TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5590-5p
miRNA Sequence: UUGCCAUACAUAGACUUUAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr121278 254 ------
NM_000084chrX96927 6574 5745 4468 2609 1644 755 492 255 --34726 2584 2577 --
NM_000090chr21685 ------
NM_000092chr284575 4404 4163 4052 3836 1177 1054 620 21715 519 ----
NM_000110chr121105 1055 --1244 1302
NM_000125chr663701 2942 2771 1048 967 166 12805 13757 1503
NM_000138chr1511022 11822 1409 12067
NM_000141chr102955 599 ------
NM_000163chr512103 ------
NM_000176chr553231 2742 1204 699 301 --13622 21139 970
NM_000192chr12----11170 --
NM_000202chrX--23393 23 --11422
NM_000216chrX63556 3355 3235 2928 1569 273 --12949 --
NM_000222chr461939 1628 1584 1537 352 327 ------
NM_000245chr722197 452 ------
NM_000267chr1741285 1068 1005 715 ------
NM_000304chr1711030 ------
NM_000310chr121229 191 ------
NM_000314chr1032381 2354 274 183 22758 2517 1426
NM_000332chr687043 6221 5963 5325 5319 5197 569 409 12500 ----
NM_000340chr331194 1107 429 2438 191 ----
NM_000368chr964764 4401 4227 4042 1286 1173 11551 11675 14583
NM_000428chr1421035 590 ----21820 22
NM_000430chr171857 ------
NM_000461chr384067 1816 844 609 519 443 329 231 --23642 860 --
NM_000474chr7--2601 428 ----
NM_000522chr7--1356 ----
NM_000555chrX96907 6745 6583 5393 4963 4783 2447 1896 1770 21760 1455 1829 --
NM_000586chr4185 ------
NM_000599chr243510 3500 3002 1499 21516 183 --23044 472
NM_000618chr1256588 6565 5349 4740 2627 --36470 5040 596 --
NM_000618chr1256588 6565 5349 4740 2627 --36470 5040 596 --
NM_000633chr18105180 4564 4255 3413 3255 1860 1355 1340 1142 333 --11714 --
NM_000640chrX127 ------
NM_000684chr1011126 ------
NM_000793chr1463929 3605 3484 1100 845 174 11948 ----
NM_000808chrX1966 ------
NM_000813chr554526 4040 1973 853 400 14404 --14014
NM_000816chr5126 ------
NM_000834chr12----11217 --
NM_000868chrX32539 1026 345 --1957 1321
NM_000872chr1031531 1165 1101 --1595 --
NM_000891chr173631 350 208 22741 503 33471 3182 1426 --
NM_000944chr41814 12232 12406 12105
NM_000950chrX42548 2451 2281 640 11327 13582 --
NM_000958chr521295 287 11043 ----
NM_001001323chr12------12964
NM_001001481chr842924 2316 804 690 ------
NM_001001484chr10--12434 1446 11881
NM_001001556chr1521060 196 21121 290 11242 --
NM_001001664chr232837 875 162 ----1526
NM_001001668chr19--33287 2900 2885 22952 446 --
NM_001001669chr562484 2343 1973 1904 455 309 ------
NM_001001701chr421909 1612 ------
NM_001001870chr171773 ------
NM_001002243chr21791 ------
NM_001003652chr1878254 7792 7684 6138 3082 2787 964 28130 6017 ----
NM_001003679chr141530 1524 320 141 ------
NM_001003792chr311061 ------
NM_001003793chr311061 ------
NM_001004051chrX1298 ------
NM_001004304chr1283164 3035 852 846 754 673 581 305 ------
NM_001004317chr644048 3320 1309 1178 ----24002 896
NM_001004346chr41103 ------
NM_001005375chrY11285 ------
NM_001005739chr21746 ------
NM_001005781chr22570 412 ------
NM_001005782chr221019 861 ------
NM_001005849chr171226 ------
NM_001006634chr161507 ------
NM_001006657chr262750 2153 1250 920 621 529 ----1170
NM_001006933chrX1212 ------
NM_001007023chr1463929 3605 3484 1100 845 174 11948 ----
NM_001007099chr12244 182 ----1237
NM_001007100chr12244 182 ----1237
NM_001007466chr654490 3610 2029 1294 325 ----11884
NM_001007538chr1321202 285 --21740 96 --
NM_001008239chr1863545 2925 2766 2487 1374 867 --21176 107 --
NM_001008660chr11----11376 --
NM_001008801chr1931517 759 653 ----4875 709 358 103
NM_001009899chr366224 5323 4862 4036 2031 1722 --22610 1057 --
NM_001009958chr71230 ------
NM_001009960chr752746 2544 2095 1822 522 ----1262
NM_001010854chr141207 ------
NM_001010862chrX53269 2554 2305 2052 722 --21315 1132 13054
NM_001010888chrX44163 3556 521 469 --34273 2855 1442 11158
NM_001011553chr7----1732 1783
NM_001011722chr11406 ------
NM_001011722chr11406 ------
NM_001011885chr151156 --166 11535
NM_001012393chr1153857 3794 1565 1386 822 ----14410
NM_001012398chr1621070 70 --11078 --
NM_001012751chr10161 11441 ----
NM_001012979chrX1212 ------
NM_001012985chr11174 ------
NM_001013406chr721457 1420 1603 ----
NM_001013415chr411558 ------
NM_001013746chr7--1658 1157 6743 574 490 410 326 242
NM_001013843chr151662 ------
NM_001014380chr1385626 5389 3640 2303 2158 1281 1065 529 21895 175 ----
NM_001014449chr161181 ------
NM_001014451chr161181 ------
NM_001014797chr1037847 7103 2422 16258 46187 6048 5041 1697 --
NM_001015877chrX1412 1423 --11180
NM_001015881chrX11222 ------
NM_001017371chr21281 1184 ----
NM_001017926chr81613 ------
NM_001017930chrX1981 ------
NM_001017977chr11101 ------
NM_001018065chr965705 5563 4522 4352 1630 89 25071 261 21590 764 --
NM_001018066chr965705 5563 4522 4352 1630 89 25071 261 21590 764 --
NM_001018067chr145033 4023 3445 993 --23331 192 24857 1462
NM_001018068chr145033 4023 3445 993 --23331 192 24857 1462
NM_001018069chr145033 4023 3445 993 --23331 192 24857 1462
NM_001018074chr553231 2742 1204 699 301 --13622 21139 970
NM_001018075chr553231 2742 1204 699 301 --13622 21139 970
NM_001018076chr553231 2742 1204 699 301 --13622 21139 970
NM_001018077chr553231 2742 1204 699 301 --13622 21139 970
NM_001023587chr311138 ------
NM_001024094chr553231 2742 1204 699 301 --13622 21139 970
NM_001024647chr1276385 5281 2099 1467 764 315 65 --12047 --
NM_001024688chr831783 1442 117 1815 ----
NM_001024808chr1212828 ------
NM_001024916chr91116 ------
NM_001025105chr51977 --1535 --
NM_001025233chr1262682 2400 2351 2277 1907 452 --1864 --
NM_001025580chrX44255 4187 1494 179 1162 --11149
NM_001025595chr41486 ----21074 551
NM_001025780chr911429 ------
