TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-567
miRNA Sequence: AGUAUGUUCUUCCAGGACAGAAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000110chr15961 897 883 780 47 ----2404 108
NM_000167chrX41690 1631 1364 1187 1392 1348 1729
NM_000216chrX114090 3658 2888 2690 2620 2547 2491 1426 1285 1127 409 82787 2772 1327 1321 1307 1295 1215 70 21336 539 --
NM_000248chr341209 960 665 615 ----12712
NM_000259chr1576241 6174 5157 2104 1139 644 453 24702 249 25913 1620 --
NM_000297chr441999 1702 1666 1541 11907 11578 --
NM_000314chr10113052 2699 2419 2407 2214 2188 1069 674 559 392 221 11283 ----
NM_000330chrX42155 2124 1531 869 11858 --1393
NM_000332chr686898 5769 5712 5578 1620 1539 1100 718 46842 6011 5393 4857 36280 4837 617 14827
NM_000337chr5166567 6275 6098 5760 5246 4764 4223 2508 1167 988 617 403 196 182 172 34 26226 2417 34870 4209 1046 15200
NM_000439chr572526 2509 2352 2264 1918 804 366 --12317 --
NM_000441chr782151 2094 1728 1547 847 742 631 175 1563 ----
NM_000448chr1162464 2405 921 896 768 477 1864 13007 12627
NM_000489chrX93473 3434 2847 2800 2686 2499 1371 811 162 1391 12553 --
NM_000599chr244260 850 803 115 24289 380 13922 --
NM_000602chr731511 1488 1463 --21479 1436 --
NM_000800chr511529 11300 21446 1309 --
NM_000813chr5105631 5588 5172 4374 3777 1643 1584 1499 1458 839 --54080 3571 3413 2225 907 34586 3456 1016
NM_000814chr1583962 1267 1213 1007 901 658 590 155 32608 249 114 --1746
NM_000826chr482627 2245 2129 1837 1767 1042 804 386 32482 1990 375 ----
NM_000838chr632349 411 322 12650 --22406 1698
NM_000868chrX52155 1771 644 628 42 31925 483 124 12330 1449
NM_000875chr1556949 6805 6258 5490 4353 21757 1192 --26383 6202
NM_000901chr43415 238 87 2779 486 22525 1723 --
NM_000950chrX93290 3191 3105 2674 1257 430 289 200 116 1254 1218 --
NM_000958chr541193 936 881 452 21352 67 1829 --
NM_001001395chr1231903 1111 220 ----11776
NM_001001419chr574419 3888 3720 3204 1615 877 591 35015 832 367 25117 273 --
NM_001001481chr8113332 3180 3170 2972 2811 2650 2355 753 458 246 196 12242 32225 2138 560 --
NM_001001484chr1052254 2198 2020 738 726 12079 --11629
NM_001001668chr19144046 4030 3105 2822 2802 1572 1187 1096 1087 1033 657 460 230 107 ----12857
NM_001001890chr2184006 2963 2895 2744 2735 1412 570 555 14329 23339 1720 --
NM_001001995chrX2595 371 1407 11386 11351
NM_001003674chr18127097 6873 5064 5020 5008 4802 2797 2722 1362 1095 1044 1031 66890 5165 4769 2131 1610 937 --11527
NM_001003679chr141506 1481 729 339 --21890 138 --
NM_001003712chr12113567 3486 1542 1332 957 947 830 672 479 394 254 23197 3065 --13781
NM_001004317chr643727 1613 1135 698 1299 --24536 3127
NM_001005404chr1744051 3955 3172 1518 --13137 --
NM_001005473chr5176354 5917 5731 5318 5293 4992 4842 4452 4375 2665 2558 2518 2276 1751 659 284 59 36051 4300 2022 12036 42073 2059 2029 1963
NM_001005505chr331547 1527 639 1597 --11535
NM_001008392chr373592 3513 3291 2952 2634 2495 505 1213 2450 244 --
NM_001008393chr472533 2388 2199 2100 686 540 113 181 12505 12735
NM_001008539chr894952 3906 3637 3333 1445 819 372 363 286 34984 4538 109 --139
NM_001008738chr582757 2550 1112 843 827 718 638 571 --22723 625 168
NM_001009894chr1231274 585 204 --21687 355 --
NM_001010895chr931323 551 340 12086 11565 1480
NM_001010986chrX32120 863 239 12256 --12333
NM_001011513chr4104126 4091 3368 3337 3072 2838 2689 2674 1233 621 --13895 --
NM_001011666chr776592 6201 6182 6107 5215 3976 996 16390 12266 --
NM_001012393chr1164046 3420 578 478 409 341 14309 15102 11781
NM_001012756chr19103199 2956 2847 2823 1234 1108 918 656 588 475 2853 373 22942 943 --
NM_001012761chr582729 2446 844 174 151 100 72 57 1328 12125 --
NM_001013031chr1073376 2687 2279 1190 179 55 48 --1873 21120 295
NM_001013406chr741132 689 414 184 11073 2675 469 --
NM_001013415chr421170 43 21311 629 --11138
NM_001014797chr1096028 5766 5755 3264 1821 1744 407 207 77 27984 6314 25988 344 --
NM_001017923chr1451510 1189 416 244 222 --11671 --
NM_001018067chr1185259 4801 4417 4410 4375 3908 3655 3622 3594 3364 3261 1972 1863 1738 1717 1155 423 317 21534 620 34319 1902 1806 --
NM_001018111chr763996 3759 3719 3574 3145 1491 12950 23021 2910 --
NM_001024660chr32516 485 1475 --11659
NM_001024688chr881566 1467 882 653 504 437 250 78 --21439 443 --
NM_001024934chr61522 ----2641 163
NM_001025079chr363968 3933 3201 2888 1283 791 22730 1303 1892 --
NM_001025108chr244171 3741 3719 1392 43902 3707 3244 870 1509 13686
NM_001025252chr873067 2231 2152 1153 967 543 119 ----173
NM_001025366chr651838 1693 1549 1225 421 1352 --11540
NM_001025580chrX93961 3731 3044 2760 1594 1530 1270 885 234 63725 3308 2721 1651 1440 1400 11561 --
NM_001025780chr941329 358 317 67 21355 570 11629 --
NM_001029875chr582469 2361 1135 1079 854 620 582 422 22791 352 --2771 505
NM_001030055chr14103710 3632 3547 3274 1041 919 809 649 638 546 33859 3043 56 ----
