TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5682
miRNA Sequence: GUAGCACCUUGCAGGAUAAGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX1273 ------
NM_000061chrX1403 ------
NM_000081chr111281 --11158 --
NM_000084chrX56831 4366 1293 1180 940 26752 2384 24988 2391 16470
NM_000088chr17----31062 930 887 --
NM_000090chr22614 294 --1249 1690
NM_000104chr242756 2391 2302 92 11022 ----
NM_000138chr1531912 677 608 --1423 --
NM_000141chr1011408 --1383 --
NM_000161chr141658 1428 ----
NM_000163chr511768 ----1276
NM_000165chr61555 --157 179
NM_000176chr543028 2783 2736 684 12432 12749 --
NM_000192chr1211165 ----1401
NM_000208chr1954601 3923 3835 3207 1642 33938 3385 2979 13618 --
NM_000210chr241966 1925 1891 658 ----11577
NM_000212chr1741642 1535 938 329 22371 2092 ----
NM_000214chr2021434 1336 1111 ----
NM_000237chr83765 262 100 ----11804
NM_000245chr721496 763 ------
NM_000259chr1575334 4857 4749 4322 4275 4230 191 16270 14760 --
NM_000264chr91755 22799 998 1970 --
NM_000267chr1723194 412 --12123 --
NM_000269chr171151 ------
NM_000272chr211186 1420 ----
NM_000276chrX31788 1585 223 ------
NM_000280chr11--142 ----
NM_000310chr12526 194 --11209 --
NM_000314chr1033263 3121 1038 21314 943 1683 --
NM_000319chr122926 470 --1276 --
NM_000332chr667062 4494 2816 2385 876 767 ------
NM_000333chr3--1246 ----
NM_000337chr511355 26212 5387 ----
NM_000345chr43827 225 178 ------
NM_000346chr171667 1352 ----
NM_000368chr943481 1353 742 263 124 14405 --
NM_000378chr1121197 143 ------
NM_000389chr631507 1046 223 ------
NM_000408chr263095 2965 2507 466 398 146 ------
NM_000411chr2132209 1138 170 ------
NM_000421chr171238 ------
NM_000426chr6------1140
NM_000430chr1722961 882 11204 ----
NM_000451chrX1796 ------
NM_000461chr313962 14455 ----
NM_000462chr152461 267 11418 ----
NM_000463chr21673 177 ----
NM_000480chr1131217 1191 663 ------
NM_000484chr2131088 741 139 ------
NM_000495chrX----2394 113 1436
NM_000533chrX1735 11349 ----
NM_000554chr1941015 704 643 137 ----1296
NM_000555chrX46859 5185 264 95 27757 2638 37740 6868 621 16433
NM_000609chr1032472 766 58 12948 32738 2690 2328 --
NM_000617chr1232176 1424 669 11956 12250 --
NM_000618chr121320 14628 1908 --
NM_000618chr121320 14628 1908 --
NM_000627chr21263 ----1663
NM_000637chr81181 --1418 --
NM_000663chr1653107 2844 2085 1932 181 ------
NM_000684chr101950 ------
NM_000693chr1531723 1233 62 ------
NM_000721chr132389 2271 1028 --1699 2751 606
NM_000724chr1021306 193 ------
NM_000783chr101380 ------
NM_000800chr511661 1315 --11057
NM_000801chr201376 --1842 --
NM_000806chr51405 ------
NM_000811chr51572 ------
NM_000813chr535245 4575 4056 14027 ----
NM_000814chr1533543 3508 3186 22807 2771 ----
NM_000817chr211018 ------
NM_000818chr102377 181 ------
NM_000826chr421908 79 12453 --1800
NM_000829chr1122329 1785 ----11602
NM_000859chr5--1630 1524 --
NM_000868chrX22291 2078 ------
NM_000875chr1556068 4767 4538 2068 730 11797 12144 --
NM_000876chr621290 1206 ------
NM_000899chr1253843 1766 1743 1028 857 ------
NM_000912chr833215 2290 1100 21174 976 ----
NM_000926chr1148274 7924 6241 3305 38895 7233 1729 19225 --
NM_000933chr201634 11181 ----
NM_000945chr241550 1509 839 160 --1508 --
NM_000950chrX12479 ------
NM_000963chr122005 811 ------
NM_000965chr31379 1858 ----
NM_001001132chr2151312 1124 509 443 317 ------
NM_001001323chr1273102 2306 2073 1962 1015 861 474 12042 ----
NM_001001331chr312275 ------
NM_001001395chr121343 12728 12845 --
NM_001001396chr132923 1034 165 1391 ----
NM_001001481chr823454 3033 ------
NM_001001549chr711065 --12496 --
NM_001001550chr711065 --12496 --
NM_001001552chr12326 37 1272 ----
NM_001001555chr711065 --12496 --
NM_001001557chr821380 568 ------
NM_001001701chr422005 1571 ------
NM_001001787chr1142 ----1406
NM_001001890chr2144285 4095 3801 1446 ------
NM_001001938chr983822 3294 3152 2645 1448 1302 761 365 --21507 164 --
NM_001001974chr1012351 --1482 --
NM_001001995chrX21825 429 --11604 --
NM_001002032chr172663 185 ------
NM_001002033chr172763 285 ------
NM_001002257chr243561 2622 2177 755 ----13101
NM_001002259chr12136 ------
NM_001002860chr1444365 3895 1350 1294 --13788 --
NM_001002909chr1742066 1694 262 65 ------
NM_001002919chr21204 ------
NM_001003406chr2232376 1327 1070 1331 ----
NM_001003652chr1858202 7620 2565 2345 346 28657 8102 12482 --
NM_001003674chr1857006 5403 4944 1888 965 --14991 --
NM_001003675chr1857006 5403 4944 1888 965 --14991 --
NM_001003679chr12680 545 12095 ----
NM_001003688chr41344 ------
NM_001003698chr641400 1383 1272 261 ------
NM_001003699chr641400 1383 1272 261 ------
NM_001003712chr1232886 2849 2822 2872 211 ----
NM_001003792chr32173 137 ------
NM_001003793chr32173 137 ------
NM_001004051chrX167 ------
NM_001004065chr973701 3436 3340 3098 977 467 33 ----13296
NM_001004196chr311196 ------
NM_001004317chr644236 4089 3046 1807 13606 ----
NM_001004342chr155706 5520 4916 621 429 --11805 --
NM_001005360chr191225 ------
NM_001005361chr191225 ------
NM_001005362chr191225 ------
NM_001005366chr123869 208 167 ------
NM_001005404chr1734507 1545 1138 --13182 --
NM_001005463chr1022069 1727 ------
NM_001005473chr534294 1578 228 1811 14948 --
NM_001005476chr2----1205 --
NM_001005505chr321513 187 ------
NM_001005609chrX51310 498 129 101 76 --11495 --
NM_001005782chr2175 1174 ----
NM_001006115chr362734 2411 2300 2222 853 812 12517 ----
NM_001006600chr531997 1907 828 --1526 --
NM_001006617chr911142 ------
NM_001006618chr9--136 ----
NM_001006619chr911142 ------
NM_001006620chr911142 ------
NM_001006621chr911142 ------
NM_001006655chr4180 ------
NM_001007097chr955044 1967 143 107 40 --34454 4058 3222 --
NM_001007098chr11124 1101 ----
NM_001007156chr1531895 1413 163 ------
NM_001007237chr142693 2644 1150 981 11806 12298 --
NM_001007246chr2121838 496 ------
NM_001007257chr131470 1397 1269 ------
NM_001007466chr643702 2032 684 345 13981 ----
NM_001007471chr9------1138
NM_001007553chr11152 ------
NM_001007565chr3------1137
NM_001007793chr10181 1285 ----
NM_001008220chr593798 3707 3700 2513 2428 1456 1365 1282 278 ------
NM_001008225chr72146 39 ------
NM_001008239chr1833763 1511 742 ------
NM_001008392chr3----13239 23097 555
NM_001008408chr786033 5980 4438 4035 2486 2047 1653 697 26420 2122 22195 204 15718
NM_001008530chr141472 156 ----
NM_001008539chr854509 1392 326 309 293 ----13721
NM_001008541chr1022058 1809 11665 11904 --
NM_001008541chr1022058 1809 11665 11904 --
NM_001008660chr1111168 --11007 --
NM_001008777chr172442 59 1201 ----
NM_001008925chr433444 588 251 ------
NM_001009899chr355993 1530 1146 647 428 15975 ----
NM_001009959chr211788 --1580 --
NM_001009993chr284216 3670 3498 3396 3112 2911 1629 1376 24370 452 166 --
NM_001010861chr12629 243 ------
NM_001010867chr162694 2543 1768 1213 723 245 25557 5518 26505 6263 --
NM_001010888chrX64562 3943 3397 3076 1350 676 ------
NM_001010891chr566589 5822 5346 2764 1251 1167 ------
NM_001010986chrX31537 520 254 1584 ----
NM_001011537chr342313 2291 1876 644 1588 ----
NM_001011553chr71187 ------
NM_001011645chrX1273 ------
NM_001011658chrX31415 838 213 22027 1654 ----
NM_001011666chr734138 451 227 36435 6243 1744 26268 1812 --
NM_001012393chr1144739 3833 3500 1892 13275 ----
NM_001012751chr1011365 --1399 --
NM_001012755chrX43449 2030 1654 1449 23523 1824 21720 711 --
NM_001012977chrX31093 564 464 ------
NM_001013031chr1053363 3076 2617 1208 204 --12450 --
NM_001013406chr721504 1266 ------
NM_001013415chr4--1335 ----
NM_001013438chr32343 148 ------
NM_001013439chr31189 ------
NM_001013620chr1287313 6529 6015 3088 3026 2151 790 455 --13283 --
NM_001013635chr123925 899 764 --1988 11191
NM_001013746chr7--173 ----
NM_001013839chr172886 65 ----11730
NM_001014286chr13--1328 ----
NM_001014797chr1068125 7435 6971 6346 3233 972 15538 12965 --
NM_001014972chr2--1221 ----
NM_001015048chr1422355 2077 23218 2563 1983 --
NM_001015049chr1422355 2077 23218 2563 1983 --
NM_001015508chr81644 ----1622
NM_001015887chr341330 683 139 79 --11152 --
NM_001017396chr241782 1721 840 163 ------
NM_001017434chr11169 ------
NM_001018009chr3--1972 ----
NM_001018057chr112197 144 ------
NM_001018067chr145010 4680 1744 1660 --15063 11706
NM_001018068chr145010 4680 1744 1660 --15063 11706
NM_001018069chr145010 4680 1744 1660 --15063 11706
NM_001018074chr543028 2783 2736 684 12432 12749 --
NM_001018075chr543028 2783 2736 684 12432 12749 --
NM_001018076chr543028 2783 2736 684 12432 12749 --
NM_001018077chr543028 2783 2736 684 12432 12749 --
NM_001018111chr733838 3191 225 ------
NM_001018159chr16--130 ----
NM_001018160chr16--130 ----
NM_001020818chr1921711 1700 11445 --1597