NM_001029858chr621249 768 ----23368 417
NM_001029863chr62918 479 --22344 651 --
NM_001030007chr1631595 1202 725 1350 --1948
NM_001030055chr1463469 1293 1005 715 656 140 --11871 1286
NM_001030272chr111345 ------
NM_001030273chr111345 ------
NM_001030287chr111126 ------
NM_001031684chr221409 187 ------
NM_001032280chr611451 ------
NM_001032283chr121340 ------
NM_001032284chr121340 ------
NM_001032380chr1041974 1788 650 357 --11398 --
NM_001033047chr432463 2426 2038 ----11944
NM_001033507chr181980 1885 1589 1445 1343 1259 694 145 --11781 --
NM_001033566chr171276 ------
NM_001033568chr171276 ------
NM_001033925chr1021360 726 --11836 --
NM_001035260chr1021274 575 11499 11398 --
NM_001037132chr722202 1435 ------
NM_001037133chr722202 1435 ------
NM_001037174chr221844 496 --1851 1273
NM_001038640chr15----1795 --
NM_001039479chr146838 781 557 541 306 211 ------
NM_001039618chr1175493 4778 4048 3953 2353 2028 1254 --25423 4042 --
NM_001039772chr11132 ------
NM_001039840chrX55183 5084 3902 485 114 ----1720
NM_001040142chr211523 --22430 1967 --
NM_001040143chr211523 --22430 1967 --
NM_001040157chr441775 628 599 346 ------
NM_001040167chr711177 ------
NM_001040441chr155339 4095 790 750 73 11304 ----
NM_001040653chr342392 2238 851 253 1263 32304 1720 642 --
NM_001042413chr924041 156 23923 3853 ----
NM_001042425chr611451 ------
NM_001042440chr521662 1325 --11285 11925
NM_001042441chr521662 1325 --11285 11925
NM_001042442chr521662 1325 --11285 11925
NM_001042443chr521662 1325 --11285 11925
NM_001042444chr521662 1325 --11285 11925
NM_001042445chr521662 1325 --11285 11925
NM_001042446chr521662 1325 --11285 11925
NM_001042481chr14--12661 --1852
NM_001042492chr1741285 1068 1005 715 ------
NM_001042506chrX1356 ------
NM_001042533chr323093 2474 22411 1001 ----
NM_001042550chr91191 ------
NM_001042555chr1244590 4240 986 434 14205 23361 3054 13610
NM_001042601chr343273 2363 792 693 ------
NM_001042603chr1254837 4316 1530 547 339 35080 4427 4414 ----
NM_001042604chr324086 3886 ----11672
NM_001046chr522677 35 3606 584 94 ----
NM_001099678chr366340 5800 2306 1509 901 283 14835 ----
NM_001106chr3118618 7941 7813 7724 7517 6555 2909 2894 2024 1385 1176 23017 2419 13268 --
NM_001121chr10188 ------
NM_001123chr101855 ----1151
NM_001126chr11744 1375 ----
NM_001128chr1631595 1202 725 1350 --1948
NM_001159chr21694 150 1699 --
NM_001167chrX86655 6246 6010 5565 5414 4366 2576 133 25584 665 ----
NM_001173chr1463469 1293 1005 715 656 140 --11871 1286
NM_001177chr1222057 1784 12125 21683 1669 --
NM_001178chr111345 ------
NM_001201chr432435 1457 619 13665 ----
NM_001237chr42112 53 --1130 11110
NM_001237chr42112 53 --1130 11110
NM_001256chr1722795 2484 12057 --12397
NM_001259chr755957 5044 4125 1259 1252 15999 ----
NM_001289chrX21110 1101 ----21572 218
NM_001300chr101195 ------
NM_001321chr12----1167 --
NM_001346chr372375 2199 2081 921 419 404 258 ------
NM_001358chr41322 ------
NM_001364chr1124357 1260 24334 1568 24088 4079 14805
NM_001386chr8--22369 2040 --12383
NM_001400chr111250 ------
NM_001416chr171437 ------
NM_001527chr674764 4624 4110 3775 2955 1565 790 --13617 --
NM_001541chr111127 ------
NM_001642chr11--1193 ----
NM_001650chr1853974 3670 2509 1567 605 23254 422 11584 13341
NM_001674chr111126 ------
NM_001682chr12------12678
NM_001695chr853761 2926 2803 298 71 --13942 11006
NM_001704chr61594 ----1147
NM_001709chr1122694 2635 --12615 22713 2661
NM_001726chr1--143 ----
NM_001731chr12--2598 137 --1876
NM_001742chr711441 ------
NM_001750chr521662 1325 --11285 11925
NM_001759chr1221227 872 --21327 425 15156
NM_001773chr111342 ------
NM_001788chr7----1732 1783
NM_001821chr164553 4365 3166 1577 1525 44 34151 1482 446 13813 --
NM_001842chr9--1556 ----
NM_001854chr141165 325 206 94 2491 169 ----
NM_001858chr625069 3201 11863 14440 --
NM_001875chr22792 292 ------
NM_001892chr51977 --1535 --
NM_001918chr1119234 8000 6333 6002 3248 2504 2455 2218 1882 1769 240 28523 6493 27309 5791 19152
NM_001920chr12------1679
NM_001939chrX53750 3311 2695 2386 861 --23646 3329 12364
NM_001993chr141008 920 244 204 ------
NM_001995chr4130 ----1210
NM_002006chr464106 3692 2279 1389 693 680 --24325 1356 --
NM_002009chr1531838 898 851 ------
NM_002024chrX21982 102 11462 --1370
NM_002025chrX79122 9101 7158 6916 6314 2720 1845 16349 --28216 3676
NM_002044chr1521060 196 21121 290 11242 --
NM_002092chr454976 1835 1550 501 263 --11016 --
NM_002128chr1332104 862 306 11620 12409 --
NM_002129chr4----1273 --
NM_002140chr91848 ------
NM_002187chr551187 1076 1049 938 834 ------
NM_002198chr5164 ------
NM_002202chr5----1165 --
NM_002214chr755270 4571 3626 1219 601 --25122 1785 --
NM_002239chr21720 --2282 266 --
NM_002245chr11570 ------
NM_002267chr131793 ----11892
NM_002270chr534963 3991 2091 ----14153
NM_002336chr1224059 4039 11995 34114 3757 1575 --
NM_002485chr831783 1442 117 1815 ----
NM_002487chr151617 ------
NM_002506chr1--1100 ----
NM_002545chr1153857 3794 1565 1386 822 ----14410
NM_002563chr31455 --142 --
NM_002613chr1685387 4226 3730 3594 1842 620 608 402 24948 4471 ----
NM_002628chr331040 82 55 ------
NM_002645chr11--1893 --13010
NM_002655chr845256 3776 3769 679 --1789 --
NM_002692chr14189 ------
NM_002709chr233179 3058 2527 32985 1324 423 ----
NM_002719chr1422345 2334 ----12390
NM_002736chr742066 1483 532 422 --12021 12078
NM_002745chr2243127 826 617 155 13648 23856 2879 24516 3160
NM_002835chr71183 ------
NM_002841chr31160 ------
NM_002869chr1131973 623 339 21472 474 12005 --
NM_002886chr364508 1845 1692 883 815 219 24759 4708 ----
NM_002890chr5--150 ----
NM_002902chr151615 ------
NM_002923chr11566 ------
NM_002942chr3----11317 --
