TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-568
miRNA Sequence: AUGUAUAAAUGUAUACACAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX93212 3099 2809 2768 2722 2716 2700 949 111 11350 1943 --
NM_000081chr141718 1683 400 223 --11860 1382
NM_000084chrX54803 2180 1089 1030 265 36836 334 316 46987 6956 5929 4830 --
NM_000092chr284158 3772 3647 3579 1664 1301 1283 1223 14134 24585 1090 --
NM_000109chrX31007 347 206 31635 700 276 1716 1284
NM_000141chr1041452 422 376 103 --2429 161 --
NM_000142chr431288 637 603 11293 11278 1576
NM_000176chr573876 3611 2946 1551 1528 787 538 23589 2903 3811 597 442 13197
NM_000216chrX123839 3777 3524 3041 1327 1305 1297 1291 1273 1241 1074 783 43810 3671 1280 1252 14087 23585 599
NM_000248chr362334 2152 2096 986 530 343 --21050 928 21075 218
NM_000259chr1566307 5781 5455 2101 2088 607 45609 4703 1412 747 15643 41731 1649 1529 1398
NM_000267chr1743355 2656 2410 2126 --31175 863 426 12980
NM_000314chr10113190 3154 3054 2409 2066 1986 1293 540 329 220 156 12402 32416 2397 2388 --
NM_000332chr686928 5282 5066 4827 2820 1429 690 655 16068 11812 --
NM_000337chr555503 2640 2619 2530 198 32550 187 177 34953 2589 1098 --
NM_000390chrX72977 2447 2286 2142 2104 1236 295 22994 829 43010 2838 2749 2586 --
NM_000408chr262978 2646 2428 2282 1070 575 --1918 12754
NM_000489chrX63442 3233 2165 729 448 308 32726 2504 1309 33431 2799 374 --
NM_000555chrX147856 6561 6015 5912 5648 5557 4845 2820 2273 1241 1198 1101 367 307 16635 36914 6728 4792 --
NM_000600chr73399 366 263 --1343 1379
NM_000618chr12136183 6051 5864 4779 4488 2548 1941 1745 1060 926 603 513 268 12403 24430 858 14735
NM_000627chr24604 580 214 70 ----1362
NM_000633chr1895101 4905 4522 3752 3426 2068 1867 1568 64 34986 4382 32 11729 1765
NM_000719chr12105953 4794 2501 2188 1946 1575 1230 1123 1113 869 22671 1399 46508 6014 5834 5357 --
NM_000793chr1443957 1530 1211 1019 11535 11169 25118 44
NM_000809chr4179267 9209 9099 8294 8227 8118 7822 7732 7432 6918 6177 5958 2918 1922 1914 1481 421 47993 7964 7197 3572 --58597 8524 5686 2744 1945
NM_000813chr5125384 4586 4453 3912 3466 3436 3426 2013 1552 1202 836 276 55591 4833 1502 1266 1017 155 --
NM_000814chr15103322 1028 1022 746 358 255 134 116 82 75 1162 1204 --
NM_000817chr25948 869 246 222 216 11220 3934 779 230 --
NM_000826chr442103 2010 1947 1044 32256 1991 1053 1419 12340
NM_000838chr672644 2476 2406 2126 1975 1950 357 11072 ----
NM_000845chr7------2480 195
NM_000875chr1592651 2642 2436 1759 1375 1368 1257 1249 442 1194 24857 2344 16870
NM_000877chr273110 3050 2959 2876 2130 2058 66 ----12997
NM_000899chr1294383 4303 2758 1648 1410 871 699 515 150 1645 34420 4354 1184 1677
NM_000901chr452507 2404 709 580 484 --11592 22517 1982
NM_000902chr383257 2850 2072 969 863 753 628 227 --1499 1729
NM_000944chr482084 1508 931 774 752 636 411 287 1472 1628 12065
NM_000945chr23630 359 313 1492 31817 473 335 --
NM_001001331chr35700 680 656 607 340 2715 693 11767 --
NM_001001396chr164325 4021 3995 3724 2736 1163 14305 --24133 2839
NM_001001433chr2041984 490 339 273 --1894 13182
NM_001001481chr893182 3050 2593 2450 2187 716 614 524 510 23175 2975 22792 853 --
NM_001001484chr1082372 2200 2157 2110 2090 2071 587 569 12146 12173 --
NM_001001557chr841975 1933 1854 1630 22193 1923 --11988
NM_001001664chr294018 3830 2965 1504 1361 841 775 744 293 23745 577 --23656 762
NM_001001668chr1973903 3550 3350 3107 2956 2821 1108 12860 23870 2978 --
NM_001001890chr2144257 3384 830 374 1575 23303 554 21652 565
NM_001002243chr26805 733 681 263 191 147 ----1948
NM_001002257chr263574 3340 2378 2325 809 206 ----13124
NM_001002860chr1474527 4301 3593 1766 1722 332 138 34442 2838 1727 44621 4503 3455 305 --
NM_001003406chr2263190 281 257 229 211 201 ------
NM_001003652chr18127436 7282 6480 5326 3304 3295 2689 2639 1771 878 492 308 36946 2119 486 68594 7126 6102 5495 2104 354 26715 6470
NM_001003674chr1865410 5267 2129 1804 1447 1266 26714 4998 66888 5015 4789 4765 1608 410 11058
NM_001003681chr22102127 2121 2036 1751 156 138 130 120 113 58 2150 143 21951 1864 --
NM_001003712chr12134045 3931 3781 3288 3265 3245 3065 2676 1625 1446 1251 674 280 --12901 --
NM_001004065chr993971 3876 3565 3547 3527 2668 1371 1277 848 23572 145 13085 --
NM_001004317chr6114450 4435 4218 3975 3729 3345 2984 1788 1137 458 265 23774 302 43643 1251 322 281 1465
NM_001004419chr1274558 3366 3186 1716 832 162 66 33709 3222 1136 23206 2854 1450
NM_001005366chr121687 --2709 294 3928 335 311
NM_001005474chr33151 86 67 1522 31283 553 140 --
NM_001006600chr572280 1778 1585 739 393 307 174 --2126 88 --
NM_001006623chr272247 1996 1886 1030 649 553 531 --1998 12436
NM_001006945chr12693 240 ----2592 131
NM_001007102chr661654 1645 515 367 153 133 11207 11633 1407
NM_001008405chr721177 342 11389 21679 199 1614
NM_001008495chr851569 1448 832 388 353 1671 --12104
NM_001008564chr1372134 2113 2090 1774 814 460 424 11695 1356 11679
NM_001008738chr582906 2891 2867 2103 1793 777 640 568 12635 11109 --
NM_001008925chr493259 2760 2518 1365 705 591 478 294 272 22692 2504 13478 11106
NM_001009554chr494256 3251 3135 3089 3021 1797 1170 1124 23 --23129 1147 --
NM_001009909chr1163610 2742 2705 2551 1215 826 --12717 23906 3530
NM_001010000chr18112926 2791 2579 2218 1320 1272 866 524 406 396 35 --1588 --
NM_001010861chr142430 613 584 574 --12279 1941
NM_001010888chrX84285 3173 3000 1513 1153 985 967 118 13115 23841 1031 23964 29
NM_001010935chr151010 912 406 399 150 --1124 1285
NM_001010942chr1231078 890 421 --1294 2507 208
NM_001010986chrX32358 923 187 12341 1915 2803 317
NM_001011666chr7104994 4950 4667 4526 3998 3978 2251 2105 285 160 --45835 5461 4558 1026 56564 5001 2036 192 172
NM_001011885chr1541832 1730 1465 702 --31258 532 200 --
NM_001012755chrX74227 4145 4066 3165 1903 1624 61 44987 3983 3667 1974 34828 3773 1731 --
NM_001012761chr572708 2574 346 330 99 91 59 --3660 283 148 --
NM_001013406chr731654 1380 416 --1437 1486
NM_001013620chr12177923 7411 6538 6262 6218 5897 5872 5844 5820 5277 2576 2464 1767 1438 1294 434 140 46136 5861 5837 5543 55856 5832 5494 5128 1274 17121
NM_001014797chr1067560 3063 1453 992 978 607 15121 28212 8201 15907
NM_001015877chrX33034 2928 2312 12370 32416 2212 1166 21892 676
NM_001015880chr1041360 640 175 153 31695 520 430 21307 230 --
NM_001017371chr251352 1238 1180 1144 1100 31201 926 546 3437 129 41 1249
NM_001017415chr14673 579 507 27 ----1133
NM_001017424chr151882 1539 1530 1427 779 11546 1445 --
NM_001017440chr768127 8075 2862 1559 1431 814 18214 --28253 8067
NM_001017923chr143274 215 195 21485 493 21352 158 1397
NM_001017926chr821323 386 11716 1588 1558
NM_001017930chrX61364 1252 1132 956 155 130 1533 ----
NM_001018067chr164800 4140 1726 1146 501 298 34921 4907 4336 45258 618 597 257 --
NM_001020658chr151616 1523 663 551 277 1572 31421 1171 260 --
NM_001024847chr372445 2411 2399 2322 1567 354 336 1292 1316 --
NM_001024948chr153349 2885 2728 2586 2328 13152 12352 13032
NM_001025076chr10116216 6071 6018 3991 2467 1936 1479 1082 752 738 594 14138 36057 4174 376 --
NM_001025077chr10147574 7429 7376 5349 5003 4829 4811 4796 2837 2440 2110 2096 1952 328 25496 687 47415 5532 4803 1734 1870
NM_001025108chr284090 3908 3902 3721 3686 3659 1364 482 43728 3623 734 175 --13645
NM_001025366chr671654 1611 1587 1555 1540 1374 423 31390 415 386 41224 410 379 364 --
NM_001025580chrX44175 3925 1596 1067 32722 1535 239 33723 3534 1647 12664
NM_001029998chr461439 1114 518 75 40 34 --150 --
NM_001030055chr14124297 3373 1896 1866 1751 1737 1597 1505 1317 1130 1089 303 --12996 23876 900
NM_001031623chr631122 356 186 1363 1274 1465
NM_001031695chr2264753 4399 3832 3332 1188 157 23450 2102 34690 3392 1332 --