NM_001020819chr1921711 1700 11445 --1597
NM_001020820chr1921711 1700 11445 --1597
NM_001020821chr1921711 1700 11445 --1597
NM_001020825chr53503 258 211 --1224 --
NM_001024094chr543028 2783 2736 684 12432 12749 --
NM_001024218chr141742 1659 ----
NM_001024401chr1642871 2546 2310 1028 --12258 --
NM_001024460chr62852 192 ------
NM_001024660chr321515 1063 ------
NM_001024847chr31218 11809 ----
NM_001024948chr153088 2861 2690 1162 1059 ------
NM_001025076chr1085012 4232 1810 1699 1509 1360 789 779 ------
NM_001025077chr1096370 5590 4577 2867 2718 2147 2137 1243 479 ------
NM_001025105chr521009 593 ------
NM_001025108chr2170 21647 374 ----
NM_001025201chr21213 ------
NM_001025266chr364627 4460 3976 3915 1840 353 ------
NM_001025366chr6--1451 11749 --
NM_001025366chr6--1451 11749 --
NM_001025367chr6--1451 11749 --
NM_001025367chr6--1451 11749 --
NM_001025368chr6--1451 11749 --
NM_001025368chr6--1451 11749 --
NM_001025369chr6--1467 11765 --
NM_001025369chr6--1467 11765 --
NM_001025370chr6--1451 11749 --
NM_001025370chr6--1451 11749 --
NM_001025389chr1131217 1191 663 ------
NM_001025390chr1131217 1191 663 ------
NM_001025580chrX33421 3186 715 13516 12659 --
NM_001025595chr41489 ------
NM_001025596chr111422 ------
NM_001025616chr43517 385 203 ------
NM_001029863chr632047 1016 642 ------
NM_001029875chr5--1861 ----
NM_001030007chr1643284 2816 1205 728 --12853 --
NM_001030055chr1434773 3645 1594 1413 14236 --
NM_001030272chr111348 ------
NM_001030273chr111348 ------
NM_001031684chr21351 --1528 --
NM_001031695chr2234750 4286 3696 ----1424
NM_001031700chr4----127 --
NM_001031710chr72372 94 ------
NM_001031716chr2--11161 ----
NM_001031740chr141234 1072 540 468 --1662 2534 373
NM_001031746chr1011089 ------
NM_001031804chr1644442 3529 1337 468 14204 23938 3429 --
NM_001032221chr951437 1360 1230 716 388 ------
NM_001032288chr202503 201 --11222 --
NM_001032380chr101637 11252 ----
NM_001033047chr44661 404 317 237 ------
NM_001033057chr321865 433 ------
NM_001033059chr622016 389 ------
NM_001033081chr11216 ----11775
NM_001033082chr11216 ----11775
NM_001033112chr52718 98 1153 ----
NM_001033117chr334225 3162 227 13562 ----
NM_001033507chr131602 704 639 --11581 --
NM_001033557chr21350 ------
NM_001033561chr17185 ------
NM_001033723chr822415 67 12373 ----
NM_001033756chr6--1385 11683 --
NM_001033756chr6--1385 11683 --
NM_001034841chr1674959 3591 1805 1522 1139 996 593 ------
NM_001034850chr511587 ------
NM_001035511chr122151 385 1194 ----
NM_001035512chr122258 492 1301 ----
NM_001035513chr122258 492 1301 ----
NM_001037172chr311247 ----11303
NM_001037174chr222000 45 11395 ----
NM_001037317chr12629 243 ------
NM_001037582chr441730 1719 1588 1554 ------
NM_001037872chr21631 1186 ----
NM_001037954chr112602 370 --1834 1561
NM_001038707chr132219 2092 1707 ------
NM_001038707chr132219 2092 1707 ------
NM_001039350chr761646 1578 1351 1204 1158 113 21622 1295 ----
NM_001039457chr1199 ------
NM_001039467chr203585 150 64 ------
NM_001039538chr22880 487 13332 ----
NM_001039574chr12923 266 ------
NM_001039580chr474534 4173 3784 3701 3161 1698 500 --11167 --
NM_001039590chrX23638 3004 13764 ----
NM_001039591chrX23638 3004 13764 ----
NM_001039618chr1121897 453 11351 15269 --
NM_001039690chr162563 266 ------
NM_001039693chr263811 3558 879 289 173 122 13583 13646 --
NM_001039716chr12977 41 ------
NM_001039802chr11950 11244 11004 --
NM_001039840chrX2285 28 34845 4215 1418 ----
NM_001039916chr1241199 797 770 276 ------
NM_001039917chr1241199 797 770 276 ------
NM_001039918chr1241199 797 770 276 ------
NM_001039919chr1241199 797 770 276 ------
NM_001039920chr1241199 797 770 276 ------
NM_001039937chr1313866 ------
NM_001040110chr731336 1321 1211 ----1716
NM_001040144chr162563 266 ------
NM_001040146chr162563 266 ------
NM_001040153chr13156 ------
NM_001040157chr422698 1021 1309 ----
NM_001040159chr42561 259 ------
NM_001040284chr1645162 4587 1077 887 25615 4013 15641 --
NM_001040402chr41133 1663 ----
NM_001040409chr22341 148 ------
NM_001040429chr1322914 2758 ------
NM_001040441chr154528 4282 4073 1126 395 ------
NM_001040450chr1512394 12457 ----
NM_001040453chr1512394 12457 ----
NM_001040458chr52603 206 ------
NM_001040624chr81230 11929 12633 --
NM_001040625chr81230 11929 12633 --
NM_001040626chr81230 11929 12633 --
NM_001040627chr81230 11929 12633 --
NM_001040628chr81230 11929 12633 --
NM_001040629chr81230 11929 12633 --
NM_001040630chr81230 11929 12633 --
NM_001040665chr754630 3274 1603 930 684 33813 3306 1396 ----
NM_001040712chr943624 2400 1388 380 --12818 --
NM_001040875chr822426 1893 1468 ----
NM_001042355chr1655367 4559 3535 1144 600 --14002 --
NM_001042357chr10--21440 81 ----
NM_001042358chr10--21440 81 ----
NM_001042360chr10--21440 81 ----
NM_001042363chr10--21440 81 ----
NM_001042388chr182801 722 ------
NM_001042389chr10--21440 81 ----
NM_001042390chr10--21440 81 ----
NM_001042392chr10--21440 81 ----
NM_001042395chr10--21440 81 ----
NM_001042406chr61916 1332 ----
NM_001042412chr1655367 4559 3535 1144 600 --14002 --
NM_001042473chr1041478 819 583 70 ------
NM_001042475chr6154 ------
NM_001042492chr1723194 412 --12123 --
NM_001042498chrX153 ------
NM_001042506chrX31103 564 464 ------
NM_001042537chrX42282 1554 401 373 12457 ----
NM_001042555chr1253725 3205 1871 864 567 ------
NM_001042576chr201472 ------
NM_001042601chr322044 464 12662 1398 --
NM_001042603chr1243531 1490 589 137 1319 11534 1403
NM_001042604chr334484 3366 960 --24757 590 --
NM_001042669chr43517 385 203 ------
NM_001043351chr131800 922 586 ----12271
NM_001046chr532735 2259 1930 1285 ----
NM_001050chr171149 1185 ----
NM_001071775chr1311652 ------
NM_001072chr21673 177 ----
NM_001083620chr421906 79 12451 --1799
NM_001083621chr121691 1213 24433 3704 ----
NM_001087chr22303 32 ------
NM_001100108chr142084 1757 550 321 18276 12065 --
NM_001106chr3118992 7557 6268 3905 3396 2687 2381 2211 2162 1612 583 29383 9137 12227 1260
NM_001113490chrX2628 425 --21428 825 --
NM_001116chr1642444 2181 815 29 --2926 112 --
NM_001128chr1643284 2816 1205 728 --12853 --
NM_001144chr162964 248 ------
NM_001146chr811539 --1449 --
NM_001148chr422064 1988 1412 1824 --
NM_001149chr1011083 11433 ----
NM_001156chr10--1413 ----
NM_001167chrX45868 5804 5733 2118 12346 ----
NM_001173chr1434773 3645 1594 1413 14236 --
NM_001178chr111348 ------
NM_001201chr411515 23397 444 --11331
NM_001204chr277248 6877 6046 5554 1860 1317 1029 ------
NM_001220chr7138 ------
NM_001222chr102735 205 --21587 692 --
NM_001238chr192489 346 ------
NM_001241chr232100 297 228 ----12307
NM_001241chr232100 297 228 ----12307
NM_001257chr16--1299 ----
NM_001259chr742108 1322 476 285 ------
NM_001271chr1543275 2835 2436 2362 --12413 --
NM_001294chr191431 ------
NM_001315chr642083 1768 801 146 ------
NM_001316chr201439 ------
NM_001329chr10--21432 239 ----
NM_001379chr191109 ------
NM_001386chr832426 973 866 ------
NM_001387chr573079 3025 2658 1094 818 482 308 ------
NM_001390chr1832986 2634 1169 ------
NM_001396chr2142424 2324 395 51 ------
NM_001399chrX51310 498 129 101 76 --11495 --
NM_001400chr11162 21074 999 ----
NM_001412chrX1315 11099 ----
NM_001438chr133271 2408 958 ----12628
NM_001448chrX21617 1218 1146 ----
NM_001453chr61302 ------
NM_001463chr2------1690
NM_001494chr101577 ------
NM_001495chr821252 293 ------
NM_001497chr972742 2668 2572 2138 878 397 214 ------
NM_001542chr142693 2644 1150 981 11806 12298 --
NM_001543chr534592 1005 729 24811 3757 34760 1408 989 --
NM_001554chr11511 --1172 --
NM_001587chrX31788 1585 223 ------
NM_001604chr11--142 ----
NM_001608chr21265 ------
NM_001616chr262550 908 796 768 685 506 ------
NM_001620chr111528 ----1592
NM_001621chr71493 11191 1223 --
NM_001621chr71493 11191 1223 --
NM_001634chr622016 389 ------
NM_001649chrX22309 412 ----12292
NM_001656chr531852 1757 1577 ------
NM_001663chr14----1922 --
NM_001677chr1----1858 11044
NM_001681chr124730 493 142 38 ------
NM_001682chr1262816 2020 1787 729 575 188 ------
NM_001683chr312275 ------
NM_001684chr132640 1610 751 1108 ----
NM_001690chr332410 1679 131 12359 12015 --
NM_001699chr1911187 2677 379 --1251
NM_001704chr61135 ------
NM_001706chr31978 ------
NM_001718chr61340 --1916 --
NM_001729chr41149 1373 ----
NM_001731chr12----1648 --
NM_001742chr721580 316 ------
NM_001743chr2--123 ----
NM_001754chr2144285 4095 3801 1446 ------
NM_001755chr1631855 1774 71 --11584 --
NM_001759chr1221768 1128 35231 5107 3726 --1914
NM_001761chr1641803 1599 1498 321 1682 11605 --
NM_001788chr71187 ------
NM_001791chr11950 11244 11004 --
NM_001797chr161317 ------
NM_001822chr21213 ------
NM_001826chr12359 141 ------
