 1605
NM_001557chr211259 --1928 11220
NM_001560chrX4966 338 329 144 --32066 1807 359 12140
NM_001567chr111747 ------
NM_001584chr1141127 414 322 312 11217 41148 1138 162 157 --
NM_001587chrX62236 815 736 591 479 410 1242 ----
NM_001604chr1141000 662 406 240 3990 761 183 ----
NM_001609chr10134190 4000 3936 3903 3713 3346 2972 1092 965 883 726 118 49 23677 1289 21132 942 24364 739
NM_001616chr2133350 3285 2743 2703 2656 2266 1271 1245 1076 570 432 411 137 23144 2314 21152 991 --
NM_001619chr1131059 85 51 11091 ----
NM_001621chr7112942 2653 2498 2364 2274 1025 937 693 463 372 146 1500 1292 21132 593
NM_001621chr7112942 2653 2498 2364 2274 1025 937 693 463 372 146 1500 1292 21132 593
NM_001624chr651785 625 401 321 189 --2469 376 --
NM_001634chr671910 1645 1451 805 608 442 284 --11781 11489
NM_001642chr1141350 1192 1151 433 11096 1890 --
NM_001650chr1893911 3336 3070 3001 2797 940 888 480 280 --22956 250 13447
NM_001655chr115741 657 528 332 326 --1337 1387
NM_001656chr541459 604 155 48 22012 1889 1522 21680 593
NM_001660chr32666 230 1651 ----
NM_001663chr14102734 2565 2089 1971 1864 1766 956 881 855 357 3592 527 336 11049 12297
NM_001668chr171961 1863 1801 1584 639 632 454 ------
NM_001677chr15997 867 772 383 123 1804 3928 404 328 21010 905
NM_001679chr34768 704 644 282 1518 ----
NM_001682chr1272866 2849 2633 2508 2170 677 302 12562 ----
NM_001683chr342703 2691 924 766 1620 11671 --
NM_001684chr172967 1528 719 607 565 490 32 12553 ----
NM_001689chr262007 1954 1902 1878 280 143 1295 ----
NM_001690chr3102569 2488 619 610 603 597 295 217 183 97 --21781 415 --
NM_001695chr8113862 3794 3409 3366 3346 3050 2663 1389 826 761 199 23691 1554 33959 3506 857 13473
NM_001701chr981615 1467 1307 1114 459 426 220 116 ------
NM_001704chr62515 459 1490 138 1396
NM_001706chr32320 71 ----1278
NM_001709chr11102761 2656 2611 2241 1058 932 886 515 408 309 12287 22341 103 --
NM_001713chr51164 ------
NM_001718chr651237 990 435 147 105 ----11138
NM_001721chrX164 1333 ----
NM_001730chr1341304 402 225 188 1574 11072 --
NM_001730chr1341304 402 225 188 1574 11072 --
NM_001731chr124819 607 201 154 --2805 235 --
NM_001742chr721675 377 ------
NM_001744chr53453 445 170 --251 42 --
NM_001746chr5152968 2710 2677 2658 2619 2609 2429 2137 1936 1108 1100 994 311 285 155 1412 ----
NM_001750chr542059 1892 1390 227 1268 ----
NM_001752chr112410 157 ------
NM_001753chr7111836 1825 1701 1664 1552 1528 1402 715 601 264 238 11671 1392 11806
NM_001754chr21103669 3662 3530 3343 3267 3251 1618 1467 642 545 34256 3301 552 23654 1604 1373
NM_001755chr1661859 1477 551 481 354 309 1536 21869 1457 --
NM_001759chr12105008 4810 4717 4329 4292 1803 1359 975 646 78 11790 11377 21778 1582
NM_001769chr122373 114 --1157 --
NM_001777chr3133984 3918 3610 3403 3359 3322 3264 2665 1599 1394 703 680 167 23849 3296 23274 2611 13941
NM_001781chr122906 200 3966 682 672 1103 2288 119
NM_001786chr10153 ------
NM_001788chr74876 280 241 98 --1778 --
NM_001789chr341240 540 495 412 --2464 459 --
NM_001792chr187914 907 720 404 291 213 82 --2451 238 190
NM_001795chr16--11583 ----
NM_001797chr163768 681 667 --1747 --
NM_001798chr1221062 282 11159 ----
NM_001799chr5123 ------
NM_001801chr5131 --1475 1430
NM_001806chr1972985 2592 2438 2066 798 748 22 --22950 524 21184 507
NM_001812chr4--2234 82 1115 --
NM_001822chr22584 495 153 ----
NM_001829chr41644 --1882 --
NM_001830chrX103975 3913 3734 3619 3580 3496 3472 3176 1357 197 22505 1218 23078 493 21188 191
NM_001839chr14286 78 42 36 1760 ----
NM_001842chr9--1580 ----
NM_001845chr1341314 1238 914 898 ------
NM_001850chr3------142
NM_001854chr161471 1338 1302 1242 1078 148 1577 1466 11123
NM_001855chr92606 574 --1745 1585
NM_001858chr6205079 4949 4860 4849 4431 3972 3876 3716 3582 3571 3323 3310 3223 3215 1667 954 615 574 385 220 3519 502 252 33628 3159 1735 12011
NM_001859chr9113596 3206 2971 2733 2606 2445 1324 1191 989 546 101 1886 11081 --
NM_001875chr271049 838 826 725 404 358 289 --1122 --
NM_001880chr2--1215 ----
NM_001881chr102478 46 1114 1467 --
NM_001882chr52185 175 1391 --1521
NM_001884chr52543 371 ------
NM_001892chr521110 76 ------
NM_001894chr2241235 1182 1135 1028 --21038 1033 11144
NM_001896chr161427 ------
NM_001903chr51792 --1878 --
NM_001914chr181333 --1346 --
NM_001920chr12--126 1580 --
NM_001921chr441208 1156 1114 198 ------
NM_001924chr12459 170 160 2484 422 --
NM_001931chr1141049 461 109 90 --11178 --
NM_001935chr26935 915 319 284 228 133 ------
NM_001938chr191950 1840 1754 1437 1228 665 624 395 249 11467 ----
NM_001942chr1831854 1363 245 ------
NM_001948chr1581274 406 384 375 260 198 149 113 1962 1222 --
NM_001949chr6123154 3087 2804 2655 2454 2140 2017 991 880 793 150 44 12760 ----
NM_001950chr16--1725 ----
NM_001954chr61814 ------
NM_001957chr482099 1910 1777 1587 766 477 392 344 --22175 747 22262 2129
NM_001961chr191321 ------
NM_001966chr341265 1186 1009 293 ----11547
NM_001968chr45843 832 359 314 157 ----1853
NM_001969chr14113947 3263 3249 3159 3035 2785 1279 955 510 358 117 --22613 826 1782
NM_001977chr491721 1704 1533 1345 503 442 338 273 166 1298 31352 481 447 11395
NM_001980chr126808 779 753 394 346 284 32018 861 744 12265 --
NM_001981chr192259 1934 1539 955 773 688 464 282 137 22194 1579 12062 --
NM_001987chr1244110 3571 2968 757 24344 2632 12724 12752
NM_001992chr592214 2091 1729 1644 1526 689 605 349 136 --22115 85 --
NM_001993chr151120 904 890 267 187 1952 --1833
NM_001998chr31394 ----198
NM_001999chr571393 1188 586 348 238 134 81 1225 11130 --
NM_002006chr4175694 5147 4936 4706 4362 3839 3665 3644 3559 1953 1514 1366 1187 697 269 127 52 44790 4191 458 205 35771 4801 2187 44625 1319 1292 792
NM_002009chr15112737 2561 2322 2277 2152 2061 1869 1019 920 489 90 1828 1939 1765
NM_002011chr5--1430 ----
NM_002015chr13103331 2953 2648 2543 1308 1262 1121 1109 1074 958 1660 1834 1932
NM_002017chr113447 323 315 21025 123 ----
NM_002024chrX92097 1929 1839 1419 477 289 257 250 144 1557 21716 70 1665
NM_002025chrX279321 9182 9148 9071 8848 8371 8342 8170 8079 7763 7305 6614 5722 5665 3029 2973 2093 2069 1908 1885 1284 1203 1160 668 264 194 119 47908 3146 2957 2577 38496 7207 1425 --
NM_002031chr6----1165 --
NM_002033chr1163918 3597 3470 2828 822 673 23969 3376 22910 500 --
NM_002040chr21193134 3109 2572 2419 2296 1993 1275 1173 1011 951 931 909 656 421 409 184 171 94 70 22426 131 32838 2166 2134 11118
NM_002041chr15--124 ----
NM_002044chr1541572 1375 1238 276 ------
NM_002056chr25831 807 733 695 205 --2863 779 1683
NM_002063chrX51270 1244 1090 871 82 174 1807 1813
NM_002065chr151568 1329 1270 1133 153 21305 663 ----
NM_002069chr7101911 1713 1677 706 682 602 565 433 349 301 11619 21859 593 --
NM_002072chr94984 971 628 267 1893 1165 --
NM_002074chr171682 1241 509 420 368 275 248 ------
NM_002077chr992178 1989 1944 1889 870 735 628 558 501 22038 749 ----
NM_002082chr511001 ------
NM_002090chr44664 514 201 193 1441 1540 --
NM_002092chr4155010 4973 4963 4032 3684 3424 3290 1713 1615 1031 918 614 448 337 269 1275 53844 3702 3554 1857 1108 --
NM_002094chr161318 ------
NM_002104chr51183 ------
NM_002106chr41280 ------
NM_002107chr11393 ------
NM_002111chr463247 2862 2734 2369 594 171 --12590 --
NM_002114chr63477 208 112 133 1365 --
NM_002126chr17114172 4139 3613 3578 3217 2935 2718 1664 1626 228 98 1536 11122 --
NM_002128chr1352441 2392 2239 1973 460 --22281 1650 --
NM_002130chr541710 394 122 94 --11295 --
NM_002136chr121204 ------
NM_002137chr762355 2196 1755 1479 857 539 1297 ----
NM_002138chr43716 246 207 ------
NM_002139chrX1146 --1185 --
NM_002140chr95947 887 470 351 101 125 1286 11015
NM_002145chr171304 1404 ----
NM_002146chr1741383 1222 967 342 1401 ----
NM_002158chr293478 3357 3016 2785 1538 1067 784 731 152 43846 2918 1011 256 1481 --
NM_002160chr92479 57 ------
NM_002163chr1671300 1293 821 491 483 414 118 --1242 --
NM_002166chr23688 659 27 3614 583 264 ----
NM_002167chr1--1470 ----
NM_002182chr362720 2297 2134 1942 462 415 1294 ----
NM_002189chr103597 279 54 ------
NM_002190chr641253 314 294 256 --2381 332 --
NM_002193chr221800 219 31519 1405 1396 11608 --
NM_002199chr48965 875 848 785 653 356 92 44 1793 2809 67 --
NM_002202chr51196 ------
NM_002203chr593852 3633 3109 1492 1450 457 359 128 97 24175 3882 1562 23455 227
NM_002210chr2113457 3375 3106 2663 2333 2253 2214 875 685 251 99 32429 1349 1238 41087 659 347 53 3536 487 294
NM_002211chr1071006 900 816 761 385 148 72 --1807 --
NM_002214chr7195591 5249 5161 5061 4817 4690 4652 4642 4449 4440 4356 4161 3999 1565 658 584 306 238 69 44856 4473 3976 2035 45134 3915 1949 768 --
NM_002222chr321153 1060 41118 351 128 36 ----
NM_002227chr131333 1110 828 21309 814 11297 --
NM_002228chr131163 1119 892 ------
NM_002229chr192460 423 ------
NM_002232chr11362 178 ----
NM_002235chr1241602 1570 563 494 --11065 11416
NM_002239chr251174 1094 1078 763 262 ------
NM_002240chr214660 425 98 91 ------
NM_002245chr12108 76 1644 ----
NM_002247chr1041704 1521 1502 162 21999 447 ----
NM_002253chr431040 980 446 --11437 21363 1125
NM_002264chr3155051 4876 4297 4166 3866 3679 3322 3076 1987 1970 1062 964 678 412 401 34959 3451 2026 23283 1227 13270
NM_002267chr13121861 1772 1641 1550 982 798 671 493 475 381 151 112 11765 ----
NM_002268chr341780 1446 1402 255 21588 1503 21707 1239 11462
NM_002270chr5235563 5521 5389 5323 5163 5127 4919 4854 4809 4679 4584 4566 3854 3779 3743 3705 3545 3490 2184 1752 1055 480 224 21968 1914 21257 1049 24516 2231
NM_002271chr1362307 1797 841 525 334 71 11505 11670 --
NM_002285chr274063 3316 3231 3215 2892 1302 232 ------
NM_002291chr7153 ------
NM_002293chr142745 2674 880 198 22659 1972 42769 2546 2518 2448 --
NM_002296chr171674 1552 1521 1201 1087 414 237 11099 11715 21757 1374
NM_002310chr5236372 6010 5626 5204 5120 5061 4820 4553 4428 4359 4353 4185 4176 4022 1672 1639 1485 1424 1386 736 643 482 232 46021 5956 1821 851 36587 1969 826 16408
NM_002312chr136721 705 659 404 227 148 1270 31016 778 86 --
NM_002313chr1095142 5085 4808 4725 4363 4263 4212 3972 308 --24049 1587 --
NM_002332chr12------1138
NM_002334chr1142073 1790 223 44 --12082 --
NM_002336chr12204985 4881 4830 4811 4391 4321 4124 4013 3984 3609 3588 3251 3222 3170 3158 1411 839 540 361 254 --24110 3938 14069
NM_002345chr123243 219 100 --273 27 1657
NM_002349chr291670 1580 1445 1387 1323 1310 1104 522 307 11504 11416 --
NM_002350chr841013 967 920 444 --11247 --
NM_002351chrX31760 1618 376 --127 2363 273
NM_002354chr22400 377 ------
NM_002356chr6112577 1136 921 736 350 327 318 282 275 128 111 --12557 --
NM_002358chr44538 419 156 84 1634 ----
NM_002359chr1774303 3079 3061 1630 959 890 720 1983 ----
NM_002360chr732512 2333 2306 ------
NM_002372chr5184 2546 42 ----
NM_002374chr2113476 3304 2724 2489 1403 1226 964 889 845 278 215 32470 2304 91 13158 --
NM_002381chr24907 355 288 221 --1702 --
NM_002383chr161921 ------
NM_002384chr182994 973 --2844 795 --
NM_002389chr151968 1708 1546 581 32 21526 447 11386 31254 534 393
NM_002395chr671236 1154 1120 593 491 191 110 2286 78 21283 456 --
NM_002396chr186684 626 442 220 117 81 ------
NM_002397chr541627 1606 804 244 12251 ----
NM_002399chr1531367 388 371 1920 11125 --
NM_002402chr781185 1037 1011 938 334 242 210 126 ------
NM_002408chr144807 338 297 98 1756 1270 1310
NM_002416chr472090 1511 1493 260 209 164 48 --1636 11359
NM_002430chr2262226 2136 2033 475 459 426 ------
NM_002438chr103583 467 225 --1494 --
NM_002440chr11101 ------
NM_002442chr1251758 1518 1429 425 257 --11508 --
NM_002445chr851566 1145 1106 555 122 ------
NM_002448chr41782 --1738 --
NM_002449chr541286 1201 326 255 1297 21240 799 11064
NM_002451chr9103836 3786 2499 1284 1205 1177 1024 839 749 243 23375 3227 33932 1161 460 31296 1223 732
NM_002467chr84383 295 179 158 ------
NM_002469chr121442 ------
NM_002480chr1251342 1238 1096 1036 974 11362 --11268
NM_002481chr1178009 7832 7813 7638 7549 7543 6936 6730 5914 5847 4959 4907 1881 1834 1620 576 208 32543 939 704 36426 2981 322 --
NM_002485chr851800 1452 195 150 114 31936 1722 1546 1846 11928
NM_002486chr952357 2171 1688 1556 438 12189 21611 517 --
NM_002487chr153643 602 540 2320 137 1595 --
NM_002492chr33453 380 38 ------
NM_002499chr1572468 905 664 653 558 349 327 11831 3400 384 308 --
NM_002500chr23947 496 406 2524 477 --11001
NM_002508chr121258 514 11857 31876 1867 1628 --
NM_002509chr203875 707 633 --1712 --
NM_002512chr17--1105 ----
NM_002514chr82247 159 1147 21218 945 1301
NM_002515chr1451873 1623 274 219 73 --12041 --
NM_002516chr191321 ------
NM_002519chr1131353 615 195 1960 --1129
NM_002520chr51311 183 ----
NM_002523chr711053 --11107 --
NM_002525chr1141 ------
NM_002526chr681741 1731 1141 632 278 266 255 83 11504 1346 1660
NM_002527chr122104 36 184 ----
NM_002538chr55533 493 214 131 75 --1208 1158
NM_002540chr92682 274 ------
NM_002542chr32216 205 ------
NM_002543chr12101395 1341 1139 1043 1027 490 257 166 68 44 ------
NM_002544chr171299 1237 1312 --
NM_002545chr11115025 4960 4510 3931 3431 3377 2068 1341 738 159 54 --14995 --
NM_002546chr81499 2775 621 2766 628 1655
NM_002547chrX74131 3802 3429 2784 1338 942 78 24269 198 13135 --
NM_002569chr15173 ------
NM_002570chr151115 --1882 11021
NM_002577chr3123967 3283 2835 2492 2486 1545 1334 947 873 866 580 293 33465 2811 183 54036 3958 3019 2925 308 1541
NM_002581chr9115663 5544 5377 5092 4839 3619 1899 1557 1544 686 140 23953 1317 25431 4553 --
NM_002583chr123421 193 34 1517 ----
NM_002588chr5--11740 ----
NM_002592chr20--1249 ----
NM_002594chr2092380 2329 1654 1554 980 918 630 349 244 ----12444
NM_002595chr12141759 1700 1615 1546 1464 1458 1434 1387 781 725 710 527 385 139 21861 164 11394 --
NM_002600chr151486 1239 622 569 385 21869 1575 11786 --
NM_002605chr1531177 1055 33 ----31039 968 936
NM_002606chr21----1176 --
NM_002608chr2211585 ------
NM_002610chr243071 2169 422 189 1681 3580 259 92 22776 2506
NM_002611chr17--1843 ----
NM_002612chr7122132 2084 2009 1988 1956 1686 839 833 704 679 357 23 12117 2571 549 --
NM_002613chr16105350 5260 5240 5075 3552 2065 1962 498 432 138 --14365 --
NM_002618chr2137 --1184 --
NM_002623chr203684 268 23 2706 597 1692 1165
NM_002627chr10----281 70 --
NM_002628chr351048 1008 879 501 357 1899 21153 262 --
NM_002635chr122385 347 173 ----
NM_002641chrX41911 1519 635 26 1431 1760 --
NM_002645chr11143082 3041 2729 2576 2544 2453 2380 2360 1237 1098 1043 1029 557 289 42742 1128 380 114 --22565 630
NM_002646chr152079 1763 1698 1372 359 --22097 806 --
NM_002648chr631249 842 409 11302 ----
NM_002651chr11683 ------
NM_002655chr8165334 5155 4965 4514 3781 3755 3685 3489 3380 3323 3242 1608 597 237 81 65 44720 4565 3211 2034 22054 1990 --
NM_002656chr63952 761 55 2426 195 1339 --
NM_002657chr2093855 3563 3356 2725 2568 1306 825 509 247 33911 3791 2430 --13751
NM_002658chr103895 876 158 ------
NM_002670chr351603 637 620 426 302 31517 1468 537 11301 --
NM_002677chr872914 2497 1016 865 742 496 32 ----1286
NM_002687chr1461327 1187 1175 504 436 305 11124 2998 846 --
NM_002699chr161473 1428 1304 1228 562 97 21512 1466 31536 1422 478 --
NM_002706chr25594 535 518 162 112 ------
NM_002709chr2193613 3498 3443 3268 3027 2920 2859 2784 2621 2598 1431 1353 1172 834 662 634 581 480 101 43344 3229 1225 690 12336 --
NM_002710chr123975 451 240 ----1830
NM_002716chr1183151 2536 2345 2309 932 742 588 262 ----1452
NM_002718chr3132310 1961 1892 1844 1809 1754 755 748 626 587 507 96 38 --22686 135 --
NM_002719chr14112380 2338 2019 1786 1712 1666 790 698 586 422 393 --1885 --
NM_002721chr95514 500 138 96 85 ------
NM_002726chr6----1153 --
NM_002727chr104618 466 174 132 --2193 50 193
NM_002731chr1133083 2715 2657 2232 2049 2024 1941 1223 987 897 864 852 131 1670 1320 --
NM_002734chr17142120 2054 2047 2005 1812 1646 1636 1418 787 627 243 223 144 67 21751 423 11732 --
NM_002736chr761831 865 739 636 462 171 41915 1654 566 437 21667 596 1231
NM_002737chr17116648 6163 6145 5451 4671 2343 1754 1583 1214 796 81 46355 5441 4463 706 16462 26076 1338
NM_002740chr392821 2745 2196 2167 1023 1012 909 628 468 1441 22640 495 22472 91
NM_002745chr2283342 3106 1767 1232 452 277 161 111 43585 3574 3223 3149 23676 421 --
NM_002748chr153854 180 59 127 41194 1189 940 119 --
NM_002758chr172493 388 ----1431
NM_002767chr171154 2543 195 2523 210 --
NM_002788chr14128 ------
NM_002808chr31154 ------
NM_002819chr1921250 67 11210 1106 --
NM_002821chr61748 1658 ----
NM_002822chr122654 599 2544 526 11139 31836 1823 281
NM_002823chr21249 --1668 --
NM_002828chr185717 694 388 349 314 --1934 1821
NM_002833chr1511164 --1382 11476
NM_002835chr74486 312 273 24 1582 ----
NM_002836chr201194 ----1151
NM_002837chr1264406 4387 4347 2962 2902 1225 32986 1568 241 14571 1145
NM_002838chr161014 921 357 351 202 137 1242 1211 1378
NM_002839chr993515 3212 3201 3000 2755 769 628 598 456 13019 22917 246 1915
NM_002841chr33477 438 213 --1148 --
NM_002843chr1142357 1340 387 108 185 11021 1340
NM_002844chr641041 190 148 96 21435 451 ----
NM_002848chr1241280 1103 861 328 1109 21224 1128 --
NM_002851chr75777 736 689 271 222 1547 1672 --
NM_002852chr31136 --1217 1603
NM_002855chr1152764 706 237 184 177 13735 ----
NM_002858chr121011 341 11040 21112 942 --
NM_002868chr1231742 971 548 ----1273
NM_002869chr1182150 2094 2024 1956 757 518 246 204 11917 1375 --
NM_002874chr962307 1605 825 619 435 254 21859 344 11992 11841
NM_002882chr22187 ------
NM_002886chr3144694 4537 4248 4028 3915 3332 3241 1596 1444 1371 1200 965 832 101 --44934 4658 3957 3603 11003
NM_002890chr54960 803 695 627 ----1784
NM_002892chr1461572 1270 1190 1116 650 467 1616 11178 11373
NM_002897chr23272 230 86 ------