NM_002968chr16155 ----1301
NM_002979chr12244 182 ----1237
NM_002994chr4--11694 --1694
NM_003016chr1711332 21870 1486 --1490
NM_003017chr631389 1326 176 ------
NM_003022chrX2184 175 ----1326
NM_003034chr1268066 6991 6413 5947 5437 217 --37595 2923 957 11215
NM_003079chr1711028 ------
NM_003090chr15163 ------
NM_003106chr31893 ------
NM_003111chr21281 1184 ----
NM_003112chr712741 23191 2826 ----
NM_003113chr21298 ----1701
NM_003115chr1----1387 --
NM_003162chr211069 ------
NM_003199chr1824387 3811 21907 998 11556 1682
NM_003216chr2252140 1291 1050 664 112 23018 2951 12526 12661
NM_003220chr611451 ------
NM_003221chr611240 11520 13175 24152 4025
NM_003262chr353589 1934 1481 318 83 1299 ----
NM_003269chr61464 ------
NM_003274chr2111041 ------
NM_003320chr1183806 1609 1220 1127 962 634 595 375 1410 --13201
NM_003352chr221019 861 ------
NM_003359chr41861 183 ----
NM_003410chrX22033 322 ------
NM_003411chrY21185 307 --11597 --
NM_003430chr1931668 1034 80 11312 11503 2308 224
NM_003441chr4--1115 41177 931 529 358 51095 446 369 200 32
NM_003452chr9165 ----1887
NM_003463chr622320 2219 ----12877
NM_003474chr1031921 272 162 --1412 --
NM_003478chr1143200 706 605 177 ----12498
NM_003489chr21197 ------
NM_003505chr711960 ------
NM_003567chr11296 ------
NM_003574chr1884383 3729 3597 1937 664 569 499 89 15557 --15037
NM_003590chr233746 3309 1442 23853 427 13001 --
NM_003597chr231775 920 239 11464 ----
NM_003663chr32836 195 22842 1025 ----
NM_003672chr12650 474 --1571 --
NM_003692chr9--1227 ----
NM_003725chr12----1415 --
NM_003750chr101788 ------
NM_003779chr11372 ------
NM_003800chr62444 97 ----11935
NM_003861chr1452682 2605 2549 2464 335 ------
NM_003872chr2--11915 ----
NM_003913chr61254 --54281 4153 3685 677 617 23279 978
NM_003916chrX41376 1042 962 294 --132 --
NM_003922chr151299 ----180
NM_003930chr752389 1960 1911 781 603 ------
NM_003948chr42979 284 12225 22163 1839 --
NM_003953chr12896 219 ------
NM_003971chr17----1556 --
NM_003998chr41573 ------
NM_004028chr1853974 3670 2509 1567 605 23254 422 11584 13341
NM_004061chr51445 ------
NM_004081chrY11285 ------
NM_004089chrX11222 ------
NM_004093chr1313011 12330 --12063
NM_004124chr1433035 1176 277 --1985 12702
NM_004136chr1543076 759 640 437 12091 22332 662 12813
NM_004165chr16123 ------
NM_004171chr1159210 9179 8257 3469 1993 26327 1276 11243 154
NM_004255chr15--1138 ----
NM_004274chr141634 22995 967 12501 --
NM_004331chr82734 355 ------
NM_004342chr72858 728 1189 12370 11918
NM_004354chr4----1686 --
NM_004369chr21169 ------
NM_004379chr21544 ------
NM_004380chr161934 32647 1888 844 ----
NM_004392chr1312329 --12582 --
NM_004397chr1124063 1444 --21193 900 24291 948
NM_004411chr71787 ------
NM_004432chr921490 817 ------
NM_004447chr121395 ------
NM_004456chr7----1225 --
NM_004464chr444212 2816 1449 1275 --13414 11418
NM_004481chr162501 800 644 588 477 447 ------
NM_004498chr151382 ------
NM_004500chr1432081 1996 281 ------
NM_004543chr21103 --1130 --
NM_004575chr431497 513 216 ----11542
NM_004586chrX13734 1963 2781 755 --
NM_004600chr121282 103 ----11031
NM_004612chr994356 3995 3661 3416 3395 2999 1148 972 869 24420 3282 13019 --
NM_004654chrY1518 ------
NM_004703chr1712207 1926 --21897 606
NM_004726chrX24424 1537 44548 4158 3914 1324 ----
NM_004734chr1332927 618 224 1306 22985 2842 1757
NM_004736chr111482 11543 ----
NM_004745chr867023 6509 6285 4749 2537 262 11070 14577 --
NM_004768chr12467 180 ----1415
NM_004775chr1821744 203 --11955 11794
NM_004786chr181134 ------
NM_004796chr1431971 1748 737 ------
NM_004799chr11328 ------
NM_004824chr611105 ------
NM_004834chr213177 13335 12407 12913
NM_004857chr1434472 4212 260 --44224 3622 316 66 --
NM_004866chr543269 1031 653 301 14429 --14456
NM_004896chr1021189 490 11414 11313 --
NM_004902chr201530 ------
NM_004912chr721457 1420 1603 ----
NM_004956chr731028 499 155 14178 1381 --
NM_004964chr11572 ------
NM_004967chr41115 ------
NM_004972chr91738 ------
NM_004992chrX75526 2784 2244 1639 735 630 537 37899 5306 1839 ----
NM_004992chrX75526 2784 2244 1639 735 630 537 37899 5306 1839 ----
NM_004999chr694064 3540 3481 3105 2841 2772 799 362 43 --1166 --
NM_005010chr722202 1435 ------
NM_005056chr1265081 4560 3406 1774 791 583 35324 4671 4658 ----
NM_005065chr1423882 1010 ----24633 4167
NM_005097chr101256 ------
NM_005113chr14--1181 ----
NM_005121chr1743676 1055 913 370 1839 23195 2967 --
NM_005126chr311416 134 21735 1491 --
NM_005160chr2265730 5676 5468 4900 2390 2169 ------
NM_005188chr11157680 7054 6836 5703 3309 2541 2328 1998 1927 1337 1283 730 675 361 63 16376 15244 12637
NM_005197chr1485481 5434 5188 4888 2284 2185 974 328 11122 23944 541 178
NM_005229chrX1255 ------
NM_005249chr141346 ------
NM_005254chr151393 ------
NM_005259chr2----1459 --
NM_005302chr7----1397 --
NM_005339chr412687 1656 23773 3607 13145
NM_005347chr921625 1072 ------
NM_005375chr621018 25 ------
NM_005433chr1842597 2340 2022 135 2265 115 ----
NM_005494chr7--1463 ----
NM_005497chr1765605 5085 4752 3763 1054 747 25568 5226 1313 143
NM_005502chr952173 1130 928 663 213 --12086 --
NM_005519chr102477 143 ------
NM_005544chr21134 ------
NM_005562chr141548 1433 624 460 11586 ----
NM_005578chr354609 3730 3513 3249 1851 11394 24950 3815 --
NM_005585chr151385 ------
NM_005595chr13230 184 105 1607 ----
NM_005596chr935550 4399 327 ----15487
NM_005644chr11297 ------
NM_005664chr153907 229 156 --1332 --
NM_005665chr123017 227 24134 3499 ----
NM_005734chr11280 61 ------
NM_005748chr1223135 3124 13057 ----
NM_005751chr71445 ------
NM_005754chr511182 ----11162
NM_005756chrX11096 ------
NM_005762chr191125 ------
NM_005776chr141211 ------
