TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5681a
miRNA Sequence: AGAAAGGGUGGCAAUACCUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51856 ------
NM_000024chr52215 138 1415 ----
NM_000038chr531764 779 283 ------
NM_000045chr61412 1101 ----
NM_000051chr1162560 1270 792 727 685 205 1820 12822 126
NM_000052chrX83412 3384 3204 2944 758 698 626 548 175 22130 906 --
NM_000068chr1931511 1495 1175 ------
NM_000074chrX3777 643 357 --3688 622 606 --
NM_000081chr1----1325 --
NM_000084chrX186288 6021 5940 5859 5821 5408 5296 4444 2711 2492 2097 2045 1899 1634 1047 687 394 179 1452 46917 5823 5446 127 --
NM_000088chr173971 367 147 --2358 320 --
NM_000089chr7152 ------
NM_000090chr24621 359 274 164 ------
NM_000093chr972364 2108 1619 1533 963 952 825 --32110 1741 1632 1828
NM_000097chr331159 992 965 ------
NM_000104chr262918 1084 760 593 537 85 ----2548 540
NM_000109chrX42138 2039 2028 526 --12158 11721
NM_000110chr13766 396 214 --188 --
NM_000112chr5105478 5179 3658 1784 1518 1474 761 685 652 131 24965 1636 11718 15070
NM_000115chr133750 452 334 32359 897 466 11989 --
NM_000125chr6114217 3951 3680 3524 3207 3017 2604 1599 1505 1181 437 23640 515 24136 235 --
NM_000129chr62393 166 1537 1440 --
NM_000138chr1512330 32379 2361 103 ----
NM_000141chr1021127 501 ------
NM_000142chr421093 1086 21385 571 ----
NM_000161chr1451709 1538 1498 759 204 ----11853
NM_000163chr542351 1959 891 91 --1136 1713
NM_000165chr641547 1497 1144 1099 1436 ----
NM_000167chrX3693 472 439 ----11212
NM_000168chr793322 3142 3106 2575 2374 1227 445 328 246 1149 52706 2298 2065 970 286 --
NM_000170chr92481 430 ------
NM_000175chr191235 --140 --
NM_000176chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_000192chr1221508 1390 1447 11343 --
NM_000194chrX1213 ----1560
NM_000202chrX103973 3914 3883 3782 2671 2548 2535 1529 1255 237 33857 3136 993 42634 2487 2455 173 --
NM_000210chr231673 847 710 12339 --1774
NM_000212chr1762007 1897 918 841 607 543 ----11749
NM_000214chr201675 21667 1158 ----
NM_000217chr12124961 4805 4739 4656 4300 3339 2061 1881 1753 1410 971 767 22123 220 33658 3348 659 --
NM_000218chr111966 ------
NM_000222chr471757 1680 1463 1423 429 293 130 179 ----
NM_000227chr181307 ------
NM_000240chrX41765 1658 1492 419 ----21768 674
NM_000245chr71823 ----1511
NM_000248chr352749 2053 686 97 41 22029 955 1453 1589
NM_000259chr1535226 4922 2077 25965 5277 35038 2521 185 --
NM_000264chr943136 2223 1157 746 1792 162 --
NM_000266chrX2398 204 ------
NM_000267chr1743320 3289 1153 898 --33488 189 78 --
NM_000276chrX71859 1710 793 449 408 239 154 --31814 1505 795 22134 615
NM_000278chr102672 559 --42020 1860 1699 1564 --
NM_000284chrX31896 1612 301 ----11846
NM_000286chr172810 638 1172 1306 --
NM_000297chr482010 1963 1887 1825 1557 508 477 418 1315 ----
NM_000304chr1711061 ----1391
NM_000310chr121238 168 --1987 --
NM_000313chr32140 116 11091 131 --
NM_000314chr1093249 2680 2276 587 413 346 226 127 68 12082 11185 --
NM_000325chr41163 2646 201 ----
NM_000329chr13915 897 171 ------
NM_000330chrX52276 2184 1506 1464 834 12115 ----
NM_000332chr6166432 6213 6166 6102 5674 5024 4890 4629 4411 2734 2589 2106 1689 1644 1199 428 34447 1964 1394 47050 6489 6215 2840 16400
NM_000333chr321049 391 4981 908 727 407 ----
NM_000335chr342110 1782 653 43 --1842 --
NM_000337chr5106257 5278 5221 5179 4815 4281 1684 1051 413 44 34828 4793 4470 24923 4297 --
NM_000345chr411049 1963 --1187
NM_000353chr161143 11193 ----
NM_000362chr2283629 3420 3335 2887 2349 1277 816 403 --11422 --
NM_000367chr632178 802 213 ----1805
NM_000368chr96932 901 691 313 289 133 34484 4313 1420 24365 3585 --
NM_000379chr21352 ----11448
NM_000390chrX33447 3127 1166 --23449 1168 12483
NM_000391chr1151667 1311 453 292 272 21496 280 1387 --
NM_000393chr241583 738 713 565 --1455 --
NM_000399chr102106 50 11205 2148 88 --
NM_000406chr442691 532 468 286 --1240 --
NM_000408chr282908 2747 2526 2377 2120 1126 293 110 12442 ----
NM_000411chr2131175 669 85 11267 11216 13325
NM_000412chr31269 193 ----
NM_000421chr17--2265 61 ----
NM_000430chr1743423 1086 352 31 1102 33075 2508 1262 --
NM_000435chr195807 749 276 182 58 184 1108 --
NM_000439chr592213 2045 2010 765 723 513 252 220 113 --1126 --
NM_000441chr732353 2205 584 ------
NM_000447chr12157 98 ------
NM_000448chr1183114 2221 2156 2107 1317 1032 637 80 --12158 --
NM_000449chr131019 534 95 11379 21021 982 1177
NM_000461chr3124353 4266 3620 3540 3463 3420 1762 1458 1065 789 514 71 21470 456 33628 1150 852 12970
NM_000462chr1531391 370 230 31646 1560 279 11291 --
NM_000478chr13700 488 227 ------
NM_000480chr1121181 355 --1555 --
NM_000484chr213882 203 126 ------
NM_000489chrX63156 2649 2480 1221 1094 687 23219 2428 ----
NM_000493chr62385 228 21113 1103 ----
NM_000503chr831719 1632 1246 --11323 11758
NM_000509chr41190 ------
NM_000533chrX71609 1500 1300 443 192 165 83 1584 123 --
NM_000538chr1331489 575 214 2683 178 ----
NM_000544chr6_cox_hap163303 3136 2623 2498 2473 1109 ----31374 1363 1112
NM_000554chr1933126 1088 780 --3740 161 45 --
NM_000555chrX207620 7548 6708 6516 5932 5603 5521 5513 5347 3159 2891 2021 1962 1946 1359 1280 1000 950 925 232 31327 917 279 56791 5811 5580 2893 442 17623
NM_000575chr241017 895 142 78 ------
NM_000578chr231725 1387 544 --11516 --
NM_000582chr42505 91 ------
NM_000587chr55984 196 186 155 93 11174 --11196
NM_000597chr2----1304 --
NM_000598chr731506 1401 1075 1200 ----
NM_000599chr2104319 3994 3358 3244 3198 3068 1025 1018 224 21 31416 1052 1031 23448 1410 --
NM_000610chr11102654 2640 2182 1980 1113 970 700 604 333 136 32929 1855 264 ----
NM_000612chr1133780 2385 2362 --2703 512 --
NM_000615chr1192789 2462 2012 1179 899 693 672 216 189 1788 1565 --
NM_000618chr12136596 5857 5301 5288 4677 4528 4474 2209 1829 1718 808 431 49 46164 5813 5675 1568 --15962
NM_000618chr12136596 5857 5301 5288 4677 4528 4474 2209 1829 1718 808 431 49 46164 5813 5675 1568 --15962
NM_000620chr1292048 2039 1986 1879 1699 1459 412 211 64 --1406 --
NM_000627chr21891 --1676 --
NM_000633chr1855052 4773 4450 2081 582 13967 ----
NM_000639chr1123 1327 ----
NM_000678chr203800 263 224 ------
NM_000679chr52154 24 ------
NM_000684chr1041117 1106 500 219 --1433 --
NM_000685chr32168 144 1100 ----
NM_000685chr32168 144 1100 ----
NM_000686chrX2304 107 21497 383 ----
NM_000701chr12240 66 ------
NM_000719chr12175930 4615 4548 4418 2522 2377 2344 2166 1765 1372 1107 915 845 752 726 703 352 --11279 15247
NM_000721chr182681 2100 1887 1673 908 319 226 193 ------
NM_000723chr1761543 1391 1060 430 403 237 1114 2318 253 --
NM_000726chr211050 1588 11475 --
NM_000735chr6197 2245 194 199 --
NM_000756chr82433 388 ------
NM_000780chr821211 73 11277 ----
NM_000788chr451060 979 928 322 177 ------
NM_000795chr113916 896 379 --1898 --
NM_000800chr511343 1172 1414 --
NM_000801chr2051128 1017 991 719 98 --1196 --
NM_000806chr531844 1630 561 ------
NM_000807chr41217 ------
NM_000808chrX1101 1794 ----
NM_000809chr4189016 8556 8495 7742 7142 7058 6967 6335 5790 3656 3109 2750 2643 2231 2174 1794 1639 1430 59039 7465 7149 6873 3395 26833 583 13112
NM_000811chr52550 215 1678 ----
NM_000813chr585459 5374 5011 3728 1663 1567 593 372 35298 4644 628 14198 --
NM_000814chr1553026 2975 2693 1472 1097 ------
NM_000816chr52590 172 ------
NM_000817chr211031 --140 --
NM_000826chr432589 2404 184 1266 --1964
NM_000827chr552451 2352 2113 1791 774 32567 2468 199 3421 206 179 --
NM_000828chrX12040 2592 136 ----
NM_000829chr1132173 2046 104 --12162 --
NM_000831chr166234 6095 5642 5527 4033 962 --35652 4613 4021 --
NM_000834chr1251137 402 348 194 110 2816 419 1802 1197
NM_000838chr652755 2359 2188 716 333 --21884 930 --
NM_000839chr31370 ------
NM_000840chr72355 107 ------
NM_000842chr113515 498 487 ------
NM_000844chr34920 805 286 76 --11060 11072
NM_000855chr111336 ----2277 90
NM_000861chr362588 1899 1823 1734 719 585 11931 11053 --
NM_000868chrX62528 295 283 275 267 22 1711 1304 --
NM_000870chr561519 1337 1279 1209 555 149 21322 1142 ----
NM_000872chr1071415 1140 571 533 397 149 70 11445 ----
NM_000875chr15176680 6006 5869 5536 4996 4883 4613 2825 2676 2412 2111 1497 1457 1401 808 517 181 26546 511 41724 1342 391 329 --
NM_000891chr17123516 3268 3259 3251 2698 1418 1068 991 659 593 440 324 22368 921 --12998
NM_000895chr12136 ------
NM_000899chr1223371 1641 11548 34347 1681 811 --
NM_000901chr452570 2297 1921 1699 963 11961 ----
NM_000902chr332806 2041 1296 11077 12034 --
NM_000903chr1631404 292 53 ------
NM_000905chr71126 --131 --
NM_000908chr51673 1189 ----
NM_000917chr10--1877 1720 --
NM_000919chr52241 55 ------
NM_000933chr2041523 1141 317 89 ------
NM_000934chr173679 216 125 --165 --
NM_000937chr171382 ------
NM_000938chr41135 ------
NM_000944chr452374 2317 1813 677 219 2362 234 ----
NM_000945chr241801 1385 544 526 --1528 --
NM_000949chr52777 717 1120 1149 --
NM_000950chrX93620 3405 3204 3128 2430 2216 1168 846 233 42370 2314 1377 890 13031 --
NM_000958chr521207 1023 1150 ----
NM_000962chr982335 2299 2063 1999 955 928 826 776 ----1958
NM_000963chr131708 737 714 22060 764 11634 --
NM_000964chr17258 48 ------
NM_000965chr361272 1060 386 359 259 194 1851 ----
NM_000984chr171152 150 --1289
NM_001001132chr2141464 929 539 264 21341 970 ----
NM_001001323chr1273052 2887 2867 2791 2654 1944 1129 33151 3113 351 12869 12370
NM_001001331chr342291 642 435 191 11736 1163 --
NM_001001344chrX52414 874 830 338 138 --12002 11004
NM_001001389chr11102654 2640 2182 1980 1113 970 700 604 333 136 32929 1855 264 ----
NM_001001390chr11102654 2640 2182 1980 1113 970 700 604 333 136 32929 1855 264 ----
NM_001001391chr11102654 2640 2182 1980 1113 970 700 604 333 136 32929 1855 264 ----
NM_001001392chr11102700 2686 2228 2026 1159 1016 746 650 379 182 32975 1901 310 ----
NM_001001394chr23582 81 55 1462 ----
NM_001001395chr1232562 783 768 22798 759 ----
NM_001001396chr1143911 3872 3682 3666 3109 2909 2715 1748 1582 1555 1327 1016 868 293 34055 3743 367 2952 813 23850 823
NM_001001419chr5104601 4118 3784 3732 1974 1903 1647 1072 944 671 23354 2096 ----
NM_001001420chr5104601 4118 3784 3732 1974 1903 1647 1072 944 671 23354 2096 ----
NM_001001433chr2083142 2826 2738 2553 1959 566 523 482 ------
NM_001001481chr811091 1128 13149 --
NM_001001484chr1062419 1643 961 862 855 846 ------
NM_001001522chr111430 ------
NM_001001549chr772781 2616 2572 2393 1933 1795 782 11815 --11936
NM_001001550chr772781 2616 2572 2393 1933 1795 782 11815 --11936
NM_001001555chr772781 2616 2572 2393 1933 1795 782 11815 --11936
NM_001001557chr822178 1570 11640 1709 --
NM_001001560chr223614 530 86 ------
NM_001001664chr263648 3507 3176 2650 2621 432 34029 1312 937 --12776
NM_001001668chr1943390 3181 3158 2827 1169 1122 --
NM_001001701chr421849 219 41495 1446 650 131 1641 --
NM_001001787chr12195 187 ------
NM_001001790chr92352 101 ------
NM_001001852chr221149 1874 1314 --
NM_001001890chr21114253 3989 3646 3467 3364 3101 2978 2864 2756 652 593 --32866 2816 629 1977
NM_001001924chr851411 1352 1316 1303 296 ------
NM_001001925chr851411 1352 1316 1303 296 ------
NM_001001931chr851411 1352 1316 1303 296 ------
NM_001001938chr963341 3075 1563 1413 1094 474 23353 626 11239 11281
NM_001001974chr1042208 1915 1816 130 22302 51 ----
NM_001001995chrX51657 1587 1446 1218 547 11261 ----
NM_001002233chr831939 1432 740 2605 349 22000 628 --
NM_001002243chr22581 33 2938 369 ----
NM_001002257chr2103220 2347 2268 2260 1436 1115 1093 725 522 60 12584 23162 617 --
NM_001002265chr105748 686 133 88 77 ------
NM_001002266chr105748 686 133 88 77 ------
NM_001002294chr12305 95 1314 ----
NM_001002295chr102906 797 1449 153 --
NM_001002296chr831404 1108 98 ------
NM_001002762chr1032644 2062 968 11855 2520 377 --
NM_001002811chr151564 1488 1477 1233 180 ------
NM_001002812chr151564 1488 1477 1233 180 ------
NM_001002812chr151564 1488 1477 1233 180 ------
NM_001002838chrX51899 1447 1356 357 241 1524 ----
NM_001002843chr152969 387 1338 --1390
NM_001002860chr1474599 4005 3992 3213 2924 1706 274 53620 3292 1487 524 401 ----
NM_001002909chr1772111 1718 1630 1588 1491 1432 905 11651 ----
NM_001003406chr2273051 3029 2256 1200 701 645 553 11023 ----
NM_001003652chr18208491 8412 7990 6843 6831 6640 6415 6313 6219 6129 5987 5569 3241 2868 2664 1783 1145 869 736 725 57208 6710 5337 1552 556 37304 6417 1018 --
NM_001003665chr172767 2681 1394 1228 816 166 90 11401 12393 --
NM_001003674chr18106926 6560 6049 5629 5135 4966 4695 4546 2025 553 56868 6795 2647 650 150 24697 1145 16308
NM_001003675chr18106926 6560 6049 5629 5135 4966 4695 4546 2025 553 56868 6795 2647 650 150 24697 1145 16308
NM_001003681chr2231911 527 338 2782 483 11635 --
NM_001003694chr3154 1597 1575 --
NM_001003712chr1273907 3618 3480 2703 1138 787 144 11403 13023 --
NM_001003792chr331236 1133 442 1768 ----
NM_001003793chr331236 1133 442 1768 ----
NM_001003800chr952694 1331 1161 1046 820 ----12685
NM_001003810chr42694 346 --1254 --
NM_001003937chr251572 1124 1100 500 88 --21495 1433 1185
NM_001003943chr1543856 2463 1053 180 1869 ----
NM_001004019chr32502 374 ------
NM_001004065chr943795 3637 3305 1039 ----13127
NM_001004127chr131819 1129 ----
NM_001004196chr331013 973 497 ------
NM_001004304chr1293271 3021 2903 2307 2166 2111 1976 1104 553 --1811 --
NM_001004313chr1711859 --12052 --
NM_001004316chr3--2320 280 --147
NM_001004317chr684429 3891 3745 2739 1735 590 491 24 --2862 630 --
NM_001004329chr1221126 349 1382 ----
NM_001004342chr1136053 5797 5076 4982 4565 4509 4332 2362 979 771 752 645 275 34678 1485 631 5831 821 810 764 718 12439
NM_001004360chr21750 32010 454 397 ----
NM_001004419chr1254103 1817 1626 1507 1428 24616 640 ----
NM_001004720chr24959 300 243 118 --1245 --
NM_001004722chr241128 469 412 287 --1414 --
NM_001005266chr15--1488 1185 --
NM_001005267chr15--1488 1185 --
NM_001005268chr15--1488 1185 --
NM_001005269chr15--1488 1185 --
NM_001005271chr1761169 1047 195 175 168 129 --11078 --
NM_001005273chr1761169 1047 195 175 168 129 --11078 --
NM_001005335chr191100 --149 --
NM_001005366chr123750 619 24 ------
NM_001005368chr102143 27 ------
NM_001005375chrY21307 1191 21384 1204 11157 11789
NM_001005386chr261882 1786 851 444 109 49 ------
NM_001005404chr1774545 3752 3241 3081 1074 186 147 23223 1687 34431 4264 3663 --
NM_001005417chr12464 213 ------
NM_001005463chr1062091 2085 1845 1685 841 226 ------
NM_001005473chr5156499 6348 5787 5643 5416 5213 5187 5035 4735 2347 2326 2292 838 387 363 45812 4226 2374 2115 --15216
NM_001005474chr331510 1422 1134 ------
NM_001005476chr21601 --130 --
NM_001005502chr1274548 4294 3440 3431 3224 2065 1845 34760 3501 574 11962 --
NM_001005505chr321694 54 --21707 1696 1518
NM_001005527chr35398 388 330 81 54 21209 890 ----
NM_001005612chrX1148 1187 ----
NM_001005739chr21673 1737 ----
NM_001005743chr1431106 1008 370 1102 11191 --
NM_001005744chr1431106 1008 370 1102 11191 --
NM_001005745chr1431106 1008 370 1102 11191 --
NM_001005746chr211050 1588 11475 --
NM_001005747chr211050 1588 11475 --
NM_001005753chr252066 2026 1901 1842 933 22124 124 32068 1858 1700 22109 714
NM_001005781chr22522 226 ------
NM_001005782chr27971 675 255 220 110 38 26 ------
NM_001005849chr171150 1128 ----
NM_001005861chr31722 ----1854
NM_001006115chr352754 1864 944 490 112 12041 12636 --
NM_001006600chr532003 1823 1812 21753 1508 ----
NM_001006605chr121176 1021 1994 --2951 202
NM_001006605chr121176 1021 1994 --2951 202
NM_001006610chr162860 382 --2760 91 --
NM_001006612chrX2384 74 ------
NM_001006613chrX2384 74 ------
NM_001006614chrX2384 74 ------
NM_001006623chr2102466 2326 1693 950 833 540 506 486 432 363 1516 22054 672 11037
NM_001006636chr22397 366 ----1923
NM_001006665chr13804 508 292 --1510 --
NM_001006939chr102746 521 ------
NM_001007024chr1753912 3739 3386 3112 387 33950 3928 1478 1465 13688
NM_001007025chr1753912 3739 3386 3112 387 33950 3928 1478 1465 13688
NM_001007067chr84999 788 340 119 --21001 884 1154
NM_001007068chr84999 788 340 119 --21001 884 1154
NM_001007069chr84999 788 340 119 --21001 884 1154
NM_001007070chr84999 788 340 119 --21001 884 1154
NM_001007075chr4141 2777 187 ----
NM_001007097chr994989 4417 4025 3835 3555 1956 1679 1357 975 23187 1722 1878 --
NM_001007099chr12762 746 ------
NM_001007100chr12762 746 ------
NM_001007102chr661501 1467 1177 619 597 400 1656 --1361
NM_001007156chr154644 222 143 87 ------
NM_001007237chr142462 587 361 349 12721 31935 374 54 12684
NM_001007246chr2141928 1707 380 333 11583 11198 --
NM_001007257chr12608 465 ------
NM_001007267chr2----2168 156 --
NM_001007277chr112773 178 1888 ----
NM_001007466chr665027 3972 1178 1106 673 306 43921 364 314 288 24794 1180 11066
NM_001007471chr92706 673 --176 --
NM_001007527chr51187 ------
NM_001007538chr1351787 1533 722 106 25 11516 --21569 397
NM_001007553chr11433 1363 ----
NM_001007559chr182719 357 11933 --1631
NM_001008220chr543910 651 231 55 13824 13784 --
NM_001008222chrX1887 21398 538 11338 1103
NM_001008225chr73675 583 73 ------
NM_001008239chr18133718 3503 2364 1379 1311 1195 799 701 685 621 568 214 55 42914 2567 917 304 1155 --
NM_001008272chr3----198 --
NM_001008273chr3----198 --
NM_001008388chr43818 366 134 ------
NM_001008391chr113211 177 111 1574 ----
NM_001008392chr383000 2709 2666 1349 946 406 233 187 1306 1385 --
NM_001008408chr7106256 5390 5171 4824 4734 4000 1519 1335 1068 831 35279 5084 1274 ----
NM_001008495chr892184 1838 1739 1514 869 820 437 359 210 ------
NM_001008530chr143363 189 24 ------
NM_001008539chr8105302 5092 4207 3396 1280 1023 952 831 731 713 1562 24056 954 --
NM_001008541chr1071940 1776 1682 822 606 534 97 --1323 --
NM_001008541chr1071940 1776 1682 822 606 534 97 --1323 --
NM_001008564chr1321743 415 1883 1855 --
NM_001008660chr1161528 1409 488 438 396 373 31083 986 266 ----
NM_001008701chr1952977 2876 1195 846 613 --42979 2864 2844 1999 --
NM_001008707chr1421894 295 1332 ----
NM_001008723chr10--1489 ----
NM_001008726chr1441732 1654 1599 503 --11615 --
NM_001008738chr542424 1798 1034 735 ----194
NM_001008740chr1124 ------
NM_001008801chr1942186 2128 1439 716 ------
NM_001008860chr151151 1760 1534 --
NM_001008892chr151151 1760 1534 --
NM_001008894chr151151 1760 1534 --
NM_001008895chr1331286 1223 293 1147 ----
NM_001008925chr463438 3146 2851 2734 802 415 22806 2402 --13277
NM_001008938chr112356 322 1372 ----
NM_001009185chr51623 --1127 --
NM_001009552chr81417 1606 ----
NM_001009566chr12961 529 ------
NM_001009569chr102607 467 1121 ----
NM_001009881chr11557 ------
NM_001009882chr11557 ------
NM_001009894chr1221549 1262 ------
NM_001009899chr3225827 5736 5199 5048 5020 4994 4500 4409 4042 4018 2506 2411 2380 1963 1880 1863 1733 1237 1167 653 580 191 --22281 1735 --
NM_001009958chr72463 418 1237 ----
NM_001009959chr251730 1705 900 391 124 12532 1498 --
NM_001009993chr274277 3930 3475 1315 969 662 506 13021 13220 11570
NM_001010000chr1852816 2705 839 814 639 13098 2841 390 --
NM_001010846chr141797 891 801 698 13161 24274 3798 --
NM_001010853chr693081 2984 2623 2532 1071 508 342 239 61 ------
NM_001010861chr152741 2685 2616 2487 2468 --21941 45 --
NM_001010862chrX42473 2146 318 166 1544 2533 99 1188
NM_001010867chr156104 2453 1973 1745 964 26663 4351 --11530
NM_001010888chrX134404 3703 3478 3016 2955 1592 1495 1210 401 390 382 288 169 21027 815 23974 3579 13613
NM_001010891chr524800 766 54987 4318 2056 959 940 25783 2343 --
NM_001010895chr921886 520 ----186
NM_001010898chr163336 2286 1167 1087 1000 105 --2851 71 --
NM_001010908chr102648 641 ------
NM_001010924chr103855 809 51 ------
NM_001010984chr132023 811 280 --1507 11045
NM_001010986chrX21982 258 1835 12497 --
NM_001010989chr161464 ------
NM_001010990chr161464 ------
NM_001011513chr484025 3161 2903 2667 1598 1117 921 344 1986 11526 13764
NM_001011515chr41125 ----143
NM_001011516chr41125 ----143
NM_001011537chr322216 423 11695 1458 1546
NM_001011553chr74874 757 629 222 1725 1768 --
NM_001011666chr7195995 5868 5588 4963 4955 4762 4700 4644 2579 2443 2095 1331 1283 683 500 489 318 231 55 1814 36528 4721 277 14352
NM_001011708chr262848 2745 2026 1061 793 347 62765 949 936 579 253 214 21182 1123 --
NM_001011713chr1441577 1527 1159 634 --1640 11530
NM_001011720chr83583 387 205 ------
NM_001011885chr15--21711 499 ----
NM_001012329chr122216 1732 22148 275 11739 --
NM_001012393chr11145033 4847 4655 4589 4574 4563 4025 3910 2066 1494 1309 1142 946 530 11071 35145 3528 280 11970
NM_001012420chr1572292 2218 1018 874 798 733 570 12035 ----
NM_001012426chr643103 1049 1003 470 --13105 --
NM_001012427chr643103 1049 1003 470 --13105 --
NM_001012514chr23951 48 39 11111 1959 --
NM_001012516chr23951 48 39 11111 1959 --
NM_001012732chr421176 1095 167 ----
NM_001012751chr101708 ------
NM_001012754chr1362056 1893 1800 1569 767 494 ----11522
NM_001012755chrX84553 4388 3197 3185 1556 1039 284 102 14374 33247 1497 1180 --
NM_001012968chrX92237 1103 971 889 826 664 509 459 329 ----12199
NM_001012977chrX61169 894 500 470 454 324 11429 11171 1528
NM_001012979chrX157 ------
NM_001013031chr1051083 1065 967 584 255 1404 31103 666 240 --
NM_001013398chr731506 1401 1075 1200 ----
NM_001013415chr411104 ------
NM_001013615chr12837 36 11002 1208 --