NM_001031732chr452505 2317 1457 1352 674 22522 433 21098 1003 1829
NM_001031812chr552253 2010 1815 1561 766 --32029 2000 355 1753
NM_001032380chr1041544 655 647 354 ----1298
NM_001032394chr642700 2027 1008 506 3781 394 243 22619 2595 --
NM_001033045chr284326 3945 3399 2948 1084 818 776 692 ----2956 333
NM_001033057chr382063 1935 1647 1521 1338 658 623 166 21942 1740 21986 138 --
NM_001033081chr141740 1716 1474 748 1321 1585 21789 760
NM_001033117chr393088 1784 1103 1054 480 440 416 386 374 --1432 13148
NM_001034852chr143547 352 334 1345 1378 --
NM_001034954chr1053250 3161 3073 2538 2145 --23102 2553 --
NM_001037174chr262111 1673 1554 623 596 474 --22231 2190 1809
NM_001039538chr252522 837 784 551 79 13139 11107 22383 2307
NM_001039547chr398091 6808 6800 3105 2758 1541 528 303 220 17087 36817 5023 4921 16924
NM_001039590chrX2641 245 44033 3253 924 167 22459 835 --
NM_001039618chr1185579 5499 4258 1982 1838 1756 1318 588 21997 1851 35830 1822 1030 23978 664
NM_001039840chrX115967 5384 4348 3820 1900 1634 1567 1355 1127 246 240 25661 5309 14994 14721
NM_001039916chr122912 894 21186 901 1884 --
NM_001039937chr1363684 3631 3022 2904 1561 426 11591 22575 1546 1461
NM_001040110chr741612 372 360 323 1352 --11590
NM_001040142chr2112103 2042 1591 852 828 820 812 792 784 776 453 ------
NM_001040284chr1695897 5516 5206 4211 3801 2230 1192 653 505 --43912 1640 1593 318 --
NM_001040429chr1372654 2430 1424 1137 1107 387 332 13407 23303 2361 --
NM_001040441chr164934 4892 4198 3638 3502 1493 11607 24881 673 35446 4849 1573
NM_001040446chr552715 2582 2471 2410 2374 22562 183 42432 2165 1827 277 --
NM_001040665chr7165018 4793 4390 3884 3822 3558 3406 1918 1717 1373 1165 900 609 565 378 270 --24020 441 --
NM_001040712chr963627 3026 3020 933 902 894 32893 2717 2242 12908 --
NM_001042403chr123243 160 122 1352 3321 114 38 --
NM_001042404chr151784 1436 670 460 414 --21980 700 1574
NM_001042413chr923225 592 --64140 3531 3521 3425 2624 643 --
NM_001042473chr1081820 1611 849 467 241 153 143 137 22067 1917 ----
NM_001042481chr1472541 2494 2029 890 725 207 24 32526 2429 904 32343 984 897 11698
NM_001042537chrX92482 2044 1668 1598 947 739 152 122 63 1109 --11811
NM_001042543chr41299 31488 163 102 21597 507 21610 308
NM_001042550chr93651 597 245 21499 307 52084 470 259 219 82 1132
NM_001042555chr1254004 3699 1257 926 369 --2211 197 11436
NM_001042599chr2127734 7014 7007 6210 5871 4989 4798 4758 2684 2146 1406 682 57742 7334 6226 2936 803 26924 4905 11575
NM_001042603chr1261425 1235 1213 1185 192 78 24058 1228 25235 4872 --
NM_001042604chr3114542 3703 3412 1709 1286 1269 1211 1044 619 530 222 23502 1758 24610 1169 11812
NM_001042749chrX102028 1966 1924 1838 1686 1337 369 243 125 90 --11793 --
NM_001044385chr243726 1151 348 81 14048 1649 2568 114
NM_001046chr572826 2670 2616 2595 811 756 615 --13007 --
NM_001049chr1452494 2341 2015 1649 1612 22162 1635 22048 1659 --
NM_001071775chr1341702 1378 783 450 179 1430 11388
NM_001106chr3129324 9295 9272 7849 7082 6885 6117 5991 5947 5936 1367 1245 49008 8582 7975 6856 59391 8888 8850 8690 1494 --
NM_001146chr871890 1832 879 479 452 433 382 32311 810 460 1909 --
NM_001167chrX96557 6448 4968 1755 1744 1416 745 717 128 36129 5499 375 22271 1310 --
NM_001174chrX42051 1856 1468 226 21850 168 11838 12201
NM_001198chr661947 1545 1525 257 222 198 --3649 231 78 1377
NM_001200chr205891 363 260 173 29 --31029 392 252 --
NM_001201chr463678 3462 3219 856 734 542 23689 3095 23968 3654 --
NM_001204chr2157143 6881 6261 5963 5592 5428 5416 5396 2960 2651 2494 263 236 172 154 47673 5852 2549 1837 36353 2521 1647 --
NM_001206chr993141 2589 2410 946 900 773 702 461 403 --23131 3042 1603
NM_001257chr1651008 966 954 946 381 --21459 982 11376
NM_001259chr765818 4585 4091 4040 1867 1634 14363 35777 1853 667 13894
NM_001270chr541064 815 191 178 11138 21150 358 --
NM_001364chr1174795 4103 4083 4055 1372 1029 439 3810 136 60 24212 1913 21059 711
NM_001390chr1853583 3118 1435 1093 532 1612 3848 525 382 --
NM_001412chrX102865 2704 2690 2433 1445 1083 895 850 776 515 21276 900 23457 3299 --
NM_001419chr1941624 233 142 23 175 14134 14194
NM_001427chr761556 1485 308 226 147 87 21588 1565 11801 --
NM_001432chr473128 2938 2916 2852 604 362 274 --23315 1558 23521 227
NM_001438chr163641 3569 3561 2749 2257 1058 42743 2728 1276 706 12649 --
NM_001451chr1611141 11146 11330 11134
NM_001455chr674577 4439 3531 1539 1451 1359 505 21140 229 34225 1562 244 11224
NM_001498chr63875 186 180 --41279 1160 256 173 1325
NM_001616chr283388 3189 3145 2617 2357 857 520 250 11318 23288 1022 13492
NM_001621chr712909 53065 3055 2661 2309 284 12609 1596
NM_001656chr52236 109 1124 31891 595 76 11960
NM_001668chr141622 1615 1609 444 1769 11717 1614
NM_001690chr332534 1783 245 11943 1533 21983 166
NM_001709chr113640 58 30 --22344 132 12775
NM_001854chr14581 393 308 117 ----11349
NM_001884chr51185 ----2466 384
NM_001938chr161743 1727 519 504 162 93 --21864 1529 --
NM_001941chr1873277 3174 2902 2798 321 137 120 --11533 --
NM_001942chr1821870 204 1373 31698 1436 1404 1472
NM_001966chr321297 1281 --11503 11550
NM_001981chr152005 1990 969 910 247 ----11998
NM_001987chr1243125 2690 2618 408 --32754 2634 419 --
NM_001999chr521373 1210 --11112 21164 228
NM_002006chr4125080 5068 4806 4697 4626 4192 2062 1084 793 715 334 206 24312 853 13878 14777
NM_002009chr1582749 2465 2166 2111 2084 1707 617 202 21769 700 12593 32316 408 258
NM_002015chr1393270 3025 2603 2571 2517 2345 471 413 186 22848 338 53316 2531 953 934 662 1712
NM_002040chr21113079 2840 2792 2496 2404 2309 1144 1097 901 517 108 12100 53225 2241 2024 1073 557 1889
NM_002069chr771308 1233 1213 662 510 388 285 1272 152 1545
NM_002126chr1784119 2741 2729 2597 1567 1117 1099 741 13440 64095 1584 1554 1509 1455 1425 --
NM_002158chr2103366 2939 2922 2736 1463 1455 1443 1435 1378 1248 12511 13449 21122 259
NM_002189chr105676 646 639 622 616 --1653 --
NM_002210chr273097 3076 1434 1350 1001 640 145 43587 3121 2748 264 22431 914 1297
NM_002214chr7115186 4749 4474 4459 4352 4131 4031 3892 3780 3477 1984 1251 55481 4177 4016 587 123 13919
NM_002227chr151291 1141 525 478 144 1869 --11312
NM_002239chr271138 972 458 452 442 317 291 --1277 --
NM_002247chr1072068 2056 1977 1966 1904 1598 954 52061 2049 2035 2027 2013 32042 2020 449 12002
NM_002264chr385040 4960 4008 3733 3651 3452 3301 291 --34184 3950 1659 --
NM_002268chr33683 69 45 21334 92 11537 21573 1491
NM_002270chr5145621 5615 5377 4957 4801 4716 4681 4517 2277 2064 1915 1523 810 341 35137 4048 1074 44849 4695 1687 1241 13519
NM_002336chr1264619 3848 3526 3285 242 113 --54600 4147 1088 180 159 --
NM_002397chr562239 1982 1898 683 91 85 --12253 3404 233 217
NM_002449chr51268 1275 31066 344 299 11225
NM_002481chr152544 1932 1456 705 147 --17896 27836 2971
NM_002487chr156654 321 262 209 196 138 2795 519 ----
NM_002500chr231089 832 387 2380 342 31003 526 455 --
NM_002514chr821032 148 1290 21156 740 1415
NM_002515chr1422028 570 1106 1721 1114
NM_002577chr373960 3258 2812 2461 1158 528 184 13573 14006 --
NM_002581chr9185699 5500 5463 5084 4982 4956 4942 4321 3927 3860 3733 3537 2176 2072 1917 866 751 239 45689 5409 4908 650 34966 4920 4204 --
NM_002594chr2082500 2253 2241 1907 1881 1871 1857 1838 32258 2232 2225 12108 --
NM_002595chr1241611 536 391 165 1543 21244 196 --
NM_002610chr242138 682 198 80 ----22252 1914
NM_002612chr772094 2086 2066 1581 684 470 249 ----11755
NM_002613chr1665203 5060 5002 4714 3712 434 ----25268 5085
NM_002655chr8114566 4430 3727 3678 2035 1897 1664 1464 1325 1118 814 44553 3761 3747 1904 23299 2109 14363
NM_002709chr253451 3320 3171 3029 2383 42431 1141 1042 60 1692 --