NM_005839chr11292 ------
NM_005840chrX44670 1781 1636 238 25504 249 ----
NM_005845chr1321484 1222 ------
NM_005871chr101308 ------
NM_005898chr1121221 1108 ------
NM_005901chr1878254 7792 7684 6138 3082 2787 964 28130 6017 ----
NM_005907chr621528 1147 ------
NM_005909chr543952 1644 1253 1148 14324 34136 3990 929 --
NM_005920chr123781 3541 ------
NM_005955chr184210 3763 2193 1781 976 896 859 852 1496 ----
NM_005964chr17--1285 ----
NM_006007chr944028 3684 1751 400 --13012 --
NM_006015chr1--1405 ----
NM_006037chr264244 3028 784 707 515 202 31929 1625 940 --1320
NM_006047chr2023465 829 --12591 --
NM_006080chr732573 1890 94 ------
NM_006095chr433704 2980 1068 ------
NM_006136chr731125 977 272 ------
NM_006139chr232806 2499 965 12506 12746 12552
NM_006141chr1652720 1815 1721 695 232 --32307 1912 83 --
NM_006157chr11--1316 ----
NM_006166chr12--1875 ----
NM_006194chr14------1468
NM_006197chr81146 1891 ----
NM_006206chr4------1817
NM_006243chr1----1340 --
NM_006254chr31152 ------
NM_006321chr391972 1877 1371 790 706 631 558 551 38 ------
NM_006322chr13--1383 ----
NM_006379chr741837 1487 544 278 ----1836
NM_006380chr1743497 1070 923 895 34000 3323 1759 --11136
NM_006386chr2232046 1724 439 11745 ----
NM_006393chr1044175 1520 1175 494 ----12949
NM_006421chr8--1440 21148 462 --
NM_006496chr151746 710 639 527 107 ----1652
NM_006524chr7----2736 148 3821 401 65
NM_006544chr1423822 2321 12371 11545 --
NM_006587chr4--11712 ----
NM_006599chr1698098 6891 6193 5761 5283 2338 2217 1984 1486 17090 ----
NM_006612chr171435 ------
NM_006614chr323636 866 12461 ----
NM_006620chr633739 3349 788 ----21205 270
NM_006621chr11433 ------
NM_006625chr11374 ------
NM_006625chr11374 ------
NM_006625chr11374 ------
NM_006654chr1244590 4240 986 434 14205 23361 3054 13610
NM_006717chr943107 1116 1044 905 ------
NM_006721chr101855 ----1151
NM_006726chr411195 ----1495
NM_006750chr1687127 6720 2017 1394 1167 1142 981 250 --11158 12876
NM_006777chrX1730 12721 1437 12942
NM_006790chr52401 100 ------
NM_006791chr151435 ------
NM_006802chr111000 ------
NM_006885chr1633680 3607 953 14198 1896 --
NM_006897chr12----1621 --
NM_006920chr2----11339 1523
NM_006924chr171486 11759 --1654
NM_006937chr171226 ------
NM_006939chr1441146 401 284 36 --1873 --
NM_006947chr441435 1343 675 176 --21385 710 --
NM_006951chr101236 ------
NM_007005chr911547 ------
NM_007006chr1632527 1376 1198 1745 --13460
NM_007007chr1294811 4772 4545 4346 4176 3819 3524 968 731 1164 23793 3537 --
NM_007011chr1575920 5281 2624 2528 2436 2425 506 16438 14320 --
NM_007038chr2165816 5730 4678 2215 337 287 ------
NM_007050chr2087634 7187 6791 6190 6030 3015 100 70 32852 2116 1493 ----
NM_007111chr13------1749
NM_007124chr631247 729 620 1269 ----
NM_007125chrY----1998 --
NM_007129chr13----1904 --
NM_007159chr32603 272 ----11332
NM_007166chr11----11376 --
NM_007212chr11533 ----12129
NM_007218chr81300 ------
NM_007222chr81613 ------
NM_007242chr161181 ------
NM_007249chr1387971 6778 6537 3596 2019 1957 1655 574 48210 7089 2786 2633 --17914
NM_007276chr71249 ------
NM_007324chr11328 ------
NM_007347chr1552671 1096 987 447 85 1860 ----
NM_007350chr1234350 735 255 23517 1750 ----
NM_007375chr132505 1117 918 22491 65 12671 --
NM_012062chr121101 ------
NM_012082chr82309 119 1636 ----
NM_012096chr353640 3427 1500 60 51 --1555 22791 2533
NM_012097chr221844 496 --1851 1273
NM_012104chr1173645 1462 1365 1316 1273 93 85 ------
NM_012104chr1173645 1462 1365 1316 1273 93 85 ------
NM_012120chr61344 1971 ----
NM_012161chr4--11024 --11129
NM_012164chr957526 5866 2791 2263 107 12183 ----
NM_012183chr1----1573 --
NM_012215chr103761 419 57 195 21575 491 1632
NM_012247chr101850 ------
NM_012257chr71817 ------
NM_012262chr175187 4638 4004 3639 1754 1735 1359 --24819 277 1623
NM_012286chrX1422 ------
NM_012288chr664198 3961 1598 1502 831 332 --25109 3836 --
NM_012290chr211656 ------
NM_012297chr4--12425 ----
NM_012309chr1153863 3536 1152 1015 456 13121 --13396
NM_012464chr442351 1177 1096 212 ------
NM_012465chr1083043 3016 2918 2224 1225 871 757 444 ----1326
NM_012479chr71524 ------
NM_013255chr738210 2767 2752 38817 5409 3293 27379 1149 18474
NM_013281chr2021395 62 ------
NM_013372chr1512739 ----12509
NM_013386chr1--1129 --191
NM_013396chr212430 187 ----1248
NM_013436chr21156 ------
NM_013438chr9----1325 --
NM_013445chr2--153 ----
NM_013943chr142421 1169 419 333 ------
NM_013958chr8--1404 ----
NM_013959chr8--1404 ----
NM_013961chr8--1404 ----
NM_013962chr8--1404 ----
NM_013989chr1463929 3605 3484 1100 845 174 11948 ----
NM_013995chrX32221 1971 616 12458 12576 --
NM_014048chr1615249 44362 4163 3264 1472 --15044
NM_014112chr884949 3871 3837 2113 1754 970 619 508 34872 4092 217 ----
NM_014117chr161185 ----1773
NM_014155chr1166957 6195 5431 4744 1450 1269 --16163 34604 774 749
NM_014268chr1821328 73 21191 360 1374 --
NM_014283chr12218 124 ------
NM_014313chr11254 ------
NM_014331chr436668 1491 998 26820 2378 --1455
NM_014333chr1122310 1134 ----1483
NM_014372chr12802 194 ------
NM_014382chr32377 248 ------
NM_014423chr544323 3826 1852 635 ----15518
NM_014445chr322052 1625 ------
NM_014447chr41486 ----21073 551
NM_014461chr3----1153 --
NM_014570chr22----1123 --
NM_014584chr14--11459 --1350
NM_014586chr2174830 3432 3418 3350 2964 1454 849 11004 14479 --
NM_014607chr221427 709 21985 1613 --1211
NM_014616chr343400 2725 1201 280 43319 2557 2181 143 ----
NM_014620chr121247 ------
NM_014661chr10103868 3795 3593 3385 2727 1341 884 830 815 225 ------
NM_014720chr1011680 ------
NM_014721chr656511 6023 2510 1210 168 46692 5990 2094 238 26252 4884 --
NM_014751chr821554 576 1692 ----