NM_001013620chr12127601 7363 6291 5912 2791 2097 1876 1736 1658 1018 726 708 58428 1961 1190 1042 1032 --1648
NM_001013635chr1251157 1042 861 286 188 ------
NM_001013699chr121463 1122 ----
NM_001013739chr72281 57 ------
NM_001013843chr153596 142 113 ------
NM_001014286chr13125 1275 ----
NM_001014380chr13115823 5373 5311 5273 5122 5105 4893 4367 4201 3590 1612 44636 1701 1551 940 24314 1950 --
NM_001014431chr142989 798 --1783 --
NM_001014432chr142989 798 --1783 --
NM_001014434chr13808 638 190 1251 ----
NM_001014442chr133121 108 27 ------
NM_001014449chr161242 ------
NM_001014451chr161242 ------
NM_001014797chr10197913 7408 7319 7154 3149 3022 2840 2797 2672 2180 2117 1666 1219 829 791 513 506 272 196 48038 7200 1499 420 ----
NM_001014809chr42879 341 --3139 133 58 --
NM_001014812chr151181 ------
NM_001014831chr191628 --2540 518 --
NM_001014832chr191628 --2540 518 --
NM_001014834chr191628 --2540 518 --
NM_001014835chr191628 --2540 518 --
NM_001014839chr12948 134 ------
NM_001014841chr12948 134 ------
NM_001015045chr462463 2280 2204 1917 783 530 ----12283
NM_001015877chrX52628 2454 2013 1021 386 23080 545 21977 664 --
NM_001015880chr10237 24 11353 149 --
NM_001017368chr1742340 1861 910 881 --32323 2008 883 --
NM_001017395chr363221 2817 2637 2490 899 266 23282 2670 ----
NM_001017405chr41353 1830 ----
NM_001017424chr141830 248 180 57 2453 361 21500 277 --
NM_001017425chr141830 248 180 57 2453 361 21500 277 --
NM_001017440chr7177225 7060 6744 6700 6013 5471 3240 2625 2491 2330 1915 1436 1427 1348 1277 1060 732 25063 399 37562 5473 620 11642
NM_001017926chr811739 ----11575
NM_001017962chr10--1877 1720 --
NM_001017969chr9--1157 ----
NM_001017975chr11200 ------
NM_001017977chr1----1121 --
NM_001017995chr594814 4715 4130 3793 3291 2971 2951 939 864 23737 747 --14499
NM_001017999chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_001017999chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_001018000chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_001018000chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_001018001chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_001018004chr152547 30 1616 ----
NM_001018006chr152547 30 1616 ----
NM_001018007chr152547 30 1616 ----
NM_001018020chr152547 30 1616 ----
NM_001018025chrX2254 35 ------
NM_001018037chr921080 539 ------
NM_001018038chr91108 ------
NM_001018054chr131257 1231 1011 11035 ----
NM_001018064chr942142 841 793 241 --3307 219 211 --
NM_001018065chr995445 5435 5082 4992 4253 3875 1730 420 169 44572 3939 3741 1407 --25044 1733
NM_001018066chr995445 5435 5082 4992 4253 3875 1730 420 169 44572 3939 3741 1407 --25044 1733
NM_001018074chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_001018075chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_001018076chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_001018077chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_001018078chr9179 ------
NM_001018088chr15--1135 ----
NM_001018090chr1542073 2037 547 323 32793 361 151 1606 --
NM_001018091chr1542183 2147 657 433 32903 471 261 1716 --
NM_001018100chr152692 67 ------
NM_001018102chr1542073 2037 547 323 32793 361 151 1606 --
NM_001018108chr1591765 1421 903 861 783 583 493 359 118 --31563 335 145 --
NM_001018111chr753832 3638 3526 976 152 ----22654 155
NM_001020658chr121248 645 11080 11416 --
NM_001020658chr121248 645 11080 11416 --
NM_001020825chr5--1122 --1152
NM_001023567chr157877 801 737 614 573 311 211 11789 ----
NM_001023587chr341128 821 809 48 --1848 --
NM_001024024chr142763 168 ----1907
NM_001024070chr142759 164 ----1903
NM_001024094chr553365 2473 1195 1006 534 42647 997 500 201 11372 23148 2677
NM_001024218chr142668 230 1615 ----
NM_001024372chr841999 912 533 366 22271 542 11968 --
NM_001024380chr861778 629 329 301 231 82 22482 1618 ----
NM_001024381chr861778 629 329 301 231 82 22482 1618 ----
NM_001024401chr1642843 2291 1897 1101 --12068 --
NM_001024460chr631205 1112 304 ----11220
NM_001024463chr151259 --1201 --
NM_001024647chr1277395 6252 5084 4828 1970 1854 571 54955 3050 1827 1213 962 1115 --
NM_001024649chr542459 1977 1045 1022 22231 642 12021 --
NM_001024660chr331354 1302 1117 21095 197 ----
NM_001024666chrX3483 448 249 --2539 450 --
NM_001024668chr121701 ------
NM_001024808chr1222724 1030 12448 --12754
NM_001024809chr17258 48 ------
NM_001024847chr352405 1828 1530 952 907 1700 1954 --
NM_001024934chr63612 101 47 --1122 --
NM_001024935chr63612 101 47 --1122 --
NM_001024936chr63612 101 47 --1122 --
NM_001024937chr17----2286 79 --
NM_001024948chr143432 1263 336 225 23525 3237 22487 1228 --
NM_001024959chr33874 864 297 --1822 --
NM_001024960chr33874 864 297 --1822 --
NM_001025068chr351746 1693 1418 1335 95 1489 ----
NM_001025069chr351746 1693 1418 1335 95 1489 ----
NM_001025076chr1085523 5472 4691 2019 677 349 332 141 --34693 2009 1441 --
NM_001025077chr10126881 6830 6049 4995 4952 2035 1707 1690 1499 549 280 249 1274 26051 2799 --
NM_001025079chr393503 3357 2821 2692 2577 2545 1596 949 784 42701 865 702 305 1776 --
NM_001025081chr1841216 1181 455 341 --1223 --
NM_001025090chr1841216 1181 455 341 --1223 --
NM_001025092chr1841216 1181 455 341 --1223 --
NM_001025101chr1841216 1181 455 341 --1223 --
NM_001025105chr541024 1018 984 341 11081 ----
NM_001025107chr172536 1670 499 476 337 251 104 --3501 459 208 --
NM_001025107chr172536 1670 499 476 337 251 104 --3501 459 208 --
NM_001025202chr72281 57 ------
NM_001025252chr862043 384 371 213 192 125 13155 11214 --
NM_001025253chr862043 384 371 213 192 125 13155 11214 --
NM_001025266chr374563 3558 3409 1310 1051 397 69 14377 --14086
NM_001025356chr1272550 1085 827 594 427 368 234 12890 22724 1928 --
NM_001025366chr621709 1519 --11248 --
NM_001025366chr621709 1519 --11248 --
NM_001025367chr621709 1519 --11248 --
NM_001025367chr621709 1519 --11248 --
NM_001025368chr621709 1519 --11248 --
NM_001025368chr621709 1519 --11248 --
NM_001025369chr621725 1535 --11264 --
NM_001025369chr621725 1535 --11264 --
NM_001025370chr621709 1519 --11248 --
NM_001025370chr621709 1519 --11248 --
NM_001025389chr1121181 355 --1555 --
NM_001025390chr1121181 355 --1555 --
NM_001025580chrX84039 4029 3718 1700 1258 398 328 85 33779 3634 802 --22968 2704
NM_001025595chr471323 1118 1099 560 356 237 223 11471 1142 --
NM_001025603chr131019 534 95 11379 21021 982 1177
NM_001025616chr421384 1311 11747 41648 1637 697 427 --
NM_001025777chr241603 1031 231 122 11110 11398 --
NM_001025780chr941373 580 54 34 ------
NM_001029858chr6113120 2720 2533 2224 2151 967 832 698 659 507 409 12132 1509 1950
NM_001029859chr1152296 2273 1866 191 157 --32275 2267 1825 --
NM_001029863chr662625 2492 2084 2038 979 485 1308 ----
NM_001029875chr532235 1922 1172 ----22461 149
NM_001029882chr12584 568 --1210 --
NM_001029882chr12584 568 --1210 --
NM_001029884chr641078 938 637 333 12649 ----
NM_001029955chr442722 365 301 209 3668 571 352 1276 1212
NM_001029998chr411304 ------
NM_001030006chr1752488 947 772 614 300 --2646 616 --
NM_001030007chr1692979 2542 1307 1282 1184 832 531 396 243 --53755 3716 1064 772 585 --
NM_001030055chr1464726 1616 1179 1115 1076 127 2907 375 --13767
NM_001030272chr111435 ------
NM_001030273chr111435 ------
NM_001031677chr52407 65 ------
NM_001031679chr1282807 2494 2270 1232 554 305 267 255 --13533 --
NM_001031690chr752567 980 662 433 411 --22255 993 1824
NM_001031695chr22104714 4483 4460 4213 4078 3571 1869 830 461 191 34881 4348 1643 34002 3920 3914 --
NM_001031711chr561822 1600 1234 491 168 70 --31241 634 223 --
NM_001031716chr221129 98 1114 11092 --
NM_001031723chr42159 37 126 ----
NM_001031732chr473230 2594 2442 506 332 270 141 13153 ----
NM_001031804chr1684420 4170 3640 3521 2855 1033 1022 554 14215 --12738
NM_001031812chr521882 413 ------
NM_001032221chr93592 585 81 --11654 11395
NM_001032280chr631683 1338 606 --21201 327 --
NM_001032282chr841344 1093 506 242 1353 ----
NM_001032288chr2031584 1450 1328 ------
NM_001032289chrX2156 118 ------
NM_001032293chr173594 543 191 --144 --
NM_001032296chr1382851 2800 1997 963 912 754 59 35 --2728 465 --
NM_001032380chr102493 445 21490 61 11229 --
NM_001032393chrX4714 495 171 161 1781 1151 --
NM_001032394chr652637 2475 2462 1939 537 22447 1025 --11942
NM_001032395chr652504 2342 2329 1806 404 22314 892 --11809
NM_001033025chr121228 411 --11219 --
NM_001033044chr141786 447 423 206 11539 ----
NM_001033045chr274152 4075 3939 3894 3492 1554 261 ----24078 3015
NM_001033047chr442519 2458 2244 46 12082 11690 2261 82
NM_001033056chr141786 447 423 206 11539 ----
NM_001033057chr332041 1583 834 --11883 --
NM_001033059chr641576 820 802 639 32008 1422 269 ----
NM_001033081chr151760 1530 714 467 70 ------
NM_001033082chr151760 1530 714 467 70 ------
NM_001033087chr2083173 2842 2818 2691 811 267 202 123 33228 2734 238 ----
NM_001033112chr51722 ------
NM_001033117chr3144923 4686 4551 4483 4052 3655 3588 3546 3292 3258 1590 1084 579 491 14068 13492 13483
NM_001033503chr51365 ------
NM_001033507chr12728 421 1669 ----
NM_001033518chr791959 1951 1938 1092 1006 892 661 569 242 1684 --11095
NM_001033519chr791959 1951 1938 1092 1006 892 661 569 242 1684 --11095
NM_001033520chr791959 1951 1938 1092 1006 892 661 569 242 1684 --11095
NM_001033557chr241296 316 38 30 11194 140 --
NM_001033561chr174774 176 168 146 ------
NM_001033566chr17------2961 696
NM_001033568chr17------2961 696
NM_001033578chr852170 2127 2083 393 278 11514 ----
NM_001033602chr1331876 1073 597 1571 12669 --
NM_001033723chr862573 2483 1989 552 473 81 1862 --1123
NM_001033756chr621643 1453 --11182 --
NM_001033756chr621643 1453 --11182 --
NM_001033925chr1031751 541 177 11618 11753 --
NM_001034837chr51659 1117 1203 --
NM_001034838chr51659 1117 1203 --
NM_001034841chr16105526 4368 3739 1812 1762 1669 1643 1351 1081 45 ------
NM_001034845chr41449 1264 ----
NM_001034850chr531520 1390 1056 11310 ----
NM_001034852chr1422044 570 ------
NM_001034954chr1062973 2496 2298 858 775 262 ------
NM_001034955chr1062973 2496 2298 858 775 262 ------
NM_001034956chr1062973 2496 2298 858 775 262 ------
NM_001034957chr1062973 2496 2298 858 775 262 ------
NM_001035chr131277 366 171 21198 1041 ----
NM_001035003chr41186 --1913 1189
NM_001035004chr41186 --1913 1189
NM_001035235chr51459 ------
NM_001035260chr103429 324 215 1462 ----
NM_001035511chr122109 1444 --52010 1871 1409 617 121 --
NM_001035512chr142216 1551 114 56 --52117 1978 1516 724 228 --
NM_001035513chr142216 1551 114 56 --52117 1978 1516 724 228 --
NM_001035521chr21669 --1157 --
NM_001037132chr742262 2145 1736 1706 ------
NM_001037133chr742262 2145 1736 1706 ------
NM_001037163chr72350 61 ------
NM_001037164chr731973 476 349 ------
NM_001037174chr251900 1893 1824 1757 1589 31516 1431 836 ----
NM_001037317chr152741 2685 2616 2487 2468 --21941 45 --
NM_001037334chr183560 426 325 1287 ----
NM_001037339chr141237 547 406 383 1118 21203 513 --
NM_001037340chr141237 547 406 383 1118 21203 513 --
NM_001037341chr141237 547 406 383 1118 21203 513 --
NM_001037341chr141237 547 406 383 1118 21203 513 --
NM_001037535chrX3522 307 83 11476 21363 443 --
NM_001037536chrX3522 307 83 11476 21363 443 --
NM_001037540chrX3522 307 83 11476 21363 443 --
NM_001037553chr2145108 4448 3529 753 34909 4244 3968 25154 3568 --
NM_001037631chr21157 3879 457 436 ----
NM_001037954chr1173122 1376 1350 892 730 678 457 13115 22521 157 22242 1353
NM_001038493chr231359 571 543 ------
NM_001038640chr153279 268 254 --3945 869 642 --
NM_001038702chr562783 1879 1811 1736 962 615 22766 279 11881 --
NM_001038707chr142213 819 649 114 --2593 518 --
NM_001038707chr142213 819 649 114 --2593 518 --
NM_001039350chr721384 548 --2688 35 --
NM_001039465chr143479 100 30 ------
NM_001039479chr1482018 1825 1554 1534 894 807 406 277 12288 12089 --
NM_001039538chr233570 1353 874 1300 1747 --
NM_001039574chr13935 691 85 --1937 --
NM_001039577chr183121 3100 1711 1574 1332 384 279 239 --1944 11647
NM_001039580chr441438 1311 669 381 34239 3820 1155 24504 1742 --
NM_001039590chrX62944 1524 1163 599 400 62 23974 3193 11165 13548
NM_001039591chrX62944 1524 1163 599 400 62 23974 3193 11165 13548
NM_001039618chr1175846 5818 5152 5015 4852 4502 2242 45769 3773 796 702 --140
NM_001039649chr13------1205
NM_001039690chr1692382 2062 1894 1715 872 332 291 254 211 --1213 --
NM_001039693chr2104108 4091 3993 3932 3571 3450 3398 985 363 185 12809 23896 1109 1366
NM_001039711chr15886 831 782 197 109 --2824 208 --
NM_001039712chr15886 831 782 197 109 --2824 208 --
NM_001039762chr10166 ------
NM_001039802chr121309 433 11398 121 1897
NM_001039840chrX144324 3889 3727 2376 1665 1544 1181 1058 962 771 684 571 134 84 21486 179 1955 --
NM_001039888chr1--1539 ----
NM_001039916chr1241012 156 83 56 --185 --
NM_001039917chr1241012 156 83 56 --185 --
NM_001039918chr1241012 156 83 56 --185 --
NM_001039919chr1241012 156 83 56 --185 --
NM_001039920chr1241012 156 83 56 --185 --
NM_001039937chr13123680 3188 2930 2909 2736 2704 2675 2650 2604 2543 695 139 22717 1236 33704 857 165 13930
NM_001039960chr1251750 1434 1321 1313 271 ------
NM_001040001chr611716 21875 45 12050 --
NM_001040058chr42505 91 ------
NM_001040060chr42505 91 ------
NM_001040101chr41251 1225 ----
NM_001040108chr1483311 2585 2412 1255 778 460 262 152 2856 563 --21011 885
NM_001040110chr751753 1621 1362 257 121 11411 ----
NM_001040113chr162825 791 --130 --
NM_001040142chr251924 1587 950 918 422 12349 ----
NM_001040143chr251924 1587 950 918 422 12349 ----
NM_001040144chr1692382 2062 1894 1715 872 332 291 254 211 --1213 --
NM_001040146chr1692382 2062 1894 1715 872 332 291 254 211 --1213 --
NM_001040152chr744753 3851 1626 1604 13800 ----
NM_001040153chr132365 97 1899 1103 --
NM_001040167chr761210 1187 1106 900 376 321 ------
NM_001040172chr561519 1337 1279 1209 555 149 21322 1142 ----
NM_001040173chr561519 1337 1279 1209 555 149 21322 1142 ----
NM_001040181chr32960 730 2330 207 ----
NM_001040182chr32960 730 2330 207 ----
NM_001040183chr32960 730 2330 207 ----
NM_001040195chr12630 46 ----1633
NM_001040199chr32960 730 2330 207 ----
NM_001040200chr32960 730 2330 207 ----
NM_001040202chr442477 1977 538 104 11711 198 --
NM_001040214chr632312 1883 621 138 2274 210 --
NM_001040260chr441177 1050 1029 447 11147 2420 388 --
NM_001040261chr441177 1050 1029 447 11147 2420 388 --
NM_001040273chr1052109 2097 1863 1538 225 11843 11311 --
NM_001040280chr621110 403 1593 --1234
NM_001040284chr1665574 4495 4174 4121 2352 934 65203 5145 5082 4691 1512 1318 ----
NM_001040402chr482915 2714 2343 1044 973 793 784 718 22924 1140 32569 365 114 --
NM_001040409chr261010 941 913 880 710 383 --1317 --
NM_001040429chr1353511 2295 1204 308 158 23358 3060 11206 13266
NM_001040441chr164029 3955 1627 1594 494 293 --167 23333 1270
NM_001040446chr54872 658 523 358 ------
NM_001040450chr1552468 1845 877 645 183 12614 ----
NM_001040453chr1552468 1845 877 645 183 12614 ----
NM_001040455chr1161301 485 409 309 289 47 1842 ----
NM_001040610chr15126 ------
NM_001040619chr131319 414 224 ------
NM_001040624chr832082 2071 2037 --147 --
NM_001040625chr832082 2071 2037 --147 --
NM_001040626chr832082 2071 2037 --147 --
NM_001040627chr832082 2071 2037 --147 --
NM_001040628chr832082 2071 2037 --147 --
NM_001040629chr832082 2071 2037 --147 --
NM_001040630chr832082 2071 2037 --147 --
NM_001040653chr392523 1986 1780 1750 1656 414 274 240 76 2793 784 --12005
NM_001040665chr794723 4654 4451 4045 1925 1840 1824 1456 1201 24817 1426 11458 --
NM_001040666chr71153 1519 ----
NM_001040708chr821032 972 ------
NM_001040709chr162438 2389 2103 948 366 71 1975 12129 --
NM_001040712chr953256 3177 2928 2710 1303 13211 23227 1037 --
NM_001040875chr832331 1787 1748 1907 ----
NM_001040876chr431378 209 189 21431 1298 ----
NM_001042355chr16104825 4594 4305 2144 1891 1337 1191 821 503 333 14931 11605 14075
NM_001042357chr102956 136 ------
NM_001042358chr102956 136 ------
NM_001042360chr102956 136 ------
NM_001042363chr102956 136 ------
NM_001042389chr102956 136 ------
NM_001042390chr102956 136 ------
NM_001042392chr102956 136 ------
NM_001042395chr102956 136 ------
NM_001042399chr12----1489 --
NM_001042404chr121757 239 31896 522 175 1284 --
NM_001042406chr61128 1905 --1131
NM_001042412chr16104825 4594 4305 2144 1891 1337 1191 821 503 333 14931 11605 14075
NM_001042413chr964070 3732 2571 1113 193 56 2241 136 1525 12686
NM_001042424chr452740 828 574 513 368 13095 22296 409 --
NM_001042425chr631683 1338 606 --21201 327 --
NM_001042453chrX41370 1128 660 100 2350 300 ----
NM_001042473chr1062169 1904 1671 1660 767 552 21691 346 ----
NM_001042476chr1642191 1971 1532 597 11636 11824 22018 724
NM_001042481chr1432566 2247 660 --1116 --
NM_001042492chr1743320 3289 1153 898 --33488 189 78 --
NM_001042494chr1543578 3264 3166 926 53597 1262 755 744 237 21255 1075 --
NM_001042495chr1543578 3264 3166 926 53597 1262 755 744 237 21255 1075 --
NM_001042496chr1543578 3264 3166 926 53597 1262 755 744 237 21255 1075 --
NM_001042497chr1543578 3264 3166 926 53597 1262 755 744 237 21255 1075 --
NM_001042498chrX3293 255 123 ------
NM_001042506chrX61179 894 500 470 454 324 --11181 1528
NM_001042510chr8181 11501 21777 429 --
NM_001042511chr8181 11501 21777 429 --
NM_001042517chr133659 340 213 ------
NM_001042533chr333056 2668 725 ----12971
NM_001042537chrX61831 968 675 487 435 182 11923 41604 579 493 306 --
NM_001042539chr1621070 251 1976 ----
NM_001042543chr421321 1116 ------
NM_001042550chr921638 126 11427 21832 1640 1807
NM_001042555chr1284287 4152 3515 1841 1127 897 554 462 54760 1297 1070 313 95 23375 1849 1900
NM_001042599chr2217824 7711 7687 7618 7583 7160 6439 6149 6132 5562 5380 2639 2163 2116 1958 1426 869 678 536 345 333 47601 6168 5147 2471 106816 6541 6441 5516 5477 2805 2603 1743 1584 65 --
NM_001042601chr353149 2076 622 316 290 --1666 --
NM_001042603chr12114728 3913 3898 3284 1808 1497 1432 1202 882 238 148 23709 1740 34844 4773 1793 --
NM_001042604chr394321 3929 3754 3295 3133 1643 1077 469 49 33043 1385 152 23931 37 --
NM_001042632chr2032546 2236 496 --21924 510 --
NM_001042633chr2032546 2236 496 --21924 510 --
NM_001042669chr421384 1311 11747 41648 1637 697 427 --
NM_001042681chr182403 2246 2159 2103 1934 687 561 302 11863 ----
NM_001042682chr182403 2246 2159 2103 1934 687 561 302 11863 ----
NM_001042682chr182403 2246 2159 2103 1934 687 561 302 11863 ----
NM_001042683chr651730 1188 1153 301 169 --11155 1172
NM_001042749chrX1725 1636 ----
NM_001042750chrX1725 1636 ----
NM_001042751chrX1725 1636 ----
NM_001043318chr14114001 3946 3919 3623 2510 1279 1098 792 667 613 574 34156 3886 1623 23532 2558 --
NM_001043351chr11298 31809 398 125 2858 374 --
NM_001044305chr611648 ------
NM_001044385chr242693 1164 845 450 23794 2744 2789 776 --
NM_001044722chr521882 413 ------
NM_001044723chr521882 413 ------
NM_001046chr562966 2294 973 666 372 255 32812 2465 112 ----
NM_001048183chr143581 3525 3432 621 23423 220 23629 623 --
NM_001049chr1472354 770 629 600 541 331 241 ------
NM_001077628chr11263 1683 ----
NM_001079874chr131712 435 309 11526 21945 437 --
NM_001083620chr432587 2402 184 1265 --1963
NM_001092chr172863 363 3834 390 342 11708 --
NM_001095chr1221490 117 --21517 1206 --
NM_001099678chr3125841 5700 5192 4495 4028 2475 2398 1741 1062 635 562 289 15992 42481 2176 1488 489 14278
NM_001100108chr1157870 7763 6836 6047 5271 5177 3226 2752 2210 1807 1539 1202 1095 1020 837 47099 5991 2972 2276 11417 --
NM_001106chr3219587 8439 7869 7716 7670 7573 7299 7293 7271 6741 3385 3184 3075 2900 2644 2445 2199 1718 710 343 316 89223 8834 6714 6062 2549 857 566 524 27077 2801 19129
NM_001111chr172536 1670 499 476 337 251 104 --3501 459 208 --
NM_001113490chrX33056 2690 2387 43659 2955 2275 2262 --32656 2586 62
NM_001117chr1872068 2007 1840 1587 818 545 164 32238 2079 656 11846 --
NM_001119chr451494 1425 1374 1362 335 11535 ----
NM_001121chr1051798 1712 1314 1194 631 11304 --11370
NM_001122679chr51856 ------
NM_001125chr361791 1544 1503 644 208 50 167 2188 52 --
NM_001126chr12937 794 1139 ----
NM_001128chr1692979 2542 1307 1282 1184 832 531 396 243 --53755 3716 1064 772 585 --
NM_001135chr151281 ----1655
NM_001140chr171212 --2244 197 1132
NM_001144chr1621189 1162 11335 ----
NM_001146chr831995 898 415 --11858 --
NM_001148chr432039 1694 331 ------
NM_001154chr42294 168 ------
NM_001157chr102533 277 --1203 --
NM_001167chrX56676 4851 2457 1437 1009 24727 341 14890 1827
NM_001173chr1464726 1616 1179 1115 1076 127 2907 375 --13767
NM_001174chrX42088 1969 309 54 --2428 56 --
NM_001177chr1272264 2222 1748 1558 405 220 52 ------
NM_001178chr111435 ------
NM_001179chr4122 1186 ----
NM_001186chr213779 136 108 13105 12523 --
NM_001192chr162211 72 ------
NM_001197chr221106 ------
NM_001200chr2031080 972 799 ------
NM_001204chr2147577 7346 7071 6348 5223 4727 2671 2256 2088 1462 1351 1272 595 488 75706 2442 2157 2132 1472 1419 1306 27396 1995 16341
NM_001206chr962787 2445 2197 1031 457 126 42973 2139 495 311 --12373
NM_001219chr792108 1844 1734 1554 1503 864 743 597 340 --31566 1394 348 1361
NM_001222chr10--11860 11656 --
NM_001232chr13140 127 107 1405 1114 1177
NM_001233chr761867 1727 840 831 567 172 22134 159 ----
NM_001235chr112692 592 ------
NM_001239chr52129 115 ----1136