NM_002710chr124952 724 396 262 41120 938 302 49 11042 1833
NM_002734chr1742233 1752 1458 633 11883 21437 127 --
NM_002740chr362680 2549 1837 1042 442 92 12368 22474 1902 --
NM_002745chr22123788 3704 3611 3586 3536 3354 3224 3116 1648 932 741 163 21032 634 23320 3151 11591
NM_002760chrY76032 5253 4577 4483 705 583 533 15608 45951 5166 1707 1512 --
NM_002822chr1281837 1578 1421 1224 1141 545 527 107 --21784 283 --
NM_002834chr1274119 3736 2844 2790 761 370 261 --13859 --
NM_002838chr171141 1117 963 456 379 133 86 --1185 1793
NM_002841chr32655 575 ----2261 89
NM_002843chr11103368 3151 3084 1178 715 600 576 536 341 86 11266 13375 --
NM_002844chr64974 452 233 69 3498 488 480 1278 --
NM_002906chr1162113 1869 1484 881 595 335 ----12351
NM_002959chr164402 3905 3881 3875 3787 1372 13890 23861 1040 --
NM_003042chr332096 2079 1482 22281 2060 --21924 458
NM_003071chr351865 439 341 158 120 21923 451 31980 1843 207 --
NM_003071chr351865 439 341 158 120 21923 451 31980 1843 207 --
NM_003099chr15106358 5586 4460 1951 1936 1823 1550 1519 1381 181 22509 279 66452 2539 1625 1594 827 49 16441
NM_003108chr297224 6532 5867 5718 5081 4946 4706 859 680 1731 36578 1186 980 --
NM_003112chr762295 2277 955 865 818 620 11174 33100 2254 266 32328 1972 1273
NM_003161chr1732611 1148 528 12510 23081 2707 1521
NM_003205chr1522026 686 12326 --11924
NM_003215chr41569 2592 585 31153 601 108 --
NM_003257chr155915 549 494 433 80 1464 31019 950 419 --
NM_003262chr385273 2086 1242 970 733 612 473 141 11631 33957 1177 388 --
NM_003298chr3146241 6138 6084 4126 4105 4088 4079 4063 4052 4019 1921 1511 862 358 1367 46170 6002 5496 3928 --
NM_003304chr341565 638 168 90 11240 31476 1452 1199 --
NM_003336chrX61128 999 986 335 292 44 --11072 1322
NM_003337chr551571 1535 1059 532 283 11161 1381 11297
NM_003342chr1753113 325 305 290 262 ----31220 1030 109
NM_003392chr374347 4282 3790 3098 2701 1433 1319 24293 1452 33448 2789 1422 --
NM_003410chrX113096 2913 2586 2110 1964 877 358 287 272 155 105 1114 2918 863 --
NM_003411chrY61692 1411 1340 680 100 89 --11835 --
NM_003412chr382318 2235 1198 951 595 541 415 59 1859 ----
NM_003413chrX71727 1457 1312 1253 707 568 107 --21950 1499 --
NM_003454chr1641409 1337 261 250 --21460 1231 --
NM_003463chr673158 2362 2261 2215 1160 1052 533 --33371 662 60 22269 2070
NM_003468chr274234 3795 3782 2786 1512 409 251 13100 13802 --
NM_003471chr352237 1981 908 334 247 11467 1562 2698 263
NM_003472chr63537 63 55 31359 610 484 2383 254 1274
NM_003478chr1173281 2148 1146 1140 896 739 280 33253 3208 2184 21154 879 --
NM_003489chr2183389 2913 2711 2669 2514 620 233 155 22701 2102 22678 2486 --
NM_003505chr721900 1779 11845 21838 1358 11892
NM_003506chr85884 539 418 126 60 --2940 397 11084
NM_003566chr1273479 2372 2316 2106 508 442 386 22474 377 33227 2728 469 --
NM_003583chr1263746 3608 3214 3100 362 201 --33854 3566 1526 --
NM_003590chr273404 3275 2804 969 887 835 757 1514 13948 1737
NM_003615chr3143908 3321 3263 3153 3145 2829 2735 2449 1548 1239 1212 783 350 36 173 21335 24 33775 1081 722
NM_003617chr195029 5019 4053 3581 3397 3287 1189 765 665 --14465 1624
NM_003618chr261227 1210 1155 860 473 336 2316 81 21309 226 --
NM_003622chr1251821 698 515 394 249 177 1493 --
NM_003626chr1141326 301 209 116 --3383 240 45 11256
NM_003670chr321378 1231 ----11239
NM_003672chr151855 1773 552 316 305 21840 380 21330 331 --
NM_003677chr12161467 1450 248 242 228 222 206 200 174 166 146 136 128 106 98 80 1309 ----
NM_003722chr372595 2011 1750 680 551 354 334 1339 12627 12567
NM_003749chr1352332 2321 2027 1946 714 32437 2188 2049 22143 1701 --
NM_003774chr1242656 2480 2458 697 12158 11255 1226
NM_003794chr341058 909 247 89 1102 --11105
NM_003895chr21122184 2087 1910 1875 1629 1417 871 568 508 471 259 140 1478 --11359
NM_003913chr674183 3748 3488 3269 3032 1257 384 178 1808 --
NM_003930chr732520 2241 218 12268 42481 1652 300 137 --
NM_003941chr742374 1991 705 21 22073 875 --11808
NM_003972chr1061282 1171 1163 998 934 922 21251 1092 3900 543 324 --
NM_004064chr1251104 1074 260 246 73 11151 --1216
NM_004093chr1363112 2877 2285 2272 2255 2247 12026 12292 --
NM_004171chr11159658 8822 8814 8303 8270 8060 8019 7291 7185 6959 3012 2962 2928 2424 1591 57765 6663 2700 2582 1296 59601 9272 3019 745 438 --
NM_004172chr521668 519 21710 181 21729 1243 1319
NM_004229chrX52051 2023 755 419 276 21763 563 --12251
NM_004232chr1863756 2525 1347 1242 1057 481 --22844 329 --
NM_004316chr121932 --21022 734 21156 777
NM_004330chr157758 750 415 356 324 238 231 1424 --2267 149
NM_004392chr1362471 1903 1727 849 807 281 52533 2404 815 716 226 12271 12522
NM_004432chr952411 2381 2137 1864 1793 143 42315 1879 72 29 --
NM_004438chr273257 2704 2485 2100 1287 1144 620 23337 3035 --12284
NM_004449chr21--21151 517 31383 1206 1198 21190 1179
NM_004459chr1772039 1928 1823 1691 1618 575 149 21921 1536 21667 1411 --
NM_004464chr4123885 3720 3180 3106 2924 2850 2687 1708 1701 506 247 190 23201 1656 ----
NM_004501chr163308 2970 1520 1386 934 318 --21378 166 11111
NM_004504chr252092 1197 888 287 273 12084 22562 524 --
NM_004540chr211131 1666 2709 123 1739
NM_004586chrX125210 5143 5013 4964 3941 2065 1833 937 661 511 477 416 11957 15127 15467
NM_004612chr964379 4115 4016 4010 3145 635 13907 11799 13626
NM_004626chr112588 580 2593 573 2568 559 --
NM_004655chr1791404 1308 1270 1248 1085 1075 1069 1044 523 --11321 --
NM_004745chr866381 5696 2150 1824 1123 909 57016 6452 6386 6374 1300 36931 6881 2673 12256
NM_004775chr1891995 1937 1685 882 556 415 342 280 151 --22126 733 --
NM_004824chr641313 1272 1042 228 31416 1407 1085 21256 235 --
NM_004842chr641742 500 347 282 1452 21770 1403 1658
NM_004850chr291433 1385 1371 694 612 580 472 448 438 31633 455 237 1538 11466
NM_004852chr182214003 12584 11834 11577 11454 11267 11161 10661 10372 10352 10003 9648 9604 5600 3993 3979 3426 2891 2643 1981 521 146 511309 9168 3972 2631 2624 410306 10203 9915 913 --
NM_004866chr5134961 4657 4038 3691 3186 1973 1899 1875 1510 1226 757 614 418 --23439 988 23955 751
NM_004888chr92965 234 --2785 168 1120
NM_004897chr104798 785 683 98 ----1275
NM_004921chr162236 2229 1990 653 480 213 --22334 2015 12411
NM_004932chr551620 718 684 356 63 ----21424 1132
NM_004956chr774542 4492 4486 4396 4125 1042 948 21084 472 34258 1275 592 13816
NM_004985chr1284339 3851 3606 2904 2854 1767 1646 595 13716 24311 56 --
NM_004992chrX108482 8446 7112 5562 5336 2764 2460 2137 2076 1110 --15482 18534
NM_005065chr14145213 5107 4910 4667 4493 4000 3986 3385 2018 1504 1429 1145 1099 792 --24367 1582 1712
NM_005121chr17133793 3306 2837 2797 2559 2358 1222 907 900 748 661 522 480 1846 1809 33762 2743 2693
NM_005126chr382163 2155 2143 2135 1867 812 67 41 ----11609
NM_005156chr965281 4158 3336 992 482 366 --1533 25091 345
NM_005171chr1251303 1269 1255 1187 1136 1478 21097 393 --
NM_005188chr11128102 7404 6027 2582 2226 1858 1560 1205 1166 558 510 258 37839 5961 5833 37118 6505 3150 --
NM_005204chr106867 834 625 619 186 83 --1700 1929
NM_005233chr372590 2434 2229 2148 1902 677 462 21840 940 22303 399 22538 1662
NM_005238chr1183317 3273 3167 3152 3146 2731 2465 1088 23159 3084 33530 2710 714 1781
NM_005259chr271528 1471 1175 1159 1091 450 263 3965 513 161 1412 1954
NM_005277chr451653 1612 775 632 386 --41868 1557 449 333 11471
NM_005284chr63203 195 186 --1493 --
NM_005316chr1181158 806 429 288 282 270 242 152 ------
NM_005339chr421307 456 43761 2951 2832 2723 54255 3017 1293 1172 1071 11710
NM_005385chr352750 2693 1697 197 23 --42667 794 448 425 --
NM_005392chr921774 1466 --31908 1497 1473 11699
NM_005399chr184389 3425 3224 2739 1131 526 320 212 24017 3328 14452 --
NM_005400chr21250 --22960 1090 21143 1035