NM_002901chr111378 1396 ----
NM_002902chr155681 538 513 89 57 140 --1559
NM_002906chr1181986 1760 1476 1461 815 705 362 340 1834 21684 1562 11828
NM_002912chr62710 634 1232 1727 --
NM_002922chr12678 494 --2480 475 --
NM_002924chr11623 1532 --153
NM_002927chr12546 62 --1501 --
NM_002930chr18----140 --
NM_002940chr451729 1380 1211 662 417 --188 --
NM_002941chr34482 169 148 124 --41329 1139 622 158 11348
NM_002942chr321194 421 --1447 --
NM_002946chr13433 165 31 ------
NM_002956chr1231424 889 332 --1478 --
NM_002958chr35855 363 265 200 139 21017 76 1775 --
NM_002959chr183477 2885 1553 1531 1209 1135 818 225 13859 24461 1097 14401
NM_002971chr351162 1089 1040 838 89 11140 ----
NM_002977chr273078 2954 2379 2198 1119 510 96 12335 --23061 2523
NM_002993chr461045 757 694 397 227 133 ------
NM_002994chr4101955 1638 1500 790 721 678 666 558 485 158 1466 2751 253 1729
NM_002995chr15744 550 543 85 50 1119 1642 --
NM_002998chr8111982 1916 1729 1626 766 593 582 537 272 118 82 11362 1378 1551
NM_003001chr141961 1883 1561 1493 --52226 1624 1583 755 695 --
NM_003010chr1772148 2079 1985 1839 958 544 86 11566 22352 902 --
NM_003011chr921161 234 ------
NM_003016chr172335 257 ----11940
NM_003017chr641214 1151 574 223 ----21263 1008
NM_003022chrX51291 1259 1178 951 284 155 ----
NM_003026chr931175 842 136 ------
NM_003027chr152407 154 1134 --1146
NM_003029chr11999 21170 986 2467 431 --
NM_003030chr341983 1878 1786 504 11806 11546 1522
NM_003031chr162891 661 21013 830 ----
NM_003034chr12257910 7750 7602 7064 6765 6691 5915 5345 5121 3168 2648 2441 2215 2072 2060 1734 1678 1630 1394 1019 793 753 613 435 148 18161 25722 5434 37144 5553 207
NM_003035chr11613 3924 770 301 ----
NM_003042chr352188 1771 793 399 292 ------
NM_003043chr344264 4190 4064 2893 34074 309 85 1283 --
NM_003046chr8185410 5360 5266 5129 5094 4627 4445 4245 4135 3848 3531 3469 3461 3343 1565 1338 1093 449 --24397 1788 --
NM_003048chr292729 2630 2609 2172 1727 1099 887 330 273 12314 32820 1796 359 12457
NM_003054chr10----3239 225 220 --
NM_003068chr831070 719 709 2899 383 ----
NM_003069chrX4570 504 288 74 1321 --1281
NM_003070chr92330 129 --1546 --
NM_003071chr3102062 1994 1869 1835 838 809 761 647 596 543 1340 2464 246 1119
NM_003072chr19----1370 --
NM_003073chr221247 ------
NM_003074chr352128 1554 402 358 309 --1636 --
NM_003081chr2031007 782 458 --1163 1948
NM_003088chr711088 ------
NM_003091chr201236 ------
NM_003095chr122257 246 127 ----
NM_003099chr15206336 5928 4786 4754 2498 2445 2002 1831 1758 1747 1610 1578 1514 1499 1492 1199 916 761 380 214 55786 4350 2467 2128 47 11859 16450
NM_003100chr52360 311 1126 2176 106 --
NM_003105chr11186 1109 143 --
NM_003106chr34965 946 928 229 ----1753
NM_003107chr642076 2035 1610 479 32330 2112 1657 --11806
NM_003108chr2156206 5847 5763 5650 5504 5446 5217 5038 4964 4916 4502 2133 1567 1123 284 35866 5319 5080 35960 5193 1308 --
NM_003111chr291160 1139 1002 553 526 486 431 236 86 139 --1154
NM_003112chr7153169 3097 3075 3042 2787 2671 2324 2241 2178 1202 1127 953 699 591 166 32531 1961 264 52283 2248 2142 1073 370 13032
NM_003114chr88848 783 734 630 271 247 177 130 1650 ----
NM_003115chr14404 190 115 44 --1409 --
NM_003118chr522077 1422 --1379 --
NM_003128chr242840 2467 2401 470 --1178 --
NM_003131chr642083 779 714 688 --11641 --
NM_003133chr131029 193 151 --286 23 --
NM_003136chr141291 ------
NM_003137chr682200 2106 1940 1803 1711 824 792 352 12235 21559 589 --
NM_003142chr2229 21 1246 ----
NM_003144chr662226 2140 1773 1467 780 657 ------
NM_003155chr882842 2550 1928 1828 846 677 603 45 32761 1981 923 32746 813 398 --
NM_003161chr1793195 2887 2845 2699 2604 1434 1386 581 154 1518 --22760 2705
NM_003170chr17185 ------
NM_003176chr11321 --187 --
NM_003176chr11321 --187 --
NM_003178chr33746 726 37 --31826 751 291 --
NM_003182chr71529 ------
NM_003182chr71529 ------
NM_003184chr841044 1002 979 61 21028 962 ----
NM_003185chr2081350 1283 1203 1174 1132 1082 1009 965 41321 996 114 29 1409 --
NM_003188chr63758 236 183 ------
NM_003194chr61360 1391 ----
NM_003199chr1885295 4157 3920 3738 3664 2213 1640 760 44581 4091 4041 1627 55592 5041 4131 2073 1893 --
NM_003201chr1081005 980 946 868 688 668 256 128 2297 112 2741 199 --
NM_003203chr2122253 2033 1675 784 703 607 388 224 155 89 56 31 21885 714 11783 --
NM_003204chr1711556 11723 11747 --
NM_003211chr1271723 1546 1530 538 301 100 90 31266 372 237 11333 --
NM_003220chr661726 1441 1389 1372 1340 529 --31731 1706 1097 --
NM_003221chr6103573 3511 3043 1465 1391 1268 434 137 75 69 14134 1888 --
NM_003222chr2051005 952 845 242 204 --21111 876 --
NM_003234chr382151 2132 1750 1677 797 718 377 246 1257 11757 11848
NM_003242chr382437 2347 2339 1768 1609 986 521 417 22410 314 21934 276 --
NM_003244chr18189 ----179
NM_003246chr1552015 2007 1740 1325 307 21857 1748 ----
NM_003248chr52106 55 ------
NM_003250chr17--1364 ----
NM_003253chr2191887 1631 1585 1418 1392 744 708 500 245 21863 1654 1161 31455 1434 1409
NM_003257chr1551087 1006 373 269 249 31054 1017 999 2413 408 --
NM_003259chr19--1156 ----
NM_003262chr3195198 5003 4361 4323 4159 3910 3356 1995 1974 1524 1338 1302 1166 998 453 351 315 225 209 41890 1780 1451 969 21424 757 23955 159
NM_003269chr621103 452 ------
NM_003272chr12177 111 1249 ----
NM_003274chr2153013 2976 2879 2452 2182 --22747 49 --
NM_003275chr92460 123 --1410 1170
NM_003286chr2071128 1020 965 955 797 408 252 --1873 --
NM_003291chr132698 26 2826 43 ----
NM_003292chr191841 1604 1407 911 860 533 395 217 119 185 --1431
NM_003298chr3146166 5961 5633 5587 4871 4845 4819 3869 3818 1847 1568 1346 1303 1235 36000 5755 296 36176 6031 5137 26083 1930
NM_003300chr14--1177 ----
NM_003304chr351495 1397 1377 290 274 --2477 472 1637
NM_003305chr44350 158 150 112 --1178 --
NM_003314chr51154 ------
NM_003317chr141725 ------
NM_003318chr62242 211 ----1290
NM_003319chr26885 797 778 632 349 265 --2620 256 --
NM_003320chr1164478 4457 1741 1255 1163 1102 24103 4082 24403 474 --
NM_003336chrX61097 1069 918 826 296 284 --191 --
NM_003337chr581725 1673 1449 1408 1368 1217 176 77 21744 379 3590 537 436 --
NM_003338chr1071965 1895 1402 1233 722 399 127 41663 1395 1351 372 1672 1413
NM_003339chr561371 1338 1152 996 604 533 --21053 462 --
NM_003340chr431059 479 49 --2556 119 --
NM_003341chr31512 --1534 1518
NM_003342chr1782700 2376 2364 1145 683 570 544 380 --13009 --
NM_003344chr771687 1485 1158 612 358 113 94 1626 ----
NM_003347chr2231497 1479 220 --21767 283 --
NM_003348chr1261382 1346 687 344 259 62 --71616 487 393 364 359 354 349 --
NM_003349chr2021610 1587 ------
NM_003352chr22907 43 --2788 685 --
NM_003360chr4151 --1194 --
NM_003368chr1--2796 130 --1578
NM_003369chr1172594 822 407 296 224 134 75 ------
NM_003370chr192803 650 ------
NM_003372chrX6784 374 217 107 83 60 --1130 --
NM_003374chr54766 257 144 28 ----1304
NM_003375chr103313 158 137 ------
NM_003376chr641800 1719 316 184 21653 1222 1269 1408
NM_003376chr641800 1719 316 184 21653 1222 1269 1408
NM_003384chr14278 35 1152 ----
NM_003385chr23878 820 195 --11035 1814
NM_003387chr282736 2653 2496 2029 1145 694 636 577 32941 2704 2453 22625 2577 32517 2160 651
NM_003390chr1141112 698 345 127 1838 1992 --
NM_003392chr394233 4135 4080 4073 3341 2862 1727 1192 95 24281 2994 24369 4102 --
NM_003399chrX1791 ------
NM_003403chr143695 173 104 2302 81 ----
NM_003405chr221253 1499 ----
NM_003406chr871850 1820 1797 1447 564 417 152 1244 1653 --
NM_003407chr191495 --1510 1531
NM_003409chr185942 433 270 263 24 ----1555
NM_003410chrX72481 2426 2198 1188 906 458 58 1271 1836 42920 2585 357 286
NM_003411chrY101803 1751 1631 1589 1540 1244 688 660 493 273 21833 679 21358 150 --
NM_003412chr3103006 2993 2933 2363 2286 2208 1943 956 694 352 ----1594
NM_003419chr1951228 989 499 469 274 21210 969 21200 377 --
NM_003423chr1972602 2563 1950 1928 1718 931 51 12532 31943 1607 997 --
NM_003431chr12465 453 ------
NM_003442chr114788 702 258 124 --1146 --
NM_003452chr91882 ------
NM_003453chr133525 223 65 ------
NM_003455chr11----21251 1028 --
NM_003457chr173597 150 102 ------
NM_003463chr662996 2291 1103 875 805 594 --2619 501 43363 2246 2067 1051
NM_003467chr2199 127 ----
NM_003468chr2174350 4325 4270 3718 3307 2920 2818 2740 1468 1443 1256 1091 843 820 650 317 227 --24009 277 --
NM_003469chr21429 ------
NM_003470chr162666 66 1203 3233 132 127 --
NM_003471chr321550 647 22236 907 21871 891 1560
NM_003472chr641492 1271 950 138 2271 239 ----
NM_003473chr1031060 835 824 --1429 --
NM_003474chr1042316 1529 301 128 12389 22203 1918 --
NM_003477chr111567 ------
NM_003478chr11133258 3169 2963 2869 2787 2359 2066 1277 1159 996 662 585 97 --13326 12077
NM_003482chr1232798 1912 835 12308 12561 12237
NM_003483chr1292957 2848 2819 2812 2489 2056 2031 1987 589 42612 1881 885 201 12805 12647
NM_003489chr2193348 3103 2952 2534 2437 1264 729 720 344 1277 22479 357 12676
NM_003496chr73785 667 308 1808 ----
NM_003503chr151321 498 232 119 111 ----159
NM_003505chr751949 1689 1631 1340 258 --21957 1373 --
NM_003506chr881298 1284 1093 486 478 458 326 306 41351 1081 538 395 11314 --
NM_003507chr252010 1988 1632 791 443 --12029 11739
NM_003557chr131652 1562 1475 ----11591
NM_003563chr1721265 489 --1917 --
NM_003566chr12143019 2874 2743 2714 2638 2385 2321 2134 1235 1229 1116 977 458 277 11026 13310 22726 658
NM_003567chr11309 ------
NM_003569chr62130 86 --1121 --
NM_003573chr19--1237 ----
NM_003574chr18185739 5140 5064 4424 4045 1929 1889 1668 1647 1425 1395 1326 1142 1128 776 337 286 252 45364 4052 1679 1562 25375 357 34084 2265 1452
NM_003576chr1372740 1121 817 619 575 375 259 12839 3239 234 229 11005
NM_003579chr1------1144
NM_003582chr1143 1222 ----
NM_003583chr12153938 3814 3656 3396 3345 3054 2531 2524 2470 2424 1120 348 190 136 89 33213 200 167 43902 1382 1296 1245 13161
NM_003590chr2204012 3938 3843 3692 3590 3491 3253 3059 2940 2582 1603 1551 1235 1189 796 718 597 494 394 189 12989 44043 3218 1247 930 --
NM_003597chr272324 2260 2247 2191 2020 1450 888 21509 367 22155 1974 --
NM_003601chr42191 31 ------
NM_003603chr482035 1991 1839 1592 1456 1402 846 527 22137 1387 12154 1797
NM_003607chr1154374 4213 4177 4035 3838 3727 3318 2997 2738 1080 949 847 737 516 268 --54343 4198 3862 2955 959 14063
NM_003608chr141180 ------
NM_003615chr3153821 3669 3394 3372 3313 1597 1265 1216 1179 984 848 834 591 567 413 33831 1333 758 63760 2918 1498 1039 956 344 11238
NM_003618chr241273 468 378 305 21209 224 1995 1114
NM_003620chr173959 335 140 11050 --1862
NM_003622chr1252603 2551 1856 543 280 21778 491 42615 2151 2140 1667 11709
NM_003626chr1151349 1079 436 310 189 --1135 --
NM_003630chr64776 716 614 533 ----2731 302
NM_003631chr10--1664 1947 1977
NM_003642chr2278 72 ------
NM_003655chr171310 ------
NM_003659chr241240 789 245 217 ------
NM_003663chr3133336 3185 2884 2752 2725 2609 1260 1091 852 745 700 595 182 13047 3981 934 833 12445
NM_003668chr121265 --168 --
NM_003670chr361420 1207 1182 1066 487 212 ------
NM_003671chr973513 3317 1349 677 571 379 168 13579 13070 --
NM_003672chr1101989 1946 1869 1797 1362 1266 737 550 451 347 --11545 --
NM_003675chr101396 1423 1155 1461
NM_003676chr15874 764 651 334 39 1726 --1258
NM_003677chr1251889 1757 1550 811 327 --1757 --
NM_003690chr24630 588 426 246 --1528 2217 189
NM_003701chr1321003 833 ------
NM_003702chr81782 --1840 --
NM_003711chr51249 ------
NM_003713chr12634 468 21605 1401 ----
NM_003714chr562450 2291 879 729 694 260 22773 2652 ----
NM_003716chr31135 1881 ----
NM_003718chr74361 117 110 33 1567 1515 --
NM_003722chr382601 2133 1949 1918 1845 1683 1677 189 32594 2558 300 --21776 679
NM_003735chr5--11740 ----
NM_003736chr5--11740 ----
NM_003743chr232074 1463 796 22055 202 ----
NM_003744chr1461337 1162 1153 1101 932 372 1977 180 --
NM_003745chr161345 --1408 1375
NM_003749chr1352194 1797 1614 881 683 22141 1840 11767 --
NM_003750chr103760 667 312 ------
NM_003758chr1561316 1265 1056 581 453 30 --11567 --
NM_003758chr1561316 1265 1056 581 453 30 --11567 --
NM_003759chr4184277 4244 4220 4211 4093 4067 4059 4043 3729 3438 3330 2735 691 625 541 508 480 225 22831 1662 34329 3920 3294 --
NM_003762chr141441 1208 927 326 21293 1186 21430 1419 1936
NM_003763chr2053012 2119 1284 1266 965 11983 ----
NM_003772chr1181229 1122 1058 1028 1021 419 178 74 ----1816
NM_003774chr12153250 3213 3189 2962 2929 2649 2636 2578 2509 2423 2391 1306 1150 839 474 1223 3482 91 86 1664
NM_003783chr161213 471 424 383 364 328 --11041 --
NM_003787chr1871302 1239 1192 1139 538 473 204 1494 --11159
NM_003794chr31173 11057 ----
NM_003796chr196444 433 386 245 182 115 --1622 --
NM_003800chr662273 2020 2012 821 766 570 ------
NM_003809chr171489 ------
NM_003818chr201139 11106 ----
NM_003819chr12267 229 ------
NM_003822chr152627 2466 2449 670 128 --32459 2454 2093 --
NM_003825chr1561488 1307 1300 1291 1028 22 1543 --11009
NM_003829chr941152 1111 252 82 --11194 --
NM_003831chr1861855 1693 1529 1376 386 370 --2430 268 --
NM_003861chr1492543 2059 1940 1853 1097 921 804 619 297 32424 1989 1924 22083 2064 --
NM_003870chr1561891 1797 1494 1435 1377 557 22100 487 ----
NM_003872chr272635 2357 2206 2164 2059 775 666 --1340 --
NM_003873chr1072452 2316 2274 2119 1797 1560 320 ------
NM_003884chr3121867 1812 1793 1708 1249 746 700 452 431 412 214 196 31583 511 500 2417 201 --
NM_003885chr1742664 2155 1928 239 ------
NM_003887chr272200 1683 1482 770 392 376 257 1175 --11710
NM_003895chr2162050 1896 1737 536 444 263 21628 1356 12100 12141
NM_003909chr873028 2898 2625 2179 1093 830 681 --52161 1223 707 702 585 22149 961
NM_003913chr6134307 3752 3681 3264 2850 2722 2656 1148 1107 972 773 654 613 13031 64023 3764 3618 3424 3274 578 1806
NM_003916chrX71274 1172 936 489 388 240 167 --1479 --
NM_003922chr152172 75 ------
NM_003927chr181972 1413 1419 --
NM_003930chr792414 2132 1851 1779 1625 663 423 256 102 12240 2523 134 32479 512 298
NM_003931chr63697 509 49 1519 ----
NM_003932chr2261538 1425 1232 481 230 167 21313 1173 ----
NM_003934chr951284 1264 500 416 338 ------
NM_003941chr7112215 2051 1979 1890 1837 1732 918 908 703 542 452 12373 1930 --
NM_003942chr112703 174 1157 1517 --
NM_003943chr421121 295 ------
NM_003948chr472583 2427 2209 1763 1647 539 331 11717 21755 415 --
NM_003953chr142879 1158 806 626 11110 ----
NM_003958chr6143830 3743 2994 2875 2837 2676 1399 1271 906 900 889 840 689 431 11546 32987 813 780 13359
NM_003966chr5257802 7633 7261 7079 7065 7010 6679 6322 6146 5222 5175 4955 2998 2907 2659 2653 2616 2602 2405 2032 1650 1637 1212 979 340 17144 45984 2086 1620 1026 22022 297
NM_003971chr172516 71 1596 1569 1138
NM_003972chr103446 347 220 2898 391 --21099 322
NM_003980chr661239 1189 1140 1128 418 225 1391 ----
NM_003983chr1683310 1169 893 868 748 665 426 386 --13171 --
NM_003987chr1022023 1470 ------
NM_003988chr1022100 1547 ------
NM_003989chr1021959 1406 ------
NM_003990chr1021959 1406 ------
NM_003993chr11318 3296 74 34 ----
NM_003994chr12183798 3692 3616 3576 3113 2919 2908 2833 2822 2812 1587 1452 1172 1070 378 248 123 80 34352 1325 568 34417 4395 3513 23833 149
NM_003998chr44669 631 455 180 1681 ----
NM_004006chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004007chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004009chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004010chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004011chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004012chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004013chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004014chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004015chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004016chrX92571 2291 2278 2121 2054 1860 1627 833 414 52334 1945 334 260 37 11646 --
NM_004017chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004018chrX92571 2291 2278 2121 2054 1860 1627 833 414 52334 1945 334 260 37 11646 --
NM_004019chrX1113 ------
NM_004020chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_004021chrX92571 2291 2278 2121 2054 1860 1627 833 414 52334 1945 334 260 37 11646 --
NM_004022chrX92571 2291 2278 2121 2054 1860 1627 833 414 52334 1945 334 260 37 11646 --
NM_004023chrX92571 2291 2278 2121 2054 1860 1627 833 414 52334 1945 334 260 37 11646 --
NM_004028chr1893911 3336 3070 3001 2797 940 888 480 280 --22956 250 13447
NM_004034chr101427 --1178 --
NM_004035chr17114968 4915 4269 3379 3369 3272 2030 1743 1685 1048 336 24020 120 22061 1187 13174
NM_004040chr241350 1265 1021 854 --21060 512 --
NM_004047chr1136 ------
NM_004050chr1432723 2685 2592 --22499 1917 --
NM_004056chr85923 875 820 772 427 1837 1854 --
NM_004060chr531195 427 296 ----1890
NM_004067chr731508 1324 431 --11106 11533
NM_004071chr2166 2107 88 ----
NM_004079chr192792 2705 2434 2417 1974 876 763 589 575 32182 1152 818 ----
NM_004081chrY81742 1537 1517 704 612 380 233 57 --21572 697 --
NM_004087chr341463 1353 396 307 1331 ----
NM_004093chr13103183 3143 2774 2721 2647 2479 2114 2070 2015 832 12900 11149 --
NM_004094chr14142927 2788 2597 844 838 810 789 669 590 492 486 462 201 113 1893 22966 1124 --
NM_004096chr1041935 1828 1363 311 --11967 --
NM_004100chr692285 1647 744 695 405 289 217 171 56 133 1520 --
NM_004101chr592094 2025 1997 1546 1452 1413 690 605 456 1666 2446 178 --
NM_004105chr231055 955 189 1423 171 11025
NM_004109chr1192276 2238 2183 1997 276 177 122 114 35 147 1486 22376 730
NM_004113chr361728 1651 737 641 352 155 --1459 --
NM_004124chr1493446 3229 2791 2735 1057 945 813 776 692 --53295 2517 1392 735 601 1187
NM_004133chr871078 993 949 667 544 334 300 42605 2522 2434 977 12613 12585