NM_001033057chr32221 164 ----22137 2063
NM_001033117chr364337 3135 1311 468 339 265 2442 376 1625 --
NM_001033576chr1732154 879 121 11047 --32674 2570 1701
NM_001033723chr842783 2625 2356 1714 ----12742
NM_001037132chr771929 1839 551 359 336 196 148 21589 832 186 11601
NM_001038702chr582655 2642 2319 2239 2156 2078 976 701 --12662 11015
NM_001039538chr283194 3136 2655 2335 1290 1078 824 782 1170 ----
NM_001039840chrX85510 5153 4876 4701 1943 1249 459 225 65969 5701 5411 5401 475 240 1707 --
NM_001039937chr1353663 2837 1361 1159 931 3428 399 95 1735 11468
NM_001040001chr651726 1383 1333 1281 511 11776 1501 11752
NM_001040110chr72326 309 41659 366 347 335 ----
NM_001040157chr472918 2410 2367 2259 2236 412 47 22222 2175 21998 85 11792
NM_001040214chr651912 1898 1801 1703 554 61840 1774 1659 1607 144 108 1487 11649
NM_001040402chr452114 2073 1278 1110 684 12708 2989 609 1595
NM_001040429chr1393578 3501 3332 3022 1105 1017 949 826 535 23093 578 --13406
NM_001040441chr175358 5104 4550 4226 3498 1728 873 24932 675 --11407
NM_001040712chr983126 2890 2603 2458 2237 1327 1062 1011 ----1892
NM_001040876chr451684 1564 611 131 99 1744 1123 21917 1350
NM_001042355chr1644890 3935 1842 511 25390 1444 --31954 832 303
NM_001042533chr353218 2623 1114 474 120 --1830 1418
NM_001042550chr962045 1719 1627 1408 1267 158 2457 84 --21287 306
NM_001042555chr12144645 4214 4124 4078 3985 3821 3474 3285 3061 1360 451 307 269 198 24008 3268 23462 504 23699 1166
NM_001042599chr2137866 7850 7532 7306 6636 6231 5818 5359 4759 2591 2248 1593 774 36928 5875 5829 22995 502 26225 4852
NM_001042603chr1255220 4200 1258 1233 1225 13812 1185 11213
NM_001042604chr384551 3949 3883 3258 1902 1845 967 62 34540 3705 997 11237 --
NM_001044305chr621033 662 ----21135 1111
NM_001046chr542845 2403 757 632 --12946 --
NM_001099678chr3226463 6365 6141 5942 5778 5634 5506 5478 4831 2267 2170 2157 1648 1603 1408 1239 756 447 438 429 422 201 --16228 22342 1549
NM_001106chr3129322 8763 8523 7847 7779 6342 3848 3601 2139 1880 1219 207 69476 9334 7430 5934 3210 1365 21324 455 27424 6075
NM_001146chr852232 1626 853 815 724 12211 --2879 382
NM_001148chr432152 2022 1560 --2583 298 11544
NM_001174chrX51957 1854 1725 1485 34 12002 12268 --
NM_001198chr662431 2380 967 531 234 225 ------
NM_001204chr2127312 7265 6882 6236 5837 5711 5407 4749 2963 2942 585 571 12138 36973 5666 467 36069 2548 53
NM_001206chr963134 2429 1945 835 785 406 ----2946 900
NM_001241chr282191 1939 915 393 287 97 62 35 2809 586 --1654
NM_001257chr1631311 303 247 51353 1010 974 952 385 --11514
NM_001304chr1743491 3118 416 29 1537 22747 1052 13397
NM_001364chr1154752 3905 721 512 55 24055 1155 165 --
NM_001427chr761973 1905 1534 1525 1365 1292 ----11485
NM_001429chr221199 --1356 3865 724 162
NM_001432chr493711 3614 3462 3324 2816 1559 1421 951 512 ----13138
NM_001455chr673713 3124 3118 1768 1525 1454 1202 1426 --11183
NM_001495chr82970 951 21015 1003 --1993
NM_001514chr11157 1387 1170 --
NM_001546chr62503 214 1965 --1907
NM_001627chr342126 2028 714 81 22250 666 22407 1539 --
NM_001650chr1894071 3488 3401 3389 2652 1166 972 466 238 --23971 3101 23889 3872
NM_001668chr152040 785 573 514 469 22034 1613 --1768
NM_001709chr1152910 2886 2502 638 272 162 --12868
NM_001854chr131311 499 306 2117 74 31420 1162 40 --
NM_001855chr94873 261 173 116 --1146 1827
NM_001858chr664443 3384 1835 1654 639 358 --25049 1371 13673
NM_001938chr131195 674 517 1502 21543 536 --
NM_001941chr1883685 3469 3344 3275 2842 2775 560 81 --12678 12902
NM_002006chr4215666 5509 5388 5338 5316 5275 5215 4602 4211 4089 4069 4045 3590 2317 1899 1877 1835 1803 1668 1280 1144 34453 715 334 11380 21643 422
NM_002025chrX128601 8313 8005 7139 7056 6660 3531 3397 3159 2501 2277 577 55987 2341 2048 1040 379 27097 444 --
NM_002035chr1893695 3648 3221 3037 2632 1557 1465 1240 1079 --11600 --
NM_002158chr2103632 3391 2762 2734 2437 1438 534 458 428 215 23224 1449 33012 2571 2334 22601 2510
NM_002203chr563682 3625 3496 1596 756 304 --1651 12652
NM_002214chr7155411 5386 5379 5322 5232 5204 5197 4278 4019 3810 3778 2265 1788 269 248 11984 25543 5451 15186
NM_002239chr26980 734 414 379 315 119 3470 464 450 2771 362 --
NM_002253chr431397 1334 1285 11298 --11171
NM_002265chr171944 11141 --11122
NM_002270chr5165660 5613 5335 5028 4698 4486 3988 3822 3455 1688 1242 1182 1065 1007 648 550 --25445 1391 24277 3595
NM_002310chr5126617 6473 6456 5925 5460 5084 4599 2085 1774 1198 1107 534 35021 1719 305 --16569
NM_002336chr12104697 4611 4568 3753 3647 3180 1062 923 49 35 21299 985 ----
NM_002397chr531896 1658 671 11992 1616 1410
NM_002500chr23985 385 375 2896 834 1858 --
NM_002594chr2072239 2229 2122 1836 679 344 196 51915 1909 1885 1859 1842 ----
NM_002641chrX41950 1747 1544 1395 21538 446 32010 1360 698 --
NM_002645chr1163098 2146 1034 543 352 265 32366 2355 56 1144 --