NM_014752chr1131533 1287 582 ------
NM_014755chr252898 1698 1662 1325 722 --13141 --
NM_014764chr121179 ------
NM_014786chr111912 ------
NM_014804chr17149 1181 11375 1252
NM_014836chr1041974 1788 650 357 --11398 --
NM_014838chr2252421 767 573 434 244 11820 ----
NM_014877chr1777177 6217 5960 5846 1774 1736 1289 47749 5118 1535 1018 16365 27457 6687
NM_014892chr61191 ------
NM_014897chr1712190 ----1429
NM_014903chr1231779 1674 810 ----1571
NM_014906chr1743700 2723 2523 716 13170 ----
NM_014916chr71616 --1682 --
NM_014927chrX1139 ------
NM_014946chr221063 355 --12690 1692
NM_014947chr133133 2178 969 12003 22748 2617 --
NM_014964chr171787 ------
NM_014969chr11794 ------
NM_014988chr432299 1979 292 ------
NM_015000chr1242014 843 822 319 ----11997
NM_015026chr1243139 647 514 436 --11685 14176
NM_015071chr596242 4738 4708 4200 3952 1879 1561 1212 38 14523 --11720
NM_015074chr174629 4244 3171 1214 833 221 106 --23315 1542 --
NM_015107chrX4977 842 836 830 ------
NM_015157chr111878 --1298 --
NM_015170chr82574 497 ----12074
NM_015172chr11444 --2523 451 --
NM_015199chr342711 2627 954 139 ------
NM_015215chr122576 1256 11110 22957 2453 --
NM_015251chr1652101 2068 882 98 32 --21742 1466 --
NM_015271chr443039 1075 351 251 --13735 --
NM_015282chr241911 993 787 437 22985 279 1762 --
NM_015310chr898009 7740 7311 6650 2202 1914 1640 1472 1128 17892 12644 13283
NM_015326chr142865 2830 2542 391 12127 2979 578 --
NM_015335chr1231996 628 418 12099 ----
NM_015347chr1232581 2525 674 1807 12519 --
NM_015355chr1711929 ------
NM_015365chrX44255 4187 1494 179 1162 --11149
NM_015387chr221869 1645 31668 1662 663 1192 --
NM_015429chr31254 ------
NM_015458chr845258 1440 631 192 45322 1661 1468 446 14271 14949
NM_015503chr161490 ------
NM_015520chr312155 ------
NM_015534chr13728 165 50 ----1876
NM_015535chr252544 1479 934 274 109 13584 22955 726 11242
NM_015548chr6169 ------
NM_015554chr1541905 583 566 197 1314 11867 --
NM_015568chr2044241 3229 1552 1415 14111 13309 --
NM_015569chr174355 3843 3273 1086 806 283 161 13489 23692 3120 --
NM_015571chr622389 1918 ----1402
NM_015577chr521237 106 --21329 471 11228
NM_015601chr101873 ------
NM_015626chr17--1400 ----
NM_015640chr145033 4023 3445 993 --23331 192 24857 1462
NM_015652chr10----1545 --
NM_015695chr652055 1685 1594 110 86 1305 11950 --
NM_015713chr873445 3080 2582 1225 1146 722 223 --13545 --
NM_015726chr111669 ------
NM_015852chr711406 --23187 238 91244 1163 1079 827 659 575 491 407 71
NM_015885chr111813 ------
NM_015886chr834017 1851 1651 11774 --15629
NM_015888chr122086 1236 --22779 2112 23265 671
NM_015906chr134282 3339 3282 2689 297 13828 11588
NM_015975chrX--11278 --1247
NM_016018chr84978 852 138 31 --1342 --
NM_016023chr841877 880 487 432 ----1122
NM_016040chr111994 ----12564
NM_016041chr171139 --1289 --
NM_016061chr21367 ------
NM_016078chr171897 ----1448
NM_016090chr11--1746 ----
NM_016120chrX11081 ------
NM_016132chr1523174 2359 ----1333
NM_016206chr328771 8677 11006 ----
NM_016220chr7--1658 1157 6743 574 490 410 326 242
NM_016227chr12218 124 ------
NM_016260chr296435 6277 4827 2587 1902 1503 899 800 415 --12600 --
NM_016277chr6171 --11169 --
NM_016315chr221710 1227 21754 1687 11438 --
NM_016338chr511236 ------
NM_016396chr1532369 842 809 1827 11105 --
NM_016410chr91553 ------
NM_016516chr21746 ------
NM_016530chr1533809 1569 461 ----1391
NM_016587chr71249 ------
NM_016588chr61661 ------
NM_016620chr121309 1167 --11446 --
NM_016623chr81461 ------
NM_016626chr1831346 559 64 ----1164
NM_016631chr211244 ------
NM_016654chr151393 ------
NM_016824chr10188 ------
NM_017423chr421487 692 31868 1452 600 ----
NM_017447chr2154195 3732 3315 1365 100 ----13769
NM_017628chr424935 1916 11804 23963 3731 1869
NM_017634chr81534 ------
NM_017637chr988449 8018 6787 6546 6508 1370 513 136 27760 3067 --12394
NM_017644chr335208 1079 744 --11428 13526
NM_017657chr21791 ------
NM_017658chr1444657 3319 731 29 ------
NM_017686chr11176 ------
NM_017737chr111880 12170 ----
NM_017742chr181372 ------
NM_017744chr1--1966 ----
NM_017754chr674839 4398 3860 1041 788 480 335 11265 23243 234 --
NM_017769chr1432974 2209 1991 --1295 --
NM_017813chr843853 1997 1267 1034 11774 14263 --
NM_017831chr1854785 4483 3282 1718 1499 24228 1270 ----
NM_018011chr13----152 --
NM_018013chr642099 1013 679 505 12084 22988 2758 --
NM_018017chr1042773 2494 1160 213 --1868 --
NM_018036chr1414141 12884 --14365
NM_018054chr161507 ------
NM_018063chr10--1148 ----
NM_018078chr411035 ------
NM_018084chr21782 23172 729 --1902
NM_018085chr198023 7241 6517 6441 2160 2125 1739 923 102 25087 681 16588 17387
NM_018092chr161138 --11106 --
NM_018098chr3174 ------
NM_018121chr1052831 2739 2622 2270 1045 ----12413
NM_018125chr11406 ------
NM_018155chr321251 80 1654 1302 --
NM_018159chrX2461 343 --11483 1399
NM_018164chr12185 --1229 --
NM_018195chr1131970 801 398 1661 ----
NM_018216chr1----198 --
NM_018260chr192898 319 --1268 2520 436
NM_018299chr842924 2316 804 690 ------
NM_018307chr171276 ------
NM_018315chr411558 ------
NM_018362chr1133856 3612 161 ------
NM_018364chr193923 3849 3650 2792 2682 2594 1143 446 394 11321 1417 --
NM_018369chr51656 ------
NM_018374chr724966 1689 24331 537 24465 468 --
NM_018375chr1411902 ------
NM_018388chrX2935 51 11113 --11471
NM_018398chr3182 ------
NM_018429chr522226 1791 --12129 1883
NM_018439chr1852589 2564 2008 884 424 --11934 1851
NM_018442chr11101 ------
NM_018444chr842366 2135 209 166 --12267 --
NM_018557chr2----1189 --
NM_018566chr134189 3906 1770 ----177
NM_018638chr1221195 764 11612 15160 --
NM_018686chr12------1315
NM_018710chr8--1896 ----
