TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-562
miRNA Sequence: AAAGUAGCUGUACCAUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr16------1195
NM_000080chr171777 --1771 --
NM_000081chr151631 1567 1294 1149 190 21329 718 11161 --
NM_000084chrX116264 6036 5918 5004 4572 2249 2130 1656 1517 1417 415 15660 22394 619 --
NM_000088chr1731327 1109 988 ----11066
NM_000089chr72765 117 ------
NM_000092chr2104215 3988 3828 3366 3080 2996 877 808 735 494 1263 13822 --
NM_000108chr731566 1311 763 1629 11677 1228
NM_000109chrX52655 2515 1072 827 799 --22205 1933 --
NM_000125chr6104281 3455 3246 2707 2616 1708 1269 1052 643 252 --21594 336 --
NM_000135chr163972 328 111 --31046 754 213 --
NM_000138chr1531741 416 349 11018 1611 --
NM_000141chr1011056 --1516 --
NM_000142chr431435 230 54 ------
NM_000151chr1761788 1371 1260 443 275 65 21763 502 ----
NM_000161chr1421476 187 21977 1572 11410 --
NM_000163chr522203 2098 --22091 576 --
NM_000165chr621125 557 11304 ----
NM_000201chr191530 ------
NM_000208chr1994318 3286 3135 1872 1777 1583 1201 580 234 --23660 584 --
NM_000238chr7151 ----1310
NM_000245chr731853 1459 1433 --11361 12090
NM_000248chr362891 2134 887 817 185 36 1543 ----
NM_000259chr15106378 6036 5232 4541 4156 1975 1212 850 638 74 --24395 4337 13926
NM_000264chr973278 2416 490 379 355 136 73 11145 --1360
NM_000267chr1731258 331 211 1422 12131 --
NM_000276chrX72202 2025 1970 1954 1541 780 378 ------
NM_000310chr131211 1087 137 --1472 --
NM_000314chr1032430 1265 645 --12623 1575
NM_000321chr1361790 1761 1619 1602 1491 342 11101 ----
NM_000332chr6107005 6983 4866 4573 4441 2700 2598 2067 1843 736 22551 2375 14497 --
NM_000337chr5156505 6496 6237 6195 5810 5737 5450 5162 4240 2155 1903 1713 1703 1470 1253 11848 25025 74 1797
NM_000338chr152865 806 --1935 --
NM_000369chr1451897 1522 648 531 392 11418 11233 11221
NM_000390chrX53327 2920 2797 2076 61 ------
NM_000408chr293241 3117 2698 2674 2231 2147 2141 812 629 11352 13262 --
NM_000430chr1732585 2312 754 13153 33456 3249 2642 --
NM_000435chr191767 --1921 --
NM_000437chr121529 359 2580 540 31596 363 138 12026
NM_000449chr131310 1055 89 1148 ----
NM_000460chr3195 --1188 --
NM_000462chr151355 --21222 464 --
NM_000480chr1131321 1300 1193 --1463 --
NM_000503chr841652 435 174 33 1477 11622 --
NM_000508chr41868 1679 1116 --
NM_000525chr1141629 422 369 116 --2373 155 --
NM_000538chr1321288 274 --31179 519 296 --
NM_000596chr71115 ------
NM_000609chr1043093 2537 2074 1129 ------
NM_000610chr1131897 1060 89 1565 22919 631 1547
NM_000615chr1122778 887 ------
NM_000618chr1256059 5744 4424 1751 365 36104 4998 4589 46355 4923 4605 911 --
NM_000621chr1351062 941 571 338 317 11045 ----
NM_000633chr1854949 3626 1873 958 459 --11804 1203
NM_000680chr8----1378 --
NM_000682chr251446 1404 473 163 56 --11895 --
NM_000684chr1021244 1055 167 1981 --
NM_000686chrX--11269 21174 38 --
NM_000721chr132273 1898 891 --12284 --
NM_000726chr23995 408 116 ------
NM_000788chr451405 1359 1053 568 551 ------
NM_000794chr52877 70 --21020 124 --
NM_000806chr561796 1382 1296 1287 706 81 --1613 --
NM_000809chr4208972 8790 8451 8003 7471 7075 6869 6399 6374 6017 5964 5772 5740 5701 3517 3509 2831 2042 1457 275 69292 9058 7478 6365 5681 794 29075 3650 25881 5820
NM_000813chr555448 4870 1750 1541 447 14361 34722 1744 707 --
NM_000814chr1573992 3714 2824 2690 1114 924 513 11459 ----
NM_000826chr41813 11704 --12004
NM_000828chrX21980 585 --158 --
NM_000842chr111766 1711 ----
NM_000844chr31179 --1161 11009
NM_000864chr1--1218 ----
NM_000868chrX52293 1719 1688 1047 507 ------
NM_000875chr15137035 6990 6617 6524 6310 6283 2379 1874 1828 1274 951 732 345 --26021 1278 11845
NM_000899chr121246 --23769 27 21201 1045
NM_000901chr442574 2289 1770 839 32234 2176 855 ----
NM_000912chr842545 1129 687 458 ----1603
NM_000922chr11--21090 251 1293 --
NM_000943chr51106 ------
NM_000944chr451977 1904 1690 506 372 1487 ----
NM_000945chr261858 1781 717 690 655 451 --3785 772 520 --
NM_000949chr55957 950 918 875 210 1263 ----
NM_000950chrX43593 2876 1211 597 --43660 2755 1448 1163 --
NM_000961chr2093985 3141 1416 1087 571 526 295 266 125 --23968 1602 --
NM_000963chr132515 515 261 11753 --192
NM_000965chr32872 251 ----186
NM_000966chr1211081 1842 --1805
NM_000990chr1153923 3191 2601 956 38 12983 11485 --
NM_000992chr3----198 --
NM_001001132chr2151197 985 445 283 214 --2966 398 --
NM_001001323chr1253165 3133 2932 2911 2025 11070 ----
NM_001001331chr31764 1449 2956 834 --
NM_001001394chr21272 ----1498
NM_001001395chr1232298 634 244 2788 583 41932 1094 879 441 --
NM_001001396chr183802 3677 1724 1343 1075 384 322 313 ------
NM_001001419chr5105234 3738 3650 1464 1235 1156 1019 822 744 281 --23343 795 15061
NM_001001433chr2033165 2240 748 2933 890 1354 --
NM_001001436chr16--1579 1868 --
NM_001001481chr873337 2964 2642 1070 935 485 121 13250 12607 --
NM_001001484chr1061996 636 320 244 186 161 ------
NM_001001556chr151116 31430 1274 32 ----
NM_001001586chr11545 --151 --
NM_001001664chr293673 3395 3088 2629 2587 1308 1239 1055 536 24144 1298 ----
NM_001001702chr51723 --21656 288 --
NM_001001890chr2164222 3928 3651 3038 1614 1448 33902 2722 2706 13682 --
NM_001001971chr1051405 1342 1316 1199 1124 --1567 --
NM_001001974chr1052246 1554 864 701 511 --11558 --
NM_001001994chrX----1197 --
NM_001001995chrX61674 1654 1474 1404 134 62 11885 --11274
NM_001002026chr331621 368 243 ----12482
NM_001002264chr131179 ------
NM_001002294chr1292 33 ----164
NM_001002296chr811067 --21323 1022 11100
NM_001002838chrX41878 1224 381 117 21669 1338 ----
NM_001002860chr14124656 4643 4637 4370 4097 3834 3813 3790 2874 1608 1427 1220 --11004 --
NM_001002909chr171326 12185 22069 834 --
NM_001003652chr18117640 6439 6158 5482 3252 2707 2548 2462 2195 1870 999 58546 8523 5997 2908 2273 22326 396 15600
NM_001003674chr18107038 6864 4643 4596 4569 2511 1950 1178 899 891 --36700 6640 4615 --
NM_001003681chr2231894 1624 174 11559 --1830
NM_001003682chr121058 1033 ------
NM_001003698chr641589 1274 745 156 21966 232 ----
NM_001003712chr1263476 3467 1524 972 406 185 12954 12889 --
NM_001003792chr311171 --1435 --
NM_001004196chr341097 838 165 42 ------
NM_001004346chr421119 1100 --2394 40 190
NM_001004360chr221980 1836 ----11259
NM_001005207chr17--1226 ----
NM_001005366chr122303 45 --1818 --
NM_001005386chr25691 435 314 290 201 --1242 12231
NM_001005463chr1071857 1646 1043 804 691 283 189 1580 11730 --
NM_001005473chr586106 4903 4429 2634 2448 321 304 219 26381 642 11471 --
NM_001005609chrX113527 3023 2992 2984 2742 2414 1459 1319 406 167 78 --23730 2936 13226
NM_001005782chr22924 360 ------
NM_001006600chr552146 2096 748 441 81 11864 ----
NM_001006610chr16----1674 1735
NM_001006612chrX1106 191 ----
NM_001006634chr16----1670 --
NM_001006946chr231700 337 176 11208 1563 --
NM_001007067chr81374 --1958 1742
NM_001007277chr113950 110 57 --2800 372 --
NM_001007553chr14916 791 391 123 ----1796
NM_001007559chr181772 --11370 12055
NM_001007565chr34325 68 40 33 ------
NM_001008239chr1893838 3176 3131 3081 2894 1523 1216 1185 266 13381 ----
NM_001008401chr1921508 1501 ----11420
NM_001008493chr131666 1601 1567 ------
NM_001008495chr821658 365 1314 12237 --
NM_001008539chr8104248 3872 3862 3710 3415 1889 1629 1568 658 502 25309 1035 25358 1785 --
NM_001008541chr1021713 482 11506 ----
NM_001008661chr1------157
NM_001008711chr82521 138 11647 130 --
NM_001008738chr582835 2804 2453 2355 2333 2245 772 581 2987 682 12460 12850
NM_001008756chr352431 2124 1770 1580 976 --11971 --
NM_001008783chr62274 252 --1601 1227
NM_001008801chr1911973 11885 11436 --
NM_001008925chr433245 2331 1267 --11423 --
NM_001009185chr51580 ------
NM_001009554chr464682 4504 3765 707 667 46 11449 ----
NM_001009555chr451775 1413 1094 367 82 1655 ----
NM_001009569chr101435 11553 ----
NM_001009570chr2136 ----1125
NM_001009571chr741593 1223 503 275 21426 1408 ----
NM_001009814chr13191 ------
NM_001009958chr71183 1559 ----
NM_001010853chr622077 1041 13111 ----
NM_001010861chr152379 972 636 525 376 22499 2254 ----
NM_001010862chrX53171 2989 2854 2399 585 ------
NM_001010888chrX84666 4571 4301 4010 3819 3345 1720 953 ----1849
NM_001010891chr5136606 6501 5039 4975 4314 2283 1528 1188 810 709 468 443 140 46964 1736 1131 1084 36930 6420 4192 22405 2392
NM_001010942chr1241279 1162 384 147 1203 ----
NM_001010986chrX52094 1570 522 378 348 12248 ----
NM_001010989chr162512 419 ------
NM_001011658chrX22134 1671 1561 174 --
NM_001011666chr7136340 5487 5400 5237 4651 4199 4123 2066 1987 1623 1569 1504 1119 1642 21323 256 15504
NM_001012267chr9--188 180 --
NM_001012329chr13602 498 149 ----1406
NM_001012418chr683685 3627 3412 2682 2648 1641 284 47 --32585 426 51 13027
NM_001012761chr562312 2264 2036 706 420 384 --22391 602 --
NM_001012968chrX42315 2141 2093 393 --21777 184 --
NM_001013031chr1063544 3198 2655 2452 2249 210 --2533 358 --
NM_001013406chr771767 1733 1268 503 384 256 82 11408 ----
NM_001013620chr12128424 7227 7221 7192 7077 5139 2998 2333 1598 1206 428 198 47418 6870 5347 3297 23286 2154 --
NM_001013699chr12----1525 --
NM_001013843chr15160 169 1359 --
NM_001014434chr11677 --1817 1312
NM_001014797chr1087437 6240 5264 2785 1878 1574 1112 153 37921 7026 1962 27441 826 --
NM_001014812chr151410 --1381 --
NM_001015048chr1412574 12202 23201 145 --
NM_001015877chrX72806 2766 2665 2404 1018 941 926 ------
NM_001017368chr1752822 2771 2179 2083 773 12169 22735 777 --
NM_001017369chr43967 166 105 11005 ----
NM_001017395chr363687 3586 2391 2218 1057 957 --22656 1067 --
NM_001017420chr83972 886 28 176 11361 --
NM_001017926chr8--1584 21331 683 --
NM_001017928chr3----1208 --
NM_001018004chr152525 89 164 ----
NM_001018054chr131446 987 273 ----11296
NM_001018056chr93467 194 165 ------
NM_001018067chr185166 5065 4690 1922 1198 1118 734 442 34986 1513 808 21570 287 --
NM_001018100chr151808 ------
NM_001020658chr131630 1454 206 ------
NM_001024218chr14--1344 ----
NM_001024226chr161197 1174 1090 1065 987 40 ------
NM_001024455chrX42671 2192 2172 62 --11897 --
NM_001024460chr62483 326 1891 ----
NM_001024463chr151908 1801 ----
NM_001024647chr12137407 6610 6557 6248 5978 5634 5221 4944 2149 934 909 530 511 46882 5075 4710 984 56143 5304 2895 2158 70 --
NM_001024649chr562779 2718 2558 2286 2246 891 ----11802
NM_001024847chr32998 925 ----11852
NM_001024947chr5--1927 1243 --
NM_001024948chr173244 2917 2839 2558 2310 2258 340 1579 33091 2150 1346 --
NM_001024956chr1155640 3569 3548 2280 988 ----11089
NM_001025076chr10105903 5205 4160 1701 1656 1647 1567 766 665 459 35558 1017 867 12462 --
NM_001025077chr10127261 6563 5518 4780 3014 3005 2925 2124 2023 1817 862 644 36916 2375 2225 1199 --
NM_001025079chr334016 3309 2573 22624 367 44005 3992 3767 745 --
NM_001025105chr551348 1167 956 360 120 1584 ----
NM_001025201chr22737 241 --1582 --
NM_001025579chr172363 235 --1284 --
NM_001025580chrX63942 3879 3856 3188 1657 1062 1443 23758 3463 --