NM_002655chr8195309 5198 5073 4824 4557 3615 3558 3522 3469 3456 3406 1933 1895 1813 1536 1510 1458 1437 1108 34649 1926 1327 34745 1578 753 --
NM_002709chr262940 2904 2837 1344 57 45 --13264 12590
NM_002719chr1452163 1820 959 344 66 12368 1531 --
NM_002736chr752051 1426 722 278 133 21856 1432 2408 213 1619
NM_002745chr2274550 3370 3196 3062 1426 931 919 13183 13821 1631
NM_002822chr1251803 1627 1260 1220 212 11441 11766 11359
NM_002843chr1183461 2638 2375 1158 517 382 352 62 33284 2791 1222 33253 2388 599 --
NM_002844chr671293 1016 881 566 493 485 264 11178 1288 11104
NM_002869chr1162236 1927 1869 711 229 113 --21508 685 --
NM_002886chr374863 4767 4131 3928 3905 3740 1905 14408 --13886
NM_002906chr1162335 1973 1886 1840 1812 939 ----1881
NM_002941chr341610 540 487 393 --1473 11131
NM_003042chr342068 1647 1487 327 32280 2098 2081 11410 11503
NM_003045chr1374697 4544 3975 3552 1028 834 398 23941 732 11834 --
NM_003155chr842781 2642 737 657 22376 2364 12716 --
NM_003161chr1793090 2730 2710 2549 2463 2217 1300 1001 526 --13063 --
NM_003262chr3124914 4873 4554 4209 2005 1785 1689 1624 1473 1222 1114 717 ----14882
NM_003337chr531428 635 220 ----21160 283
NM_003392chr384022 3788 2856 1469 1463 1457 842 293 11443 13175 33355 3237 1431
NM_003410chrX82852 2599 2510 1130 981 911 484 444 3875 869 84 32691 615 223 1155
NM_003440chr1241006 884 842 329 ----1878
NM_003463chr683334 2980 2885 2059 819 221 74 63 11272 1532 --
NM_003468chr273880 3793 3619 1361 1025 577 398 13786 11339 11525
NM_003471chr332196 1937 484 --22261 2061 11924
NM_003478chr1173232 2646 2619 1134 1070 977 880 11144 2846 824 --
NM_003483chr1292914 2446 2230 2095 1953 1815 1155 1124 722 ------
NM_003489chr21123392 3333 3260 3170 3058 2876 2798 2373 1125 618 503 158 22512 2461 11069 --
NM_003590chr253621 3262 1181 967 840 24051 917 --2529 513
NM_003618chr261327 1312 1156 1076 495 180 31229 274 230 ----
NM_003743chr23892 567 57 251 41 ----
NM_003783chr131022 852 388 --1986 1242
NM_003941chr762550 2414 2057 1989 1878 473 ----11016
NM_003972chr1071375 1125 874 492 454 225 126 21138 902 --1912
NM_004064chr1221253 95 173 --11150
NM_004124chr1453326 2448 1214 980 62 13266 23360 2641 --
NM_004136chr1583224 2535 2236 2124 696 623 407 145 12211 22027 184 --
NM_004162chr331085 818 280 ----2966 174
NM_004171chr11119602 8268 7614 7077 6818 3383 2843 2762 2087 1351 791 48863 7291 3021 2426 12647 43045 2960 2699 1735
NM_004232chr1883543 3160 2644 1565 1493 1243 793 543 1479 2577 449 --
NM_004272chr511793 21597 1356 1561 11256
NM_004293chr9103352 3035 2945 2617 1543 1472 1399 671 659 493 --1502 13764
NM_004323chr952693 2666 2629 2617 1034 12644 --32682 2673 2653
NM_004342chr721976 855 31520 711 705 --12252
NM_004392chr13102199 2087 2006 1824 1661 820 726 713 660 578 --12424 --
NM_004464chr4124192 2905 2706 2696 2648 1667 1502 1310 779 490 454 229 33935 3198 1651 24328 1446 2963 342
NM_004501chr1104116 3788 3442 3056 2926 2660 2556 2503 394 29 33731 2669 1380 23224 1282 --
NM_004525chr22247 104 149 11332 21417 1309
NM_004586chrX155205 4963 4652 4627 4405 3942 2119 2063 1578 1426 1233 819 664 514 226 34806 3340 477 2936 271 11402
NM_004612chr964557 4187 1861 616 554 369 13227 --11011
NM_004709chrX21614 375 1527 2388 62 --
NM_004713chr142805 671 1528 --1237
NM_004719chr1272121 1975 866 527 158 128 58 --1487 --
NM_004730chr522048 500 22087 2077 21785 62 1852
NM_004745chr886391 6379 4935 2800 2262 1849 1190 1146 15698 12606 --
NM_004788chr1142596 2545 2521 413 22134 854 32371 2211 957 --
NM_004801chr241584 1471 362 58 51296 1188 1134 1035 98 ----
NM_004808chr1073002 2640 2398 2227 2060 1205 809 ----1620
NM_004849chr621089 267 1668 11146 21474 630
NM_004850chr231605 1139 161 41201 470 135 123 --11632
NM_004852chr182314262 13669 13097 12871 12758 12061 11219 11035 10568 9800 9466 9046 9029 5598 3977 3841 3721 3568 3325 2628 2539 2225 506 414001 3965 2641 1180 211403 4745 --
NM_004898chr472477 2420 2221 1985 1760 387 270 --12123 --
NM_004929chr831178 495 274 --1255 21158 175
NM_004956chr784397 4279 4128 4108 3832 3120 1400 347 14260 14563 11081
NM_004985chr1264335 4247 3455 3439 776 31 13608 12985 14300
NM_005063chr1022650 1082 21088 622 --23724 740
NM_005065chr14135282 4489 4414 4242 3949 3714 3505 3493 3383 1568 889 565 556 23273 546 34062 704 267 1792
NM_005068chr661040 1021 402 393 291 156 --145 --
NM_005121chr1771541 1026 832 558 381 344 223 --1367 33306 2358 845
NM_005156chr975364 4000 3897 3625 1993 1914 60 1491 15239 --
NM_005201chr35782 746 281 157 22 --1293 --
NM_005233chr382606 2331 2241 2232 2156 636 529 282 32401 803 401 32043 964 926 --
NM_005261chr83936 393 146 --1949 1834
NM_005339chr473588 3553 1654 1564 1501 1074 418 --23035 275 --
NM_005400chr292790 2732 2085 2064 1133 1091 1078 985 707 11228 ----
NM_005406chr1821209 1163 --31566 1458 1443 --
NM_005509chr531349 1328 231 ----164