NM_004136chr1563061 3004 2669 2365 2347 174 12511 23121 271 --
NM_004156chr83611 528 419 127 1424 --
NM_004161chr241508 1334 217 164 --21638 1064 --
NM_004162chr351178 867 503 400 142 11312 11143 --
NM_004163chr181135 ------
NM_004170chr921653 1151 1439 ----
NM_004171chr11119268 7497 6060 3298 3165 2895 2784 1856 1453 996 893 59599 8345 8302 6141 201 18066 1743
NM_004172chr51354 21727 316 1463 12026
NM_004202chrY2570 58 ------
NM_004203chr16136 ------
NM_004215chr85593 456 400 108 85 ------
NM_004225chr84964 604 576 458 2997 465 ----
NM_004229chrX112220 2198 1778 1694 1632 1607 1534 1370 672 434 105 22022 275 21810 1477 1418
NM_004232chr18143799 3526 3427 3273 2621 1559 1518 1141 899 690 511 326 115 30 43512 3209 2852 2524 11312 --
NM_004235chr92640 554 --1894 --
NM_004242chr62370 361 --2142 30 --
NM_004244chr122433 100 ----1500
NM_004253chr93369 327 115 --1784 --
NM_004261chr1--41004 909 248 199 1924 --
NM_004272chr582016 1874 1741 1570 1295 1234 735 171 11266 1724 --
NM_004274chr1462890 2509 2206 2186 1254 697 --22125 581 12100
NM_004277chr651670 1433 1413 1381 1155 --1143 --
NM_004279chr772387 851 705 428 269 235 174 12336 11933 --
NM_004280chr62187 155 ------
NM_004281chr108503 490 435 391 96 79 54 44 ------
NM_004282chr63183 82 62 ------
NM_004286chr2262766 2594 2455 2172 603 274 ------
NM_004293chr9133721 3375 3047 2885 2828 2495 1251 1150 1017 852 783 423 246 --63872 3509 1533 1464 1102 825 --
NM_004302chr1232961 2856 537 --12820 --
NM_004311chr1052980 2783 1945 1000 982 13046 ----
NM_004316chr1241116 840 809 40 11153 --1959
NM_004326chr161041 806 496 450 438 397 --11065 --
NM_004327chr2252084 2048 707 305 220 ------
NM_004329chr1051010 956 398 259 215 2442 201 21192 488 21467 1048
NM_004330chr153972 363 93 1230 1771 3798 264 237
NM_004331chr8112624 2345 1986 892 884 877 575 435 364 213 177 --1154 12638
NM_004337chr862276 1969 1473 758 686 490 --1616 --
NM_004338chr18236749 6702 6614 6589 6182 6154 5973 5378 5369 5307 5128 5087 4978 4921 4524 2737 2693 1556 742 555 467 343 135 35448 1657 376 25576 1054 --
NM_004342chr782320 2028 1934 1739 1449 742 674 115 ----32204 837 419
NM_004349chr851196 992 497 346 316 21240 424 --1974
NM_004354chr45869 705 694 257 214 1587 3860 816 230 1345
NM_004360chr1641785 1726 292 270 22013 146 12021 1162
NM_004364chr191938 --21031 357 --
NM_004365chr5199 1221 1341 --
NM_004370chr62340 251 12131 11587 --
NM_004379chr271547 1461 1317 1302 1274 581 536 --21395 81 11311
NM_004380chr1651893 641 379 360 80 --21843 469 --
NM_004384chr5102251 2157 2075 1973 1821 1697 1475 811 205 195 1374 1764 11567
NM_004385chr52463 153 ------
NM_004386chr1952301 1977 1902 1511 594 1143 ----
NM_004392chr1392464 2141 2111 1774 1744 1034 884 317 43 --12326 --
NM_004393chr382411 2350 2331 891 620 213 207 194 ------
NM_004397chr11123965 3666 3612 3535 3430 3385 3240 1731 1160 844 97 79 ----23700 995
NM_004404chr292061 2024 1774 1631 1416 513 373 161 120 1635 1583 --
NM_004411chr73715 690 38 1212 --1277
NM_004415chr64756 656 644 173 --158 --
NM_004430chr872802 2610 2513 2237 1109 1036 268 32789 2324 2102 32775 2291 1833 --
NM_004432chr9112267 2256 1914 1907 1692 731 494 424 356 194 155 42410 844 667 90 --21624 70
NM_004433chr131322 689 259 ----1236
NM_004434chr1431847 1776 1183 11897 21914 1521 --
NM_004436chr11562 ------
NM_004438chr273216 3137 2774 1306 1138 718 58 13256 ----
NM_004440chr661927 1871 1837 1669 1462 1273 31974 1571 1341 31588 607 451 --
NM_004442chr121748 606 11129 --11105
NM_004447chr1251049 905 235 176 56 --2846 273 --
NM_004449chr2171279 1018 956 937 422 323 109 11176 11475 --
NM_004451chr111696 ------
NM_004457chr23625 283 217 21096 611 11393 11172
NM_004458chrX152634 2523 2257 2202 1837 1750 1641 1070 1064 957 696 458 168 75 66 12141 11018 --
NM_004459chr1751852 1461 423 126 60 --21640 257 --
NM_004462chr82100 82 1666 ----
NM_004463chrX1214 --1520 --
NM_004464chr4204209 3606 3239 3216 2952 2915 2770 2763 1725 1622 1453 1369 898 640 598 589 476 469 356 244 32849 1193 189 33874 944 504 1271
NM_004469chrX2402 105 ------
NM_004480chr142724 266 1535 --1758
NM_004482chr23936 607 142 1724 --1900
NM_004483chr16--1493 ----
NM_004492chr153257 174 78 ------
NM_004496chr1461359 1316 1257 1217 1055 126 --1177 --
NM_004499chr53465 415 42 ----1372
NM_004500chr1452039 1283 691 287 254 11411 31300 726 704 11575
NM_004501chr1134008 4001 3951 3706 3382 3120 3070 2873 1542 1062 332 289 134 31108 902 317 44145 3626 3501 259 22969 1376
NM_004503chr121582 ------
NM_004504chr2133031 2997 2914 2873 2470 2244 2178 965 479 433 337 97 35 22560 739 22786 1165 --
NM_004505chr1751859 1696 1671 1327 437 --1108 11597
NM_004514chr1763102 3094 2817 2038 957 838 --2849 669 --
NM_004516chr1971268 1159 804 381 369 324 176 11217 1341 --
NM_004520chr54714 557 271 93 1761 ----
NM_004523chr1031401 146 89 1549 125 1475
NM_004525chr221491 1030 --31550 1433 92 --
NM_004535chr2031182 612 349 11346 --11196
NM_004537chr1231214 1165 164 11452 11577 --
NM_004561chr1151833 1689 1537 692 682 ----11839
NM_004563chr141161 ------
NM_004569chr143715 572 216 1651 ----
NM_004571chr2162928 2120 1022 875 63 52 2612 80 22164 1160 --
NM_004575chr4101607 1598 1515 1216 1171 555 500 445 400 357 ------
NM_004580chr1541826 1667 1509 631 1175 1528 --
NM_004582chr12123 43 --1171 --
NM_004586chrX135302 4882 4370 4222 3993 3946 3928 3701 1865 1113 823 359 166 25142 326 14105 13713
NM_004600chr151515 1475 1010 616 282 1475 31276 1198 602 --
NM_004602chr2031432 966 931 ----21505 1453
NM_004607chr52221 51 --1243 1191
NM_004612chr9194734 4363 4082 3950 3853 3720 3449 3349 3184 1847 1615 1325 1093 995 932 456 298 252 245 11280 --11681
NM_004615chrX1777 ------
NM_004619chr132106 2070 170 31719 435 231 1380 --
NM_004622chr252195 1552 916 490 111 ----1471
NM_004627chr211519 --1147 1687
NM_004631chr151275 1259 1211 512 430 21450 223 ----
NM_004643chr141746 ------
NM_004654chrY71207 1088 1038 988 862 440 27 11383 ----
NM_004655chr1741391 1256 1133 422 --11246 11403
NM_004660chrY82333 2189 1695 446 338 321 315 245 --11640 11540
NM_004663chr1531477 144 97 1152 21534 1470 11528
NM_004666chr651059 1018 348 119 25 --2399 184 --
NM_004667chr152692 446 ------
NM_004670chr1061716 1275 505 305 102 58 2112 74 31304 1205 598 --
NM_004673chr181577 1443 1222 1129 1068 301 217 127 --1412 140
NM_004685chr1392986 2874 2805 2720 2554 1960 859 172 102 2813 409 12384 --
NM_004687chr1721761 28 --11771 11374
NM_004689chr142345 331 --1339 --
NM_004694chr174710 649 632 118 1555 ----
NM_004703chr173710 394 33 11569 31923 1630 540 2948 470
NM_004709chrX71707 1340 1208 1142 300 80 25 11646 --11278
NM_004717chr721164 306 --31377 1368 993 --
NM_004719chr12112443 2420 2170 1884 1834 807 734 723 705 657 410 22613 2184 --11081
NM_004721chr31297 --1246 1307
NM_004722chr71213 ------
NM_004723chr11248 1725 ----
NM_004725chr1041388 1259 1022 106 --21368 1090 --
NM_004726chrX175732 5559 5428 5378 5047 4660 4372 4311 3765 3560 2311 1520 1349 1309 998 990 820 --22210 1820 --
NM_004727chr1541785 1748 1563 1406 ------
NM_004730chr571940 1498 1448 1350 356 236 181 1742 1306 --
NM_004731chr1261687 1315 603 399 274 150 1384 139 --
NM_004733chr33593 536 98 --1489 --
NM_004734chr1323002 517 1254 23142 453 --
NM_004736chr192156 1865 1815 1423 1405 844 797 791 196 --21951 1472 --
NM_004741chr102446 134 1422 --1312
NM_004744chr4203977 3881 3661 3532 3517 3422 2819 1529 1456 1439 1426 1167 859 732 712 671 579 540 453 383 --22812 400 13941
NM_004745chr8146969 6897 6862 6837 6655 6506 5580 4818 4466 2080 2073 1829 1574 822 1355 46481 5744 5550 1550 --
NM_004747chr1061620 1402 1249 1224 643 221 21286 149 11278 11599
NM_004748chr15183873 3521 2987 2937 2847 2719 1670 1306 1126 987 542 358 312 235 197 171 76 27 64183 3331 2944 2784 1352 559 22826 1045 43926 3909 3701 3416
NM_004755chr1461142 1098 1053 849 71 39 --1465 41120 881 788 757
NM_004760chr741626 456 433 166 1547 1132 11919
NM_004764chr124609 535 65 45 --2199 135 2193 172
NM_004772chr541580 1571 617 130 11253 1456 --
NM_004774chr17113077 2969 2592 1148 807 609 600 578 506 378 218 1624 1461 --
NM_004775chr18132133 1951 1853 1789 1770 1619 922 802 618 571 445 421 316 32124 433 279 ----
NM_004776chr20103277 2702 2638 2393 2325 2271 1225 831 776 25 ------
NM_004779chr531222 1164 165 ------
NM_004787chr41125 ------
NM_004788chr1162340 2098 1941 1851 1725 799 1394 12483 1903
NM_004789chr95441 339 327 110 73 ------
NM_004791chr133765 706 572 ------
NM_004792chr2274 41 ------
NM_004795chr1351861 1707 1689 1679 1448 11281 21641 1495 1634
NM_004796chr1472329 2097 1924 1640 1589 1520 916 11901 22280 580 --
NM_004800chr13186 ------
NM_004801chr241420 974 260 86 --148 --
NM_004804chr262396 2071 1957 1799 971 57 ----1383
NM_004815chr1114304 3941 1853 1841 1587 1183 1128 752 709 609 443 24369 1418 31613 1402 921 3804 759 476
NM_004821chr53675 528 505 --1533 --
NM_004824chr661333 1075 922 339 207 180 11433 1966 1227
NM_004830chr63592 344 129 1787 1836 1811
NM_004831chr1931043 862 708 ------
NM_004834chr283198 3185 2715 2681 2201 1177 1078 391 --1823 --
NM_004835chr33866 328 278 --1883 --
NM_004835chr33866 328 278 --1883 --
NM_004836chr25878 849 643 223 216 3340 259 131 ----
NM_004837chr151610 1446 542 332 39 --11676 --
NM_004840chrX42419 2121 2085 1712 12475 1957 --
NM_004841chr11309 --11120 --
NM_004842chr661715 1481 1227 593 513 274 11401 1375 11108
NM_004845chrX53738 2943 1172 634 590 --22545 1137 11047
NM_004846chr2----1122 --
NM_004849chr661713 1536 1132 565 381 176 --11111 --
NM_004850chr251545 1288 1222 1172 1076 41463 1432 1370 536 1528 --
NM_004855chr151192 ------
NM_004856chr154530 464 381 106 1424 ----
NM_004857chr1494162 3981 3746 3419 3054 1837 1805 1433 670 34646 3924 55 34220 4023 3462 13502
NM_004859chr17103000 2885 2638 2057 1188 1164 421 230 192 109 1983 ----
NM_004863chr14144693 3957 3726 3622 3328 2045 2015 1844 1551 1360 1209 1141 230 60 11321 24633 260 --
NM_004865chr63345 300 111 --1155 --
NM_004866chr5234891 4701 4133 4054 3871 3815 3766 3748 3674 3664 3621 3279 3170 1950 1795 1653 1508 1392 1280 869 454 167 76 14037 44478 3880 3239 1783 13829
NM_004867chrX4695 175 123 59 ------
NM_004869chr18101699 1565 1545 1411 1369 1322 1312 642 492 303 1145 --1376
NM_004871chr1764139 4026 3440 3193 1746 1619 --24334 3128 14294
NM_004873chr1473203 3016 2940 2745 2449 2209 292 --22950 2784 --
NM_004874chr82465 167 ----1131
NM_004883chr51154 1201 ----
NM_004887chr52269 61 1354 --1194
NM_004896chr1071458 1343 1318 1218 991 260 132 --41257 604 226 156 --
NM_004897chr101910 3842 784 97 ----
NM_004898chr472737 2592 2028 1132 1102 924 760 --11990 --
NM_004904chr7196276 5811 5754 5394 4965 4957 4818 4684 4535 4262 2553 2536 2382 2283 2255 2052 1908 1508 671 86301 4703 2033 1928 1024 950 159 132 --25739 4058
NM_004906chr65695 609 473 227 139 2273 23 ----
NM_004912chr751607 1178 1144 1086 125 41379 1185 578 483 ----
NM_004915chr214823 550 261 205 --1610 --
NM_004926chr1461788 1570 1466 1449 1369 1262 --21389 390 1243
NM_004929chr841235 511 400 242 189 ----
NM_004932chr561704 1340 1308 391 194 169 2717 62 ----
NM_004938chr931052 434 233 21246 465 ----
NM_004946chr52424 334 1436 1399 --
NM_004947chr362548 2496 1938 338 259 214 ------
NM_004948chr1841249 1048 1031 484 1427 2918 316 --
NM_004949chr18122109 2092 1756 1623 1581 1514 1478 1464 1361 782 586 245 --1685 11404
NM_004953chr31307 ------
NM_004954chr111292 ------
NM_004956chr754274 3441 1272 579 77 44353 4256 3813 590 53891 3665 365 178 102 --
NM_004965chr214683 656 484 69 1305 1512 --
NM_004966chr103950 693 677 11000 ----
NM_004967chr42499 463 1340 ----
NM_004969chr104581 515 220 81 1560 ----
NM_004972chr9--154 21129 732 --
NM_004985chr12134267 4141 3324 3286 3276 3005 2865 1457 1405 884 809 369 148 23558 791 23620 2812 --
NM_004987chr22272 125 --1372 --
NM_004992chrX78377 8302 7042 5438 5374 2755 1373 15480 12948 11193
NM_004992chrX78377 8302 7042 5438 5374 2755 1373 15480 12948 11193
NM_004993chr1441009 978 965 75 --21488 983 --
NM_004996chr16----11782 --
NM_004999chr6124305 3866 3666 3441 3405 2986 2789 1628 1198 1102 1066 1051 2997 700 1123 1474
NM_005011chr741755 1737 1708 97 21611 1587 ----
NM_005013chr11198 ------
NM_005014chr94853 819 769 722 ------
NM_005020chr71439 --1417 --
NM_005022chr17----179 --
NM_005028chr1072288 2204 2082 1865 1690 270 164 --21797 211 --
NM_005032chrX31006 934 248 ------
NM_005037chr3----1134 --
NM_005045chr71681 --1327 --
NM_005052chr17------1353
NM_005054chr2121762 1701 1605 1599 1341 1334 1091 674 588 463 407 182 ----11532
NM_005056chr1285614 4663 3871 2218 1932 1678 1560 1016 34120 1588 893 ----
NM_005057chr1101693 1650 1332 1243 766 725 469 274 85 34 --1139 --
NM_005063chr1033769 772 174 13560 1247 --
NM_005065chr14135258 4886 4327 4286 4189 3541 1832 1756 1128 931 683 577 161 45106 2017 1580 1144 11333 --
NM_005066chr15697 211 203 98 77 ------
NM_005067chr32619 76 2920 66 ----
NM_005076chr132820 1272 125 ----1162
NM_005078chr1511565 21867 1553 ----
NM_005086chr1291704 1642 1473 1405 1337 661 489 139 73 1132 21392 313 --
NM_005093chr2075254 5247 4207 1968 1215 916 688 ----14214
NM_005095chr151437 879 392 373 325 --22099 1807 --
NM_005102chr23700 608 320 1157 1776 --
NM_005109chr351910 722 513 133 122 1486 --12545
NM_005113chr141419 2474 381 1106 1438
NM_005116chr2094506 4439 4381 4375 4337 3278 3194 1377 900 13064 44565 3498 3477 2801 --
NM_005119chr161216 1004 899 499 417 243 1912 ----
NM_005121chr17113411 3269 2854 2597 2326 1493 1484 1350 1139 1008 537 1498 13629 22565 807
NM_005123chr12171 --1327 --
NM_005124chr63961 325 29 2933 311 4776 649 233 73 --
NM_005125chr111152 ------
NM_005126chr342118 1638 859 371 22043 1912 42192 1523 1434 877 --
NM_005131chr18122 1102 ----
NM_005132chr141155 ------
NM_005134chr182362 211 ------
NM_005151chr18132186 2093 2042 1880 1865 1752 1652 1578 916 659 569 260 75 1672 21911 1780 --
NM_005153chr162536 228 --1632 --
NM_005156chr9134308 4246 3971 3800 3456 2019 1611 1555 1448 1220 1191 821 134 35088 4036 858 33471 3466 750 --
NM_005157chr931777 1596 1532 11806 21559 233 --
NM_005160chr22196772 5949 5906 5646 5562 5456 5101 5089 4972 4945 4854 4514 1496 1382 1246 1062 937 281 227 25205 2211 26340 4303 25580 4935
NM_005164chr12122460 2444 2170 2081 1022 976 821 682 642 606 400 128 2508 120 --1897
NM_005168chr251787 1541 1109 699 373 --21484 561 --
NM_005171chr1231085 816 99 61135 1052 1039 1010 208 69 1969 1906
NM_005180chr1091603 1576 1491 1173 1149 1058 628 421 30 --11135 --
NM_005186chr111593 1581 ----
NM_005188chr11178201 8183 8071 7919 7819 7608 7226 6182 5950 5810 5463 5441 2686 2168 1833 716 189 23338 1559 38213 2777 197 --
NM_005190chr63774 439 316 1806 1131 --
NM_005192chr141132 ------
NM_005194chr202147 103 --1156 --
NM_005197chr1485047 4921 4660 4449 2259 1313 173 144 14811 1195 --
NM_005203chr101399 159 ----
NM_005204chr103385 305 293 1833 --1618
NM_005207chr2273709 3058 1151 1013 915 212 30 12510 23251 1120 --
NM_005214chr22421 85 --1412 --
NM_005222chr72927 697 ----1946
NM_005224chr192463 451 --1631 --
NM_005227chr1--1510 ----
NM_005230chr122218 157 2617 235 ----
NM_005231chr1131293 252 238 21323 152 --11118
NM_005233chr362497 2209 661 515 355 165 32597 2301 397 12171 --
NM_005235chr2207665 7296 7127 6977 6702 6622 6346 6305 6286 6151 5918 4927 3075 2970 2074 1960 794 769 705 338 47219 4988 2890 681 35605 1540 1102 22906 1572
NM_005238chr11103558 3485 2968 2840 2826 2663 2633 1169 668 95 13528 1578 --
NM_005239chr2141913 1305 815 585 11546 --1798
NM_005241chr321242 469 11328 21114 858 --
NM_005242chr571282 1169 1112 1098 1053 601 353 --11471 11431
NM_005245chr42313 31 1700 ----
NM_005249chr142701 88 ------
NM_005252chr142685 633 --2690 489 --
NM_005254chr15101401 1257 1250 1234 914 900 476 309 166 27 2526 468 1965 --
NM_005256chr114976 737 359 227 1919 ----
NM_005257chr1861258 1196 974 931 527 122 31381 1310 905 ----
NM_005259chr261387 1287 1006 998 331 207 ----21393 1174
NM_005261chr85919 857 712 705 367 1825 1977 --
NM_005264chr103848 364 241 ------
NM_005271chr103841 393 265 ----31208 995 467
NM_005273chr72324 312 ------
NM_005277chr461798 1610 1500 1223 621 149 31838 1468 385 11955 --
NM_005279chr24811 748 715 38 ------
NM_005281chr13713 626 331 ------
NM_005292chr131130 ------
NM_005295chr72310 96 ------
NM_005296chrX4853 410 289 148 --1415 --
NM_005302chr71143 --1458 1362
NM_005316chr1121111 293 11157 ----
NM_005318chr2231280 1272 954 11266 --1120
NM_005328chr85780 765 561 304 232 ------
NM_005333chrX21243 430 ----1879
NM_005336chr232217 1939 611 ----22283 380
NM_005339chr4104010 3519 1724 1158 1124 1065 996 497 282 213 11707 33321 1270 807 --
NM_005342chrX52172 1862 961 333 283 --12717 --
NM_005347chr921133 397 ----11415
NM_005358chr1341724 1613 1508 1171 21678 1214 21312 346 --
NM_005359chr18206463 6079 5479 5438 5356 4945 4875 4183 2396 1980 1969 1923 1521 1436 618 501 486 379 322 101 21936 1143 25896 5424 11204
NM_005375chr631188 851 303 1965 --1783
NM_005385chr352223 878 292 206 195 --1686 --
NM_005387chr116680 483 465 231 82 66 1589 ----
NM_005388chr951695 1355 451 113 75 51627 1293 1057 678 102 ----
NM_005391chrX----1134 --
NM_005392chr971813 1490 1397 1355 1340 1195 273 11465 11749 --
NM_005397chr763213 3025 3010 2923 2892 1501 13676 --1272
NM_005398chr1031463 1322 75 1235 ----
NM_005399chr1184436 4333 4216 3829 3811 3765 3295 3144 3090 2838 2814 1732 1215 974 873 647 195 173 --1735 13032
NM_005400chr292987 2952 2921 2835 2275 1973 1937 660 23 --12776 --
NM_005402chr751729 534 371 163 93 ----1363