NM_001241chr221816 127 12406 ----
NM_001241chr221816 127 12406 ----
NM_001254chr171107 --1216 --
NM_001256chr17112947 2726 2328 1997 1032 974 966 749 276 254 203 --12330 --
NM_001257chr1621503 196 --11055 --
NM_001268chr136829 777 770 256 71 31 --11081 --
NM_001269chr13172 157 149 --4409 276 151 126 --
NM_001270chr56858 809 415 130 33 23 1983 1849 --
NM_001271chr1532295 1112 734 32783 2734 163 1736 --
NM_001273chr122385 379 ------
NM_001275chr141320 --1402 --
NM_001277chr112907 799 1261 ----
NM_001280chr192614 189 ------
NM_001282chr1752488 947 772 614 300 --2646 616 --
NM_001283chr72679 124 1605 2463 194 --
NM_001284chr52503 232 ------
NM_001290chr46919 850 319 154 147 102 --1204 --
NM_001293chr114436 387 128 99 1452 1101 --
NM_001304chr1763811 3201 2436 1143 880 464 13587 ----
NM_001310chr1262670 2388 1962 1231 904 348 2792 403 12343 --
NM_001313chr42879 341 --3139 133 58 --
NM_001315chr671938 1695 1544 1527 1425 907 269 1309 1782 21899 55
NM_001316chr203373 333 94 ------
NM_001326chr112479 44 ------
NM_001329chr102438 292 ------
NM_001331chr11122648 2288 2229 1964 1893 1879 1785 1121 943 317 150 77 --52064 1766 1728 1030 945 --
NM_001332chr551534 1140 478 240 63 ------
NM_001343chr551698 1099 638 601 577 1169 1640 --
NM_001344chr142241 55 1225 ----
NM_001346chr342613 1912 871 552 --1334 --
NM_001349chr2--196 ----
NM_001351chr321281 1145 21771 1358 11127 --
NM_001356chrX12496 ----1759
NM_001362chr141239 11007 ----
NM_001364chr11134376 4365 3871 3308 3266 3176 3155 3111 2932 2897 1441 1215 500 64445 3811 3659 1613 1042 898 43244 3178 1825 859 --
NM_001385chr81113 1154 ----
NM_001386chr8111710 1618 1600 1587 743 725 405 398 352 80 69 1893 21589 777 1355
NM_001387chr543004 2515 1213 812 --42870 2273 742 713 --
NM_001389chr213575 440 64 ------
NM_001391chr1831029 482 453 21010 283 --1485
NM_001396chr2152655 2593 957 288 231 --1431 --
NM_001400chr141242 1010 353 35 11166 ----
NM_001401chr911416 11345 1389 --
NM_001406chr1761240 1126 406 365 345 241 21361 469 ----
NM_001408chr111469 11329 21098 355 --
NM_001412chrX83705 2933 2870 2528 954 720 286 32 43654 3333 1345 540 ----
NM_001416chr17----1173 --
NM_001417chr1261936 1664 568 126 117 22 1400 ----
NM_001419chr19134819 4411 4153 4052 3907 3833 3509 3277 1861 952 486 223 61 23884 380 54029 3164 1747 1239 488 13493
NM_001420chr1912227 13171 ----
NM_001421chrX21766 556 --11372 --
NM_001422chr1131058 204 94 --1520 --
NM_001426chr23570 544 472 --1641 --
NM_001427chr792133 1910 1819 1769 1754 1466 771 729 283 11383 1825 --
NM_001430chr241570 641 557 158 ------
NM_001431chr671137 957 931 882 855 248 163 1461 --1983
NM_001438chr1102583 799 514 506 369 339 310 252 208 185 43647 1076 288 262 9480 474 468 451 440 387 254 233 215 --
NM_001439chr121228 411 --11219 --
NM_001448chrX161 ------
NM_001449chrX31078 1021 129 ------
NM_001451chr1641277 1167 974 506 ------
NM_001453chr621210 654 1337 11526 --
NM_001458chr72644 602 ------
NM_001460chr1103490 3473 3462 3246 3230 2561 1169 395 169 127 11360 13432 --
NM_001463chr23303 185 152 1817 ----
NM_001482chr152327 156 --1724 1672
NM_001483chr72213 135 ------
NM_001491chr632563 1801 482 12486 ----
NM_001497chr942423 2084 582 543 1502 42468 2425 2169 2062 --
NM_001498chr64890 456 444 414 ------
NM_001521chr21669 --1157 --
NM_001530chr1471108 1100 983 404 271 166 24 1366 2308 141 --
NM_001533chr191100 --149 --
NM_001542chr142462 587 361 349 12721 31935 374 54 12684
NM_001543chr554621 3750 3557 1681 293 --34009 3022 701 --
NM_001546chr63483 225 186 ------
NM_001552chr1721094 222 ------
NM_001560chrX32531 2126 499 1955 ----
NM_001570chr321415 215 ------
NM_001587chrX71859 1710 793 449 408 239 154 --31814 1505 795 22134 615
NM_001609chr1054337 3684 3674 3018 155 24410 171 14134 13241
NM_001616chr243140 2622 2580 135 32871 1049 399 12533 --
NM_001621chr752830 1873 929 837 630 12497 ----
NM_001621chr752830 1873 929 837 630 12497 ----
NM_001634chr641576 820 802 639 32008 1422 269 ----
NM_001635chr7----1972 1436
NM_001642chr1131240 1228 1144 --1463 --
NM_001650chr1863547 3469 2976 2892 1340 879 21236 264 13016 --
NM_001654chrX1150 --2421 386 --
NM_001655chr1172077 1880 1604 776 757 655 324 --31886 1538 107 11607
NM_001656chr531656 1457 818 21345 344 --21659 432
NM_001659chr1272462 2433 1021 399 359 318 161 --22139 2093 12100
NM_001660chr32648 222 ------
NM_001662chr72285 102 --190 --
NM_001663chr1472425 870 833 400 333 192 166 31093 590 374 2896 182 180
NM_001664chr34917 284 197 81 --1772 --
NM_001665chr113545 147 131 --1107 --
NM_001668chr182281 1971 1920 1787 644 477 256 69 1657 32283 592 131 --
NM_001677chr12833 825 ------
NM_001678chr17111646 1601 1479 1406 1357 641 600 416 268 190 135 --41703 1408 634 137 --
NM_001682chr1272766 2601 2581 2505 2368 1126 843 32865 2827 65 12583 22084 1171
NM_001683chr342291 642 435 191 11736 1163 --
NM_001684chr1123628 3589 3399 3383 2826 2626 1465 1299 1272 1044 733 585 33772 3460 84 31684 669 530 23567 540
NM_001690chr3112225 2103 1698 930 593 359 293 215 181 87 32 --31664 312 34 --
NM_001693chr83804 418 62 11162 1441 1976
NM_001701chr931014 242 42 11270 ----
NM_001702chr81558 --1560 --
NM_001706chr32936 838 --1883 1104
NM_001709chr1162609 2472 2353 2223 884 857 22200 2182 --1341
NM_001711chrX21076 683 ----1748
NM_001731chr122774 338 2309 188 ----
NM_001740chr161494 --2496 465 --
NM_001742chr721527 1208 21866 1396 ----
NM_001743chr2----156 --
NM_001746chr542459 1977 1045 1022 22231 642 12021 --
NM_001754chr21114253 3989 3646 3467 3364 3101 2978 2864 2756 652 593 --32866 2816 629 1977
NM_001755chr1632209 524 342 1663 42100 807 687 344 --
NM_001759chr12124985 4290 3580 3415 3396 3342 3274 1532 1265 1047 843 58 15206 11341 --
NM_001768chr251295 1225 821 470 47 --1448 172
NM_001773chr151427 1288 1093 1081 549 ------
NM_001777chr393503 3357 2821 2692 2577 2545 1596 949 784 42701 865 702 305 1776 --
NM_001785chr12306 209 ----1235
NM_001788chr74874 757 629 222 1725 1768 --
NM_001791chr121309 433 11398 121 1897
NM_001792chr183813 257 247 ------
NM_001797chr16----1186 --
NM_001806chr1912485 22958 2716 ----
NM_001810chr203769 605 112 --4807 564 219 204 --
NM_001812chr41324 ------
NM_001819chr201207 ------
NM_001829chr43617 102 66 ------
NM_001833chr91108 ------
NM_001839chr13153 146 34 2586 184 ----
NM_001842chr91107 ------
NM_001844chr121145 --1158 --
NM_001845chr131546 11237 ----
NM_001854chr11256 21502 1110 2550 258 --
NM_001855chr91886 1336 ----
NM_001859chr963069 2996 852 349 263 99 12925 13076 13422
NM_001874chr1274548 4294 3440 3431 3224 2065 1845 34760 3501 574 11962 --
NM_001884chr53564 549 501 --1108 --
NM_001890chr4--1355 ----
NM_001891chr42341 144 --169 --
NM_001892chr541024 1018 984 341 11081 ----
NM_001893chr171280 --1282 --
NM_001895chr2031000 839 777 1208 ----
NM_001896chr16142 ------
NM_001901chr621054 676 ------
NM_001903chr51916 --1668 --
NM_001904chr34873 829 311 304 11010 ----
NM_001920chr121308 1627 ----
NM_001921chr421176 1095 167 ----
NM_001923chr113481 101 21 1475 1589 --
NM_001932chr172651 192 --2731 658 --
NM_001936chr721384 548 --2688 35 --
NM_001938chr131803 1717 180 11886 --2748 370
NM_001939chrX93520 1480 1223 818 263 252 225 82 60 --13834 --
NM_001946chr124997 789 357 187 ------
NM_001949chr633005 2152 2087 ------
NM_001951chr8199 ------
NM_001955chr61893 1224 ----
NM_001957chr4--32247 2107 1848 11975 --
NM_001964chr54777 745 208 172 ------
NM_001967chr33245 194 76 ------
NM_001969chr1473922 3634 3497 3313 2686 1402 1082 1993 --11405
NM_001973chr14383 274 268 157 ------
NM_001981chr132191 1499 615 ------
NM_001982chr12----2205 105 --
NM_001987chr1284108 4022 3435 1476 1377 1203 605 504 44072 3636 3498 1340 44272 4168 3686 1478 --
NM_001993chr12748 250 ------
NM_001995chr42971 441 ------
NM_001998chr32502 374 ------
NM_001999chr531521 542 115 ------
NM_002006chr465484 5432 1487 1185 1123 1103 35793 3598 448 15494 24159 203
NM_002010chr13--1386 ----
NM_002015chr1383329 3301 2971 1260 671 418 150 142 184 --198
NM_002023chr141345 351 208 133 ------
NM_002024chrX42024 1431 552 467 ------
NM_002025chrX158435 8037 7556 7444 6987 6883 6786 3403 3218 2091 1977 1787 917 796 101 46759 6309 2545 1202 98882 8783 7452 7446 6993 6819 6233 1154 643 17707
NM_002026chr241032 992 111 96 ------
NM_002028chr144912 863 197 25 1945 21280 1133 --
NM_002033chr11113696 3305 3174 3156 3033 3023 3000 1470 895 778 218 1576 ----
NM_002035chr1883689 3571 3118 3094 2519 1605 924 647 --1518 --
NM_002037chr62413 321 ------
NM_002040chr21103055 2149 1273 1261 1060 1045 1030 907 851 33 1958 11062 --
NM_002045chr31124 --1145 --
NM_002048chr921065 444 1551 ----
NM_002051chr102906 797 1449 153 --
NM_002061chr12267 112 --11637 --
NM_002063chrX31126 359 351 1259 ----
NM_002065chr141786 447 423 206 11539 ----
NM_002068chr193665 507 221 ------
NM_002069chr721443 174 21687 1475 ----
NM_002071chr182684 671 ----1515
NM_002072chr97934 889 784 754 333 325 310 --1364 1821
NM_002074chr151669 1612 507 490 347 --21661 1618 --
NM_002076chr1242841 2562 389 226 33266 2377 2278 145 11103
NM_002077chr972035 1691 1671 868 690 609 390 1529 ----
NM_002080chr165839 723 247 232 34 1113 --1726
NM_002084chr52851 269 --2330 103 --
NM_002086chr1742225 2061 275 256 21913 1555 1247 --
NM_002092chr454969 3928 3116 638 60 24922 4120 11877 23358 1625
NM_002103chr193755 721 202 --2930 731 --
NM_002106chr41109 ------
NM_002107chr11428 ------
NM_002111chr452860 2784 545 279 169 12903 1607 11234
NM_002114chr6167 1199 ----
NM_002126chr17124185 4027 3593 3317 3261 3195 3133 2933 1019 533 213 82 22968 648 11183 12952
NM_002130chr53522 266 173 --1550 --
NM_002131chr621341 1097 --11343 --
NM_002135chr122510 377 ------
NM_002137chr772022 1894 959 706 440 366 283 ------
NM_002138chr42694 346 --1254 --
NM_002139chrX1567 1207 1605 --
NM_002140chr91453 1783 ----
NM_002141chr7144 ------
NM_002145chr172299 24 --1148 --
NM_002146chr171449 ------
NM_002148chr23658 607 113 1542 ----
NM_002158chr283618 2915 2871 2791 1132 737 368 305 42367 876 730 117 23170 2853 130
NM_002160chr92555 185 --1429 --
NM_002166chr22495 127 --1240 1612
NM_002182chr342685 2195 847 338 ------
NM_002187chr5--1405 11138 --
NM_002193chr231721 1423 1391 ------
NM_002196chr2041041 904 191 181 --1258 --
NM_002196chr2041041 904 191 181 --1258 --
NM_002199chr43885 854 168 --1887 --
NM_002202chr51770 1927 ----
NM_002210chr252496 1302 1274 994 746 33038 1266 468 ----
NM_002211chr103942 789 244 --1254 --
NM_002214chr774835 4814 3967 3529 1471 1071 650 44471 3953 3757 1750 23969 3531 24337 521
NM_002222chr321083 235 134 ----
NM_002223chr1233084 3016 396 42457 1089 903 32 ----
NM_002224chr63732 707 309 ------
NM_002225chr152557 44 --2388 24 --
NM_002227chr131306 383 192 21174 812 ----
NM_002228chr131200 773 284 --1491 --
NM_002230chr175442 122 106 41 30 ------
NM_002232chr151394 1266 991 380 210 1431 1212 --
NM_002234chr123602 171 133 1126 ----
NM_002235chr1231600 1436 1112 --11297 --
NM_002240chr21148 --168 --
NM_002241chr183105 2938 2360 984 943 858 402 37 11944 33149 2181 189 12941
NM_002245chr11641 ------
NM_002247chr1031996 644 432 1836 21474 108 --
NM_002253chr431210 228 75 --1987 --
NM_002254chr262274 2057 785 579 271 172 --42059 2049 1740 374 1582
NM_002264chr3124569 4446 4212 3769 3425 1577 1121 1017 766 566 354 231 44846 1705 1102 474 1313 23061 1569
NM_002265chr172855 330 1841 ----
NM_002266chr17----2248 79 --
NM_002267chr1351852 1788 348 110 24 22393 2096 ----
NM_002268chr331778 1626 1585 --1761 --
NM_002270chr5165347 5125 4256 4115 3955 3884 2174 1985 1910 1851 1663 1656 1596 1029 699 94 44918 4645 2168 693 11412 --
NM_002271chr131418 --21570 55 --
NM_002293chr152801 2634 2408 983 126 22657 2383 11937 --
NM_002296chr161672 1649 1562 1096 459 370 1338 ----
NM_002309chr2243053 3012 2053 287 12036 22599 1129 --
NM_002310chr5105873 5442 4434 2402 2255 2190 1829 1818 455 230 25570 1064 26121 2126 45824 4437 1394 718
NM_002317chr52374 302 ----1274
NM_002332chr121746 ------
NM_002333chr193903 310 84 ----11123
NM_002334chr1142109 1667 797 42 --1314 1641
NM_002336chr1234967 1542 1337 13701 15025 14305
NM_002345chr122559 519 1275 ----
NM_002350chr821030 918 ------
NM_002351chrX21694 466 11732 ----
NM_002355chr1251417 1312 1148 934 169 21285 1237 ----
NM_002356chr662357 1979 1953 1005 272 37 32643 907 674 ----
NM_002358chr42479 266 1155 ----
NM_002359chr1763076 1081 957 718 435 170 34329 2732 743 3933 251 93 --
NM_002360chr732331 2253 1915 12259 ----
NM_002373chr153375 72 46 --1478 --
NM_002374chr233570 1353 874 1300 1747 --
NM_002376chr141160 ------
NM_002382chr1461313 1061 933 519 495 101 160 2122 114 --
NM_002383chr162893 74 1799 ----
NM_002385chr1841216 1181 455 341 --1223 --
NM_002387chr544786 4496 3587 374 11990 24621 421 --
NM_002395chr621526 243 2387 50 ----
NM_002397chr532069 1865 276 1261 11800 --
NM_002398chr211382 ------
NM_002399chr1521317 899 ------
NM_002408chr144753 727 318 149 ------
NM_002430chr2262528 2357 1763 829 438 289 11687 71747 1726 998 992 831 440 350 1458
NM_002448chr43689 133 102 --1649 --
NM_002449chr511207 1229 1222 --
NM_002451chr993832 3401 3238 1278 1201 855 656 492 364 --23368 3246 --
NM_002469chr123312 203 70 ------
NM_002470chr17190 ------
NM_002473chr2231030 453 383 --21282 999 --
NM_002479chr12749 309 --1232 --
NM_002480chr1221398 1285 1472 ----
NM_002481chr1197379 7225 6934 6706 6148 5578 5353 5142 5051 3122 2837 2639 1956 1671 1643 1568 686 119 60 67853 4893 2882 2747 2431 702 37381 4969 2685 16674
NM_002486chr922272 1620 42198 634 378 101 ----
NM_002492chr3136 ------
NM_002499chr1542009 1828 913 218 --22414 691 12215
NM_002500chr23931 422 81 ------
NM_002501chr1941530 1278 1246 1173 --53206 2557 1609 1599 867 11176
NM_002505chr621452 102 ----1204
NM_002508chr141575 1552 141 24 --1302 --
NM_002509chr203697 627 550 ------
NM_002514chr811126 --1470 --
NM_002515chr1421541 40 --11643 --
NM_002516chr19----128 --
NM_002518chr251165 977 936 914 396 --11167 1980
NM_002519chr1111221 --1571 --
NM_002520chr52197 78 ------
NM_002522chr17103814 3463 3133 1585 1330 1322 1098 979 510 390 11014 2361 86 --
NM_002545chr11145033 4847 4655 4589 4574 4563 4025 3910 2066 1494 1309 1142 946 530 11071 35145 3528 280 11970
NM_002547chrX83775 2902 1133 939 745 739 195 62 23566 1172 31375 1041 41 11437
NM_002553chr7--1391 ----
NM_002556chr1131348 854 298 32062 1892 1362 11338 --
NM_002569chr1511295 --11347 --
NM_002572chr112349 339 --179 --
NM_002577chr3143939 3712 3127 2951 1543 1519 902 633 445 424 406 337 77 27 54056 3966 2809 245 54 22822 1508 --
NM_002578chrX1144 1115 ----
NM_002581chr9105315 5089 4581 1590 1555 1472 846 566 428 53 34447 3908 1566 ----
NM_002583chr122472 244 4531 420 217 192 ----
NM_002586chr62314 249 --2299 219 --
NM_002589chr42151 51 ------
NM_002592chr20280 38 ------
NM_002595chr1251751 1717 1582 1276 39 21945 1526 11753 --
NM_002597chr1135 1335 --1274
NM_002600chr141237 547 406 383 1118 21203 513 --
NM_002608chr2231108 593 318 11584 11110 --
NM_002613chr16105324 4743 4392 3874 3550 1633 1457 1354 1294 430 14936 21083 536 11920
NM_002628chr351141 1032 783 444 388 1349 ----
NM_002629chr101881 1798 ----
NM_002631chr12369 80 --1363 --
NM_002633chr14470 399 381 224 ----1227
NM_002645chr1172858 2428 2157 1125 767 577 196 1378 ----
NM_002648chr651330 1002 978 971 496 --1437 --
NM_002653chr51177 ------
NM_002655chr8124767 4256 4185 1733 1671 1488 1232 1208 1151 836 827 360 53851 3684 3343 845 763 11618 --
NM_002656chr621079 1042 11114 ----
NM_002657chr2083692 3196 2603 2508 2462 2427 1442 317 13078 33215 2863 1161 --
NM_002669chr4127 ------
NM_002670chr341513 1459 468 171 1425 11334 11466
NM_002674chr12--127 ----
NM_002687chr1431311 434 70 11326 ----
NM_002693chr151305 --1307 --
NM_002697chr1132 1237 ----
NM_002698chr1992585 2367 2333 2247 2225 1963 1145 1137 887 11117 ----
NM_002699chr131509 1463 74 --21091 534 --
NM_002702chr123665 417 159 1799 3934 698 399 --
NM_002706chr21579 1477 ----
NM_002709chr282568 2392 1279 1025 990 923 861 99 12846 ----
NM_002711chr71731 1685 ----
NM_002713chr12274 227 1110 2883 251 21017 230
NM_002714chr6----4971 297 95 56 --
NM_002715chr511124 ------
NM_002716chr1153452 3149 990 728 157 23283 918 33500 2548 1116 --
NM_002718chr331850 1723 50 ----22698 740
NM_002719chr1462017 2009 1920 1762 506 43 12354 12278 --
NM_002721chr94498 378 360 123 ------
NM_002725chr154415 4343 3634 3249 254 13551 23239 92 --
NM_002730chr193906 462 233 --1245 --
NM_002731chr162959 2798 2726 279 252 240 1668 2658 281 --
NM_002734chr1721747 241 1701 21535 25 --
NM_002737chr1766229 6086 2449 2017 1639 1387 46341 6049 1974 697 35798 4041 954 --
NM_002740chr322803 1005 12360 11846 --
NM_002742chr141537 1717 1667 --
NM_002745chr2283310 3104 1547 1243 604 488 336 119 22762 1530 34229 3521 338 --
NM_002752chr5------1522
NM_002755chr152775 692 1845 ----
NM_002763chr14559 510 200 48 ------
NM_002764chrX3856 679 630 --1645 --
NM_002779chr101542 --2441 200 --
NM_002806chr14--1233 ----
NM_002808chr31113 ------
NM_002815chr172101 23 ------
NM_002816chr171276 ------
NM_002821chr64828 563 178 153 --1632 --
NM_002822chr1221860 678 21231 130 ----
NM_002827chr2021480 1269 1187 ----
NM_002828chr182994 312 1985 ----
NM_002829chr9----130 --
NM_002830chr2----1293 --
NM_002833chr1581492 1162 627 499 410 320 151 110 --21140 370 --
NM_002835chr71301 ------
NM_002836chr201180 ------
NM_002839chr953256 3177 2928 2710 1303 13211 23227 1037 --
NM_002840chr131260 386 326 11152 ----
NM_002841chr32434 66 ------
NM_002843chr1153133 2339 911 889 683 --3891 742 526 11315
NM_002844chr621270 296 --21365 372 --
NM_002845chr182625 123 ----133
NM_002847chr721490 460 ------
NM_002850chr1941146 777 769 240 --21055 800 --
NM_002851chr71170 ------
NM_002855chr1153508 3111 902 704 258 --13598 33672 2763 1345
NM_002858chr11355 ------
NM_002868chr12102403 2266 2089 2032 1990 1933 1659 538 408 308 --21935 1826 --
NM_002869chr1141954 1407 511 390 --21761 96 31526 746 61
NM_002874chr952241 883 823 299 283 31921 942 548 1590 --
NM_002880chr33174 165 63 1567 174 --
NM_002882chr22124 194 133 --
NM_002886chr3135034 4893 3636 3439 3365 3299 1866 1153 931 582 548 419 224 11143 31998 1257 584 11304
NM_002890chr53859 103 75 1266 ----
NM_002892chr1451663 1654 1433 237 123 --11435 --
NM_002895chr201618 2219 78 1847 --
NM_002897chr23619 589 539 1563 1591 --
NM_002898chr124640 612 260 185 ----1675
NM_002902chr153679 645 240 138 ----
NM_002906chr1121518 720 1241 2924 383 --
NM_002911chr192554 348 --1320 --
NM_002912chr61791 1218 ----
NM_002924chr12237 202 2629 559 ----
NM_002931chr61313 --1212 --
NM_002938chr441912 362 151 131 1647 21943 1337 --
NM_002940chr431378 209 189 21431 1298 ----
NM_002941chr361316 1172 1021 600 518 440 ------
NM_002942chr321100 317 --1207 --
NM_002945chr171849 ------
NM_002953chr13804 508 292 --1510 --
NM_002956chr122507 158 2888 352 ----
NM_002958chr31722 ----1854
NM_002959chr162854 651 612 569 499 261 13123 34129 3331 1124 1329
NM_002970chrX2347 215 ------
NM_002971chr321022 765 ------
NM_002973chr12------1405
NM_002977chr262927 957 910 714 92 66 2722 317 22450 732 --
NM_002979chr12762 746 ------
NM_002994chr411965 21661 323 11572 21520 1222
NM_002995chr14665 541 267 116 184 1596 --
NM_002996chr1651947 1820 633 525 271 --11390 --
NM_002998chr841796 1719 788 452 145 ----
NM_003001chr142216 1551 114 56 --52117 1978 1516 724 228 --
NM_003010chr1752432 1787 706 700 231 ------
NM_003011chr94589 384 133 31 11194 1214 --
NM_003016chr1742040 1843 781 281 11517 1749 --
NM_003026chr93951 914 373 --21112 1078 11243
NM_003027chr153391 131 88 1397 ----
NM_003028chr963767 3350 2709 985 703 357 --11193 12716
NM_003029chr171431 1382 1099 1090 1031 252 43 11168 --11111
NM_003030chr331579 708 87 21949 764 11347 --
NM_003031chr163860 630 382 --2760 91 --
NM_003034chr12148111 7982 7805 7580 6941 6326 5903 3211 3163 2961 2088 1035 637 482 15486 36677 5588 942 --
NM_003035chr12766 297 ----123
NM_003042chr351769 1734 789 412 228 --11569 --
NM_003043chr344331 4230 4104 1178 11566 13749 --
NM_003046chr8105302 5092 4207 3396 1280 1023 952 831 731 713 1562 24056 954 --
NM_003051chr131809 1701 1512 --2779 663 11296
NM_003060chr541204 1071 871 812 11135 3873 471 398 --
NM_003068chr84851 312 274 203 ------
NM_003069chrX2582 255 ------
NM_003071chr331833 1500 1376 2338 260 31693 1446 1378 --
NM_003074chr362285 1882 1842 1740 536 407 32108 1656 93 ----
NM_003077chr173848 768 580 ------
NM_003079chr175920 290 274 197 172 ------
NM_003081chr203763 390 61 21073 330 1190 --
NM_003088chr7--2718 115 3878 712 291 --
NM_003093chr61178 ----1217
NM_003095chr12--1312 1280 --
NM_003099chr15115926 5919 4347 2464 2125 1308 1197 753 710 550 43 12218 16052 --
NM_003100chr51358 ------
NM_003104chr1541020 983 957 92 11273 ----
NM_003107chr652416 2218 897 669 346 --1535 --
NM_003108chr2147269 6890 6626 5531 5425 5316 5086 5003 4651 4621 1843 1802 282 259 1785 56853 1819 1042 499 24 25503 4501
NM_003110chr1711049 --1772 --
NM_003112chr762782 2761 2669 2634 1017 514 ------
NM_003128chr241961 1740 761 585 ----140
NM_003130chr751210 926 362 66 53 ------
NM_003131chr621755 1437 --11876 22290 64
NM_003133chr11353 ------