NM_001830chrX43938 3430 2473 1418 --13889 --
NM_001839chr12596 190 ------
NM_001851chr63508 487 310 --1175 --
NM_001854chr11328 11357 1281 --
NM_001858chr644872 3409 842 415 --21905 1807 --
NM_001880chr21307 --1326 --
NM_001892chr521009 593 ------
NM_001904chr3--1704 1970 --
NM_001918chr177791 7360 6406 3289 3254 923 533 17827 --1245
NM_001936chr761646 1578 1351 1204 1158 113 21622 1295 ----
NM_001938chr13289 237 158 --1417 --
NM_001939chrX33823 3138 3000 ------
NM_001949chr622777 2610 12022 ----
NM_001969chr1443440 3280 3184 3004 11056 ----
NM_001980chr122906 629 3727 308 116 ----
NM_001987chr1243182 844 753 313 --13887 --
NM_001999chr541222 960 952 505 11349 ----
NM_002006chr444664 1687 1251 752 15762 ----
NM_002017chr11--11349 ----
NM_002024chrX1782 12155 ----
NM_002025chrX39144 7280 2936 ------
NM_002032chr111168 ------
NM_002039chr42785 165 1842 ----
NM_002069chr721662 1328 21877 223 ----
NM_002072chr91956 ------
NM_002074chr141555 1414 1095 202 ------
NM_002076chr1212860 22266 174 22592 646 --
NM_002077chr932013 811 246 ------
NM_002087chr172260 238 ------
NM_002107chr12486 379 ------
NM_002114chr61502 ------
NM_002119chr642597 2219 398 274 1107 2528 333 --
NM_002128chr1322262 2112 --11713 --
NM_002139chrX2513 103 2640 231 ----
NM_002140chr91146 ------
NM_002147chr172854 126 ------
NM_002158chr233237 2425 831 13045 ----
NM_002182chr321930 38 --1818 --
NM_002203chr523916 2567 22645 1178 ----
NM_002211chr1021132 836 ------
NM_002214chr714603 1725 --15712
NM_002221chr142178 398 387 187 12000 2884 798 --
NM_002222chr3--1442 ----
NM_002234chr122622 533 ------
NM_002247chr1031699 395 61 ------
NM_002264chr345070 1964 1510 1013 23343 1975 11447 14586
NM_002267chr1321943 1567 ------
NM_002285chr2170 21647 374 ----
NM_002296chr121687 1133 21530 1402 ----
NM_002317chr52384 44 ------
NM_002336chr1274894 4863 3891 3740 1741 606 565 13440 14789 --
NM_002355chr1211386 ------
NM_002356chr631868 1791 796 ------
NM_002360chr732504 2467 697 ------
NM_002361chr191262 ------
NM_002371chr2----1167 141
NM_002374chr22880 487 13332 ----
NM_002381chr21823 ----1664
NM_002395chr61967 ------
NM_002397chr5154 --11569 --
NM_002399chr15------11431
NM_002401chr172397 379 --11926 --
NM_002402chr71253 1363 --11076
NM_002425chr112249 31 ------
NM_002430chr2222516 2421 2879 252 1962 --
NM_002431chr14--1120 ----
NM_002442chr1221686 1389 ------
NM_002449chr511218 1449 ----
NM_002451chr931109 542 464 ------
NM_002473chr2221388 160 ------
NM_002480chr1231146 1128 174 1936 ----
NM_002487chr152242 227 1276 ----
NM_002501chr1943466 2798 1159 746 13548 ----
NM_002515chr141244 11930 ----
NM_002519chr1111044 ----133
NM_002537chr1511101 ------
NM_002545chr1144739 3833 3500 1892 13275 ----
NM_002547chrX54040 3927 3466 2922 183 --1557 --
NM_002581chr943779 2013 1843 1115 22051 1144 ----
NM_002586chr631272 1016 151 ----1161
NM_002595chr1211795 --21804 1429 --
NM_002607chr73413 100 72 --1465 --
NM_002612chr741633 1427 492 53 ------
NM_002618chr21119 ------
NM_002641chrX----1505 1311
NM_002655chr815267 24164 3423 14478 --
NM_002657chr2023501 3371 ----1732
NM_002667chr611231 ------
NM_002670chr311610 1377 ----
NM_002709chr221104 171 ------
NM_002710chr122792 383 ----1253
NM_002715chr51953 11219 ----
NM_002717chr81184 ------
NM_002719chr1411780 22147 781 ----
NM_002731chr12349 332 12907 ----
NM_002734chr171252 12245 ----
NM_002745chr2274053 3529 3361 1289 960 645 51 21738 873 14351 --
NM_002748chr152899 485 ------
NM_002768chr1641456 470 201 44 188 11315 --
NM_002836chr201164 ------
NM_002839chr943624 2400 1388 380 --12818 --
NM_002841chr31241 ------
NM_002844chr621392 272 ------
NM_002849chr121383 ------
NM_002852chr32490 228 ------
NM_002855chr1143655 3148 243 218 --13446 --
NM_002857chr132671 2357 2187 ----1612
NM_002868chr1232357 1699 613 ------
NM_002886chr334353 4223 1344 13159 14810 --
NM_002892chr14----1319 --
NM_002897chr22484 24 ------
NM_002906chr114701 604 225 124 ------
NM_002912chr63384 243 71 --130 --
NM_002922chr1----1469 1582
NM_002923chr13569 562 103 ------
NM_002938chr422005 1809 ------
NM_002948chr3----170 --
NM_002955chr641400 1383 1272 261 ------
NM_002977chr22876 545 23161 55 ----
NM_002996chr1631623 1573 548 1650 21547 466 --
NM_003001chr122258 492 1301 ----
NM_003010chr175804 353 205 199 123 --11736 1767
NM_003015chr10192 ------
NM_003016chr171116 21287 84 12033 --
NM_003017chr621395 1275 ------
NM_003027chr15174 ------
NM_003035chr11683 ------
NM_003045chr1323463 1825 24326 3209 ----
NM_003046chr854509 1392 326 309 293 ----13721
NM_003069chrX1608 ------
NM_003070chr92853 847 ------
NM_003071chr311325 ------
NM_003074chr331580 1426 704 ----1556
NM_003075chr121276 ------
NM_003079chr171342 --171 --
NM_003090chr15183 ------
NM_003092chr201321 --136 --
NM_003107chr6------11769
NM_003108chr231797 1543 110 17231 ----
NM_003112chr763090 2839 2558 2311 1084 32 1298 ----
NM_003128chr252462 1028 861 339 316 ------
NM_003155chr862834 1859 1721 462 449 53 11954 ----
NM_003156chr1121360 48 --11305 --
NM_003161chr1723527 1051 1814 ----
NM_003174chr102348 86 ----1600
NM_003178chr322138 1902 ------
NM_003188chr6190 ------
NM_003194chr62233 90 1517 ----
NM_003199chr1865248 4924 4459 4167 3747 1166 ------
NM_003201chr101396 ------
NM_003211chr1231423 549 422 1626 ----
NM_003215chr411083 ------
NM_003216chr2223056 951 ------
NM_003217chr1221968 1509 ------
NM_003221chr613181 14184 ----
NM_003222chr20--1419 1297 --
NM_003234chr32919 768 42366 835 70 61 12216 --
NM_003239chr141875 --1892 --
NM_003242chr31218 11809 ----
NM_003253chr2131786 1370 752 ------
NM_003269chr61485 1845 ----
NM_003270chrX1417 ------
NM_003275chr91333 11160 ----
NM_003291chr131200 ------
NM_003298chr365688 4196 2281 1862 1693 991 --15887 12430
NM_003320chr1123212 2792 13610 ----
NM_003330chr121656 ----1393
NM_003347chr2222261 262 ------
NM_003348chr121339 11158 ----
NM_003349chr202503 201 --11222 --
NM_003352chr2175 1174 ----
NM_003371chr92549 141 ------
NM_003373chr1041516 1209 723 512 ------
NM_003376chr6--1451 11749 --
NM_003376chr6--1451 11749 --
NM_003392chr311258 13057 ----
NM_003403chr141780 2676 314 ----
NM_003410chrX42163 2142 2036 757 ------
NM_003418chr3----1209 --
NM_003452chr91276 --1637 --
NM_003463chr61623 13330 --12224
NM_003468chr221377 925 --199 --
NM_003471chr321699 871 --21787 68 --
NM_003473chr10--1406 ----
NM_003474chr1072347 2182 1646 838 750 165 148 ------
NM_003477chr112788 25 --1259 --
NM_003478chr1122208 74 ------
NM_003483chr1221175 1131 12083 ----
NM_003489chr2153295 1081 913 640 548 1459 ----
NM_003498chr1632667 956 577 ------
NM_003557chr131571 651 501 ------
NM_003566chr1232112 1199 562 ------
NM_003574chr1865666 5237 1538 1044 638 21 ------
NM_003583chr1223011 472 23313 2808 ----
NM_003590chr22791 248 22930 1194 ----
NM_003597chr221609 402 ----12117
NM_003615chr352524 1611 1134 444 370 12925 ----
NM_003622chr1232506 2445 1865 --12643 --
NM_003628chr2----1205 --
NM_003629chr132484 905 894 ------
NM_003651chr12------1442
NM_003663chr333036 2397 225 ----1791
NM_003671chr932505 2207 1139 ------
NM_003672chr121238 322 ------
NM_003677chr1221589 695 11430 11562 --
NM_003692chr92881 796 ------
NM_003701chr133915 200 21 ------
NM_003718chr71495 ------
NM_003745chr16147 ------
NM_003750chr101221 ------
NM_003762chr1--11203 ----
NM_003766chr172555 537 ------
NM_003772chr11--1390 ----
NM_003787chr181164 21737 158 ----
NM_003794chr321128 1087 1150 --1219
NM_003799chr1823367 1279 --11197 --
NM_003816chr82971 357 11102 ----
NM_003819chr1--1217 ----
NM_003829chr94930 878 870 835 ------
NM_003831chr1841816 1356 1324 112 127 ----
NM_003850chr13271 41 ----133
NM_003861chr1471164 1083 854 748 483 442 199 2958 205 1819 --
NM_003870chr151330 ------
NM_003872chr212050 ------
NM_003873chr1042199 780 610 244 ------
NM_003877chr121166 ------
NM_003887chr221537 776 --11857 --
NM_003888chr1521744 1296 ------
NM_003905chr16--130 ----
NM_003913chr633326 1329 561 1244 ----
NM_003924chr411618 11356 ----
NM_003927chr18----1816 --
NM_003934chr91889 ------
NM_003936chr21177 ----11072
NM_003938chr1911073 1112 ----
NM_003941chr71945 ------
NM_003948chr422665 2440 172 --1805
NM_003968chr32178 172 --1528 --
NM_003971chr172200 186 ------
NM_003972chr1031262 283 271 ------
NM_003983chr1624409 1396 --23121 1100 --
NM_003994chr1253843 1766 1743 1028 857 ------
NM_004034chr10--1413 ----
NM_004036chr21475 ------
NM_004040chr2----1534 --
NM_004047chr1199 ------
NM_004075chr12--1565 ----
NM_004080chr711264 11505 ----
NM_004087chr321847 1824 ----1749
NM_004094chr1412785 --12251 --
NM_004096chr1011450 ------
NM_004098chr10--11227 ----