NM_001025616chr451880 1845 1754 1525 192 --31669 608 371 --
NM_001025780chr9122 --11217 --
NM_001029839chr361080 612 594 514 497 379 1280 ----
NM_001029863chr662782 2776 968 774 734 396 --33113 2763 76 --
NM_001029998chr41325 ------
NM_001030007chr1663215 3131 2677 1564 734 146 --33434 221 208 --
NM_001030055chr14124690 4472 4010 3531 3212 1553 996 623 576 494 383 241 24541 1734 33909 3017 1217 --
NM_001031695chr2265262 4760 3888 1660 1046 57 --25127 3599 --
NM_001031716chr22171 47 ----2883 287
NM_001031804chr1693471 3431 3196 2913 2754 1339 1188 1179 526 --1905 --
NM_001031812chr511530 11966 --134
NM_001032288chr2041224 1085 1071 349 1272 11231 --
NM_001032999chr2065053 4258 4210 4088 2106 31 35356 4160 3479 2886 686 --
NM_001033047chr462516 2207 2180 663 157 130 21979 1720 ----
NM_001033057chr311801 --12105 11369
NM_001033059chr631605 585 507 --1606 --
NM_001033117chr344676 3509 3171 747 11071 --11561
NM_001033506chr11147 ------
NM_001033557chr241079 313 49 27 1904 11289 --
NM_001033557chr241079 313 49 27 1904 11289 --
NM_001033566chr171940 --1107 --
NM_001033602chr1332345 2121 868 --1617 --
NM_001033925chr1011742 --1615 --
NM_001034841chr1695531 5383 5255 3735 1489 1277 1014 509 431 ----11122
NM_001034915chr841301 1277 1227 308 --11281 --
NM_001035260chr1031339 1263 343 ------
NM_001035521chr22629 581 1592 1818 --
NM_001037132chr73679 629 435 11671 11985 --
NM_001037163chr71327 --1901 --
NM_001037164chr751614 1317 756 690 109 11745 --11719
NM_001037165chr7128851 6833 6368 6108 5521 3446 3331 3216 2487 2207 871 849 --1973 15575
NM_001037174chr211801 11420 1653 1431
NM_001037290chr113950 375 155 ------
NM_001037339chr121303 625 --31222 581 125 --
NM_001037553chr2164705 4548 4479 4164 1921 98 --44211 4133 3833 305 --
NM_001037582chr411193 --11327 --
NM_001037631chr211101 --1118 --
NM_001037637chr5370 50 40 --154 --
NM_001037954chr1173080 2836 2722 2422 836 698 326 33197 3100 1003 22505 52 --
NM_001039140chr20----1489 --
NM_001039479chr1462126 1681 1507 978 420 258 --11685 --
NM_001039538chr233468 3220 355 2931 150 ----
NM_001039585chr193397 3110 3048 2878 1534 707 581 572 215 --22757 219 --
NM_001039590chrX113808 3785 3404 3279 3110 2913 2563 2471 1136 809 754 11398 23464 1512 --
NM_001039618chr11155713 5670 5260 4948 4455 4243 4191 2369 1411 1394 1305 1194 1134 498 339 34717 1753 602 1330 --
NM_001039775chr1----184 --
NM_001039840chrX95016 4451 2357 1629 1471 1281 1101 904 446 --26020 372 14581
NM_001039937chr1393903 3558 3135 2629 1583 1134 845 523 300 --2370 108 1806
NM_001040001chr641989 1951 1713 178 ------
NM_001040057chr721028 195 11485 21479 183 --
NM_001040101chr42428 99 --1138 --
NM_001040142chr282401 2113 1726 665 618 463 263 217 ----11502
NM_001040152chr775101 4743 3615 3384 3351 1435 1239 ----13274
NM_001040158chr5----1474 --
NM_001040214chr632045 1577 640 --12243 1454
NM_001040284chr1675164 4276 4267 3813 2074 1258 1184 14400 --1232
NM_001040402chr433039 159 140 --2192 93 --
NM_001040429chr1333634 2218 1199 1768 23366 112 --
NM_001040432chr32357 134 ------
NM_001040441chr1135427 5248 5177 4232 4064 4055 3928 2116 1800 1518 946 274 254 24870 319 ----
NM_001040446chr542505 1976 879 229 1501 12132 --
NM_001040450chr1552518 2396 2298 1862 326 1779 12816 1143
NM_001040613chr821273 481 --2167 87 --
NM_001040624chr832215 488 258 --2615 35 --
NM_001040633chr72832 749 ------
NM_001040665chr7114838 4592 4583 4575 4473 4335 4056 3437 3366 1288 954 24984 807 33540 1676 265 23058 1311
NM_001040709chr192484 2356 2306 1810 894 798 270 258 21 --12221 --
NM_001040712chr983525 3088 3064 2820 1440 1022 884 413 1116 ----
NM_001042403chr122384 180 ------
NM_001042422chr17------163
NM_001042473chr1042105 1758 1657 808 11784 1342 --
NM_001042481chr1442312 2185 2163 80 21968 868 12685 --
NM_001042493chr651299 798 733 620 373 --2571 387 --
NM_001042506chrX31386 577 171 11293 1467 --
NM_001042510chr822067 1485 --178 --
NM_001042517chr132370 362 --1983 --
NM_001042533chr343288 1022 753 30 2989 907 12848 2926 553
NM_001042537chrX51902 1849 1556 964 462 --1233 2890 119
NM_001042543chr471349 1223 1124 430 371 339 224 1522 21521 1337 --
NM_001042555chr1274163 3549 3207 1562 1300 1066 569 2647 242 24728 1156 --
NM_001042599chr297767 7391 6140 6016 5961 5722 911 792 696 11403 36301 5136 4883 --
NM_001042601chr342841 400 376 262 162 31257 867 467 --
NM_001042632chr2032473 2160 51 --1473 --
NM_001042749chrX----11263 --
NM_001043318chr1464124 1619 1269 1031 771 395 --11105 23481 1563
NM_001043351chr13875 634 25 1725 22066 115 --
NM_001046chr563016 2757 2486 2261 687 456 13050 23001 262 --
NM_001100108chr1188316 7048 6771 6218 5987 5580 5285 2991 2961 2832 2760 2422 2018 1525 1306 600 522 333 11724 25792 2324 --
NM_001106chr3109764 7263 6953 6738 5908 3145 2545 1972 1285 114 48593 6800 6107 1476 69657 8875 6957 6645 726 118 --
NM_001109977chr45767 677 542 297 96 ----181
NM_001116chr1622482 398 --12595 --
NM_001121chr102363 286 11815 ----
NM_001144chr1621126 261 --11414 --
NM_001146chr852048 1779 1663 1549 190 1593 ----
NM_001149chr1031265 945 456 --1115 --
NM_001156chr101590 ------
NM_001167chrX106355 6180 5345 4388 1809 1704 1316 1053 882 837 25139 958 14188 --
NM_001191chr2021271 1233 --1539 --
NM_001198chr662346 2334 1936 1813 1594 160 11522 ----
NM_001200chr2021130 463 --1156 --
NM_001204chr2146048 5499 5382 4991 4797 2406 2020 1884 1829 1609 1335 1256 677 85 11479 12970 16321
NM_001206chr962880 2651 2582 2345 2085 1160 22115 886 12364 1669
NM_001222chr1031773 1549 569 1482 ----
NM_001233chr742285 2144 2109 1651 1596 12246 --
NM_001241chr242102 860 210 131 --4635 441 382 231 --
NM_001257chr161284 --1558 --
NM_001259chr7146380 5373 5346 5204 4766 2460 2081 1327 834 766 751 271 140 118 35804 1989 727 46355 5471 1400 479 --
NM_001260chr131252 --1239 --
NM_001270chr5----2463 125 --
NM_001271chr1573277 2404 819 657 478 415 112 --13050 --
NM_001278chr1041053 996 479 465 1313 1974 1263
NM_001284chr51523 ------
NM_001286chr131783 1768 1016 --22835 359 --
NM_001292chr15------11110
NM_001304chr1763322 2916 2799 1414 972 807 --1265 1812
NM_001315chr642302 1395 655 300 1817 22219 701 --
NM_001316chr202433 324 --2442 355 --
NM_001332chr521334 643 --21069 155 --
NM_001351chr331405 636 331 --11659 --
NM_001356chrX31779 1745 1640 1871 ----
NM_001364chr1194063 3958 3807 3135 3094 1299 1147 660 70 12971 --12918
NM_001395chrX2726 703 --3730 373 208 --
NM_001396chr2142786 2262 1114 1107 --182 --
NM_001407chr341502 1149 1114 1064 --11073 --
NM_001412chrX53200 3158 2899 2841 2697 --2509 283 --
NM_001420chr191599 43100 2488 2444 2140 12187 --
NM_001423chr1231914 1657 1547 --11443 --
NM_001427chr71428 12039 --21882 269
NM_001429chr221411 11037 ----
NM_001431chr62316 297 ------
NM_001438chr163195 2707 1331 875 534 190 23381 3027 33245 2356 783 --
NM_001440chr832514 1972 743 --11976 --
NM_001449chrX31277 420 61 11138 ----
NM_001518chr761102 428 353 146 126 61 ------
NM_001527chr694355 4138 4047 3700 1724 1281 1009 466 99 33986 876 507 14051 14678
NM_001530chr141973 2147 65 ----
NM_001546chr641425 1239 1197 359 ------
NM_001570chr321241 1178 11463 11434 --
NM_001584chr1121135 1017 2992 82 11145 --
NM_001614chr17----1523 --
NM_001616chr273163 2603 1265 1168 568 508 52 21018 71 23413 377 --
NM_001621chr7112934 2546 2529 2479 2285 2142 713 459 386 336 121 22986 706 ----
NM_001627chr332229 1939 921 --1328 --
NM_001659chr1232558 2408 1972 12160 --11832
NM_001660chr31233 ----1170
NM_001664chr31333 ------
NM_001668chr11848 --1855 --
NM_001677chr12819 401 ------
NM_001681chr12----1558 --
NM_001701chr921431 1286 1224 ----
NM_001707chr74934 595 319 192 141 ----
NM_001709chr112457 51 22848 157 2817 307 --
NM_001718chr611134 --1332 --
NM_001722chr83582 217 43 ----1239
NM_001743chr21452 1539 1501 --
NM_001753chr741598 1550 1494 185 --1176 --
NM_001755chr1662299 2131 1894 1425 436 162 --32059 1866 1587 --
NM_001759chr12134806 4715 4599 4505 3501 2076 1770 1698 1082 705 625 565 201 23290 1810 45318 1774 1566 1513 --
NM_001796chr16----186 --
NM_001797chr164656 630 569 537 ------
NM_001806chr1952931 2535 1193 889 427 --2963 125 --
NM_001829chr44977 919 393 88 --1981 --
NM_001830chrX84034 3843 3617 2776 490 460 452 242 33868 3647 970 33470 2752 1553 --
NM_001845chr1341372 1293 171 156 --140 --
NM_001858chr643754 3194 1982 496 34959 3926 541 24847 4702 --
NM_001893chr171358 ------
NM_001897chr152423 368 ------
NM_001901chr61985 --1341 --
NM_001904chr32931 907 --1113 --
NM_001905chr12783 644 --1812 --
NM_001938chr141752 1213 136 24 --11599 --
NM_001941chr18104013 3908 3439 3305 2996 2920 2521 1622 937 124 --13010 23934 3036
NM_001945chr521147 567 ------
NM_001946chr1221191 1183 --177 --
NM_001949chr652497 2330 2130 878 224 2909 784 22756 2452 --
NM_001968chr41126 1860 ----
NM_001969chr1431191 1162 356 --22832 778 --
NM_001977chr431227 539 501 ------
NM_001981chr1--32138 511 62 1280 --
NM_001995chr441357 1016 513 403 --21453 375 --
NM_001999chr521224 213 --1491 --
NM_002015chr1393354 2730 2716 2637 2291 1139 831 676 222 ----1970
NM_002024chrX--1230 11428 --
NM_002025chrX107813 5725 3631 3182 3027 2583 2124 1124 657 588 66602 5786 3112 2335 1519 200 26936 2634 --
NM_002035chr1873860 3303 3056 2658 903 617 55 1322 33956 3929 2924 --
NM_002039chr41369 ------
NM_002040chr2183157 2844 2408 2294 2060 977 373 169 12330 1407 --
NM_002063chrX1904 ------
NM_002131chr631311 1025 822 --11321 --
NM_002137chr752194 1570 956 811 399 --1727 --
NM_002139chrX2515 424 --1106 --
NM_002146chr1711228 --21399 1220 --
NM_002184chr51184 --1156 --
NM_002187chr5----11205 1244
NM_002190chr62329 242 1432 --1420
NM_002196chr2021024 982 21119 922 --11077
NM_002203chr563720 2807 1515 1071 518 223 --11164 --
NM_002211chr1031041 1004 214 1743 --11136
NM_002214chr775247 4961 4902 4637 1460 731 176 --15261 --
NM_002226chr14----1222 --
NM_002232chr12862 555 21008 288 1154 --
NM_002241chr112988 --11251 --
NM_002247chr1042236 1619 630 595 1943 1825 --
NM_002253chr4151 --11180 --
NM_002264chr384910 4874 4793 4295 4035 3331 1654 1630 34477 1175 424 21967 1952 --
NM_002265chr1721171 434 ----1273
NM_002267chr1362464 2150 1708 731 607 249 12078 ----
NM_002268chr331704 1434 134 --11224 --
NM_002270chr575686 5555 4874 4338 2182 2115 1660 35205 4662 1615 34989 3504 846 --
NM_002310chr5115880 5234 4494 4449 4380 4329 4157 2317 2263 1916 296 11611 14544 16548
NM_002336chr1274282 4206 3519 1667 1586 1054 86 11201 24792 208 --
NM_002359chr1743280 3162 1134 698 --23419 1511 --
NM_002360chr742632 2622 2250 1006 --32507 2470 936 --
NM_002382chr142877 448 ----1847
NM_002395chr641118 453 383 113 ----11191
NM_002397chr532074 1732 1516 1758 ----
NM_002481chr1136596 6485 6054 5979 5038 2460 2216 1633 1627 1618 1252 1018 310 26511 5425 35329 3136 319 --
NM_002500chr251162 966 815 494 412 1219 2912 882 --
NM_002508chr131864 1267 52 --1596 --
NM_002514chr851189 752 297 233 43 ------
NM_002524chr14928 781 233 167 --1129 --