NM_005578chr3134943 4697 4527 4344 3626 3315 3185 1566 1537 1521 1469 1356 1165 13905 14260 24162 1050
NM_005587chr154725 698 90 56 3175 128 106 ----
NM_005596chr9125492 5006 4721 4359 4218 1698 838 609 404 348 297 73 16114 --12049
NM_005665chr194349 4130 3173 1420 1388 1355 1326 1048 1029 2463 94 34572 3224 1884 11101
NM_005668chr5123978 3711 3636 3318 3214 3144 1814 1602 1202 1196 1185 343 24017 3587 23869 3179 --
NM_005725chr182474 2170 1860 1744 891 784 605 203 72328 2318 2292 2278 2202 2146 541 12387 --
NM_005779chr553500 2806 2794 211 177 12825 13203 12755
NM_005780chr131147 1347 1721 1637
NM_005795chr293000 2941 2792 2210 1954 1210 1000 803 426 22109 973 --21887 367
NM_005941chr874170 3624 3537 3522 3450 1332 681 22758 618 11001 --
NM_005955chr165300 4528 4470 4222 1399 739 35215 3641 1068 14410 --
NM_006011chr1563346 1638 1426 1039 582 141 --11560 13812
NM_006016chr641990 1941 643 285 11637 21918 277 --
NM_006037chr293963 3639 3629 3615 1516 1484 1149 1134 1008 23607 187 --14500
NM_006055chr262843 2330 2120 682 496 315 2638 273 1602 --
NM_006080chr732306 1987 550 1834 11109 176
NM_006106chr11103465 3327 3033 3016 1186 947 668 659 641 440 2929 55 ----
NM_006251chr562902 2334 2256 992 222 144 13255 --1229
NM_006320chr44738 443 423 342 ----1908
NM_006390chr1271623 1250 1214 727 448 424 183 --21269 432 --
NM_006420chr2073146 3015 2683 843 704 362 198 12848 13112 12724
NM_006460chr1731758 1252 385 168 --21670 568
NM_006467chr552341 1726 590 308 159 ----1559
NM_006520chrX31714 1651 376 11327 --11615
NM_006544chr14165919 5616 5577 5460 4789 4755 4729 4682 4586 4005 3939 1863 1783 1326 1126 954 13769 2534 357 1896
NM_006546chr1754544 4233 1852 1596 1523 --22262 1428 1352
NM_006547chr73626 497 455 31551 1440 99 11383 11897
NM_006595chr1171819 1789 1664 800 737 587 461 --199 1721
NM_006599chr16177235 7095 6888 6682 6626 6271 6158 6143 5418 3296 2996 2030 1418 747 470 357 97 37675 6532 2048 27435 908 1303
NM_006614chr3123339 3305 3007 2939 2904 1388 1246 995 931 901 635 169 11420 196 1505
NM_006628chr1584603 4410 3749 1228 774 454 364 213 --34461 3971 150 12952
NM_006729chrX65674 5442 4010 2115 1955 1757 31736 1718 432 ----
NM_006734chr651636 1485 397 301 127 11521 1422 11627
NM_006738chr151604 2447 425 14577 13042
NM_006750chr1677978 6405 6140 5830 4954 2732 335 28082 6715 --18022
NM_006754chr751251 1175 406 308 109 11088 1465 1378
NM_006756chr841278 1164 1054 437 --31195 296 220 1331
NM_006813chr62814 31 2282 135 --1102
NM_006852chr1742737 1795 1765 76 32170 2164 2158 --22664 582
NM_006873chr2103176 3126 2409 2324 2188 1263 839 702 678 421 --21235 767 --
NM_006874chr461108 873 472 405 183 50 2376 117 1834 --
NM_006885chr1663906 3785 3533 3225 2608 162 23742 3136 14208 --
NM_006902chr153086 1107 685 121 78 --12162 23314 2946
NM_006914chr941488 1232 367 227 3530 524 314 --1221
NM_006915chrX52142 1590 541 474 54 ----12149
NM_007013chr84966 717 660 324 1261 --2864 279
NM_007038chr21106119 5756 5558 5467 5421 5326 4630 4309 1690 203 2955 696 25378 4405 14593
NM_007114chr383237 2944 2887 2706 2394 1039 846 700 1336 2447 407 --
NM_007125chrY11331 2940 544 1176 11149
NM_007146chr1762302 880 695 676 626 597 1484 11846 22875 1071
NM_007159chr31481 3465 459 408 ----
NM_007195chr18113705 3695 3103 2601 2402 2318 983 864 446 261 174 11069 33760 1004 742 --
NM_007231chrX7963 815 513 491 152 101 21 22078 715 --1391
NM_007249chr13139252 8996 7998 7867 6988 3683 3444 2973 2566 1792 1753 953 225 --29089 8320 36711 5981 1556
NM_007374chr141359 ----2483 401
NM_012081chr593621 2949 2465 2445 1310 1289 1164 1063 418 2573 559 21196 721 --
NM_012092chr251597 1295 770 745 535 2730 110 ----
NM_012096chr343698 3378 1355 196 21466 1344 ----
NM_012158chr1331597 467 428 2707 405 11542 --
NM_012164chr9117425 7314 5545 5364 1914 1817 1781 1741 1518 1289 1026 27233 192 ----
NM_012214chr265904 5420 1062 477 418 287 1329 --1428
NM_012223chr23320 314 288 11158 --1982
NM_012281chr772457 2400 1801 423 319 305 60 12107 22245 447 --
NM_012287chr363955 3488 1645 1005 520 159 13083 14523 --
NM_012302chr121072 33 2386 191 --1174
NM_012309chr11124892 4809 4264 3992 3903 3077 3034 1586 1024 723 248 158 --13425 --
NM_012338chr761069 1006 404 327 125 66 --11113 --
NM_012347chr6102308 2097 2083 2073 2062 851 743 547 277 194 12047 --12337
NM_012399chr2241727 673 361 283 2277 162 --1476
NM_012431chr783186 2915 2674 2454 2259 914 365 153 22268 2242 22538 1063 --
NM_013374chr3--11173 11077 21056 763
NM_013381chr1252422 2289 1903 1858 1548 --1334 --
NM_013437chr821079 211 --21183 415 1571
NM_013995chrX52368 2058 1895 728 383 21853 1833 --161
NM_014106chr1561876 450 361 342 273 207 12505 --22677 250
NM_014112chr8145433 4837 4784 4709 3524 1724 1534 1229 1023 919 606 366 315 121 2658 652 14771 11894
NM_014117chr1672406 2290 1933 1803 784 435 81 ----31795 263 59
NM_014166chr13--21079 340 --123
NM_014264chr44519 436 188 84 123 1427 --