NM_005433chr1831935 901 21 2779 509 --12380
NM_005436chr1021237 367 11093 33728 1492 1284 12752
NM_005504chr1266213 5880 2171 1453 851 294 24884 4771 16611 --
NM_005509chr571826 1769 1573 645 587 114 64 21352 23 2415 361 --
NM_005578chr394914 4418 3905 3560 1536 1468 1263 497 249 15123 ----
NM_005585chr153169 163 152 1334 2325 146 --
NM_005587chr156863 817 130 112 97 23 2855 335 --1905
NM_005596chr9116356 5861 5084 4651 4358 4262 2055 2049 1673 1623 896 26425 1165 35560 5504 3983 36159 1848 1839
NM_005599chr141014 985 553 399 --11069 11480
NM_005611chr1621309 1093 --1845 11055
NM_005665chr194523 3642 3238 1563 1398 1089 384 96 90 1902 11045 14475
NM_005668chr5114088 4071 4047 3985 3661 3633 3216 1816 1753 637 27 34018 3781 2995 34027 3962 1428 --
NM_005669chr54539 447 171 62 31826 627 400 1301 1410
NM_005725chr1122473 2330 2308 2290 2276 2256 2230 2209 2172 2142 2125 1752 22264 2220 41679 539 244 125 2777 288
NM_005739chr1532425 2371 1478 12092 1780 11925
NM_005746chr7102477 2432 2416 996 845 782 752 708 677 354 --3688 293 54 2552 375
NM_005748chr1262802 2796 1277 1110 410 61 1418 1250 12877
NM_005786chr1841018 1005 968 151 11037 21228 1199 --
NM_005795chr262832 2669 2343 2197 1925 642 21003 694 --22024 858
NM_005813chr272411 2043 1869 1668 809 667 397 22360 330 1319 1416
NM_005859chr541314 610 586 288 11346 1366 1435
NM_005930chr143607 359 308 --1256 1234
NM_005935chr4114781 4626 4400 4285 3679 3438 2025 1555 1302 1101 913 24118 3421 44974 4797 4775 188 --
NM_005941chr853086 2756 1388 763 75 23483 3036 33288 2774 721 --
NM_005955chr165467 4732 4068 3647 3637 1300 24451 3864 13837 --
NM_005966chr262179 2160 1678 1635 937 255 21568 307 ----
NM_005977chr1341012 858 851 377 1729 1111 2998 168
NM_006033chr1852127 1986 1866 1610 745 32296 2287 2233 32205 1778 1471 11965
NM_006037chr2134539 4301 3881 3708 3700 3631 3617 3179 1719 1425 1239 1151 1136 34503 3610 1250 11667 --
NM_006047chr2083231 2992 2325 2162 1349 986 499 313 12927 ----
NM_006080chr792466 2175 1966 1201 877 836 673 273 76 --12305 --
NM_006085chr131045 457 444 --21165 1060 --
NM_006106chr1173329 3293 2537 2288 1065 1037 473 --22296 927 --
NM_006153chr34504 408 174 163 ----1626
NM_006154chr1542868 1103 1001 665 12164 1540 22025 925
NM_006197chr842274 1876 345 332 12286 12166 2741 366
NM_006206chr472944 2783 2716 2657 2643 785 328 22963 2579 22629 2245 --
NM_006251chr5132788 2700 2333 1357 1325 1295 1070 952 287 277 229 217 170 23337 2149 41319 896 345 87 23011 2719
NM_006252chr1137064 6678 6468 5700 5241 4689 2520 2099 1313 1185 417 406 48 --27391 3042 26952 549
NM_006254chr33365 301 279 1288 ----
NM_006256chr192342 2246 2116 2010 1704 953 780 608 186 1520 21093 1040 --
NM_006283chr894928 4900 4876 4715 4249 1995 1674 1478 1462 14526 --24242 3282
NM_006301chr122258 64 --250 23 142
NM_006315chr494414 3980 3875 3849 3501 3283 2918 2832 2806 11818 --1503
NM_006352chr152096 2043 411 60 26 145 ----
NM_006364chr1461262 1230 1165 976 850 474 ----1959
NM_006393chr1073815 1626 1619 1391 643 615 520 23710 3444 24381 3694 14550
NM_006415chr951066 811 467 307 294 --21213 1037 --
NM_006420chr2063293 2848 2788 2519 2208 1293 22710 2411 --13389
NM_006520chrX61615 1567 470 303 273 191 21163 1054 ----
NM_006526chr2092183 2006 1947 1859 1621 1578 195 129 123 1384 --11466
NM_006544chr14115750 5327 4838 3989 3889 3752 2249 2047 1625 346 56 36107 4685 2170 45985 3938 1732 1233 --
NM_006572chr1763244 3199 2676 2263 1132 553 12476 23256 2339 13346
NM_006599chr16187626 7081 6844 6628 6528 6109 6016 5966 5942 5554 5441 5009 2998 2388 2004 1930 1617 208 36128 2057 1549 56424 5815 2042 1352 852 47049 5786 5248 3077
NM_006609chr22517 183 12750 --12679
NM_006614chr3133619 3473 3414 3231 3194 2604 2341 1192 617 505 381 369 206 13058 63658 3004 2701 1380 984 898 2861 757
NM_006628chr1584659 4473 3605 3330 1013 680 242 151 ----21257 1065
NM_006682chr742239 2105 192 129 52670 2028 2013 1754 827 1242 11970
NM_006714chr62262 251 ----2288 245
NM_006717chr963322 2152 1020 455 435 422 2918 429 --13281
NM_006729chrX105675 5010 1620 1317 1284 1193 1121 821 781 461 24910 435 53918 2089 1559 750 492 1770
NM_006734chr671546 588 458 430 399 265 138 11628 5636 510 298 232 124 --
NM_006750chr16118102 8084 6507 5079 5073 2855 2512 2361 1775 1475 1372 28073 7532 38068 8032 6713 --
NM_006754chr741186 483 378 334 --31145 1030 396 --
NM_006775chr693123 2920 2802 2341 2238 996 969 870 580 22117 942 --12815
NM_006777chrX32699 2410 673 --21160 213 12865
NM_006823chr841311 880 564 511 --11167 1505
NM_006827chr1473276 3104 2173 1190 788 527 32 1675 23347 994 12302
NM_006888chr1482925 2896 2603 1413 964 553 238 118 --22885 2617 --
NM_006902chr193314 3289 2946 2533 2081 1146 1115 876 520 21153 907 42356 1131 1123 1102 12956
NM_006914chr931160 608 165 3484 315 222 2520 503 11436
NM_006915chrX92532 2513 2458 2441 1697 882 508 469 455 1743 1528 22092 486
NM_006948chr2192449 2436 2053 1834 895 712 688 318 305 --12232 21750 534
NM_006956chr732386 903 240 --32368 1782 81 12380
NM_006981chr91214 22279 2187 32979 2729 1967 11830
NM_006988chr2121216 1067 --11182 11257
NM_007006chr1663498 3490 3333 2553 841 58 --13064 22407 233
NM_007007chr1254376 3808 3662 1040 362 --23853 270 12996
NM_007030chr544842 4127 4120 4094 14412 24878 3534 --
NM_007034chr15720 712 397 330 252 --2986 832 1700
NM_007038chr21114338 4112 4064 2126 1462 1304 1267 951 890 450 420 45821 5765 5424 1911 25452 22 --
NM_007054chr5133964 3945 3792 3711 3135 2573 1478 1155 722 599 450 237 218 23164 2963 1431 1193
NM_007106chr1332490 2333 1898 1439 42294 2160 984 434 12254
NM_007114chr353137 2623 2089 697 474 1337 22857 371 --
NM_007124chr621646 301 21824 230 1606 21576 775
NM_007125chrY4938 921 904 893 3957 545 111 11186 11327
NM_007159chr361598 1425 1411 1128 467 457 ----1152
NM_007195chr1873677 3559 3456 3013 2955 515 226 --23367 305 1970
NM_007249chr1389340 6086 3773 3728 3371 2184 1558 1194 36490 5982 2193 48995 8634 3067 296 23643 3620
NM_007347chr1573017 2399 2132 2066 1030 978 126 --41062 721 261 198 --
NM_012081chr573623 3080 3046 2951 2369 661 571 11097 11062 --
NM_012092chr251636 1603 736 726 524 1753 21594 718 --
NM_012096chr383697 3650 3406 2819 1466 1338 1042 109 33573 3490 1345 23768 448 --
NM_012129chr762446 1635 1616 208 174 125 2783 336 22440 1719 --
NM_012156chr2052138 921 180 164 152 ----1326
NM_012158chr1361829 1202 1176 707 354 344 1541 1258 31771 1757 1636
NM_012214chr2106205 6171 5315 4768 3994 950 852 428 264 248 35442 421 413 35417 408 284 --
NM_012234chr393611 2797 2313 713 637 477 446 310 217 23183 484 1499 13426
NM_012238chr1021637 692 1309 31747 1643 1410 1184
NM_012259chr631353 1124 370 31424 1113 437 21283 931 11345
NM_012262chr175194 5036 4969 4739 4691 3195 254 35153 3811 2050 1415 14338
NM_012281chr772415 1961 1934 1796 1642 1492 795 --1200 1757
NM_012287chr3154500 3284 3028 1755 1596 1166 1092 1082 1066 1007 895 836 640 581 52 21648 960 44272 3197 1057 679 --
NM_012294chr763984 3932 3921 3579 3169 778 23926 669 --14024
NM_012297chr462539 2120 1971 1711 838 616 12135 2940 460 11747
NM_012300chr562401 2109 783 636 584 363 --32493 2376 730 --
NM_012316chr183865 3578 3433 2142 1659 1180 1172 538 --25580 4508 --
NM_012330chr1031518 1211 154 1499 --2235 172
NM_012347chr672968 2871 2337 2310 808 102 48 12048 12877 --
NM_012395chr773296 3049 2931 2854 2480 2103 345 --22962 632 12909
NM_012464chr462962 2936 2778 1810 511 143 12332 --22279 97
NM_013231chr1444382 2993 894 264 1154 34083 1273 141 1275
NM_013255chr7128846 7960 7688 7272 7191 7169 6423 3278 3048 2905 2684 243 43057 1650 1068 690 48895 8137 2463 992 --