NM_002547chrX64225 3678 1648 847 726 354 --1910 --
NM_002553chr7--2312 190 --169
NM_002572chr111393 ------
NM_002577chr323517 296 1727 32972 2650 1332 --
NM_002581chr9115353 5346 4004 3877 3615 3497 2257 2190 854 839 78 14653 1843 --
NM_002590chr131223 1402 1127 --
NM_002592chr20149 --1315 --
NM_002594chr2042275 1694 716 586 ----12192
NM_002609chr531709 493 375 --11842 --
NM_002616chr172566 443 ------
NM_002618chr21127 --1111 --
NM_002628chr341046 993 368 104 ------
NM_002655chr885224 4984 4756 4444 3365 310 104 79 15186 ----
NM_002703chr461934 1845 1771 1658 1600 85 177 ----
NM_002709chr211290 1522 ----
NM_002711chr72891 768 1303 1314 140
NM_002715chr51447 11068 3956 268 258 --
NM_002719chr142410 264 12095 ----
NM_002731chr153077 2977 2216 1158 234 12243 ----
NM_002737chr1766281 5105 4424 1598 1466 1359 26157 5698 35428 5008 2042 --
NM_002738chr1651006 922 454 303 54 ------
NM_002748chr1531186 937 86 1841 1364 --
NM_002750chr101196 ------
NM_002750chr101196 ------
NM_002752chr5--2578 159 1414 --
NM_002753chr42624 293 1609 ----
NM_002755chr15----1230 --
NM_002815chr17198 ------
NM_002825chr71444 ------
NM_002841chr33620 522 243 --1103 --
NM_002847chr731566 1501 1467 ------
NM_002850chr1921003 912 --11172 --
NM_002851chr7--1192 ----
NM_002866chr19------1146
NM_002869chr1132127 372 42 21658 1455 ----
NM_002874chr942189 758 340 179 --42300 1739 617 503 --
NM_002890chr53966 919 210 ------
NM_002892chr142384 241 ----1491
NM_002906chr1132134 1919 399 --11628 --
NM_002912chr62640 302 --2387 33 --
NM_002941chr331264 1169 247 1353 11361 --
NM_002956chr1221422 538 11159 1348 --
NM_002959chr132946 1479 1413 --21021 123 --
NM_002971chr32455 196 1771 11117 --
NM_002993chr41131 1216 1710 --
NM_002994chr441731 1629 711 266 1544 21491 240 1738
NM_003010chr1752329 1796 719 497 342 12385 ----
NM_003017chr62372 40 --1221 --
NM_003026chr921102 60 21320 1221 21262 1096 175
NM_003030chr321813 1385 --2459 72 11652
NM_003036chr11261 ----1304
NM_003069chrX2610 105 --1185 --
NM_003071chr32636 169 11699 1243 --
NM_003081chr201377 --1886 --
NM_003099chr15125071 2000 1574 1213 1159 842 784 772 522 339 212 149 15033 46599 5988 2252 526 --
NM_003101chr12548 80 --21289 496 --
NM_003107chr622224 878 12211 ----
NM_003108chr2146806 6660 6565 6346 5861 5477 5106 5000 4914 4852 825 781 517 362 15654 ----
NM_003112chr733020 2631 645 ------
NM_003128chr242603 1945 823 412 --32465 887 836 --
NM_003131chr612202 1692 1686 --
NM_003135chr5----1281 --
NM_003137chr662162 1938 1556 1517 541 158 12029 ----
NM_003144chr642091 559 480 110 134 1525 --
NM_003146chr114362 356 283 258 --1287 --
NM_003150chr1762386 2268 1920 758 202 135 ------
NM_003161chr1783550 3100 2935 2682 2205 1189 1113 794 1781 ----
NM_003162chr23908 838 752 --11088 --
NM_003170chr171560 ----1418
NM_003176chr1----1225 --
NM_003178chr332150 1468 1458 --1703 --
NM_003185chr2041313 1286 1039 1003 1457 11263 --
NM_003200chr191680 --1672 --
NM_003202chr541746 1635 1564 749 175 ----
NM_003205chr1522013 621 --11668 --
NM_003238chr11233 ------
NM_003243chr121191 55 --1320 --
NM_003246chr1561959 1852 1599 1271 326 268 ----11806
NM_003262chr384945 3761 3735 3674 1972 1674 1605 521 11214 11486 1772
NM_003272chr1----1203 --
NM_003304chr351344 1194 1069 613 496 2561 266 1252 11090
NM_003318chr61230 ------
NM_003325chr221464 ------
NM_003326chr122659 1859 12584 --12751
NM_003329chr9------139
NM_003336chrX2883 88 --1216 --
NM_003339chr541622 1336 578 85 --11236 --
NM_003340chr431436 199 87 --11043 --
NM_003341chr32673 531 1656 --154
NM_003342chr1742698 2354 934 638 2948 916 23308 1331 --
NM_003347chr2242147 247 237 128 1411 ----
NM_003369chr1142474 2113 777 291 --1283 --
NM_003370chr193184 74 59 ----1510
NM_003390chr11186 ----1273
NM_003392chr353554 2938 1145 992 529 11165 12640 --
NM_003400chr21248 1857 ----
NM_003405chr222679 119 --1800 --
NM_003406chr881618 1591 1521 1458 1232 737 314 122 11633 1116 --
NM_003409chr18--11016 1146 --
NM_003410chrX53048 1952 604 498 129 --1232 --
NM_003411chrY31242 1235 685 2653 280 ----
NM_003412chr343023 2530 2206 590 135 1826 12315
NM_003413chrX3727 542 239 11379 11750 --
NM_003439chr731281 484 413 1431 32839 2413 393 --
NM_003469chr23366 151 25 ------
NM_003473chr10--1214 2426 263 --
NM_003474chr1052059 893 323 175 135 ------
NM_003478chr1122864 2199 13311 1660 --
NM_003483chr1241905 792 569 535 1706 22202 1134 --
NM_003489chr2163441 3190 2532 1168 727 136 11361 12271 1644
NM_003498chr1672669 1782 964 695 593 300 80 --32435 896 264 --
NM_003506chr82467 21 21213 275 1324 --
NM_003557chr141587 1573 138 96 11454 11432 --
NM_003558chr9----1260 1580
NM_003559chr1783927 3903 3337 3104 2435 1419 1023 985 1229 --1384
NM_003566chr12133307 3282 2636 2523 2222 2182 1126 1119 555 353 204 170 84 1689 ----
NM_003574chr1885499 5239 5129 3976 3634 1009 976 190 14803 15737 12116
NM_003583chr1273776 2565 1252 1242 788 444 294 --12468 1960
NM_003598chr19----1720 --
NM_003603chr43533 222 162 --1793 --
NM_003612chr152602 169 --1634 --
NM_003615chr374007 3991 2526 1139 953 480 288 14037 ----
NM_003618chr231085 1057 977 --1110 --
NM_003620chr172832 766 --1812 --
NM_003626chr1171345 1334 1268 1250 1239 1128 28 ----1248
NM_003629chr153151 3118 3041 2671 92 --23224 2269 13046
NM_003633chr552449 2203 1637 444 73 1615 11011 1674
NM_003676chr11675 --2620 293 --
NM_003677chr1221948 1835 --32221 2072 317 --
NM_003685chr191718 ------
NM_003692chr93691 378 284 ------
NM_003704chr4----1631 --
NM_003716chr3----1946 --
NM_003743chr232175 792 255 ------
NM_003749chr1352352 2272 1686 1599 734 1889 2583 90 --
NM_003758chr1531564 383 218 21201 505 ----
NM_003768chr121397 306 11327 1271 --
NM_003769chr121296 --150 --
NM_003787chr1841394 1212 536 360 --1202 --
NM_003790chr1------166
NM_003791chr16----2440 424 --
NM_003794chr33763 451 391 ------
NM_003806chr12------1259
NM_003822chr142403 2066 833 25 12883 13079 --
NM_003884chr341410 698 589 408 2667 223 1267 --
NM_003885chr1752510 2114 2101 1666 661 ------
NM_003887chr232198 1859 1681 11994 22160 414 --
NM_003895chr212809 130 --1743 --
NM_003908chr2051092 974 903 449 185 --1958 --
NM_003913chr653064 2740 970 943 776 --21566 1074 --
NM_003930chr752236 2219 334 294 30 1115 3875 344 230 --
NM_003932chr2221702 1354 ------
NM_003934chr94873 467 171 57 --11090 --
NM_003941chr762213 1700 360 347 197 54 21719 322 ----
NM_003948chr431643 860 398 --1250 --
NM_003980chr631299 1074 490 ------
NM_003998chr43676 601 275 --1664 --
NM_004040chr231119 955 468 ------
NM_004052chr102790 41 ------
NM_004063chr8170 1422 142 --
NM_004064chr12151 ----1522
NM_004077chr1211179 ------
NM_004093chr1383181 2677 2180 2056 2010 1131 1101 769 --12425 --
NM_004119chr131766 --1114 --
NM_004124chr1473333 3049 2899 2744 2470 965 227 1297 --198
NM_004143chrX------169
NM_004165chr16----2384 350 --
NM_004225chr841380 1371 1325 1207 3979 951 935 1258 --
NM_004232chr18103884 3271 2927 2461 2409 1077 688 509 308 106 --12817 --
NM_004242chr62433 408 --162 --
NM_004255chr15----145 --
NM_004263chr261632 1489 1392 1198 218 127 1423 ----
NM_004272chr541739 1544 674 377 11326 11293 --
NM_004273chr1095047 5007 4392 3682 3652 3618 1846 580 390 --14753 1717
NM_004274chr1433022 2614 2196 12671 2782 252 --
NM_004279chr71316 --21996 731 12380
NM_004280chr6------1337
NM_004311chr1082972 2701 2572 1905 1181 1112 971 524 --32812 2510 71 --
NM_004326chr13831 494 266 --2128 62 --
NM_004344chrX1141 --1478 --
NM_004349chr81120 --11235 --
NM_004354chr43526 154 127 --3703 296 255 --
NM_004370chr611696 11821 32126 867 575 129
NM_004385chr51255 --1459 --
NM_004393chr331533 963 636 --21702 916 --
NM_004397chr1133957 2886 2783 1444 23546 1660 --
NM_004423chr362669 2604 2300 1870 893 81 12256 12465 --
NM_004427chr1----1355 --
NM_004432chr952023 1807 1646 1608 662 1125 ----
NM_004450chr141296 ------
NM_004451chr111694 ------
NM_004483chr16----1488 --
NM_004496chr142854 122 --1174 --
NM_004504chr262961 2188 963 634 445 364 1520 1312 --
NM_004514chr1752637 2518 2056 930 620 --22116 818 --
NM_004521chr10--1265 ----
NM_004535chr2021270 1202 ----11168
NM_004555chr161475 --1427 1449
NM_004566chr1032192 2035 800 ----12356
NM_004569chr142634 214 --2669 567 --
NM_004571chr2142408 686 571 416 11166 22245 607 1818
NM_004575chr441645 1317 644 409 --11625 --
NM_004586chrX94430 3659 2130 1652 1238 496 148 138 126 45316 5076 3957 1289 12141 --
NM_004591chr2--1367 1349 --
NM_004593chr31136 ------
NM_004609chr20--1590 ----
NM_004612chr953986 2966 1929 1823 1563 11382 34769 1423 1050 --
NM_004643chr144527 318 276 183 ----1228
NM_004655chr1721352 251 21305 224 21065 420 --
NM_004660chrY41711 1678 336 243 --11457 --
NM_004663chr1531510 258 102 --11524 --
NM_004687chr171444 11900 11468 --
NM_004694chr171595 ----1836
NM_004715chr183662 454 195 --192 --
NM_004719chr12----22356 636 --
NM_004725chr1021310 439 --1429 --
NM_004730chr53824 693 269 11952 11752 --
NM_004734chr1363059 2301 2153 1053 854 315 --1840 --
NM_004735chr23690 309 136 --1156 --
NM_004736chr181802 1796 1709 1678 1469 838 226 207 --2842 537 --
NM_004742chr321563 1448 --21579 372 --
NM_004744chr463768 3760 2489 930 506 397 23898 675 1730 --
NM_004745chr8166831 6596 6572 6478 5731 5676 5456 4990 4650 2555 1941 1751 1315 798 350 197 36530 5262 2330 16164 --
NM_004747chr101358 --21595 478 --
NM_004750chr19------1324
NM_004755chr144877 847 784 183 --1295 --
NM_004758chr1711241 --11025 --
NM_004760chr732016 871 543 --2706 423 --
NM_004762chr171449 11821 1146 --
NM_004768chr131005 949 139 1463 1252 --
NM_004772chr51354 --21578 564 --
NM_004774chr1732451 2286 1032 ----1586
NM_004788chr1142480 1969 1803 1681 --52704 2449 1041 389 347 --
NM_004789chr9----1439 --
NM_004793chr19------1176
NM_004801chr251549 1198 970 252 76 --11050 --
NM_004817chr91765 --1261 --
NM_004824chr611071 ----1148
NM_004831chr192854 196 --11049 --
NM_004841chr1----2305 98 --
NM_004842chr651552 1444 615 372 46 --21722 1309 --
NM_004852chr181513910 13714 12787 12776 12740 12352 11120 10738 9083 4320 2564 1916 1698 1349 1187 11664 210752 1920 213645 8700
NM_004856chr152473 437 ----1442
NM_004857chr14124670 4358 4042 3752 3709 3459 3262 1907 1786 1469 1196 973 --43361 804 629 471 --
NM_004862chr1651607 1351 1086 603 343 --1186 --
NM_004863chr14134463 3967 3722 2052 1686 1267 941 835 446 373 278 177 123 11061 24525 4302 --
NM_004872chr11123 ------
NM_004874chr82426 32 ------
NM_004884chr1531725 1339 1263 11295 11216 --
NM_004897chr102646 103 2270 218 ----
NM_004902chr20----1767 --
NM_004921chr122142 2124 --11704 --
NM_004923chr111683 ------
NM_004932chr5----2512 55 --
NM_004943chr191416 --11096 --
NM_004947chr342245 1816 1765 570 ------
NM_004973chr621723 1663 ----11281
NM_004992chrX78300 6999 6896 6826 5371 3066 2176 18526 22811 942 --
NM_004999chr651572 1468 1237 910 525 24397 3178 23999 101 --
NM_005006chr24807 791 354 142 --1746 --
NM_005028chr1031693 1643 157 1819 1201 --