NM_018945chr673670 3397 2917 2279 1399 1289 870 --21159 923 --
NM_018976chr1222837 1112 11028 --12045
NM_018999chr1064052 1175 1158 1134 135 85 1657 ----
NM_019001chr324086 3886 ----11672
NM_019004chr72150 45 ------
NM_019022chr18--12409 13195 1911
NM_019044chr284516 4401 4191 4170 3173 1664 1315 576 --11892 --
NM_019057chr51261 ------
NM_019067chrX41505 807 311 172 1742 14481 24746 3004
NM_019072chr533925 928 42 1845 --14292
NM_019557chr1----1848 --
NM_019859chr1031562 1196 1132 --1626 --
NM_019860chr1031610 1244 1180 --1674 --
NM_019903chr10188 ------
NM_020066chr11785 --1241 --
NM_020199chr5--11336 --1983
NM_020228chr1152194 2035 1034 404 327 12131 11863 --
NM_020245chr654396 3516 1935 1200 231 ----11790
NM_020311chr22315 64 ------
NM_020357chr331022 266 73 ------
NM_020390chr354650 3901 3724 622 600 1701 13975 14192
NM_020420chrY11285 ------
NM_020474chr181336 1270 ----
NM_020630chr102703 213 ------
NM_020640chr342200 1898 1440 302 ------
NM_020651chr21497 1466 ----
NM_020673chr2057406 4909 4830 712 277 ----17198
NM_020715chr141641 ------
NM_020718chr1654638 4362 2479 776 445 ----15123
NM_020727chr2123824 3457 13941 23550 913 --
NM_020772chr1758196 8084 3307 2670 721 ------
NM_020774chr1835982 5495 4969 26233 461 --15399
NM_020779chr262750 2153 1250 920 621 529 ----1170
NM_020791chr171884 --1120 --
NM_020794chr1--1101 21031 608 --
NM_020800chr311164 ------
NM_020830chr253207 1130 747 463 403 --12868 --
NM_020834chr1441555 713 641 137 --198 11430
NM_020854chr181356 ------
NM_020866chr13--165 --1382
NM_020871chrX32198 2056 1583 22084 1722 12352 --
NM_020917chr1963739 2661 2572 2391 1532 1321 22624 316 ----
NM_020918chr1033068 1282 379 ----11275
NM_020935chr254469 3073 2879 819 232 --13954 --
NM_020940chr1012874 12696 --12804
NM_020993chr1212828 ------
NM_021007chr211523 --22430 1967 --
NM_021033chr1352657 2189 1332 1001 283 12800 12237 --
NM_021105chr3--1749 ----
NM_021120chrX83183 2778 2628 2105 1280 713 673 624 32363 1964 472 ----
NM_021136chr141622 ----1519
NM_021140chrX----21103 1031 --
NM_021148chr762333 2280 2273 1986 1889 890 --11754 --
NM_021183chrX21957 1796 1859 22336 536 11600
NM_021205chr152901 2276 2110 1047 371 1437 1623 --
NM_021614chr5282 47 ------
NM_021627chr311151 ------
NM_021648chr632495 2290 2050 ----1449
NM_021911chr554526 4040 1973 853 400 14404 --14014
NM_021914chr14--21552 754 2847 478 11509
NM_021964chr352350 2280 1379 993 463 16032 ----
NM_022041chr1651978 1078 897 228 78 ----1115
NM_022048chr1584509 4367 4114 2550 2187 790 520 465 25104 2141 11332 --
NM_022079chr101873 ------
NM_022080chr20--1562 22418 21 12506
NM_022373chr711028 ------
NM_022456chr1276385 5281 2099 1467 764 315 65 --12047 --
NM_022473chr1584137 3327 3116 2996 2871 934 915 248 11377 ----
NM_022474chr1442229 1912 833 181 --122 --
NM_022476chr1621070 70 --11078 --
NM_022650chr5--150 ----
NM_022658chr12----158 --
NM_022725chr111348 --12037 --
NM_022733chr11941 ------
NM_022763chr312108 11156 12559 --
NM_022776chr341338 1265 1219 1044 ------
NM_022826chr2--156 1420 11105
NM_022893chr252501 2247 2221 2074 384 12863 1375 --
NM_022897chr51340 ------
NM_022901chr9----11812 --
NM_022918chr11--1701 --21481 1440
NM_022970chr102955 599 ------
NM_023016chr222754 683 ------
NM_023929chr81836 --193 --
NM_024052chr1732085 810 221 --12167 1835
NM_024060chr111288 ------
NM_024061chr71230 ------
NM_024332chrX41516 1208 654 145 1310 ----
NM_024408chr123039 633 ------
NM_024503chr11273 ------
NM_024524chr343131 2893 576 88 12751 ----
NM_024529chr11397 --21012 845 --
NM_024569chr12973 296 ------
NM_024596chr874914 3685 3415 1070 922 810 277 ------
NM_024615chr51173 ------
NM_024635chr91245 ------
NM_024639chr622171 1170 --31789 1072 850 1544
NM_024665chr353688 3676 3254 809 623 11191 13748 1950
NM_024721chr842637 2441 1646 167 ------
NM_024755chr151662 ------
NM_024770chr256035 5922 5456 1280 790 31257 1184 743 11883 --
NM_024814chr71398 ------
NM_024835chr171336 1279 --193
NM_024947chr368813 8490 6898 6492 3616 2285 39412 5968 3210 27216 3627 --
NM_024949chr444709 3289 1661 408 --24401 3213 24975 1085
NM_024989chr238096 1844 242 1585 27989 1727 --
NM_025027chr191248 ------
NM_025054chr843346 3238 2989 803 ------
NM_025134chr1622250 2069 ------
NM_025184chrX1245 ------
NM_025238chr15------11332
NM_030625chr1022060 776 12247 ----
NM_030648chr421746 380 --23590 967 1878
NM_030664chr10--12434 1446 11881
NM_030768chr2132 ------
NM_030784chr6--1140 ----
NM_030791chr14--11569 ----
NM_030816chr133298 2402 791 1589 23307 2385 --
NM_030881chr2232046 1724 439 11745 ----
NM_030918chr184324 4029 3408 1881 1787 1273 809 659 1787 ----
NM_030920chr12608 330 --12033 --
NM_030933chr1178 ------
NM_030939chr61336 ------
NM_031216chr181761 ------
NM_031262chr91791 ------
NM_031263chr91848 ------
NM_031268chr1685387 4226 3730 3594 1842 620 608 402 24948 4471 ----
NM_031296chr422216 2194 ------
NM_031307chr11141 ------
NM_031314chr1432081 1996 281 ------
NM_031417chr1972740 2437 2387 2103 1761 211 38 12556 ----
NM_031427chr1454143 4076 3945 2374 538 25984 1063 14101 1742
NM_031442chrX23079 2856 1841 1991 --
NM_031461chr82899 305 1864 ----
NM_032012chr944427 1664 1582 68 21520 730 14650 --
NM_032021chr1111192 ------
NM_032116chr1385626 5389 3640 2303 2158 1281 1065 529 21895 175 ----
NM_032144chr221829 189 31329 679 323 ----
NM_032182chr1011699 ------
NM_032186chr121309 1167 --11446 --
NM_032208chr232862 2263 820 --1595 --
NM_032217chr411403 1377 11222 --
NM_032221chr20--1333 --1145
NM_032228chr1122500 39 --1134 --
NM_032373chr1024037 1862 1251 22323 921 11722
NM_032427chr111428 ------
NM_032445chr1522275 85 ------