NM_004100chr62682 177 ------
NM_004119chr131663 ------
NM_004124chr1423568 2334 1786 ----
NM_004136chr1532393 949 56 --1195 --
NM_004161chr221090 223 11023 ----
NM_004171chr1189066 8189 7524 6804 2328 2203 1659 400 16101 1176 17331
NM_004229chrX12205 ------
NM_004232chr1833188 1091 873 1622 ----
NM_004242chr62343 284 ------
NM_004274chr141637 ------
NM_004293chr943241 3091 605 283 13829 ----
NM_004295chr1721024 167 --1316 --
NM_004302chr1222708 358 1369 21840 987 --
NM_004321chr263521 3230 3220 2778 2762 922 ------
NM_004330chr1531119 1036 53 2877 40 ----
NM_004338chr1857006 5403 4944 1888 965 --14991 --
NM_004342chr721570 748 ------
NM_004349chr811122 ----11087
NM_004360chr1641323 660 182 37 ----11934
NM_004369chr22674 260 ----1174
NM_004370chr641453 1400 673 25 ------
NM_004379chr211147 1351 ----
NM_004380chr1612629 ------
NM_004381chr62306 152 ------
NM_004393chr341744 896 583 58 --1725 --
NM_004396chr17159 ------
NM_004397chr1144227 2661 1203 1171 1216 ----
NM_004440chr641825 1709 1306 625 1492 ----
NM_004458chrX32499 448 231 --11977 --
NM_004469chrX------188
NM_004472chr5174 ------
NM_004491chr1954253 4005 3880 1703 1157 --14131 --
NM_004499chr51179 1410 ----
NM_004501chr134036 3665 1629 ------
NM_004503chr121787 ------
NM_004504chr211141 --1396 --
NM_004505chr1722020 1740 ------
NM_004506chr6----1180 --
NM_004514chr1732958 2222 645 --12546 --
NM_004521chr10------127
NM_004529chr911050 ------
NM_004538chrX1843 --1269 1661
NM_004575chr421565 1155 1593 ----
NM_004582chr1--1113 ----
NM_004586chrX23855 723 ------
NM_004587chr201472 ------
NM_004593chr32805 187 --1697 --
NM_004595chrX4429 388 182 29 ------
NM_004598chr532024 1122 197 ------
NM_004615chrX1772 ------
NM_004630chr11----11149 --
NM_004643chr141681 ------
NM_004655chr17--11031 ----
NM_004657chr2129 11581 ----
NM_004661chr521076 930 ------
NM_004690chr6157 ------
NM_004698chr11169 ------
NM_004703chr1721730 1579 --11845 12360
NM_004705chr11----1320 --
NM_004715chr182231 163 ----1215
NM_004719chr1232841 1819 267 --11768 --
NM_004725chr1011302 11506 ----
NM_004726chrX55232 4727 4384 4253 2093 25552 5539 15764 --
NM_004730chr532164 1696 822 ------
NM_004734chr1352885 2764 2422 990 536 ------
NM_004736chr1--12070 ----
NM_004739chr11----1158 --
NM_004744chr411573 23280 958 12894 --
NM_004745chr866857 5765 2711 2586 1231 1162 25590 4694 1452 --
NM_004747chr102575 424 ------
NM_004748chr1522672 837 13641 ----
NM_004761chr6137 ------
NM_004768chr111003 --1249 --
NM_004772chr521222 639 --1561 --
NM_004775chr1811877 ------
NM_004776chr2042837 1308 559 490 ------
NM_004781chr121588 261 1115 ----
NM_004781chr121588 261 1115 ----
NM_004788chr1132156 503 386 ------
NM_004796chr1422002 714 22031 962 1898 --
NM_004804chr2--1256 ----
NM_004805chr21353 --11347 --
NM_004822chr1723019 3009 ------
NM_004834chr222619 2489 33364 2093 444 2260 236 --
NM_004844chr3--1972 ----
NM_004845chrX23227 77 13285 1957 14073
NM_004846chr2172 ----1189
NM_004856chr151540 ------
NM_004857chr1444623 3003 1742 1681 1142 ----
NM_004859chr1732413 799 680 --12527 --
NM_004863chr1435046 3935 3613 --13411 --
NM_004873chr1422355 2077 23218 2563 1983 --
NM_004884chr1511515 11234 ----
NM_004887chr511077 ------
NM_004904chr734138 451 227 36435 6243 1744 26268 1812 --
NM_004906chr61522 ------
NM_004912chr721504 1266 ------
NM_004945chr191225 ------
NM_004947chr321865 568 --11876 --
NM_004956chr721406 1066 ----13692
NM_004960chr16153 ------
NM_004967chr41532 ------
NM_004976chr1123533 338 13857 24790 3345 --
NM_004985chr1224464 977 13870 --13134
NM_004992chrX37101 6960 6511 17999 ----
NM_004992chrX37101 6960 6511 17999 ----
NM_004999chr644384 1623 1466 1072 ------
NM_005006chr2--2973 368 ----
NM_005011chr731336 1321 1211 ----1716
NM_005028chr10--22174 1829 ----
NM_005029chr101111 ------
NM_005056chr1243775 1734 833 381 1563 11778 1647
NM_005066chr1------1569
NM_005068chr6--1993 ----
NM_005087chr31189 ------
NM_005088chrX1872 ------
NM_005109chr322105 577 11022 ----
NM_005121chr1723377 3043 12608 ----
NM_005124chr62734 77 ------
NM_005134chr182801 722 ------
NM_005154chr151128 1158 ----
NM_005180chr1021392 247 ------
NM_005188chr1147966 6702 6439 647 38023 5113 433 12477 --
NM_005194chr20----1226 --
NM_005197chr1446058 5103 4851 1567 11918 15192 --
NM_005207chr2273718 3471 3288 3158 2988 2810 837 --11397 --
NM_005233chr321024 982 12442 ----
NM_005238chr1113371 1566 ----
NM_005241chr31936 ------
NM_005245chr41148 1242 ----
NM_005259chr2------1570
NM_005261chr81254 ------
NM_005277chr431262 329 43 ------
NM_005281chr11135 ------
NM_005296chrX1387 ------
NM_005311chr711065 --12496 --
NM_005318chr2211235 ------
NM_005329chr1641713 740 566 95 1309 --1705
NM_005330chr11124 ------
NM_005339chr484006 3828 3626 2756 1438 1105 1061 386 1688 ----
NM_005358chr131328 ------
NM_005375chr6----1739 --
NM_005376chr1--11097 ----
NM_005397chr733838 3191 225 ------
NM_005400chr233011 1016 475 ------
NM_005402chr71340 --11766 --
NM_005415chr22144 135 2162 83 ----
NM_005418chr112710 254 ------
NM_005436chr1042987 2704 807 591 14117 13627 --
NM_005455chr111854 1196 ----
NM_005461chr2021761 1567 ------
NM_005488chr22------184
NM_005493chr61176 ------
NM_005497chr1785889 5032 3922 3807 2453 2284 1883 430 15046 14959 --
NM_005504chr1275516 5347 4322 1966 1471 189 132 21386 527 ----
NM_005509chr531789 1208 273 21183 266 ----
NM_005513chr321169 512 11563 --1187
NM_005520chr51671 ------
NM_005521chr101803 ----1782
NM_005522chr71928 11385 ----
NM_005523chr721346 1248 11508 ----
NM_005542chr721185 397 ------
NM_005544chr21844 ------
NM_005561chr131262 --1818 1181
NM_005566chr111530 ------
NM_005574chr112300 33 ------
NM_005578chr354003 3800 3713 1885 390 13446 ----
NM_005587chr152169 33 ------
NM_005596chr945469 4455 1766 1328 --1544 11312
NM_005606chr141472 156 ----
NM_005610chr12635 151 ------
NM_005613chr141517 641 604 175 ------
NM_005618chr61420 ------
NM_005627chr62737 378 --1228 --
NM_005664chr151375 1171 ----
NM_005667chr2--1170 ----
NM_005668chr564085 3969 3387 3333 920 859 --13513 --
NM_005711chr52994 147 ------
NM_005715chr612797 21883 860 ----
NM_005717chr111100 1202 ----
NM_005724chr151116 ------
NM_005737chr242829 931 721 678 11115 ----
NM_005746chr721757 544 42797 2462 1969 202 ----
NM_005752chr1611005 --1431 --
NM_005754chr5--1144 11215 --
NM_005759chr254024 3987 3414 1513 711 24308 403 1887 13786
NM_005766chr131424 11349 ----
NM_005776chr141250 ------
NM_005779chr533448 3064 1063 22668 499 ----
NM_005786chr181843 ----1238
NM_005789chr1731853 399 393 ------
NM_005796chr161147 ------
NM_005806chr21--11283 1420 --
NM_005808chr3----13239 23097 555
NM_005819chr122921 331 12390 --1668
NM_005822chr6197 ------
NM_005828chr1774959 4896 4486 1021 692 406 190 ------
NM_005840chrX76645 6593 3053 1898 1740 1473 700 1944 ----
NM_005859chr511156 --11292 --
NM_005873chr203585 150 64 ------
NM_005896chr2172 1844 ----
NM_005898chr1122181 1161 ------
NM_005900chr41344 ------
NM_005901chr1858202 7620 2565 2345 346 28657 8102 12482 --
NM_005904chr1811434 1914 11451 --
NM_005909chr524109 1621 ------
NM_005911chr21199 ----11289
NM_005922chr61341 175 ----
NM_005924chr71999 ------
NM_005938chrX31386 925 138 --1881 --
NM_005941chr834111 4060 3469 ------
NM_005944chr311196 ------
NM_005955chr1115429 4914 3805 2106 1512 1289 1263 867 574 546 411 11413 ----
NM_005962chr1022058 1809 11665 11904 --
NM_005962chr1022058 1809 11665 11904 --
NM_005964chr1711066 11277 ----
NM_005966chr2--2848 243 ----
NM_005986chr1342773 2540 2502 238 11007 ----
NM_005996chr1251497 1399 1192 330 155 ----11454
NM_006007chr954423 3848 1167 374 158 ------
NM_006011chr152853 196 --11005 --
NM_006015chr11115 11321 ----
NM_006030chr321513 187 ------
NM_006037chr264889 3382 1313 1063 805 416 ------
NM_006047chr2052773 1081 983 665 363 22966 2417 ----
NM_006054chr111134 ------
NM_006064chrX----1427 --
NM_006070chr3------1137
NM_006080chr742226 1893 766 730 ------
NM_006089chrX21871 517 --11578 --
NM_006094chr821474 39 ------
NM_006095chr424437 1064 1768 ----
NM_006100chr3135 ------
NM_006106chr1132825 2429 568 12995 ----
NM_006129chr81591 ------
NM_006141chr1622661 1104 ------
NM_006148chr1711849 ----12335
NM_006153chr3--1441 ----
NM_006154chr1552749 2037 2020 585 501 12046 ----
NM_006156chr14----1193 --
NM_006157chr111146 ------
NM_006166chr1211012 12393 --1154
NM_006178chr1711230 11526 ----
NM_006194chr14--21083 148 ----
NM_006201chrX11013 --1903 1201
NM_006203chr544810 1280 990 713 ------
NM_006211chr8175 ------
NM_006224chr1732436 2094 1765 --22308 887 --
NM_006226chr221375 915 ------
NM_006241chr3----12273 --