NM_005406chr183617 501 174 ----11128
NM_005410chr55753 511 269 190 147 2584 65 1155 --
NM_005412chr121345 ------
NM_005433chr1862811 2431 2233 1991 1920 853 12619 --12474
NM_005436chr10104089 3685 3451 3330 3096 1436 1241 1159 915 710 43000 2749 2605 366 11326 13288
NM_005437chr1081397 1135 1062 1012 580 273 240 82 11260 ----
NM_005445chr102326 236 2301 129 1279 --
NM_005455chr1121685 1520 1417 1371 1186 669 660 532 463 376 284 36 ------
NM_005461chr2071947 1869 1576 1239 707 592 363 ------
NM_005465chr131999 1784 267 ------
NM_005475chr1293229 3217 2857 2834 2500 2025 912 574 516 ------
NM_005476chr951381 1304 434 225 117 ------
NM_005479chr1061543 1487 441 410 222 200 21390 1246 --11549
NM_005484chr14----184 --
NM_005487chr2252047 2008 858 340 176 32035 530 112 1192 --
NM_005496chr32804 126 --1689 --
NM_005497chr17145504 5162 4260 3928 3768 1989 1957 1554 1276 1263 985 611 463 228 41491 1208 1087 382 44045 1408 1388 439 --
NM_005502chr9113086 3056 2870 2726 2319 2270 2185 2099 2041 1150 1059 21103 195 --13230
NM_005504chr12136575 6481 6370 5560 5532 4694 1580 1374 860 806 782 433 278 56315 1838 1452 736 690 35615 4266 1702 25567 2170
NM_005509chr571884 1811 1733 1519 1469 1258 403 1113 21366 123 --
NM_005513chr351404 1306 1109 230 154 11595 --11498
NM_005517chr141284 343 283 65 176 ----
NM_005519chr101543 ------
NM_005520chr51489 ------
NM_005521chr10----1270 1823
NM_005530chr1531451 289 210 ------
NM_005537chr133339 214 68 --1367 --
NM_005539chr1031186 1178 919 1567 ----
NM_005540chr181594 1227 442 276 266 259 235 22 ------
NM_005542chr751949 1548 1480 1450 1403 --11627 --
NM_005561chr133831 825 699 ------
NM_005563chr12636 100 --2885 75 --
NM_005565chr52557 127 1434 ----
NM_005570chr1831174 1129 174 21121 788 ----
NM_005573chr52588 103 193 1191 --
NM_005575chr55837 812 757 553 263 1717 1773 --
NM_005576chr151229 1237 --1184
NM_005578chr3144897 4462 4453 4416 4042 3891 1760 1677 1491 1298 1286 1247 1007 214 24971 496 --13559
NM_005585chr15--2323 144 ----
NM_005587chr154973 948 798 385 ----1816
NM_005593chr122412 203 --1554 1146
NM_005596chr9156234 6082 6029 5557 5501 4784 4349 2093 1679 1606 1588 1424 456 409 356 15083 14267 1575
NM_005599chr151438 1396 1222 413 328 11477 --11067
NM_005600chr1------1218
NM_005602chr321226 904 1946 21297 1009 --
NM_005603chr1861940 1736 1515 542 243 51 1130 21393 72 --
NM_005604chr682410 2283 1768 1714 854 726 636 105 11866 32557 2478 1010 --
NM_005610chr1126 --189 --
NM_005611chr1641102 1030 873 178 ----11308
NM_005613chr1194 11538 22026 1913 --
NM_005614chr72419 197 --21082 256 --
NM_005618chr6--1493 1659 --
NM_005625chr841111 960 376 320 1279 11042 --
NM_005627chr63899 698 206 --133 --
NM_005637chr1841620 632 177 155 31415 723 323 22046 775 --
NM_005638chrX41768 1522 1290 163 ----1359
NM_005639chr1221799 380 11244 ----
NM_005647chrX93268 3127 2522 1077 1040 1025 924 905 548 --23105 2157 1512
NM_005650chr2231384 1325 1160 11108 1377 --
NM_005651chr4151 1303 1337 --
NM_005655chr871096 947 921 491 320 236 34 --1814 11317
NM_005657chr153133 118 25 ------
NM_005662chr81110 ------
NM_005665chr1144883 4692 4194 3697 3401 3374 1271 1194 972 893 837 492 170 149 14472 23729 382 44956 3237 1088 909
NM_005667chr22436 286 123 ----
NM_005668chr5134604 4392 4188 4144 3236 3228 3067 3044 2839 1757 973 611 196 11426 43956 2824 1266 504 14206
NM_005669chr581727 920 869 604 376 322 187 87 1714 11652 21670 407
NM_005688chr321196 1079 1289 1108 1363
NM_005700chr11------1374
NM_005707chr1521332 923 11200 ----
NM_005708chr132450 34 ------
NM_005711chr531029 932 779 1317 2200 195 1960
NM_005713chr5130 ------
NM_005715chr662548 2036 1018 165 53 27 --32671 1866 179 11747
NM_005721chr221082 143 2833 394 ----
NM_005722chr2132079 1895 1752 668 614 495 376 352 298 245 155 131 51 1975 1655 12073
NM_005724chr151217 1612 ----
NM_005725chr182445 1937 1815 1721 1690 863 798 346 32255 537 242 --12124
NM_005733chr54256 189 83 77 ------
NM_005737chr262424 2291 2257 1789 1057 725 12919 ----
NM_005738chr7102068 1651 1644 1404 1355 1334 1290 609 312 119 21976 391 ----
NM_005739chr1552412 2211 111 98 83 11922 31728 473 395 --
NM_005742chr21571 --1833 --
NM_005746chr7102505 2148 1893 1062 1003 888 795 445 345 77 22554 291 --1751
NM_005748chr12163482 2901 2895 2710 2648 2429 2400 2393 1187 1140 978 876 858 847 832 606 32257 712 351 1159 --
NM_005749chr171197 1268 --1181
NM_005751chr7133 --1462 --
NM_005752chr1661189 1180 1110 991 823 800 ------
NM_005754chr591237 1192 1107 1094 1040 863 279 222 127 --1913 --
NM_005756chrX2392 56 1488 199 1224
NM_005759chr2124520 4315 3640 3611 3561 3553 3322 1394 1330 969 703 243 --44303 3440 3131 2985 11810
NM_005765chrX5825 729 130 96 77 ------
NM_005766chr132403 374 11022 ----
NM_005767chr131117 1322 ----
NM_005776chr145708 695 619 204 117 ------
NM_005779chr552986 2784 2745 1397 638 13210 ----
NM_005782chr172223 110 ------
NM_005786chr183946 213 95 21004 967 --11017
NM_005791chr2--165 ----
NM_005795chr262554 2525 2036 1179 1098 462 22412 2242 32583 1202 946 32272 952 855
NM_005798chr13165191 5161 5080 5026 4910 4624 4341 4301 4029 3985 3736 3679 3639 3617 3337 934 --55115 5044 4742 4008 3372 24989 3884
NM_005802chr94660 607 285 124 1532 --1739
NM_005806chr2151344 1261 826 268 237 11193 ----
NM_005807chr13748 510 474 --171 --
NM_005808chr3103350 3136 2401 2379 1228 729 475 419 218 175 ----1751
NM_005813chr262545 2165 1695 1050 879 274 42195 317 217 74 139 12662
NM_005822chr662309 2294 879 411 270 40 1827 ----
NM_005826chr13263 244 165 ------
NM_005828chr17104885 4561 3888 3373 1817 1728 546 524 511 472 24837 3419 21804 1641 25076 480
NM_005832chr381335 1204 1151 1045 1003 936 566 172 ----11086
NM_005836chr8141 ------
NM_005839chr14865 289 231 83 --131 --
NM_005840chrX187060 5984 5686 5203 5073 4727 4663 2928 2825 2370 2329 2041 1625 1198 764 736 488 235 56846 5868 5816 4745 1037 26717 3015 21935 1000
NM_005841chr411029 --21068 967 --
NM_005842chr135696 665 637 581 514 ----1646
NM_005843chr251966 1775 1758 522 439 --11604 --
NM_005845chr1351547 1382 342 184 87 --21138 616 --
NM_005850chr11168 ------
NM_005857chr181406 1392 1081 983 286 223 158 146 --1997 --
NM_005859chr561562 1427 1024 1005 491 470 --1223 --
NM_005862chr36991 969 678 432 340 291 --1384 1753
NM_005863chr1051246 578 526 472 418 1544 --198
NM_005868chr7112438 2217 2033 1926 1566 835 773 699 478 198 58 --31894 1685 666 21908 142
NM_005871chr1031084 53 38 ------
NM_005876chr21733 ------
NM_005880chr1691602 1532 1362 1316 381 331 318 297 183 11074 ----
NM_005884chr19------1659
NM_005885chr511585 11545 31257 544 317 --
NM_005886chr16----1282 --
NM_005888chr122385 347 173 ----
NM_005895chr1274109 4025 3200 3183 581 540 424 --31052 989 449 --
NM_005896chr24826 751 216 183 1761 1221 --
NM_005898chr1183094 3036 2637 2458 2294 2265 347 284 12768 22979 1218 --
NM_005899chr1761317 352 311 253 195 50 11515 11206 --
NM_005900chr481234 1170 1113 990 790 462 409 354 --1267 --
NM_005901chr18238514 8445 8423 8417 8368 7740 6934 6677 6441 6277 6160 6142 3471 3254 3245 3142 2887 2870 1735 1290 1062 871 230 98592 7124 6899 6712 6467 6222 3167 2102 419 35537 2777 2341 18265
NM_005902chr1583676 3634 3173 3083 2882 1584 718 226 24519 4013 21486 972 14471
NM_005903chr5235236 4933 4841 4751 4397 4284 3982 3845 3821 3815 3689 1887 1775 1333 1284 1091 857 844 517 433 303 62 51 13657 35204 1969 284 23347 748
NM_005904chr1841373 1119 413 56 11308 11261 --
NM_005906chr661452 1355 1335 543 391 154 ----11470
NM_005907chr6101649 1630 1597 1410 1114 1075 377 189 138 90 ------
NM_005909chr564230 3724 3234 3053 2640 1296 --138 --
NM_005922chr61505 ------
NM_005923chr63278 262 105 ------
NM_005930chr144693 611 306 283 1254 2357 187 --
NM_005935chr4155084 5047 4820 4759 4565 4008 3750 3714 3571 3336 2056 1536 1461 1427 1400 ----11100
NM_005937chr1793849 3653 3294 2785 936 693 448 424 222 14110 13798 --
NM_005941chr8123685 3135 2680 2605 2571 1679 1406 974 534 454 233 223 1719 43616 3301 1282 1254 --
NM_005955chr195471 5269 4719 3667 3587 3434 377 166 141 14067 24367 3598 13503
NM_005962chr10122332 2232 1697 1684 1585 1553 1525 1479 893 824 536 397 --11590 11472
NM_005962chr10122332 2232 1697 1684 1585 1553 1525 1479 893 824 536 397 --11590 11472
NM_005964chr1721398 1340 1187 --1274
NM_005966chr262186 2126 1957 1603 1585 387 11634 32336 1728 412 2936 254
NM_005967chr12----1746 --
NM_005977chr134664 419 346 252 ------
NM_005986chr1362416 2056 2050 1888 845 832 --2666 594 12198
NM_005989chr741526 1116 614 159 --21391 1074 --
NM_005996chr1231577 977 521 --157 1476
NM_005999chr141519 579 310 251 1265 21169 87 --
NM_006007chr9134169 3534 3225 3080 3069 1790 1716 1567 1330 1027 832 143 37 11211 21363 31 14400
NM_006010chr31230 ------
NM_006011chr1584260 3727 3274 3243 1331 716 323 113 --14145 --
NM_006016chr672202 2076 1590 1516 1436 363 234 --1798 11492
NM_006024chr76611 589 247 216 191 139 --1599 --
NM_006033chr1851972 1831 1549 1502 811 21609 1469 --11962
NM_006036chr292531 2508 1956 1776 1626 927 892 882 404 11582 22015 551 --
NM_006037chr2154305 4259 4100 3888 3590 3574 1711 1587 1579 1435 1118 1082 975 897 685 11504 34372 3493 3373 23699 3178
NM_006041chr17------187
NM_006047chr20123426 3350 3265 2857 2766 1022 752 680 578 521 452 434 42991 2586 2324 312 53041 2675 2662 2213 2199 --
NM_006051chr5162 ----1279
NM_006055chr2102988 2913 2809 2284 1114 988 897 855 785 208 12354 13226 12228
NM_006060chr753601 3391 1028 942 191 13547 ----
NM_006067chr1621070 417 3894 806 314 1866 --
NM_006070chr32117 70 ------
NM_006073chr6112195 2163 2043 1966 1511 874 821 615 517 39 31 --32101 497 492 --
NM_006078chr222279 192 ------
NM_006079chr62843 688 ------
NM_006080chr762446 2032 1869 1039 881 237 12303 42628 2458 785 636 --
NM_006083chr5----1110 --
NM_006089chrX111907 1734 1610 1561 1541 1263 1251 1213 579 274 55 1360 51601 1257 703 157 117 11548
NM_006090chr12128 121 --2648 632 --
NM_006095chr4134530 4486 4151 4088 4012 3874 3575 3565 2822 1769 1218 1200 729 24398 230 --13069
NM_006099chr12874 866 ------
NM_006100chr3142 ------
NM_006106chr11123356 3281 2971 2747 2676 2521 2313 1236 424 341 232 133 43292 1320 1033 925 23193 598 22790 2387
NM_006113chr131971 1850 372 21622 679 42068 1989 1778 782 22126 1655
NM_006114chr191471 ------
NM_006136chr751259 1217 909 305 29 --21227 1222 --
NM_006139chr252295 2203 862 591 373 --1797 --
NM_006141chr16132555 2517 2153 2064 1959 1952 1940 1927 1920 860 830 199 122 --22328 2284 --
NM_006148chr171725 22830 2684 12629 --
NM_006153chr33631 220 139 ------
NM_006154chr1582906 2765 2669 2041 798 573 469 264 32393 1000 45 --12012
NM_006155chr292061 2024 1774 1631 1416 513 373 161 120 1635 1583 --
NM_006157chr111382 ------
NM_006158chr871751 1423 1404 693 641 543 176 11527 ----
NM_006160chr1741568 1392 550 412 ------
NM_006164chr22439 147 2402 368 --190
NM_006166chr12122434 2404 2338 2097 2070 1978 1849 1674 889 437 208 189 32650 863 103 ----
NM_006167chr852131 1803 815 688 611 --12408 1293
NM_006183chr123538 407 386 ------
NM_006186chr251277 1131 1083 1071 283 11164 ----
NM_006187chr1232962 927 861 --21163 749 --
NM_006194chr1471317 1302 534 482 319 207 143 --21078 883 --
NM_006195chr93985 286 102 --2263 214 --
NM_006196chr2----2247 123 --
NM_006197chr872241 1974 1772 1759 1641 786 371 32222 738 363 12163 --
NM_006202chr1941937 1771 698 255 --1241 --
NM_006203chr5195357 4635 4421 4320 4125 4117 3588 3541 3476 1983 1655 1231 982 888 877 826 744 599 349 45387 4557 1287 804 64295 4290 4285 4280 1932 846 --
NM_006204chr102230 37 ------
NM_006206chr442787 2488 1833 825 12943 3285 185 69 --
NM_006207chr8173 1250 --1270
NM_006209chr82353 105 151 ----
NM_006211chr8179 ------
NM_006212chr1115077 4970 4913 4789 4698 4623 4279 3899 2082 1503 835 34597 3389 1357 ----
NM_006223chrX--130 ----
NM_006237chr1372250 1623 1577 1489 731 511 502 --12012 --
NM_006241chr392401 2222 1930 1508 568 462 303 297 205 ------
NM_006242chr2052164 2141 1858 846 632 11567 11436 --
NM_006244chr111495 ------
NM_006246chr143218 111 92 11270 --11343
NM_006251chr5122812 2679 2459 2444 2413 2232 2201 1144 921 869 863 502 1402 53215 2736 2715 1178 526 23008 276
NM_006252chr1227044 7014 5387 5363 4897 4789 4674 2751 2729 2679 2234 2200 1390 1341 1246 1165 1011 909 650 432 403 63 47301 6467 6438 4741 45721 4815 2906 2720 16391
NM_006253chr122901 814 11057 --11287
NM_006256chr1152755 2590 2455 2415 2362 2229 2143 2125 1853 1790 1119 1098 1019 620 118 32152 388 322 --32210 607 574
NM_006257chr102968 149 ------
NM_006258chr1021448 610 --21532 553 --
NM_006264chr43401 214 186 ----2574 370
NM_006265chr851431 1349 1001 324 249 --11078 --
NM_006267chr291792 1780 1756 1656 1647 1550 640 406 322 --21858 1216 1563
NM_006275chr2072513 2448 2422 667 407 353 217 2446 200 11756 1225
NM_006281chr84829 427 354 336 --1932 --
NM_006281chr84829 427 354 336 --1932 --
NM_006282chr2064695 4520 4367 4131 1528 117 --23747 1894 --
NM_006283chr884319 3870 3740 3629 1664 977 765 426 24899 1994 24211 3677 24875 3279
NM_006287chr262604 2523 1900 898 745 727 1360 12113 144
NM_006292chr112163 59 ------
NM_006298chr6122905 2753 2692 2672 2578 2333 2188 1135 928 546 504 105 13200 23382 300 13395
NM_006300chr1992359 2226 2183 2063 1909 458 195 110 36 --22329 1742 12322
NM_006301chr121609 ------
NM_006306chrX85936 4005 2209 1765 1391 1294 850 703 --11571 --
NM_006307chrX2345 107 --2121 96 --
NM_006308chr51110 ------
NM_006310chr17--1337 1985 --
NM_006313chr1281580 1335 1208 1146 635 180 140 131 21542 599 ----
NM_006315chr483854 3847 2804 2782 2755 1621 408 370 --13936 14358
NM_006320chr431151 1016 434 ------
NM_006322chr132937 322 1606 1763 --
NM_006325chr122739 719 140 ----
NM_006330chr871505 1203 1146 1106 610 591 303 21409 454 --11049
NM_006333chr26603 544 501 485 193 172 1256 2532 467 --
NM_006345chr461199 951 897 871 314 234 --1139 --
NM_006346chr131349 --1183 2484 201
NM_006352chr172000 1951 1834 832 397 185 135 1410 ----
NM_006359chrX92436 2309 2111 1835 1578 929 470 437 266 1946 41974 1862 911 667 --
NM_006363chr203619 164 97 ----1121
NM_006364chr1441257 864 515 380 1249 11267 --
NM_006366chr661275 1041 487 214 203 101 ------
NM_006367chr131068 714 285 ------
NM_006371chr3125150 5139 5072 4751 4261 3783 3518 2028 1600 928 762 55 --14279 --
NM_006372chr64502 455 122 110 --1183 1386
NM_006375chrX31713 1626 1222 11408 --11349
NM_006379chr7102221 2111 1892 1706 764 618 541 361 251 85 11939 32116 1441 239 --
NM_006380chr17194107 4051 4026 3977 3737 3381 3371 3272 3055 2921 2900 1612 1508 1131 974 798 778 765 379 34082 2998 461 44088 3088 1602 445 13220
NM_006386chr2272156 1668 1628 665 607 450 45 1894 1958 --
NM_006390chr1291618 1591 1570 1417 1231 482 190 169 144 --21677 43 --
NM_006393chr10174582 4449 4235 3722 3683 3640 1784 1714 1388 1379 1254 902 363 301 212 99 27 14204 33619 3541 1758 --
NM_006403chr631401 1373 121 11693 1130 1103
NM_006413chr1061010 958 335 250 220 79 31453 977 46 ----
NM_006420chr20103487 3279 2863 2653 2546 2505 2340 2170 911 591 --23195 2121 --
NM_006421chr82958 872 ------
NM_006425chr571521 1467 1444 1011 564 252 113 --41604 1137 644 236 --
NM_006434chr1052834 2780 2536 1159 31 --13270 12742
NM_006439chr42576 98 ------
NM_006449chr252168 2135 2105 1726 670 --1505 2690 359
NM_006451chr561077 775 732 708 413 134 2812 28 1170 --
NM_006452chr451828 1579 1545 213 89 --41682 728 524 230 --
NM_006457chr4113514 3125 2766 2759 1175 881 817 561 469 305 137 33766 2793 240 62925 2713 2603 484 402 219 --
NM_006459chr1012031 21768 1620 11496 --
NM_006460chr173717 350 97 --1436 --
NM_006464chr281521 1048 985 949 574 509 265 236 14530 34572 1449 700 --
NM_006467chr5102289 2053 1907 1736 1640 953 854 417 148 29 12275 4769 757 446 73 1763
NM_006469chr171626 1119 562 518 477 228 219 2543 533 11436 --
NM_006482chr12153938 3814 3656 3396 3345 3054 2531 2524 2470 2424 1120 348 190 136 89 33213 200 167 43902 1382 1296 1245 13161
NM_006489chr1451873 1623 274 219 73 --12041 --
NM_006495chr172355 106 159 ----
NM_006496chr181688 1358 1278 1270 508 429 411 392 --1403 --
NM_006504chr1072942 2631 2478 1815 989 609 531 32888 2781 107 ----
NM_006516chr141211 1081 243 181 31366 265 233 ----
NM_006526chr2042146 2100 685 68 42005 1946 1659 1563 21357 675 --
NM_006529chr481627 1446 1390 1167 1066 565 332 272 21686 136 --1681
NM_006534chr2083348 3085 2563 2339 1265 478 166 135 32585 2472 2437 21304 722 12767
NM_006536chr15968 784 377 290 193 ------
NM_006538chr2114180 4130 3934 3895 3692 3223 1664 1218 1173 985 392 1679 --14192
NM_006540chr841590 1439 1174 398 11527 1440 --
NM_006544chr14366004 5786 5759 5374 5360 5317 5226 5139 5081 4816 4466 4355 4253 4074 4057 3921 3874 2414 2378 2088 2031 1796 1694 1666 1638 1551 1532 1395 1148 969 814 717 480 285 226 169 65738 5326 2399 2258 2046 1730 24433 631 45652 4938 3936 2075
NM_006546chr17136469 6455 6035 5567 5180 4057 2535 2231 2211 1465 917 497 491 15476 26118 1796 21745 897
NM_006547chr741979 477 280 207 --1177 2632 623
NM_006548chr341607 1389 571 475 ------
NM_006549chr1262867 1057 783 583 291 146 ------
NM_006554chr22326 83 ------
NM_006555chr731940 1570 123 ------
NM_006557chr931727 395 149 ----11633
NM_006558chr81329 --2358 141 --
NM_006559chr13258 190 81 1291 --11096
NM_006561chr10106255 6227 5296 4561 3783 2069 836 565 495 33 11478 31859 1570 1164 1737
NM_006565chr1621201 110 1876 ----
NM_006570chr9159 --1351 --
NM_006571chr81270 --1112 --
NM_006572chr1772548 2349 2300 1302 1182 539 293 22721 2337 22855 449 --
NM_006575chr143939 134 97 2555 427 --1361