NM_013261chr463527 1155 1119 697 630 498 31127 531 121 31487 1281 1245 --
NM_013281chr2051292 1089 251 143 124 --1945 11163
NM_013381chr1272327 710 687 673 644 278 264 1736 2722 463 1445
NM_013449chr1232503 1911 1892 --11898 12465
NM_013995chrX82412 2271 1907 1855 1835 1679 845 402 1731 12367 --
NM_014034chr661323 1249 1148 943 267 246 11474 11222 --
NM_014048chr1685209 5182 4451 3634 2131 772 628 316 --35241 1237 813 --
NM_014112chr884576 3777 1875 1789 1356 1120 648 374 21568 1328 --15456
NM_014155chr11137572 7311 7295 7145 6638 6273 6005 5044 2984 2332 2304 2056 693 17063 37087 1158 330 15981
NM_014181chr251808 1059 541 208 183 ----1890
NM_014232chr17--31685 332 168 2177 161 --
NM_014243chr462130 2108 2048 2036 1651 740 ----21724 1490
NM_014271chrX2853 227 2874 858 2839 140 --
NM_014294chr871451 1440 1196 1065 994 904 122 ------
NM_014319chr1271827 747 725 713 687 578 394 31626 1619 1303 21837 1808 11346
NM_014331chr4227752 7743 7113 6574 6537 5399 5261 4991 4932 3085 2821 2814 2764 2366 2027 1899 1689 1056 865 551 360 206 --67800 2845 2715 1732 1641 1048 47301 5094 2758 2730
NM_014363chr1341299 991 794 516 --1823 41267 1145 1105 274
NM_014395chr431916 1252 450 --11404 1518
NM_014421chr431929 804 236 11917 --3440 368 213
NM_014423chr565436 4078 3509 1886 1091 678 35071 3485 1928 105398 5270 5189 5024 4800 4030 3837 3526 3440 423 15603
NM_014456chr102626 42 --11285 21864 366
NM_014458chr131389 365 26 1445 169 21055 904
NM_014554chr1261757 1418 935 923 573 435 22109 585 22031 605 11482
NM_014584chr1461483 1449 1338 1150 546 135 --11572 1108
NM_014606chr441508 1497 471 61 1613 --21555 1351
NM_014616chr353498 616 457 413 308 23525 690 23462 920 1985
NM_014630chr1563583 3517 3381 3023 794 114 13416 23612 3549 --
NM_014666chr541312 1041 489 352 1997 21332 963 --
NM_014673chr82259 251 1264 2226 95 --
NM_014682chr862325 2229 2123 1891 1485 257 1921 21977 1683 --
NM_014683chr1742122 1438 863 684 11567 --11801
NM_014686chr1942601 2147 1971 1743 ----1588
NM_014701chr1572843 2207 2181 1161 858 102 62 --32784 2424 751 --
NM_014702chr6103171 3085 2891 2825 2484 1374 1094 456 443 407 21305 244 2732 559 --
NM_014705chr761818 1806 1709 1553 1369 263 21459 787 21589 290 --
NM_014711chr1652074 1454 779 648 248 1229 12009 --
NM_014720chr1051835 1790 1665 1655 1394 11724 --11648
NM_014755chr2114281 4246 4057 3222 1607 1517 1047 713 687 553 395 54157 3883 3719 3276 674 33767 613 562 14288
NM_014774chr162610 2232 2188 2100 355 330 1149 --13096
NM_014784chr151040 1024 1014 994 308 31052 1045 1033 ----
NM_014795chr251053 1030 995 354 271 --1209 1197
NM_014819chr541916 1748 791 106 --181 1918
NM_014829chr552335 1627 1605 1588 794 1808 1786 1573
NM_014877chr17137555 7082 6921 6819 6745 2802 2771 2287 2257 2251 2085 1353 873 37384 2822 437 57428 6843 2792 1180 1012 24871 2305
NM_014897chr1782988 2934 2849 2438 2274 1298 371 325 13175 32861 2352 2207 12105
NM_014901chr532199 2058 1961 21948 1504 22161 1941 11749
NM_014903chr1272238 2230 1617 1575 946 723 217 --22246 1978 --
NM_014904chr1093941 2621 1270 957 722 529 480 470 450 33597 2882 504 33001 1165 458 24038 1281
NM_014912chr1083142 2966 2772 2258 1408 905 676 270 1958 32495 1196 1175 --
NM_014920chr6103371 3301 3295 3090 2582 2387 748 735 607 266 23145 2709 1292 23464 614
NM_014932chr361412 1405 632 360 165 122 1170 11686 11649
NM_014936chr652628 2237 1950 1103 472 22567 823 22057 390 1423
NM_014945chr541692 250 164 22 ----135
NM_014946chr273055 2939 2905 2849 2087 1993 1154 1175 11058 12948
NM_014951chr1032124 1866 312 11728 12579 11637
NM_014953chr1394199 4135 3411 3323 2784 1686 1425 777 766 33758 1701 1363 23705 206 --
NM_014982chr14135041 4759 4745 4726 4701 4371 3871 3818 2089 1102 783 482 294 15101 34736 1406 614 24449 1916
NM_015000chr1252554 1079 722 513 228 --22663 2404 1762
NM_015025chr292576 2191 2037 1934 1891 1732 262 201 118 22299 1948 12385 12674
NM_015026chr1294535 3656 3136 2985 1873 935 897 299 254 --14086 23944 429
NM_015035chr2032023 1240 324 --21997 1977 16672
NM_015042chr1583956 3699 3501 3458 2859 1385 1376 1103 23510 3494 43535 3485 2853 1143 --
NM_015049chr242692 1010 489 56 --1944 2712 30
NM_015055chr1152930 2684 2607 1080 337 --12767 12864
NM_015071chr545817 5401 4176 1730 --24260 2464 1552
NM_015076chr684526 4325 3983 3480 1642 1169 654 414 23755 1537 54204 3740 942 815 134 14046
NM_015087chr13102581 2416 2126 2106 1728 888 361 325 211 24 32706 2569 827 12140 --
NM_015100chr131937 1410 120 --1520 1567
NM_015130chr42945 322 --11279 11064
NM_015143chr461255 497 437 419 411 47 --1397 --
NM_015149chr142011 1965 287 266 2312 302 11992 --
NM_015172chr151433 1415 1109 270 201 31440 212 130 31579 1521 258 11408
NM_015192chr2072897 2668 2308 1909 1188 1044 1012 22965 2316 1693 --
NM_015199chr362994 2454 1938 1895 1861 704 --12808 --
NM_015205chr13145205 4861 4846 4587 3819 3682 3547 3440 3386 3327 3281 3231 3189 2116 13405 14816 --
NM_015206chr1563733 3624 3494 3077 2841 158 23846 3167 21416 358 13778
NM_015271chr473939 3825 3185 1696 1184 1126 95 --34027 1156 408 --
NM_015272chr1651881 1535 563 454 257 2725 93 31820 743 544 --
NM_015310chr8178225 7730 7624 7606 7573 6494 6309 6084 5520 5448 2550 2192 2157 2038 439 430 156 28404 8138 --16355
NM_015313chr11134740 4630 4278 4009 3466 3351 3082 1808 1486 1449 564 491 307 24283 1881 1904 --
NM_015323chr611158 185 21332 400 11131
NM_015328chr782988 2980 2964 2954 2929 2765 1928 1916 167 --1513
NM_015335chr1262646 2624 2406 2169 1661 1029 22215 365 42479 2071 945 886 --
NM_015435chr821061 477 2511 36 --2524 310
NM_015446chr141159 322 193 25 --31680 431 215 195
NM_015455chr5134067 4012 3692 3474 3174 2840 1659 1501 1009 833 649 495 197 13234 13699 --
NM_015458chr845044 4246 3762 915 31341 778 702 --24928 4648
NM_015534chr151133 1059 997 870 360 1720 --1698
NM_015541chr341387 469 243 99 21351 184 1216 1301
NM_015550chr763309 3102 677 604 338 196 22862 669 2230 79 1594
NM_015554chr1552794 1167 392 268 39 32888 2741 988 42838 2722 2709 2541 1639
NM_015564chr533031 1288 814 --31405 733 269 11169
NM_015569chr1164647 4561 4555 4543 4228 4192 3670 3293 3249 3099 1613 814 793 223 216 42 43419 3254 3083 660 14065 --
NM_015678chr1371429 1247 1190 1161 225 211 137 21737 1639 31176 433 109 --
NM_015691chrX62924 273 263 155 149 109 --1540 --
NM_015878chr842143 1861 1636 345 1260 --11710
NM_015886chr8135674 5345 5136 4906 4747 3764 920 747 356 350 321 293 56 55681 5498 4957 4890 4772 51724 1022 479 380 91 25545 652
NM_015888chr193398 3143 3118 2270 822 766 662 420 68 2488 459 22579 235 12416
NM_015898chr194973 146 128 108 22036 984 1963 --
NM_015906chr164377 3925 3755 839 756 552 34145 3389 346 14059 11734
NM_016076chr173140 3033 2201 1127 996 934 142 197 12691 1256
NM_016081chr492137 1971 1938 1852 1807 738 598 397 100 ----11719
NM_016083chr652426 1525 1518 1062 86 23771 2475 --12569
NM_016087chr791363 1279 1247 1157 1121 487 316 254 225 143 11546 --
NM_016138chr163301 89 76 --1274 199
NM_016195chr104753 321 286 84 1674 2127 91 --
NM_016206chr3197723 6150 5999 5802 5707 5692 5656 3403 2839 2428 1939 1874 1817 1806 1774 1305 716 561 273 28856 1178 48178 6224 1337 917 38483 5942 3576
NM_016224chr652102 1669 1557 784 322 11581 --1349
NM_016231chr1741234 1093 688 89 11282 --21695 1136
NM_016248chr1393811 3573 3423 2954 2625 2571 2541 218 165 ----12827
NM_016271chr185937 917 893 261 29 --1353 1535
NM_016275chr362425 2222 798 716 400 138 --1514 --
NM_016315chr291659 1630 1483 1442 1434 1407 1204 647 47 ----21401 268
NM_016353chr852367 2310 1746 1562 1003 12110 12165 22176 1930
NM_016374chr131537 106 62 --21465 1231 21581 434
NM_016396chr15112935 2870 2712 2070 1993 1957 1092 1032 696 254 102 1785 2586 521 --