NM_006245chr64964 843 754 189 ------
NM_006251chr533156 355 341 ------
NM_006252chr156789 4767 1829 1547 920 17408 1927 --
NM_006258chr1021350 535 1569 ----
NM_006265chr831557 978 577 ------
NM_006267chr21158 ------
NM_006283chr844816 1973 1692 225 1333 ----
NM_006306chrX14443 12078 --34237 1106 224
NM_006310chr1721295 1206 ------
NM_006328chr11----1605 --
NM_006330chr811623 21356 104 --11421
NM_006352chr11210 22080 1701 ----
NM_006359chrX42282 1554 401 373 12457 ----
NM_006364chr1421227 218 --11128 --
NM_006378chr91100 1549 ----
NM_006379chr721953 1929 ------
NM_006393chr1011005 --23603 231 --
NM_006420chr2053162 2525 1388 465 24 13005 --1790
NM_006482chr1223011 472 23313 2808 ----
NM_006489chr141244 11930 ----
NM_006496chr111988 --1290 --
NM_006517chrX2666 157 --1360 --
NM_006519chr6------1246
NM_006526chr2042211 1728 1508 633 ------
NM_006534chr2073196 2907 2320 809 522 290 225 ------
NM_006538chr251351 989 974 890 291 --13347 --
NM_006539chr161454 ------
NM_006540chr811382 11195 ----
NM_006544chr1421482 1260 24102 1987 ----
NM_006546chr1766428 6175 5851 4264 1496 362 11942 12198 --
NM_006547chr71527 1519 11908 --
NM_006548chr311317 ------
NM_006558chr8--1481 ----
NM_006560chr111422 ------
NM_006561chr1085012 4232 1810 1699 1509 1360 789 779 ------
NM_006572chr1743334 2587 2458 1387 23461 3100 ----
NM_006575chr1411181 ------
NM_006587chr4--2577 443 1314 --
NM_006593chr2--1549 ----
NM_006599chr1685737 5667 3088 2350 2309 1647 1364 1292 23253 2888 27342 1056 16697
NM_006602chr201669 1540 ----
NM_006606chr2032852 1277 423 --23157 3069 --
NM_006609chr221039 868 11867 ----
NM_006614chr333609 2800 220 12762 ----
NM_006621chr111469 ----1743
NM_006624chr1022018 1817 12135 ----
NM_006625chr11756 --21049 61 --
NM_006625chr11756 --21049 61 --
NM_006625chr11756 --21049 61 --
NM_006634chr2171 ------
NM_006636chr22341 148 ------
NM_006644chr131535 ------
NM_006650chr593798 3707 3700 2513 2428 1456 1365 1282 278 ------
NM_006654chr1253725 3205 1871 864 567 ------
NM_006675chr1243086 2466 2107 1183 --1919 13042
NM_006677chr3--1261 ----
NM_006703chr61436 ----1163
NM_006706chr51750 1308 ----
NM_006724chr61341 175 ----
NM_006734chr631542 1272 1070 ------
NM_006738chr1544326 4163 1510 724 14445 13304 --
NM_006749chr83917 521 46 ------
NM_006750chr1635022 2211 1326 12447 1438 17252
NM_006751chr21710 1847 ----
NM_006756chr8--11370 ----
NM_006775chr611008 --1950 --
NM_006805chr52231 156 1609 ----
NM_006807chr1711295 1372 1901 --
NM_006811chr203724 633 261 ------
NM_006813chr61269 1308 ----
NM_006814chr2052109 2053 1707 1067 326 ------
NM_006823chr841117 481 470 110 ------
NM_006826chr211280 ------
NM_006827chr1412748 --13187 --
NM_006838chr121382 1706 --11429
NM_006852chr173893 491 116 12269 ----
NM_006854chr72784 40 11390 --1724
NM_006885chr1634029 2995 854 --13462 --
NM_006888chr1422733 1232 --12489 1903
NM_006892chr2021074 237 --11209 --
NM_006892chr2021074 237 --11209 --
NM_006897chr121201 1638 ----
NM_006898chr21641 ------
NM_006912chr132114 82 40 --12189 --
NM_006914chr921280 605 --1242 --
NM_006922chr21503 ------
NM_006924chr1764186 4144 2844 814 501 302 ----12975
NM_006931chr1231591 656 409 ------
NM_006939chr1421091 227 1932 1405 --
NM_006940chr1221826 412 ------
NM_006943chr2043323 2788 2651 2491 --22615 1125 --
NM_006948chr2112246 1789 ----
NM_006952chr31316 --155 --
NM_006981chr91625 22949 2607 ----
NM_006982chr12--1304 ----
NM_006996chr151619 1295 484 329 298 21579 1345 ----
NM_007005chr911138 ------
NM_007007chr1221500 1316 23308 1479 ----
NM_007011chr1556707 6661 5816 5065 1379 ------
NM_007026chr171129 ------
NM_007030chr535097 4354 817 23935 354 1560 15232
NM_007034chr121035 302 ----1919
NM_007036chr51806 ------
NM_007039chr142585 204 ------
NM_007050chr2067888 7817 6692 5492 1511 691 18076 1353 --
NM_007064chr321515 1063 ------
NM_007067chr1711181 ------
NM_007078chr1022892 513 32918 1183 23 ----
NM_007084chr131971 ------
NM_007118chr51366 ------
NM_007120chr21673 177 ----
NM_007137chrX75056 4722 3503 1733 459 366 261 ------
NM_007146chr1722588 979 ------
NM_007158chr11152 ------
NM_007166chr1111168 --11007 --
NM_007175chr82999 334 --1583 --
NM_007192chr141221 ------
NM_007200chr1544326 4163 1510 724 14445 13304 --
NM_007203chr973701 3436 3340 3098 977 467 33 ----13296
NM_007217chr31304 ------
NM_007218chr81152 1632 ----
NM_007249chr1349226 2259 763 259 187 21505 1346 --
NM_007257chr842259 1921 771 483 --22581 1133 --
NM_007275chr321174 173 ------
NM_007282chr32692 347 --1203 --
NM_007285chr161349 ------
NM_007345chr1821738 460 196 ----
NM_007347chr1532621 2492 336 13112 11100 --
NM_007350chr12--33782 3365 1347 ----
NM_007358chr1----2748 289 --
NM_007361chr14------1537
NM_007363chrX184 1800 ----
NM_007375chr11591 22018 1058 ----
NM_012081chr563660 3427 1374 871 859 646 ----13615
NM_012090chr11119 ------
NM_012092chr231723 1676 125 ------
NM_012096chr323180 3119 --12430 --
NM_012097chr222000 45 11395 ----
NM_012110chr42111 65 ------
NM_012137chr11105 1700 12774 --
NM_012141chr1313866 ------
NM_012155chr192213 199 ------
NM_012157chr31348 ------
NM_012164chr942470 1942 1322 256 35243 533 483 1423 16247
NM_012193chr1165015 4187 4074 2140 1334 481 --23407 581 --
NM_012199chr134109 3373 2827 1322 13504 --
NM_012210chr931402 1057 563 --1239 --
NM_012214chr234421 1787 994 11752 14760 15677
NM_012215chr1031872 747 243 ----1251
NM_012218chr1942441 1152 987 296 12118 ----
NM_012234chr322871 540 1612 ----
NM_012238chr1011562 ----21092 643
NM_012247chr102734 306 1993 ----
NM_012249chr221316 970 1940 11439 --
NM_012252chr764492 4349 4220 4128 1259 205 34889 348 176 152 --
NM_012257chr71965 --1719 1291
NM_012262chr165203 3749 3706 3506 3224 909 2592 435 ----
NM_012272chr121168 ------
NM_012279chr521985 762 ----2650 303
NM_012281chr711792 12282 ----
NM_012288chr664866 4776 4118 2258 1076 265 24806 3898 --1545
NM_012293chr221728 515 11937 2286 135 --
NM_012297chr42965 345 12530 ----
NM_012301chr712052 --1594 --
NM_012307chr181986 ------
NM_012309chr1144742 1901 1779 657 161 ----
NM_012325chr2021171 1080 --11538 --
NM_012329chr1721685 1266 ----11306
NM_012342chr101190 ------
NM_012347chr632709 2578 242 ------
NM_012399chr2221251 585 ------
NM_012448chr171235 1118 12090 --
NM_012464chr432120 760 540 --11100 --
NM_012479chr742520 2497 1002 199 --22295 1088 --
NM_013231chr1431739 801 175 ------
NM_013233chr211359 ------
NM_013253chr112197 144 ------
NM_013255chr756677 3110 1218 922 584 38771 5883 2844 27644 7005 --
NM_013279chr11----177 --
NM_013281chr2011461 ------
NM_013336chr341484 309 145 76 ----11266
NM_013351chr17136 --1252 --
NM_013354chr821388 1292 ------
NM_013357chr8----1896 --
NM_013377chr12------1532
NM_013381chr1232275 422 209 1111 ----
NM_013386chr121401 315 ------
NM_013437chr8--11351 ----
NM_013450chr211237 --1271 --
NM_013937chr61426 ------
NM_013958chr82429 366 --121 --
NM_013959chr82429 366 --121 --
NM_013961chr82429 366 --121 --
NM_013962chr82429 366 --121 --
NM_014000chr1041516 1209 723 512 ------
NM_014007chr93921 453 83 11018 ----
NM_014011chr23204 120 87 22594 2408 ----
NM_014023chr1072837 2219 1814 1170 892 493 114 ------
NM_014034chr61206 ------
NM_014043chr32496 437 ------
NM_014048chr1634918 3247 589 11263 24383 3280 --
NM_014056chr331902 1446 257 ----1930
NM_014071chr201190 1501 ----
NM_014117chr1632370 2016 657 --1584 --
NM_014141chr745153 4951 4737 313 ------
NM_014153chr161678 ------
NM_014155chr1136855 5173 1115 1217 12036 --
NM_014181chr2--22733 315 12417 --
NM_014186chr1111476 ----1569
NM_014271chrX1802 1731 ----
NM_014278chr41193 ------
NM_014289chrX11109 ------
NM_014292chr2241833 1478 1362 126 --1708 1350
NM_014309chr2234740 4276 3686 ----1414
NM_014325chr1251763 1625 769 281 250 --1602 --
NM_014333chr1112355 ------
NM_014342chr111129 ------
NM_014350chr521081 749 ------
NM_014363chr131962 --1867 --
NM_014372chr121280 616 1287 ----
NM_014382chr321422 524 ------
NM_014393chr8----1349 --
NM_014423chr514768 1707 ----
NM_014426chr203753 715 483 ------
NM_014431chr1031647 1162 64 --194 --
NM_014447chr41489 ------
NM_014473chr51422 ------
NM_014488chr112690 502 ----1632
NM_014489chr112650 157 ----1267
NM_014491chr71393 1673 ----
NM_014494chr161472 11992 ----
NM_014497chr2--1221 ----
NM_014498chr32347 319 ------
NM_014500chrX176 ------
NM_014505chr121366 ------
NM_014552chr231502 190 43 ------
NM_014563chrX31415 838 213 22027 1654 ----
NM_014575chr32505 101 --1381 --
NM_014606chr421568 229 ------
NM_014607chr221354 152 ------
NM_014612chr9--1537 ----
NM_014614chr21133 ------
NM_014615chr1622258 771 --13418 --
NM_014618chr9------1341