NM_006577chr281140 1090 982 474 455 301 194 108 --31041 1029 406 --
NM_006578chr1541376 1268 530 373 --1438 --
NM_006582chr1164 ------
NM_006587chr4101683 1280 1219 1190 1112 1094 513 497 345 218 1478 1243 11420
NM_006593chr24577 510 218 167 --1111 --
NM_006595chr1151853 1795 1496 1304 265 31813 191 183 ----
NM_006599chr16298003 7894 7633 7135 6774 6653 6473 6348 6049 6033 6020 5981 5820 5782 5313 5043 3048 2491 2453 2170 1706 1248 1198 1106 947 886 518 130 79 46945 5245 2971 850 58013 7423 6523 2401 646 47267 5008 2533 207
NM_006601chr1261063 923 770 381 196 120 ------
NM_006603chrX61765 1742 1694 1394 597 59 11791 31547 521 237 --
NM_006609chr292848 2633 2564 2294 2287 880 744 470 272 42593 236 182 82 42031 1899 1887 1876 --
NM_006614chr3173466 3149 3120 2809 2789 2733 2585 2548 2326 1278 1267 1179 943 646 530 409 314 22947 754 32533 2357 1451 33582 3230 1069
NM_006620chr6164290 3762 3665 3554 3441 3326 3037 1598 1328 1274 1093 1020 879 778 254 222 --23797 3756 --
NM_006621chr161412 1388 1373 287 236 73 ------
NM_006622chr54566 553 502 183 ------
NM_006624chr1081822 801 741 718 292 263 230 219 1620 ----
NM_006625chr151021 773 465 423 173 11207 --21167 202
NM_006625chr151021 773 465 423 173 11207 --21167 202
NM_006625chr151021 773 465 423 173 11207 --21167 202
NM_006626chr9132337 2293 1938 1826 1692 1081 862 808 604 520 432 366 101 2946 574 31947 801 669 11811
NM_006628chr15134322 3264 3162 1704 1646 1534 1421 1181 1036 550 536 302 73 21254 344 23435 3430 11465
NM_006633chr52790 256 1512 1567 --
NM_006636chr23758 682 368 --2648 287 --
NM_006640chr1731797 1618 635 --180 186
NM_006646chr1373015 2527 2043 2035 1014 981 48 22924 2832 32490 2223 2143 --
NM_006648chr91122 ------
NM_006654chr12154730 4609 4428 4154 4042 3929 3733 2955 1755 1556 1222 730 464 283 33 53953 3871 2962 349 97 33721 3467 1810 23832 3706
NM_006667chrX51150 1143 779 480 441 ------
NM_006675chr1243386 3103 512 65 1490 2517 336 --
NM_006682chr782801 2600 1013 768 363 184 170 65 12326 12227 --
NM_006691chr1131139 1023 790 ------
NM_006693chr71847 ------
NM_006698chr2061438 1039 969 439 182 143 11487 11193 --
NM_006699chr152416 2354 912 461 163 11030 2956 904 1181
NM_006700chr122751 112 ------
NM_006703chr62381 191 ------
NM_006705chr91455 ------
NM_006706chr57863 807 709 528 260 178 155 --2789 688 --
NM_006713chr51535 1314 2203 188 --
NM_006717chr9173411 3265 3214 3147 2930 2922 2729 2723 2378 2136 1087 825 747 603 587 549 498 33359 2151 1019 13272 13278
NM_006718chr63952 761 55 2426 195 1339 --
NM_006720chr1095142 5085 4808 4725 4363 4263 4212 3972 308 --24049 1587 --
NM_006721chr103571 269 169 ----1290
NM_006722chr3162698 2467 2309 1989 1071 938 891 881 826 689 517 341 312 261 187 123 31983 1048 529 3831 751 147 1463
NM_006724chr61505 ------
NM_006727chr51378 1513 1194 --
NM_006729chrX155437 5349 4608 4277 3823 3478 3439 2096 1838 1357 1308 1065 1032 811 226 11557 31094 724 565 2780 767
NM_006731chr9165737 5688 5546 4869 3909 3587 2275 2029 1404 1263 1234 988 925 833 500 246 --2838 689 1889
NM_006734chr641538 453 305 258 2429 327 1495 --
NM_006735chr74303 233 89 70 ------
NM_006738chr1583936 3472 2951 1765 1610 1314 640 369 --14593 --
NM_006743chrX3858 730 369 ----1117
NM_006745chr461093 995 943 722 421 168 --11066 --
NM_006746chrX81561 1388 1177 1139 971 591 549 252 1230 21247 456 --
NM_006750chr16158124 7959 7949 6806 6552 6483 5770 5146 2682 1907 1473 1154 882 840 801 48101 8092 6519 2932 37476 6633 767 --
NM_006751chr27946 933 802 768 187 84 53 1839 1796 --
NM_006755chr11----1128 --
NM_006756chr871507 1435 1199 1076 534 443 60 1236 31229 199 125 --
NM_006763chr182143 1956 1943 1782 1770 1763 765 520 12094 ----
NM_006766chr8132692 2385 2361 2355 2301 2121 1745 1652 1087 968 698 351 221 52580 2525 2078 674 57 22531 140 11666
NM_006772chr611628 --11391 --
NM_006773chr281563 587 304 266 260 195 171 86 21534 573 134 --
NM_006775chr6113063 3017 3001 2680 2542 2376 2353 2173 1117 1043 722 43122 2801 2237 579 23103 2915 1995
NM_006777chrX102885 2615 2603 2403 1100 1018 940 897 653 373 ----1672
NM_006788chr1872133 2125 1358 335 282 261 205 ----21800 1492
NM_006791chr153432 256 131 --1494 --
NM_006803chr871847 1604 1569 1557 351 320 269 ------
NM_006805chr571757 1739 1377 617 601 504 259 21086 287 1400 --
NM_006806chr211174 1130 2376 333 --
NM_006811chr206891 869 823 714 667 304 2850 279 ----
NM_006813chr64736 659 610 296 --1331 1158
NM_006815chr124555 361 283 88 11175 2878 538 --
NM_006818chr15814 691 683 626 82 ------
NM_006819chr111294 ------
NM_006826chr241303 1110 1058 831 11036 --11014
NM_006827chr1453174 3115 3108 1199 608 23006 992 12957 1526
NM_006831chr111406 1312 ----
NM_006832chr1431100 321 51 --21076 106 1742
NM_006838chr1281926 1634 1620 1280 631 118 45 31 1654 11234 --
NM_006841chr3--1781 ----
NM_006842chr111111 ------
NM_006851chr12102950 2911 2795 2119 2106 1017 1010 960 445 91 11956 ----
NM_006852chr1752804 1039 604 550 121 --22513 2137 --
NM_006854chr771755 1549 1345 622 363 329 200 --11338 --
NM_006870chr204744 321 265 182 --1342 --
NM_006873chr283431 2955 1161 1040 1011 961 942 682 ----1916
NM_006874chr441151 958 481 95 ----1398
NM_006884chr341983 1878 1786 504 11806 11546 1522
NM_006885chr1693773 3322 2732 1541 1318 1303 657 498 183 32852 1349 545 34168 2583 524 11179
NM_006887chr22221 215 ------
NM_006888chr1433498 3087 2650 42906 2895 913 353 ----
NM_006892chr2031290 1104 262 11258 ----
NM_006892chr2031290 1104 262 11258 ----
NM_006893chr11122 ------
NM_006896chr721156 930 ----11007
NM_006901chr151510 ------
NM_006908chr741166 587 371 180 21149 46 11079 --
NM_006912chr152321 2282 1700 1619 712 --22461 900 --
NM_006914chr941421 619 333 185 11159 2300 260 --
NM_006915chrX92300 2114 977 800 464 398 302 226 181 22531 2512 12431 1551
NM_006916chr241185 949 409 232 1252 11258 --
NM_006918chr11125125 4783 4716 4348 4154 3812 3552 1745 1294 641 292 198 44590 4520 2351 1164 44942 4579 3679 1522 --
NM_006920chr292081 1647 1629 1321 1293 678 389 332 66 --31717 1451 1446 11413
NM_006922chr2132396 2212 2202 2136 2006 1701 1681 819 685 609 592 214 24 --31792 930 720 --
NM_006924chr17164060 4054 3792 3381 3296 3281 3249 3188 3092 2955 2839 1585 1035 432 187 53 --1599 14243
NM_006930chr581738 1268 455 428 316 166 134 80 11409 ----
NM_006931chr1282154 2012 1743 1490 1325 519 471 277 --2480 188 --
NM_006937chr172425 152 ----1467
NM_006939chr1451037 1011 999 840 85 11164 ----
NM_006940chr1231633 578 108 1505 2683 322 11433
NM_006947chr461806 1791 1267 683 396 264 1201 21718 1134 --
NM_006948chr2192224 2098 1786 1767 1670 889 702 608 139 --1634 11747
NM_006951chr102772 285 1794 ----
NM_006962chrX266 55 ------
NM_006963chr102896 207 21213 95 ----
NM_006965chr1851132 973 918 426 204 1365 ----
NM_006981chr952882 2501 1945 659 523 41965 1052 377 213 13017 --
NM_006996chr1101913 1898 1865 1565 1534 1249 596 586 560 260 1334 21634 1262 --
NM_006999chr572092 2054 1883 1572 1288 686 521 ------
NM_007005chr941215 1193 1146 47 --11303 --
NM_007006chr1683542 3174 2591 2580 981 972 259 100 13497 23547 2819 1552
NM_007007chr12184528 4448 4300 4270 4202 4163 3865 3201 1751 1623 1321 1245 956 721 390 208 190 183 12993 34722 4678 257 --
NM_007010chr1751450 1270 1256 716 622 --2568 41 --
NM_007011chr15176763 6233 5418 5179 5091 4776 4271 2482 2350 2079 1953 1542 1479 1249 1220 795 693 --16804 --
NM_007013chr83916 741 360 1301 3793 247 175 --
NM_007017chr57894 856 849 658 611 355 268 --1616 --
NM_007023chr22982 408 --1991 --
NM_007026chr171142 ------
NM_007033chr131640 857 626 1751 ----
NM_007034chr12999 661 --3873 696 209 --
NM_007038chr21176067 5577 5007 4977 4903 4670 4527 4302 4134 4050 3863 2111 2075 1892 1849 1670 535 35566 4035 1562 11108 35394 1420 419
NM_007039chr1462299 1863 1854 629 393 309 1901 3805 439 398 1484
NM_007040chr1951018 978 813 732 220 1706 ----
NM_007042chr342202 1670 920 334 22437 473 22665 2660 --
NM_007043chr1242163 1825 1616 1374 51916 1695 1332 210 147 --11321
NM_007054chr593721 3490 3046 1203 1134 981 964 944 528 --33914 2872 870 11571
NM_007064chr361652 1471 1359 1243 377 292 ----1646
NM_007078chr1062562 2472 2199 858 849 138 12909 ----
NM_007080chr42401 47 1100 --1353
NM_007084chr1371456 1436 1410 1331 1300 1002 586 --11078 --
NM_007087chr16140 ------
NM_007106chr1392749 2672 2607 2095 1905 1072 1040 196 37 1982 22573 840 --
NM_007107chr342283 1542 896 29 1101 ----
NM_007111chr131792 --1561 --
NM_007112chr1135 ------
NM_007114chr3143341 3286 3228 3212 3103 3028 2627 2570 2414 2352 1234 803 522 417 186 51142 1086 1005 276 195 12330
NM_007118chr51864 --2873 243 --
NM_007121chr191357 ------
NM_007124chr682031 1780 1677 1643 1495 1433 1427 392 31573 772 189 3799 760 656 --
NM_007125chrY71300 1170 981 971 463 328 282 ----21132 903
NM_007126chr91456 ------
NM_007129chr133997 132 116 ------
NM_007137chrX145324 5146 4868 4528 4404 4316 4025 3878 3586 3492 1703 794 778 616 2624 317 --1654
NM_007145chr192279 111 11133 21426 1371 11349
NM_007146chr17132841 2772 2673 2399 2320 1028 888 864 523 469 418 405 200 --31920 353 104 11138
NM_007147chr1931246 985 167 21057 922 1435 --
NM_007156chrX140 ------
NM_007157chrX52690 2649 2238 711 40 32317 1099 569 1551 12117
NM_007158chr171108 1059 460 301 258 249 190 21166 898 --1972
NM_007159chr361771 1429 1415 675 334 142 --1194 --
NM_007166chr1141419 1172 638 566 11503 ----
NM_007172chr22103220 2369 2187 2164 2158 1001 989 702 524 513 ----12750
NM_007173chr11112328 2161 1802 932 901 724 507 324 316 169 50 ----1692
NM_007174chr1262338 2128 1809 676 410 367 --22401 246 12081
NM_007175chr8133566 3520 3320 3308 2960 2797 2585 2543 2317 611 540 191 45 33553 2996 2890 33104 2579 272 --
NM_007191chr122714 49 --1116 2680 232
NM_007192chr1441061 916 459 57 --21094 923 --
NM_007195chr18123664 3554 3536 3330 3140 2877 2871 2616 2430 1476 1088 207 23455 2440 --23365 225
NM_007197chr12--199 21019 928 --
NM_007198chr861662 1480 1429 1079 1008 371 ------
NM_007200chr1583936 3472 2951 1765 1610 1314 640 369 --14593 --
NM_007203chr9134012 3817 3753 3726 3210 3051 2715 1578 1430 827 717 619 77 13083 ----
NM_007212chr1112166 2124 2046 1899 1836 1811 870 574 558 159 81 21606 38 11501 --
NM_007214chr681310 1184 1003 943 516 373 364 255 ------
NM_007217chr33320 67 55 ------
NM_007218chr87916 882 799 643 611 350 251 ------
NM_007222chr891620 1429 1370 1352 1190 712 440 427 250 31743 1577 1342 1610 --
NM_007231chrX52411 2330 2057 868 306 1622 1887 12001
NM_007235chr122543 373 1520 ----
NM_007236chr1562347 2252 1791 1783 961 587 1414 12273 1819
NM_007240chr11151 1209 1188 --
NM_007245chr163961 918 793 ------
NM_007246chr461068 1031 840 676 375 105 1140 1369 --
NM_007249chr13179464 9426 8923 8777 8763 7859 7677 6933 6426 6155 6122 3696 3658 3010 1758 1107 433 36970 3640 1711 68386 8025 7232 6696 6506 5703 --
NM_007266chr21645 ------
NM_007269chr1--1197 1100 1563
NM_007270chr721115 422 --11453 --
NM_007271chr661858 1806 1565 1558 1398 1254 31708 424 42 1592 11697
NM_007276chr741144 1020 222 183 21135 22 11095 11055
NM_007279chr191643 ------
NM_007282chr321023 652 2972 331 ----
NM_007285chr161184 ------
NM_007286chr51637 ------
NM_007287chr3103255 3195 3014 2986 2419 2043 1164 929 579 451 1752 12171 --
NM_007288chr3103255 3195 3014 2986 2419 2043 1164 929 579 451 1752 12171 --
NM_007289chr3103255 3195 3014 2986 2419 2043 1164 929 579 451 1752 12171 --
NM_007292chr17114968 4915 4269 3379 3369 3272 2030 1743 1685 1048 336 24020 120 22061 1187 13174
NM_007294chr171251 --1126 --
NM_007295chr171251 --1126 --
NM_007296chr171251 --1126 --
NM_007297chr171251 --1126 --
NM_007298chr171251 --1126 --
NM_007299chr171251 --1126 --
NM_007300chr171251 --1126 --
NM_007302chr171251 --1126 --
NM_007303chr171251 --1126 --
NM_007304chr171251 --1126 --
NM_007305chr171251 --1126 --
NM_007308chr46700 601 587 513 492 219 --1581 --
NM_007313chr931777 1596 1532 11806 21559 233 --
NM_007315chr221499 457 11465 1585 --
NM_007331chr472770 2503 2377 2316 2013 1770 467 32292 1988 196 32696 1749 655 --
NM_007345chr1892215 2202 2032 1897 1860 1801 1774 1588 118 22237 332 12112 11780
NM_007347chr15183119 3023 2992 2977 2908 2630 2190 2159 2110 2079 2072 1236 1169 799 665 590 137 21 22398 2065 23170 2964 31084 719 316
NM_007349chr74437 390 379 183 1415 ----
NM_007358chr182001 1943 1596 1482 1346 1320 1256 739 ------
NM_007359chr1741398 445 430 21 ------
NM_007361chr142638 238 ------
NM_007363chrX21082 770 ------
NM_007373chr1031748 535 397 --1470 11655
NM_007375chr182697 2655 2454 2034 1983 1093 708 694 11840 1303 1186
NM_009585chr33866 328 278 --1883 --
NM_009585chr33866 328 278 --1883 --
NM_012069chrX72445 2325 1799 1764 1730 1722 43 --21814 1804 --
NM_012081chr583770 3482 2998 2989 1275 963 149 94 23144 3045 11496 --
NM_012082chr84789 364 245 207 ----2726 259
NM_012084chrX1382 --1524 1456
NM_012089chr1101522 1050 1032 480 442 376 340 266 176 34 11412 21549 1301 11568
NM_012095chr1063322 3033 2863 755 633 171 42922 2704 887 619 22467 1302 --
NM_012096chr3113600 3311 3272 1431 1422 1372 869 793 531 477 136 43502 508 446 108 23628 684 11041
NM_012097chr282253 1904 1664 1577 414 315 306 52 11672 --22110 595
NM_012102chr162405 2149 1896 549 469 291 1119 ----
NM_012104chr1183352 3027 2521 1312 898 481 298 59 ------
NM_012104chr1183352 3027 2521 1312 898 481 298 59 ------
NM_012111chr141187 ------
NM_012115chr62551 383 1394 ----
NM_012120chr6102949 2927 2731 2692 2478 2115 898 778 523 299 --32905 2547 691 11132
NM_012124chr112919 338 1295 --1684
NM_012129chr7132432 2341 1989 1868 1599 1581 944 701 587 446 222 158 94 12106 ----
NM_012141chr13163905 3555 2677 2621 2572 2560 1577 1083 1041 863 823 795 597 525 348 152 13683 43257 3114 1434 1382 2771 374
NM_012154chr82684 309 --1123 --
NM_012158chr1361863 1856 1683 1281 384 59 1665 11788 31797 1201 1175
NM_012161chr4101090 1080 932 926 767 740 468 266 62 21 --31002 855 793 --
NM_012164chr9177432 7395 7360 7133 7000 6898 6815 6552 6308 2875 2637 2518 2166 1826 1444 183 31 34921 2943 2376 45418 5384 2892 2200 12906
NM_012175chr115944 822 667 275 179 1805 1843 1291
NM_012176chr5--1248 ----
NM_012177chr61233 2572 493 195 --
NM_012180chr43632 551 156 1605 ----
NM_012183chr12493 456 ----1612
NM_012193chr11134347 3887 3460 2085 1146 1085 993 924 601 409 263 192 80 45093 1215 765 494 44352 1749 736 554 --
NM_012197chr931614 1223 1196 --21560 519 --
NM_012199chr154445 4428 3904 528 403 34665 2904 1265 ----
NM_012207chr1061001 867 334 297 190 84 2241 211 --195
NM_012210chr981516 1470 1305 306 297 279 201 156 ------
NM_012214chr2266260 6090 5736 5720 5612 5298 5282 5041 4932 4830 4743 4482 4328 3959 2568 2531 1945 1914 1295 1027 902 747 716 367 197 75 55219 1226 949 654 389 55751 5200 1095 965 335 14767
NM_012215chr1071918 1774 1363 1207 766 700 156 1668 --1604
NM_012218chr195683 468 398 390 63 1414 2428 234 --
NM_012219chr363219 2979 2876 2838 1244 448 23231 430 1464 --
NM_012223chr271117 1110 1024 970 870 151 66 21338 41 ----
NM_012228chr1031119 993 82 ------
NM_012229chr1031396 1026 596 1508 1143 --
NM_012233chr231155 951 925 1241 ----
NM_012234chr373716 3628 3345 2516 1129 378 198 32547 271 216 23701 2319 12656
NM_012238chr1061654 1576 1407 1362 1196 51 21636 435 11280 --
NM_012242chr104743 166 158 60 134 ----
NM_012243chr16971 802 660 650 371 263 ----1726
NM_012247chr101681 --1367 --
NM_012249chr2143402 3371 3184 3086 2997 2916 2898 2876 2710 2533 866 798 681 552 183 22865 220 --
NM_012250chr112453 279 2910 870 11327 --
NM_012252chr7195313 5303 5180 5131 5008 4826 4807 4666 4644 4428 4411 4057 3887 3869 2158 1621 1202 898 286 55334 4624 3649 3424 1613 53892 3374 2011 1494 634 1498
NM_012255chr203454 334 47 --1108 --
NM_012257chr75861 831 814 331 205 ------
NM_012259chr621066 520 1929 --11408
NM_012262chr1144213 4001 3943 3716 3677 3553 1802 1714 1650 1544 1374 1085 197 58 55282 4690 3291 2026 914 54655 4635 1034 976 461 14219
NM_012266chr931163 1084 971 11106 ----
NM_012281chr721596 717 11513 22188 230 --
NM_012284chr12--1321 ----
NM_012286chrX2612 419 --1245 --
NM_012287chr3184404 4369 4292 4223 3942 3543 3380 3317 3182 3108 3059 3049 1481 1098 852 614 204 83 44270 3504 1709 894 43723 3194 1657 676 --
NM_012291chr12--1111 ----
NM_012294chr782957 2657 1632 803 616 396 104 39 21543 777 ----
NM_012297chr482514 2480 2466 2412 2064 2032 2014 665 21970 1693 1589 --
NM_012300chr552154 1619 946 671 377 22400 728 12219 --
NM_012301chr752145 1977 879 667 292 --11879 2825 356
NM_012302chr161189 884 841 400 313 251 1165 11126 1185
NM_012309chr11194670 4648 4596 4515 4457 4330 4221 4076 3997 3982 3316 3105 3072 3015 1764 1727 1541 981 702 ----13333
NM_012316chr175442 4962 4649 1128 385 343 337 11171 ----
NM_012323chr2211256 11141 11171 11148
NM_012325chr2051641 1296 1127 357 142 --21589 1420 --
NM_012327chr1831575 1493 1368 21594 1000 21618 1317 --
NM_012328chr751358 1067 583 326 106 ------
NM_012329chr1761405 1242 621 486 296 287 1276 21616 1596 1113
NM_012330chr1061590 1490 1397 1216 652 468 21699 232 11516 --
NM_012333chr151322 1228 623 515 304 11268 ----
NM_012341chr101403 --1439 --
NM_012343chr561113 1106 1050 305 280 184 11086 1423 1254
NM_012345chr1371849 1439 1295 593 444 260 143 21835 251 11630 11320
NM_012347chr652952 2552 613 213 164 32889 2208 807 1427 12967
NM_012382chr5164443 4104 3861 3780 3307 3093 1391 1362 1284 973 855 841 695 614 361 278 11192 63763 1696 1537 1309 1278 1127 --
NM_012388chr15113017 2954 2935 2631 2571 2309 2023 722 675 550 219 --32343 430 365 --
NM_012399chr2281889 1660 1332 1296 773 756 487 381 --11289 --