NM_003137chr682206 1532 733 626 312 294 273 77 2620 351 --180
NM_003139chr111801 ------
NM_003140chrY2105 47 ------
NM_003144chr631396 861 328 --1686 --
NM_003152chr17125 1206 ----
NM_003155chr872264 2255 918 857 555 355 246 --32422 2322 2233 --
NM_003161chr1783446 3251 2885 2307 1392 1247 1118 1081 23554 364 ----
NM_003162chr21824 1912 2995 99 --
NM_003164chr11----1432 1443
NM_003165chr93691 684 180 --11753 11494
NM_003174chr104663 337 310 202 ------
NM_003178chr372238 2155 1595 744 592 499 489 31988 1907 112 12173 --
NM_003184chr8122 128 --1265
NM_003185chr2051348 1231 1034 95 50 11202 ----
NM_003186chr111430 ------
NM_003188chr61159 --1161 --
NM_003189chr183343 3101 3044 2152 1356 1336 333 171 ------
NM_003199chr1875453 4957 3936 3816 3660 1696 305 25003 4039 23708 807 15629
NM_003201chr101716 1110 1722 --
NM_003204chr1721377 1286 --2598 242 --
NM_003211chr1241568 1263 688 532 ----1370
NM_003216chr2293335 3170 2973 2816 2153 2111 2083 2045 1333 --31025 845 654 13338
NM_003217chr1231908 584 58 --2619 222 --
NM_003220chr631683 1338 606 --21201 327 --
NM_003221chr663427 3034 2801 1647 313 262 33002 2867 803 43379 1092 577 505 --
NM_003223chr165727 649 309 133 121 ------
NM_003234chr372452 2148 2117 1824 861 678 457 --22320 275 --
NM_003236chr252785 2402 2150 1297 138 13279 ----
NM_003242chr352405 1828 1530 952 907 1700 1954 --
NM_003244chr181437 --1290 --
NM_003246chr1531972 251 114 21466 1332 ----
NM_003253chr2161651 1544 1511 1288 647 548 ----1417
NM_003257chr1541012 905 349 85 ------
NM_003262chr374174 4150 3908 3774 3705 2060 880 ------
NM_003269chr641257 1115 1007 360 21179 23 ----
NM_003274chr2162768 2082 809 502 406 202 1358 11190 --
NM_003275chr921118 598 11184 1106 --
NM_003285chr12548 516 ------
NM_003286chr2031106 820 795 1858 --11144
NM_003288chr2041585 1537 961 308 1602 ----
NM_003290chr193403 78 54 --1191 --
NM_003292chr13726 531 182 2594 463 ----
NM_003297chr122328 208 ------
NM_003298chr3185606 5362 5260 5162 5093 4827 4682 4253 4149 3851 3816 2452 2031 1522 1403 799 207 177 ----25851 4439
NM_003304chr311411 1570 ----
NM_003309chr651881 1752 585 132 115 11217 ----
NM_003311chr111256 ------
NM_003317chr142172 103 ------
NM_003319chr2271 43 2934 158 ----
NM_003320chr1164376 4130 4122 2772 233 161 13062 ----
NM_003336chrX1768 11068 --1933
NM_003338chr1011454 1782 ----
NM_003339chr551508 1492 616 277 65 21570 651 ----
NM_003342chr1793107 2876 2567 2477 850 688 562 432 394 1517 --12195
NM_003344chr71154 21436 22 11095 --
NM_003347chr2252070 1519 479 269 218 1555 1355 --
NM_003348chr1251416 1274 403 129 60 11148 1412 --
NM_003349chr2031584 1450 1328 ------
NM_003352chr27971 675 255 220 110 38 26 ------
NM_003360chr4--1234 ----
NM_003369chr112208 73 32401 2070 276 --12497
NM_003370chr192220 32 --2594 212 --
NM_003371chr922164 457 --1762 --
NM_003373chr1061806 1582 1556 1386 524 167 --1367 1527
NM_003376chr621709 1519 --11248 --
NM_003376chr621709 1519 --11248 --
NM_003379chr61114 1757 ----
NM_003387chr232189 1151 381 1180 12323 --
NM_003390chr115812 737 366 309 241 --1729 --
NM_003392chr384352 3932 3606 2978 2692 1725 1711 1106 23187 3088 13155 --
NM_003394chr123659 299 64 ----157
NM_003400chr2----1121 --
NM_003403chr14178 2807 332 ----
NM_003404chr2021850 1757 --1701 --
NM_003405chr222672 548 1578 1214 --
NM_003406chr861681 1596 1559 1453 1445 541 --11740 --
NM_003407chr192580 493 --1124 --
NM_003409chr181327 1159 1253 11251
NM_003410chrX22075 1240 22069 608 ----
NM_003411chrY41642 1151 676 138 ------
NM_003412chr352840 2284 983 189 120 22301 177 22927 1119 --
NM_003413chrX51901 1786 790 578 452 --1178 --
NM_003418chr3126 --1240 --
NM_003423chr1922529 1004 1302 ----
NM_003432chr51194 ------
NM_003439chr721407 1243 32653 1365 284 135 --
NM_003442chr111255 141 ----
NM_003452chr92663 183 2385 239 ----
NM_003453chr131677 --1679 --
NM_003457chr173594 543 191 --144 --
NM_003458chr383406 2921 2801 2628 2519 1621 382 263 22908 1320 33836 3780 943 --
NM_003462chr12461 89 11789 21508 1271 --
NM_003463chr652648 2564 1059 834 257 ------
NM_003466chr21653 --32488 574 549 --
NM_003468chr273027 1117 1109 1089 997 677 240 23342 1354 23504 889 12807
NM_003471chr312339 21882 657 ----
NM_003472chr63520 135 87 11231 189 --
NM_003473chr1011088 1233 2861 746 --
NM_003478chr1142856 2357 341 201 11212 ----
NM_003481chr123479 399 108 --1102 --
NM_003482chr1232477 2124 534 --32629 2516 2126 --
NM_003483chr1292955 2786 2704 2063 1179 1037 882 542 98 32389 1069 624 ----
NM_003489chr2162841 2216 845 686 610 421 42951 2833 752 368 --1613
NM_003495chr6----142 --
NM_003496chr72792 302 ------
NM_003498chr1631048 1016 646 --1371 --
NM_003503chr12819 471 31320 497 280 1473 --
NM_003505chr741570 574 382 133 11606 3608 396 121 --
NM_003506chr82949 267 11331 31275 828 269 --
NM_003507chr2123 1508 ----
NM_003509chr6--155 ----
NM_003511chr6--141 ----
NM_003512chr6--154 ----
NM_003517chr1134 ------
NM_003520chr6--158 ----
NM_003521chr6--155 ----
NM_003522chr6136 ------
NM_003524chr6--134 ----
NM_003527chr6--137 ----
NM_003529chr6--142 158 --
NM_003531chr6--138 ----
NM_003536chr6--142 ----
NM_003538chr6147 ----150
NM_003542chr6165 ----168
NM_003545chr6152 ----155
NM_003547chr6157 ----160
NM_003548chr1----144 --
NM_003558chr91285 ------
NM_003559chr1773788 3191 3087 2902 2407 930 606 1302 33113 2500 282 --
NM_003566chr1283495 3120 2543 1262 975 498 456 358 22278 198 1756 --
NM_003567chr1--134 ----
NM_003569chr62571 154 2513 273 1592 --
NM_003573chr191216 ----1235
NM_003574chr18115331 5138 3493 1927 1902 1353 961 478 348 281 250 23885 1013 35319 3495 1700 23502 1492
NM_003575chr7----11475 --
NM_003576chr1382851 2800 1997 963 912 754 59 35 --2728 465 --
NM_003581chr24959 300 243 118 --1245 --
NM_003583chr1252865 2821 809 791 398 33211 1022 123 31069 780 400 --
NM_003586chr161411 --1615 1461
NM_003587chr6137 --139 --
NM_003589chr1331286 1223 293 1147 ----
NM_003590chr253701 3690 2628 1601 150 11530 ----
NM_003592chr7------1112
NM_003597chr242296 1719 911 158 32200 540 447 2324 47 --
NM_003603chr421904 1537 21493 473 --11469
NM_003607chr152653 1614 1565 914 735 11574 13849 --
NM_003615chr3103466 2781 2566 1518 1289 982 832 788 291 183 53957 3476 3058 996 972 ----
NM_003618chr221190 1003 ----11006
NM_003626chr111477 41376 1225 318 285 ----
NM_003627chr11177 1423 ----
NM_003628chr21601 --130 --
NM_003629chr162953 2373 1337 1325 1109 78 ------
NM_003632chr171287 --2757 687 --
NM_003633chr532172 941 609 11702 22382 327 --
NM_003644chr17155945 5018 4554 4414 4290 4274 4080 2171 2149 1996 1696 1482 1472 1253 485 21559 1165 64904 4233 4187 4034 2120 1354 11616
NM_003658chr11--1871 ----
NM_003659chr221075 367 ------
NM_003660chr192312 260 --2674 262 --
NM_003663chr31850 2653 567 ----
NM_003664chr5--171 1188 --
NM_003670chr351475 1172 982 298 222 21125 928 1479 --
NM_003671chr943079 2926 1363 735 --12997 --
NM_003672chr111518 --1681 --
NM_003677chr122747 439 171 1740 --
NM_003679chr153134 2986 2422 2257 1325 1412 1321 --
NM_003685chr19--2646 211 2971 799 --
NM_003688chrX2263 59 ------
NM_003692chr91381 ------
NM_003701chr131945 1810 ----
NM_003704chr42671 440 ------
NM_003713chr14699 632 434 315 21370 1305 ----
NM_003714chr552770 2684 844 268 28 21898 1172 ----
NM_003718chr72546 48 ------
NM_003722chr352718 2478 1840 767 658 22472 561 ----
NM_003743chr252167 1762 873 583 196 ------
NM_003744chr1431106 1008 370 1102 11191 --
NM_003749chr1341689 934 805 344 1880 1187 --
NM_003750chr102828 725 2849 751 1815 --
NM_003754chr111140 ------
NM_003758chr1531498 604 70 177 ----
NM_003758chr1531498 604 70 177 ----
NM_003759chr473961 3518 3388 773 428 376 156 34007 2612 479 31107 746 349 13521
NM_003760chr12540 264 1791 ----
NM_003763chr2083142 2826 2738 2553 1959 566 523 482 ------
NM_003766chr171241 1498 ----
NM_003768chr121683 591 11723 41558 1166 548 313 --
NM_003772chr114986 381 335 50 1177 ----
NM_003780chr12464 213 ------
NM_003783chr121137 1057 1378 ----
NM_003787chr1831149 636 610 1685 2625 599 --
NM_003794chr31871 ------
NM_003795chr61200 --1218 --
NM_003798chr9172 ------
NM_003800chr642398 2051 1545 764 32057 1948 425 22400 1875 --
NM_003816chr821304 86 11178 ----
NM_003822chr132023 1205 497 ------
NM_003825chr152616 208 --11391 169
NM_003829chr91192 ------
NM_003831chr1861550 701 504 450 416 124 ------
NM_003840chr862119 2045 1871 1750 1670 782 11469 144 --
NM_003842chr851716 1592 703 399 45 22410 169 ----
NM_003858chr143614 506 27 ------
NM_003861chr1462521 2057 1986 1952 575 241 22221 371 ----
NM_003870chr1581997 1774 1504 1348 484 219 73 58 --1179 --
NM_003872chr2123038 2711 2679 1878 1224 1197 1148 640 477 391 271 76 1470 42219 867 689 437 --
NM_003873chr1061942 826 756 386 318 125 21016 78 1979 --
NM_003877chr123785 691 317 1241 ----
NM_003883chr51167 140 ----
NM_003884chr31497 2159 151 ----
NM_003885chr1742344 2310 614 113 --21909 392 --
NM_003887chr231924 1721 489 11514 ----
NM_003888chr1541333 1305 1098 362 --21232 1100 --
NM_003895chr2142048 771 291 217 31354 747 645 1594 --
NM_003902chr13723 534 125 1672 --2850 557
NM_003907chr3121 --1327 --
NM_003908chr2021342 326 1298 ----
NM_003909chr8112978 2697 2398 2286 1887 1191 1022 690 490 241 149 11907 22400 116 --
NM_003913chr674212 3979 3210 2904 1577 1369 1130 43232 1106 1032 497 13874 --
NM_003919chr7294 69 ------
NM_003931chr63612 101 47 --1122 --
NM_003932chr2251803 1733 1648 1364 768 ------
NM_003934chr92334 89 ------
NM_003936chr22435 341 1842 2783 413 11002
NM_003938chr193990 210 183 ------
NM_003939chr10134018 3463 3278 3089 2971 2937 2860 2781 2721 2587 989 685 637 1291 33332 1492 897 --
NM_003940chr3143 ------
NM_003941chr751711 1625 729 450 125 ------
NM_003947chr311195 ------
NM_003948chr432425 1946 1054 21012 232 1744 --
NM_003953chr142632 956 873 824 3385 309 269 22610 2598 --
NM_003955chr171390 ------
NM_003957chr1121096 851 ------
NM_003958chr693741 3188 2992 2705 2636 887 871 741 685 ------
NM_003966chr5217266 7141 7077 6635 6173 5864 5854 5753 5571 5322 5310 5238 2960 2803 2741 2726 2714 2707 2682 2338 328 17176 22648 1206 12637
NM_003968chr32278 130 ------
NM_003971chr17183 170 ----
NM_003980chr64590 416 171 65 31050 1043 389 ----
NM_003983chr1674393 3837 3691 1116 866 614 102 24401 3714 14045 13515
NM_003987chr102672 559 --42020 1860 1699 1564 --
NM_003988chr102749 636 --42097 1937 1776 1641 --
NM_003989chr102608 495 --41956 1796 1635 1500 --
NM_003990chr102608 495 --41956 1796 1635 1500 --
NM_003994chr1223371 1641 11548 34347 1681 811 --
NM_003998chr41158 --1586 1144
NM_004006chrX42138 2039 2028 526 --12158 11721
NM_004007chrX42138 2039 2028 526 --12158 11721
NM_004009chrX42138 2039 2028 526 --12158 11721
NM_004010chrX42138 2039 2028 526 --12158 11721
NM_004011chrX42138 2039 2028 526 --12158 11721
NM_004012chrX42138 2039 2028 526 --12158 11721
NM_004013chrX42138 2039 2028 526 --12158 11721
NM_004014chrX42138 2039 2028 526 --12158 11721
NM_004015chrX42138 2039 2028 526 --12158 11721
NM_004016chrX42052 1953 1942 440 --12072 11635
NM_004017chrX42138 2039 2028 526 --12158 11721
NM_004018chrX42052 1953 1942 440 --12072 11635
NM_004020chrX42138 2039 2028 526 --12158 11721
NM_004021chrX42052 1953 1942 440 --12072 11635
NM_004022chrX42052 1953 1942 440 --12072 11635
NM_004023chrX42052 1953 1942 440 --12072 11635
NM_004024chr121228 323 ------
NM_004028chr1863547 3469 2976 2892 1340 879 21236 264 13016 --
NM_004035chr1795184 4986 4977 4912 3934 1663 894 556 251 11097 23941 116 14340
NM_004041chr114511 242 94 88 ----1245
NM_004050chr144967 685 609 395 ------
NM_004059chr92433 55 --1435 --
NM_004061chr52534 146 1645 ----
NM_004063chr83813 660 122 174 1746 --
NM_004067chr711253 11156 ----
NM_004075chr122532 435 159 ----
NM_004077chr1221231 957 --11106 --
NM_004078chr13943 911 147 144 ----
NM_004080chr711319 2968 301 --1445
NM_004081chrY21307 1191 21384 1204 11157 11789
NM_004087chr351554 459 79 57 26 41352 765 594 344 31334 461 65 --
NM_004093chr1383138 2986 2859 2818 2645 2379 2358 673 ------
NM_004094chr141370 32091 668 555 1311 12051
NM_004096chr1032015 1641 643 11362 21653 1532 1553
NM_004097chr21654 --1287 --
NM_004099chr951971 1646 1619 1571 83 --22087 1897 --
NM_004100chr652574 2385 1960 611 558 12261 ----
NM_004103chr85839 803 747 740 723 --3765 716 710 --
NM_004112chr1751636 1225 438 378 255 --2553 286 1381
NM_004114chrX21261 499 ------
NM_004117chr651666 1622 1484 756 413 42126 2115 1611 840 ----
NM_004124chr1472730 2722 2279 2238 627 354 230 1691 ----
NM_004134chr51599 ------
NM_004136chr1532906 1300 50 43012 710 469 26 ----
NM_004156chr81417 1606 ----
NM_004162chr331127 1012 934 1386 1812 --
NM_004163chr181110 ----1196
NM_004171chr11189283 9093 8506 8299 7392 7310 6532 3856 3520 3193 2490 1709 1681 1448 1040 710 567 326 49227 3285 1838 1825 89029 8247 6582 6576 6094 3768 3178 295 --
NM_004180chr22461 245 1184 ----
NM_004181chr41343 ------
NM_004186chr3----1377 150
NM_004193chr102406 189 ------
NM_004200chr1143233 2885 1092 544 1873 1239 12820
NM_004202chrY----1130 --
NM_004209chr161830 1950 ----
NM_004210chr102312 109 --1576 --
NM_004225chr821375 994 ------
NM_004226chr21111 ------
NM_004229chrX62123 1902 1616 1526 873 346 31738 748 155 11711 11843
NM_004232chr1831516 883 302 13322 32922 2902 758 --
NM_004233chr621110 403 1593 --1234
NM_004235chr9--161 ----
NM_004236chr151426 --2428 413 --
NM_004237chr52904 28 1583 1804 --
NM_004238chr2162 ------
NM_004261chr13629 377 28 1787 1836 --
NM_004263chr241613 1350 694 109 ------
NM_004272chr51677 --2592 347 --
NM_004273chr1084472 4457 4396 3731 3227 1559 1354 52 ------
NM_004274chr1472904 2888 2224 1171 347 316 218 1549 12986 12727
NM_004277chr64474 181 170 93 ------
NM_004279chr712333 22351 745 ----
NM_004281chr101172 ------
NM_004283chr19----2601 316 --
NM_004286chr2262605 2453 2380 655 647 387 --22841 631 --
NM_004293chr973459 2807 2765 2356 1437 312 224 13147 1119 --
NM_004296chr1493972 3432 2885 1603 1507 1410 1027 634 624 ------
NM_004302chr1212283 21106 726 21966 190 --
NM_004311chr1032139 638 611 12979 53055 2943 2549 2318 2149 --
NM_004316chr1231185 1098 1075 --1442 --
NM_004319chr172764 2506 2492 2436 2213 2007 850 11260 12522 --
NM_004326chr14989 804 369 342 11040 31147 995 844 --
NM_004327chr2232130 980 578 ------
NM_004329chr1021032 242 2405 149 1109 --
NM_004331chr841698 746 728 266 12090 32121 2027 195 --
NM_004337chr81260 ------
NM_004338chr18106926 6560 6049 5629 5135 4966 4695 4546 2025 553 56868 6795 2647 650 150 24697 1145 16308
NM_004342chr71253 12222 ----
NM_004344chrX4504 425 111 93 ------
NM_004349chr841303 1225 1194 228 --11022 --
NM_004352chr161428 ------
NM_004354chr41867 1300 ----
NM_004356chr112455 125 ----1173
NM_004370chr641879 1444 820 166 1763 21487 645 --
NM_004379chr2--1248 ----
NM_004380chr1672411 2219 1995 728 319 200 46 12336 123 130
NM_004382chr172730 722 11057 1724 --
NM_004384chr521882 413 ------
NM_004385chr55718 679 528 498 64 ------
NM_004389chr23633 230 34 ------
NM_004392chr1342651 1872 1845 927 21635 93 --12658
NM_004393chr341683 1627 1577 1468 ------
NM_004395chr53714 700 178 ------
NM_004396chr17146 ------
NM_004397chr1173755 3222 2997 2809 2751 187 77 13077 54019 1360 937 604 530 --
NM_004403chr71171 ------
NM_004405chr23931 917 401 1851 ----
NM_004411chr7--1266 ----
NM_004414chr2141175 622 484 302 ------
NM_004415chr61594 ------
NM_004416chr1211081 11037 1890 --
NM_004419chr101716 ----1296
NM_004423chr361092 1085 1075 1014 770 382 --22245 260 1394
NM_004426chr1231615 1284 646 --21577 1411 --
NM_004427chr141138 1114 780 422 1174 1296 --
NM_004428chr12800 251 ------
NM_004429chrX31030 960 59 --21032 143 --
NM_004430chr882608 2235 2172 2066 1107 998 796 28 2875 165 1798 1988
NM_004432chr952195 634 596 408 309 1276 1400 --
NM_004434chr1421894 295 1332 ----
NM_004436chr12217 203 --1144 --
NM_004437chr193409 3143 2900 2472 1234 1042 574 452 188 32346 988 235 22415 487 1755
NM_004438chr242547 1128 794 238 1416 22445 1017 --
NM_004440chr661568 1226 593 483 413 282 1739 11795 --
NM_004441chr341197 468 418 407 21278 1081 ----
NM_004447chr1211103 ------
NM_004449chr2111110 --21172 932 --
NM_004454chr372313 2174 1929 1608 886 863 108 --21812 658 --
NM_004457chr231630 1592 1079 21638 192 ----
NM_004458chrX52081 1942 1797 772 221 22102 1054 ----
NM_004459chr1751660 1596 1544 1511 548 31792 1517 1340 ----
NM_004468chr1158 --160 --
NM_004472chr52174 51 --153 --
NM_004480chr143703 532 181 ----1275
NM_004481chr162675 2469 2410 2290 2110 980 11906 ----
NM_004482chr23753 671 40 1914 1755 --
NM_004484chrX2337 302 --1322 --
NM_004485chr184376 3857 2804 2758 1067 443 180 28 23865 2814 42933 2766 2760 30 1183
NM_004494chr141222 945 808 133 --197 --
NM_004496chr1421155 150 --2316 305 --
NM_004497chr192682 293 --1606 --
NM_004499chr52436 352 1364 ----
NM_004500chr1451903 1522 624 252 187 1338 ----
NM_004502chr171375 ----1559
NM_004504chr232014 1059 500 --11903 12017
NM_004505chr1721515 422 --21382 549 11518
NM_004506chr62142 135 ------
NM_004514chr172587 436 22641 1166 3970 809 515 --
NM_004516chr1911266 2422 120 ----
NM_004519chr81193 ----1196
NM_004520chr51157 ------
NM_004529chr921146 573 ----1492
NM_004535chr2021493 347 ------
NM_004539chr184378 122 84 51 1388 2740 110 --
NM_004540chr211704 --1169 --
NM_004554chr1431506 1499 372 11575 2115 59 --
NM_004561chr1121273 628 1691 11150 --
NM_004571chr2153331 2961 2727 2314 2252 33238 1312 158 ----
NM_004575chr441463 1260 245 47 21581 73 2575 33 --
NM_004586chrX75215 5139 3386 1845 1243 949 669 14022 ----
NM_004592chr12----1242 --
NM_004593chr31896 1124 ----
NM_004598chr593278 3242 2927 2770 2121 937 817 591 268 12445 21179 357 1995
NM_004600chr121082 1008 41555 1426 1174 543 ----
NM_004602chr2021426 502 ------
NM_004606chrX3270 131 62 ------
NM_004612chr994548 3240 1171 826 666 214 190 114 28 44104 3612 1614 595 13775 --
NM_004627chr212710 517 ------
NM_004630chr1131040 274 253 1962 ----
NM_004631chr131257 1231 1011 11035 ----
NM_004634chr3154 1597 1575 --
NM_004637chr331288 1158 989 21117 857 21205 441 --
NM_004641chr102607 467 1121 ----
NM_004643chr144735 728 568 537 ----1745
NM_004645chr171746 1538 2748 281 --
NM_004654chrY2477 25 1561 ----
NM_004655chr1721253 990 ------
NM_004660chrY2723 655 ------
NM_004661chr5------31271 1218 301
NM_004663chr15--1262 ----
NM_004666chr63412 215 117 ------
NM_004670chr10237 24 11353 149 --
NM_004673chr1--31159 518 47 ----
NM_004686chr84611 565 437 348 21536 540 1493 --
NM_004687chr1731456 841 538 22004 1827 1272 11558
NM_004689chr14--1453 ----
NM_004690chr6--1156 ----
NM_004703chr1742350 1760 1566 794 32260 2026 531 ----
NM_004708chr19--196 ----
NM_004709chrX21566 1310 11256 ----
NM_004715chr183707 693 605 1620 ----
NM_004716chr113902 255 37 1863 ----
NM_004717chr741552 1387 1172 436 ----11390
NM_004718chr23647 55 44 ------
NM_004726chrX65679 5321 4300 3839 1693 51 35525 3559 736 45301 4852 1669 141 15155
NM_004733chr32236 153 ------
NM_004734chr1382955 2584 2281 1056 651 596 267 144 13017 22374 598 33053 120 106
NM_004736chr171716 1421 558 455 175 82 52 --21896 781 1751
NM_004737chr2241130 986 458 123 ------
NM_004739chr111562 --3535 457 75 --
NM_004742chr351865 656 620 362 127 1304 21247 184 --
NM_004744chr423684 3585 23531 711 ----
NM_004745chr836633 4953 829 35757 5516 946 26494 4512 15890
NM_004747chr1051400 306 266 146 63 --1331 --
NM_004748chr1583382 3264 2935 2903 2842 1362 631 302 23574 255 12870 24101 1332
NM_004755chr142359 208 ------
NM_004765chr16----166 --
NM_004768chr12321 52 ----1860
NM_004772chr52469 388 --11045 1332
NM_004774chr1732685 2144 607 23035 900 22152 345 12745
NM_004775chr184816 800 651 585 12116 1102 --
NM_004779chr53912 493 290 --1500 --
NM_004788chr1182264 2058 2051 1925 1906 291 101 87 --51893 495 293 89 72 --
NM_004796chr1412394 32252 2208 347 ----
NM_004798chr20113618 3536 3410 3107 2573 2444 1471 819 682 345 128 --32551 347 330 12872
NM_004801chr261569 1443 1159 1056 456 82 --1590 --
NM_004805chr231003 909 115 ------
NM_004815chr154672 4336 887 127 92 33452 1297 488 34359 4132 1463 --
NM_004821chr54628 620 606 188 --3743 591 329 --
NM_004822chr1753906 3082 2785 1334 926 --43830 1433 950 525 --
NM_004824chr6--11018 11382 --
NM_004831chr194926 810 751 181 --1768 --
NM_004834chr243099 3044 2679 305 12251 53412 3350 3070 1350 1325 12874
NM_004835chr32168 144 1100 ----
NM_004835chr32168 144 1100 ----
NM_004839chr152618 151 1285 1620 1154
NM_004841chr14805 745 290 190 1153 1975 --
NM_004842chr6--1136 1570 --
NM_004849chr631352 1340 506 1646 31342 1037 66 --
NM_004857chr1473743 3394 3308 1916 1476 1022 366 14010 ----
NM_004859chr17--12157 1261 --
NM_004863chr14125316 5134 5095 5061 3922 3511 3338 3326 1138 653 530 191 43487 1843 1309 551 33740 1246 749 --
NM_004865chr62146 108 143 ----
NM_004866chr594584 4519 3593 913 817 547 404 43 30 53534 1095 1019 1011 347 ----
NM_004869chr1841214 1150 156 96 21258 44 ----
NM_004871chr1753912 3739 3386 3112 387 33950 3928 1478 1465 13688
NM_004874chr82122 74 ------
NM_004879chr113651 331 56 1766 ----
NM_004887chr541133 884 295 117 --21001 973 --
NM_004888chr92881 299 ------
NM_004891chr21212 ------
NM_004896chr104611 344 239 130 1377 ----
NM_004897chr103925 832 640 1122 ----