NM_014620chr121260 ------
NM_014646chr1832593 2256 112 22542 2279 ----
NM_014647chr1672253 1844 1657 1587 902 423 300 ------
NM_014665chr822724 820 ------
NM_014670chr2--11293 ----
NM_014677chr8----1415 --
NM_014682chr842321 1821 1778 1519 ------
NM_014686chr1932025 1879 1866 --22395 2348 --
NM_014689chr2------1107
NM_014711chr1611945 ------
NM_014717chr192783 706 ------
NM_014720chr1031714 1359 120 ----1607
NM_014721chr646971 6147 1059 1008 ------
NM_014729chr82351 271 ------
NM_014732chr1695821 5644 4182 3887 2022 1519 912 828 589 15808 14788 --
NM_014733chr52669 277 ------
NM_014738chr171943 --1956 --
NM_014739chr613913 11325 ----
NM_014757chr532075 387 235 ------
NM_014760chr361962 1868 1749 1571 1554 1406 1794 11826 --
NM_014765chr142170 2007 524 516 22581 2241 ----
NM_014773chr521366 288 ------
NM_014779chr3164 ------
NM_014781chr821048 481 ------
NM_014795chr2--2216 76 ----
NM_014803chr1011891 11985 ----
NM_014820chr331587 154 120 ------
NM_014827chr11325 1483 ----
NM_014829chr532164 1554 31 ------
NM_014830chr1222839 67 11095 1409 --
NM_014832chr1311951 ----1121
NM_014836chr101637 11252 ----
NM_014839chr122483 578 12538 --1459
NM_014840chr1252532 1360 1252 555 520 --12917 --
NM_014841chr611205 11102 ----
NM_014850chr334225 3162 227 13562 ----
NM_014862chr1524105 3889 ------
NM_014870chr121691 1213 24433 3704 ----
NM_014872chr93741 219 158 --22358 1774 1577
NM_014873chr154674 4176 4017 1619 1465 13467 --14247
NM_014877chr1736356 3019 807 24741 1805 16337 --
NM_014900chr221192 1036 ------
NM_014903chr1221813 1591 --41944 1838 814 448 --
NM_014905chr221529 119 ------
NM_014906chr1743892 3707 1362 719 ------
NM_014912chr1032822 1165 364 ----12571
NM_014917chr12890 769 ------
NM_014920chr623780 68 13564 ----
NM_014924chr1442127 954 352 246 ----1368
NM_014937chr1011302 21323 1100 ----
NM_014962chr2012711 ------
NM_014969chr141184 434 202 152 --1163 --
NM_014982chr1435310 4215 699 ------
NM_014988chr431773 576 305 ------
NM_014989chr621317 389 1630 ----
NM_014990chr141934 ------
NM_014991chr432192 2116 2058 1127 12390 --
NM_015000chr1242950 2714 315 107 --1473 --
NM_015015chr1911625 --1281 --
NM_015020chr1643232 982 371 322 23847 513 13207 --
NM_015024chr811441 ------
NM_015025chr242725 2112 2059 115 ------
NM_015026chr1223424 383 32960 1769 319 ----
NM_015027chr1631859 1734 802 ------
NM_015032chr1321120 763 11105 --1574
NM_015035chr2075972 2622 2409 2100 1609 1557 1177 36514 5184 831 24407 1198 16283
NM_015040chr2--23042 2439 ----
NM_015051chr922521 2413 --22305 1141 --
NM_015057chr132486 237 ------
NM_015064chr1242899 2473 1082 815 --11135 --
NM_015071chr566205 4979 4861 2276 1926 494 --11172 15047
NM_015076chr643598 3288 3000 903 ------
NM_015079chr1542672 1017 508 413 13206 ----
NM_015091chr14--1524 1731 --
NM_015092chr16--14177 13343 --
NM_015093chr63304 256 123 11492 ----
NM_015107chrX22410 2120 ----1102
NM_015110chr922162 902 ------
NM_015115chr41133 1663 ----
NM_015130chr4--11365 ----
NM_015144chr1633564 3021 113 ------
NM_015155chr1052703 1057 962 486 220 2510 40 ----
NM_015156chr1452772 831 649 233 42 11123 12935 --
NM_015170chr812369 ------
NM_015185chrX--12977 ----
NM_015191chr1152522 2493 2047 379 209 --1316 --
NM_015192chr2021934 740 12806 ----
NM_015200chr442483 2041 985 952 ------
NM_015206chr1533756 3275 1314 13211 ----
NM_015208chr181717 12658 ----
NM_015216chr531433 1083 585 ------
NM_015219chr172886 65 ----11730
NM_015231chr111203 ----1187
NM_015238chr5----179 --
NM_015239chr91154 ------
NM_015247chr1655367 4559 3535 1144 600 --14002 --
NM_015252chr21287 ------
NM_015263chr151431 ------
NM_015268chr31113 ------
NM_015271chr432656 1040 1026 ------
NM_015272chr16--1508 ----
NM_015282chr213016 --1394 --
NM_015284chr131651 1503 632 --11554 --
NM_015285chr1831749 428 397 22566 2539 ----
NM_015288chr521037 182 --11555 --
NM_015291chr153451 2868 2302 1067 432 11251 1222 --
NM_015296chr132920 417 ------
NM_015326chr132311 1825 767 ------
NM_015328chr762589 2205 2045 578 536 129 12448 ----
NM_015336chr1212603 1575 ----
NM_015338chr20--11322 ----
NM_015339chr201893 1340 ----
NM_015344chr822078 123 1575 ----
NM_015347chr122981 710 ------
NM_015353chr1742300 2175 1072 930 ------
NM_015365chrX33421 3186 715 13516 12659 --
NM_015375chr165028 4862 3589 1528 267 115 24759 367 ----
NM_015382chr141222 ------
NM_015387chr21584 11879 ----
NM_015398chr4180 ------
NM_015436chr433263 407 70 ------
NM_015455chr533346 1186 565 --1161 --
NM_015458chr835261 4992 1054 25349 5302 1233 --
NM_015460chr331739 1558 1497 11748 ----
NM_015469chr9161 1640 --1107
NM_015520chr322563 1131 ------
NM_015525chr6--1779 ----
NM_015534chr11451 ------
NM_015535chr253917 3856 3430 2608 434 ----157
NM_015550chr733329 1286 1245 --1514 --
NM_015554chr1521076 430 ------
NM_015560chr332489 2322 387 ------
NM_015569chr114540 21338 935 14144 --
NM_015570chr731621 1466 517 ------
NM_015571chr642362 2332 2112 757 ------
NM_015576chr31538 12961 ----
NM_015577chr531457 1446 49 1343 11529 --
NM_015630chr221092 914 130 ----
NM_015640chr145010 4680 1744 1660 --15063 11706
NM_015657chr23986 790 135 ------
NM_015676chr14--1369 ----
NM_015691chrX12622 1496 ----
NM_015866chr131470 1397 1269 ------
NM_015878chr831575 1460 858 ------
NM_015879chr1887884 6024 5665 3161 2361 1815 1601 935 23196 1124 ----
NM_015881chr112197 144 ------
NM_015886chr835400 4822 4085 25391 104 14204 44022 4008 3903 1229
NM_015888chr132590 2157 1126 33052 2946 1116 11057 --
NM_015898chr1941947 1565 1558 748 ------
NM_015906chr124589 317 13236 ----
NM_015912chr852203 1819 984 565 149 --11020 --
NM_015948chr6----1383 --
NM_015994chr141270 ------
NM_015995chr1524085 2175 15036 --13859
NM_016009chr111117 21505 99 13184 --
NM_016019chr731067 291 274 ------
NM_016025chr1621856 1257 ------
NM_016040chr112548 ------
NM_016061chr23615 497 482 --11184 --
NM_016072chr12140 ------
NM_016087chr711201 ----1541
NM_016090chr113805 686 235 ------
NM_016107chr51157 127 ----
NM_016141chr31614 ------
NM_016152chr31379 1858 ----
NM_016185chr172763 285 ------
NM_016201chr311666 --1556 --
NM_016206chr358736 7992 7534 6105 2798 39015 2203 754 16520 --
NM_016219chr91458 ------
NM_016220chr7--173 ----
NM_016231chr1721338 600 ------
NM_016248chr1352567 1038 812 327 149 13703 12903 12794
NM_016258chr11516 ------
NM_016260chr236174 4773 1087 36759 2451 970 --16033
NM_016269chr41781 11161 ----
NM_016271chr1811662 1456 ----
NM_016287chr11172 11755 ----
NM_016289chr232184 1850 243 ------
NM_016302chr3--1334 ----
NM_016308chr152082 1760 1424 741 217 ------
NM_016316chr21631 1186 ----
NM_016322chr922609 2423 1998 1862 --
NM_016356chr622763 608 ------
NM_016357chr123833 246 42 ------
NM_016376chr1784118 3728 2765 1379 1206 1099 792 767 ----11273
NM_016396chr1522748 376 ------
NM_016422chr1133104 2933 869 ------
NM_016424chr171645 11731 ----
NM_016436chr2031090 943 430 --12344 --
NM_016441chr232236 1938 324 ------
NM_016480chr52718 98 1153 ----
NM_016485chr631641 917 763 ------
NM_016488chr12--21729 709 ----
NM_016507chr171440 12997 ----
NM_016512chr82242 101 ------
NM_016513chr623780 68 13564 ----
NM_016529chr13--160 ----
NM_016530chr1522690 305 22621 1387 12813 --
NM_016531chr423379 2914 --1688 --
NM_016569chr1251497 1399 1192 330 155 ----11454
NM_016577chr334180 2826 1045 --1808 --
NM_016605chr542531 2458 680 670 22697 2610 ----
NM_016620chr121147 337 ------
NM_016621chr1131842 1354 1300 13452 11697 --
NM_016643chr161205 ------
NM_016656chrX----1427 --
NM_016836chr22484 24 ------
NM_016839chr22484 24 ------
NM_016936chr1621812 101 --12162 --
NM_016937chrX1624 ------
NM_016946chr123368 2930 12982 2997 50 --
NM_016950chr42561 259 ------
NM_017409chr122740 165 ------
NM_017415chr5124432 4344 3971 3652 3258 1482 643 333 268 198 148 108 23632 416 31678 788 44 --
NM_017420chr1413120 ------
NM_017440chr12--2473 67 ----
NM_017548chr3----11977 --
NM_017551chr1021971 532 --12437 --
NM_017558chr161343 ------
NM_017569chr13--1365 ----
NM_017572chr19--169 ----
NM_017582chr111222 --11281 21627 733
NM_017583chr1141822 1429 633 553 ------
NM_017594chr931263 763 684 2369 103 ----
NM_017599chr1221433 512 ------
NM_017602chrX1908 ------
NM_017628chr454877 4146 1716 1019 900 1770 ----
NM_017629chr141849 1717 595 329 ------
NM_017633chr643883 3760 3475 3001 13575 ----
NM_017635chr1111423 ------
NM_017637chr957692 5759 2619 2476 189 78078 7295 6478 2483 1484 980 740 28014 750 --
NM_017643chr17--1707 12682 --
NM_017644chr354708 4502 3974 3914 1082 14383 ----
NM_017650chr755614 4224 1915 557 353 ------
NM_017651chr61343 ------
NM_017658chr1474362 4049 3763 3247 1177 1108 765 2806 435 1404 1930