NM_005032chrX11044 --161 --
NM_005045chr71679 --1944 1381
NM_005063chr1042641 2520 1317 937 --23789 3124 --
NM_005065chr1495412 5138 5026 3728 3453 1509 1224 934 686 11171 --1144
NM_005067chr31395 ----1947
NM_005072chr161105 ----1321
NM_005077chr91135 ------
NM_005095chr1----1390 --
NM_005109chr32601 228 11861 22335 2108 --
NM_005114chr43494 257 174 ------
NM_005116chr2023119 3030 21157 909 14562 --
NM_005121chr1763181 3161 3045 2702 988 122 12922 1171 --
NM_005126chr341714 572 516 423 --11658 --
NM_005156chr9115332 4776 4296 4107 3517 3463 1616 1407 851 657 403 34805 1038 841 24516 3739 --
NM_005180chr1021546 1519 --11540 11246
NM_005189chr1732537 2525 2025 --12340 --
NM_005207chr2231399 1117 965 --32824 2529 27 --
NM_005212chr4160 ------
NM_005229chrX31227 836 247 ------
NM_005254chr1561350 1342 1212 1080 169 30 ------
NM_005271chr1011204 --1773 --
NM_005274chr11131 ------
NM_005316chr113975 328 148 --1349 --
NM_005318chr222240 44 1250 11238 --
NM_005324chr1721305 283 21855 1558 1526 --
NM_005335chr31127 --1358 --
NM_005339chr4103980 3895 3862 3848 3753 3657 3572 1186 902 444 12804 1280 13058
NM_005370chr1911177 --1218 --
NM_005385chr382013 885 740 683 604 301 132 85 ------
NM_005389chr63741 293 272 --2813 567 --
NM_005399chr1104214 3996 3710 3492 3173 2885 2812 1730 886 145 1441 14291 --
NM_005415chr22271 153 --1138 --
NM_005438chr111597 ----1602
NM_005455chr151415 672 611 181 34 ------
NM_005458chr931937 1770 664 ----12271
NM_005460chr52583 524 ------
NM_005479chr1021508 1425 1210 1404 1531
NM_005493chr61857 ----1561
NM_005524chr3----2147 117 --
NM_005539chr1041324 1189 1000 912 --1555 --
NM_005540chr121020 25 --21365 119 --
NM_005563chr13787 633 253 --2668 230 --
NM_005570chr18130 --1916 --
NM_005575chr52334 261 ------
NM_005581chr19----1321 --
NM_005587chr154872 378 285 35 ------
NM_005595chr11858 --1938 --
NM_005596chr946381 6349 4844 2578 --11986 16169
NM_005598chr131068 659 193 41350 1242 1234 61 --11270
NM_005599chr111307 ------
NM_005604chr642289 2022 767 436 --12004 --
NM_005607chr81837 --11035 --
NM_005668chr564482 4202 4177 3656 2821 1215 13255 ----
NM_005715chr632730 2642 1016 12403 11863 --
NM_005725chr161733 1610 1604 1548 804 304 --22347 1688 1362
NM_005754chr531173 277 130 2809 111 21218 1092 --
NM_005760chr2--136 ----
NM_005763chr7----1258 --
NM_005765chrX2820 760 ------
NM_005776chr141668 1725 2693 115 --
NM_005779chr561338 1262 1057 981 376 169 --13193 --
NM_005780chr13----1996 --
NM_005785chr1231742 1724 714 1274 ----
NM_005795chr262851 2733 2537 1199 702 243 ----22401 2060
NM_005822chr622292 1797 1781 1907 --
NM_005828chr1784978 4176 1957 1932 1801 1618 535 137 14440 44933 4234 3125 2001 --
NM_005859chr571534 1158 1135 1087 379 306 251 ------
NM_005880chr161407 --11586 --
NM_005895chr1264180 3468 1049 471 427 301 23340 898 34017 3243 265 --
NM_005898chr1131004 190 85 ------
NM_005899chr174517 307 251 34 ----11373
NM_005904chr1841286 925 61 54 --11132 --
NM_005909chr513560 23818 3069 21657 1624 --
NM_005910chr1753980 3356 3290 142 102 --1359 --
NM_005927chr531289 1219 1126 --11156 --
NM_005930chr142738 207 ----171
NM_005933chr1162670 2571 2529 2475 1869 754 --11072 --
NM_005937chr1743362 3323 1626 1175 --11288 --
NM_005941chr894183 3613 3598 3471 3181 3133 2737 2683 563 --33298 1217 775 --
NM_005955chr165116 4859 4658 1762 1529 297 --15009 --
NM_005964chr1731532 244 155 --1517 --
NM_005966chr251887 932 769 409 390 ----1743
NM_005977chr131126 ------
NM_005986chr1322006 1071 --22071 828 --
NM_006011chr1523741 3272 --21195 845 --
NM_006015chr11304 ----1984
NM_006037chr254400 4228 3399 1766 1183 13915 24920 4472 --
NM_006038chr20----1192 1835
NM_006047chr2053308 2210 560 396 376 --1575 --
NM_006054chr1121479 31 --165 --
NM_006055chr293021 2965 2853 2645 2135 1020 583 328 172 22943 179 32911 2802 2240 --
NM_006058chr51245 --1728 --
NM_006080chr722972 959 22911 2837 1769 --
NM_006106chr1182907 2711 1140 1000 540 245 168 144 12855 12241 --
NM_006154chr1542833 1096 628 503 11896 --1515
NM_006158chr841788 1537 1394 614 11684 --21516 458
NM_006159chr121561 ----1529
NM_006166chr1221607 684 11744 1342 --
NM_006167chr852143 1910 1801 793 113 ------
NM_006186chr2----1185 --
NM_006195chr91316 --1260 --
NM_006216chr2139 ------
NM_006224chr1742417 2100 1771 678 1623 22439 2245 --
NM_006247chr191115 --1459 --
NM_006251chr552733 2627 2450 2196 257 12236 22101 272 11084
NM_006256chr132175 416 290 32615 2067 722 1661 --
NM_006257chr103262 173 68 ------
NM_006264chr41539 --1184 --
NM_006275chr2042504 2446 2388 57 3790 574 47 ----
NM_006281chr81307 --1419 1380
NM_006282chr2021891 637 --14577 --
NM_006283chr8154915 4751 4236 3444 1986 1960 1493 999 975 817 719 620 543 318 267 --2456 43 --
NM_006306chrX45207 1818 1069 587 34390 1973 1769 25846 2276 11701
NM_006307chrX2322 118 --1239 --
NM_006313chr1221734 273 --21590 1217 --
NM_006322chr132836 621 ------
NM_006328chr112210 177 ------
NM_006345chr4--2917 183 ----
NM_006352chr121621 503 --11783 --
NM_006358chr221300 1328 ----
NM_006371chr354901 3991 3562 1828 1646 --14439 --
NM_006372chr61165 --2491 439 --
NM_006378chr921415 149 ------
NM_006379chr752005 1970 742 596 351 21749 1584 --11957
NM_006380chr17104077 4022 3330 3145 2968 2785 1419 1211 1063 132 1335 23303 750 --
NM_006393chr1084569 4524 4068 3667 2935 707 266 233 1601 ----
NM_006403chr641564 1385 87 40 --11829 --
NM_006415chr921235 1193 1279 11239 --
NM_006451chr551045 808 706 320 118 ------
NM_006461chr17124 ----1105
NM_006469chr131093 467 231 --11162 --
NM_006478chr22------1187
NM_006520chrX21571 553 ----11275
NM_006534chr2063451 3408 2710 2679 2482 292 ----12911
NM_006536chr1----1375 1900
NM_006537chr153576 560 110 --1214 --
NM_006544chr14136048 4934 4912 4746 4408 4072 1441 1357 1343 1088 695 666 628 14109 15399 11679
NM_006547chr731982 1479 715 11989 ----
NM_006557chr91611 --11563 11510
NM_006558chr81138 ------
NM_006570chr91344 ----1116
NM_006577chr22950 339 11200 --1920
NM_006591chr1131377 777 148 --11647 --
NM_006595chr1161856 1369 693 518 424 205 1640 ----
NM_006599chr16137529 7470 7374 5117 5070 1992 1389 889 866 369 344 240 77 47922 7837 5997 5890 55726 2529 2000 1580 163 --
NM_006601chr122449 118 ------
NM_006602chr201646 1703 1572 --
NM_006609chr252562 2317 969 903 664 1700 ----
NM_006614chr373691 3226 2541 2267 836 582 26 1809 1347 --
NM_006618chr1--129 31376 222 121 --
NM_006624chr1022099 1866 --11820 --
NM_006626chr921763 798 --12651 11953
NM_006628chr15164489 3303 3074 3039 3033 1798 1671 1166 1093 943 553 351 323 225 136 68 14031 --161
NM_006633chr5--197 --1809
NM_006662chr16178 ------
NM_006690chr202813 507 1248 21869 725 --
NM_006698chr2021425 406 --11211 --
NM_006699chr172500 2183 2168 1873 1025 621 276 ----1723
NM_006717chr91221 12100 12897 --
NM_006726chr451078 977 887 251 197 --1140 --
NM_006729chrX105487 5277 5249 5214 5198 4676 4159 1645 763 596 21610 1185 1789 15649
NM_006732chr1921698 854 ----11535
NM_006749chr821233 379 ----1261
NM_006750chr16107734 6101 5904 3062 2501 1261 1039 895 725 677 47710 6683 5166 1856 22721 1641 --
NM_006751chr21422 --190 --
NM_006754chr7----2931 135 --
NM_006763chr132071 2047 1752 --42141 762 587 188 21669 106
NM_006769chr13677 655 579 ------
NM_006777chrX72895 2510 2427 2241 2114 1930 963 --11908 --
NM_006791chr15------1484
NM_006795chr1121419 379 --1221 --
NM_006802chr141201 946 65 56 --1394 --
NM_006805chr561416 448 397 267 253 165 ----1142
NM_006807chr173993 416 69 ------
NM_006815chr1221014 875 --11114 --
NM_006824chr1----1183 --
NM_006826chr211081 ------
NM_006832chr142423 319 1358 --176
NM_006851chr1282916 2831 2703 1999 1870 522 402 89 --32117 836 357 --
NM_006852chr1772802 2234 2134 1789 840 518 260 --1896 --
NM_006856chr1231088 1031 703 --1715 --
NM_006873chr241287 812 269 75 53092 2456 2174 956 539 23263 662 1382
NM_006875chrX1638 1928 ----
NM_006885chr1654065 3861 2923 2648 655 13277 11607 13591
NM_006888chr1483361 3190 2973 2880 2648 2581 1259 1234 21076 60 13387 --
NM_006892chr2021286 441 --21212 216 --
NM_006899chr20----1262 --
NM_006902chr122455 976 --11266 132
NM_006908chr7----11076 --
NM_006915chrX4719 642 427 157 1312 --2632 216
NM_006920chr262016 1829 1605 1524 449 212 21975 1383 ----
NM_006930chr541673 1448 1315 225 ------
NM_006931chr1232142 857 103 1212 11866 1108
NM_006939chr143446 407 123 --1838 --
NM_006940chr1251220 765 576 549 264 11686 1106 11283
NM_006951chr103639 333 33 --2283 130 --
NM_006981chr922100 47 --12496 --
NM_007005chr931264 216 162 21325 627 ----
NM_007007chr12114719 4534 4200 4123 3814 3348 1347 945 685 516 179 ----11200
NM_007010chr1751829 1737 1218 610 305 ------
NM_007011chr15146819 6663 6521 5550 5129 4623 4547 4526 2737 2051 1107 943 592 197 --21993 182 --
NM_007013chr81172 21033 678 1739 --
NM_007030chr554739 4340 4326 4137 517 ------
NM_007034chr121002 978 1319 1809 1957
NM_007038chr2176090 6038 4958 2183 904 558 175 35917 5517 712 35440 2051 495 15787
NM_007040chr193986 770 445 ------
NM_007051chr1------1165
NM_007067chr1721173 423 11382 ----
NM_007085chr322208 423 --1653 --
NM_007106chr1372643 2034 1994 1718 1139 595 50 --12418 --
NM_007146chr1722383 330 1845 12752 --
NM_007159chr361728 1677 1154 547 520 498 --11437 --
NM_007174chr1252158 2122 2027 625 250 --1365 --
NM_007175chr8103560 3357 3351 3213 3151 2948 2684 812 362 110 23111 3057 --12689
NM_007207chr1129 --1297 --
NM_007214chr621356 1308 1525 11058 --
NM_007232chr201312 --1758 --
NM_007245chr161913 ------
NM_007249chr13107949 7007 6420 6299 6064 3300 2394 2265 2202 1166 13088 17418 --
NM_007276chr711092 --1181 --
NM_007345chr1872353 2205 2131 2028 1758 1585 1569 --12151 --
NM_007353chr742787 2688 499 198 --11038 --
NM_012069chrX21811 262 --11010 12454
NM_012081chr5153604 3429 3415 3391 3265 3200 2715 2577 1107 861 813 691 427 177 152 11058 2913 133 --
NM_012082chr82958 923 1870 ----
NM_012089chr151400 1272 427 323 118 1514 ----
NM_012090chr131059 334 156 ----1838
NM_012095chr1052861 801 788 782 577 12952 13402 1140
NM_012104chr1153336 3124 3058 2705 2587 1564 2475 274 --
NM_012120chr672990 2704 2130 1024 519 423 381 1893 --176
NM_012137chr1102622 2485 2423 2311 2294 2025 1169 683 452 107 --1480 --
NM_012153chr1132110 132 89 --22276 184 1749
NM_012154chr81345 ----1246
NM_012161chr43924 765 27 ------
NM_012164chr977103 6107 2902 2680 2513 2197 2143 26220 2102 14819 --
NM_012193chr11115339 4294 3511 3424 3357 2005 1659 1647 1247 927 717 11187 44982 4090 3433 2143 15427
NM_012199chr1114687 4547 4337 4151 4003 3536 2978 1833 1603 1030 666 13652 33350 1118 914 --
NM_012207chr102945 252 --11092 --
NM_012214chr2126311 5930 5340 5011 4431 4376 1966 1585 1163 1000 253 83 15070 55748 4763 1870 1428 745 --
NM_012215chr102540 311 --11880 --
NM_012223chr221022 226 --11242 --
NM_012234chr3113746 3714 3664 3128 2962 2614 2421 2410 1421 265 137 23734 2288 172 --
NM_012245chr143462 165 125 ------