NM_012405chr1103380 2646 1166 906 703 650 516 479 469 103 33476 3025 585 ----
NM_012406chr124895 432 257 177 183 ----
NM_012413chr2--1455 2468 366 --
NM_012414chr14821 293 280 64 --2834 87 --
NM_012416chr92988 178 --172 --
NM_012417chr172547 92 130 ----
NM_012419chr63223 152 140 ------
NM_012420chr1081952 1722 1591 607 462 289 78 71 11902 1768 1152
NM_012425chr1082693 2643 2223 2159 1994 462 407 110 --1584 --
NM_012428chr152252 175 1789 --1918
NM_012430chr31774 1531 ----
NM_012431chr7123433 3190 2998 2876 2626 2236 1082 1026 936 442 299 175 21143 625 1486 --
NM_012434chr661691 1642 1578 432 216 42 11669 ----
NM_012443chr104909 573 229 151 ------
NM_012446chr52410 130 1475 ----
NM_012454chr65416 391 231 160 39 ------
NM_012460chr143353 307 51 ------
NM_012463chr1251517 1506 1232 1174 214 11394 1346 --
NM_012464chr472735 2379 2348 2162 1933 905 625 52935 2777 1900 142 94 12877 1439
NM_012465chr10143382 3368 3242 2859 2849 2729 2539 2533 2262 2167 1281 1180 1080 790 --23312 3009 --
NM_012482chr13717 158 50 ------
NM_012484chr52206 104 --1166 186
NM_013229chr1272808 2037 1962 1781 607 484 342 186 22250 2193 --
NM_013230chrY41696 1148 626 128 11320 ----
NM_013231chr1484418 3652 1453 1391 1278 1191 1120 341 --34353 1417 1081 --
NM_013233chr23460 429 203 --1547 --
NM_013235chr57868 805 644 366 246 221 174 1931 ----
NM_013242chr16--1354 ----
NM_013254chr122726 571 177 2498 191 --
NM_013255chr7198689 8583 8186 7167 6516 6323 6289 6252 5658 5489 2543 2482 2283 1923 1366 857 743 447 330 57436 6619 6609 1983 990 88782 3264 2739 2128 2049 1478 1107 269 37183 7103 715
NM_013257chr872185 2005 1904 1871 1785 1599 632 2386 109 2938 566 --
NM_013261chr4103709 3582 3328 3190 3030 3024 2761 2565 1107 107 21485 629 11112 --
NM_013262chr661490 1380 1353 1242 1047 258 31469 950 513 ----
NM_013264chr11178 ------
NM_013267chr122523 420 ----1488
NM_013269chr1284040 4032 3225 3034 1667 745 603 61 24376 1439 14201 --
NM_013281chr2051553 479 415 230 158 --2942 296 --
NM_013282chr1951319 1172 1129 153 147 --11309 --
NM_013286chr393823 3258 3077 2980 953 494 265 85 53 --12409 --
NM_013296chr1--1368 ----
NM_013302chr1694464 3824 3687 3123 1860 1729 1579 674 611 --23863 1374 21869 130
NM_013304chr161236 ------
NM_013309chr1592638 2545 2274 1747 841 673 545 400 184 12603 21924 1070 2589 366
NM_013313chr2262893 2784 2246 1093 395 301 33167 3149 2198 ----
NM_013322chr761475 1195 534 304 172 158 ------
NM_013330chr1182 1223 ----
NM_013336chr331301 546 177 --1217 --
NM_013341chr2102932 2903 2852 2504 2166 2052 924 915 509 133 12748 ----
NM_013354chr881369 1237 514 464 433 291 60 25 --2939 123 11158
NM_013357chr82769 737 --1621 1640
NM_013372chr1593003 2942 2874 2504 1350 1042 943 833 250 12812 42584 2570 2446 327 --
NM_013373chr222998 720 11007 11034 --
NM_013374chr3143090 3041 2981 2915 2640 2463 2412 2355 2277 2207 2116 790 700 461 22663 2599 1657 11040
NM_013377chr123575 429 32 2112 91 ----
NM_013381chr1292336 2150 1769 1760 1618 1592 649 170 143 22098 776 11685 --
NM_013386chr171615 1368 1349 1313 1157 612 339 51472 1178 413 394 374 1230 --
NM_013390chr941658 1460 567 69 21756 1425 ----
NM_013396chr21111465 1280 1142 1040 954 423 295 288 200 149 109 11196 21575 240 --
NM_013411chr132792 703 356 22140 182 ----
NM_013423chrX21090 839 41222 1012 798 520 21159 1060 --
NM_013427chrX21090 839 41222 1012 798 520 21159 1060 --
NM_013434chr212006 ------
NM_013434chr212006 ------
NM_013436chr22228 74 1747 ----
NM_013437chr8101416 1314 1299 1290 994 922 368 320 188 67 --11085 --
NM_013438chr961698 469 412 133 73 59 21282 258 ----
NM_013448chr143707 634 134 ------
NM_013449chr1222105 278 12462 31945 1916 1833 11891
NM_013450chr241187 1106 945 497 --2793 425 1393
NM_013943chr173260 3143 2348 2151 830 270 187 33205 3105 602 62721 2472 2265 818 727 385 --
NM_013956chr8--1128 139 145
NM_013957chr8--1128 139 145
NM_013960chr8--1804 2761 715 1721
NM_013964chr8--1128 139 145
NM_013981chr51154 1201 ----
NM_013982chr51154 1201 ----
NM_013983chr51154 1201 ----
NM_013989chr14115145 5135 4935 4662 4251 3891 3731 3654 3447 1519 1387 --21858 1853 24711 3221
NM_013993chr61814 ------
NM_013994chr61814 ------
NM_013995chrX112427 2349 2190 1968 1949 1038 775 493 292 257 176 32411 2314 1887 2912 820 --
NM_013996chr71529 ------
NM_013996chr71529 ------
NM_013997chr71529 ------
NM_013997chr71529 ------
NM_013998chr71529 ------
NM_013998chr71529 ------
NM_014005chr5102814 2775 2569 2171 1195 1080 425 404 376 235 --31057 96 27 --
NM_014011chr252495 2327 2060 1934 697 22307 2269 1658 --
NM_014016chr351295 1179 611 332 108 21613 1331 21682 675 --
NM_014021chr173260 2393 1372 1229 756 740 526 1968 --11050
NM_014023chr1052833 2734 970 939 733 32860 635 119 ----
NM_014026chr11------198
NM_014028chr6153342 3197 3081 2651 2425 2114 2063 1257 1185 799 704 669 649 397 226 42491 736 637 597 1276 1282
NM_014031chr53347 254 68 ------
NM_014033chr1262312 2264 2157 1979 1840 1830 --1912 --
NM_014034chr661439 1384 1270 513 430 358 21248 266 1212 --
NM_014035chr541414 966 579 384 ------
NM_014039chr1171350 1311 1094 1022 403 393 140 ------
NM_014043chr321514 206 ----11436
NM_014048chr16155073 4685 4635 4473 4448 4346 4324 4135 3590 1605 1221 1146 972 763 372 35208 5109 1235 14966 22130 627
NM_014055chr123367 195 122 ------
NM_014057chr94641 458 417 129 21563 275 2523 495 --
NM_014059chr131293 ------
NM_014071chr201106 --1412 --
NM_014089chr1352230 2147 1848 1408 546 32133 1676 1430 ----
NM_014106chr15112995 2756 2629 1958 1880 1184 431 255 234 193 77 --42520 2213 2185 2097 12661
NM_014109chr851264 992 432 291 206 31220 781 29 1351 2816 793
NM_014112chr8155387 5186 4899 4682 4656 4307 4061 3784 3678 1914 1906 1787 1340 797 756 33605 2044 1195 25392 1038 --
NM_014117chr1692421 2165 1948 1821 1736 988 914 830 634 --1649 --
NM_014141chr7105300 5096 5085 4746 2048 1991 1873 1121 990 828 2917 196 24393 2026 --
NM_014153chr161478 --1611 1716
NM_014154chr341341 1059 424 373 21440 1234 21038 440 --
NM_014155chr11307576 7441 7275 7112 7044 6961 6860 6692 6561 6318 6258 6203 5800 5636 5490 5363 5310 5050 4883 4760 4712 4652 2993 2831 2796 2490 2425 1920 1421 813 46929 6147 5084 879 1436 37085 6235 1156
NM_014160chr341326 995 550 297 21172 221 11373 --
NM_014171chr26653 635 545 267 212 38 --1305 --
NM_014181chr262609 2505 2294 1821 673 403 --1218 --
NM_014191chr1221032 388 --2358 345 --
NM_014212chr123275 68 61 --255 50 --
NM_014217chr141814 1506 1282 59 11785 --11426
NM_014225chr192399 385 --1390 --
NM_014240chr374125 4006 3710 3582 1544 739 345 1570 ----
NM_014243chr472097 1861 1785 1413 1337 510 378 --21849 114 --
NM_014246chr2231877 1846 1718 1475 21892 537 --
NM_014250chr2252047 2008 858 340 176 32035 530 112 1192 --
NM_014253chrX62455 2304 2249 950 791 156 11929 12202 --
NM_014263chr1031444 128 34 --21327 299 --
NM_014264chr43633 217 119 1451 --1505
NM_014267chr112808 164 3610 88 23 3894 878 315 --
NM_014268chr1841370 1307 1301 339 ------
NM_014271chrX1332 2226 164 2337 220 --
NM_014278chr42386 325 1146 1344 --
NM_014283chr141571 1331 555 334 21010 435 1442 21414 229
NM_014294chr88986 932 579 539 490 443 257 190 1351 1246 1546
NM_014305chr131693 1557 ----
NM_014309chr22115313 5169 4567 4475 3937 3780 3660 3326 2100 1221 855 35376 1803 146 --21320 1177
NM_014313chr131629 1564 1510 --1247 --
NM_014319chr1271847 1739 1566 1387 1256 618 102 1574 41651 1211 662 262 --
NM_014322chr12993 203 11215 2979 974 --
NM_014323chr224903 892 668 105 1790 1828 --
NM_014325chr1271905 1484 893 463 439 311 220 2450 396 ----
NM_014331chr4267822 7807 7713 6794 6744 6734 6394 6291 6236 6071 5882 5294 5136 4978 2989 2955 2395 1382 1207 870 564 540 480 139 127 96 42755 2727 1730 1046 37357 5730 5362 67786 7298 6771 6530 2820 1055
NM_014332chrX----1267 2398 74
NM_014333chr1182445 1886 1852 1105 478 342 230 99 1900 22307 1976 22522 2053
NM_014342chr1131388 1095 237 1325 1290 11413
NM_014344chr112803 770 --2819 779 --
NM_014345chr62797 779 --21047 282 1828
NM_014350chr541033 999 163 115 ------
NM_014351chr2241070 914 457 443 ----1325
NM_014363chr1331187 1055 929 1425 41222 1141 509 341 1271
NM_014368chr92735 387 12121 1523 --
NM_014372chr171826 1323 829 776 433 201 166 ----42047 1581 1472 451
NM_014381chr1492587 2490 2349 2324 2085 2074 1996 780 583 22135 1185 12028 1766
NM_014382chr3111713 1651 1399 1358 1212 1096 672 665 352 185 148 21769 1366 --1237
NM_014388chr1105755 4825 4711 4606 3835 1567 1053 878 780 298 12085 23787 2386 --
NM_014393chr8112243 2184 2016 1848 1776 1673 1636 789 746 413 403 32047 550 421 12248 --
NM_014415chr3101619 1506 1408 1396 1187 587 577 519 403 278 --2552 351 11540
NM_014421chr451627 1543 1415 772 688 12061 11582 12092
NM_014423chr5175318 5283 5221 5205 5181 5044 4788 4214 4026 3796 3588 3490 1794 1541 437 416 311 15600 54797 1390 843 559 303 13524
NM_014426chr20199 3727 624 524 ----
NM_014445chr3112296 2022 1977 1798 1720 1622 915 804 611 290 42 32002 1825 413 1429 12226
NM_014447chr431545 152 129 11042 31590 1431 591 1401
NM_014454chr63897 390 309 1376 1983 11027
NM_014455chr11378 ------
NM_014456chr1061468 1257 697 663 468 373 --21860 1346 1131
NM_014458chr121450 545 21052 67 41308 1031 306 98 --
NM_014461chr31172 ------
NM_014469chr111148 ------
NM_014470chr12--1739 ----
NM_014472chr10----1731 --
NM_014487chr41660 1157 1675 --
NM_014489chr11----1861 --
NM_014494chr1631467 737 699 11699 21781 127 --
NM_014495chr13667 245 116 ------
NM_014497chr2--1179 ----
NM_014504chr752145 1758 1550 744 647 --22098 552 2493 400
NM_014505chr121386 ------
NM_014506chr931354 1256 1185 11621 11066 11043
NM_014516chr19--1271 ----
NM_014517chr371509 1360 1342 748 696 394 93 --21934 1502 --
NM_014520chr17184 ------
NM_014521chr271875 1831 1752 1257 450 361 309 --21819 1579 --
NM_014547chr152713 213 --1668 1175
NM_014547chr152713 213 --1668 1175
NM_014548chr153606 243 192 --186 --
NM_014552chr251533 1477 610 410 301 --21160 268 21556 1307
NM_014554chr1292300 2097 1718 1698 1469 617 527 201 50 21479 603 --12029
NM_014572chr1331197 508 317 11248 2483 357 11683
NM_014574chr1451269 1188 1003 547 503 3994 603 591 21581 1293 11083
NM_014575chr34547 447 199 163 ------
NM_014577chr225862 807 789 718 138 3926 639 595 1856 1726
NM_014583chr31466 ------
NM_014584chr1461358 1148 519 316 231 211 11337 21188 598 1105
NM_014585chr241178 1115 1061 941 21252 956 ----
NM_014587chr1641590 620 602 596 11353 --11319
NM_014592chr52124 85 ----1783
NM_014600chr21624 ----21581 1530
NM_014602chr32231 25 ------
NM_014606chr491314 1232 1196 1149 1077 989 437 325 94 11475 21162 994 --
NM_014607chr272142 1633 1363 781 407 337 121 189 1747 --
NM_014608chr151408 ----1140
NM_014612chr971558 1297 1103 1092 602 458 122 ------
NM_014613chr593057 2243 2177 2138 1967 1216 590 524 368 13112 12063 --
NM_014615chr1672927 2531 1358 835 828 650 520 11377 154 --
NM_014616chr3123332 3249 3155 2597 2255 1371 1082 839 816 446 312 242 1110 23186 2157 --
NM_014620chr122767 504 ------
NM_014629chr851367 1229 905 506 457 --11255 --
NM_014630chr1574010 3988 3269 3142 2511 1180 732 ----11292
NM_014635chr2101740 1679 1583 1309 638 552 427 371 146 23 ----11504
NM_014636chr9164373 4365 4347 4091 3903 3884 3451 3227 3053 3004 2863 1338 1314 1294 1281 592 ------
NM_014637chr81324 31355 1057 362 ----
NM_014647chr1672292 2077 2012 1751 662 597 262 --12223 --
NM_014655chr162354 2009 1984 1847 451 150 --11647 --
NM_014660chr73991 729 67 155 1842 --
NM_014663chr11781 ------
NM_014666chr531282 267 96 2479 145 31301 1077 869 2961 351
NM_014670chr231533 1275 1188 --31288 317 133 11603
NM_014671chr761428 1413 1201 1084 244 163 --31470 1054 554 --
NM_014674chr3114020 4007 3751 3442 2810 1614 1295 1104 528 387 335 23959 308 23885 397 --
NM_014675chr1--1457 ----
NM_014676chr161698 1677 1213 1081 456 368 21169 172 1185 --
NM_014677chr851197 1183 1024 917 334 1327 --1550
NM_014678chr222757 105 ------
NM_014679chr1141175 1016 554 528 2940 326 2466 25 1271
NM_014682chr861961 1669 1543 523 338 244 1306 21983 135 12122
NM_014683chr17102186 1992 1811 1693 1553 1366 1327 844 787 670 1221 11792 11798
NM_014685chr164531 509 225 211 ----1423
NM_014686chr1932588 701 528 ----1464
NM_014690chr7--22628 1005 22709 164 --
NM_014701chr1583184 3055 2251 1300 1263 1050 508 60 22422 2347 --23377 2842
NM_014702chr6173432 3413 2901 2597 2479 2444 2214 2165 2120 1284 1272 943 900 758 415 382 261 32824 2777 730 12790 12349
NM_014705chr7102084 1846 1714 1624 1564 1472 1309 426 271 87 31722 1368 288 ----
NM_014707chr751424 659 652 614 244 12024 11937 1858
NM_014709chr25574 568 509 246 226 ------
NM_014711chr16112080 2033 2002 1870 1724 1592 1533 1521 1418 1367 445 12073 151 2439 247
NM_014712chr16--1614 1632 --
NM_014720chr1051740 1504 1285 1173 1143 21798 1645 11433 21570 240
NM_014721chr6177419 7389 7314 7025 5971 5961 2904 2894 2519 2205 1984 1972 1891 1631 1441 1193 272 17275 76248 2433 2116 1977 1660 1505 605 1334
NM_014727chr191263 ------
NM_014729chr8102168 2076 2037 1867 911 776 646 623 194 175 167 3811 246 92 --
NM_014732chr1675182 5175 4067 3977 2291 2203 920 23792 1062 25089 2045 --
NM_014733chr582098 2030 1974 1840 388 339 323 212 41875 1773 738 711 11996 --
NM_014739chr6124000 3753 2940 2761 2583 1266 1018 428 354 282 103 92 12644 13507 --
NM_014743chr452418 1246 786 416 155 23028 2743 13199 --
NM_014746chr2144328 4093 4077 3662 3588 1494 1447 1399 1262 1163 849 627 570 455 ------
NM_014749chr142126 54 3810 780 348 ----
NM_014751chr882059 1835 1621 1512 455 355 306 230 1298 11609 --
NM_014752chr117784 643 587 349 336 232 133 1595 --1306
NM_014755chr2143612 3478 3093 2880 1703 1617 1592 1159 1141 1124 1074 822 367 118 44280 3765 712 694 --1552
NM_014757chr5112371 2270 2240 2189 2104 2021 1977 576 412 79 48 22207 2182 1358 12129
NM_014764chr122347 72 11266 31133 1128 1123 --
NM_014765chr192672 2523 2267 2010 2002 1956 1043 623 44 1863 32553 162 139 --
NM_014766chr763551 3188 2997 2750 1023 257 --12507 --
NM_014772chr1873109 2429 1414 1143 704 559 322 --13114 --
NM_014774chr1113266 2846 2392 2065 2045 1042 987 716 236 181 116 1354 13148 23072 392
NM_014775chr22194 ------
NM_014776chr1253075 3030 2270 2132 511 141 12673 --
NM_014779chr351085 993 983 439 260 1968 1773 2890 78
NM_014781chr83869 162 95 1435 ----
NM_014787chr132647 701 447 11909 22838 2620 --
NM_014790chr53418 365 118 ------
NM_014795chr281105 1064 957 539 403 366 332 275 11360 41179 1171 1008 975 1994
NM_014797chr6122607 2523 2502 2148 2102 1218 989 746 629 564 558 237 --1870 11236
NM_014802chr122853 285 21046 269 21148 712 --
NM_014810chr183674 3401 3363 2599 2480 1172 1013 631 13307 ----
NM_014811chr91152 2749 492 ----
NM_014812chr171911 1760 1449 1365 1252 1229 249 --2580 133 11509
NM_014819chr542314 2019 1819 315 1909 22241 2218 --
NM_014820chr361854 1841 1386 1357 383 199 11414 ----
NM_014824chr1121819 1664 1291 11850 --
NM_014826chr1154374 4213 4177 4035 3838 3727 3318 2997 2738 1080 949 847 737 516 268 --54343 4198 3862 2955 959 14063
NM_014827chr161577 664 528 365 353 22 --1444 1186
NM_014829chr592212 2189 2097 1846 1563 1501 660 524 251 2707 570 32343 2285 352 --
NM_014830chr1253918 1556 1112 820 339 23886 3297 43184 2749 1090 760 --
NM_014832chr1331887 672 617 2407 380 31908 1815 506 --
NM_014836chr1072008 1828 1471 1465 559 270 153 3729 353 295 1400 --
NM_014838chr22112835 2403 2280 1089 1045 963 651 409 393 256 196 22774 720 32888 2454 338 --
NM_014839chr192336 2322 2002 931 830 757 574 332 310 1348 1551 1818
NM_014840chr1293426 3274 3200 3181 3138 2651 1299 733 235 ------
NM_014848chr1572713 2588 2280 1827 1010 926 766 22349 1945 32627 717 124 --
NM_014850chr394374 3870 3645 3484 3300 3018 1472 1162 501 ------
NM_014860chr2122659 2505 2432 2409 1997 1652 906 849 748 677 335 165 1186 --11982
NM_014862chr1554225 3535 3473 3396 3235 13671 22987 243 --
NM_014864chr174412 3210 1487 1154 741 412 400 11346 13105 --
NM_014868chr121162 ------
NM_014870chr194735 4727 4289 4073 3512 3307 1479 1385 1056 --24636 3240 --
NM_014873chr1144670 4557 4495 4426 4419 4179 3896 3857 3601 3351 916 204 153 69 13836 14511 14608
NM_014876chr2232198 1373 244 1874 ----
NM_014877chr17247763 7654 7615 7609 7593 6948 6883 6840 6682 6583 6391 6310 6214 5380 4972 2950 2592 1907 936 830 513 217 206 100 66920 5502 4868 2958 1352 565 47229 5060 4827 4798 17554
NM_014883chr421827 746 12207 2818 423 --
NM_014888chr781607 1532 1347 475 394 369 267 85 11425 1384 11046
NM_014892chr63482 406 209 --1435 --
NM_014893chrY82341 1843 1540 943 672 401 244 114 --1506 1600
NM_014897chr1751170 1130 575 554 529 52350 693 370 324 254 --1287
NM_014898chr1962357 2302 857 426 194 125 --31745 222 33 1571
NM_014899chr5133146 3109 2983 2720 2683 2066 2011 1996 1099 998 460 270 34 12798 43047 3042 2051 586 --
NM_014900chr251085 1050 849 233 225 1287 1733 1358
NM_014902chr203195 179 29 ------
NM_014903chr1282465 2002 1681 766 434 319 192 31 42320 722 658 216 --12237
NM_014904chr10123715 3558 3295 2798 2625 2619 2513 1560 1221 1147 799 120 24035 1269 --22775 456
NM_014905chr262000 1844 1489 810 758 99 --31823 1289 576 --
NM_014906chr17143915 3842 3512 3398 2933 2667 1610 1538 996 972 833 751 737 533 --34071 3743 1643 --
NM_014912chr10113455 3327 3049 3021 1341 1158 786 604 244 230 137 43411 3141 2357 269 33346 3224 2305 21194 904
NM_014916chr71725 1599 ----
NM_014918chr1561492 1250 1129 654 223 102 21315 1137 ----
NM_014920chr673575 2970 2503 2385 1418 1411 671 --43171 1129 624 217 53370 2345 304 290 116
NM_014923chr1342380 2003 1553 1439 21522 76 31675 171 37 --
NM_014924chr1473198 2874 2599 2037 1140 995 387 --22548 567 --