NM_004898chr4102727 2674 2624 2590 2293 1995 730 696 648 479 ----22282 482
NM_004902chr202727 41 2538 226 ----
NM_004904chr7195995 5868 5588 4963 4955 4762 4700 4644 2579 2443 2095 1331 1283 683 500 489 318 231 55 1814 36528 4721 277 14352
NM_004906chr63563 154 94 ------
NM_004915chr212799 566 --1197 1790
NM_004922chr104664 328 221 146 ------
NM_004926chr1461614 1492 1464 1318 674 298 11507 21783 128 --
NM_004930chr12605 50 ------
NM_004937chr1731970 1658 239 1666 2894 505 --
NM_004938chr94461 429 377 74 1340 ----
NM_004947chr332187 429 248 12222 32587 2132 211 --
NM_004952chr16925 769 690 674 328 302 ------
NM_004955chr62603 540 ------
NM_004956chr793255 1432 1330 1122 974 878 816 135 38 11055 --33910 1139 881
NM_004957chr9179 ------
NM_004961chrX31352 603 523 --1569 --
NM_004964chr12558 524 ------
NM_004973chr631605 1156 290 11727 11115 --
NM_004975chr202243 80 ------
NM_004976chr1145197 5028 4485 3539 21765 1483 24191 3565 --
NM_004978chr131598 1354 593 1395 31600 507 220 --
NM_004979chrX31049 1035 51 ----11038
NM_004985chr1294422 4205 3934 1429 1210 893 708 666 553 11377 --2871 669
NM_004987chr2121 1328 ----
NM_004992chrX147051 7006 6995 6805 5696 5167 3096 2048 1371 1266 1240 956 340 250 45709 3126 1258 128 66534 6166 3075 3003 2050 1813 46417 5437 3335 1560
NM_004992chrX147051 7006 6995 6805 5696 5167 3096 2048 1371 1266 1240 956 340 250 45709 3126 1258 128 66534 6166 3075 3003 2050 1813 46417 5437 3335 1560
NM_004993chr1451380 1369 1246 1018 567 1439 ----
NM_004995chr141372 --3482 374 237 --
NM_004996chr1641789 1714 1630 1186 11682 ----
NM_004999chr674303 3693 1731 922 656 537 275 22985 836 14255 --
NM_005010chr742262 2145 1736 1706 ------
NM_005011chr751753 1621 1362 257 121 11411 ----
NM_005026chr131886 548 127 1513 ----
NM_005027chr1931119 207 195 --41108 197 155 149 --
NM_005028chr1042244 1632 828 333 --11679 --
NM_005032chrX--1115 1187 --
NM_005044chrX64272 4209 3263 1414 255 121 14596 21352 1335 13998
NM_005055chr112184 170 --147 --
NM_005056chr12124972 4157 4142 3528 2052 1741 1676 1446 1126 482 392 30 23953 1984 35088 5017 2037 --
NM_005063chr10113127 3003 2950 2450 952 817 673 339 264 238 24 --43766 3738 959 383 1241
NM_005065chr14134884 4080 3890 3760 3311 2160 2002 1903 1600 895 321 310 256 24184 469 24872 4808 --
NM_005066chr12717 199 ------
NM_005067chr32651 391 ------
NM_005076chr163608 3502 3252 2952 1375 1187 13150 1139 --
NM_005078chr1531452 1385 414 11477 1332 --
NM_005079chr862043 384 371 213 192 125 13155 11214 --
NM_005080chr221782 --4829 747 351 277 --
NM_005088chrX4911 578 230 179 --1913 --
NM_005095chr112173 21455 878 --1643
NM_005096chrX41114 1082 816 118 129 ----
NM_005097chr101294 2354 107 ----
NM_005099chr111253 --124 --
NM_005105chr11676 11915 ----
NM_005109chr392531 2354 2259 2228 2138 1701 1000 419 159 12046 1161 --
NM_005110chr52700 526 2301 35 ----
NM_005112chr431033 860 773 --1862 --
NM_005113chr142512 172 ------
NM_005114chr42449 436 ------
NM_005116chr2064353 4231 4098 271 216 142 34071 3527 736 1965 --
NM_005121chr1793689 2996 2890 2735 1408 1346 494 255 195 ------
NM_005124chr63870 323 136 --2179 143 --
NM_005126chr352040 2026 689 672 369 ------
NM_005128chr213702 655 638 ------
NM_005135chr1543578 3264 3166 926 53597 1262 755 744 237 21255 1075 --
NM_005151chr183560 426 325 1287 ----
NM_005153chr163110 87 76 --1103 --
NM_005154chr151466 1506 ----
NM_005156chr9125350 4960 4741 4553 3794 1964 1529 1443 1306 1148 622 196 45384 3581 2137 1700 24098 202 34963 1691 96
NM_005157chr941816 1749 1623 715 ------
NM_005160chr22106609 6199 6058 5813 5642 5039 2569 2104 1107 54 ----22064 2012
NM_005163chr142989 798 --1783 --
NM_005168chr231374 497 403 21314 1302 ----
NM_005184chr1931378 453 216 --21285 171 --
NM_005188chr11247614 7194 7130 5973 5907 5461 5352 2983 2902 2784 2461 2333 2307 2202 1753 1667 1367 1324 1235 1228 1001 614 549 86 27690 2685 77867 7364 5975 3138 2240 1378 1360 --
NM_005191chr341373 1044 981 112 --1361 --
NM_005194chr201546 ------
NM_005197chr14136155 5509 5385 4949 4808 4727 4408 4338 1734 1494 1467 1262 127 55471 4477 3847 259 143 24377 1473 --
NM_005202chr12198 40 11969 1891 2627 61
NM_005203chr10----1168 --
NM_005207chr2273618 3303 3168 2320 1251 419 55 22419 1235 ----
NM_005210chr2123 ------
NM_005214chr21120 3842 420 399 ----
NM_005219chr531566 398 128 1467 11660 --
NM_005221chr7126 1241 ----
NM_005222chr75253 229 206 189 171 2964 247 2759 216 --
NM_005228chr751609 1482 1432 247 191 21092 267 141 --
NM_005229chrX21245 397 2853 315 --11038
NM_005230chr121577 2243 122 ----
NM_005233chr362298 1006 969 825 512 163 22511 775 1827 --
NM_005235chr2217824 7711 7687 7618 7583 7160 6439 6149 6132 5562 5380 2639 2163 2116 1958 1426 869 678 536 345 333 47601 6168 5147 2471 106816 6541 6441 5516 5477 2805 2603 1743 1584 65 --
NM_005238chr1162959 2661 2347 1399 1039 866 --12575 --
NM_005241chr351240 958 945 484 391 21352 1069 2881 562 155
NM_005252chr141300 --1308 --
NM_005254chr1521345 1083 --11224 --
NM_005257chr1841286 1178 929 882 21308 1272 1392 11181
NM_005259chr21993 ------
NM_005261chr82235 28 2704 327 ----
NM_005264chr105950 814 767 668 170 1148 ----
NM_005268chr11225 --1227 --
NM_005276chr1221164 494 1120 --1579
NM_005276chr1221164 494 1120 --1579
NM_005277chr471603 1415 732 637 344 226 203 31763 1290 761 11605 --
NM_005291chr23835 654 302 --174 --
NM_005311chr772781 2616 2572 2393 1933 1795 782 11815 --11936
NM_005313chr1531008 866 319 ------
NM_005316chr112953 919 --1955 --
NM_005321chr6--155 ----
NM_005324chr1731700 463 320 41648 1374 835 125 ----
NM_005327chr4181 --1203 --
NM_005328chr82593 567 1713 ----
NM_005329chr1622264 1575 ------
NM_005336chr262149 2023 1888 1735 907 407 --22000 1725 --
NM_005339chr463941 3728 3537 2621 1720 565 ------
NM_005347chr9--1157 11700 --
NM_005349chr41433 2637 106 ----
NM_005354chr191563 --3584 533 251 --
NM_005359chr18136522 6461 5908 4985 4815 4164 4105 2494 2464 1167 826 743 300 75078 4353 1875 1617 545 321 109 24373 2388 --
NM_005369chrX1478 1159 135 --
NM_005370chr1921149 860 --11137 --
NM_005374chr1742418 2103 1784 614 11806 ----
NM_005375chr61388 182 ----
NM_005376chr12288 92 1316 1239 --
NM_005381chr2----125 --
NM_005385chr322499 2419 21084 1075 12149 --
NM_005386chr202732 207 --1587 --
NM_005388chr941344 1300 1051 73 41605 1443 693 89 11269 1112
NM_005392chr951736 1671 1353 1187 203 11194 ----
NM_005397chr753832 3638 3526 976 152 ----22654 155
NM_005398chr1021410 480 ------
NM_005399chr1114244 4002 3780 3558 3103 2925 2684 1583 896 705 580 44295 3549 2772 956 12797 11013
NM_005400chr292972 2869 2649 2456 2360 2246 1964 658 417 1610 32672 2666 959 12459
NM_005401chr11193 1250 ----
NM_005402chr761868 1743 1522 1375 1155 278 11589 ----
NM_005406chr181280 1607 ----
NM_005407chr1461578 1250 456 422 135 28 --1314 11290
NM_005409chr421098 111 ------
NM_005410chr52751 590 ------
NM_005412chr123182 172 80 --1493 --
NM_005417chr2051854 1827 1718 419 141 11724 1331 --
NM_005430chr123994 818 390 --1835 11046
NM_005433chr1842809 2503 689 309 --2864 691 --
NM_005436chr1094087 3934 3116 3094 2997 2788 1434 1183 705 23329 2747 1868 --
NM_005443chr44495 475 467 205 ------
NM_005445chr102296 266 1127 ----
NM_005455chr13743 657 529 2234 224 ----
NM_005458chr922134 1530 ------
NM_005465chr151667 1631 1553 814 793 1148 ----
NM_005467chr113164 151 63 2136 102 ----
NM_005471chr531253 497 50 11097 11040 --
NM_005475chr1252495 1132 1076 341 82 --1984 1813
NM_005479chr102601 565 ----1418
NM_005487chr2231911 527 338 2782 483 11635 --
NM_005488chr223737 229 127 --1117 --
NM_005493chr61269 ------
NM_005497chr1754202 3926 1552 711 605 35943 773 30 11427 11646
NM_005499chr194267 208 126 72 ------
NM_005501chr17----144 1395
NM_005502chr933054 1100 54 32953 2398 1243 ----
NM_005503chr1531019 785 319 ------
NM_005504chr12116312 5188 4287 2280 2040 1809 1578 1475 804 616 289 44422 2250 1953 1712 14373 34985 4715 2283
NM_005509chr52401 296 1731 11217 --
NM_005512chr1132036 1523 131 --11296 --
NM_005520chr51157 3773 728 707 ----
NM_005522chr761283 1006 315 298 111 83 1287 21255 104 11393
NM_005523chr741493 1338 1291 594 ------
NM_005524chr31328 ------
NM_005530chr1541449 1295 1170 560 --1130 --
NM_005536chr84471 386 105 36 ------
NM_005541chr221188 1058 --1991 --
NM_005542chr721707 1264 11338 ----
NM_005544chr221017 973 ------
NM_005552chr144578 532 184 167 ------
NM_005558chr11406 11031 2111 87 --
NM_005562chr131336 1218 676 ------
NM_005563chr14835 248 216 196 1675 --1720
NM_005570chr182954 825 21043 475 ----
NM_005572chr1--179 ----
NM_005573chr53747 145 101 ------
NM_005575chr52166 117 ------
NM_005578chr3115030 4823 4788 4670 3432 1921 1445 948 810 459 329 35135 4334 310 ----
NM_005584chr132231 113 ------
NM_005587chr152965 121 ------
NM_005593chr123507 448 435 1110 ----
NM_005595chr12978 130 1878 ----
NM_005596chr995499 5080 5026 4233 2523 2510 2461 2008 88 11785 32512 1441 677 --
NM_005599chr131189 996 529 ------
NM_005602chr321154 253 --1857 --
NM_005604chr61188 21877 494 2579 62 --
NM_005606chr143363 189 24 ------
NM_005607chr83976 146 34 --1787 --
NM_005610chr11941 --138 --
NM_005613chr122136 1696 31624 1452 659 ----
NM_005614chr71417 --11022 --
NM_005618chr61630 ------
NM_005625chr84999 788 340 119 --21001 884 1154
NM_005627chr62393 64 --1362 --
NM_005637chr182719 357 11933 --1631
NM_005638chrX11476 21419 77 11658 --
NM_005639chr1241771 1277 1252 44 21930 85 ----
NM_005644chr11417 --1363 --
NM_005647chrX63386 3157 3141 3066 866 671 --1840 13350
NM_005648chr8--136 ----
NM_005650chr22--11275 21086 404 --
NM_005652chr1641171 1011 828 817 1395 172 --
NM_005654chr51199 ------
NM_005655chr831093 506 242 1353 ----
NM_005657chr151158 ------
NM_005659chr222384 364 ------
NM_005665chr184408 4148 3988 3659 3563 3049 1472 167 --14927 13662
NM_005667chr2152 --1350 --
NM_005668chr5103308 3064 3025 2837 2802 1333 1295 578 545 36 24373 1172 14639 --
NM_005685chr71141 194 ----
NM_005688chr361194 1021 403 113 98 26 ------
NM_005707chr152456 438 --140 --
NM_005708chr13164 --1148 --
NM_005711chr52881 247 ----1175
NM_005715chr642034 1969 211 202 52618 2576 2354 1754 803 137 --
NM_005717chr121246 165 1225 ----
NM_005718chr33874 864 297 --1822 --
NM_005721chr24830 821 254 52 ------
NM_005722chr261882 1786 851 444 109 49 ------
NM_005724chr15--1139 ----
NM_005725chr111872 11780 22050 1588 --
NM_005730chr1283669 3407 3290 3061 1149 1067 493 421 1970 33254 794 644 --
NM_005731chr22426 282 --1268 --
NM_005735chr21619 --166 1622
NM_005736chr1011147 --1984 --
NM_005737chr262899 2861 2698 2252 2058 254 22917 766 1712 --
NM_005738chr731973 476 349 ------
NM_005739chr1552303 1807 1526 899 865 ----1179
NM_005740chr223837 613 110 --2324 38 --
NM_005742chr22528 35 1109 ----
NM_005746chr772694 2662 2146 494 425 224 142 2435 263 --1128
NM_005748chr1243352 2978 2866 2320 ------
NM_005749chr171514 ------
NM_005751chr72347 47 ------
NM_005754chr511189 1195 1177 1904
NM_005756chrX31473 561 485 41366 307 217 63 --11353
NM_005759chr2114484 3638 3590 3519 3397 3077 1863 1392 448 325 186 --13627 --
NM_005766chr1341222 506 368 54 --21169 1018 --
NM_005768chr12270 55 ----158
NM_005772chr91749 ------
NM_005778chr33482 393 79 ------
NM_005779chr513680 23112 443 13144 --
NM_005786chr185992 886 831 395 89 1426 ----
NM_005789chr1731800 463 174 1733 11660 --
NM_005795chr263015 2089 579 517 460 293 ------
NM_005797chr1141526 726 86 75 31452 577 373 1428 --
NM_005802chr92529 257 ------
NM_005808chr383000 2709 2666 1349 946 406 233 187 1306 1385 --
NM_005813chr262475 2192 985 631 585 314 ------
NM_005814chr141446 1356 453 74 --1526 --
NM_005819chr153240 2631 596 369 127 13300 ----
NM_005822chr652282 2165 1697 824 38 32125 1830 1647 ----
NM_005826chr11537 1179 ----
NM_005828chr17154701 3965 3765 3746 3738 1764 1722 1681 1603 1394 721 565 442 252 239 41936 981 924 105 --45019 3909 1798 1684
NM_005832chr341293 1270 934 494 31422 1227 54 11068 --
NM_005839chr12372 298 1194 1253 --
NM_005840chrX166896 6276 6234 6048 5467 5201 4800 2685 2039 1593 1434 617 527 178 117 30 36460 5072 1402 4920 676 581 569 1505
NM_005842chr132536 44 ----1695
NM_005843chr231773 1588 1510 1209 ----
NM_005851chr111379 --1412 --
NM_005852chr1761169 1047 195 175 168 129 --11078 --
NM_005853chr16128 ------
NM_005857chr141437 1404 566 367 --1575 1958
NM_005859chr521489 444 ----1447
NM_005862chr32967 429 --1140 --
NM_005871chr102183 50 1426 ----
NM_005875chr31406 1100 ----
NM_005880chr1621644 36 --11231 1247
NM_005882chr41353 1830 ----
NM_005884chr191628 --2540 518 --
NM_005885chr54452 63 44 33 31189 1083 384 ----
NM_005896chr22153 134 --1646 --
NM_005898chr1193164 3090 2794 2719 2436 2229 1014 766 480 22766 2353 --21017 98
NM_005901chr18208491 8412 7990 6843 6831 6640 6415 6313 6219 6129 5987 5569 3241 2868 2664 1783 1145 869 736 725 57208 6710 5337 1552 556 37304 6417 1018 --
NM_005902chr1591441 1431 1101 984 709 684 313 214 111 34626 4460 3885 12890 13709
NM_005903chr5104601 4118 3784 3732 1974 1903 1647 1072 944 671 23354 2096 ----
NM_005904chr183411 178 103 21046 91 ----
NM_005907chr651628 681 441 187 61 --163 --
NM_005909chr5104009 3595 3583 3336 3166 2924 2828 2801 2726 1294 53520 1709 1661 1393 1176 44034 3973 3253 72 --
NM_005910chr1753529 3458 1013 297 208 --11506 23636 3461
NM_005911chr221200 529 11417 --1104
NM_005920chr163769 3407 2898 2754 269 104 --1229 23861 1006
NM_005922chr63411 315 94 ------
NM_005927chr531168 1033 467 1189 1927 --
NM_005933chr1182795 2481 2425 2009 1863 769 731 674 --52129 1944 723 378 71 --
NM_005935chr4105276 5184 4753 4237 3953 3920 3774 3217 2089 1932 13558 23266 2126 25283 1469
NM_005937chr1774020 4009 3847 3651 2783 1484 691 --33926 2731 205 --
NM_005941chr8113965 3185 2987 1677 1316 1015 826 253 228 221 21 32806 792 129 13875 --
NM_005943chr621513 1117 21359 194 11393 --
NM_005944chr331013 973 497 ------
NM_005955chr164892 4619 4346 4102 3983 768 1125 85203 5104 5089 4975 4785 3952 1487 1199 --
NM_005962chr1071940 1776 1682 822 606 534 97 --1323 --
NM_005962chr1071940 1776 1682 822 606 534 97 --1323 --
NM_005964chr1741448 1396 1325 1055 --2294 183 --
NM_005967chr122686 544 1692 ----
NM_005977chr131797 1407 ----
NM_005986chr1352079 2037 950 730 502 ------
NM_005994chr171899 ------
NM_005996chr1231545 1050 105 2411 24 --11130
NM_005997chr12124 30 --2186 126 --
NM_006007chr983571 3317 2886 2748 1593 518 454 337 ------
NM_006010chr3169 ------
NM_006011chr1584212 4156 3929 3725 3605 3193 1352 1050 --24042 2839 --
NM_006015chr171258 1249 1115 928 248 198 73 ------
NM_006016chr622055 1415 ----12147
NM_006022chr132304 144 1906 ----
NM_006029chr14149 ------
NM_006030chr321694 54 --21707 1696 1518
NM_006034chr1152491 2460 262 146 68 ----1691
NM_006036chr231579 578 340 22549 1820 --11919
NM_006037chr2124842 4729 3759 3185 3128 3119 1871 1827 1800 1648 678 150 24099 1684 24197 2976 --
NM_006038chr2051827 1663 1532 321 48 --21928 711 11830
NM_006039chr17----31047 307 222 --
NM_006041chr171145 ------
NM_006042chr172479 327 --1385 --
NM_006047chr2052848 1210 887 767 750 ----33209 1202 890
NM_006048chr131202 1116 496 ------
NM_006054chr1151466 1322 1010 524 148 --1526 --
NM_006055chr272986 2958 2447 939 783 460 411 62901 2718 2616 2200 997 144 21287 41 --
NM_006060chr764207 3750 3311 1253 995 895 --24431 4242 --
NM_006079chr61287 194 ----
NM_006080chr71285 22989 611 ----
NM_006094chr832347 669 281 --22222 671 --
NM_006095chr464454 3934 3302 3008 1526 196 21607 1466 11614 --
NM_006096chr871640 1296 1277 1164 501 456 413 11377 2458 68 --
NM_006106chr11133472 3440 3353 3149 2923 2629 2507 2397 983 921 556 422 311 --12636 1193
NM_006108chr112846 155 31529 574 484 12042 --
NM_006113chr131712 435 309 11526 21945 437 --
NM_006134chr2131562 1345 28 11274 ----
NM_006135chr131093 964 572 21030 564 ----
NM_006136chr731170 234 221 1541 1463 --
NM_006139chr22560 406 12132 1320 --
NM_006141chr1642449 1078 237 197 ------
NM_006145chr195825 723 410 64 37 1154 2859 412 1808
NM_006147chr14311 190 94 29 ------
NM_006148chr1762952 2902 2678 2648 874 716 12465 31949 778 505 --
NM_006153chr32448 247 ------
NM_006157chr111161 1381 ----
NM_006158chr841524 1324 358 174 11672 ----
NM_006160chr17----2630 464 --
NM_006166chr1242430 1641 971 895 11754 --2790 391
NM_006167chr851973 1518 971 607 597 32055 954 619 12026 --
NM_006180chr942142 841 793 241 --3307 219 211 --
NM_006186chr231258 1203 457 ------
NM_006190chr21842 2345 224 ----
NM_006191chr121713 --3689 299 289 --
NM_006194chr1441315 532 180 141 ------
NM_006195chr941361 1271 1263 983 1441 1952 --
NM_006197chr812219 ------
NM_006201chrX1475 --1818 --
NM_006203chr583832 3790 3743 2229 1653 1175 345 25 14235 33629 907 864 --
NM_006216chr23518 445 61 2435 74 ----
NM_006224chr1762508 1917 1584 909 874 358 2980 344 12137 --
NM_006237chr1352143 2135 1674 1639 729 22304 1426 1140 --
NM_006241chr341876 830 816 788 1862 1901 12426
NM_006243chr11762 1381 --1367
NM_006244chr11----2593 492 --
NM_006245chr61747 ------
NM_006246chr143852 389 247 ------
NM_006247chr191141 ----1112
NM_006251chr553183 3036 2870 2215 500 22689 2388 --1803
NM_006253chr1231143 1034 361 11236 11223 --
NM_006256chr162730 2422 2379 1738 616 465 32385 2268 823 1848 --
NM_006258chr101182 31362 984 245 2594 431 --
NM_006259chr45888 728 700 256 225 181 ----
NM_006265chr851540 968 443 123 81 --1970 --
NM_006267chr261839 1790 1695 1194 684 661 31845 1517 332 --1612
NM_006268chr1131171 736 75 1463 2976 858 --
NM_006275chr2041954 919 677 528 --12380 --
NM_006282chr20134767 4722 4657 4431 4342 4248 3394 999 711 681 549 456 340 1744 33424 3414 1536 1734
NM_006283chr894385 3627 3243 3040 1884 782 550 350 92 24668 4430 14895 43560 3261 1372 495
NM_006287chr262521 1724 542 357 299 163 21889 1032 ----
NM_006290chr651733 1364 723 666 566 21956 683 11487 --
NM_006298chr673197 2985 2670 2331 1070 240 147 32782 2228 70 ----
NM_006305chr151214 ------
NM_006306chrX24781 1467 15185 34579 4362 101 --
NM_006310chr1731172 1162 883 1103 ----
NM_006311chr171343 1116 ----
NM_006313chr1241226 596 297 129 ----1262
NM_006319chr163749 561 144 ------
NM_006320chr45957 319 307 295 287 --21120 325 157
NM_006321chr31833 3219 170 87 21622 381 --
NM_006323chr42710 637 ------
NM_006325chr121315 --1317 --
NM_006328chr11195 --1631 --
NM_006330chr81643 --163 1590
NM_006335chr1----1389 --
NM_006336chr921330 145 1406 11236 --
NM_006345chr441258 489 326 114 ------
NM_006348chr73627 269 148 1196 --1240
NM_006352chr151949 1926 407 329 218 1255 21928 1561 --
NM_006353chr61969 11432 1346 1999
NM_006357chr22478 128 2472 437 ----
NM_006359chrX61831 968 675 487 435 182 11923 41604 579 493 306 --
NM_006364chr142911 64 21315 359 ----
NM_006366chr621037 867 21048 401 ----
NM_006367chr14820 216 90 71 --1822 --
NM_006369chr13121 113 96 --1102 1401
NM_006375chrX51483 1403 463 392 101 1537 1227 --
NM_006378chr931026 191 184 --2461 290 --
NM_006379chr751965 1890 1773 1492 344 --1261 --
NM_006380chr1733310 2767 1227 34279 4013 3976 131 --
NM_006382chr171272 ------
NM_006386chr2262439 1862 1677 708 100 61 21514 153 31983 355 86 --
NM_006389chr1151402 1215 894 290 112 21311 436 1499 --
NM_006390chr1231589 1408 160 --1154 --
NM_006391chr111325 ------
NM_006401chr91506 ------
NM_006403chr611804 21550 542 ----
NM_006407chr31559 --11118 --
NM_006416chr63649 604 589 127 ----
NM_006420chr2032690 2358 908 ------
NM_006421chr83927 870 45 ----1167
NM_006427chr141160 1115 ----
NM_006430chr21508 1487 1510 --
NM_006434chr1062973 2496 2298 858 775 262 ------
NM_006439chr41450 ------
NM_006449chr261600 1466 483 430 418 23 22163 2116 ----
NM_006451chr551040 839 382 323 309 ------
NM_006457chr484025 3161 2903 2667 1598 1117 921 344 1986 11526 13764
NM_006459chr1082000 1943 1930 1617 1532 1325 568 226 31442 546 189 21304 454 --
NM_006460chr174643 223 211 94 ------
NM_006465chr1531977 1907 799 --12001 1366
NM_006469chr11529 --1406 --
NM_006482chr1252865 2821 809 791 398 33211 1022 123 31069 780 400 --
NM_006489chr1421541 40 --11643 --
NM_006496chr1111961 1568 1248 1222 694 565 506 492 323 134 59 11622 21889 1459 --
NM_006504chr1042885 2476 2239 2001 22465 1105 --12057
NM_006510chr65868 854 647 411 157 --2856 159 --
NM_006517chrX42020 1491 1481 213 --2624 28 11541
NM_006519chr6494 81 31 25 ------
NM_006520chrX157 1289 --1348
NM_006526chr2051943 1890 1591 460 79 --1462 1511
NM_006532chr1952027 1735 1540 1466 805 11777 2573 320 --
NM_006534chr20123210 2861 2808 2561 2387 2330 2257 1170 1018 855 510 476 42672 2201 1209 692 33082 2432 2126 --
NM_006536chr131023 881 393 1956 ----
NM_006537chr151402 199 ----
NM_006540chr811542 ------
NM_006544chr14126002 5300 4281 3944 3684 2207 2041 1727 1360 1058 903 37 55359 5345 4252 1522 1032 16125 2512 453
NM_006546chr17126619 6527 5816 5422 5140 4642 4382 2267 2183 2155 1867 1673 22389 1557 46221 5362 2148 468 --
NM_006547chr741849 1562 606 278 21959 854 11727 --
NM_006548chr321199 562 --1368 1314
NM_006549chr1252940 2595 2561 781 144 12866 22846 2451 --
NM_006557chr911390 1261 --2418 282
NM_006558chr8--2364 324 187 --
NM_006559chr111243 2855 289 ----
NM_006561chr1085523 5472 4691 2019 677 349 332 141 --34693 2009 1441 --