NM_014271chrX3869 863 143 1847 --199
NM_014319chr1251825 1623 1614 1608 1453 2749 731 11789 --
NM_014331chr4177803 6754 6485 6298 5741 5005 2906 2865 2109 2025 1926 1777 1496 1441 1124 896 144 42847 2778 1707 963 56885 5878 5378 862 308 25397 440
NM_014363chr1361302 1165 797 405 353 149 1390 21136 1061 --
NM_014368chr972101 1956 1532 1416 815 800 706 ----11994
NM_014372chr121850 232 11511 --12060
NM_014393chr882386 2087 1834 1823 1698 521 162 101 11977 21766 1679 --
NM_014415chr371690 631 470 415 271 128 101 21525 1366 ----
NM_014423chr595399 5271 4824 4553 4008 3550 504 424 394 13515 25484 77 --
NM_014554chr1222106 838 3929 445 435 --12083
NM_014612chr931330 625 366 ----1610
NM_014616chr353149 1055 795 317 202 23176 689 1854 --
NM_014666chr551236 1039 925 487 294 ----1518
NM_014682chr832018 784 704 11911 --1920
NM_014686chr1941741 1003 603 543 ----12601
NM_014701chr1563474 3060 3023 2743 2602 2522 13269 23396 101 --
NM_014707chr762243 1952 1660 908 588 139 --21759 562 --
NM_014784chr141058 1049 1038 299 21018 345 --1994
NM_014803chr1052737 1157 1002 892 502 12243 1763 32138 1864 1067
NM_014810chr132872 1346 1156 --13670 12726
NM_014819chr562380 992 986 666 301 89 --12503 1684
NM_014832chr1352106 357 245 228 187 2645 222 1420 1680
NM_014841chr621187 1058 1374 --21288 485
NM_014906chr1763786 3059 3051 2747 2532 638 1354 187 --
NM_014912chr1053212 2722 2500 2256 2210 11410 13204 --
NM_014920chr693789 3688 3668 3397 3356 2749 2437 1076 827 13092 ----
NM_014932chr381953 1868 1764 1289 1233 789 444 325 21925 169 --1122
NM_014936chr612535 --32601 2385 351 22807 2231
NM_014946chr262240 2085 737 668 287 121 22903 1067 --1174
NM_014961chr431996 702 160 22042 324 21759 1504 --
NM_014989chr642066 1845 1803 161 3297 285 279 1216 --
NM_014991chr462558 2211 1205 976 934 477 22485 2469 --11075
NM_015001chr151022 730 693 683 676 ------
NM_015017chr131139 155 63 1833 21208 173 --
NM_015032chr1372959 2432 2004 1174 939 239 166 1955 12094 11913
NM_015035chr2046736 6730 1978 89 22021 2009 16412 24907 322
NM_015040chr282592 2251 1223 1166 954 869 751 380 --13047 22537 2336
NM_015042chr1564325 3499 1201 1176 681 307 33509 1105 629 ----
NM_015051chr943204 2133 1250 173 1431 2916 564 1996
NM_015149chr142009 1993 1518 309 11932 1809 1264
NM_015155chr1032091 1115 700 12714 --1743
NM_015156chr1473763 3073 2862 2652 584 514 130 --22487 1374 --
NM_015192chr2032900 2643 936 21050 1044 --1484
NM_015205chr13105044 5027 4965 3774 3332 3324 3286 1454 1300 523 123817 3807 3750 3744 3670 3617 3498 3478 3380 3264 3235 3215 --13273
NM_015265chr252017 2005 1790 1640 982 1438 12578 11887
NM_015271chr494275 4209 3202 2637 1475 737 511 409 319 21182 1170 --13185
NM_015275chr12102189 2160 1977 1723 1389 479 455 413 389 25 1397 ----
NM_015310chr8128259 7943 7683 6360 6314 6012 5801 5194 1097 1056 912 79 16327 36792 1961 429 12192
NM_015313chr1164765 4438 4394 4276 4199 1878 11332 1753 14726
NM_015335chr1272647 2625 2063 1744 962 783 718 11033 ----
NM_015349chr632298 888 627 --11975 1951
NM_015358chr2151326 938 858 268 64 11159 ----
NM_015455chr564125 2659 1497 1114 675 59 33701 3408 689 ----
NM_015458chr875337 4244 1669 1407 1095 1064 675 15042 --2771 701
NM_015548chr641013 963 629 225 3935 652 402 11000 --
NM_015560chr342520 2474 1814 243 134 --22102 108
NM_015565chr2162244 2220 2054 1849 1539 226 ------
NM_015569chr1154352 4188 4179 3767 3719 3485 3375 3259 3125 1802 1462 773 655 391 345 13670 155 24647 3407
NM_015576chr382414 2319 2248 1200 1167 1102 1072 753 ----171
NM_015578chr1951956 1830 824 218 205 --1713 --
NM_015602chr151664 1225 629 477 133 ----1142
NM_015626chr1741141 481 247 200 --1192 1234
NM_015713chr893627 3311 2514 2260 1282 1143 769 603 580 12656 11012 --
NM_015886chr8265537 5411 5019 4745 4622 4516 4488 4219 3927 3776 3653 3614 3543 3478 2283 2205 1993 1898 480 413 319 248 94 85 44 26 75678 5114 3806 3530 922 727 354 25558 1572 1396
NM_015906chr184437 3974 3963 3446 3402 3393 3053 1085 1446 11919 14375
NM_015912chr892398 2388 2373 2365 2352 2142 881 684 670 12379 1450 --
NM_016009chr194778 4021 3479 3451 1943 1534 1350 978 720 150 ----
NM_016018chr842391 1911 656 256 11062 --1872
NM_016072chr1241783 1732 531 126 --42414 2304 2134 682 --
NM_016075chr1332869 677 261 1538 2491 423 12359
NM_016081chr441667 1381 906 357 --2297 262 1397
NM_016132chr1583456 3409 2262 2232 2223 1149 863 339 --52849 2356 898 831 154 --
NM_016133chr25440 216 163 144 65 21034 152 31522 1187 306 --
NM_016142chr1191352 1283 1215 1010 313 237 214 114 43 1175 1934 --
NM_016206chr3148851 8611 8510 8303 7289 6410 5854 3234 2930 2576 1807 1696 271 34 35902 1339 919 37732 6346 5630 12839
NM_016257chr163069 2799 2789 2659 1268 1068 --22610 847 12968
NM_016271chr1812037 31429 921 897 21630 717 --
NM_016272chr2232321 2312 2295 --12369 --
NM_016287chr132104 1445 421 12080 --11556
NM_016300chr32460 354 1428 --1155