NM_016467chr221150 1044 1427 --1506
NM_016531chr4123806 3743 3727 3709 3703 3482 3172 3090 2999 436 134 93 13737 33750 2559 1106 --
NM_016617chr1342219 880 455 350 --1706 1550
NM_016620chr171409 1338 1076 965 582 397 174 11282 1183 --
NM_016631chr216937 896 331 322 122 63 2825 636 21007 316 --
NM_016644chr55533 347 176 164 149 ----1507
NM_017420chr14143859 3778 3631 3052 3042 2927 2665 2413 2385 1132 480 340 166 117 12396 53866 3585 3096 2376 1230 --
NM_017594chr943284 3243 3214 2611 33187 2900 2891 32944 1139 767 --
NM_017633chr6113596 3514 2670 1374 1272 1079 1072 1047 1032 813 793 --11060 12790
NM_017637chr9169465 9071 8409 8106 6947 6561 6201 5696 3631 2535 2517 2436 2135 627 391 146 26697 3259 38170 5812 1155 29456 2814
NM_017643chr1762892 2686 2154 1045 654 73 53093 2986 2909 1092 481 1580 22795 2403
NM_017644chr364676 4330 3611 3344 1931 1900 34827 1325 100 24417 762 --
NM_017645chr963198 2454 2430 2303 775 732 32685 2183 432 23094 2386 --
NM_017650chr7115600 5552 5359 5142 4936 4202 2240 2186 1732 1351 1218 14725 45813 5629 5391 5018 --
NM_017658chr14134439 4197 3735 3683 1784 1701 1621 1215 1111 992 673 302 43 --54203 3541 1256 1244 864 --
NM_017742chr18121931 1844 1802 1557 1539 1424 629 594 213 142 116 97 ----11958
NM_017745chrX5720 627 610 555 23 ----1123
NM_017752chrX72105 1887 1719 1672 417 274 123 21751 290 32113 1765 1687 --
NM_017769chr14123296 3201 3184 2758 2618 2375 2351 1306 1277 589 558 497 --42915 2732 2067 1037 42560 1075 610 459
NM_017813chr8105206 5107 4473 4389 4104 3799 1001 691 256 89 1496 35481 4758 4639 --
NM_017848chrX113750 3658 1060 1042 1030 989 944 926 659 531 402 --21000 629 1964
NM_017919chr975599 5050 4905 3871 3852 1692 1110 24032 215 13956 --
NM_017946chr731107 1034 1028 --1115 181
NM_017953chr161198 1147 1109 1013 855 814 --11127 --
NM_018157chr1283184 1205 1195 1171 1157 572 532 88 13191 22159 885 --
NM_018181chr1871962 1346 1300 303 226 203 153 --11419 --
NM_018254chr162110 1756 908 334 282 48 --1519 22273 640
NM_018293chr362975 2969 2793 2620 1120 282 --42186 2120 1903 535 12602
NM_018328chr23325 89 64 2439 388 1372 1424
NM_018351chr1244697 4658 3137 3063 ----24751 1891
NM_018364chr163395 3353 2981 2923 1270 1189 13248 11612 21476 169
NM_018374chr7105050 4874 4804 3750 3421 1837 1797 1242 464 190 1724 24578 757 45002 4820 4379 3741
NM_018439chr1892603 2560 2529 2520 2382 2348 620 387 152 --32546 1684 43 --
NM_018440chr875822 3257 2748 2500 1487 1340 1161 48633 8344 8229 1151 16873 13149
NM_018444chr892341 2204 2095 1848 1722 470 457 409 39 ----12229
NM_018482chr83646 485 82 11635 32281 2274 864 1690
NM_018490chr1141870 1376 504 314 11825 31557 1525 668 --
NM_018557chr271491 694 673 500 337 319 76 11270 21596 377 21447 1297
NM_018566chr133513 605 209 23900 3391 34434 2027 1261 13763
NM_018638chr1285663 4124 3944 3705 2169 1957 1089 127 35223 1460 1423 64974 4390 3981 3772 3744 1143 23510 1107
NM_018700chr531379 379 268 --11282 21611 1563
NM_018836chr151106 1092 1076 1042 992 --1978 --
NM_018841chr1133293 3148 3003 2958 2683 2571 2421 2412 2406 554 481 461 398 1435 33614 2797 292 21579 614
NM_018847chr92631 294 --11479 21967 250
NM_018898chr552258 1956 1542 766 671 11933 11555 1847
NM_018945chr673602 787 774 714 634 533 173 --1541 12442
NM_018947chr763940 3810 3637 1101 810 326 14559 --1340
NM_018999chr1061742 1651 1438 889 321 233 11228 23918 1386 --
NM_019022chr1893069 2623 2093 2079 2017 1269 939 586 421 --32984 810 521 --
NM_019067chrX64477 4122 3631 3573 3381 1165 14683 14464 13372
NM_019080chr1351505 1320 1071 215 33 11142 --1480
NM_019117chrX73472 3436 2161 1360 1021 992 720 21059 732 12616 21348 1157
NM_019593chr2073109 2565 1108 1091 488 401 392 2315 256 2975 783 --
NM_020116chr461573 1396 645 257 180 94 11495 ----
NM_020177chr552983 2632 578 534 326 11117 12045 2477 352
NM_020182chr2013200 2414 404 32384 846 399 23635 600
NM_020337chr443085 2929 2196 355 22813 555 --22280 1213
NM_020342chr2112384 2325 2053 2028 1901 1649 1044 600 325 74 66 12040 11715 12285
NM_020353chr361866 1816 1637 1511 778 685 22061 255 4820 805 631 532 11899
NM_020390chr384332 4146 3781 3219 3104 1412 1372 597 1845 34778 1841 434 --
NM_020432chr771808 811 754 538 416 195 148 ----1551
NM_020452chr132134 1996 1940 --12010 11989
NM_020456chr134675 462 283 273 --32271 836 433 --
NM_020640chr392306 1854 1846 1836 1475 814 424 252 27 139 2790 715 11549
NM_020661chr1242079 1790 1783 369 --21734 137 1611
NM_020699chr134705 1549 342 54071 4058 3508 2117 1304 23542 2106 14101
NM_020718chr16116571 6518 6495 6282 4598 4514 1593 1316 1110 578 94 24262 1544 36564 6352 290 --
NM_020728chr751162 811 799 716 416 --2321 113 11198
NM_020734chr1263363 3200 2705 2395 1357 915 1678 42843 2462 1058 454 1340
NM_020742chrX52707 2348 1016 761 633 22064 754 ----
NM_020747chr55931 876 224 214 202 2652 233 2188 58 --
NM_020752chr1052951 2576 2305 808 483 1387 32224 1999 759 32607 834 611
NM_020772chr17158673 7998 7187 6437 6356 6106 5737 5331 2667 2405 1797 1164 155 141 75 42034 1810 827 134 26538 1788 26818 1488
NM_020774chr18126139 5660 5556 4726 4169 4120 4064 2326 1708 1365 1328 941 24507 4090 24837 792 25016 3889
NM_020791chr173948 267 261 --1294 11020
NM_020792chr351996 1066 991 727 695 22544 1788 22650 2047 12624
NM_020794chr12622 601 1461 2387 64 11426
NM_020802chr1163317 3303 3238 2279 682 221 33310 2243 569 ----
NM_020805chr1821627 1558 31565 778 559 11917 11750
NM_020850chr1633287 3011 465 1456 22608 445 --
NM_020854chr1831116 276 62 --1337 1269
NM_020909chr264118 4034 2977 1437 1182 1059 21419 1153 24156 2817 12893
NM_020918chr1083619 3259 3043 1432 1181 1165 1068 559 ----13518
NM_020921chr1443664 3559 2708 2340 --22512 998 13248
NM_020935chr293863 3729 3623 3443 3337 3154 1437 289 269 13759 24634 752 --
NM_020940chr10142839 2810 2588 2580 2572 2351 2170 2104 1967 1144 1093 337 214 44 22593 219 12554 --
NM_020951chr19162450 1496 890 865 851 842 833 790 757 721 693 668 651 636 597 170 ------
NM_021033chr1322593 2199 23008 2455 21399 219 42832 2724 1188 318
NM_021038chr393328 2461 2401 1255 896 680 327 204 90 32071 914 901 3950 293 213 --
NM_021072chr572495 2458 2371 1829 228 176 154 32638 2628 2185 32349 2314 2180 1912
NM_021079chr171326 2381 346 1339 --
NM_021101chr372462 1559 1009 933 453 304 290 ------
NM_021111chr971405 1254 1217 1174 1091 986 876 --11055 --
NM_021140chrX61098 976 958 881 299 241 2952 119 3931 920 807 --
NM_021148chr7102491 2389 2245 2120 2044 1743 1684 415 358 123 31853 1775 56 21966 348 1563
NM_021180chr13688 671 617 2678 657 1648 --
NM_021205chr172875 2428 2170 2096 420 343 277 --12298 1202
NM_021229chr1281248 1217 1124 1109 1016 939 903 495 21136 42 ----
NM_021252chr1071802 1731 1682 1555 1383 671 114 41631 1489 1296 60 11462 --
NM_021255chr1474071 4031 2604 1429 1419 1104 493 --11413 --
NM_021629chr384280 2017 1683 1415 909 360 297 86 --25067 4898 --
NM_021813chr6125586 5194 4810 4532 4121 1224 1073 835 456 443 425 397 45387 2089 483 448 35869 4562 434 --
NM_021814chr62597 163 1255 --2386 173
NM_021914chr1462449 2332 1806 670 499 256 11580 2969 204 --
NM_021954chr1353418 2844 2762 2716 2259 12749 23378 1115 11011
NM_021960chr182652 2202 922 886 859 700 556 547 21030 472 165 --
NM_021961chr11177212 6942 6168 4926 4875 4536 1218 1212 1165 1026 911 904 787 755 657 35 21 ----1391
NM_021964chr3195670 5122 4929 4690 4593 4414 4408 1825 1636 1479 1448 1405 1330 904 750 719 654 564 87 16040 56514 5033 4865 743 322 24530 2289
NM_021998chrX61437 1085 961 929 464 253 --11006 1395
NM_022351chr8103342 3239 3148 3126 2995 2546 764 758 540 294 33821 3225 2687 33297 1551 1424 --
NM_022458chr742644 2195 2002 734 21245 739 32696 1232 672 13190