NM_014926chr33901 369 294 31008 392 276 ----
NM_014932chr371300 1272 741 422 407 180 136 ----11684
NM_014936chr6102776 2749 1849 1762 1140 965 741 584 419 95 22627 471 21101 140 22055 1949
NM_014937chr10101268 1220 869 483 446 269 234 161 71 34 ------
NM_014945chr52232 162 21761 249 ----
NM_014946chr2133109 3039 2916 2735 2458 1918 1094 1037 1002 964 874 626 33 32938 1056 502 ----
NM_014947chr1102670 2440 2305 2038 1088 825 440 172 149 104 ----12375
NM_014949chr14984 663 370 360 1999 ----
NM_014950chr1461734 1691 1364 1127 551 180 --1192 1307
NM_014951chr1052324 1973 1933 1684 1008 --22434 187 --
NM_014953chr13104186 3618 2720 1285 948 625 396 334 139 113 14134 33925 1293 530 --
NM_014961chr472203 1865 1744 1557 1395 242 123 ------
NM_014962chr20142568 2419 2376 2358 2351 2271 2077 1110 1102 1081 1067 1038 515 227 1980 42512 2493 2252 735 --
NM_014964chr1752163 808 761 550 360 2872 680 1469 --
NM_014969chr131037 1014 908 2989 349 21066 974 --
NM_014977chr143530 521 515 ----1486
NM_014978chr1081782 1580 1461 1251 561 332 251 42 --1478 --
NM_014982chr14154971 4566 4512 4080 4007 3879 1862 1797 1765 1487 1128 1000 541 308 98 11913 33285 1251 1164 --
NM_014988chr421928 1894 22823 2000 1382 --
NM_014989chr631458 1365 265 --11670 1682
NM_014990chr146910 822 543 462 416 316 ------
NM_014991chr411219 53101 2836 2629 2254 327 11083 --
NM_014997chr772763 2738 2314 2243 1140 728 56 12906 ----
NM_014999chr1281629 1461 1399 1199 1071 653 123 92 11281 --11565
NM_015000chr12122954 2929 2902 2684 2660 2616 2606 2518 1016 972 899 830 12630 32201 223 205 --
NM_015002chr1262168 1620 1425 817 802 617 1327 2761 720 12082
NM_015008chr3123480 2921 2364 2220 1394 1102 1024 890 836 691 436 222 1730 1182 13054
NM_015009chr34742 649 299 164 1773 ----
NM_015011chr1331111 458 402 1442 1433 --
NM_015013chr1--1296 ----
NM_015020chr1663108 2778 2592 2546 903 274 --11495 --
NM_015024chr841326 1320 966 492 11151 ----
NM_015025chr292604 2314 1976 1064 1018 875 551 338 154 --2484 143 22671 1933
NM_015026chr12214707 4700 4494 4486 4368 3931 3875 3820 3507 3452 3324 3306 1624 1433 1309 1286 914 694 551 472 210 34072 2949 896 64510 3223 3088 2977 1653 425 1934
NM_015027chr1632015 1822 1602 11318 1252 --
NM_015032chr13152436 2240 2121 816 788 751 745 721 663 522 435 324 313 170 138 22026 1036 21016 798 22086 1073
NM_015039chr1124359 4249 4231 3792 3229 2798 1699 1625 976 550 503 44 14050 13117 --
NM_015040chr2113329 3223 2902 2302 2089 1106 925 671 538 180 80 12602 12232 23346 2748
NM_015042chr1554188 3826 3175 2811 1415 43533 3483 1384 1375 --11141
NM_015045chr1062258 2148 2020 622 304 268 --11675 12154
NM_015046chr952707 2691 1850 1811 599 12456 --22570 414
NM_015049chr2113288 3274 3009 2970 2904 2591 2264 2042 2020 1238 411 32240 709 27 13259 --
NM_015051chr982755 2503 2492 849 702 568 241 98 1265 --22068 1162
NM_015052chr731064 484 118 2559 438 ----
NM_015054chr123467 433 91 ------
NM_015055chr1152989 2837 1845 126 57 22929 1870 11974 --
NM_015056chr2182573 2440 2130 1854 1844 320 233 85 --12608 --
NM_015057chr131616 1706 ----
NM_015059chr1553991 2986 2726 364 319 --13831 --
NM_015060chr71222 ------
NM_015062chr10--1109 ----
NM_015068chr7103518 3490 3444 3436 3379 2740 1514 1450 419 84 --13917 --
NM_015069chr161208 ------
NM_015071chr5126360 6247 5985 5593 5513 4841 2391 2303 2185 1936 1613 31 11729 --14943
NM_015074chr1114815 4732 3458 3058 3017 1657 692 475 422 349 69 --34626 3568 759 --
NM_015076chr6114557 3501 3126 3119 1371 1140 764 651 538 373 169 64324 4202 3479 813 687 413 --14525
NM_015079chr1532596 668 531 23185 2652 --12698
NM_015082chr552634 2566 1694 384 115 --1589 1622
NM_015087chr1362686 2267 1879 1794 995 860 32105 404 324 32579 772 141 --
NM_015091chr144706 633 248 125 1722 1699 --
NM_015092chr16113769 3725 3699 3512 1849 1549 1323 1306 1274 1226 723 14086 14634 --
NM_015093chr661778 1348 1197 661 518 378 11846 ----
NM_015094chr2284462 4129 1824 1774 909 888 310 153 --14691 --
NM_015097chr3121957 1851 1702 1692 797 763 670 434 424 400 366 187 --21879 287 12151
NM_015100chr151980 1764 1668 682 410 22040 564 11745 1119
NM_015101chr192899 2738 2316 2295 2136 1837 1003 747 508 1434 ----
NM_015110chr9102515 1827 1784 1545 798 773 564 432 361 344 22539 2070 41736 778 587 541 1826
NM_015113chr172846 49 --1871 --
NM_015115chr472917 2875 2847 2814 2095 2058 2010 12746 21236 390 12390
NM_015116chr1331250 1075 512 21689 1202 21552 1163 1173
NM_015120chr23298 116 102 1276 141 --
NM_015124chr2262529 2505 2332 2020 829 159 --12465 --
NM_015130chr471319 1268 1147 1127 907 487 53 --11273 11061
NM_015132chr761799 1491 795 741 683 667 11587 21252 719 --
NM_015137chr8112510 2408 2023 2011 1952 1919 1757 1640 926 626 492 --1266 11818
NM_015138chr15122867 2653 2526 2313 2284 1935 1857 1835 829 627 245 170 22030 656 ----
NM_015141chr3142680 2397 2311 2147 2070 2035 2012 1930 1896 735 522 503 403 340 12370 11805 --
NM_015143chr461401 1377 1331 1302 424 287 --153 --
NM_015144chr16144024 3990 3942 3935 3273 3189 3146 3069 2956 2767 1602 1429 951 116 12645 33952 3278 441 13839
NM_015149chr142086 1467 601 473 1509 2502 324 --
NM_015153chr66702 590 544 299 292 263 ------
NM_015155chr1062827 2082 1317 1153 300 210 12563 42396 1296 1212 749 --
NM_015156chr14123856 3814 3732 3690 3310 3196 2743 2563 1502 1083 999 542 --22753 400 --
NM_015161chr1661428 1399 974 617 355 103 --21543 955 --
NM_015163chr1442018 1886 304 287 --11681 --
NM_015170chr852136 2127 1640 899 838 22312 2241 ----
NM_015172chr171479 1461 1252 1213 1143 1117 516 21405 539 11332 --
NM_015173chr451651 1394 659 589 248 --31705 686 643 --
NM_015176chr191775 1687 1558 1360 1274 1194 1181 466 199 1585 ----
NM_015178chr8--22671 857 1270 --
NM_015180chr142679 564 1556 1292 --
NM_015184chr32679 106 ------
NM_015185chrX42936 2886 1943 26 --1475 --
NM_015186chr94456 383 313 22 1444 ----
NM_015192chr20112775 2677 2493 2473 2263 2171 2008 915 586 429 340 32667 2307 2069 13002 --
NM_015196chr4--1112 ----
NM_015199chr362874 2795 2708 1866 239 69 1703 1360 --
NM_015200chr4152374 1983 1663 1045 1035 924 882 826 780 718 647 531 509 417 362 1860 --1625
NM_015203chr1179 ------
NM_015206chr1563157 2895 2820 1207 1003 517 --13665 13076
NM_015208chr1893839 3654 3228 2826 2679 1344 998 637 361 33526 2632 1323 22982 1054 43317 1292 526 152
NM_015209chr172347 2086 2039 1625 762 604 395 ------
NM_015213chr112684 161 ------
NM_015215chr173046 2503 2437 2310 801 525 172 13173 21283 1086 --
NM_015216chr561209 627 576 352 340 115 2996 29 ----
NM_015225chr952918 2903 875 221 100 23022 949 52432 632 601 291 170 --
NM_015230chr441672 1352 394 56 --1190 --
NM_015231chr111979 2947 25 1844 --
NM_015233chr1321882 432 1409 ----
NM_015234chr631246 1044 898 ------
NM_015235chr1062106 1915 1898 1582 222 212 11546 21688 40 --
NM_015236chr431057 1000 103 --1591 --
NM_015239chr93352 186 56 --1209 --
NM_015245chr662638 2544 2086 1910 860 563 1296 ----
NM_015247chr16195422 5233 5227 5073 5067 4981 4850 4076 3960 3638 1893 1694 1345 912 443 371 309 262 108 34885 1463 1378 1770 24183 1259
NM_015256chr51188 --2182 113 --
NM_015265chr2112618 2543 2367 2311 2091 1751 1652 469 171 131 116 --2936 259 --
NM_015267chr1252176 1994 1775 1438 340 11796 22165 2086 --
NM_015269chr12630 156 ----1410
NM_015271chr4154234 4129 4061 4006 3881 3576 3102 3062 3012 2792 1627 888 832 521 93 24040 3938 --13567
NM_015272chr1641816 858 392 336 1453 2541 468 --
NM_015275chr1251326 667 522 203 144 1871 21964 1699 1619
NM_015277chr183589 502 297 --2539 400 --
NM_015278chr662571 2440 1221 1136 589 245 --12551 --
NM_015282chr252769 2725 2700 2009 1965 --22665 400 22750 1091
NM_015285chr1832330 2236 588 --31847 1797 1730 --
NM_015286chr1562094 1783 1722 613 429 73 21842 153 1209 --
NM_015288chr553559 3486 3229 2880 129 13619 23413 2939 --
NM_015291chr1163545 3510 3439 3158 3060 2881 2553 2537 2356 2164 1413 1313 832 782 148 105 11007 ----
NM_015294chr1741059 925 784 763 2419 216 ----
NM_015296chr1351141 1104 953 944 159 --21186 395 11157
NM_015299chr1493906 2503 1394 1123 775 749 580 228 138 ------
NM_015308chr114799 707 225 72 2898 839 ----
NM_015310chr8248410 8339 8120 8112 8101 7584 7514 7367 7231 6764 6481 6006 5164 5147 5085 3228 3150 2946 2406 2177 1500 1416 1298 315 58279 5661 5447 1787 438 45559 5431 3049 1174 --
NM_015313chr11184713 4680 4652 4558 4494 4471 4366 4344 4182 3973 3832 3115 1860 1614 1126 432 385 377 43817 3369 1682 896 53788 3735 3650 2920 849 --
NM_015314chr7102320 2251 2091 2037 1926 1020 950 801 562 516 42447 2433 724 501 31819 973 406 --
NM_015315chr543429 2960 724 127 23439 271 1729 --
NM_015317chr292690 2568 2416 2237 2064 1971 1051 877 517 42793 2349 1795 476 1130 --
NM_015321chr1951685 1240 1017 999 805 34918 4901 581 13323 --
NM_015323chr641635 1148 486 271 ----31157 1128 398
NM_015326chr192924 2134 2018 1144 966 871 481 464 445 2925 565 1626 --
NM_015328chr753073 2830 2763 1207 628 32392 1915 510 ----
NM_015331chr12626 584 ------
NM_015335chr12122607 2572 2261 2177 2108 2028 1984 1866 1831 1678 831 609 32477 943 884 22251 642 --
NM_015336chr12102562 2546 2096 2030 2015 1916 1874 225 154 130 11700 11792 12552
NM_015339chr2051024 1003 915 819 406 11015 1276 --
NM_015342chr51130 ------
NM_015344chr892196 1972 1872 1686 1602 749 709 139 117 --1648 --
NM_015345chr6--12782 ----
NM_015347chr12102347 2176 2089 1922 1155 1078 737 701 691 399 12773 12444 32999 2275 1174
NM_015349chr692857 2812 2755 2725 2408 1901 1085 475 166 12910 12145 1930
NM_015352chr2053822 3802 3490 2740 2618 1340 ----
NM_015355chr17121839 1808 1656 1604 1256 720 571 514 477 224 196 46 ----1359
NM_015358chr2191298 1220 1100 1075 983 957 865 336 276 2891 81 ----
NM_015359chr872942 2782 2066 2020 1983 1912 1898 11861 12825 1852
NM_015361chr22815 28 2281 265 ----
NM_015365chrX164191 3944 3914 3780 3750 3635 3525 3048 2754 2711 1126 637 563 439 207 200 23924 3721 41491 950 826 101 44174 2644 1066 749
NM_015367chr2241587 1199 1099 437 ------
NM_015378chr142208 2154 680 196 12466 22836 2501 --
NM_015379chr71215 --174 --
NM_015382chr146580 553 522 227 130 35 1721 ----
NM_015385chr1052834 2780 2536 1159 31 --13270 12742
NM_015387chr261620 1343 745 576 102 64 ------
NM_015391chr31629 ------
NM_015393chr4113667 3661 3463 3257 2846 2668 1517 1158 996 299 41 21232 968 12931 --
NM_015394chr1241627 950 706 480 1674 2167 38 --
NM_015397chr931797 225 214 1366 1554 --
NM_015409chr1272732 2610 2383 1928 1827 329 62 22785 448 1145 12697
NM_015423chr1121630 1143 --31746 1635 90 --
NM_015429chr36771 746 730 371 259 189 2928 319 --1862
NM_015432chr161641 ------
NM_015435chr86990 977 571 369 211 195 --21388 395 --
NM_015436chr4163259 3213 3097 3044 3024 2979 2967 2870 2649 2532 1234 1157 1131 921 452 317 22685 539 --13154
NM_015446chr161642 1631 1323 1143 436 113 31678 537 321 11330 2422 192
NM_015455chr5154130 3960 3777 3458 3413 3386 3372 2815 2714 1484 1478 1400 748 450 395 31658 1008 196 11045 24011 3173
NM_015457chr1161117 1100 1093 876 324 212 ------
NM_015458chr8135099 4285 3941 3872 3567 3554 3377 1381 1257 932 670 213 108 14327 33219 298 243 --
NM_015460chr362018 1661 1384 797 472 321 22003 1859 ----
NM_015462chr172252 44 ----132
NM_015464chr74821 711 311 45 1898 1858 --
NM_015469chr93666 651 91 2310 157 ----
NM_015472chr34500 477 352 131 ------
NM_015472chr34500 477 352 131 ------
NM_015474chr203439 273 98 ------
NM_015475chr251080 933 853 805 167 ------
NM_015483chr74724 367 126 42 --2230 120 --
NM_015484chr13857 784 277 1929 2684 82 1242
NM_015485chr1193 1284 ----
NM_015497chr1531099 831 409 ------
NM_015508chr351578 1534 991 573 519 ------
NM_015520chr382807 2663 2457 2386 2127 1921 1777 320 12621 1833 --
NM_015525chr62191 27 ----1202
NM_015530chr22786 217 ------
NM_015532chr1592805 2549 2169 2075 1072 1015 941 311 254 22460 1779 12387 1106
NM_015534chr11929 1996 ----
NM_015535chr294197 2719 1586 911 574 520 468 231 221 11046 ----
NM_015544chr173607 594 588 ------
NM_015548chr64940 819 371 148 --1153 --
NM_015550chr7103418 3226 3051 2379 1426 1116 1094 1028 545 292 2591 228 33470 3455 2509 22304 930
NM_015553chr695061 4901 4099 1972 1699 1360 1352 875 345 24188 1602 2648 34 13252
NM_015554chr15132801 2453 2398 2374 2095 1819 1156 1095 931 912 413 247 83 32929 2836 2784 22366 806 --
NM_015555chr6101746 1740 1202 1180 687 587 556 483 264 152 11121 2540 350 --
NM_015556chr141214 ------
NM_015559chr18--1936 ----
NM_015564chr532862 176 46 ------
NM_015565chr21112047 2024 1964 1948 1865 1479 1405 591 494 436 174 31605 267 186 ----
NM_015567chr1361210 1058 1032 972 476 255 ------
NM_015568chr2054098 1691 1635 1084 860 13607 14054 --
NM_015569chr184629 4569 4160 1774 1485 871 498 260 34224 1893 215 13161 --
NM_015570chr731557 1368 456 11322 --1463
NM_015571chr652679 2480 2430 1852 585 3872 490 419 11945 --
NM_015575chr293635 3481 3454 3288 1474 556 266 150 93 13536 13274 --
NM_015576chr322388 2201 12490 42956 2466 807 413 --
NM_015578chr1961868 1453 1339 1295 697 328 1598 12035 21465 652
NM_015599chr61276 ------
NM_015601chr106977 870 826 656 366 273 ------
NM_015602chr161799 1787 1693 1483 1428 1341 1434 11255 11659
NM_015605chr1031136 570 25 --31517 1124 366 1411
NM_015608chr102140 74 ----1562
NM_015609chr122983 2420 11831 --12971
NM_015610chr742905 549 216 81 --2116 60 --
NM_015622chr71247 ------
NM_015626chr1741056 936 372 64 --1783 --
NM_015630chr24844 812 802 283 11058 2783 399 --
NM_015635chr971846 1816 1496 1490 1451 350 125 --51511 1506 1501 1476 864 --
NM_015640chr1195389 5216 5168 5110 5056 4500 4381 4323 4311 4130 1618 1554 1363 1115 1084 760 530 483 33 55256 3326 1877 848 616 32075 499 142 34945 1725 1122
NM_015646chr1251164 1050 997 386 323 11074 179 1342
NM_015652chr10152 179 1541 --
NM_015660chr71249 ------
NM_015676chr141147 ----1412
NM_015678chr1341669 1371 1118 158 21360 1216 2512 164 1431
NM_015691chrX72885 2039 399 387 281 271 43 ----2233 162
NM_015693chr4--1303 ----
NM_015695chr642115 1880 1858 1767 --12023 --
NM_015713chr873399 3100 2858 2788 2353 1222 79 43591 3138 2724 554 13316 --
NM_015714chr12325 139 1389 ----
NM_015723chr76595 540 483 256 228 94 ------
NM_015833chr2162179 1636 1529 868 451 437 --1354 --
NM_015844chr182994 973 --2844 795 --
NM_015846chr182994 973 --2844 795 --
NM_015847chr182994 973 --2844 795 --
NM_015852chr7153635 3485 3422 3303 3109 3059 2858 2826 2810 2769 2690 2403 2321 1303 1270 ------
NM_015859chr14--123 ----
NM_015866chr141341 1231 1022 613 --21247 1074 11521
NM_015869chr3----1134 --
NM_015878chr8102252 2222 2204 1891 1840 1706 1428 806 588 564 2665 344 ----
NM_015879chr18168014 7987 7719 7243 6728 5587 2863 2770 2588 2373 2153 1465 1355 625 308 283 15225 58241 7083 6225 2234 1419 16540
NM_015885chr114773 645 153 74 ------
NM_015886chr8185607 5570 5431 5076 4719 4064 4048 3973 3735 3585 3501 2071 1888 1739 1603 1482 1249 1034 34646 4258 133 21397 689 --
NM_015888chr1133334 3273 3129 2235 2183 2127 2078 1106 592 495 300 166 126 11323 13396 --
NM_015889chr222865 121 ------
NM_015891chr661661 1447 1419 724 416 122 1183 ----
NM_015892chr1042407 1939 1738 58 22092 1892 ----
NM_015901chr10----1829 1578
NM_015902chr83861 671 330 2823 693 ----
NM_015904chr22533 301 2845 793 --1330
NM_015906chr1104428 4356 4067 3064 1939 1493 1138 603 550 496 24057 3475 43834 1855 1833 968 13739
NM_015912chr882515 2331 1764 779 759 381 205 53 22217 2195 ----
NM_015914chr16----169 --
NM_015938chr32397 234 1266 1249 1897
NM_015939chr204639 564 521 62 ------
NM_015948chr6132 1360 ----
NM_015959chr114619 540 137 82 --1499 --
NM_015976chr11327 ------
NM_015982chr17----1374 --
NM_015984chr12496 447 --1461 --
NM_015986chr1751210 1061 513 147 75 11400 21254 201 --
NM_015994chr143566 234 49 ------
NM_015995chr1544992 4602 4592 4584 14335 25532 3608 15453
NM_016002chr11750 --2639 195 --
NM_016003chr742905 549 216 81 --2116 60 --
NM_016009chr1114942 3835 3392 3227 3166 1586 1564 548 414 327 228 44614 3906 1786 1623 14890 140
NM_016018chr882596 2371 2007 1870 1832 1745 746 55 12159 41975 1839 1044 169 --
NM_016019chr731072 737 254 1231 --1396
NM_016021chr6123048 2953 2595 2569 2558 2318 1979 920 871 636 593 279 22765 855 32423 552 515 1627
NM_016023chr8121920 1765 1743 1662 850 692 563 515 410 193 167 117 21372 826 12097 --
NM_016025chr1651791 553 509 214 204 31603 283 159 41715 1361 1236 808 --
NM_016040chr182665 2654 2391 2131 877 785 268 130 42745 2174 616 566 12559 --
NM_016041chr174285 112 72 65 --1130 --
NM_016048chr53812 347 237 21008 384 ----
NM_016059chr62834 160 1860 ----
NM_016061chr241362 1189 390 333 ----11146
NM_016072chr1272361 1736 972 913 610 470 343 11883 --22221 1751
NM_016073chr155964 919 735 299 181 --1909 --
NM_016075chr13103180 3044 2187 2155 2001 914 907 870 569 271 32822 2181 1982 33171 1942 526 22426 300
NM_016076chr172885 2508 2419 1003 807 705 216 43239 933 376 253 12025 2995 191
NM_016078chr173166 106 24 --3990 831 127 11117
NM_016079chr262305 1903 1727 550 352 336 --155 1907
NM_016081chr482183 1686 1675 1626 1485 835 441 270 32136 1870 737 --11806
NM_016083chr6103639 3283 3057 2884 2829 2610 1412 589 512 99 22762 333 13879 23766 2440
NM_016087chr761518 1495 1447 684 471 166 11156 21664 1368 --
NM_016090chr1113954 946 834 431 393 299 262 253 219 200 168 99 39 2121 28 ----
NM_016093chr51140 1208 1154 --
NM_016096chr871905 1583 1502 1487 1370 306 135 11782 21516 500 --
NM_016097chr1861092 1069 1044 1010 959 59 ------
NM_016098chr61192 1133 ----
NM_016099chr861373 1325 1298 1249 389 275 --1196 --
NM_016100chr204385 147 103 41 ------