NM_012249chr263358 2697 2663 1197 560 323 33231 3029 2942 33084 3067 998 --
NM_012255chr20----154 --
NM_012257chr71721 1401 1915 1953
NM_012259chr621404 924 --1126 --
NM_012262chr194774 4282 3756 3256 3177 1741 1476 896 868 24966 4021 24680 1614 --
NM_012266chr931042 924 818 --1294 --
NM_012281chr722084 1900 ------
NM_012285chr172340 166 ------
NM_012287chr364399 4341 3606 1479 1043 81 2220 93 44265 3070 817 231 13521
NM_012290chr231559 660 355 ------
NM_012296chr1133335 2976 668 --33633 3175 266 --
NM_012297chr462043 2012 1657 792 595 347 ----11761
NM_012300chr532535 2357 1825 --12527 --
NM_012301chr722141 1956 ------
NM_012309chr1164312 4074 3710 3696 1824 398 --13304 --
NM_012325chr2021639 1173 --21541 545 --
NM_012328chr73498 126 82 --11159 --
NM_012329chr1731191 433 388 --11709 --
NM_012330chr102624 302 11465 1227 --
NM_012334chr554413 4242 3560 3223 340 --43439 3386 998 729 --
NM_012384chr2031912 1525 447 --22069 1780 --
NM_012388chr1563163 3015 2363 805 783 427 --22367 1151 --
NM_012414chr1------1300
NM_012417chr174628 488 475 89 ------
NM_012419chr62241 112 ----1571
NM_012433chr2----137 --
NM_012464chr452293 1102 961 886 880 --11931 12859
NM_012479chr742620 2014 928 37 --12048 --
NM_013233chr241153 1034 392 201 ----1282
NM_013248chr202242 234 ------
NM_013255chr7128779 8246 7099 7036 6454 5545 5495 1630 1014 500 440 266 47581 6930 6147 1505 --16792
NM_013261chr432732 198 105 22827 1277 13580 --
NM_013262chr631347 410 153 ------
NM_013277chr1241062 685 330 94 --121 --
NM_013281chr2041463 1107 293 183 --11220 --
NM_013309chr15--12460 22249 443 --
NM_013351chr17------1681
NM_013354chr821154 528 --1403 --
NM_013357chr81765 1718 1226 --
NM_013374chr332925 2275 192 1475 1426 --
NM_013377chr122492 207 ------
NM_013381chr1232446 2439 878 --11643 --
NM_013436chr2172 1545 ----
NM_013437chr82294 186 ----11280
NM_013943chr153299 2525 617 487 67 --1872 --
NM_013958chr81141 --124 --
NM_013995chrX22163 255 --21616 491 12377
NM_014007chr92861 92 --2436 86 21274 457
NM_014011chr262058 1686 726 434 313 235 11760 --1151
NM_014016chr341535 1177 219 165 --21609 1355 --
NM_014023chr1072512 2299 2263 2143 1943 628 189 ----12662
NM_014028chr662905 2059 1124 797 627 224 --12244 12688
NM_014035chr51322 11179 11428 --
NM_014039chr1141360 1309 1092 218 1257 ----
NM_014043chr32286 21 131 --2500 151
NM_014106chr1512754 11016 12299 1881
NM_014112chr875164 4067 4011 3841 1662 1414 867 11796 ----
NM_014117chr1622197 745 1938 22178 33 --
NM_014181chr252595 2584 1044 776 671 22558 811 ----
NM_014220chr33592 117 40 1528 ----
NM_014231chr1251899 1399 631 245 184 ------
NM_014243chr431965 1842 655 1431 11846 --
NM_014253chrX22302 2236 32461 2342 912 2668 389 --
NM_014268chr1811379 --1255 --
NM_014275chr52336 289 ------
NM_014283chr121389 342 1381 11329 --
NM_014294chr851484 1359 1320 118 44 1298 ----
NM_014296chr331574 1008 451 --11270 --
NM_014319chr1221259 1208 --11953 --
NM_014325chr12----2461 284 --
NM_014331chr497810 6767 5463 5174 2222 2142 1513 620 63 26174 2793 27592 1003 --
NM_014332chrX----1324 --
NM_014335chr1531114 480 32 ------
NM_014341chr61523 ------
NM_014351chr2231432 1410 1217 --11379 --
NM_014368chr931609 1476 396 12012 ----
NM_014372chr1--11844 ----
NM_014379chr82938 430 ------
NM_014393chr832040 1710 273 32107 1470 738 12180 --
NM_014423chr585670 4628 4541 4093 3605 1709 1590 907 --11634 --
NM_014426chr204755 620 461 272 --1186 --
NM_014445chr352290 1910 802 717 609 1261 11541 --
NM_014454chr62793 408 --1141 --
NM_014470chr12135 1822 ----
NM_014488chr11----1646 --
NM_014496chrX199 --1293 --
NM_014504chr742029 1863 1704 198 1187 ----
NM_014505chr122469 376 ----1337
NM_014517chr351555 1475 1397 731 266 11724 11931 --
NM_014547chr152589 194 ------
NM_014548chr1511341 41660 1441 631 155 ----
NM_014572chr1341702 1135 332 121 21533 1403 21679 561 --
NM_014575chr32507 174 ------
NM_014584chr14----21427 658 11182
NM_014587chr1661412 1406 1374 1365 1290 1249 ------
NM_014612chr911523 ------
NM_014630chr1563556 3140 2681 1342 821 396 33970 3119 1089 22623 237 1285
NM_014634chr2262519 2258 1414 1270 832 634 --1846 --
NM_014647chr1632220 2006 660 ----11888
NM_014648chr341038 502 452 34 ------
NM_014660chr74720 458 422 256 --1207 --
NM_014661chr1033114 2739 520 12456 13913 --
NM_014667chr332053 610 248 ----11886
NM_014671chr731548 976 436 --21365 242 1441
NM_014673chr8------191
NM_014682chr822118 425 ------
NM_014686chr1942099 2080 1608 774 ------
NM_014689chr2----1627 --
NM_014701chr1573094 2676 2646 2587 1023 976 140 31234 730 294 13053 --
NM_014702chr663426 3353 3005 2950 2884 2442 11344 21040 941 --
NM_014709chr24602 427 111 23 ------
NM_014713chr2----1348 --
NM_014741chr1182115 1813 1639 804 769 509 298 75 --21544 1379 --
NM_014755chr274267 3950 3711 3693 3265 1022 351 13876 21465 629 --
NM_014757chr542359 2177 1822 77 ------
NM_014761chr1631185 1026 985 --1173 --
NM_014762chr131925 919 317 --22575 73 --
NM_014774chr143145 2581 2568 790 3185 71 45 23164 2556 --
NM_014779chr34886 820 789 455 --2755 459 --
NM_014790chr51144 ----1497
NM_014795chr23491 57 29 1313 ----
NM_014803chr1022716 89 12489 11037 --
NM_014810chr142742 2458 1333 789 --1913 --
NM_014813chr12388 375 ------
NM_014835chr2082197 2188 1982 1840 1500 742 611 585 ------
NM_014839chr162518 1985 929 666 308 29 32288 749 502 2571 548 --
NM_014841chr631214 898 264 --1333 --
NM_014877chr17117053 6655 6618 6389 5678 4975 2719 2343 1347 828 140 15164 47652 6678 3022 2487 27330 2406
NM_014898chr1911501 1934 ----
NM_014900chr221048 859 --1223 --
NM_014903chr1232463 1946 1840 --11816 --
NM_014906chr1753752 3117 3005 1236 831 23765 1152 33725 1246 992 --
NM_014912chr1083422 2940 2600 855 695 567 331 250 1874 ----
NM_014932chr351666 1619 805 651 24 193 ----
NM_014934chr1331287 743 228 23777 899 23681 552 1233
NM_014937chr101456 --21266 481 --
NM_014939chr1811564 ----11239
NM_014947chr163008 2065 697 322 168 125 13166 21218 457 --
NM_014953chr1343484 2660 951 865 11725 33784 2726 99 1719
NM_014969chr141186 1040 445 204 --11063 --
NM_014978chr1011662 --11268 --
NM_014982chr14114921 4612 4510 4394 3308 3289 2078 1592 1532 891 701 45038 3627 3361 1776 34005 2134 1155 13832
NM_014988chr432696 2356 855 22260 66 --1580
NM_014991chr432060 1183 335 33312 1113 515 12941 12235
NM_014999chr1221414 1074 1616 ----
NM_015000chr1242499 2162 2082 909 --22198 878 1967
NM_015004chr3140 --1125 --
NM_015011chr1311136 --21099 449 --
NM_015015chr1921426 283 ----11801
NM_015017chr1----11155 --
NM_015023chr181712 1529 1511 1163 1145 623 267 33 --11518 --
NM_015026chr1244320 1702 1650 1554 3626 589 135 14242 14160
NM_015035chr20106584 5435 4973 4144 1849 1482 1275 745 642 109 14711 36588 4410 2287 --
NM_015039chr153361 1589 1566 585 110 12837 1467 --
NM_015040chr283327 2671 2384 1241 825 780 745 412 23441 391 13342 1454
NM_015042chr1594292 3622 3596 3193 2801 2777 1459 924 360 23992 1278 1822 --
NM_015045chr1082144 1439 660 653 411 340 266 184 --12279 --
NM_015060chr74218 76 62 23 ------
NM_015069chr164604 476 424 140 ------
NM_015072chr141630 ------
NM_015074chr1114327 4148 3647 3453 1907 1311 1267 936 748 404 116 --24011 1241 13581
NM_015079chr1563136 2694 2426 2339 824 114 --22660 373 --
NM_015082chr552548 2088 784 236 166 --1496 12594
NM_015091chr141675 --1121 --
NM_015092chr16134631 4424 4412 4010 3576 3538 3204 3191 1683 1336 1309 1217 612 14117 ----
NM_015094chr2253968 3939 3153 2873 1822 ----14173
NM_015097chr342301 2277 1955 1629 --1432 12255
NM_015099chr171711 1623 ----
NM_015107chrX52412 1890 1513 928 119 --1733 --
NM_015132chr7--11539 --11395
NM_015141chr342468 2365 809 501 --22068 1802 --
NM_015143chr431327 963 323 1264 ----
NM_015150chr32725 627 --1776 1948
NM_015156chr1484003 3881 3306 3217 2536 1474 397 112 13926 12815 --
NM_015161chr1641540 1506 1436 408 1422 ----
NM_015170chr81123 --12171 --
NM_015172chr151393 1369 1115 398 167 --1534 --
NM_015176chr141215 401 197 161 --11384 --
NM_015191chr1192634 2524 2460 2387 2240 911 534 381 55 ----12172
NM_015192chr2052773 2416 1998 756 621 ------
NM_015199chr382872 2671 2531 2523 1190 894 832 684 1306 1977 --
NM_015205chr13105274 5250 4832 4785 4045 1433 1389 1360 538 527 ------
NM_015215chr163108 2870 2172 2123 818 726 1841 ----
NM_015216chr5----11532 --
NM_015252chr23601 131 120 ------
NM_015265chr272447 2134 2070 1927 1033 603 51 32419 1807 618 12116 --
NM_015271chr463773 3574 3341 2658 1557 519 24155 3291 13481 --
NM_015275chr1251640 741 594 249 179 1684 1665 --
NM_015277chr1851413 1181 536 366 46 ----1257
NM_015315chr543427 3387 1190 112 --1692 12981
NM_015328chr782803 2712 882 863 775 400 252 192 --22770 89 12382
NM_015335chr1222180 408 --11698 --
NM_015336chr1212442 ----12595
NM_015347chr1262865 2728 845 402 251 182 12695 12537 --
NM_015349chr642599 2403 2171 118 12816 1425 --
NM_015355chr1761788 1295 1231 500 355 158 11848 --11404
NM_015358chr21------11087
NM_015378chr152533 2521 2305 2022 2008 --32879 2790 2670 --
NM_015382chr142701 160 --1225 --
NM_015435chr821277 440 2474 74 ----
NM_015439chr62146 54 --1489 --
NM_015443chr1731388 536 136 21282 1144 ----
NM_015446chr161335 1122 493 414 188 32 --11373 --
NM_015447chr92625 108 ------
NM_015455chr583032 1573 1441 1163 698 654 349 260 13180 11189 1887
NM_015484chr13796 775 238 ------
NM_015508chr32988 469 41042 1033 613 396 ----
NM_015509chr1271526 1351 1227 1201 1146 1022 532 1402 1179 --
NM_015534chr1192 1938 ----
NM_015541chr341341 1282 1184 495 --21308 262 --
NM_015542chr10----11118 --
NM_015550chr783321 3294 3256 3114 2931 2921 817 413 1241 23279 2905 --
NM_015554chr1572660 1873 1816 1130 1111 934 326 12323 22664 2474 --
NM_015559chr182729 683 --1931 --
NM_015564chr572902 1439 1046 347 313 241 44 13283 --1424
NM_015565chr2162291 2249 1583 1563 519 102 1168 ----
NM_015570chr731555 459 228 1533 1520 --
NM_015576chr352603 2463 625 200 44 --22371 2107 1375
NM_015577chr511283 3582 493 183 21532 1430 --
NM_015578chr1911737 --22032 175 --
NM_015602chr121820 1152 --11797 --
NM_015608chr101641 2660 226 ----
NM_015609chr152410 1822 914 485 119 1591 ----
NM_015630chr2--1350 21140 224 --
NM_015633chr121475 ------
NM_015635chr932094 1844 214 --175 --
NM_015651chr951952 1814 1741 1486 507 --22223 1384 --
NM_015675chr191550 --1558 --
NM_015693chr4----1247 --
NM_015726chr161732 1559 1210 524 380 285 --21563 1327 --
NM_015850chr842419 1880 892 860 --42059 1869 896 820 --
NM_015859chr141134 1172 ----
NM_015878chr812220 --1136 --
NM_015886chr855507 4307 1806 936 199 25153 1280 24377 1687 --
NM_015888chr173255 2985 2645 2164 1343 498 351 1981 11060 --
NM_015902chr84927 887 731 702 ------
NM_015904chr23578 263 256 --2568 530 --
NM_015906chr183990 3685 1852 1502 1336 1097 494 319 13437 ----
NM_015912chr84714 583 367 67 --1939 --
NM_015957chr111103 --169 --
NM_015981chr5113133 3032 2395 2323 2154 781 634 623 295 155 68 ------
NM_015995chr1594598 4012 2108 1878 1747 1661 1323 1272 1140 ------