NM_006565chr163449 436 79 --1522 --
NM_006571chr81237 ------
NM_006574chr31108 ------
NM_006578chr1541784 1547 1330 1266 ------
NM_006587chr441441 462 342 248 21338 101 ----
NM_006593chr27675 640 624 616 296 231 174 --1318 --
NM_006595chr1152065 1494 1302 649 140 --11915 --
NM_006599chr16147565 7495 7289 5586 5155 5139 5040 1739 1724 1704 1583 1437 877 391 57852 6759 2452 1858 870 47406 5908 1776 846 --
NM_006601chr123860 777 317 21025 897 1319 --
NM_006603chrX1725 1636 ----
NM_006609chr2102890 2517 2447 2384 2352 2312 2018 557 289 73 ----11951
NM_006614chr353543 3288 2730 2254 845 21370 1108 ----
NM_006618chr181624 1388 1331 1319 1095 520 505 156 --11455 21598 307
NM_006621chr151492 788 265 183 90 --11601 1408
NM_006624chr1021829 123 31375 604 42 ----
NM_006626chr952135 1651 943 139 56 22103 515 22680 1007 --
NM_006628chr1593262 3068 1859 1419 1305 1250 1179 652 401 31023 934 82 --23996 3948
NM_006629chr1852540 2446 2389 1852 647 --11046 11798
NM_006633chr51159 ------
NM_006636chr261010 941 913 880 710 383 --1317 --
NM_006646chr1392586 2363 2019 1969 1881 907 631 444 102 31063 995 155 --1634
NM_006650chr543910 651 231 55 13824 13784 --
NM_006654chr1284287 4152 3515 1841 1127 897 554 462 54760 1297 1070 313 95 23375 1849 1900
NM_006660chr15135 ------
NM_006667chrX11013 --1402 --
NM_006698chr203561 437 125 21295 958 1456 --
NM_006704chr131123 ------
NM_006706chr52742 173 1259 1860 --
NM_006709chr61293 ----1121
NM_006711chr163743 330 64 1659 ----
NM_006713chr53542 533 264 ------
NM_006717chr983409 3145 2636 2532 2300 1160 585 374 13241 1198 1674
NM_006718chr621079 1042 11114 ----
NM_006722chr352749 2053 686 97 41 22029 955 1453 1589
NM_006724chr63411 315 94 ------
NM_006726chr441225 1110 980 917 ------
NM_006727chr51157 ------
NM_006729chrX95025 4598 3932 3904 3800 3437 1849 1554 922 54374 3528 2157 2147 2121 44439 2016 1052 1041 25348 3553
NM_006732chr1942062 1837 1794 558 --31738 1543 476 --
NM_006734chr62539 345 11356 21294 249 --
NM_006735chr74362 231 119 44 ------
NM_006738chr1574602 4235 4007 3442 3196 1293 880 33873 1559 368 --14652
NM_006746chrX3522 307 83 11476 21363 443 --
NM_006750chr16197724 7608 7327 7236 6583 6516 5548 5464 5188 4999 4901 3180 2927 2724 2680 1962 1152 682 84 87373 7069 6444 6156 5014 2950 1895 168 47027 6069 3160 2714 15637
NM_006751chr2196 ------
NM_006755chr111166 ------
NM_006756chr831293 963 280 --11303 --
NM_006763chr162133 1890 1712 863 590 514 --11625 11715
NM_006766chr8102646 2522 2504 2404 2158 2119 1650 1056 166 86 52311 609 462 280 55 32657 2105 443 --
NM_006772chr641721 1247 227 32 --41696 1405 1289 198 --
NM_006775chr652178 1109 1101 1041 574 ------
NM_006777chrX42438 1843 1055 815 22899 1978 12440 --
NM_006788chr1831700 1519 322 --1359 --
NM_006790chr51150 ------
NM_006791chr153460 178 167 ------
NM_006800chrX1569 --1622 --
NM_006803chr841523 1368 814 572 1846 1122 --
NM_006805chr511515 11630 41446 1278 1074 46 --
NM_006806chr211153 ------
NM_006807chr171108 --2840 234 --
NM_006810chr3124 ------
NM_006813chr61657 ----1639
NM_006814chr2052541 2255 1780 483 407 22640 2558 --2248 227
NM_006815chr123968 297 157 ------
NM_006823chr81179 1253 ----
NM_006825chr12--3857 785 248 1383 --
NM_006826chr25840 471 449 43 27 2435 132 --11109
NM_006827chr1493038 2867 2845 1300 1064 969 471 341 133 23024 516 32874 2243 782 2760 437
NM_006828chr6--2200 183 ----
NM_006838chr1221548 554 --1611 11346
NM_006851chr1262802 2706 2507 2409 2306 791 32490 1954 858 1935 --
NM_006852chr1762679 2473 2442 2353 2207 423 32695 2519 1923 32863 2531 600 1876
NM_006854chr731600 1495 108 11645 ----
NM_006856chr1261139 966 763 394 315 264 ------
NM_006857chr22732 109 --1744 1363
NM_006861chr1221385 666 12060 ----
NM_006873chr253506 3369 2868 2786 2677 41133 731 712 180 23035 449 --
NM_006874chr41822 ------
NM_006877chr63308 268 54 --2294 282 --
NM_006884chr331579 708 87 21949 764 11347 --
NM_006885chr16134214 3508 2846 2815 1511 1449 1361 1038 928 688 344 257 204 --32817 1097 1070 21568 347
NM_006888chr1453295 3132 2903 2849 21 13544 --12699
NM_006892chr2021099 1080 11191 ----
NM_006892chr2021099 1080 11191 ----
NM_006894chr12305 95 1314 ----
NM_006908chr751308 1251 1019 965 573 ------
NM_006910chr161415 ------
NM_006914chr941166 347 248 182 ------
NM_006915chrX2404 38 22241 324 ----
NM_006920chr231959 1518 81 ------
NM_006922chr2--22339 1680 ----
NM_006924chr1794230 4136 3839 3184 1382 1348 993 359 51 33858 349 70 13725 --
NM_006925chr143479 100 30 ------
NM_006930chr521878 656 21985 1366 11862 --
NM_006931chr1261610 1406 867 816 287 116 --21578 1553 --
NM_006937chr171150 1128 ----
NM_006939chr142424 360 11152 ----
NM_006940chr1261401 1245 761 545 484 472 1490 21921 474 --
NM_006943chr2062820 2812 2305 877 644 357 13315 42397 842 760 314 1483
NM_006948chr211700 12202 170 --
NM_006950chrX2775 698 1215 ----
NM_006951chr103831 519 23 ------
NM_006973chr102143 27 ------
NM_006981chr962937 2162 2152 657 521 155 1505 22697 349 --
NM_006990chr1101881 1793 1564 875 673 634 570 538 299 35 --2448 243 --
NM_006999chr541296 700 593 396 --11595 --
NM_007002chr20188 ------
NM_007005chr921072 61 --2393 137 --
NM_007006chr1673440 2871 2444 2270 1420 131 106 --12775 --
NM_007007chr1264727 4246 3671 3019 688 540 --12948 --
NM_007008chr21367 ----1370
NM_007010chr1751387 683 650 462 186 --11178 --
NM_007011chr15136472 6246 5786 4628 2674 2480 1996 1922 1572 1434 1146 533 355 36116 2151 947 36474 4231 1436 11925
NM_007013chr82783 165 1816 1167 --
NM_007030chr554744 4635 3214 1736 1343 ------
NM_007033chr1166 ------
NM_007038chr2164922 4872 4300 4032 2337 1827 --15307 --
NM_007039chr1412096 --21558 1552 --
NM_007040chr193976 959 280 2812 219 ----
NM_007042chr352586 698 470 443 314 22366 1669 ----
NM_007043chr1231860 820 36 21606 1330 21711 335 11533
NM_007050chr2077766 7380 6982 2713 2343 1094 218 47911 7593 2351 1003 158 1221
NM_007052chrX2229 40 ------
NM_007054chr553632 3434 3191 836 639 13583 ----
NM_007064chr331354 1302 1117 21095 197 ----
NM_007067chr1751357 1131 555 415 109 21514 1061 ----
NM_007078chr1072197 2149 2065 1148 1134 751 123 ----11137
NM_007096chr91108 ------
NM_007100chr4122 ------
NM_007106chr1372602 2549 2357 2052 676 284 148 143 ----
NM_007107chr321570 944 --22308 810 --
NM_007111chr132614 84 1791 ----
NM_007114chr352412 2248 857 671 540 22322 427 12068 --
NM_007118chr5------132
NM_007122chr11619 --176 --
NM_007123chr13465 110 60 11109 ----
NM_007124chr641600 1443 460 49 --2768 223 152
NM_007125chrY31469 1254 278 ------
NM_007137chrX74681 4514 4436 3627 1701 906 776 1720 13423 24517 3877
NM_007144chr1721274 466 --167 --
NM_007145chr1911238 ----11154
NM_007146chr1712671 21865 222 ----
NM_007150chrX22117 1636 22129 577 ----
NM_007158chr11433 1363 ----
NM_007166chr1161528 1409 488 438 396 373 31083 986 266 ----
NM_007170chr11339 --2602 368 --
NM_007174chr1252334 1782 417 408 237 21939 675 11679 1256
NM_007175chr843304 2449 894 277 23036 704 1151 --
NM_007185chr121025 812 --2755 234 --
NM_007192chr14185 1970 ----
NM_007195chr1883413 3232 3199 3130 2989 1161 921 770 22758 235 23270 896 --
NM_007197chr12274 55 --1864 --
NM_007200chr1574602 4235 4007 3442 3196 1293 880 33873 1559 368 --14652
NM_007203chr943795 3637 3305 1039 ----13127
NM_007207chr13811 805 81 1289 1282 --
NM_007212chr181897 1620 346 211 173 157 151 116 1528 21622 348 --
NM_007214chr631245 359 253 1204 ----
NM_007216chr113924 345 173 1382 ----
NM_007218chr82189 170 1705 ----
NM_007219chr201916 1350 1967 --
NM_007222chr811739 ----11575
NM_007236chr1531999 476 409 1485 22400 726 1342
NM_007238chr2043881 3844 3147 897 --1316 --
NM_007242chr161242 ------
NM_007246chr411054 ------
NM_007249chr13179274 8685 8611 7675 7625 7406 6978 6967 6878 6803 6626 3200 2556 2422 1538 1146 559 59109 3477 1595 642 377 78082 7884 5755 2677 1870 1203 420 23203 2919
NM_007259chr12356 208 1384 1375 --
NM_007269chr1--2457 117 ----
NM_007270chr751555 1440 1110 1090 569 ------
NM_007275chr31439 ----1456
NM_007276chr741142 942 282 220 ------
NM_007285chr16----1462 --
NM_007287chr332806 2041 1296 11077 12034 --
NM_007288chr332806 2041 1296 11077 12034 --
NM_007289chr332806 2041 1296 11077 12034 --
NM_007292chr1795184 4986 4977 4912 3934 1663 894 556 251 11097 23941 116 14340
NM_007294chr1731154 315 63 ------
NM_007295chr1731154 315 63 ------
NM_007296chr1731154 315 63 ------
NM_007297chr1731154 315 63 ------
NM_007298chr1731154 315 63 ------
NM_007299chr1731154 315 63 ------
NM_007300chr1731154 315 63 ------
NM_007302chr1731154 315 63 ------
NM_007303chr1731154 315 63 ------
NM_007304chr1731154 315 63 ------
NM_007305chr1731154 315 63 ------
NM_007313chr941816 1749 1623 715 ------
NM_007325chrX12040 2592 136 ----
NM_007331chr442509 2236 1932 496 --1890 12261
NM_007345chr1842081 1575 490 203 2532 151 ----
NM_007346chr201300 --1328 --
NM_007347chr1542555 1993 872 822 12976 11128 --
NM_007350chr1253658 3234 1006 958 838 21144 181 13236 13400
NM_007358chr151830 1682 1514 1268 89 2501 435 ----
NM_007363chrX21090 880 --2849 49 --
NM_007373chr1041764 1592 1217 1152 21799 367 ----
NM_007375chr132321 1091 706 22654 433 ----
NM_009585chr32168 144 1100 ----
NM_009585chr32168 144 1100 ----
NM_012064chr1221044 153 21122 172 ----
NM_012069chrX32552 227 129 ------
NM_012081chr583438 3344 3281 3158 3021 2750 454 142 23696 1366 33440 2597 182 13284
NM_012083chr102855 834 --3975 938 537 --
NM_012084chrX----191 1415
NM_012090chr12933 446 11219 ----
NM_012092chr23693 455 432 ------
NM_012095chr1053329 2776 2670 2439 1067 3508 217 189 --22797 1070
NM_012096chr383357 3309 2450 2400 2337 2274 1449 443 1385 ----
NM_012097chr251900 1893 1824 1757 1589 31516 1431 836 ----
NM_012102chr182403 2246 2159 2103 1934 687 561 302 11863 ----
NM_012104chr11103079 2687 2483 2472 2464 896 800 740 342 311 --11019 --
NM_012104chr11103079 2687 2483 2472 2464 896 800 740 342 311 --11019 --
NM_012110chr42231 43 ------
NM_012120chr642473 2113 2048 887 2998 404 ----
NM_012129chr772304 1830 1640 914 739 92 69 22340 1817 21915 1832 1839
NM_012137chr1112870 2591 2168 2159 2151 2133 1887 924 538 489 441 32861 2616 1029 ----
NM_012141chr13123680 3188 2930 2909 2736 2704 2675 2650 2604 2543 695 139 22717 1236 33704 857 165 13930
NM_012153chr1152493 1736 696 687 92 --32482 1787 1726 --
NM_012156chr2093353 3330 3172 2885 2839 2451 2243 806 273 --32891 2515 354 --
NM_012157chr32620 40 1982 ----
NM_012158chr13--11383 ----
NM_012161chr44466 449 388 351 41184 990 219 53 197 --
NM_012180chr43670 537 132 --1539 --
NM_012188chr51933 --1138 --
NM_012189chr184540 472 208 73 1256 1136 --
NM_012192chr1132225 1489 131 --1133 --
NM_012193chr11135192 5090 4752 4688 4417 4345 3900 3348 3333 1876 1819 1553 400 33669 591 429 23454 1869 --
NM_012197chr971473 1454 1365 1283 467 362 46 ------
NM_012199chr1154523 3323 3304 2953 2939 2924 2901 1873 1549 1459 1149 1070 1054 824 815 --52960 2926 1797 1502 1072 --
NM_012200chr11--133 ----
NM_012210chr941223 1003 587 304 21150 478 ----
NM_012214chr2105234 5216 4928 4055 2388 2052 1873 887 547 385 35977 2376 1970 12522 --
NM_012215chr102698 228 21414 260 ----
NM_012223chr241065 427 250 38 1175 ----
NM_012224chr42914 771 ------
NM_012234chr363626 2607 1438 1127 1068 434 53028 2914 1256 420 407 ----
NM_012238chr1021631 429 11263 ----
NM_012243chr12301 269 --1382 --
NM_012244chr1441803 1636 1315 1161 11406 1509 143
NM_012247chr103950 895 167 ------
NM_012249chr233400 1285 387 21008 81 23222 1109 12330
NM_012250chr114259 225 144 86 --154 --
NM_012252chr7104804 4474 3726 3530 3351 3303 1521 863 458 284 21819 958 23556 3474 13306
NM_012257chr7--1944 ----
NM_012259chr651460 1415 1064 984 166 --1182 --
NM_012262chr184397 4244 4052 3844 3714 2003 1678 1272 13676 24399 1936 --
NM_012281chr732154 284 222 21521 634 ----
NM_012286chrX2407 173 --1175 --
NM_012287chr394130 4090 3629 3501 3073 1541 696 663 201 24108 913 23432 1622 --
NM_012288chr6195115 5070 4979 4967 4726 4246 3967 3740 3574 3561 1744 1293 1254 1228 862 343 305 272 216 11807 23969 222 --
NM_012290chr221548 1469 1634 ----
NM_012295chr223413 372 265 --2399 267 --
NM_012297chr461841 822 550 413 301 99 12354 21832 815 --
NM_012300chr541714 591 481 190 11947 1665 --
NM_012301chr762246 1768 1428 1411 892 877 --1676 --
NM_012302chr131187 903 800 ------
NM_012308chr1162492 2301 1997 1677 813 582 --22303 836 --
NM_012309chr11124954 4646 4251 3739 1855 1675 1609 1166 1125 632 596 442 14793 21393 494 --
NM_012311chr102561 225 --1644 --
NM_012316chr1124137 3668 3651 1915 1714 1310 1083 977 728 714 383 332 --11312 --
NM_012322chr71297 ------
NM_012323chr2221614 263 ------
NM_012325chr2061617 1547 1294 1146 1011 160 21559 107 2162 74 --
NM_012327chr1861581 1551 1050 559 259 243 21574 46 ----
NM_012328chr741328 1322 948 549 ------
NM_012329chr1741194 1043 673 361 ------
NM_012330chr1041694 1161 263 194 11500 1686 --
NM_012333chr161541 1192 1185 651 100 76 ------
NM_012334chr583422 2892 2882 1409 1325 529 357 154 24423 961 --13872
NM_012342chr102497 47 1385 ----
NM_012343chr531048 736 214 ------
NM_012347chr662976 2464 2403 1942 1031 562 1537 1322 --
NM_012382chr5134439 4341 4261 3852 3676 3452 2843 1741 1455 993 920 894 836 11412 34211 3462 3392 12794
NM_012388chr1562569 599 548 488 382 145 --1778 1421
NM_012392chr1286 41 ------
NM_012395chr763117 3054 2806 2368 577 116 23197 279 33119 2289 2279 --
NM_012399chr2211658 31806 735 486 ----
NM_012402chr114408 237 115 86 ------
NM_012412chr72829 624 ----1184
NM_012414chr12180 115 ------
NM_012420chr103716 300 185 ----11713
NM_012428chr154730 697 250 77 ----194
NM_012446chr52151 127 ------
NM_012448chr174910 678 497 88 1647 ----
NM_012453chr741443 1345 219 72 193 ----
NM_012463chr121337 ----11755
NM_012464chr442532 2424 2140 899 21974 1787 --21017 768
NM_012465chr1063181 2965 2845 2173 651 474 ------
NM_012479chr762370 2145 2021 789 645 150 ------
NM_012482chr1--1128 --1115
NM_012486chr12157 98 ------
NM_013227chr151281 ----1655
NM_013230chrY31689 1608 1500 2625 127 11327 --
NM_013231chr1451706 1427 791 219 182 --23816 1429 --
NM_013232chr52291 107 1378 ----
NM_013233chr221279 457 21213 401 21250 74 --
NM_013236chr221478 1464 ----
NM_013243chr1531469 1154 516 2137 28 ----
NM_013245chr161719 --3721 642 268 --
NM_013248chr203229 210 22 ----1213
NM_013254chr121611 ------
NM_013255chr7167966 7569 7432 7329 7228 7165 6969 6870 6336 5485 3526 2613 1161 789 496 318 27370 5499 37331 875 429 1321
NM_013257chr852170 2127 2083 393 278 11514 ----
NM_013259chr3----198 --
NM_013261chr493670 3424 2820 2776 2601 976 788 770 266 11178 --13378
NM_013262chr61984 31267 948 333 1986 --
NM_013263chr16--167 ----
NM_013269chr1254030 1744 1553 1434 1355 24543 567 ----
NM_013277chr124818 346 309 242 ------
NM_013281chr2021299 1243 ------
NM_013283chr51671 3747 305 119 --2674 369
NM_013300chr121238 ------
NM_013302chr1654735 4714 4632 1476 828 44473 1482 1031 698 11157 13637
NM_013309chr1532633 1766 907 21032 990 1601 11769
NM_013313chr2263238 2742 2527 858 91 24 1294 1885 --
NM_013316chr72248 178 --11039 --
NM_013326chr18167 ------
NM_013341chr262848 2745 2026 1061 793 347 62765 949 936 579 253 214 21182 1123 --
NM_013351chr172715 648 ------
NM_013354chr821405 98 1136 1322 1110
NM_013357chr8290 71 1835 ----
NM_013365chr223614 530 86 ------
NM_013372chr1573420 2809 2770 1036 768 467 362 23086 445 11345 --
NM_013374chr363051 2114 2056 939 662 384 12008 12031 --
NM_013377chr122199 109 ------
NM_013381chr1242310 2138 831 771 ------
NM_013396chr2131046 301 38 ----11049
NM_013399chr1621877 712 --21811 349 21239 737
NM_013400chr721062 843 --1845 11065
NM_013423chrX21050 931 1101 ----
NM_013427chrX21050 931 1101 ----
NM_013433chr1921785 1468 11626 21928 1336 --
NM_013437chr8--1237 11152 --
NM_013438chr941353 1289 708 180 1256 11691 --
NM_013443chr94952 893 301 219 --1895 --
NM_013444chrX4346 266 241 189 --1183 --
NM_013446chr741442 1190 997 162 21368 312 11426 --
NM_013448chr141173 2701 622 1684 --
NM_013449chr1262533 2255 655 634 550 270 12441 52367 2131 772 636 172 --
NM_013937chr63918 900 105 --1902 --
NM_013943chr173102 2514 2019 1147 234 196 54 1265 12634 --
NM_013951chr21653 --32488 574 549 --
NM_013952chr21730 --32565 651 626 --
NM_013953chr21730 --32565 651 626 --
NM_013992chr21730 --32565 651 626 --
NM_013995chrX72417 873 593 582 420 412 105 ------
NM_014000chr1061806 1582 1556 1386 524 167 --1367 1527
NM_014007chr911149 ----11129
NM_014011chr222552 952 1485 22554 567 11955
NM_014016chr351738 1311 455 435 182 1350 ----
NM_014021chr153442 3258 2968 2952 646 --22230 1204 1455
NM_014023chr1032572 2128 64 1132 ----
NM_014034chr621040 263 ------
NM_014041chr31126 1239 ----
NM_014043chr331674 536 254 ------
NM_014055chr123507 354 202 ------
NM_014057chr92364 357 ------
NM_014071chr20----2184 122 --
NM_014089chr1321743 415 1883 1855 --
NM_014106chr1542231 1195 955 351 1871 1604 11077
NM_014109chr81945 ------
NM_014110chr12274 227 1110 2883 251 21017 230
NM_014112chr8124380 4033 3676 3628 2171 1902 1683 847 813 711 684 147 15270 13331 --
NM_014117chr1672267 2239 2041 1946 1785 983 846 --11971 --
NM_014141chr795179 3477 3447 3235 1180 907 498 434 181 35312 4762 3611 14196 11826
NM_014155chr11147364 7166 6774 6379 6144 5716 5373 4555 2948 2227 1496 1199 801 141 66221 5905 5898 4718 1852 1002 46876 6307 5759 407 --
NM_014182chr123479 290 127 ------
NM_014189chr451494 1425 1374 1362 335 11535 ----
NM_014190chr471846 1777 1726 1714 1157 687 319 21887 1183 ----
NM_014212chr124838 717 617 88 ------
NM_014217chr141830 248 180 57 2453 361 21500 277 --
NM_014223chr13727 633 195 ----1690
NM_014231chr1252096 1905 1585 1472 136 --21952 545 --
NM_014232chr172401 347 183 4625 409 288 282 --
NM_014232chr172401 347 183 4625 409 288 282 --
NM_014233chr1752044 1892 1731 1517 119 1717 12178 --
NM_014238chr1711374 --11491 --
NM_014240chr384097 3580 3255 3078 2662 1498 203 145 33090 2617 487 1408 12907
NM_014243chr432093 2072 172 ------
NM_014246chr2252267 2252 1644 1619 413 22201 1710 ----
NM_014250chr2231911 527 338 2782 483 11635 --
NM_014253chrX51926 1661 445 426 178 1133 ----
NM_014263chr102483 251 21368 1125 ----
NM_014267chr11--1243 --1114
NM_014268chr1861317 1290 1145 335 288 274 --21273 303 --
NM_014271chrX2621 344 --1295 --
NM_014278chr42442 323 ------
NM_014280chr14709 202 71 30 1590 ----
NM_014282chr93922 107 58 ------
NM_014283chr161368 1307 1268 372 326 135 ------
NM_014284chr12948 134 ------
NM_014285chr94783 421 306 103 ----1247
NM_014286chr953579 2558 2550 2407 2385 13127 1938 --
NM_014288chr11223 ------
NM_014289chrX11075 ----144
NM_014290chr9--1181 ----
NM_014294chr841342 1335 1147 105 31210 402 60 11132 --
NM_014299chr1971628 1511 1450 649 639 402 387 11773 ----
NM_014305chr132205 96 --1217 --
NM_014309chr22104704 4473 4450 4203 4068 3561 1859 820 451 181 34871 4338 1633 33992 3910 3904 --
NM_014313chr1175 11228 11342 --
NM_014316chr1642191 1971 1532 597 11636 11824 22018 724
NM_014319chr1221378 72 ------
NM_014320chr61142 --1300 --
NM_014330chr19177 ------
NM_014331chr4117034 6242 6200 5552 5064 4925 3091 2626 2465 2426 1855 26365 2211 ----
NM_014332chrX--1376 ----
NM_014333chr11122664 2260 1926 1850 1103 1002 853 622 433 340 327 201 1898 22038 445 --
NM_014338chr22138 161 1396 --
NM_014342chr1141475 1386 193 144 ------
NM_014344chr11--2177 135 1151 --
NM_014345chr63950 933 163 --2176 170 --
NM_014368chr921792 161 12107 ----
NM_014372chr131959 1886 401 21979 1965 2763 696 --
NM_014374chr721062 843 --1845 11065
NM_014381chr1483311 2585 2412 1255 778 460 262 152 2856 563 --21011 885
NM_014382chr331529 584 488 ------
NM_014388chr195715 5269 4422 4118 4010 3683 1504 1486 144 2208 150 14992 --
NM_014392chr41251 1225 ----
NM_014393chr831771 1739 787 --1375 --
NM_014394chr101164 ------
NM_014397chr941434 1421 1320 218 1445 ----
NM_014399chr74991 268 171 25 ------
NM_014411chr751478 1243 755 621 162 ----11246
NM_014415chr31392 21567 277 --1561
NM_014418chr1452010 413 386 241 218 --11888 --
NM_014423chr593690 1981 1792 1549 1336 1164 1137 511 175 75043 4722 4648 4389 4185 1579 1536 ----
NM_014426chr202543 532 ------
NM_014429chr32645 217 123 2448 219 --
NM_014432chr651373 1092 136 56 24 ----11279
NM_014445chr362294 2209 1956 1822 1548 437 12000 11586 --
NM_014447chr471322 1117 1098 560 356 237 223 11470 1142 --
NM_014452chr641139 380 194 175 1822 1893 --
NM_014456chr103514 320 255 1326 ----
NM_014458chr111338 --11278 --
NM_014469chr112614 32 2212 115 --135
NM_014488chr111623 --1198 --
NM_014491chr73763 274 153 1966 1922 --
NM_014494chr1631693 1668 388 --22046 339 --
NM_014498chr31325 145 ----
NM_014504chr721837 1502 1315 11328 --
NM_014515chr1221052 255 --135 --
NM_014517chr351734 1633 1617 374 135 21204 786 ----
NM_014521chr22576 378 1551 11689 1503
NM_014552chr22595 564 ------
NM_014554chr12132298 2249 1922 1787 1707 1696 1643 1625 1429 692 563 162 48 21935 256 42146 1685 1679 1669 --
NM_014569chr73534 179 123 --1467 --
NM_014570chr2231008 226 42 1859 ----
NM_014572chr1311741 1207 ----
NM_014574chr1421372 1045 21002 299 --1487
NM_014577chr222317 104 ------
NM_014583chr31444 1125 ----
NM_014584chr1421504 1356 ------