NM_016396chr1582847 2735 2636 2401 2326 2011 1996 767 2689 189 --1784
NM_016422chr1163152 2760 2530 2038 1974 1041 32124 1967 1267 23036 2226 --
NM_016530chr1553132 3081 911 852 198 1224 23956 426 13062
NM_016531chr4173751 3741 3721 3694 3507 3434 2922 2745 2663 1293 1263 1241 1171 870 835 309 297 23729 3308 --13172
NM_016570chr123171 78 42 --2441 116 --
NM_016617chr1342172 480 453 371 --289 21 --
NM_017420chr1493869 3586 3266 1130 782 642 452 440 349 1121 12584 --
NM_017437chr1431654 417 144 1734 1476 195
NM_017633chr663559 3531 2854 1246 1170 917 31083 1064 1051 13295 1813
NM_017635chr1151406 1142 602 403 362 11481 2145 121 --
NM_017637chr976739 6113 3185 3031 1478 1042 705 66322 3484 3236 300 294 144 35939 5713 1744 16312
NM_017686chr121112 746 ----1395
NM_017694chr25808 606 592 172 141 --21933 1594 --
NM_017813chr8135811 5781 5695 5616 5311 4696 4583 4268 3576 1490 1205 888 398 12085 11356 --
NM_017824chr10112704 2625 2101 2049 1746 1700 956 438 424 328 127 ------
NM_017848chrX33919 1848 992 41070 1058 1050 948 ----
NM_017915chr1231134 210 58 ----2402 271
NM_017919chr975509 4962 4523 4016 1962 1902 33 --11703 25839 4031
NM_017994chr71158 1695 21029 545 --
NM_018036chr1474316 3917 3529 3495 1054 684 452 12812 21742 935 1155
NM_018046chr561926 1704 1538 1415 674 467 21943 483 1545 --
NM_018048chr12----1253 1709
NM_018084chr243322 3113 2917 2415 --22060 1255 12483
NM_018092chr1651524 1314 1130 497 43 21681 1629 --11418
NM_018157chr1253060 2353 803 530 142 41199 1181 1173 889 13258 --
NM_018184chr351624 844 505 281 229 --11518 --
NM_018361chr883476 3040 3032 2967 2614 2544 1484 1355 13683 43795 2823 1507 177 13422
NM_018444chr821885 955 31848 470 39 --1421
NM_018490chr1151526 1379 547 275 237 --11332 --
NM_018566chr1114919 4437 3511 3343 1777 1758 1656 1561 755 746 382 23899 213 23451 1992 14464
NM_018638chr1285578 4609 3982 3577 1632 1182 678 628 --25022 182 --
NM_018717chr482831 2631 2522 2286 2279 2010 1974 543 ----12269
NM_018948chr12355 279 1271 11359 1970
NM_018999chr1084262 4118 3358 3316 1447 919 907 447 31436 1373 225 21734 1540 --
NM_019045chrX4918 855 292 117 2608 326 283 28 1262
NM_019049chr13804 676 174 ----1651
NM_019083chr131430 296 77 ----1289
NM_019084chr1072295 2233 1914 891 844 800 608 --1762 --
NM_019106chr2231293 1093 29 ----11170
NM_019117chrX133470 3439 2985 2549 2482 1338 1002 425 417 232 208 193 183 2720 648 31304 670 398 --
NM_019593chr2092981 2418 2382 1974 1268 712 292 253 233 1515 1276 22913 737
NM_020116chr441713 1112 514 323 21766 167 11622 11494
NM_020122chr2105810 5196 4500 4118 2279 2271 2056 1935 1468 148 24316 245 12402 11479
NM_020177chr573105 2202 1250 843 567 194 176 --1183 --
NM_020337chr493184 3094 3019 2445 2303 1079 688 353 264 12198 2420 70 13076
NM_020341chr2051726 1530 1477 1352 322 1312 --181
NM_020346chr1171578 1571 1283 1151 1072 635 97 ----11188
NM_020353chr371827 1808 1741 1570 1275 419 281 1538 --22060 252
NM_020357chr321237 1043 21137 184 11566 11257
NM_020374chr1221786 163 11694 --2445 385
NM_020390chr3144889 4844 4534 4199 4044 3758 3752 3674 3422 3339 1636 755 416 354 23381 533 24225 3616 --
NM_020432chr772229 1843 1834 1801 1791 812 536 --11683 --
NM_020443chr144367 2024 1407 677 21554 1366 12248 16197
NM_020456chr1352193 2186 313 265 90 2435 277 1793 --
NM_020466chr643784 1071 851 843 14889 34995 3551 169 13898
NM_020640chr382172 2159 2044 1986 1928 1795 1639 1581 --2423 383 --
NM_020673chr2087106 5593 2967 2738 2720 1155 875 562 1581 27736 5411 2444 262
NM_020718chr1666199 4517 1590 1107 579 293 15944 --14281
NM_020728chr782941 2701 679 612 414 376 116 75 ------
NM_020734chr1293387 2537 2317 2191 1271 911 813 593 377 22299 2108 13062 22855 2485
NM_020742chrX52722 1721 759 515 51 21099 771 12528 --
NM_020752chr1072629 2349 2166 1792 1118 348 107 1384 22945 1070 --
NM_020772chr17178575 8410 7606 6838 6409 6257 5892 5738 3417 3045 1795 1679 1386 1177 889 749 139 78427 5748 2385 2176 826 149 133 12094 17998
NM_020792chr372732 2541 2529 1747 1024 859 198 167 1885 11066
NM_020796chr542075 1099 307 291 2365 352 --1996
NM_020801chr582385 2206 1871 545 516 481 330 234 21004 962 21708 194 --
NM_020802chr11143416 2769 2600 2356 2249 1099 1010 632 620 360 266 246 91 59 13307 --13317
NM_020805chr1851860 1570 1556 1325 721 --11618 --
NM_020810chr1463223 1393 1313 963 652 222 --23447 631 1201
NM_020824chr105761 708 653 257 201 --1601 1175
NM_020825chr1673849 3776 3216 2434 1102 1011 990 13658 ----
NM_020872chr361706 1511 1234 224 217 138 ------
NM_020921chr1463665 3052 1116 428 255 183 --13647 --
NM_021038chr372617 2068 969 953 884 308 140 ----12873
NM_021097chr2123020 2958 2654 2641 2423 2366 2290 1191 1149 930 673 614 246 36 1130 --
NM_021148chr751982 1583 506 484 249 11928 --22044 2007
NM_021229chr1231215 1142 838 11174 --21135 110
NM_021238chr1232024 1733 692 --11890 1846