NM_032457chr433313 3237 3037 13818 1858 --
NM_032557chr41218 ------
NM_032560chr141842 ------
NM_032581chr731296 1204 181 ------
NM_032778chr323093 2474 22411 1001 ----
NM_032802chr151216 ------
NM_032804chr1012574 ------
NM_032830chr16--165 ----
NM_032859chr1343582 723 527 455 33910 804 394 --23532 2502
NM_032895chr171773 ------
NM_032926chrX1212 ------
NM_032961chr411262 ------
NM_032968chrX44189 4178 3485 3265 13961 13001 --
NM_032969chrX44189 4178 3485 3265 13961 13001 --
NM_032973chrY44181 4170 3481 3260 13953 12996 --
NM_033020chr134282 3339 3282 2689 297 13828 11588
NM_033055chr121093 380 ------
NM_033138chr72858 728 1189 12370 11918
NM_033139chr72858 728 1189 12370 11918
NM_033140chr72858 728 1189 12370 11918
NM_033143chr454543 3147 1780 1606 96 --13745 11749
NM_033157chr72858 728 1189 12370 11918
NM_033224chr777935 5394 5269 3103 1848 1080 999 --12668 --
NM_033285chr874265 3566 2906 1313 1010 565 519 1971 --12892
NM_033290chrX32503 2298 430 23261 3153 13806 --
NM_033394chr231544 1418 619 --1314 --
NM_033429chr1532005 1226 172 2105 93 13229 12797
NM_033512chr852471 2234 946 599 472 --1132 12804
NM_033535chr4--11024 --11129
NM_033632chr411558 ------
NM_033656chr2185070 2342 2270 1726 1543 1433 326 51 --14364 14327
NM_052900chr811563 ------
NM_052906chr2275029 3963 3464 1737 1450 923 747 21378 1236 ----
NM_052911chr183978 310 124 1759 ----
NM_052953chr31209 ------
NM_052978chr1411647 --1121 --
NM_053002chr3------1998
NM_053016chr986737 6481 5664 5391 3137 2292 1230 700 --35408 2640 304 1455
NM_053023chr113795 667 424 11127 ----
NM_053024chr331362 404 377 1976 ----
NM_053053chr11989 ------
NM_053067chr9----1325 --
NM_053281chrX1353 ------
NM_057164chr21169 ------
NM_057165chr21169 ------
NM_057166chr21169 ------
NM_057167chr21169 ------
NM_058172chr43414 276 38 --11702 1434
NM_080629chr141165 325 206 94 2491 169 ----
NM_080630chr141165 325 206 94 2491 169 ----
NM_080717chr12----11170 --
NM_080759chr1312329 --12582 --
NM_080760chr1312329 --12582 --
NM_080867chr1494713 4659 3619 3200 1863 1731 1583 1149 710 ----13369
NM_080927chr342868 2542 637 179 11334 23138 3065 --
NM_130469chr141807 ------
NM_130847chr1155608 4572 4408 1231 973 25871 4906 1499 --
NM_133170chr2087634 7187 6791 6190 6030 3015 100 70 32852 2116 1493 ----
NM_133334chr496126 5522 4955 3928 2255 1371 1189 1164 1140 1780 11782 --
NM_133503chr12------1679
NM_133504chr12------1679
NM_133505chr12------1679
NM_133506chr12------1679
NM_133507chr12------1857
NM_133510chr14--1132 ----
NM_133634chr2111730 ------
NM_133646chr255316 3703 1688 633 538 34751 4316 3393 ----
NM_134265chr17--1400 ----
NM_134442chr21544 ------
NM_138285chr21408 ------
NM_138437chrX1298 ------
NM_138459chr643168 2911 2626 2343 ------
NM_138468chr275020 3866 2234 1757 1592 1552 1504 35577 4400 147 ----
NM_138494chr752746 2544 2095 1822 522 ----1262
NM_138638chr14--21552 754 2847 478 11509
NM_138709chr9147 ------
NM_138713chr1698098 6891 6193 5761 5283 2338 2217 1984 1486 17090 ----
NM_138714chr1698098 6891 6193 5761 5283 2338 2217 1984 1486 17090 ----
NM_138727chr1--1966 ----
NM_138728chr1--1966 ----
NM_138970chr1431971 1748 737 ------
NM_138971chr1173645 1462 1365 1316 1273 93 85 ------
NM_138971chr1173645 1462 1365 1316 1273 93 85 ------
NM_138972chr1173645 1462 1365 1316 1273 93 85 ------
NM_138972chr1173645 1462 1365 1316 1273 93 85 ------
NM_138973chr1173645 1462 1365 1316 1273 93 85 ------
NM_138973chr1173645 1462 1365 1316 1273 93 85 ------
NM_138995chr21112 150 ----
NM_139135chr1--1405 ----
NM_139166chr8138 ------
NM_139246chr961610 933 822 676 381 129 2363 74 1790 --
NM_144571chr434477 1016 84 35351 2613 555 46847 5084 4904 1332 --
NM_144643chr4--173 ----
NM_144658chrX1289 ------
NM_144778chr13----1194 --
NM_144963chr8--1325 ----
NM_145055chr1863545 2925 2766 2487 1374 867 --21176 107 --
NM_145251chr14--181 ----
NM_145259chr235099 2311 712 ------
NM_145284chrX42065 1880 1643 984 ------
NM_145686chr213177 13335 12407 12913
NM_145687chr213177 13335 12407 12913
NM_145802chrX1203 ------
NM_147164chr9--1556 ----
NM_147171chr71445 ------
NM_147175chrX31548 346 55 --21870 1385 --
NM_147185chr71445 ------
NM_147190chr121628 ------
NM_148921chr171787 ------
NM_152253chr2242682 1646 731 718 24200 2980 14015 12962
NM_152265chr121084 614 ------
NM_152271chr81741 ------
NM_152309chr101837 12132 ----
NM_152330chr14--12661 --1852
NM_152363chr192945 218 ------
NM_152407chr532972 2778 379 13153 ----
NM_152409chr541340 589 261 92 ------
NM_152417chr81367 ------
NM_152424chrX64575 4333 4237 1590 1417 177 --1587 11722
NM_152556chr7--12434 ----
NM_152622chr532171 1120 401 --13279 --
NM_152625chr5--1337 ----
NM_152629chr924041 156 23923 3853 ----
NM_152665chr141049 836 405 360 11067 ----
NM_152678chr352719 1899 922 438 92 --12063 --
NM_152685chr5130 ------
NM_152688chr61882 ------
NM_152716chr11----11318 --
NM_152731chr61264 ------
NM_152739chr71375 ------
NM_152742chr7--1615 ----
NM_152756chr5--13243 ----
NM_152758chr822991 1008 --13019 1532
NM_152774chr712009 --1587 --
NM_152793chr733185 397 273 24402 4386 1927 --
NM_152835chr172529 2461 2286 1949 1921 1123 69 --1771 11182
NM_152838chr2023465 829 --12591 --
NM_152902chr121510 650 ------
NM_152924chr1575920 5281 2624 2528 2436 2425 506 16438 14320 --
NM_152998chr7----1225 --
NM_153042chr621708 336 ----11641
NM_153182chr323093 2474 22411 1001 ----
NM_153184chr321702 664 --11664 --
NM_153188chr534963 3991 2091 ----14153
NM_153207chr1222612 237 --21381 1182 13624
NM_153223chr521362 96 ----11164
NM_153321chr1711030 ------
NM_153322chr1711030 ------
NM_153331chr3----1258 --
NM_153607chr513091 --53026 2864 2333 453 325 1938