NM_014586chr2194486 4134 4041 3813 3372 3327 1203 686 351 24429 473 --14044
NM_014587chr1641526 1368 593 211 ------
NM_014592chr51659 1117 1203 --
NM_014607chr22447 119 ------
NM_014608chr153394 118 42 --1447 --
NM_014612chr941148 498 141 97 ------
NM_014613chr5112693 2653 2305 2136 2077 1996 1221 1017 885 755 588 ------
NM_014614chr2--2993 34 ----
NM_014616chr373418 2519 2409 2386 877 240 40 1470 32750 1066 1035 --
NM_014618chr92405 27 ------
NM_014620chr121117 ----1220
NM_014622chr115957 665 606 177 100 --1234 --
NM_014630chr1582935 2723 2474 1216 971 750 553 230 43502 2811 1559 1404 ----
NM_014633chr112580 121 ------
NM_014634chr2272724 2261 1079 1057 915 861 740 --22793 2413 --
NM_014636chr984246 3901 3282 2947 1368 1336 1019 765 ----13041
NM_014637chr831373 1002 97 1120 ----
NM_014644chr12658 204 11031 183 --
NM_014646chr18123081 3036 2997 2864 2496 2319 2039 1994 1981 617 244 140 --23017 2489 12894
NM_014647chr165204 197 182 151 82 --22154 84 --
NM_014659chr151259 --1201 --
NM_014660chr761072 952 364 163 130 51 ------
NM_014661chr1033551 1547 285 23118 478 1295 --
NM_014663chr1----11061 --
NM_014665chr8103692 2945 2351 1241 797 712 370 360 298 44 --12891 --
NM_014666chr51361 1422 190 --
NM_014667chr342124 1777 680 376 1899 11899 --
NM_014670chr211216 1242 11375 11203
NM_014671chr731141 507 147 2202 120 ----
NM_014672chr14--1165 ----
NM_014674chr3113986 3674 3322 3292 3259 3000 2922 2625 1334 939 613 31533 1243 897 13174 --
NM_014675chr11463 ------
NM_014676chr121248 645 11080 11416 --
NM_014677chr861050 1040 1008 915 343 310 ----1313
NM_014679chr111966 2938 150 1440 --
NM_014682chr841435 792 440 262 22165 548 ----
NM_014683chr1731691 1550 1360 21841 588 3695 213 207 --
NM_014685chr161464 ------
NM_014689chr22539 412 ------
NM_014690chr752567 980 662 433 411 --22255 993 1824
NM_014699chr162316 144 ------
NM_014701chr1553017 2453 2360 2248 186 2962 59 ----
NM_014702chr663104 2477 2335 1352 1007 994 1471 ----
NM_014705chr741914 767 268 258 1681 11916 --
NM_014707chr752291 2175 1626 487 132 ------
NM_014709chr21475 1639 ----
NM_014711chr162666 427 32125 1473 1375 1274 --
NM_014713chr21546 1428 ----
NM_014719chr711081 1148 ----
NM_014720chr103578 529 127 11781 --138
NM_014721chr6127272 7190 6828 6310 5959 5796 5536 5357 4560 1955 1449 880 --36945 4711 775 --
NM_014723chr2043212 3205 2657 2334 --42705 2615 2301 710 --
NM_014727chr191248 ------
NM_014729chr842218 1693 192 22 1775 11757 --
NM_014730chr12145083 4338 4325 3899 3751 3516 1762 1637 1488 986 897 567 343 214 24681 1322 64850 3644 3538 3518 3327 240 14163
NM_014730chr12145083 4338 4325 3899 3751 3516 1762 1637 1488 986 897 567 343 214 24681 1322 64850 3644 3538 3518 3327 240 14163
NM_014733chr55803 579 551 321 130 2355 150 11929 --
NM_014735chrX72109 1540 1510 1491 764 516 457 21820 543 22126 1512 1460
NM_014739chr664009 3337 3224 2662 1555 1091 12931 32885 723 692 11388
NM_014741chr1121424 505 11900 21823 33 --
NM_014742chr2041775 1660 1184 1122 21274 637 1565 --
NM_014743chr43608 468 138 22464 565 12876 --
NM_014746chr2114379 4364 3980 3777 3109 785 769 625 553 482 92 34262 1446 596 24056 1751 --
NM_014747chr1115673 5508 5283 5147 4870 4416 3976 3773 2032 275 88 25634 4065 25543 1584 14130
NM_014751chr83763 219 122 21882 1684 1247 --
NM_014752chr1131822 750 243 1642 125 --
NM_014755chr2114121 3068 2878 1687 1284 1104 1029 1006 994 475 97 --34150 3806 430 --
NM_014756chr112356 322 1372 ----
NM_014757chr5102204 1758 1643 1576 1540 931 913 574 559 543 ------
NM_014764chr123402 266 124 1152 1459 --
NM_014765chr132500 1037 473 1206 1547 1772
NM_014767chr1053553 2512 1259 670 316 --1950 --
NM_014772chr1832463 736 687 ------
NM_014774chr172840 2318 2063 2009 1280 414 268 1126 2434 279 33030 2532 2524
NM_014776chr1253109 2955 2535 2130 307 23029 2728 12097 --
NM_014779chr33386 153 69 1824 --1122
NM_014781chr82420 387 1910 ----
NM_014782chrX184 1115 ----
NM_014783chr1551777 1110 1103 539 262 ------
NM_014786chr1111262 ----11035
NM_014787chr152808 2021 1798 736 262 12104 ----
NM_014791chr92320 301 ------
NM_014795chr231344 484 424 ------
NM_014803chr1052541 919 875 798 726 ----1416
NM_014810chr183388 3128 2379 1199 886 250 181 52 23160 2961 12589 12629
NM_014812chr121757 239 31896 522 175 1284 --
NM_014819chr542133 1551 455 144 21668 539 1749 --
NM_014820chr342051 1425 515 29 11913 1598 11663
NM_014824chr1131885 404 180 ------
NM_014826chr152653 1614 1565 914 735 11574 13849 --
NM_014827chr121060 576 --11562 --
NM_014828chr141533 22473 477 1134 --
NM_014829chr53872 703 224 --1761 --
NM_014830chr1253537 3308 1540 1483 729 --23429 2405 --
NM_014832chr1332094 1378 1321 --11877 --
NM_014835chr2041843 839 368 98 1403 --1268
NM_014836chr102493 445 21490 61 11229 --
NM_014838chr2222771 717 21143 832 22237 1943 --
NM_014839chr132320 1979 727 1134 ----
NM_014840chr1252319 2201 2084 1009 82 22946 2545 2836 414 1692
NM_014841chr61417 ------
NM_014844chr1444157 4147 1680 1163 --11668 --
NM_014850chr3144923 4686 4551 4483 4052 3655 3588 3546 3292 3258 1590 1084 579 491 14068 13492 13483
NM_014858chr12981 783 11075 ----
NM_014859chr1761122 326 256 240 222 200 1564 2392 106 21125 1049
NM_014860chr251650 746 734 668 597 1900 21803 740 --
NM_014862chr1534006 3668 1475 14197 24081 3784 --
NM_014864chr164267 3689 1618 1032 410 367 --21042 861 --
NM_014869chr341420 1325 1187 332 11171 --154
NM_014872chr932295 1796 1675 ------
NM_014873chr144665 3598 664 142 151 1472 14812
NM_014877chr17157802 7621 7604 7006 6946 6917 6838 5643 5563 2955 2607 2579 1706 1421 98 56927 5448 5042 3110 1146 11863 11609
NM_014883chr462463 2280 2204 1917 783 530 ----12283
NM_014892chr62133 30 ------
NM_014893chrY21827 769 11677 ----
NM_014897chr1733072 552 367 1442 1985 12004
NM_014898chr1921796 22 1167 21831 90 --
NM_014899chr573178 2795 2758 2196 831 593 144 32971 1236 558 ----
NM_014900chr22758 284 ------
NM_014901chr51288 --1290 --
NM_014903chr1262110 952 432 412 367 328 1898 --1784
NM_014904chr1063456 1456 1399 1185 778 118 13314 1751 --
NM_014905chr251912 1601 1445 657 164 --1714 --
NM_014906chr1733896 2931 497 11193 33155 3065 2734 --
NM_014912chr1012880 --23101 2731 12447
NM_014917chr11695 --1835 --
NM_014918chr1561585 1282 1134 401 284 131 21112 1069 ----
NM_014921chr1952977 2876 1195 846 613 --42979 2864 2844 1999 --
NM_014923chr1331623 249 238 ------
NM_014924chr1472751 993 927 613 530 457 229 12774 12626 --
NM_014926chr34899 454 116 80 ------
NM_014932chr351812 1623 1607 1375 1279 11613 ----
NM_014934chr1353792 3702 2531 1281 147 53962 2583 2436 1081 1046 12533 11097
NM_014942chr652440 1835 830 445 110 --1489 22399 2302
NM_014944chr12961 529 ------
NM_014945chr561898 1865 721 244 180 122 31883 1300 231 2350 297 --
NM_014946chr273060 3019 2765 2251 2021 1136 426 32601 1242 625 ----
NM_014947chr152811 1221 767 700 41 --12546 --
NM_014949chr11850 --2320 138 --
NM_014950chr1441430 605 332 102 --1607 1662
NM_014952chr1532024 589 504 1349 22038 572 --
NM_014962chr2042540 2374 668 342 2523 149 ----
NM_014964chr171444 22150 113 21686 969 --
NM_014974chr1041785 1748 268 29 21725 493 ----
NM_014977chr141153 1105 3497 467 155 --
NM_014978chr1041375 330 100 31 11368 1302 --
NM_014982chr14115196 4750 4094 4034 3750 3722 3500 1439 1110 450 153 33686 2166 999 95198 4077 3913 3724 2144 1928 1787 1378 668 --
NM_014988chr432586 2527 146 12363 ----
NM_014989chr611996 32087 1364 42 ----
NM_014990chr141428 1909 --1239
NM_014991chr462514 2424 2251 2148 445 307 2641 607 --1820
NM_014996chr341006 317 206 129 --1912 --
NM_014997chr7122590 2241 1129 1051 1032 852 726 651 598 318 139 54 ------
NM_014999chr1231397 1147 563 1639 ----
NM_015000chr1253091 2321 1140 1041 190 --21913 264 --
NM_015001chr11273 --1267 --
NM_015005chr1431720 1616 414 1565 ----
NM_015008chr363221 2817 2637 2490 899 266 23282 2670 ----
NM_015009chr31249 ----1265
NM_015015chr19--11644 1352 --
NM_015020chr1643555 2677 1217 692 2884 781 1605 --
NM_015023chr151800 1639 1565 676 363 --1103 --
NM_015024chr841402 1333 100 40 ------
NM_015025chr221010 855 12426 22049 857 11013
NM_015026chr1274556 4529 4483 4445 3291 3111 123 44273 3065 3012 925 24599 396 24591 4570
NM_015027chr1631782 425 226 1367 1306 --
NM_015032chr1332800 2291 520 2808 704 ----
NM_015035chr20126707 6029 5637 5228 4654 4605 4225 1297 723 543 532 245 44091 2389 1966 782 1972 --
NM_015037chr101265 ------
NM_015039chr154047 3754 1499 475 450 13538 24110 3310 11224
NM_015040chr233262 2725 586 3949 683 119 22463 1013 --
NM_015042chr1584247 3522 2979 2781 1502 1381 916 878 --44283 3775 2840 848 --
NM_015044chr1632619 2489 830 13260 12863 --
NM_015045chr1032127 2065 460 11540 ----
NM_015046chr932640 2142 364 42399 2178 455 338 ----
NM_015049chr243272 2998 2599 610 125 ----
NM_015050chr631026 961 368 --1952 --
NM_015051chr932958 1119 363 2372 30 ----
NM_015052chr751126 1094 505 482 93 --41096 1052 74 67 --
NM_015056chr2152457 2126 1791 931 81 ------
NM_015061chr9--1783 ----
NM_015068chr763605 2703 1527 1478 478 456 12652 ----
NM_015070chr1341421 1151 211 146 --1524 --
NM_015071chr586549 4337 4149 2471 2153 2082 768 81 11279 2904 796 12319
NM_015072chr142590 403 --1486 --
NM_015074chr1154717 3788 3538 3148 1903 1741 1407 912 572 524 454 358 180 140 67 13778 13704 23801 1804
NM_015075chrX----21996 1595 --
NM_015076chr6144351 4321 4290 4224 4174 3535 3153 3047 2741 1567 1359 912 360 316 2457 351 ----
NM_015079chr1532772 2293 1307 13183 ----
NM_015082chr532303 2144 506 22045 877 22394 1801 11032
NM_015087chr1352673 2051 2007 613 436 1338 12250 --
NM_015089chr6----1133 --
NM_015090chr1146033 5890 5731 5187 5135 4710 2437 2186 1645 1327 655 580 477 415 15113 45666 4079 769 334 11240
NM_015091chr141547 ------
NM_015092chr1694503 4324 3815 3618 3482 3015 1055 681 265 21018 710 1947 --
NM_015093chr651346 724 675 631 317 1751 11172 --
NM_015094chr2251315 1156 861 667 308 24701 1814 ----
NM_015097chr3190 --11479 --
NM_015100chr131839 734 617 --2802 619 1368
NM_015107chrX62336 2036 1540 1492 260 30 21837 638 32447 1881 1808 --
NM_015115chr482915 2714 2343 1044 973 793 784 718 22924 1140 32569 365 114 --
NM_015120chr2----1260 --
NM_015124chr2231701 835 819 1492 12053 --
NM_015129chrX51608 1440 393 292 78 142 ----
NM_015130chr451290 1266 1231 970 80 11254 ----
NM_015132chr721576 728 ----21689 511
NM_015135chr71132 ------
NM_015137chr822303 236 22140 299 22335 1707 --
NM_015138chr15102411 2027 819 653 489 275 168 83 64 57 --1474 --
NM_015143chr441274 1073 249 83 11132 ----
NM_015144chr1663067 2762 2642 1281 817 122 ----12546
NM_015149chr182181 2154 2025 1688 1680 1434 471 216 ------
NM_015155chr1073308 2767 2572 2327 1012 982 584 ------
NM_015156chr1493866 3354 2869 1622 1251 886 861 771 467 41157 1082 916 733 13487 --
NM_015157chr114445 339 277 180 ------
NM_015158chr93771 753 188 ------
NM_015161chr1661345 513 311 287 243 101 ------
NM_015170chr812081 ------
NM_015172chr131283 1186 1035 --11294 --
NM_015176chr141589 1554 637 155 --11471 --
NM_015178chr842666 2492 727 425 11061 ----
NM_015184chr31191 ------
NM_015185chrX122735 2191 2097 1938 913 620 553 520 374 355 319 66 --12628 --
NM_015187chr42944 375 143 ----
NM_015191chr1152619 1071 1046 1013 892 171 ----
NM_015192chr2031895 503 245 12848 ----
NM_015197chr1412149 1557 12278 --
NM_015199chr362908 2706 2579 2292 2087 1900 23005 1963 11957 --
NM_015200chr4102435 2372 2269 1997 1792 560 544 518 253 156 ----22272 159
NM_015206chr1573716 2576 1251 436 383 319 237 12981 1550 --
NM_015208chr1843361 913 508 73 12752 --1353
NM_015209chr1112273 2153 2098 2072 2052 2020 1961 1950 757 715 391 --1374 12156
NM_015213chr112659 60 ------
NM_015215chr133180 2167 867 22130 43 22095 784 12399
NM_015216chr53993 481 441 ------
NM_015225chr96966 946 555 380 91 31 1768 ----
NM_015230chr411595 1274 11802 --
NM_015233chr1331876 1073 597 1571 12669 --
NM_015245chr622024 561 1533 22579 2063 1590
NM_015247chr16104825 4594 4305 2144 1891 1337 1191 821 503 333 14931 11605 14075
NM_015251chr1631734 548 141 1254 12274 1239
NM_015252chr22621 161 --1149 --
NM_015254chr853175 2906 2238 404 25 --2337 46 --
NM_015256chr51623 --1127 --
NM_015260chr1941582 1554 1511 1005 --11584 --
NM_015265chr212504 12310 22139 157 --
NM_015267chr1261450 885 354 329 296 205 --11725 --
NM_015268chr33258 120 91 ------
NM_015269chr11557 ------
NM_015270chr1242391 399 392 219 11662 22243 1670 --
NM_015271chr494304 3010 2790 1266 958 760 665 638 617 1655 ----
NM_015272chr162654 519 --11796 --
NM_015275chr1222137 1779 1562 12139 --
NM_015277chr1871831 1680 1549 1464 1146 305 190 ------
NM_015278chr631259 717 211 11097 12959 143
NM_015282chr272698 2685 2049 2035 1963 149 62 2824 558 23051 2614 1456
NM_015285chr182524 470 22085 1633 1900 --
NM_015288chr583860 3665 3616 2717 2688 2596 979 172 12460 12690 22477 932
NM_015291chr173156 3056 981 815 279 210 142 11312 1508 --
NM_015296chr1321039 502 ------
NM_015299chr1442816 1570 1417 747 --2823 62 --
NM_015305chr1441975 1952 1890 1551 31368 610 516 2385 135 --
NM_015308chr112836 701 ------
NM_015310chr8177882 7703 7466 6873 6812 6679 6534 5460 3225 2621 2355 1985 1331 1263 1020 277 61 12678 22735 224 17885
NM_015313chr1174809 3829 3683 3449 3429 3125 805 23404 1571 22979 1285 --
NM_015314chr761924 797 721 708 622 435 ----1679
NM_015315chr5113461 3436 2924 2771 2429 2363 2172 1032 860 745 665 --12944 --
NM_015317chr242708 2070 993 459 32610 791 474 ----
NM_015321chr1924915 1894 1923 13950 --
NM_015326chr152552 1816 1009 740 562 32029 2013 939 22554 2068 22170 1851
NM_015328chr7102778 2464 2389 2320 1137 927 713 617 599 403 22479 972 152 --
NM_015329chr1931811 1070 530 22836 1897 ----
NM_015335chr1272441 2386 1909 1734 386 329 94 1301 196 --
NM_015336chr12289 66 1918 ----
NM_015339chr2021012 298 1844 --1287
NM_015344chr841870 674 400 195 1866 ----
NM_015345chr642777 2761 834 677 ------
NM_015346chr1441643 1562 519 239 1171 177 --
NM_015347chr1242795 2770 2732 2131 32784 2369 1096 ----
NM_015349chr662291 2066 1000 672 205 144 1127 22253 1957 --
NM_015353chr1782557 2539 2441 2282 879 683 603 298 11730 --1215
NM_015355chr1721865 1837 1591 1407 --
NM_015358chr211840 2864 317 ----
NM_015359chr862842 2242 2064 1904 342 232 --22174 234 1745
NM_015361chr21945 1894 ----
NM_015365chrX84039 4029 3718 1700 1258 398 328 85 33779 3634 802 --22968 2704
NM_015375chr164853 3983 1438 1134 221 54 21153 314 14874 122
NM_015378chr142524 2463 2165 2145 ------
NM_015381chr2212080 11762 21364 783 --
NM_015382chr142520 110 ------
NM_015384chr51119 ------
NM_015385chr1062973 2496 2298 858 775 262 ------
NM_015387chr211501 31427 761 138 ----
NM_015388chr62271 235 --132 --
NM_015393chr483614 3435 3255 2940 2641 1229 485 278 --1171 --
NM_015394chr12--1203 --11640
NM_015396chr361378 1277 444 421 270 244 --11483 --
NM_015397chr931423 363 198 21566 241 ----
NM_015409chr1252781 2597 2115 1871 994 22239 261 --12268
NM_015416chr121701 ------
NM_015423chr1131342 356 125 31300 348 312 1191 --
NM_015429chr331058 1002 744 11075 ----
NM_015435chr811339 ------
NM_015436chr463257 2965 2670 2553 621 234 32625 2221 1275 --13096
NM_015443chr1741447 1382 1097 569 1959 --11312
NM_015444chr32443 54 --2569 257 --
NM_015446chr121456 635 11270 ----
NM_015447chr91140 ------
NM_015455chr574033 3581 1289 1242 1004 908 406 1235 23122 645 --
NM_015457chr11------21092 211
NM_015458chr884586 4433 4353 3565 1857 1824 1503 1012 23805 1478 ----
NM_015461chr18165 ------
NM_015463chr22721 616 137 --1552
NM_015464chr71178 ----1181
NM_015465chr52790 758 2591 53 --1500
NM_015466chr32218 191 ------
NM_015475chr22931 217 ------
NM_015477chr154988 703 667 217 195 ----
NM_015481chr121223 1689 21079 1029 --
NM_015496chr8----1209 --
NM_015508chr321549 191 51456 1283 1227 254 115 ----
NM_015509chr1241413 1282 1152 387 11402 21415 636 --
NM_015514chr144409 397 389 56 1437 1619 --
NM_015516chr1141187 482 432 193 --2484 447 --
NM_015520chr342739 2281 1890 1881 --12581 --
NM_015527chr161514 1684 139 --
NM_015532chr1542073 2037 547 323 32793 361 151 1606 --
NM_015534chr12890 786 ------
NM_015541chr311160 1948 ----
NM_015542chr101218 ------
NM_015550chr752908 2440 2273 2241 134 13137 22257 1137 --
NM_015553chr694739 3840 3681 2004 1979 1335 1299 735 680 23866 1417 1539 --
NM_015554chr1572781 2688 2631 1913 955 501 372 12527 11915 --
NM_015556chr141176 ------
NM_015557chr133673 415 103 --23430 280 --
NM_015559chr183873 739 690 1718 ----
NM_015564chr563321 3069 2641 2598 644 613 33580 2701 1186 22669 1038 --
NM_015565chr2162295 2044 1627 1586 1520 654 --21532 1498 --
NM_015567chr133496 370 169 --1411 1421
NM_015568chr2093202 2876 2843 2836 1733 1536 1254 1006 871 44352 3728 1634 118 11295 --
NM_015569chr1124379 1932 1920 1772 1446 926 845 782 558 494 485 399 1204 14602 --
NM_015570chr721761 1729 2627 361 --1660
NM_015571chr642036 1030 763 416 22102 525 ----
NM_015575chr273027 1262 783 649 637 148 91 --11063 22326 2302
NM_015576chr353001 2376 2258 1823 1037 --12311 --
NM_015577chr531600 1535 413 21715 1114 1128 --
NM_015578chr1921919 465 11595 ----
NM_015601chr101651 ------
NM_015602chr151536 1495 688 321 83 11748 --1432
NM_015604chr142301 214 --3282 240 234 1217
NM_015607chr11200 1161 1193 --
NM_015609chr142575 2418 2336 464 11927 12338 --
NM_015610chr791959 1951 1938 1092 1006 892 661 569 242 1684 --11095
NM_015626chr171291 --1284 --
NM_015627chr131444 1314 1177 --31389 385 183 --
NM_015630chr2--1950 ----
NM_015635chr921941 376 1349 2339 190 --
NM_015652chr10--297 51 --1596
NM_015676chr141331 ------
NM_015678chr13--1391 ----
NM_015686chrX21920 419 11889 1400 --
NM_015690chr22593 234 --2259 48 1663
NM_015691chrX42900 2883 1849 685 1430 ----
NM_015695chr641916 1856 741 547 --31807 549 535 --
NM_015697chr41343 ------
NM_015704chr22140 ------
NM_015716chr17----2286 79 --
NM_015719chr192546 152 --1241 --
NM_015723chr71678 1482 ----
NM_015726chr151863 576 456 427 261 --31700 449 63 --
NM_015840chr172536 1670 499 476 337 251 104 --3501 459 208 --
NM_015841chr172536 1670 499 476 337 251 104 --3501 459 208 --
NM_015845chr18----1681 --
NM_015866chr12608 465 ------
NM_015874chr41433 2637 106 ----
NM_015878chr821821 1683 1387 ----
NM_015879chr18238305 8055 7491 7175 7026 6649 6101 5656 5615 5560 5222 3079 2794 2408 1932 1632 1543 1487 1480 1187 677 149 131 1780 48275 2814 2716 1220 12727
NM_015886chr875256 4978 4869 1374 1247 171 130 45758 5362 4063 2174 15094 11531
NM_015888chr163249 2990 2746 2497 2367 2151 174 12748 --
NM_015891chr642047 518 288 120 --11858 --
NM_015892chr1082318 2161 1539 1522 718 614 579 69 --1432 11890
NM_015898chr1942175 1866 998 199 22183 467 42483 1598 1587 939 --
NM_015902chr81903 ------
NM_015904chr2----1321 --
NM_015906chr194202 4054 1869 1759 1742 1606 1474 1416 871 44711 4020 1883 696 14164 24274 1872
NM_015907chr4--1262 ----
NM_015912chr842189 2036 1943 1685 --12340 --
NM_015913chr11217 122 3565 514 219 --
NM_015916chr102222 22 ------
NM_015941chr82310 120 1350 ----
NM_015949chr73759 303 289 --11006 1717
NM_015955chr22326 134 ------
NM_015959chr113725 617 97 181 149 --
NM_015975chrX31228 269 149 11791 1549 --
NM_015981chr573075 2808 2505 2497 1180 1079 797 22565 2399 22987 2088 --
NM_015982chr171312 1131 2138 97 --
NM_015986chr1741120 1067 912 383 1921 11384 --
NM_015990chr4141 2777 187 ----
NM_015995chr1565378 5318 4390 4044 1185 55 --54571 3839 3446 1262 247 11088
NM_016003chr791959 1951 1938 1092 1006 892 661 569 242 1684 --11095
NM_016009chr154735 1953 456 224 136 14465 13318 24081 1585
NM_016018chr842441 2156 1999 1753 12419 12774 --
NM_016019chr72715 252 1261 ----
NM_016021chr662708 2389 2168 2050 312 115 12532 12259 --
NM_016022chr11146 11075 1771 --
NM_016025chr163449 223 202 1432 ----
NM_016032chrX1887 21398 538 11338 1103
NM_016040chr141954 973 704 486 12521 21869 975 --
NM_016041chr17170 --1306 --
NM_016047chr2264 56 ------
NM_016057chr1251101 1026 439 378 317 --1252 --
NM_016061chr241542 1360 142 26 ------
NM_016072chr1292446 2323 2177 1933 1880 1827 897 890 336 ------
NM_016073chr152999 188 1298 ----
NM_016075chr1392819 2642 2416 2178 912 836 567 131 23 --32586 1102 838 --
NM_016076chr152906 2790 2417 2230 80 1931 12964 13022
NM_016079chr252066 2026 1901 1842 933 22124 124 32068 1858 1700 22109 714
NM_016081chr422083 268 11736 ----
NM_016083chr633668 3637 3095 12620 13582 --
NM_016087chr741656 1407 234 164 11235 --2696 553
NM_016090chr1141080 1050 701 47 2418 186 --1704
NM_016096chr8181 11501 21777 429 --
NM_016097chr181308 1841 1721 --
NM_016099chr831404 1108 98 ------
NM_016103chr51365 ------
NM_016120chrX3324 287 147 ------
NM_016122chr12----1489 --
NM_016127chr82654 62 ------
NM_016129chr4------1109
NM_016131chr262142 2019 1978 1673 1497 545 21456 147 12257 --
NM_016132chr1573246 2722 2522 2478 2155 1247 877 11134 --13249
NM_016133chr22483 463 ------
NM_016141chr3----2762 63 --
NM_016147chr1141081 1041 875 232 ----2458 153
NM_016151chr161323 195 ----
NM_016152chr361272 1060 386 359 259 194 1851 ----
NM_016156chr1122219 938 1514 31974 1871 460 --
NM_016162chr123842 307 260 1860 --1310
NM_016169chr1083098 2987 2805 2648 2636 2329 1178 725 11152 53017 2642 2471 889 341 11081
NM_016192chr21249 ------
NM_016194chr1541784 1547 1330 1266 ------