NM_021255chr1453382 3169 2963 1624 148 21417 1104 12977 --
NM_021813chr6135859 5527 5450 5332 5149 5059 4594 4043 1674 607 454 441 428 --24525 2058 --
NM_021954chr1343360 3053 1225 729 12725 12399 12547
NM_021961chr11147300 5857 5799 5552 4876 1822 1676 1648 1630 854 773 464 420 48 31232 1216 37 12735 1753
NM_021998chrX31251 962 259 ----21510 979
NM_022048chr15135929 5660 5603 5327 4869 4173 2499 2179 2044 1086 879 787 382 --1986 --
NM_022058chr261931 1745 1548 813 696 656 1122 1833 --
NM_022118chr133421 251 77 --1231 --
NM_022351chr8103721 3700 3528 2818 2385 1269 886 814 711 290 43128 1553 1428 1115 13606 13239
NM_022444chr721645 690 31209 571 407 21679 626 --
NM_022475chr45760 730 650 245 181 1190 ----
NM_022497chr372896 2746 2729 2435 1058 626 400 13302 13377 12380
NM_022725chr1172087 2032 1970 638 75 34 27 22129 1875 11922 --
NM_022726chr621482 1330 --21777 1554 11631
NM_022763chr343189 2122 406 103 23092 3015 --1482
NM_022781chr952886 2870 1041 506 53 22076 2065 --13151
NM_022826chr24871 203 65 35 1127 1395 --
NM_022841chr1592456 2346 1856 1056 1002 892 776 488 42 ------
NM_022893chr282817 2558 2415 2173 1958 828 504 423 1489 --12135
NM_022900chr731142 176 101 --2299 147 1931
NM_022901chr961653 1431 717 402 336 78 ----1121
NM_023943chr3179 168 --158
NM_024007chr562080 1187 1092 940 846 547 --22029 599 --
NM_024490chr15128 ----1206
NM_024524chr382863 2759 2368 2120 1139 1105 919 169 43154 2312 408 244 2530 471 --
NM_024548chr351741 1195 434 354 321 11226 1650 --
NM_024561chr1331141 562 506 --181 11286
NM_024645chr83357 133 22 1458 1248 1416
NM_024665chr394733 3945 3308 2993 1568 1364 982 840 635 1136 --31502 312 292
NM_024686chr14211 141 132 80 1116 1401 2159 71
NM_024692chr251792 1686 1633 105 31 21821 1810 11411 --
NM_024813chr13315 247 110 1454 --11094
NM_024989chr2187627 7579 6724 6685 6629 6618 6599 6466 5987 5574 5450 3068 2682 1847 1831 1260 946 635 37601 2673 2017 16694 17912
NM_025054chr8104165 3860 3243 3232 2682 1559 1240 520 411 307 --1174 --
NM_025134chr1652152 1798 785 356 303 12242 22590 918 --
NM_025195chr841860 1529 366 182 11548 11426 11499
NM_030621chr1474137 4113 3873 3299 3036 2778 1020 --21522 169 --
NM_030627chr5113203 2993 2984 2580 1546 1325 1166 1093 645 366 151 ----1373
NM_030637chr143693 612 465 1711 --1122
NM_030648chr4145046 5000 4873 4117 3994 3615 3520 1552 1351 947 824 689 238 144 --15062 25621 3646
NM_030650chr283823 3738 3722 2618 716 336 284 161 --23306 1314 --
NM_030786chr161857 1589 1581 1543 298 193 ----11447
NM_030816chr1113461 3179 2836 1441 1039 989 970 539 387 341 325 22673 2465 23675 2960 1212
NM_030918chr143759 1889 686 427 31237 1214 1185 25447 4862 --
NM_031216chr1842162 383 377 222 1743 11469 --
NM_031291chr41645 175 --2134 49
NM_031442chrX103068 3044 2773 2749 2743 2726 2554 2431 2303 214 42653 2635 2627 869 12982 12820
NM_031483chr2093078 3043 3007 2489 2185 1230 1184 835 219 1353 12536 1382
NM_032144chr241783 1725 563 79 --21365 537 --
NM_032145chr671916 1212 733 603 529 518 401 126 ----
NM_032199chr1073666 3546 2486 1458 1376 1098 1028 23151 588 1155 --
NM_032208chr253351 1457 1145 1071 926 13185 11123 11470
NM_032228chr1173460 2444 1337 1123 1028 543 36 --31010 696 326 21311 354
NM_032289chr5--21893 663 --21936 642
NM_032373chr10125674 5526 5489 4629 4595 4435 3986 3622 2134 1602 592 379 ----11579
NM_032446chr583470 3213 1286 957 948 828 781 445 13544 3806 577 464 1639
NM_032457chr4103935 3814 3562 2797 2785 2534 2497 1432 1330 469 ------
NM_032842chr761699 1615 1607 1598 1396 1378 --11192 --
NM_032859chr1363982 3707 3516 2586 929 514 23677 3485 33958 3767 3591 11434
NM_032866chr1532124 977 408 22991 2889 12860 12970
NM_032873chr1143894 1488 1092 116 --23936 492 14099
NM_032968chrX94264 3738 3715 3138 1650 1586 1311 1063 447 23065 631 ----
NM_032973chrY94256 3730 3707 3133 1644 1585 1311 1063 447 23060 631 ----
NM_033132chr1341762 1733 744 337 1357 --11925
NM_033224chr797717 7447 6965 6533 6424 5170 2725 352 132 11108 17194 11824
NM_033225chr863163 2374 2223 2176 195 76 22353 2193 11197 --
NM_033285chr873372 3299 3042 2805 1639 275 244 --34102 1507 237 13734
NM_033389chr1764731 4594 4054 2974 1068 729 24405 2983 --23034 75
NM_033495chrX2814 713 3698 690 680 1235 --
NM_033515chr651305 1149 363 354 289 --1483 --
NM_044472chr1------2761 722
NM_052832chr852746 2463 2207 911 261 32450 1110 1094 --12768
NM_052879chr12134025 3505 3392 3242 3005 1629 1607 1555 1397 1376 1115 216 210 33615 240 230 --1353
NM_052927chr551913 1608 791 643 492 --21472 664 --
NM_054027chr552160 2132 2104 1950 1425 31812 766 546 31702 1409 159 --
NM_080546chr941891 896 889 208 41735 1501 127 51 --1557
NM_080743chr662131 1881 1025 812 522 37 185 12001 --
NM_080867chr1474534 3317 1574 1055 779 451 32 --21907 674 14934
NM_101395chr2163470 3366 3161 3085 2946 2149 --1536 --
NM_130386chr181549 1418 1457 1676
NM_130808chr3----1385 1102