NM_016009chr174574 3744 3524 1688 1438 709 258 33774 3158 966 ----
NM_016018chr842855 2656 1821 610 12309 ----
NM_016019chr71865 --1294 --
NM_016021chr6103028 2688 2316 2099 918 811 367 233 224 38 2976 187 1608 12586
NM_016037chr121090 768 ------
NM_016045chr2041577 1391 1260 398 21803 1414 ----
NM_016048chr5126 ----1209
NM_016061chr221455 1250 161 ----
NM_016072chr1252124 1672 970 651 516 --22359 270 --
NM_016076chr162874 2824 2066 2047 645 458 --1908 --
NM_016081chr472181 2056 1863 1770 1541 762 350 ------
NM_016106chr14131 ------
NM_016107chr521364 284 11174 1426 --
NM_016120chrX3904 790 251 --1841 --
NM_016131chr231571 160 133 12362 1781 --
NM_016205chr411419 11228 11465 --
NM_016206chr3138493 8415 8354 7938 7837 7184 3367 3045 2652 1517 1238 981 398 18174 1442 17996
NM_016213chr151178 ------
NM_016217chr642866 1379 1031 46 --2116 29 12443
NM_016221chr552349 820 445 175 71 --22205 75 --
NM_016231chr1731175 163 131 ------
NM_016240chr8----21661 1413 --
NM_016242chr43543 399 121 --2554 515 --
NM_016248chr1353933 3794 2465 533 329 43647 3199 3106 563 13691 --
NM_016261chr172180 64 ----1788
NM_016271chr182547 341 12209 12290 --
NM_016275chr332585 639 301 12203 12252 --
NM_016289chr252026 756 692 169 53 --1176 12217
NM_016308chr1156 --1243 --
NM_016315chr231768 451 70 1297 11735 1703
NM_016320chr11----11110 --
NM_016338chr531043 1033 456 ----1273
NM_016353chr842383 2199 1693 1589 ------
NM_016356chr662500 2447 841 453 409 172 1188 ----
NM_016374chr13422 183 101 ----11193
NM_016376chr1731182 652 54 11618 24059 3913 1423
NM_016396chr153939 654 609 --33038 2751 409 --
NM_016406chr13121 90 56 --1355 --
NM_016422chr1163066 1113 545 198 128 29 2459 356 13174 --
NM_016424chr173754 466 76 21932 1806 1216 --
NM_016436chr2052636 2388 1063 977 531 1794 22318 1093 11042
NM_016441chr212256 --1680 --
NM_016467chr221156 36 ------
NM_016505chr12691 655 ------
NM_016526chr1142280 2226 694 146 134 ----
NM_016530chr15113687 2902 2889 2762 1536 808 739 319 290 99 50 12832 ----
NM_016561chr16192 --2911 121 --
NM_016575chr12115265 4964 4948 4524 3894 3858 3849 1716 1550 1112 473 15419 34767 2005 429 15443
NM_016577chr363319 1505 1375 1199 1097 208 24174 3132 11258 1197
NM_016604chr51497 --11203 --
NM_016605chr542372 2126 1984 52 --12273 --
NM_016607chrX41321 1313 1134 187 1683 1248 --
NM_016626chr181157 1535 --11774
NM_016628chr101729 ------
NM_016652chr2051745 1489 1463 1372 601 --31357 290 124 --
NM_016937chrX1220 --2817 305 --
NM_016952chr1163849 2841 2726 2585 1288 1007 12871 23486 343 13542
NM_017413chrX72493 2443 1705 1693 951 153 69 --12484 11725
NM_017415chr573555 3349 2908 1590 1281 940 110 13939 31835 1664 484 --
NM_017423chr482007 1991 1785 1671 871 808 201 185 --22024 510 --
NM_017426chr42699 228 2611 559 ----
NM_017450chr1741053 321 180 27 --11488 --
NM_017508chr1142112 1791 349 311 ----1981
NM_017516chr1151106 782 244 161 126 ------
NM_017544chrX2640 199 --1926 --
NM_017548chr331944 1601 1565 ------
NM_017553chr151817 --11240 11192
NM_017582chr151590 584 518 377 151 --11550 --
NM_017583chr1131288 1137 92 21677 1255 1284 --
NM_017593chr42399 162 --1458 --
NM_017596chr164149 4143 3203 1177 668 448 --184 --
NM_017610chr1582087 2026 1899 1659 1489 1302 766 505 --22120 318 --
NM_017629chr141236 765 565 432 1452 ----
NM_017632chr41313 ------
NM_017633chr6103751 3524 3396 2803 2776 2687 2546 2507 1522 949 23113 2436 --11476
NM_017635chr1131615 1332 35 ------
NM_017637chr986980 6381 6020 5977 3195 3116 3110 2796 --49319 8755 6984 2940 16044
NM_017643chr172976 83 --1153 --
NM_017645chr912664 --1769 --
NM_017658chr1493931 3473 3172 2840 1345 1316 1250 645 443 13835 2500 324 13050
NM_017669chrX----1342 --
NM_017693chr1311664 --11612 --
NM_017734chr1----1211 --
NM_017740chr161319 --1697 --
NM_017742chr181755 123 ----
NM_017744chr142148 957 622 345 --12487 1264
NM_017745chrX4478 260 220 73 --1656 --
NM_017769chr1493213 3050 2957 2768 2726 1218 1182 492 41 --12943 --
NM_017780chr82349 268 --1763 --
NM_017811chr942805 889 672 504 --13157 21086 775
NM_017824chr1042253 924 213 102 --11857 --
NM_017831chr1854561 3779 3708 3441 159 13637 33203 709 57 --
NM_017848chrX53868 3795 1763 1588 50 23194 981 ----
NM_017913chr91163 --3434 63 33 --
NM_017943chr1411025 ------
NM_017946chr771359 1047 525 477 367 357 266 1135 1427 --
NM_017948chr9----1390 --
NM_017952chr294394 3935 781 684 390 357 174 127 43 2992 910 24379 3892 21154 187
NM_017955chr143956 933 474 --1434 --
NM_018017chr1062827 2219 2006 1967 1170 881 21987 733 1410 1682
NM_018045chr142827 2649 1202 531 1146 12480 1430
NM_018051chr71352 ------
NM_018072chr1----186 --
NM_018084chr253186 2639 2280 923 356 --12808 --
NM_018086chr241623 1557 1396 773 --21495 718 --
NM_018120chr821365 1353 11072 11357 --
NM_018126chr4----21454 507 --
NM_018159chrX51563 1116 538 333 293 ------
NM_018180chr101304 ------
NM_018184chr351932 1878 1678 1544 657 11345 ----
NM_018191chr1341958 1733 1416 1330 1764 ----
NM_018199chr1441248 1193 1065 776 11004 ----
NM_018227chr432785 1973 22 12166 22498 782 1245
NM_018243chr443861 3752 3376 39 23360 815 22742 288 --
NM_018254chr122265 861 ----12223
NM_018263chr262239 690 665 658 336 309 12578 --1131
NM_018293chr382882 2500 2203 2156 2069 1995 1897 502 --183 --
NM_018323chr451670 1594 605 481 181 --1485 --
NM_018325chr92674 560 --11115 --
NM_018330chr101456 ----11576
NM_018360chrX196 ----1157
NM_018362chr1174016 3957 1218 1200 416 368 145 3755 740 603 --12614
NM_018364chr153911 2670 1485 781 225 --44062 1379 1027 229 --
NM_018374chr7115213 4312 4167 4026 3939 3859 2093 1954 1924 1177 205 11105 25188 1159 --
NM_018416chr1272322 1928 1640 881 809 595 508 ------
NM_018440chr8157889 7822 7316 7061 6711 5531 5465 3189 2928 2782 2175 2153 1707 550 423 12333 65795 3099 2687 1136 554 101 --
NM_018448chr1211135 2850 306 ----
NM_018482chr852574 716 511 395 88 11619 --12408
NM_018566chr195016 4984 4565 3585 1948 1803 1281 1166 1028 --12066 24608 3731
NM_018584chr1----21221 304 --
NM_018638chr12154826 4804 4313 4130 3609 2250 2207 2075 2027 2017 1064 833 771 392 149 11370 15214 14831
NM_018650chr121725 813 1560 ----
NM_018657chr31230 ------
NM_018686chr121139 ------
NM_018691chr521231 64 11261 11091 --
NM_018704chr162172 2037 1578 824 504 299 --1806 --
NM_018715chr121460 676 --11644 --
NM_018718chr742355 2257 1942 1522 ------
NM_018724chr13231 145 21 1498 ----
NM_018834chr54975 928 712 396 1954 --1262
NM_018836chr11217 --1517 --
NM_018841chr163945 3648 3418 973 246 148 12944 43544 2644 2529 497 --
NM_018898chr532364 2304 2043 11966 ----
NM_018948chr131102 511 339 --11129 11313
NM_018962chr2161434 1299 1249 948 390 166 21383 358 1384 --
NM_018970chr772860 2638 2604 2017 940 596 164 12221 22390 621 --
NM_019006chr15--1517 1453 --
NM_019012chr123580 290 240 2620 304 --1808
NM_019022chr18103122 2674 2337 2204 2100 1006 854 804 771 261 156 1573 --
NM_019050chr451845 1615 913 395 121 12141 2859 796 --
NM_019063chr22414 387 ----12120
NM_019072chr554189 4036 3807 3472 512 13943 33645 3608 345 --
NM_019084chr1042272 1840 734 35 ------
NM_019096chr61803 ------
NM_019098chr8----11160 --
NM_019106chr2272585 2107 1366 875 834 727 680 22692 2627 22527 2232 --
NM_019116chr1653539 3171 2879 697 659 --13068 --
NM_019555chr311574 --1262 --
NM_019556chrX61501 1409 1376 1246 1171 74 11003 ----
NM_019593chr2042805 2052 555 172 12938 11227 1164
NM_019600chr151698 --1623 --
NM_019604chr111241 --2754 451 --
NM_019885chr232662 1853 588 12433 1592 --
NM_019891chr12869 268 --2945 829 --
NM_020116chr441818 1680 1234 116 31668 1530 1461 ----
NM_020150chr1072196 2093 1925 1888 402 338 33 ------
NM_020157chr203826 820 649 11040 ----
NM_020159chr421722 1128 --1503 --
NM_020177chr582784 2058 1216 1207 912 895 688 413 12769 ----
NM_020180chr18------2506 373
NM_020205chr173355 3090 2299 1112 972 837 479 22864 1084 ----
NM_020310chr1731874 364 278 1644 12495 --
NM_020315chr22------1947
NM_020336chr2043144 1146 1057 978 11420 11150 --
NM_020337chr43988 735 56 --1630 11153
NM_020338chr1032667 701 410 13273 ----
NM_020341chr2041996 1470 1253 558 ------
NM_020342chr262646 2131 1939 894 750 587 1111 12279 --
NM_020346chr1121562 1223 21748 303 1352 --
NM_020353chr331574 1401 527 --11613 11406
NM_020363chrY21431 31 ------
NM_020390chr364419 4285 1531 1367 828 548 23938 563 23288 1082 --
NM_020432chr732143 911 367 --1735 --
NM_020437chr22----1331 --
NM_020440chr132714 606 448 --23067 1113 --
NM_020443chr1106439 2535 2493 2389 2201 2195 1858 1342 1206 816 1870 12543 --
NM_020463chr221358 399 --11023 1956
NM_020474chr1811267 --11561 --
NM_020640chr331718 1593 1465 1857 11765 --
NM_020645chr112272 215 ------
NM_020647chr831500 422 328 11420 1584 --
NM_020666chr52905 345 149 ----
NM_020682chr104876 869 278 65 ------
NM_020699chr165324 3753 3330 3302 1387 962 --13515 --
NM_020708chr2022326 408 --12492 --
NM_020718chr1686034 5561 5491 4615 4335 4025 1695 1620 --45691 4691 2646 2504 11679
NM_020724chr431710 1678 408 12646 12055 --
NM_020734chr1243308 2686 2196 58 22875 2233 23244 175 --
NM_020747chr52778 254 --1867 1374
NM_020748chr1721604 202 --12148 --
NM_020752chr1042047 725 623 424 31027 910 434 1846 --
NM_020768chr552792 1165 797 242 146 ------
NM_020769chrX2929 386 ------
NM_020774chr18125944 4544 4340 4050 3960 2414 1978 1755 1477 1356 904 798 31227 925 863 25071 4006 --
NM_020783chr1812050 1188 12441 --
NM_020792chr342644 2483 108 53 --21012 646 --
NM_020794chr131437 1261 1244 ------
NM_020801chr542355 812 397 107 --1876 --
NM_020803chr472349 1896 1844 914 470 314 203 --21666 922 --
NM_020805chr1821867 1694 --1486 --
NM_020809chr1122228 162 1816 11660 --
NM_020814chr2----21103 178 --
NM_020818chr141267 --1336 --
NM_020830chr2103255 3028 2898 2850 2706 1251 1117 980 898 232 ------
NM_020843chr15--1145 ----
NM_020850chr1662631 2243 1159 1007 261 240 12166 22544 1059 --
NM_020854chr182347 148 1414 1993 --
NM_020860chr421106 272 2263 172 --1412
NM_020861chr621331 504 ----1403
NM_020871chrX52326 2246 2210 2202 1815 --11943 1829
NM_020872chr351425 1156 561 521 115 --1370 --
NM_020917chr1963364 3056 2839 1523 787 452 --23859 663 --
NM_020919chr231207 1176 273 ------
NM_020926chrX1344 ----1331
NM_020935chr264255 3806 3065 1225 95 45 --1172 --
NM_020951chr1932249 541 327 22267 379 12217 --
NM_020981chr22784 608 ----2664 238
NM_020988chr1641315 1072 35 27 ------
NM_021005chr15------1246
NM_021025chr51379 --1533 --
NM_021072chr552531 746 556 333 297 1304 1965 --
NM_021097chr223062 2210 --11223 --
NM_021111chr921384 884 --11148 --
NM_021145chr71144 --1879 --
NM_021155chr1931045 578 293 ------
NM_021156chr201992 1259 ----
NM_021180chr1----1100 --
NM_021183chrX21850 475 32344 822 151 2439 69 --
NM_021204chr4--3792 753 88 --1785
NM_021219chr21172 --1163 --
NM_021220chr202433 370 ------
NM_021224chr92135 33 --1113 --
NM_021238chr1241913 646 477 329 ------
NM_021252chr1091852 1771 1414 1356 620 556 368 329 321 --21692 78 --