NM_022459chr1375921 5409 5014 4493 1859 306 214 14475 46132 4337 1360 1296 --
NM_022465chr1283056 2743 2729 2720 2586 869 521 298 ------
NM_022483chr541373 399 168 100 2473 150 11461 --
NM_022648chr254606 4498 1769 1619 1592 11602 24582 4478 11613
NM_022763chr393196 3146 3092 2609 2525 2403 865 839 360 22602 806 1102 --
NM_022781chr993345 2273 2171 2164 593 545 505 192 52 --63228 2885 2243 2146 2136 375 --
NM_022841chr1572804 2689 2585 1693 1111 889 657 11729 22270 1919 --
NM_022843chr13111514 1413 1376 1354 1247 1031 1020 989 563 394 179 --1408 --
NM_022893chr262784 2692 2597 2293 941 512 12811 22555 2160 11942
NM_022918chr113871 841 438 --21731 245 1283
NM_024524chr393099 3074 2997 2308 2038 1076 622 369 290 1633 53168 2942 2363 2284 406 --
NM_024548chr341094 238 223 138 1357 2403 115 --
NM_024583chr21341 --3885 859 303 189
NM_024590chr441768 1732 1593 1294 --1558 21357 784
NM_024607chr854365 3662 3481 1598 967 --34423 3750 1473 13547
NM_024612chr175875 770 727 712 434 1738 11046 --
NM_024613chr851713 1368 1319 751 708 11586 1722 --
NM_024624chr251684 486 380 310 302 --2296 124 --
NM_024665chr3134028 3342 3044 1613 1535 1504 740 539 423 384 292 134 42 1150 24473 3633 11152
NM_024692chr251817 1764 1624 501 33 1725 11596 --
NM_024834chr1061892 1418 1331 292 153 73 --1595 1225
NM_024913chr751527 1409 1389 1367 1132 --11356 --
NM_024921chrX41446 1335 483 390 31879 801 477 21546 641 11966
NM_024947chr3239580 9571 9442 8559 7785 6987 6629 6485 6087 5957 3588 3016 2963 2632 2505 2229 1969 1744 1542 1377 1171 483 280 27205 2622 39094 645 385 11772
NM_024953chr12112757 2620 2435 2211 2195 2031 908 892 882 564 240 32551 184 162 32129 838 228 12820
NM_024989chr2247985 7746 7705 7409 7312 6819 6726 6568 5838 5655 5098 4990 3202 3077 2988 2689 2669 2660 2572 2017 983 906 803 690 47867 6577 6484 6373 37194 5943 1830 37934 5849 5273
NM_025134chr1652033 1627 1028 669 277 12113 1332 21717 1647
NM_025160chr183028 2638 1554 723 622 549 435 289 --12792 --
NM_025191chr152279 1238 977 843 464 43501 3489 3433 940 33229 3005 2961 12621
NM_025222chr373013 1144 1086 1019 950 321 145 12994 21042 856 1828
NM_025235chr1072225 2201 1836 1764 420 284 174 --31694 1556 292 --
NM_030621chr1483711 3646 3171 3148 1649 1560 1423 524 --23717 747 --
NM_030625chr1032388 2255 612 31903 1765 833 22070 1888 --
NM_030627chr564115 4106 3869 3747 3691 3205 11096 22741 930 14019
NM_030647chr766074 5839 2115 1087 1069 699 25122 4940 1615 15633
NM_030650chr2104251 3865 3338 3332 3321 3231 3025 1297 701 190 3789 690 220 1158 --
NM_030665chr1781291 1276 1270 1260 1235 1201 956 934 21285 912 11251 --
NM_030758chr22--31295 1014 1004 21290 984 --
NM_030775chr122786 83 2114 70 --160
NM_030791chr1441357 1339 533 322 3397 304 288 3329 311 276 --
NM_030806chr1129371 8783 8751 8467 7363 6014 3252 2487 2177 1133 274 130 17546 29399 9385 --
NM_030816chr151070 1025 612 327 212 13695 --1441
NM_030918chr1105195 4408 3382 1243 1235 1187 1129 931 644 438 --11210 --
NM_031418chr1192574 2451 2437 2347 1992 956 739 589 569 12631 42529 2146 970 792 --
NM_031427chr1485631 4749 2337 819 672 645 587 379 1424 35879 1919 197 167
NM_031431chr1341827 1799 1764 1525 --11580 11787
NM_031439chr851965 1764 1751 709 645 --1688 11645
NM_031442chrX62998 2784 2637 2627 744 576 --22892 934 11241
NM_031483chr2073247 3120 2952 2338 2242 1021 962 32188 976 383 --12462
NM_032153chr382749 2542 2507 2420 2180 729 336 261 22694 254 12469 --
NM_032199chr1083867 3793 3658 3565 3151 1444 993 536 --33684 928 586 --
NM_032228chr1183081 2422 2385 2247 1367 195 163 33 154 11179 --
NM_032233chr142621 603 1608 --2594 130
NM_032239chr44957 532 265 144 --11471 11297
NM_032268chr161796 --22824 894 21048 321
NM_032289chr531922 661 642 --21891 628 --
NM_032303chr94665 227 107 93 --2456 431 --
NM_032325chr1141989 1981 1969 1566 12028 ----
NM_032352chr1441368 485 467 423 21463 1412 --1297
NM_032373chr10105844 4909 4597 4479 4306 4276 2136 1464 1287 434 25828 4799 22171 1170 23814 1563
NM_032410chr831035 924 353 51234 1222 882 488 346 1228 --
NM_032439chr1061202 634 605 501 358 280 --31259 1098 304 --
NM_032445chr1582602 2133 1051 996 569 518 295 232 22484 1946 12518 12611
NM_032446chr5103857 3663 3603 3540 3432 3392 3134 3014 2437 1195 33551 1289 640 22935 399 --
NM_032451chr165128 113 94 86 80 --1136 --
NM_032457chr473795 3083 2676 2593 1531 938 725 33155 3062 182 43883 3118 3054 781 12509
NM_032458chrX63364 3258 2642 274 79 57 12700 22746 2542 22222 1006
NM_032471chr641134 1086 941 851 ----1746
NM_032505chr372476 2322 2202 1056 929 476 305 --22241 107 12046
NM_032510chr1832466 2282 1731 22022 804 22499 1649 22251 1697
NM_032521chr2073162 2692 2421 2385 2260 2082 75 --22049 50 22857 2659
NM_032682chr323156 222 11445 43385 3010 1319 100 1734
NM_032810chr1081393 1266 1145 1093 502 423 407 123 --1258 --
NM_032828chr1943966 3938 1788 1340 11012 --34975 4837 4449
NM_032859chr1393675 3603 3566 3475 3297 3141 1587 981 541 13987 23016 926 1477
NM_032873chr1174187 3195 3160 1579 1222 1059 296 34100 1498 1384 24279 1007 --
NM_032968chrX134266 4017 3611 3569 3554 3051 2915 1436 662 629 444 279 42 --23797 238 --
NM_032973chrY134258 4009 3603 3565 3550 3046 2910 1436 662 629 444 279 42 --23789 238 --
NM_033055chr15974 832 704 279 70 11012 2774 257 1925
NM_033081chr2061432 1423 1408 1395 1136 1065 --1582 11041
NM_033083chr362326 1105 1092 747 728 248 12776 23147 1138 --
NM_033132chr1362166 1843 1655 363 339 280 --61822 1661 1575 683 247 161 12129
NM_033222chr941342 1183 1031 1014 1485 21371 201 2927 903
NM_033224chr7128101 6467 6362 6072 6015 5752 2817 2139 2127 1875 1396 1108 57370 6573 2369 1825 1789 27454 3110 --
NM_033225chr842203 2187 2173 1968 1739 32912 2220 720 --
NM_033285chr8164319 4256 4244 4160 3830 3411 3003 2903 2807 2714 1660 919 739 410 160 69 --54350 3602 3214 287 209 --
NM_033360chr1294460 3972 3727 3025 2975 1767 716 134 28 23837 2817 24432 177 --
NM_033364chr331547 1454 423 ----21889 1297
NM_033389chr1774661 4399 3790 2979 2969 1186 1052 22986 1325 21392 1171 13574
NM_033394chr261481 1309 1239 1139 394 215 11475 21359 467 11427
NM_033428chr961750 1571 1327 1305 535 272 11252 4378 349 304 100 1330
NM_033505chr246097 6055 4935 1050 36523 4850 4262 32403 1942 1848 11877
NM_033656chr21105942 4667 4502 4306 3773 1247 1015 912 550 108 1774 ----
NM_052832chr873053 2992 2951 2774 2571 1985 1202 22453 1838 22351 1090 12507
NM_052851chr1362347 2341 1787 1527 383 350 --2405 238 --
NM_052867chr1361390 1086 574 561 490 304 --11484 --
NM_052879chr1243533 3394 694 218 31561 541 243 12492 --
NM_052885chr12134868 4641 4541 4498 4249 4238 4224 3735 3631 1460 1370 1147 281 44230 3913 1470 821 24698 3289 --
NM_052886chr851799 1677 546 478 52 --22152 669 1751
NM_052907chr1264035 3931 2615 1131 786 33 22846 2604 33867 3408 481 1957
NM_052937chr842050 1968 713 492 --1334 1363
NM_053042chr463163 2852 2774 2161 473 226 --32984 2155 206 --
NM_057175chr442555 959 655 632 41628 497 166 51 12676 1294
NM_080546chr97727 369 190 125 111 89 49 1712 --22309 1900
NM_080672chr201478 ----2496 458
NM_080867chr1464934 4867 4515 3086 69 34 13392 51394 442 299 274 179 --
NM_080927chr3103398 3335 2633 2364 2348 2275 1074 1045 936 79 --11029 12218
NM_130386chr183686 676 426 ----2492 272
NM_130809chr563030 1227 1088 1016 666 68 21159 242 22863 2539 32884 1196 1107
NM_133265chrX83201 3181 3175 2802 2763 831 680 284 --32564 2525 701 1254
NM_133473chr195656 495 413 329 274 31863 1761 336 11917 2674 57
NM_133496chr194458 3781 3771 3356 3228 1708 558 501 71 33918 1060 1031 23437 21 --
NM_134268chr173453 441 403 2434 423 ----
NM_138333chr972551 2246 2057 831 806 485 460 22560 620 12425 12522