NM_016101chr1681395 1291 1262 1060 550 355 209 50 21449 1017 11079 21324 1170
NM_016103chr52387 356 ------
NM_016107chr54465 381 297 248 --2429 253 --
NM_016120chrX3289 184 67 ------
NM_016125chr171380 1429 1505 --
NM_016128chr31214 ------
NM_016131chr262228 2006 1980 1694 1595 783 --41836 363 171 136 11789
NM_016132chr1563388 3358 3135 2726 2253 931 23105 369 1582 --
NM_016133chr251655 1435 1423 1374 486 ----11604
NM_016138chr1621548 1286 2479 272 3321 316 311 11301
NM_016169chr1032098 2042 1086 --2533 507 13148
NM_016194chr1541376 1268 530 373 --1438 --
NM_016195chr103894 736 140 3189 176 125 2854 354 134
NM_016200chr74697 282 213 79 138 1151 --
NM_016203chr72228 215 --2907 166 --
NM_016205chr431298 1248 967 ------
NM_016206chr3228948 8863 8617 8227 7562 6405 6049 5935 5891 5634 3507 3182 3111 3034 2341 1976 1837 1235 1025 978 264 197 46203 5883 2181 1571 68692 8382 6706 3126 3065 770 56662 6334 5998 5691 3499
NM_016217chr693396 2970 2868 2633 1222 1214 1067 1025 265 22840 64 51373 1337 119 49 32 --
NM_016218chr54840 284 193 77 2294 178 1381 149
NM_016221chr562334 2105 1911 1694 940 809 12082 21513 559 --
NM_016224chr631749 782 302 1470 21713 144 1821
NM_016227chr141571 1331 555 334 21010 435 1442 21414 229
NM_016230chr63395 190 24 ------
NM_016231chr1761540 1529 310 235 213 99 11233 --11692
NM_016248chr13183965 3879 3349 3305 3265 3116 3042 3019 1453 997 946 856 815 763 736 591 145 26 32953 2846 1609 43538 3273 2515 2435 --
NM_016252chr23820 195 157 --4680 632 325 320 --
NM_016255chr672796 2740 2421 1265 1232 615 338 --12305 2983 235
NM_016258chr11248 ------
NM_016260chr2297634 7337 7299 6949 6905 6578 6442 6086 5952 5940 5628 5466 5389 5380 5186 5133 4992 4960 4939 4867 2496 2236 1622 1533 1246 776 398 222 103 36774 5786 1308 47477 2936 950 428 27468 726
NM_016264chr192145 36 1511 ----
NM_016269chr431026 998 148 11186 11048 --
NM_016270chr19--2445 358 ----
NM_016271chr1892346 2309 2156 2075 1650 1638 580 205 120 128 42065 1577 344 266 --
NM_016272chr2252724 2392 2221 2037 1855 1243 12152 --
NM_016274chr1174 ------
NM_016275chr362797 2680 2611 2587 2034 860 52424 944 715 418 399 22632 1013 1469
NM_016277chr6101647 1536 1516 1464 1388 1174 647 339 289 97 ----11119
NM_016281chr1271104 1084 973 848 349 289 88 --1472 --
NM_016282chr961675 1330 1170 1119 657 121 11561 31716 1467 136 --
NM_016283chr51222 --186 --
NM_016287chr162112 1821 295 207 177 166 21496 356 1331 --
NM_016289chr2112200 1955 1838 1688 1451 707 689 462 356 215 129 --11682 --
NM_016290chr51275 1189 ----
NM_016298chr352745 2565 2414 2160 771 ----1763
NM_016299chr101114 ------
NM_016303chrX276 52 1455 ----
NM_016304chr153676 630 25 --175 --
NM_016306chr32122 89 --123 --
NM_016308chr15664 559 502 344 151 31393 1335 276 ----
NM_016312chr121440 ------
NM_016315chr2111909 1834 1737 1634 1625 1469 517 213 174 113 72 21528 671 1476 --
NM_016316chr26742 718 666 241 194 102 196 ----
NM_016322chr9153181 2973 2866 2664 2486 2269 2180 1992 1256 1182 1116 1099 705 603 338 21109 615 1624 --
NM_016338chr521115 1067 11173 21036 300 1209
NM_016351chr73563 548 511 152 ----
NM_016356chr6202889 2857 2826 2809 2786 2703 2577 2487 2477 2449 2413 2322 2296 2272 2221 1095 377 316 195 162 22850 1060 12870 --
NM_016357chr12101263 1248 1185 986 793 423 221 203 125 61 11160 ----
NM_016374chr151299 994 475 158 25 21152 61 21225 1093 1105
NM_016374chr151299 994 475 158 25 21152 61 21225 1093 1105
NM_016376chr17114300 4200 3953 3892 3393 3134 1515 1344 1184 636 437 1803 14062 --
NM_016377chr661715 1481 1227 593 513 274 11401 1375 11108
NM_016396chr15142973 2538 2433 2412 2366 2262 2068 1955 1905 612 580 454 357 249 12934 52420 1854 412 326 166 --
NM_016410chr91139 ------
NM_016422chr11112988 2889 2710 2577 2484 2335 2282 981 874 575 118 --12408 33070 2035 826
NM_016424chr1771857 1666 1384 524 497 428 57 --1469 --
NM_016436chr2032184 993 985 ----1884
NM_016441chr282258 2211 2201 2105 1994 1840 868 684 11681 ----
NM_016448chr151872 1435 1291 1223 606 21202 1187 21321 472 --
NM_016451chr112312 28 ----1290
NM_016463chr5--1143 ----
NM_016467chr241158 473 449 28 31368 503 218 ----
NM_016472chr1441409 1380 379 109 --11079 21073 429
NM_016476chr171153 ------
NM_016485chr661662 766 651 527 380 145 1315 --22077 1720
NM_016486chr11499 --1460 --
NM_016487chr6176 ------
NM_016499chr11163 --1543 1549
NM_016507chr1772133 2082 1142 740 663 429 295 11967 ----
NM_016513chr673575 2970 2503 2385 1418 1411 671 --43171 1129 624 217 53370 2345 304 290 116
NM_016516chr22814 581 1782 --1337
NM_016519chr42534 51 --2502 415 --
NM_016522chr1181481 1431 1401 1193 606 599 452 165 --21468 1072 --
NM_016530chr15183827 3762 3684 3550 3356 3180 2998 2891 2857 2759 2748 1111 1005 833 654 581 292 253 14114 44091 3961 3806 2606 --
NM_016531chr4114156 3462 3225 2846 2718 2574 1671 1269 1195 590 98 21104 846 23017 434 13514
NM_016542chrX31652 1438 681 ----1170
NM_016548chr951554 1032 569 196 134 --2328 147 --
NM_016557chr31272 --11042 1716
NM_016559chr341493 1036 987 519 --171 --
NM_016569chr1231577 977 521 --157 1476
NM_016570chr122462 124 ------
NM_016587chr741144 1020 222 183 21135 22 11095 11055
NM_016588chr66865 722 680 240 180 156 --1297 --
NM_016599chr461551 1333 302 257 186 61 --11453 1313
NM_016603chr552136 1977 1845 1734 321 32242 1949 1916 21814 299 11851
NM_016604chr521269 1043 --1887 --
NM_016605chr542745 2356 2227 2114 12663 12657 --
NM_016607chrX41344 1336 1326 216 ------
NM_016617chr1392135 2042 1934 1828 1678 1672 715 587 512 11835 12083 --
NM_016620chr121237 1051 1581 11294 1181
NM_016621chr11104622 4614 4483 4014 2984 1210 1173 1040 1024 866 23209 1231 ----
NM_016622chr261907 1797 1413 591 169 46 3759 692 582 --12136
NM_016623chr82564 108 ------
NM_016626chr1871750 1588 1307 1254 469 370 113 --21672 1247 --
NM_016630chr151376 --1434 --
NM_016631chr212778 739 --1222 --
NM_016641chr1651743 1607 1518 368 73 11349 11406 --
NM_016644chr54550 400 372 184 --1420 --
NM_016647chr811451 ------
NM_016651chr143319 266 97 11083 ----
NM_016654chr15101401 1257 1250 1234 914 900 476 309 166 27 2526 468 1965 --
NM_016655chr15--124 ----
NM_016818chr214823 550 261 205 --1610 --
NM_016819chr32523 512 ------
NM_016820chr3127 ------
NM_016824chr1071941 636 454 392 347 204 122 --2582 545 1179
NM_016836chr23272 230 86 ------
NM_016839chr23272 230 86 ------
NM_016929chr674413 3998 3943 3241 3009 937 347 1107 24234 2829 24346 1779
NM_016950chr451463 1210 1005 601 434 1195 1160 1293
NM_016952chr11123764 3447 3421 3376 3337 3304 1569 1290 1009 809 752 616 23353 169 14015 23467 856
NM_016953chr2146133 6113 5818 5669 4982 4653 4634 4154 4123 4083 2042 1882 1546 1292 --36013 5895 491 --
NM_017412chr82530 459 3324 270 153 151 2452 287
NM_017415chr5114577 4539 3239 3059 3007 2910 1592 1348 1016 575 259 23024 2973 31749 1174 591 11626
NM_017416chrX--1130 ----
NM_017420chr14123799 3395 3283 2446 1449 1249 1096 1008 935 820 759 131 43406 3051 2412 971 33485 3460 685 23858 3441
NM_017423chr4112245 1890 1778 1692 1635 1354 445 436 356 285 159 12054 22162 1904 32092 688 218
NM_017426chr43650 555 230 1547 ----
NM_017431chr2----1692 --
NM_017437chr1451774 827 739 627 606 ----22451 922
NM_017440chr126591 488 440 107 52 21 ----1657
NM_017447chr21234416 4234 4173 4012 3900 3873 3035 2996 2857 2672 1696 1226 1191 1064 964 444 435 401 291 142 97 61 36 22879 458 3543 280 238 1417
NM_017449chr121748 606 11129 --11105
NM_017452chr2031432 966 931 ----21505 1453
NM_017453chr2031432 966 931 ----21505 1453
NM_017454chr2031432 966 931 ----21505 1453
NM_017455chr152252 175 1789 --1918
NM_017490chr111292 ------
NM_017495chr2021439 218 ------
NM_017516chr1111108 --2350 247 1130
NM_017519chr63920 914 350 11326 --1926
NM_017522chr151275 1259 1211 512 430 21450 223 ----
NM_017526chr14397 166 133 77 1117 ----
NM_017528chr7174 ------
NM_017544chrX4671 299 278 237 ----1905
NM_017548chr331847 777 300 ------
NM_017549chr751436 1323 460 242 113 11138 2574 420 --
NM_017553chr151163 11245 11338 --
NM_017558chr161448 ------
NM_017563chr3136226 6202 5226 5187 4760 4590 4126 1845 1063 584 404 365 32 14643 11625 14596
NM_017577chr341037 608 449 341 11603 --21563 1084
NM_017578chr3122 ------
NM_017580chr103523 399 193 --2528 228 --
NM_017581chr42313 122 ------
NM_017594chr983032 2309 2197 1032 1012 841 629 487 23213 3007 13289 --
NM_017599chr12132034 1838 1729 1677 1631 1615 1427 1416 1386 768 603 575 235 --1441 --
NM_017610chr1592122 2115 1901 1536 845 427 389 320 230 32078 1557 1493 21356 742 --
NM_017612chr125567 498 452 396 148 --2184 39 --
NM_017617chr961539 235 211 193 167 135 21507 113 ----
NM_017626chr1011328 ------
NM_017628chr4175115 4213 3834 3787 3770 3693 3664 3628 3543 3283 2036 1407 1124 1062 1027 712 312 33934 3850 220 23494 1731 25126 2070
NM_017629chr161903 1301 551 496 288 146 --21470 568 --
NM_017633chr673202 2867 2778 2646 2548 1544 1150 11373 3887 882 863 21071 1058
NM_017634chr861785 1564 1213 487 364 277 1576 1446 --
NM_017635chr1171445 1324 1299 1285 538 183 37 --11335 --
NM_017637chr9289321 9277 9243 8475 7626 7569 7340 7225 6890 6865 6855 6804 5739 3779 2771 2758 2736 2510 2466 2440 2296 2255 2005 1993 999 869 760 479 49464 5810 2516 216 29405 5951 17707
NM_017640chr67938 823 808 743 696 125 106 1856 1904 --
NM_017641chr1271083 867 835 807 246 233 57 1848 ----
NM_017643chr17112923 2770 2722 2619 1975 1911 1125 980 568 155 39 1653 23087 554 --
NM_017644chr3174993 4929 4917 4689 4340 4308 4033 3595 1910 1904 1805 1786 1718 1677 759 473 89 45069 4329 3343 250 33384 590 508 24415 1364
NM_017645chr9103091 3048 2741 2526 2394 2351 1216 752 523 439 42302 1102 774 194 22654 2380 13197
NM_017650chr7205765 5056 4971 4957 3890 3674 2422 2402 2160 1919 1630 1607 1465 1349 1226 1199 1159 1097 1035 180 35727 5599 2279 11480 12287
NM_017654chr751773 1744 1293 1098 75 ------
NM_017658chr14214604 4543 4506 4394 3965 3675 3574 3019 1836 1747 1434 1347 1280 878 647 620 505 397 345 287 236 34196 3953 862 34548 3338 1486 11254
NM_017660chr19----1923 13212
NM_017661chr1561169 1092 483 371 229 128 ------
NM_017666chrX31769 1708 1678 11658 31743 1689 1638 --
NM_017667chr7173 1173 1108 --
NM_017669chrX2285 26 1308 ----
NM_017672chr1561179 1171 1120 1114 375 212 1260 3877 360 286 --
NM_017680chr931004 734 328 --2312 142 --
NM_017684chr1561591 1584 1388 714 385 71 11261 ----
NM_017691chr153427 386 38 --1391 --
NM_017693chr1341441 1336 390 79 1351 --11477
NM_017694chr231939 1620 587 1614 12027 --
NM_017699chr331722 1513 1481 ------
NM_017700chr42100 57 1138 ----
NM_017704chr116967 742 340 234 220 149 1373 ----
NM_017709chr1144047 3865 3339 3331 3315 1635 1354 1262 1164 1035 991 900 469 143 13393 12652 13583
NM_017714chr204856 374 330 84 199 ----
NM_017719chr392381 2084 1971 1834 1592 348 233 164 89 11943 ----
NM_017724chr34627 240 233 182 1126 1728 1133
NM_017730chr35570 549 533 156 98 ------
NM_017734chr11247 ------
NM_017736chr1672952 2717 2466 2375 581 185 96 12763 32701 1028 392 23068 2917
NM_017737chr141804 1550 1530 1518 --2555 269 --
NM_017738chr931262 43 21 --1979 --
NM_017741chr462394 1995 829 629 566 207 32827 925 788 ----
NM_017742chr1841893 1628 1400 90 --41954 1821 1807 1681 --
NM_017745chrX2648 194 2554 120 1625 --
NM_017752chrX72143 1891 1853 1772 1650 171 152 32155 2022 273 ----
NM_017753chr98902 819 797 401 362 353 218 196 1327 1877 1780
NM_017754chr6115020 4994 4153 4053 3857 3844 3645 3313 1849 1737 1455 11714 11919 --
NM_017760chr7--1307 ----
NM_017762chr15102409 1935 1814 1749 1642 660 614 590 513 172 --42279 2235 1832 1556 198
NM_017768chr14682 663 340 193 ------
NM_017769chr14112971 2945 2545 2419 2337 1207 1195 933 852 87 60 43275 2913 2557 2365 32729 411 283 42624 2617 2307 2065
NM_017770chr672884 2741 2448 2400 2167 1823 632 12969 12732 --
NM_017772chr631733 1718 1199 --1579 --
NM_017780chr83869 853 765 193 1758 1833
NM_017785chr51543 2507 369 ----
NM_017786chr82712 640 ------
NM_017787chr1042802 2776 2333 708 --11130 --
NM_017799chr1451703 1496 1290 688 454 ----1676
NM_017811chr962995 2721 2405 780 466 167 1949 2696 604 11987
NM_017812chr71672 ------
NM_017813chr8175815 5180 4500 4446 4143 3768 3645 2219 1890 1822 1494 1426 1240 576 404 209 189 34080 2322 672 42258 2213 1946 964 24388 796
NM_017824chr1082753 2670 2496 1665 1065 870 336 217 32517 1866 1072 22446 641 --
NM_017826chr131786 1753 ----
NM_017831chr18174801 4687 4658 4141 4078 4028 3559 3420 3340 3249 3067 1327 1101 570 371 167 161 34351 4271 922 21367 1279 11474
NM_017845chr45831 779 645 540 297 --136 --
NM_017848chrX144298 4152 3772 3293 3282 3146 3024 2857 1672 1595 621 614 606 61 34026 961 658 14111 2998 627
NM_017849chr252920 2228 2003 559 522 --12890 --
NM_017864chr8125 ------
NM_017872chr5--1265 ----
NM_017890chr861697 1194 1176 733 680 551 --1600 --
NM_017905chr133688 536 174 ------
NM_017910chr22371 328 ----159
NM_017911chr2261543 1516 1172 1051 573 224 ------
NM_017913chr92436 78 1364 194 --
NM_017915chr122326 21 1827 ----
NM_017919chr9135252 5190 5030 4802 4118 4075 3614 1851 1730 1544 1314 1100 434 11691 25701 4368 15337
NM_017933chr251573 1161 594 539 530 ------
NM_017935chr41246 1612 1631 --
NM_017938chrX82073 2056 1971 1914 1857 1742 1586 874 --1325 --
NM_017944chr1172970 2725 2238 2092 1933 568 309 1966 13033 --
NM_017948chr92372 110 --1400 --
NM_017952chr294481 4196 3939 3836 3099 1700 883 686 373 13058 11619 --
NM_017953chr11753 21012 117 11186 1157
NM_017964chr231013 203 70 3843 299 22 ----
NM_017969chr22209 74 ----1175
NM_017974chr251247 1022 973 876 455 --11044 --
NM_017987chr10102090 2026 1972 1814 1791 1744 1571 1381 888 365 1450 12224 --
NM_017994chr783007 2346 2066 1984 1010 660 625 597 --1474 --
NM_017998chr931309 1025 997 1388 1220 --
NM_018003chr1581872 1569 948 563 235 210 57 32 --32376 1999 1915 --
NM_018004chr31300 ------
NM_018014chr231004 911 417 --1172 --
NM_018015chrX51092 1023 828 134 47 11100 2801 389 --
NM_018017chr10162804 2742 2336 2304 2244 2172 2154 2008 1961 1849 1124 1033 803 740 695 311 22567 298 22876 78 --
NM_018018chr1241893 1244 694 278 --11840 11529
NM_018027chr1053154 2890 2727 2112 1172 --12895 --
NM_018028chr19----11301 --
NM_018030chr1871119 1053 759 376 329 323 274 ----1235
NM_018034chr5296 68 ------
NM_018036chr14104279 4255 3771 3687 3669 3018 1437 1182 1020 999 12830 3599 333 92 11218
NM_018043chr1141438 1200 1091 1015 ------
NM_018046chr511649 --1255 11878
NM_018048chr1282024 1941 1928 1791 614 369 316 81 22007 681 ----
NM_018051chr72314 131 ------
NM_018060chr1--1335 --1342
NM_018061chr171751 1623 1378 1347 1166 431 232 1154 21413 1257 --
NM_018063chr103426 344 98 ------
NM_018070chr12199 167 ------
NM_018078chr431009 754 76 2967 251 ----
NM_018079chr23395 230 143 --131 1438
NM_018084chr2113022 2800 2641 2419 2277 1273 1154 995 809 375 76 ----32912 2312 1142
NM_018086chr261670 1398 775 494 423 368 11655 21874 1498 1722
NM_018089chr21182 ------
NM_018092chr1631102 404 149 21248 436 11186 --
NM_018098chr331183 1040 911 1992 2780 319 11212
NM_018103chr1190 ------
NM_018105chr871111 1100 1041 404 381 209 196 11215 ----
NM_018112chr96877 780 383 326 210 140 1253 11061 --
NM_018115chr41153 ------
NM_018117chr104651 640 565 263 1692 --1245
NM_018120chr891359 1218 955 510 421 302 205 156 145 21003 456 1310 --
NM_018121chr10112876 2785 2779 2635 2537 2315 2232 2205 1955 1943 751 1531 22398 2151 13152
NM_018126chr461362 1140 510 500 451 193 11026 1587 --
NM_018131chr103810 760 719 1833 1338 --
NM_018133chr382150 1864 1722 728 687 485 312 267 --31984 1748 798 --
NM_018137chr121415 441 11190 ----
NM_018155chr3143462 3209 3114 3062 2729 2518 1389 1232 1042 980 811 484 398 332 ----12682
NM_018156chr142208 2154 680 196 12466 22836 2501 --
NM_018157chr1283200 2598 2260 2156 1992 1240 912 34 32930 2066 1297 2990 270 --
NM_018159chrX21365 1189 11323 1669 --
NM_018164chr12----1225 --
NM_018167chr143641 370 163 ------
NM_018169chr121169 1449 --1487
NM_018171chr124790 637 217 207 1979 ----
NM_018177chr44913 814 97 55 1308 2794 221 --
NM_018184chr372048 2027 2007 1961 1568 874 256 1348 1518 --
NM_018191chr133780 218 186 ----1743
NM_018193chr152559 29 1535 ----
NM_018195chr1151627 1526 1488 1480 1473 ------
NM_018199chr1451067 849 253 195 73 --11166 11135
NM_018200chr1592580 2489 2418 2369 1926 1604 1029 685 384 --12474 --
NM_018202chr16731 364 348 284 276 215 ------
NM_018206chr162558 53 ------
NM_018207chr111712 --11733 --
NM_018211chr171576 1391 1385 850 666 651 602 11660 ----
NM_018214chr671161 1013 999 458 397 318 271 21091 1024 2822 514 --
NM_018216chr1--1220 ----
NM_018221chr23455 447 92 ------
NM_018223chr1221022 158 --1475 --
NM_018227chr4113225 3159 3005 2924 2782 2560 1168 1043 522 228 122 33166 2203 1091 62916 2071 1283 1058 785 378 22752 2631
NM_018229chr1441085 922 264 173 11016 1212 --
NM_018238chr791351 1336 1233 981 953 562 475 208 35 ------
NM_018243chr4133762 3379 3281 3184 3020 3004 2608 1575 1212 1028 559 249 84 --53746 530 99 94 89 --
NM_018246chr8132794 2174 2041 2007 1980 1888 1841 1128 1069 941 878 859 299 ------
NM_018247chr6133092 2965 2563 2170 2124 1967 1221 1105 927 516 322 256 137 22421 728 22434 1199 1761
NM_018254chr142125 2080 1606 588 32336 2270 333 2516 319 --
NM_018257chr2072511 2371 2204 2017 1855 576 484 11031 12422 --
NM_018266chr31689 2940 76 --196
NM_018270chr202744 671 2771 684 ----
NM_018287chr102423 183 11225 2225 76 --
NM_018290chr431243 1172 1042 11026 1877 21274 1035
NM_018293chr382879 2566 2559 2406 1809 804 235 103 52270 2145 1901 1119 815 42224 1927 1027 415 12893
NM_018294chr10122 1246 ----
NM_018299chr8163164 2987 2707 2219 2207 1395 1