NM_017667chr71158 ------
NM_017699chr321209 678 11659 146 --
NM_017709chr154271 4043 4015 3717 501 41372 927 443 359 ----
NM_017715chr72295 180 ------
NM_017719chr322574 1964 12442 ----
NM_017737chr131797 1570 1399 ------
NM_017745chrX131 140 ----
NM_017752chrX--12085 2427 414 --
NM_017754chr633749 3632 1416 2875 87 --14753
NM_017762chr1532460 1973 916 12151 --1825
NM_017768chr11214 ------
NM_017778chr821319 598 ------
NM_017787chr1012864 12486 12715 --
NM_017799chr1421356 207 ------
NM_017811chr922204 414 32046 1060 609 --12311
NM_017813chr865338 4918 4706 4212 1609 1217 ------
NM_017824chr1032481 947 555 ------
NM_017830chr41149 1177 ----
NM_017831chr1823977 890 --14177 --
NM_017902chr1033994 1762 144 13925 ----
NM_017913chr93454 161 30 --186 --
NM_017919chr985821 5653 4671 4100 3867 1136 735 170 14080 25720 3810 11239
NM_017938chrX11430 11819 ----
NM_017966chr1121026 102 11203 1243 --
NM_017988chr12--1759 1336 --
NM_017998chr911046 ------
NM_018014chr221262 426 ------
NM_018023chr3--11968 ----
NM_018027chr1011156 --12990 --
NM_018030chr1821081 22 ------
NM_018036chr1432903 1562 647 11665 13924 --
NM_018061chr131560 473 177 ------
NM_018067chr11545 ------
NM_018078chr41129 ------
NM_018084chr232703 415 312 ------
NM_018086chr231199 465 365 1409 ----
NM_018094chrX--1378 ----
NM_018112chr921051 184 165 ----
NM_018120chr81995 11197 ----
NM_018121chr1023196 2744 ------
NM_018126chr4--11163 185 --
NM_018133chr331767 424 143 2490 379 ----
NM_018137chr131366 1265 1216 ------
NM_018150chr11590 ------
NM_018155chr331266 1241 597 33343 2910 1177 ----
NM_018157chr1221043 933 --12914 --
NM_018159chrX1479 131 1425 --
NM_018179chr121268 ------
NM_018181chr1821576 607 --11415 --
NM_018182chr1741695 1557 458 376 ------
NM_018192chr321040 819 ------
NM_018195chr111472 --11452 --
NM_018201chr932505 579 375 ------
NM_018223chr124959 821 131 85 ------
NM_018227chr423172 2277 ------
NM_018237chr10------133
NM_018287chr101160 ------
NM_018299chr823454 3033 ------
NM_018312chr112550 497 ------
NM_018315chr4--1335 ----
NM_018328chr2------1136
NM_018330chr1031372 1241 566 ------
NM_018351chr121168 ------
NM_018364chr1--14047 ----
NM_018367chr112311 176 ------
NM_018369chr51309 --126 --
NM_018374chr7--24740 176 ----
NM_018375chr142455 222 ----11221
NM_018388chrX4554 534 486 391 ------
NM_018403chr321151 271 1257 12546 --
NM_018433chr2--1568 ----
NM_018440chr857272 6751 5676 1705 523 12183 28339 5792 --
NM_018452chr6_random1175 12702 13536 --
NM_018471chr2--1554 ----
NM_018477chr141195 1679 ----
NM_018482chr83967 554 393 12565 ----
NM_018486chrX2499 487 ------
NM_018489chr122134 802 11863 ----
NM_018490chr1111845 21834 1289 ----
NM_018557chr2--11708 ----
NM_018566chr133657 3319 1084 ----14136
NM_018569chr411014 11481 ----
NM_018584chr12412 402 ------
NM_018638chr1245301 5234 4824 1666 1221 ----
NM_018640chr121343 12728 12845 --
NM_018644chr1121442 277 ------
NM_018650chr111622 ------
NM_018657chr31711 ------
NM_018667chr1622813 86 ----12834
NM_018695chr531997 1907 828 --1526 --
NM_018697chr741816 673 544 242 --12080 --
NM_018700chr521207 300 ------
NM_018704chr111356 --11704 1664
NM_018708chr1941661 1538 610 441 1204 31284 180 163 --
NM_018712chr111225 11180 ----
NM_018834chr51157 1151 ----
NM_018841chr133375 3108 449 --13534 --
NM_018846chr72372 94 ------
NM_018898chr5----12362 1198
NM_018899chr5----12362 1198
NM_018900chr5----12362 1198
NM_018901chr5----12362 1198
NM_018902chr5----12362 1198
NM_018903chr5----12362 1198
NM_018904chr5----12362 1198
NM_018905chr5----12362 1198
NM_018906chr5----12362 1198
NM_018907chr5----12362 1198
NM_018908chr5----12362 1198
NM_018909chr5----12362 1198
NM_018910chr5----12362 1198
NM_018911chr5----12362 1198
NM_018945chr621425 297 --1710 --
NM_018948chr121223 1162 ------
NM_018972chr822426 1893 1468 ----
NM_018975chr162743 708 2732 681 ----
NM_018977chrX2965 356 ------
NM_018979chr1262564 2370 1832 1699 1689 99 12399 12307 --
NM_018999chr10----24272 1550 --
NM_019000chr511587 ------
NM_019001chr334484 3366 960 --24757 590 --
NM_019027chr41959 12453 1580 --
NM_019036chr61916 1332 ----
NM_019045chrX--1143 ----
NM_019063chr231894 544 189 --1622 --
NM_019071chr71210 ----1792
NM_019072chr533638 1381 510 13393 --11268
NM_019075chr21673 177 ----
NM_019076chr21673 177 ----
NM_019077chr21673 177 ----
NM_019078chr21673 177 ----
NM_019084chr1032591 2526 993 ----12560
NM_019093chr21673 177 ----
NM_019116chr1651328 1167 736 657 446 ------
NM_019556chrX1469 ------
NM_019590chr102457 248 1129 ----
NM_019593chr2032645 1956 971 11142 21224 817 1768
NM_019594chr921088 428 11142 ----
NM_019605chr1----2658 492 --
NM_019859chr102289 199 1610 ----
NM_019860chr102337 247 1658 ----
NM_019884chr191230 ------
NM_019885chr23753 301 284 ------
NM_020116chr421204 402 ------
NM_020119chr753616 3347 1221 873 518 ------
NM_020122chr244109 3836 1502 36 15874 11860 --
NM_020137chrX--1151 ----
NM_020141chr131952 606 599 1826 ----
NM_020147chr15130 --1761 --
NM_020150chr1021896 207 ------
NM_020151chr221379 31 ------
NM_020156chr7--1179 ----
NM_020177chr522562 287 2919 777 12648 --
NM_020189chr81159 ------
NM_020228chr1112539 12526 ----
NM_020239chr132219 2092 1707 ------
NM_020244chr12188 ------
NM_020245chr643608 1938 590 251 13887 ----
NM_020338chr1013641 --13318 --
NM_020342chr23728 720 153 --11633 11802
NM_020346chr1111541 11732 ----
NM_020354chr101777 ----1226
NM_020403chr1371711 1153 690 681 479 411 128 1520 ----
NM_020416chr42899 756 22331 1986 ----
NM_020443chr146610 6203 5998 5949 --22503 161 12294
NM_020449chrX1273 1244 ----
NM_020463chr211273 --1413 --
NM_020465chr1651648 1430 1337 540 168 11813 41942 1917 561 372 --
NM_020473chrX----1505 1311
NM_020474chr1821558 372 11783 --21748 693
NM_020640chr31507 ------
NM_020645chr111699 ------
NM_020647chr8143 ------
NM_020651chr21653 1307 ----
NM_020654chr3170 ----1354
NM_020672chr12563 30 ------
NM_020686chr1653107 2844 2085 1932 181 ------
NM_020699chr154807 3938 3615 646 556 ------
NM_020708chr2032489 2070 940 --11831 --
NM_020711chr211788 --1580 --
NM_020717chrX------13364
NM_020727chr2133628 3586 1461 ----13009
NM_020734chr1223286 3197 ------
NM_020739chr1522672 837 13641 ----
NM_020742chrX61702 1022 694 580 329 188 ------
NM_020747chr51356 ----180
NM_020760chr221758 118 ------
NM_020766chrX74189 3155 3035 2950 648 580 186 1914 14519 --
NM_020769chrX1968 ------
NM_020772chr1797764 6813 6573 6123 2992 2816 950 913 625 ----25497 5404
NM_020774chr1854892 2132 1373 1025 170 12020 ----
NM_020782chr1244504 3513 3373 1029 12959 --24478 1902
NM_020791chr1711064 11425 ----
NM_020799chr101256 ----1203
NM_020801chr511795 --11725 12562
NM_020806chr141742 1659 ----
NM_020819chr6------21216 1039
NM_020825chr1643760 2832 1295 451 ------
NM_020841chr1232886 2849 2822 2872 211 ----
NM_020859chr443461 1241 277 108 1520 ----
NM_020871chrX11017 --11827 --
NM_020888chr141549 1469 710 161 ------
NM_020918chr1062790 2338 1383 741 583 391 ------
NM_020919chr241092 901 115 45 11151 ----
NM_020940chr1012911 22865 2786 ----
NM_020952chr9------1138
NM_020977chr422064 1988 1412 1824 --
NM_020981chr2160 ------
NM_020987chr1011083 11433 ----
NM_021005chr1511137 ------
NM_021012chr1732722 624 361 12444 23009 2198 --
NM_021027chr21673 177 ----
NM_021033chr1333177 2895 1269 ----199
NM_021072chr53675 521 225 ------
NM_021083chrX43523 3077 2764 2401 ----1743
NM_021088chr241782 1721 840 163 ------
NM_021096chr2232376 1327 1070 1331 ----
NM_021106chr91771 ------
NM_021111chr9--21308 938 ----
NM_021120chrX73054 2771 2670 2429 1272 1006 723 ------
NM_021136chr141297 ------
NM_021144chr91190 ------
NM_021145chr72839 250 ------
NM_021168chr1631173 529 215 --11307 --
NM_021183chrX--1746 ----
NM_021192chr21354 ------
NM_021215chr2042480 1780 892 869 ------
NM_021255chr1413983 --22815 415 --
NM_021622chr1012351 --1482 --
NM_021629chr364962 4737 3763 3143 940 899 21545 1465 --14627
NM_021638chr474559 4480 3647 1093 858 752 256 --13823 --
NM_021639chr11587 ------
NM_021728chr141364 ------
NM_021738chr102348 86 ----1600
NM_021784chr202654 95 ------
NM_021813chr635516 5213 4265 15813 1200 --
NM_021911chr535245 4575 4056 14027 ----
NM_021912chr1533543 3508 3186 22807 2771 ----
NM_021913chr1911187 2677 379 --1251
NM_021914chr14------12339
NM_021943chr6------1376
NM_021946chrX1595 ----11464
NM_021954chr1312382 1900 ----
NM_021956chr61421 ------
NM_021958chr11257 ------
NM_021960chr1--32505 1947 392 11734 --
NM_021961chr1157388 5583 5037 2781 2406 15254 --11288
NM_021964chr366499 4935 2596 2306 1799 83 25462 4807 ----
NM_021980chr1021264 75 ------