NM_138423chr1561949 1890 851 396 337 160 --22058 329 --
NM_138444chr1384772 4569 3593 3581 1979 1658 1105 1085 11989 11241 14414
NM_138473chr12123570 3369 3343 3335 3249 1993 1885 1201 638 523 446 370 23829 437 23524 420 25141 990
NM_138554chr9122701 2614 2514 2208 2195 2096 2090 1847 1793 1711 137 101 22685 1970 32590 2036 636 --
NM_138694chr673480 3383 3070 2962 1107 1026 314 43447 3409 3002 913 12986 --
NM_138771chr781480 1311 1193 1144 999 465 159 45 1362 --21068 1006
NM_138782chr542117 1856 741 593 52428 2017 1717 801 535 32216 1740 1587 11602
NM_139279chr223407 2917 --23545 29 12897
NM_139318chr14476 68 59 43 --1206 --
NM_144571chr4126068 5443 4471 2213 2182 1675 1593 1419 879 549 249 49 56753 6098 5166 1711 1549 32006 692 144 --
NM_144578chr14145180 4879 4702 4660 3995 3989 3736 3614 1513 737 516 504 152 54 2182 71 --11080
NM_144664chr1162563 2477 2462 1907 786 148 1773 32539 729 616 --
NM_144710chr261266 1248 528 518 511 440 1957 ----
NM_144963chr872415 1753 717 681 371 333 262 --12096 12659
NM_145257chr183350 3306 2910 2836 2614 1062 739 453 13839 --23686 115
NM_145284chrX62560 2367 1884 554 482 308 3882 764 465 --22460 2305
NM_145735chr13102835 2813 2766 2625 2172 2134 481 347 171 137 12568 22759 2446 --
NM_145808chr753091 2499 733 264 256 --22109 768 11983
NM_152277chr52847 820 ----21660 398
NM_152400chr462107 1940 1911 1588 202 189 11817 3256 139 63 21953 1540
NM_152409chr5123563 3431 3203 2763 2756 2579 2233 1425 686 611 339 80 12896 33067 2444 204 --
NM_152475chr1922725 1746 12718 12609 22745 2227
NM_152594chr15122153 2121 1827 1735 1704 1698 1552 727 720 710 584 510 22243 1654 31907 1591 316 1847
NM_152608chr152461 2434 2360 961 651 ----1832
NM_152622chr563496 3478 2841 2762 2426 1024 12318 13436 12956
NM_152624chr5117294 6930 6631 6544 5882 2676 2568 2238 1659 1012 488 36305 5851 2429 45875 4731 4620 195 --
NM_152641chr1252846 2037 760 414 328 22510 1031 42737 1116 1095 895 --
NM_152695chrX32302 1798 415 --12214 22039 599
NM_152737chr631658 1356 309 --11820 11893
NM_152739chr75921 888 823 771 294 1798 1989 --
NM_152774chr792677 2659 2647 2043 1006 758 732 623 325 1296 ----
NM_152787chrX53369 2755 2601 739 264 --23216 689 33886 3125 382
NM_152890chr171213 1017 995 925 467 291 217 ------
NM_153018chr1763001 2929 2868 2546 2202 76 23285 69 --12229
NM_153184chr391999 1948 1575 1351 1333 582 331 298 260 --1315 --
NM_153207chr12103851 3414 2937 2580 1456 1207 1174 1122 366 150 1748 33435 3326 931 --
NM_153235chr68532 484 477 455 446 440 385 266 2553 347 22436 522 --
NM_153332chr863217 3040 2866 1181 530 481 12388 ----
NM_153354chr51833 1854 1842 --
NM_153607chr5123095 2939 2891 2681 2618 2546 1975 911 747 678 527 334 22747 520 33001 2629 2158 --
NM_153634chr1271599 1539 1438 1361 1327 1131 1084 11034 --11472
NM_153686chr491804 1602 1554 721 473 247 153 144 112 31698 1530 309 1467 --
NM_153687chr1231652 589 306 --139 11289
NM_153705chr1192674 2655 2610 2482 2173 985 371 286 232 --32043 294 123 1331
NM_170665chr1274287 4195 1045 1018 948 266 211 14047 1182 34188 1055 235
NM_172071chr1137485 7274 6685 5663 5023 4682 2365 1965 1803 1783 1707 1672 1425 --75783 2670 1926 1771 1760 1646 328 --
NM_172193chr1481372 1240 976 951 888 394 184 55 31321 1175 360 --11310
NM_172375chr1461010 1002 993 977 950 940 --11140 --
NM_173468chr4145996 5633 5227 5035 4557 4525 4314 2216 2206 1515 615 576 200 70 --35481 2063 780 25884 4280
NM_173475chr1641408 1357 1335 1312 21349 1323 ----
NM_173500chr1511301 --21062 370 2454 211
NM_173511chr273334 3325 3223 2973 1583 932 768 1653 23751 2591 --
NM_173576chr1021581 223 11649 2613 538 1779
NM_173591chr122157 91 128 --2868 149
NM_173644chr2041988 1617 436 382 --11463 1694
NM_173698chrX51751 1662 763 709 134 --11332 --
NM_173808chr174442 3669 3527 3287 3043 2709 1290 24258 3296 33063 1694 1190 13075
NM_173851chr873567 2719 2507 2453 547 236 60 13023 1196 1647
NM_174916chr1562288 2235 2174 1993 1757 325 ----22325 1626
NM_175061chr762066 2034 2011 1690 772 602 --1179 1694
NM_175607chr351444 1175 597 560 265 1523 2284 152 --
NM_175624chr1297764 7104 6459 2517 1346 1282 1087 763 384 27444 1429 37396 1932 40 --
NM_175736chr1287679 7565 6922 6841 6641 6468 5426 838 --26183 808 15915
NM_175854chr1352780 2585 2319 1854 289 1529 --21890 778
NM_175861chr1295861 5218 4659 4475 4417 4363 1247 1156 1149 11277 1633 25990 1850
NM_175921chr554307 4242 3212 2618 1056 --33415 3032 170 12931
NM_176824chr441190 1069 1033 110 --31305 1076 384 --
NM_178013chr1463049 2800 2774 2757 2419 957 32987 2843 2811 12764 --
NM_178140chr512698 21028 657 32660 2623 945 12728
NM_178539chr124758 586 510 96 --22007 1945 1748
NM_178812chr881406 1216 1103 1007 426 406 86 56 --1394 299 67
NM_181054chr1451223 1187 947 819 214 186 11106 11231
NM_181291chr144674 307 299 288 1293 ----
NM_181358chr183862 3851 2700 1635 1477 1268 1089 595 1909 --33793 3633 1153
NM_181504chr5134001 3946 3903 3889 3875 3863 3845 3797 3747 3029 1330 960 713 2811 703 11030 --
NM_181782chr6111900 755 749 743 711 693 633 582 390 343 231 --22332 624 --
NM_181783chr1231452 1310 687 --21492 1434 11970
NM_181787chr893890 3870 3850 3201 3159 3153 1217 695 553 --31541 1408 1344 23492 527
NM_181836chr572515 2315 2264 1712 1674 856 264 32606 2307 133 1665 --
NM_182485chr4113709 3661 3494 3111 1312 766 757 608 475 326 264 53463 3295 2474 934 927 22804 1001 12326
NM_182515chr19136471 6225 5500 4356 2573 2558 2339 2229 1247 651 485 323 234 22605 1502 12566 46351 4932 2239 669
NM_182540chrX1767 2842 817 1694 1757
NM_182557chr1122123 2106 32142 2128 1487 --12116
NM_182756chr21134 --2619 105 1149
NM_182765chr104930 718 649 31 42150 1668 921 455 32370 362 253 22317 683
NM_182767chr1272130 2067 1941 1629 1304 735 360 22103 2081 1714 21639 801
NM_182830chr1411608 ----21905 1649
NM_194247chr244117 1434 1177 258 24207 2973 --14029
NM_194282chr442373 2287 198 35 32445 2240 917 31949 1902 230 --
NM_194291chr882983 2929 1061 960 571 466 337 261 12096 1475 --
NM_194314chr1125137 5011 4986 4953 4622 3962 3880 3474 2029 1800 802 39 14396 75530 4120 4068 2067 2041 1366 1059 35033 729 470
NM_194318chr1342496 1802 1032 544 1413 1224 22072 2040
NM_198215chr1021423 1394 1931 1157 21452 1037
NM_198270chrX42687 1263 1253 992 ----12970
NM_198273chr572281 2066 1938 1181 1088 735 65 43031 2431 2162 979 22116 831 13067
NM_198468chr674636 4485 3591 1196 639 507 133 --34618 4578 594 24249 4071
NM_198581chr2147198 6373 6347 6267 6095 5637 4579 2167 1775 1607 1392 790 373 342 46426 1192 1159 637 36725 2205 1185 1173
NM_198935chr2033236 2386 948 23070 2795 32439 2419 1073 --
NM_203301chr1471558 1490 1459 1196 379 371 244 2406 39 2365 127 11416
NM_203364chr1121155 388 1186 11031 1344
NM_203406chr5152863 2735 2373 2360 2272 2062 1913 1104 811 783 659 519 376 208 99 --2111 36 --
NM_203451chr1362149 1917 1885 1875 938 800 11936 31684 1560 863 12355
NM_203458chr162967 2948 2802 967 932 377 32809 2795 897 --1592
NM_203459chr162495 1660 1646 1034 963 939 21674 986 12196 --
NM_206853chr633554 2575 584 12974 22998 2831 11409
NM_206854chr664815 3836 1845 897 711 422 14235 34259 4092 372 --
NM_207043chr122019 2006 32011 1999 1856 31994 1971 48 --
NM_207303chr1064081 4075 4006 3582 1426 324 11612 43528 1576 1517 378 11651
NM_207322chr1521518 1335 --11783 21841 1462
NM_207406chr486255 5435 4786 4324 4137 2535 907 203 21482 940 16351 --
NM_207517chr1551892 1753 1743 1394 184 --11780 1649
NM_207647chr962526 2127 993 857 767 693 22533 576 --11955
NM_212558chr943722 3533 2681 859 12605 21295 1018 1442
NM_213589chr2185575 5362 5053 4979 4772 3923 3432 1859 1355 1140 1022 574 213 189 181 168 156 144 --35243 3947 3692 1434