NM_021255chr1491574 1523 1503 1150 903 636 273 218 40 13366 11225 11579
NM_021619chr931304 1165 294 ------
NM_021627chr351094 462 428 402 29 1442 2944 182 --
NM_021643chr251803 1701 1334 715 678 21190 602 11543 --
NM_021648chr652614 2378 711 691 92 --1456 --
NM_021785chrX----1286 --
NM_021813chr674627 4166 4108 4096 2332 1059 884 --24022 3702 13574
NM_021818chr1431169 1022 309 --195 --
NM_021914chr142928 465 12446 1197 11503
NM_021946chrX1585 --11362 --
NM_021951chr9--1909 1341 --
NM_021960chr152585 1969 1070 720 584 --12156 --
NM_021961chr11117058 6949 6640 6277 6121 6103 5168 4817 2528 1780 1769 --37365 4972 4606 --
NM_021964chr3136185 5884 5098 4783 4716 4446 4131 937 894 642 249 225 64 1627 34426 2599 1183 --
NM_021979chr141367 ------
NM_021998chrX31492 1460 1271 1184 150 130
NM_022048chr1596207 5837 5445 4011 1727 828 322 241 226 12122 16201 --
NM_022051chr13455 230 51 1547 1641 --
NM_022058chr251959 1807 481 420 159 1670 ----
NM_022073chr1451448 1377 1252 546 327 --41230 1046 213 113 --
NM_022085chr641094 1015 545 333 --21253 613 --
NM_022130chr521226 277 ------
NM_022133chr861855 1845 1200 584 384 65 11594 1183 --
NM_022138chr621547 1029 ----1143
NM_022166chr1685863 5393 4690 4602 3904 2084 591 402 ----16000
NM_022170chr721503 377 21601 607 1234 --
NM_022351chr843271 2795 2771 369 12538 13284 13501
NM_022373chr72288 249 --3630 387 317 --
NM_022444chr741895 1584 1271 118 --21797 1552 --
NM_022451chr102845 235 --1610 --
NM_022465chr1232593 2442 1129 ------
NM_022484chr71118 1418 1107 --
NM_022497chr383860 2560 2450 1202 872 409 185 67 1797 23382 1132 --
NM_022648chr264216 3665 2881 1224 1161 404 11116 14613 --
NM_022659chr83395 355 148 135 ----
NM_022726chr621740 1527 ----11305
NM_022731chr1--176 ----
NM_022735chr131252 547 73 --11777 --
NM_022739chr1751188 1113 830 323 230 133 --1235
NM_022754chr51144 21810 1562 1148 --
NM_022763chr343084 2335 1106 812 --2778 766 --
NM_022766chr2261937 1680 739 600 552 237 147 22717 507 --
NM_022771chr121755 --1180 --
NM_022776chr341282 553 306 91 11258 ----
NM_022781chr933246 1185 462 ------
NM_022782chr122125 78 --1141 --
NM_022824chr5------11424
NM_022826chr221115 73 --1750 --
NM_022893chr221164 767 12959 2958 389 --
NM_022894chr22528 470 --11121 --
NM_022898chr1484551 3966 3634 3430 1732 1623 919 516 24589 4526 43438 3246 1283 439 11882
NM_022901chr911361 --21825 1791 --
NM_022918chr112560 330 11409 2669 518 --
NM_023012chr121249 ------
NM_023016chr272849 2465 2164 900 837 389 110 1916 --22522 1845
NM_023037chr131272 --2927 729 --
NM_023071chr122863 399 --1187 --
NM_023073chr54991 836 449 298 ----11289
NM_023076chr1662910 2273 2122 2060 1120 934 --1434 --
NM_024016chr17----1655 --
NM_024045chr10140 1168 ----
NM_024092chr112773 357 --31242 777 50 --
NM_024111chr154622 554 188 170 ------
NM_024122chrX------1255
NM_024306chr1621050 276 ----11139
NM_024501chr22572 268 --1472 --
NM_024524chr333216 3120 1112 12700 33018 1985 271 --
NM_024528chrX1110 1124 --1156
NM_024529chr161172 1067 1059 867 450 176 1261 ----
NM_024539chrX1377 1491 2877 499 11064
NM_024548chr331713 1077 300 4692 220 197 111 --11234
NM_024551chr1232563 948 73 11686 ----
NM_024554chr121671 372 21771 618 1678 --
NM_024563chr521836 1708 11217 184 --
NM_024602chr11364 --1292 --
NM_024612chr1731153 915 59 ------
NM_024613chr831289 1149 538 11552 11226 --
NM_024631chr111514 --2568 244 --
NM_024636chr742808 2467 2282 596 12727 12961 --
NM_024639chr641081 1010 1004 569 1989 12500 --
NM_024665chr373727 3418 2890 1858 1674 1381 1318 --22872 1795 13516
NM_024670chr1031684 510 428 1247 ----
NM_024692chr241416 1401 598 74 11621 31519 1487 758 --
NM_024698chr1111337 1415 --11348
NM_024700chr1----1376 11051
NM_024702chr173559 206 112 --1116 1492
NM_024713chr1531203 172 117 --1457 --
NM_024721chr812519 11023 ----
NM_024751chr432093 2063 1573 12040 ----
NM_024785chr221333 490 11051 --11094
NM_024786chr51976 1308 --1356
NM_024811chr1141319 726 594 169 --21371 582 1766
NM_024828chr941456 462 194 171 --21183 381 11516
NM_024893chr20----1934 1977
NM_024913chr751728 1705 1349 1297 1088 --1253 --
NM_024920chr421276 365 11148 ----
NM_024947chr3127963 7724 7709 6814 6594 6345 5813 3276 2806 1293 763 38 26931 3327 13113 19453
NM_024953chr1252794 2306 1100 1060 267 12724 1504 --
NM_024963chr745369 5183 4482 1085 --13639 --
NM_024969chr21648 --1657 --
NM_024989chr285714 5322 5286 3129 2483 1990 1482 115 28041 1507 55239 1566 1500 763 666 --
NM_024993chr23635 254 169 --1525 1136
NM_025054chr8134129 3996 3948 3818 3199 3138 3078 2879 2813 2706 1676 1501 1136 23966 323 ----
NM_025076chr21538 --1692 --
NM_025090chr1741472 1218 1207 1003 11328 11166 --
NM_025147chr241080 980 405 29 11088 1939 --
NM_025160chr144303 3735 3605 3546 13799 13459 --
NM_025164chr1132146 1434 1370 --1124 --
NM_025179chr1104918 4341 3950 3666 3206 1885 1352 930 841 501 --23715 309 --
NM_025187chr161881 --1484 --
NM_025222chr361983 1890 849 456 328 170 22847 2169 22422 22 --
NM_025248chr1742916 2818 2095 596 --12102 --
NM_025251chr81976 ----1789
NM_030571chr52156 113 11553 ----
NM_030579chr1693541 3491 3157 2728 2683 1486 1331 1317 327 23142 2974 13525 --
NM_030621chr1453888 3667 2979 1682 246 --13315 11066
NM_030625chr1042607 2489 1779 633 --11933 --
NM_030627chr563991 3874 3630 2832 1119 1106 24103 814 11137 --
NM_030647chr7136230 6100 5558 5247 4882 4642 4145 2175 1431 1224 1030 936 640 11257 --1392
NM_030648chr4105068 4014 3859 3450 3414 2202 1780 1634 1134 790 15144 11574 14151
NM_030650chr294176 3434 3147 3013 2758 1408 746 415 79 2964 480 1138 --
NM_030758chr222128 116 --11025 --
NM_030762chr1231761 1385 1373 --11494 --
NM_030791chr1471699 1522 1504 694 528 200 44 11629 1193 11209
NM_030806chr1178745 6803 6281 6264 6214 5972 3588 3410 1824 1695 1075 1016 562 399 337 226 32 13056 37203 1757 1372 --
NM_030816chr12752 725 11282 1701 --
NM_030906chr114635 590 573 40 ----1162
NM_030915chr242362 2159 2010 504 ----1247
NM_030920chr152014 1745 1578 1367 137 --11640 --
NM_031216chr1841535 1440 494 205 1129 21870 39 --
NM_031296chr432657 2052 2020 1153 ----
NM_031412chr1231018 937 395 --2987 185 --
NM_031418chr1132715 994 784 --3689 574 122 12525
NM_031422chr181508 --1233 --
NM_031435chr1233228 852 102 1954 22329 1079 --
NM_031442chrX43020 3002 1176 79 23062 422 11180 --
NM_031445chr233310 2801 2164 --193 --
NM_031453chr1021726 329 ----12039
NM_031469chr683575 2490 1239 898 888 739 655 219 11610 41259 1021 892 677 --
NM_031476chr1621787 1038 --22702 985 --
NM_031483chr2043368 3241 3148 445 53310 3179 2935 2566 1349 13468 12285
NM_031890chr2232229 268 93 12883 1825 --
NM_031935chr14934 679 420 397 --1243 --
NM_032038chr16----1218 --
NM_032042chr572276 2110 1818 1103 847 377 63 32229 2175 2152 22242 381 --
NM_032052chr2241141 971 395 180 ------
NM_032102chr1142621 2185 1242 619 --1656 --
NM_032121chrX62721 2394 2321 2282 327 295 --11115 --
NM_032139chr191760 --1847 --
NM_032144chr24705 668 269 222 21312 439 --11514
NM_032160chr1843952 3357 1725 837 1652 21675 388 13961
NM_032172chr72748 327 ----1303
NM_032174chr121472 1451 ------
NM_032181chr21558 ------
NM_032182chr1041075 396 161 91 ------
NM_032217chr451125 997 456 314 152 ------
NM_032221chr2051777 1478 1421 1373 498 21788 1715 2797 65 --
NM_032228chr1113023 22804 1296 ----
NM_032233chr141648 --1123 --
NM_032239chr431183 1151 931 ------
NM_032242chr363301 2778 2581 2533 1053 699 --23294 220 --
NM_032246chr1521089 910 --21335 1138 --
NM_032256chr124403 375 241 167 --1710 --
NM_032315chr1------1261
NM_032352chr1431270 915 555 11180 ----
NM_032373chr1074896 3778 2120 1340 741 198 43 --35411 982 810 15754
NM_032374chr1421778 465 1291 11572 --
NM_032457chr453649 2735 1545 1272 1231 13847 23737 205 12892
NM_032466chr821244 450 --11464 --
NM_032521chr2072722 2637 2196 2017 1976 776 650 --22428 1211 11970
NM_032539chrX142 1568 ----
NM_032547chr441420 1121 431 36 --11443 --
NM_032552chr921280 553 --11982 --
NM_032557chr41715 ----11001
NM_032558chr931455 935 566 --21505 1114 --
NM_032560chr141905 ------
NM_032569chr1612001 --11763 --
NM_032622chr421422 490 1508 ----
NM_032632chr1421618 226 21487 355 12005 --
NM_032682chr363322 3151 2436 1336 441 198 --12417 --
NM_032772chr10186 --1517 --
NM_032786chr121595 ------
NM_032796chrX2758 154 --1180 --
NM_032800chr1--1877 1191 --
NM_032811chr1141987 759 313 211 21497 804 21583 170 1764
NM_032846chr1461515 1114 970 500 457 355 1941 ----
NM_032858chr1--1114 ----
NM_032873chr11104392 4344 4222 3654 3144 2802 1228 1180 829 333 13818 11123 --
NM_032884chr1----1366 --
NM_032898chr31394 --1123 --
NM_032918chr122430 202 --1280 --
NM_033055chr11393 --2994 244 --
NM_033089chr2011403 --21447 525 --
NM_033103chr1941353 1138 521 211 --3550 483 285 --
NM_033132chr1331748 803 764 1131 1489 --
NM_033141chr1452132 1751 1530 332 106 1627 1802 --
NM_033222chr92943 244 11386 2477 338 --
NM_033224chr797508 7395 5604 2584 2328 2203 1980 894 762 12283 27880 5244 15534
NM_033225chr832878 2785 2168 11002 12694 --
NM_033272chr22316 82 2310 68 ----
NM_033285chr864239 3788 3122 1414 794 199 23580 366 23448 3184 --
NM_033340chr101106 --11308 --
NM_033394chr2--1333 --11162
NM_033420chr19--11179 168 --
NM_033426chr1442961 2589 2367 154 --126 --
NM_033505chr2116673 6111 5181 4283 2012 1966 1723 1236 1197 183 86 36484 6046 1377 26335 1441 --
NM_033512chr892994 2630 2559 2339 1084 580 537 303 39 --12202 --
NM_033516chr921648 1575 --1319 --
NM_033631chr193688 3582 3515 3034 2448 1387 784 770 39 --43526 3425 3038 2977 --
NM_044472chr13695 581 29 --2222 33 --
NM_052832chr862606 2364 1073 894 852 497 ------
NM_052851chr1362045 1782 967 886 631 527 1247 --1292
NM_052880chr2251378 1306 1106 562 267 ------
NM_052886chr851713 1492 1445 1429 47 ----11562
NM_052898chr831816 1680 1596 ------
NM_052900chr831716 1333 602 --11473 --
NM_052905chr261826 1610 1247 1169 580 442 31913 1764 1555 11870 --
NM_052910chr1321667 393 1174 11507 --
NM_052923chr61207 --176 --
NM_052927chr522154 1391 --12070 --
NM_052932chr1152507 1935 1812 1639 821 --32127 911 852 --
NM_052937chr852268 1943 1912 457 191 22569 449 1593 --
NM_052940chr1176 ------
NM_052950chr1372196 1890 713 578 517 400 328 --1220 --
NM_052958chr81258 ------
NM_052962chr631431 585 504 1554 ----
NM_053281chrX------1126
NM_054035chr172615 266 ------
NM_057749chr85993 541 528 306 246 21400 1044 11088 --
NM_058237chr142916 900 --11032 --
NM_078471chr1721146 475 1802 ----
NM_080476chr20------1298
NM_080546chr922172 544 --22205 1801 --
NM_080625chr202765 235 --176 --
NM_080671chr22834 635 11485 1410 --
NM_080672chr20--1567 ----
NM_080743chr632216 818 304 --1112 12057
NM_080820chr20182 ------
NM_080836chr2064662 4571 1840 1433 710 354 23306 440 1379 --
NM_080867chr1484951 4371 4359 4108 3911 3877 1459 846 25098 907 23237 938 --
NM_080927chr372982 2318 2270 2227 2210 245 191 --12584 --
NM_130446chr364179 3648 2915 1727 915 691 ----13946