NM_016201chr332281 2170 1451 --52303 2172 833 656 103 12008
NM_016205chr431119 328 188 1117 ----
NM_016206chr3188582 8561 8111 7196 6771 6454 5715 5454 3384 3377 2459 2178 1861 1812 1252 1210 247 150 25530 363 37713 1109 876 --
NM_016217chr643307 3055 2327 94 21433 855 ----
NM_016221chr532077 847 623 --32305 2294 2226 --
NM_016227chr161368 1307 1268 372 326 135 ------
NM_016231chr171327 ------
NM_016233chr1----1149 --
NM_016234chr103803 194 88 ------
NM_016235chr1641517 1217 1040 64 --11162 --
NM_016247chr31510 ------
NM_016248chr1383994 3830 2843 2492 1151 760 485 391 43841 3582 2748 635 ----
NM_016257chr193254 3089 3004 2400 2203 1037 1025 802 500 23172 2320 ----
NM_016258chr12773 561 ----1247
NM_016260chr2126916 6311 6294 6230 5938 5182 2995 2464 2215 2027 1111 79 46162 1161 1054 102 55623 5562 2706 2466 1036 16596
NM_016262chr6155 1462 1230 --
NM_016263chr1922600 1352 ------
NM_016269chr44946 877 376 318 --1208 --
NM_016271chr1852123 1727 1553 1479 738 31787 1693 666 ----
NM_016272chr2252035 1853 962 851 769 22336 681 32456 2431 2422 1575
NM_016275chr362708 2468 2086 941 436 28 --12470 --
NM_016277chr671638 1526 1146 1014 401 377 205 1153 --11415
NM_016281chr121909 --1911 --
NM_016282chr931757 675 72 11509 11476 --
NM_016284chr162669 107 181 1936 1876
NM_016287chr182065 2046 1653 1612 1491 601 312 261 188 31717 515 193 --
NM_016289chr212289 31977 696 609 1136 --
NM_016303chrX2384 74 ------
NM_016308chr121786 371 21773 92 171 1274
NM_016319chr123707 649 553 ------
NM_016322chr962359 2314 1008 629 378 325 33063 2508 36 1631 12317
NM_016328chr71141 194 ----
NM_016333chr161102 1461 2149 138 --
NM_016338chr531170 1120 397 ----132
NM_016339chr1721251 91 --21273 1267 11447
NM_016351chr7--1587 ----
NM_016352chr771378 1092 1085 944 492 456 234 --177 --
NM_016353chr851881 935 829 620 109 11546 22007 1912 --
NM_016357chr1231154 1029 59 11283 1934 --
NM_016358chr5--163 ----
NM_016374chr141380 1366 570 186 2632 273 ----
NM_016374chr141380 1366 570 186 2632 273 ----
NM_016376chr1763597 3491 1526 1280 578 465 11423 14219 24199 561
NM_016377chr6--1136 1570 --
NM_016396chr1572531 2306 2064 1976 481 401 117 2736 530 151 --
NM_016410chr95452 202 136 100 68 ------
NM_016418chr2263540 3321 3137 2827 1170 316 --23531 1324 --
NM_016422chr11102975 2575 2481 2386 2266 898 677 531 472 115 22431 2295 --1150
NM_016424chr173724 308 252 11495 11311 --
NM_016436chr2061773 1072 925 555 455 379 11944 1457 1832
NM_016441chr252251 2000 572 534 184 11659 ----
NM_016442chr542116 1622 775 164 21996 523 11563 --
NM_016447chr71232 ------
NM_016448chr111374 31900 493 147 --1126
NM_016451chr111243 1120 --2246 81
NM_016470chr201134 1164 1104 --
NM_016475chr1411121 ------
NM_016480chr51722 ------
NM_016486chr11175 1424 ----
NM_016506chr112670 36 --2274 38 --
NM_016507chr1793095 1280 863 551 494 457 417 373 33 23174 1168 2788 753 --
NM_016516chr21673 1737 ----
NM_016522chr1151284 1190 1090 303 238 ------
NM_016530chr1593768 3421 3291 2996 2885 1324 744 312 280 23859 3269 2189 44 22652 1181
NM_016531chr453594 3399 2552 987 588 ------
NM_016536chr191271 --1338 --
NM_016538chr173449 309 97 ------
NM_016542chrX41370 1128 660 100 2350 300 ----
NM_016544chr2103869 3837 3630 3425 2866 1307 1153 716 581 533 1108 --1355
NM_016559chr341218 1210 615 538 11020 1275 --
NM_016569chr1231545 1050 105 2411 24 --11130
NM_016570chr122396 51 ------
NM_016574chr113916 896 379 --1898 --
NM_016577chr384395 4147 4007 3806 2928 595 410 117 --2707 382 --
NM_016578chr112201 147 ------
NM_016587chr741142 942 282 220 ------
NM_016603chr551659 1562 1438 542 416 2306 279 11644 --
NM_016604chr53326 250 77 142 ----
NM_016605chr561916 836 794 703 584 334 12205 1929 --
NM_016612chr83452 270 24 ------
NM_016617chr1351434 1382 725 713 693 133 1143 --
NM_016618chr24422 228 174 86 ------
NM_016621chr1154481 3496 3410 1690 973 23418 1711 33151 979 891 --
NM_016622chr251463 688 615 579 260 12158 ----
NM_016623chr84408 164 136 115 1212 ----
NM_016626chr1811599 ------
NM_016628chr103667 638 629 1322 --1680
NM_016649chr20138 195 ----
NM_016652chr2031810 1200 230 1294 ----
NM_016654chr1521345 1083 --11224 --
NM_016818chr212799 566 --1197 1790
NM_016824chr1051798 1712 1314 1194 631 11304 --11370
NM_016834chr1753529 3458 1013 297 208 --11506 23636 3461
NM_016835chr1753529 3458 1013 297 208 --11506 23636 3461
NM_016836chr23619 589 539 1563 1591 --
NM_016839chr23619 589 539 1563 1591 --
NM_016841chr1753529 3458 1013 297 208 --11506 23636 3461
NM_016929chr684107 3996 3941 1843 1613 1352 371 229 24519 158 1373 --
NM_016932chr26707 374 350 335 208 30 1295 3663 325 317 --
NM_016936chr1671934 1800 1609 1551 1525 822 598 --187 --
NM_016946chr183470 2788 2598 1387 1233 1181 1105 1027 --3977 400 193 --
NM_016952chr1183321 3181 3156 2752 1586 1567 1381 1049 33086 3072 416 24006 1616 1167
NM_016953chr2104429 4333 2040 1406 1290 526 439 383 228 74 24633 1308 1669 --
NM_017409chr122585 58 ------
NM_017412chr82226 63 ------
NM_017415chr554570 3193 3137 2969 405 12956 23570 1813 --
NM_017420chr14133515 3403 3112 2629 2464 2443 1056 1005 989 499 218 195 24 32639 1184 49 ----
NM_017423chr41874 ----1550
NM_017426chr42647 108 ------
NM_017437chr1432323 968 36 ------
NM_017439chr7163 1433 ----
NM_017444chr841217 519 145 132 21572 321 11266 --
NM_017447chr2142692 455 210 34 44065 4039 3713 803 ----
NM_017450chr1761442 1158 324 237 132 113 ------
NM_017452chr2021426 502 ------
NM_017453chr2021426 502 ------
NM_017454chr2021426 502 ------
NM_017455chr154730 697 250 77 ----194
NM_017481chr11143 ------
NM_017491chr431033 860 773 --1862 --
NM_017519chr641280 309 234 214 --11282 --
NM_017522chr131257 1231 1011 11035 ----
NM_017540chr563173 3000 2784 2581 2570 2561 12020 12912 2279 62
NM_017548chr321535 825 1236 ----
NM_017551chr1032614 1834 325 1769 --2465 123
NM_017553chr151303 11290 11222 --
NM_017569chr13162 1312 ----
NM_017575chr1751591 1526 1498 1192 299 --11181 1429
NM_017577chr3--2194 141 11163 11023
NM_017580chr1032217 1494 397 1407 --1694
NM_017582chr121502 1294 --11520 --
NM_017590chr2222539 976 --21636 603 12350
NM_017596chr164491 4119 1296 1191 188 124 --61153 892 190 62 52 46 22930 31
NM_017599chr1241317 669 377 215 31751 1705 42 ----
NM_017602chrX4771 598 120 105 ------
NM_017610chr1521868 640 1648 21667 642 --
NM_017617chr951106 365 190 94 32 --1456 --
NM_017628chr4114964 4829 4502 4032 3929 3274 1873 1384 1060 446 217 24602 2035 34966 500 448 14651
NM_017629chr141379 1205 370 218 11300 11263 --
NM_017632chr41359 ------
NM_017633chr683794 3538 3170 2976 2865 2677 1367 199 --23314 201 --
NM_017634chr851854 1402 505 246 58 1562 ----
NM_017635chr1121443 356 21357 621 ----
NM_017637chr9189058 8895 8758 8244 8229 8218 7070 6453 5928 3539 2508 1991 1845 1663 1508 1330 271 213 68850 8628 6709 2263 1963 1107 17966 --
NM_017640chr64853 242 154 77 ------
NM_017643chr1793005 2755 2702 2523 2424 2280 797 663 400 23027 1188 23124 2532 12313
NM_017644chr374862 4008 3433 794 173 132 87 53594 1543 1273 304 154 ----
NM_017645chr973084 2412 2245 1977 1231 1099 191 2414 138 22875 1945 --
NM_017650chr765938 3970 3864 1743 1371 1133 55715 5374 3876 1987 1708 ----
NM_017657chr22581 33 2938 369 ----
NM_017658chr1494526 3950 3942 3424 1537 1194 1166 968 678 11117 ----
NM_017660chr19103267 2329 1242 1228 1165 938 441 261 253 234 12375 ----
NM_017661chr152969 387 1338 --1390
NM_017664chr134709 412 372 218 ------
NM_017666chrX41767 803 520 247 1143 1492 --
NM_017672chr153416 257 64 11102 ----
NM_017691chr15----1383 --
NM_017694chr221794 703 ------
NM_017700chr44552 501 417 135 ------
NM_017709chr1103464 3390 2936 2783 1693 1588 1060 853 253 141 13753 34211 2875 701 1881
NM_017712chr19136119 4894 3952 3918 2468 2070 2009 1247 627 573 557 541 509 24986 1170 66244 5728 5713 5189 5116 467 --
NM_017714chr203683 633 89 ------
NM_017715chr75580 480 272 244 116 ------
NM_017719chr372082 1832 998 971 343 185 124 11905 ----
NM_017724chr32685 554 --1836 185
NM_017730chr34581 531 262 164 2742 121 ----
NM_017737chr122141 732 22234 1946 ----
NM_017742chr1841964 767 412 343 11575 ----
NM_017744chr16731 573 562 311 244 220 ------
NM_017745chrX1279 2224 173 ----
NM_017747chr5121 1289 ----
NM_017748chr174780 218 161 68 193 ----
NM_017753chr95968 951 707 666 316 ------
NM_017754chr6104064 3795 3232 1645 1311 862 717 644 572 267 14280 23437 1144 --
NM_017758chr1731398 949 58 --2539 429 --
NM_017768chr11660 ------
NM_017769chr1452293 1193 1178 505 57 12555 --23225 76
NM_017770chr692966 2892 2814 2786 1903 958 860 470 264 --1544 --
NM_017772chr651607 1522 1135 588 265 --31609 1087 590 --
NM_017778chr811171 ------
NM_017779chr172771 2723 2575 2000 1857 729 481 12072 ----
NM_017780chr82739 600 1868 ----
NM_017784chr321179 320 ------
NM_017787chr1092832 2774 2452 2403 2328 2316 969 265 115 --2818 703 --
NM_017789chr2--1266 ----
NM_017791chr1431186 1163 316 --2597 46 1236
NM_017799chr1451972 1693 1602 1288 1241 1264 --11702
NM_017803chr162219 186 1237 ----
NM_017811chr973083 2776 2301 2148 1969 563 163 72720 2698 2608 2294 2139 1171 362 ----
NM_017813chr8115723 5251 4904 4567 3926 3658 1732 1525 1424 1386 762 31253 1014 945 25072 764 25260 1633
NM_017824chr1042513 1909 1063 350 12549 ----
NM_017845chr41538 ------
NM_017848chrX94483 4036 3947 3802 3520 3075 958 144 53 11649 14452 --
NM_017849chr283228 3198 2688 2226 2037 845 528 77 1732 22043 213 --
NM_017851chr151839 1272 1371 --
NM_017866chr83446 376 68 ------
NM_017869chr164590 506 466 426 --1200 --
NM_017880chr23430 312 182 ------
NM_017893chr1011002 --31477 352 346 --
NM_017896chr20113350 2932 2433 2370 2344 1270 771 712 549 199 102 --12971 --
NM_017902chr1075495 5066 4359 2215 1616 1393 1189 24338 4019 44642 4529 1395 1018 34139 1843 765
NM_017905chr13--1535 ----
NM_017906chr63281 105 29 ------
NM_017910chr22322 300 ------
NM_017915chr121746 21167 807 ----
NM_017919chr994116 3666 1515 1171 1117 1084 820 627 79 85087 4868 4710 3752 2337 2101 1560 1035 11086 24422 1590
NM_017925chr91234 21701 1494 ----
NM_017933chr211307 --11154 --
NM_017938chrX21977 410 11585 ----
NM_017944chr1132997 2064 963 22202 806 ----
NM_017945chr321296 857 2939 75 2488 403 --
NM_017953chr13311 214 139 1951 1479 --
NM_017958chr231900 727 115 12665 ----
NM_017964chr241003 850 839 217 ------
NM_017969chr2155 ------
NM_017974chr21919 11317 11019 --
NM_017987chr1061883 1658 1503 688 556 497 32097 1904 655 1479 --
NM_017994chr742739 964 595 518 22749 1871 22728 997 --
NM_018000chr232118 2110 524 ----11379
NM_018011chr13----1157 --
NM_018027chr1042725 2651 2287 757 11060 ----
NM_018028chr1921017 273 11259 11004 --
NM_018032chr162828 386 ------
NM_018037chr12264 51 ------
NM_018043chr1151354 1272 171 160 152 11437 1532 --
NM_018045chr173023 2992 2338 2292 1017 860 72 ------
NM_018046chr531732 1378 435 1565 ----
NM_018048chr1221440 225 22048 785 1794 21443 813
NM_018061chr151376 1184 1164 408 290 21447 654 1133 --
NM_018078chr42936 655 1249 ----
NM_018079chr24495 462 187 141 --1189 --
NM_018080chr15--1135 ----
NM_018084chr253133 3040 993 823 679 22843 2614 ----
NM_018085chr186491 5372 2451 2437 961 695 529 242 --37616 1497 818 --
NM_018086chr221787 1661 21684 1514 21818 81 --
NM_018087chr1----1197 --
NM_018092chr1621434 413 31225 618 403 21323 87 --
NM_018095chr112670 36 --2274 38 --
NM_018097chr152281 163 1197 ----
NM_018098chr321172 988 1976 ----
NM_018105chr81506 1792 ----
NM_018112chr91867 --1161 --
NM_018117chr101686 1650 ----
NM_018120chr83507 497 432 31335 352 236 ----
NM_018121chr1063125 2643 2504 2161 2007 1032 31195 219 55 12492 11146
NM_018133chr332145 1759 1568 ------
NM_018137chr121240 1016 --1119 31414 1053 1019
NM_018150chr14901 810 677 77 ------
NM_018155chr353010 2958 2694 809 174 11224 13039 --
NM_018156chr142524 2463 2165 2145 ------
NM_018157chr1232499 72 47 21232 840 12501 12874
NM_018164chr121280 ------
NM_018169chr12143 1537 149 --
NM_018178chr161946 1858 1338 557 105 24 --3563 107 26 --
NM_018179chr123185 45 28 --1602 --
NM_018181chr1841305 634 419 231 ----1124
NM_018182chr1762044 1738 794 534 298 228 --2746 697 --
NM_018184chr331551 331 113 ------
NM_018191chr1331608 231 172 21909 291 11531 --
NM_018193chr15----1202 --
NM_018195chr1172175 1907 1859 1831 1806 1458 1366 --31861 551 175 --
NM_018196chrX1898 1257 ----
NM_018199chr141911 11046 1827 --
NM_018200chr1542631 2179 1027 114 1358 1715 1383
NM_018202chr13748 739 346 1283 ----
NM_018206chr162206 27 189 ----
NM_018208chr121180 469 --11103 --
NM_018211chr131459 445 93 --11839 --
NM_018214chr61431 ------
NM_018216chr1--1218 ----
NM_018222chr1131755 585 515 11748 --1450
NM_018227chr443157 3115 2707 1243 12789 --1106
NM_018241chr4--2907 765 ----
NM_018244chr201309 ------
NM_018247chr621058 117 33018 2150 428 23089 674 21913 291
NM_018252chr12521 292 ------
NM_018254chr171675 1657 963 809 675 600 215 2555 34 11677 --
NM_018256chr22253 97 ------
NM_018266chr31423 31019 333 178 ----
NM_018287chr1031060 892 101 ------
NM_018293chr31934 22676 2643 --12769
NM_018299chr811091 1128 13149 --
NM_018302chr462137 1858 1725 838 681 391 ------
NM_018307chr17------2961 696
NM_018312chr1132006 1978 1503 1853 11625 --
NM_018313chr312249 ------
NM_018315chr411104 ------
NM_018320chr111240 ------
NM_018323chr441541 1356 1337 1237 --1644 --
NM_018326chr74751 701 328 314 1884 ----
NM_018327chr2031890 1673 639 11263 1641 1317
NM_018328chr21521 ------
NM_018330chr1051627 1515 514 337 249 11215 --1252
NM_018334chr71474 ------
NM_018335chr142371 185 1163 ----
NM_018338chr3184 ----1166
NM_018339chr9--21776 1700 ----
NM_018340chr1685074 4534 4473 4414 1077 469 192 128 129 44969 4475 3770 3278 --
NM_018351chr12114520 4138 4066 4045 3789 2866 1715 1704 1630 1065 601 --34068 2872 1843 14569
NM_018361chr8104024 4014 3612 3317 2713 1435 1126 951 937 772 11377 --11608
NM_018362chr1122972 246 --12482 --
NM_018364chr164147 3419 3239 2631 1221 866 44011 3732 3465 1113 13068 --
NM_018367chr1172186 2146 2101 702 371 336 287 21810 217 ----
NM_018371chr821432 38 21102 596 ----
NM_018373chr14116199 5398 5295 4674 4664 4587 4045 2511 1635 321 79 26390 1886 ----
NM_018374chr763981 2054 1694 1675 661 434 31284 946 521 21855 1411 --
NM_018383chr22820 110 11675 ----
NM_018386chr132275 99 ------
NM_018387chr92128 71 1497 ----
NM_018388chrX51178 1166 289 56 31 11125 ----
NM_018394chr351589 1448 308 266 239 21614 990 2310 96 --
NM_018403chr373801 3496 3140 2619 1289 909 828 --23142 830 --
NM_018409chr473176 2422 2267 1089 623 611 295 22683 2582 23022 2930 --
NM_018416chr12132540 2494 2275 2034 1941 1778 993 576 420 387 309 125 115 11650 42047 1662 960 175 --
NM_018424chr931707 1236 494 21445 618 ----
NM_018429chr532662 1129 900 21806 184 ----
NM_018439chr1872576 2367 2128 1679 799 419 139 2505 410 --11011
NM_018440chr8157216 7066 6868 6445 6110 5840 5656 5468 3398 2284 1833 1738 1635 1274 1169 45491 2517 1677 800 37068 410 404 --
NM_018442chr1----1121 --
NM_018444chr822146 387 21474 927 1116 --
NM_018445chr15--179 ----
NM_018448chr1221138 360 1936 ----
NM_018452chr6_random31508 1201 411 21363 1149 ----
NM_018462chr34563 326 298 86 ----1231
NM_018469chr1731064 938 370 ----1497
NM_018471chr2170 --1576 --
NM_018482chr832103 1931 591 31951 831 707 12070 --
NM_018489chr172388 2244 2064 1958 1853 1494 535 11802 11504 --
NM_018509chr1781507 1389 1227 693 674 666 144 81 21373 1241 1285 1381
NM_018553chr1761692 1572 1330 251 224 188 11169 1408 --
NM_018557chr241441 1433 368 288 --1104 --
NM_018559chr13152 1101 ----
NM_018566chr142055 1731 1495 1393 23470 118 24282 223 14430
NM_018569chr431329 1033 85 1208 --11284
NM_018571chr2----2478 444 --
NM_018584chr141168 1017 972 897 ------
NM_018590chr1041332 480 119 86 11518 1482 11275
NM_018593chr62686 59 166 ----
NM_018602chr1521212 152 ------
NM_018638chr1244469 4372 441 52 55567 3875 3820 1300 830 ----
NM_018640chr1232562 783 768 22798 759 ----
NM_018648chr15291 25 ------
NM_018649chr103591 443 208 ------
NM_018650chr121764 572 --11649 --
NM_018652chr153279 268 254 --3945 869 642 --
NM_018657chr31553 ------
NM_018660chr843005 2118 998 430 --2786 591 --
NM_018682chr72576 163 --1125 --
NM_018684chrX51294 1106 1057 541 159 11330 --1544
NM_018689chr1542591 2407 2058 1015 22075 572 21955 1932 21779 629
NM_018693chr21100 ------
NM_018695chr532003 1823 1812 21753 1508 ----
NM_018698chrX21768 1452 11524 1139 --
NM_018699chr41335 --1282 --
NM_018700chr521142 211 31717 370 183 ----
NM_018703chr161415 ------
NM_018704chr11516 12044 --11766
NM_018710chr8----1880 2291 221
NM_018711chr1211496 ------
NM_018712chr111116 1379 ----
NM_018713chr13979 220 189 21116 863 ----
NM_018715chr152050 1806 314 200 174 --31753 893 351 --
NM_018718chr71929 144 --1409
NM_018834chr52110 66 ------
NM_018841chr163605 2560 1037 274 180 163 21165 598 12665 --
NM_018847chr951961 1901 1829 700 401 ------
NM_018890chr751308 1251 1019 965 573 ------
NM_018898chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018899chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018900chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018901chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018902chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018903chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018904chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018905chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018906chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018907chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018908chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018909chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018910chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018911chr582202 1820 1635 1549 879 831 257 82 --2833 205 --
NM_018945chr673580 3485 2704 1025 726 160 119 43294 3166 1220 982 1162 --
NM_018948chr121097 542 11453 1506 --
NM_018951chr721029 518 ------
NM_018953chr124738 145 72 59 --165 --
NM_018959chr193688 287 182 ------
NM_018963chr2131452 1444 268 ------
NM_018964chr2131040 112 105 157 ----
NM_018970chr71948 --11024 --
NM_018972chr832331 1787 1748 1907 ----
NM_018976chr1252075 771 594 476 100 --1985 --
NM_018977chrX21044 226 ----1952
NM_018979chr124802 772 504 483 22275 1876 2548 467 --
NM_018981chr231156 1018 996 ------
NM_018992chr1651412 1301 1099 1061 135 ------
NM_018993chr2051379 1062 429 418 204 --11070 --
NM_018994chr12114 23 1568 125 --
NM_018999chr1074605 4552 4138 3255 1393 1108 103 --11884 21111 545
NM_019000chr531520 1390 1056 11310 ----
NM_019001chr394321 3929 3754 3295 3133 1643 1077 469 49 33043 1385 152 23931 37 --
NM_019004chr772107 520 489 463 384 211 189 1583 1218 --
NM_019006chr15--2643 220 ----
NM_019008chr2263803 3723 3652 2511 1047 375 1456 43353 2744 886 158 13439
NM_019016chr17190 131 ----
NM_019022chr1882891 2727 2496 2474 2065 1187 1163 836 ----12068
NM_019026chr12135 33 --1108 --
NM_019027chr431904 1791 699 ------
NM_019030chr51179 ------
NM_019035chr421854 828 21966 1950 --11836
NM_019036chr61128 1905 --1131
NM_019041chr642462 2431 2305 507 ----12308
NM_019042chr731240 1155 1079 1969 1985 --
NM_019045chrX3590 364 315 ------
NM_019049chr11527 2662 564 ----
NM_019050chr441982 1586 607 293 11932 ----
NM_019053chr1031011 984 929 ----11020
NM_019058chr101825 ------
NM_019063chr241786 1710 778 25 --22338 629 --
NM_019083chr161582 1456 1239 353 200 148 11261 ----
NM_019084chr1031821 1665 147 22120 1921 ----
NM_019088chr192138 59 184 ----
NM_019091chr2----1877 --
NM_019096chr63982 964 404 ------
NM_019098chr881796 1784 1737 1637 1577 682 279 264 --2348 266 --
NM_019106chr2283186 2356 1369 1359 1306 1183 745 288 31116 902 821 22280 753 --
NM_019114chr961834 1782 956 783 268 55 22103 2009 11899 21941 271
NM_019116chr16173561 3457 3378 3224 2978 2958 2924 2811 2596 1321 1128 1101 1001 789 633 539 459 --32512 545 205 --
NM_019117chrX42873 1184 1007 574 11201 22929 2541 --
NM_019555chr321815 1164 11342 ----
NM_019557chr12776 752 --1839 --
NM_019590chr1021471 1286 2509 446 ----
NM_019593chr2042828 2438 202 90 32042 621 345 --1137
NM_019597chrX4714 495 171 161 1781 1151 --
NM_019600chr153635 583 196 ------
NM_019606chr74482 139 114 86 ------
NM_019610chr131883 576 114 22168 213 1614 1727
NM_019842chr6--1142 ----
NM_019857chrX41778 1392 1156 203 ------
NM_019859chr1071446 1171 602 564 428 180 101 11476 ----
NM_019860chr1071494 1219 650 612 476 228 149 11524 ----
NM_019862chr1641789 1714 1630 1186 11682 ----
NM_019885chr242605 2036 1856 348 12350 --1360
NM_019891chr151326 1317 1065 1021 306 21096 55 11090 --
NM_019895chr32960 730 2330 207 ----
NM_019898chr1641789 1714 1630 1186 11682 ----
NM_019899chr1641789 1714 1630 1186 11682 ----
NM_019900chr1641789 1714 1630 1186 11682 ----
NM_019903chr1051798 1712 1314 1194 631 11304 --11370
NM_020039chr1221490 117 --21517 1206 --
NM_020062chr20----1993 --
NM_020066chr11367 --1220 --
NM_020116chr41371 11160 ----
NM_020120chr241603 1031 231 122 11110 11398 --
NM_020122chr275296 2308 1431 1398 1384 676 539 56000 5759 1783 1096 1056 43873 2010 1433 1417 11401
NM_020123chr1031472 1323 557 --1130 --
NM_020127chr151874 713 639 601 212 --11807 --
NM_020130chr821410 1031 ----