NM_153633chr121247 ------
NM_153634chr121178 ------
NM_153704chr81435 ------
NM_153810chr1084994 4798 4710 4568 4372 3950 700 692 --1667 21240 1132
NM_170731chr1122694 2635 --12615 22713 2661
NM_170732chr1122694 2635 --12615 22713 2661
NM_170733chr1122694 2635 --12615 22713 2661
NM_170734chr1122694 2635 --12615 22713 2661
NM_170735chr1122694 2635 --12615 22713 2661
NM_170750chrX1775 ------
NM_170751chr611105 ------
NM_170752chr611105 ------
NM_170774chr2074083 3810 2716 1688 1635 920 277 --1842 --
NM_170775chr5282 47 ------
NM_172070chr231856 1804 168 ------
NM_172071chr124817 2862 ----16390
NM_173060chr521662 1325 --11285 11925
NM_173061chr521662 1325 --11285 11925
NM_173063chr521662 1325 --11285 11925
NM_173163chr161475 ------
NM_173165chr161356 ------
NM_173172chr221521 46 --11488 --
NM_173214chr1698098 6891 6193 5761 5283 2338 2217 1984 1486 17090 ----
NM_173468chr42996 343 1624 --12222
NM_173473chr1061904 952 822 722 351 329 --1596 --
NM_173496chr1032984 740 351 ----1752
NM_173508chr1----2392 121 --
NM_173511chr232429 1458 69 13887 --12660
NM_173531chr1943269 3222 2528 1222 23839 1501 --23786 96
NM_173582chr1156039 5241 2276 1333 447 2666 362 ----
NM_173595chr1211107 ------
NM_173642chr1139064 9015 8838 8516 8311 7876 7244 6955 6936 5801 3215 2638 531 ------
NM_173822chr222010 1843 ------
NM_173829chr565472 5130 4972 4598 1370 1337 11062 --14836
NM_173848chr81205 1288 ----
NM_174900chr411229 ------
NM_175607chr341555 1129 478 145 ------
NM_175612chr341555 1129 478 145 ------
NM_175623chr1276385 5281 2099 1467 764 315 65 --12047 --
NM_175624chr1276480 5376 2194 1562 859 410 160 --12142 --
NM_175625chr1276480 5376 2194 1562 859 410 160 --12142 --
NM_175768chr641471 476 201 63 11661 ----
NM_175861chr1275593 5108 4979 4958 4704 4405 2400 11718 14188 14263
NM_175910chr19------9889 810 726 642 558 474 222 138 54
NM_176812chr201769 ------
NM_176814chr7192 ------
NM_177398chr181980 1885 1589 1445 1343 1259 694 145 --11781 --
NM_177399chr181980 1885 1589 1445 1343 1259 694 145 --11781 --
NM_177972chr1183806 1609 1220 1127 962 634 595 375 1410 --13201
NM_177985chr221844 496 --1851 1273
NM_178140chr512402 --11803 --
NM_178151chrX96907 6745 6583 5393 4963 4783 2447 1896 1770 21760 1455 1829 --
NM_178152chrX96907 6745 6583 5393 4963 4783 2447 1896 1770 21760 1455 1829 --
NM_178153chrX96907 6745 6583 5393 4963 4783 2447 1896 1770 21760 1455 1829 --
NM_178498chr1164023 3695 3633 2728 2684 648 ------
NM_178566chr9------1343
NM_178586chr1422345 2334 ----12390
NM_178812chr841565 1375 1336 622 --11605 --
NM_178815chr1012046 ------
NM_180989chr1311875 --1782 --
NM_181486chr12----11170 --
NM_181504chr5----13487 --
NM_181521chr1687170 6849 5963 5728 5672 4573 1664 1517 --11372 --
NM_181523chr5----13487 --
NM_181524chr5----13487 --
NM_181672chrX1164 1128 ----
NM_181673chrX1164 1128 ----
NM_181832chr2293486 2901 2823 2493 1408 974 784 700 280 --23366 2613 --
NM_181836chr5--1525 ----
NM_182488chr132927 175 ------
NM_182501chr242479 978 972 533 --23333 1312 --
NM_182515chr1945845 4690 4147 1771 22392 353 22577 1410 34942 605 270
NM_182975chr121004 900 ------
NM_183227chr6171 --11169 --
NM_183353chrX11081 ------
NM_183380chr6169 ------
NM_184234chr201530 ------
NM_194314chr175294 4145 3617 3572 2077 1550 49 --12058 --
NM_194318chr135726 456 310 102 54 --1144 --
NM_194434chr1884383 3729 3597 1937 664 569 499 89 15557 --15037
NM_194454chr721457 1420 1603 ----
NM_194455chr721457 1420 1603 ----
NM_194456chr721457 1420 1603 ----
NM_197941chr532598 2032 745 --32129 1093 841 --
NM_197977chr9165 ----1887
NM_198057chrX11222 ------
NM_198066chr1442904 2253 2003 934 12973 ----
NM_198123chr811563 ------
NM_198124chr811563 ------
NM_198225chr1041974 1788 650 357 --11398 --
NM_198318chr191172 ------
NM_198319chr191172 ------
NM_198391chr2021395 62 ------
NM_198395chr511182 ----11162
NM_198404chr13--1366 ----
NM_198581chr235523 1435 345 11169 --14656
NM_198793chr31878 21648 1005 2471 463 --
NM_198889chr411403 1377 11222 --
NM_198896chr1131973 623 339 21472 474 12005 --
NM_198903chr5126 ------
NM_199132chr1931517 759 653 ----4875 709 358 103
NM_199280chr2197 ------
NM_199421chr1494713 4659 3619 3200 1863 1731 1583 1149 710 ----13369
NM_199436chr221063 355 --12690 1692
NM_199437chr1152194 2035 1034 404 327 12131 11863 --
NM_199438chr1152194 2035 1034 404 327 12131 11863 --
NM_199439chr1152194 2035 1034 404 327 12131 11863 --
NM_199461chr1033486 3178 622 12338 --1277
NM_199482chr221869 1645 31668 1662 663 1192 --
NM_201266chr2--11915 ----
NM_201269chr121309 1167 --11446 --
NM_201279chr2--11915 ----
NM_201280chr661601 1558 1315 659 379 115 ----21451 547
NM_201453chr91116 ------
NM_201516chr71629 ------
NM_203301chr1411711 ------
NM_203390chr8----11571 11717
NM_203394chr1242140 936 473 241 12266 ----
NM_203437chr21791 ------
NM_203459chr152640 2504 2468 2160 327 137 ----
NM_203504chr4--12425 ----
NM_203505chr4--12425 ----
NM_205842chr21156 ------
NM_206839chr151435 ------
NM_206852chr141622 ----1519
NM_206853chr643934 3413 2899 401 23478 189 ----
NM_206854chr675195 4674 4160 3376 1662 1242 961 24739 1450 ----
NM_206855chr686160 5639 5125 4341 3977 3907 2207 1926 25704 2415 14013 --
NM_206857chr141622 ----1519
NM_206876chr233179 3058 2527 32985 1324 423 ----
NM_206909chr898009 7740 7311 6650 2202 1914 1640 1472 1128 17892 12644 13283
NM_207015chr322210 417 ------
NM_207189chr1--143 ----
NM_207303chr1043640 2972 2958 69 13139 11189 --
NM_207304chr13----181 --
NM_207406chr444639 4368 1092 870 --1175 14401
NM_207435chr12--1283 ----
NM_212539chr31152 ------
NM_213651chr1--1129 --191