NM_130783chr1141508 701 543 270 --1154 --
NM_130830chr333528 3037 2818 13473 14003 --
NM_130847chr1165156 3783 1858 1655 1200 689 11587 1856 15826
NM_133265chrX83126 2849 2768 2437 1022 440 178 148 --33681 2964 2231 13271
NM_133433chr51602 --1615 --
NM_133445chr993561 3471 3375 3207 3183 3167 1438 785 363 11205 13211 --
NM_133474chr441343 433 425 395 ------
NM_133493chr6114683 4017 3913 3476 3316 2996 768 579 293 89 83 13269 --23128 1390
NM_133646chr2125465 5457 5142 4486 3955 3901 3424 2210 1919 1827 811 159 11241 24916 1115 --
NM_134424chr1241245 502 85 57 1266 ----
NM_138288chr1452137 1674 388 344 221 1506 ----
NM_138333chr952603 2533 2452 250 101 1310 21006 94 --
NM_138340chr181142 ----1202
NM_138423chr1542304 2231 1597 57 12054 ----
NM_138426chr722095 1884 ------
NM_138444chr13104901 4453 4086 3608 3418 1789 852 806 758 96 11195 21873 195 11359
NM_138473chr1264755 3948 2055 948 769 624 --13594 --
NM_138731chr1474254 3363 1610 1404 973 261 176 21255 749 21360 54 --
NM_138764chr192278 97 ------
NM_138782chr542308 1930 666 78 ------
NM_139015chr1241335 1107 1100 1080 ------
NM_139057chr1532830 2777 2302 --12655 1495
NM_139319chr1251478 1436 1292 1197 33 ------
NM_139321chr2054060 1588 1510 903 201 --2624 597 1479
NM_144571chr4126928 6405 6134 5884 5724 2483 2123 1661 1395 1385 1181 514 36672 6505 5604 56658 5552 2745 1316 100 --
NM_144628chr20102301 869 862 742 690 586 567 439 403 153 23060 2231 31211 904 301 --
NM_144632chr252064 1693 945 807 117 --11914 --
NM_144633chr321257 526 --1589 --
NM_144643chr4----1407 --
NM_144653chr93137 103 57 --145 --
NM_144665chr111231 --169 --
NM_144775chr1784418 4040 3767 3743 3335 1911 1480 1402 --34627 3111 1876 --
NM_144963chr882741 2517 1842 1003 920 778 664 93 12092 ----
NM_144973chr1264631 4578 4558 4098 3943 1307 --13320 14503
NM_144975chr1751723 1198 731 606 591 ----11178
NM_145011chr1022179 647 11881 --21998 1370
NM_145117chr1152920 2857 2568 2032 859 23204 2063 ----
NM_145243chr1----164 --
NM_145251chr143633 347 37 --21558 1364 --
NM_145280chr21820 --2626 255 --
NM_145313chr1031543 299 212 --11566 --
NM_145332chr61757 2764 78 ----
NM_145658chr15129 ------
NM_145735chr1332377 342 50 ------
NM_145804chr11--11169 11268 --
NM_145808chr762943 2810 2069 2026 1998 412 1991 12149 11956
NM_145891chr1631630 559 350 --1367 --
NM_148957chr1382619 2517 2492 2303 2129 1696 895 498 ------
NM_152253chr2294252 4102 3620 3546 3286 1433 1040 888 72 --11400 --
NM_152261chr12--22304 864 11920 --
NM_152265chr131320 1169 94 1357 1407 --
NM_152275chr281878 1702 1484 816 706 495 441 200 ------
NM_152292chr42725 456 11568 32320 671 484 --
NM_152317chr12----1180 186
NM_152390chr2--1205 ----
NM_152399chr43863 856 405 ------
NM_152409chr593513 3444 3162 2793 1065 732 435 286 137 12514 --12286
NM_152414chr82604 58 --11490 11388
NM_152424chrX63593 3470 1311 660 567 215 --34169 3921 3597 --
NM_152470chr1832780 976 490 --31344 1138 405 12945
NM_152495chr11817 --1316 11092
NM_152510chr222693 229 --1294 --
NM_152519chr212156 22175 234 2754 375 --
NM_152520chr23483 330 230 --1789 --
NM_152522chr22829 264 --1877 --
NM_152546chr521372 962 21168 232 --2986 540
NM_152556chr762156 1835 1688 757 280 146 12048 2230 136 --
NM_152622chr593413 3208 2912 2902 2540 2370 2268 741 250 13061 --12460
NM_152624chr5146902 6508 6185 5197 5143 4723 4590 4547 2936 2439 2072 500 472 312 31514 1397 1351 47463 2087 1707 754 11445
NM_152636chr1163114 3097 2981 2068 1934 926 ----152
NM_152641chr1252897 1153 973 553 61 ------
NM_152653chr32509 103 1643 ----
NM_152658chr191406 ------
NM_152667chr201552 1112 ----
NM_152678chr362648 2590 2345 2145 501 174 12684 2945 347 --
NM_152682chr461593 561 478 395 220 74 21745 587 1325 --
NM_152695chrX32078 1860 803 ------
NM_152699chr353408 3393 3271 928 487 12505 33033 634 56 --
NM_152721chr181158 --1743 --
NM_152723chr11--11113 1132 --
NM_152734chr675493 3821 1945 1907 453 421 87 12133 --1106
NM_152744chr773065 2452 1259 1127 1091 141 56 --12208 --
NM_152745chr73975 472 113 ----2944 770
NM_152754chr722790 2594 12957 23781 2351 --
NM_152756chr594080 3785 3508 3288 1684 621 549 298 132 --23856 3425 23121 1689
NM_152758chr83840 552 385 199 1433 --
NM_152774chr752340 2200 1816 1030 305 21756 1019 ----
NM_152787chrX52652 2516 1081 769 315 1736 43703 3458 2776 547 --
NM_152835chr122061 703 --139 --
NM_152889chr31227 --1708 --
NM_152910chr13----154 --
NM_152995chr4----1613 1881
NM_152996chr131635 1353 626 21544 497 --1797
NM_153015chr83741 384 264 1161 ----
NM_153020chr631613 1518 122 --21453 607 11102
NM_153184chr32745 608 ----11264
NM_153207chr1223361 2597 --33467 323 313 --
NM_153223chr551594 1494 1462 599 162 --11371 --
NM_153235chr632383 2363 646 2373 204 31827 891 166 --
NM_153350chr16----11725 --
NM_153354chr51797 ------
NM_153365chr442593 1860 833 423 --1449 --
NM_153367chr1042498 1194 177 68 --156 --
NM_153371chr1352281 2269 1810 1779 95 --22081 2009 --
NM_153374chr15----1486 --
NM_153437chr9129 ------
NM_153456chr1386227 6132 4728 4299 4036 1508 1064 525 --1802 26269 5098
NM_153607chr583127 2915 2701 2408 2039 1935 1229 211 22625 2556 ----
NM_153619chr1553030 2748 1407 1255 326 12211 130 --
NM_153634chr1251530 1417 1301 562 390 21336 601 ----
NM_153687chr1251646 1638 230 193 179 --172 --
NM_153697chr22618 323 --1735 --
NM_153706chr5141 --1179 --
NM_153708chr32411 349 ------
NM_153756chr141794 1312 475 427 --1496 --
NM_153812chr141866 522 360 204 1492 12348 --
NM_153836chr231709 705 73 --11899 11959
NM_170606chr71720 11288 2755 689 --
NM_171998chrX41561 806 250 36 1454 22356 927 1937
NM_172020chr762030 1657 1451 607 519 231 --1764 --
NM_172070chr242009 666 363 317 11833 21618 1525 --
NM_172071chr1117468 7053 6872 6159 5104 4907 2223 1652 1389 1315 1030 24760 2042 27305 4710 --
NM_173156chr112216 --1265 --
NM_173354chr2171987 1916 1604 1347 789 490 464 12069 21489 1399 --
NM_173468chr495899 5530 5459 4076 3977 3938 2102 871 547 35255 2159 1019 1252 --
NM_173491chr531108 255 52 ------
NM_173503chr17139 ------
NM_173508chr121068 914 1993 1908 --
NM_173511chr253571 3207 2488 425 203 --13094 --
NM_173517chr7----1168 --
NM_173552chr372424 975 496 388 289 238 166 --22118 542 1958
NM_173576chr1031596 1454 212 --12142 --
NM_173595chr1264536 4298 4036 4012 1141 144 151 ----
NM_173654chr311656 11544 11650 1193
NM_173791chr10----1114 --
NM_173797chr511060 --1460 --
NM_173808chr184426 3792 3593 2754 1493 749 583 245 33829 3507 3436 14402 --
NM_173822chr221603 830 130 ----
NM_173826chr311343 --1120 1212
NM_173827chr463025 2975 2776 2676 2145 599 22488 2083 2319 82 --
NM_173849chr14--130 169 --
NM_173851chr863987 3964 2895 874 579 55 33487 2666 135 --12875
NM_174890chr104805 670 527 150 --1537 --
NM_174911chr883474 3463 3105 1433 1003 912 474 57 13140 22680 466 --
NM_174916chr1521468 544 12009 ----
NM_174934chr1153316 927 782 704 524 --21114 104 --
NM_175052chr52938 49 --1405 --
NM_175061chr721355 216 11955 11770 12174
NM_175607chr321256 1062 --11560 --
NM_175767chr531868 418 199 1373 21840 405 11645
NM_175854chr1352615 1999 1903 843 265 11092 2152 125 --
NM_177424chr14630 608 593 498 11414 1389 --
NM_177968chr222231 1734 --12066 1718
NM_178011chr1063208 2307 576 482 455 381 12838 ----
NM_178140chr572795 2215 2010 1984 1960 1845 1839 32789 791 542 --12318
NM_178313chr271976 1804 1556 1432 756 609 225 196 1554 --
NM_178450chr51185 --1741 --
NM_178505chr1043622 3549 789 385 13381 12229 --
NM_178539chr122346 126 1825 ----
NM_178582chr2031359 561 381 ----1433
NM_178815chr1021885 72 131 1925 22143 1026
NM_178831chr742602 2123 1900 166 --12586 --
NM_181291chr141172 --2716 550 --
NM_181358chr193916 3883 3720 3713 3531 649 505 472 213 ------
NM_181359chr122352 202 1744 12417 --
NM_181504chr533742 3268 1391 13149 11125 --
NM_181532chrX----1298 --
NM_181672chrX42012 471 194 84 ------
NM_181704chr2151426 1111 280 236 130 ------
NM_181704chr2151426 1111 280 236 130 ------
NM_181705chr585617 5393 4687 4183 3983 2009 1604 942 35323 3659 688 1318 --
NM_181784chr2--22087 2034 12414 --
NM_181836chr562634 2357 1805 1075 323 213 --1601 --
NM_182485chr463189 3088 2638 603 321 104 33706 2270 747 2563 463 --
NM_182691chr7--1342 1501 --
NM_182700chr711397 --1513 --
NM_182717chr1031347 249 193 161 ----
NM_182760chr31227 ------
NM_182765chr1031696 1680 895 --22135 769 --
NM_182767chr1231819 756 692 ------
NM_182798chr511068 ------
NM_182920chr31356 --21195 384 --
NM_182944chr142344 325 ------
NM_182975chr181008 944 882 867 743 451 274 108 11032 ----
NM_183416chr111640 1279 11692 11857
NM_194071chr763962 3741 1944 1938 1285 41 15097 11242 --
NM_194247chr274333 4079 1524 744 501 225 156 23796 3674 33304 1074 73 --
NM_194285chr1123091 36 13206 22566 329 --
NM_194286chr1276082 4873 4838 4274 2315 676 121 12102 25878 1324 --
NM_194291chr832873 2642 603 2578 406 32418 2370 2309 1326
NM_194298chr1061795 377 206 160 96 23 21649 599 132 --
NM_194314chr1105181 5152 4158 3426 2140 1406 925 626 279 81 34727 1055 813 45640 4544 909 85 --
NM_194460chr19--1593 --1579
NM_197941chr562983 2511 2486 1921 1870 702 12634 22232 1192 --
NM_198279chrX1849 21048 967 11060 --
NM_198396chr172373 298 --1425 --
NM_198404chr132650 119 ----1269
NM_198427chr11430 ------
NM_198468chr654226 4021 3056 1118 73 23244 1696 13325 --
NM_198504chr33848 723 62 1925 1705 --
NM_198513chr851853 1656 1492 1366 759 ------
NM_198560chr353786 3443 728 461 110 ------
NM_198570chr7----1234 --
NM_198859chr3134941 4659 4616 4496 4483 4125 3454 3434 2059 2019 1354 1000 338 --25030 1163 24729 870
NM_198904chr512072 1309 ----
NM_198991chr181631 --1709 --
NM_198993chr1731224 414 290 --31428 614 343 --
NM_199000chr741892 1587 855 563 11825 12339 --
NM_199003chr821494 259 1383 ----
NM_199044chr142744 2717 2355 419 1572 1667 --
NM_199051chr11235 ------
NM_199072chr763122 2793 2239 589 194 151 12044 --22102 1130
NM_199129chr2011135 1889 ----
NM_199245chr12102305 1805 1689 1037 651 590 404 396 106 80 ------
NM_199328chr2141194 478 265 61 --1163 1145
NM_199355chr1651526 1366 1325 1237 528 1604 ----
NM_201286chrX173 ------
NM_203301chr1441383 1146 295 141 11442 ----
NM_203349chr151694 11508 12132 --
NM_203364chr111180 ----11128
NM_203394chr1242594 2223 1053 423 12539 32531 2493 765 22656 2588
NM_203458chr173539 2816 2753 2689 972 688 170 12705 13601 22508 960
NM_203459chr172100 1929 1922 1859 1598 679 261 21031 619 32592 2360 410 12460
NM_206853chr673890 3663 2648 1484 1100 763 111 ------
NM_207009chr101239 1910 ----
NM_207303chr1042701 1361 930 41 --11499 --
NM_207325chr19126 --12032 11380
NM_207371chr102234 146 ------
NM_207406chr4106461 6247 6149 5266 5120 2254 2015 1700 1324 638 --35205 4528 1417 --
NM_212464chr1511627 11865 22033 1455 1509
NM_212464chr1511627 11865 22033 1455 1509
NM_212558chr973446 3032 2897 1213 1165 238 76 23301 3000 33187 687 397 --
NM_213589chr2105482 5293 4856 4687 3685 3576 3457 1999 1298 1243 1241 34877 4578 463 --
NM_213609chr32794 102 --1288 --