NM_130809chr552425 2117 1082 640 367 32865 1158 598 1269 1241
NM_133329chr241794 1746 1497 464 127 2567 455 --
NM_138333chr962578 2428 933 364 343 269 ----1237
NM_138473chr1253525 3446 3250 368 27 23337 640 ----
NM_138731chr14194245 4144 3923 3437 3296 3074 2948 2878 2691 1303 1009 925 892 548 447 350 318 284 201 43545 3529 2699 435 13825 --
NM_144571chr4126958 5649 5042 4238 2667 2212 2054 2007 1546 1005 776 224 36223 5165 4908 --21988 1593
NM_144632chr24707 689 263 85 21906 462 22181 915 --
NM_144664chr1142291 1831 1692 1615 2733 148 --1302
NM_144778chr1372292 2169 1980 519 296 259 68 --1431 --
NM_144778chr1372292 2169 1980 519 296 259 68 --1431 --
NM_144963chr862355 930 865 574 351 263 12702 1139 --
NM_144973chr1275233 4645 4299 3381 1573 376 368 --1108 25280 678
NM_145011chr1071948 1856 845 781 745 289 216 22068 677 12239 1726
NM_145808chr762915 2230 1946 1258 1133 376 12390 11111 22224 256
NM_145913chr1231056 373 292 ----1908
NM_147128chr741396 1044 435 103 ----2485 223
NM_147156chr102951 295 --1377 11221
NM_152263chr195757 4983 4658 4568 3913 2436 2108 1055 736 24458 878 --11968
NM_152400chr472089 1351 679 634 597 344 187 11991 --2532 202
NM_152409chr5143561 3325 2991 2855 2447 1434 1407 1020 992 789 768 682 492 387 180 13189 --
NM_152424chrX23435 2861 4436 426 398 366 --14708
NM_152519chr262207 1912 1803 652 610 418 4386 344 338 322 --2457 430
NM_152594chr1562154 1862 1779 829 543 262 ----12249
NM_152608chr172492 2479 2054 1646 948 325 224 ----22360 2160
NM_152641chr1282711 2699 2661 1169 1002 941 564 54 ----1328
NM_152687chr55855 429 415 200 174 1129 11146 --
NM_152756chr5104334 4158 4086 3816 3375 2962 2733 1509 318 31 12951 23838 3559 11231
NM_152774chr7172587 2440 2191 2164 1736 1664 1100 1086 763 752 745 735 651 543 502 338 140 22679 2659 12096 22629 777
NM_152787chrX53935 3271 2431 1231 1197 1577 --12741
NM_152835chr132874 1918 83 11171 --2624 405
NM_152902chr131248 642 477 1632 11533 11349
NM_152996chr161644 1602 1517 802 727 229 11528 1532 1836
NM_153184chr361985 1955 1727 616 531 427 11999 2516 503 31948 260 245
NM_153371chr1321655 1537 12092 41773 1469 905 444 11852
NM_153607chr582937 2819 1963 1209 591 525 189 142 21107 547 ----
NM_153689chr272178 2019 1805 907 744 609 42 ----1552
NM_153810chr1075091 3553 2046 1674 1289 782 332 --11916 13851
NM_153836chr271756 1650 1574 1547 1426 606 587 12158 11520 11458
NM_172070chr241453 675 482 403 31998 1799 1534 --2807 120
NM_172071chr177438 5589 1963 1647 1219 761 395 44564 1777 1707 332 ----
NM_172127chr411756 21862 1747 --11726
NM_173468chr4155850 4555 4445 4417 4334 4305 4030 3902 2378 2231 1513 1110 628 587 416 15485 1493 11539
NM_173469chr153967 375 242 ----161
NM_173475chr1631804 1522 1355 31371 1365 1316 ----
NM_173505chr184964 767 472 445 11151 1850 --
NM_173576chr1072059 1998 1872 1646 1514 829 131 1161 ----
NM_173694chrX32186 929 305 12322 147 12399
NM_174911chr853569 3428 3075 1543 1186 13743 23394 2929 --
NM_175061chr73538 515 413 11498 1574 11690
NM_175607chr351690 1421 1305 255 36 11592 11350 1321
NM_175768chr651562 1433 1153 593 109 --21631 464 1158
NM_175876chr172737 2487 2430 2033 870 272 204 --52630 2443 2292 979 83 --
NM_178011chr1043167 2685 1218 1200 --32269 1141 780 1536
NM_178013chr1423138 2464 12798 --22755 2747
NM_178127chr114587 441 179 42 --190 1222
NM_178496chr321452 88 --11560 11010
NM_181354chr891725 1606 1586 1564 1454 1411 641 506 93 ------
NM_181836chr572603 2242 2224 2103 2090 1917 771 12306 ----
NM_181869chr1272634 2585 1961 1907 810 391 337 --2265 34 --
NM_182493chr16124607 4541 4455 3728 3709 3656 3453 3425 3400 1704 1467 774 31434 852 839 21045 246 12089
NM_182767chr1262108 1769 1564 1440 662 453 --22086 806 --
NM_194247chr283864 3699 3232 2809 1711 1448 1364 983 11436 ----
NM_194282chr442735 2539 1905 816 11951 --1613
NM_194285chr1193191 3149 3128 2799 2090 1335 853 155 126 13398 13385 --
NM_194314chr1145660 5533 5041 4393 3744 2262 2254 2185 1884 1744 840 706 587 163 63518 2043 1982 1252 1073 1061 1904 --
NM_198270chrX82974 2631 2562 2254 1010 697 448 232 11315 13094 --
NM_198273chr553164 2173 2135 832 786 22151 859 2868 515 12066
NM_198503chr172323 1877 1817 765 642 118 91 11840 22254 720 1845
NM_198549chr163148 2166 718 690 422 402 33042 517 394 1445 22287 72
NM_198715chr1195600 5565 5178 5100 5059 4617 4481 4111 3885 3833 2451 1843 1782 1763 1144 809 688 194 144 21383 355 --16164
NM_199000chr792155 1659 1439 804 755 689 336 327 307 --22068 913 --
NM_203301chr1451542 666 527 158 35 2369 244 --11067
NM_203406chr592618 2582 2281 1857 1781 624 574 254 236 32889 459 38 12594 3940 783 560
NM_206853chr6103762 3754 3512 1556 1492 1323 1237 1076 593 398 33957 2743 586 ----
NM_206854chr695023 5015 4773 3659 3269 1854 1659 1002 488 35218 4004 1847 --11079
NM_207311chr1211174 1826 --11237
NM_213606chr1052293 2251 2202 567 315 22355 790 1135 --