NM_021988chr202503 201 --11222 --
NM_021998chrX21416 1109 ------
NM_021999chr131589 ------
NM_022045chr81218 ------
NM_022058chr2172 ------
NM_022072chr32222 30 ------
NM_022130chr511348 ------
NM_022136chr21--1218 ----
NM_022140chr521626 407 1448 --1777
NM_022153chr1033539 3164 3030 ----31384 752 224
NM_022166chr1645341 4558 2055 2026 25648 4316 21625 1077 1386
NM_022351chr833614 3281 47 ------
NM_022373chr72777 115 --1247 --
NM_022442chr202503 201 --11222 --
NM_022451chr10----1591 --
NM_022454chr8144 ------
NM_022459chr1375619 5258 1895 1823 1577 774 194 25286 1962 24924 979 --
NM_022461chr31257 ------
NM_022465chr1212575 --12064 12363
NM_022474chr1432080 970 839 22279 390 ----
NM_022475chr41725 ------
NM_022491chr1243486 3084 2727 2541 1678 ----
NM_022648chr223252 3044 14256 13973 --
NM_022726chr621242 605 1155 1427 11205
NM_022728chr71104 ------
NM_022757chr32968 26 1677 ----
NM_022771chr121891 ------
NM_022781chr963089 2760 2526 1295 569 34 12028 ----
NM_022782chr121312 ------
NM_022802chr10--21432 239 ----
NM_022817chr241863 1580 400 50 ----12098
NM_022826chr21319 ------
NM_022828chr521757 91 1531 ----
NM_022841chr1512253 12333 ----
NM_022843chr1311290 ------
NM_022845chr1631809 1728 25 --11538 --
NM_022893chr222778 2274 --12045 --
NM_022903chr32192 69 ------
NM_022910chr1651648 1430 1337 540 168 11813 41942 1917 561 372 --
NM_022912chr222522 995 ------
NM_022918chr112515 98 ------
NM_022970chr1011408 --1383 --
NM_022977chrX32499 448 231 --11977 --
NM_023000chr14----1319 --
NM_023001chr14----1319 --
NM_023012chr122733 99 --1165 1482
NM_023037chr1331016 242 43 1785 ----
NM_023071chr12--11092 ----
NM_023925chr12136 ------
NM_024007chr51198 ------
NM_024040chr10--1128 ----
NM_024090chr421842 1194 ------
NM_024117chr911142 ------
NM_024293chr21831 ------
NM_024295chr831493 721 53 ------
NM_024308chr17170 ------
NM_024345chr966031 5056 4406 2086 1689 37 21117 937 ----
NM_024415chr5------1209
NM_024423chr1833786 1182 227 ------
NM_024424chr1121197 143 ------
NM_024425chr1121197 143 ------
NM_024426chr1121197 143 ------
NM_024496chr14--1234 ----
NM_024524chr372076 865 732 721 670 579 314 1449 --12932
NM_024539chrX2982 420 --11297 --
NM_024545chr21301 ------
NM_024548chr3------11276
NM_024586chr11534 ------
NM_024639chr632701 1079 394 ------
NM_024640chr1--1906 137 --
NM_024645chr811547 ------
NM_024646chr113272 23988 795 13295 1939
NM_024686chr13563 497 94 1380 ----
NM_024692chr211832 ------
NM_024700chr14413 299 156 98 11093 --1394
NM_024713chr151576 ------
NM_024715chr531592 168 61 ------
NM_024721chr812128 ------
NM_024742chr1611498 ------
NM_024744chr232630 830 751 ------
NM_024749chr121463 39 ------
NM_024753chr24659 598 173 22 ------
NM_024761chr923261 185 24676 1489 ----
NM_024770chr236113 1686 42 12340 ----
NM_024771chr1132021 687 194 ----1991
NM_024811chr111297 11686 ----
NM_024817chr1523841 1046 35759 5164 4901 31951 795 374 --
NM_024824chr142571 197 21420 1138 ----
NM_024944chr211305 1188 ----
NM_024947chr399193 8910 7707 7564 7238 6160 5852 3530 277 16111 --15976
NM_024953chr1211095 ----1152
NM_024971chr9------1138
NM_025074chr413072 12543 23012 2005 --
NM_025099chr173896 823 148 ----11151
NM_025126chr121726 1662 ----
NM_025133chr22293 202 ------
NM_025134chr1611624 ------
NM_025138chr1321270 589 ------
NM_025154chr721094 181 ----11198
NM_025160chr134064 3025 257 --11276 --
NM_025164chr1121444 152 ------
NM_025179chr164804 4306 3817 3237 3144 1095 ------
NM_025191chr122165 170 --23385 1306 --
NM_025196chr4123 ------
NM_025222chr342699 1016 659 141 ----12924
NM_025230chr1441529 1250 473 291 ------
NM_025235chr1021951 1566 ------
NM_025238chr1531006 626 89 ------
NM_030594chr151523 ------
NM_030625chr1031004 406 289 1385 158 --
NM_030627chr554060 3514 3284 1052 157 ------
NM_030640chr122345 308 ------
NM_030647chr745112 2112 1286 478 --12043 16000
NM_030648chr475465 5208 4147 2094 1974 903 397 11420 --14349
NM_030650chr233968 2879 486 11203 ----
NM_030786chr11472 ------
NM_030795chr82458 147 ------
NM_030801chrX1182 ------
NM_030802chr17------1891
NM_030816chr133385 2920 283 --1698 --
NM_030820chr62113 37 ------
NM_030918chr153831 3317 2092 340 302 --23797 1538 --
NM_030920chr111614 22134 2053 ----
NM_030938chr17--21003 176 ----
NM_030939chr62928 352 ------
NM_030949chr631394 1142 570 11015 ----
NM_030962chr111172 11351 1503 --
NM_030963chr61562 ----1198
NM_030964chr553271 2831 1259 957 728 12938 --11425
NM_031216chr1821585 1438 1483 1765 --
NM_031244chr6------11112
NM_031262chr9189 ------
NM_031263chr91146 ------
NM_031266chr51179 1410 ----
NM_031267chr71495 ------
NM_031291chr42114 89 ------
NM_031292chr12184 --1662 --
NM_031305chr43517 385 203 ------
NM_031411chr5----12362 1198
NM_031427chr1445996 4907 3630 2168 125 15686 --
NM_031438chr5--1601 1566 --
NM_031442chrX------22152 1078
NM_031445chr223017 1063 ----13180
NM_031461chr81308 1224 ----
NM_031469chr643194 2609 472 136 ------
NM_031476chr1662618 2489 2315 1779 673 194 --11773 --
NM_031483chr2012419 ------
NM_031844chr134036 3665 1629 ------
NM_031845chr22880 487 13332 ----
NM_031847chr22880 487 13332 ----
NM_031849chr5----12362 1198
NM_031857chr5----12362 1198
NM_031860chr5----12362 1198
NM_031866chr101958 ------
NM_032041chr81230 11929 12633 --
NM_032042chr5--12485 ----
NM_032047chr322283 2185 --1592 --
NM_032104chr1------153
NM_032105chr146860 5879 2922 2713 ----153
NM_032128chr41915 1900 ----
NM_032156chr12136 ------
NM_032181chr21336 ----1230
NM_032186chr121147 337 ------
NM_032208chr232782 2710 647 ------
NM_032228chr1132929 934 192 22922 267 ----
NM_032256chr122131 99 ------
NM_032268chr1673187 2426 2206 1260 1043 978 348 --12402 --
NM_032288chr342313 2291 1876 644 1588 ----
NM_032291chr111737 1528 ----
NM_032316chr33488 196 165 --11968 12491
NM_032345chr121375 ------
NM_032352chr14141 1440 ----
NM_032373chr1035308 1444 364 13684 1807 --
NM_032410chr81375 --11229 --
NM_032436chr133787 135 35 ------
NM_032439chr1031436 485 348 ------
NM_032468chr821396 467 1431 ----
NM_032482chr1952357 1818 1763 819 691 --52311 1836 1694 704 373 1417
NM_032505chr311717 2665 74 1723 --
NM_032520chr16--1220 ----
NM_032521chr2032194 1126 1065 ------
NM_032539chrX--2538 108 ----
NM_032590chr1231041 380 339 ------
NM_032632chr141204 ------
NM_032646chr1751497 1448 1362 1206 234 ------
NM_032682chr342247 1204 1009 722 33434 1431 146 ----
NM_032689chr191567 1198 ----
NM_032727chr101479 11105 --1301
NM_032731chr1721466 133 ------
NM_032765chr52810 35 ------
NM_032804chr1032204 2060 901 ------
NM_032812chr10------145
NM_032826chr71983 22108 104 12090 --
NM_032833chr122418 1859 1961 ----
NM_032844chr10135 ------
NM_032857chr15--1227 ----
NM_032859chr1322873 77 13901 ----
NM_032864chr11399 11053 --1155
NM_032867chr111255 ----1557
NM_032873chr1153598 2843 1707 1129 827 ------
NM_032875chr17--1323 ----
NM_032900chr1033138 3015 1187 13668 160 --
NM_032932chr1756294 6043 5360 5306 4771 --45984 4290 4276 1847 --
NM_032968chrX23252 1018 ------
NM_032969chrX23252 1018 ------
NM_032973chrY33425 3247 1018 ------
NM_032975chr1832986 2634 1169 ------
NM_032980chr1832986 2634 1169 ------
NM_033012chr133915 200 21 ------
NM_033018chrX11013 --1903 1201
NM_033020chr124589 317 13236 ----
NM_033023chr73389 76 48 --1441 --
NM_033030chr231341 341 116 1239 ----
NM_033044chr11119 ------
NM_033055chr12991 332 ------
NM_033081chr2011221 ------
NM_033132chr1331513 762 155 --11866 --
NM_033136chr521842 201 1496 --11238
NM_033137chr521842 201 1496 --11238
NM_033138chr721570 748 ------
NM_033139chr721570 748 ------
NM_033140chr721570 748 ------
NM_033157chr721570 748 ------
NM_033224chr716069 ------
NM_033225chr832545 795 666 ------
NM_033228chr52422 147 ------
NM_033259chr31638 ------
NM_033267chr52726 44 ------
NM_033284chrY1124 ------
NM_033331chr932505 2207 1139 ------
NM_033360chr1224585 1098 13991 --13255
NM_033380chrX----2394 113 1436
NM_033381chrX----2394 113 1436
NM_033389chr1754685 4185 1308 568 143 --14353 --
NM_033394chr221254 615 --11158 --
NM_033425chr112602 370 --1834 1561
NM_033429chr1542534 2469 2298 498 --11059 --
NM_033449chr531537 748 605 1509 1533 --
NM_033480chr632709 2578 242 ------
NM_033481chr632709 2578 242 ------
NM_033515chr621192 159 ------
NM_033540chr31180 ------
NM_033632chr4--1335 ----
NM_033656chr2135473 671 602 11784 12346 --
NM_048368chr181282 ------
NM_052832chr832584 850 314 22700 2428 ----
NM_052834chr1831749 428 397 22566 2539 ----
NM_052864chr441388 702 430 160 22130 653 ----
NM_052869chr1751497 1448 1362 1206 234 ------
NM_052879chr12--43051 1443 1137 1103 14094 --
NM_052885chr1254128 1882 1061 946 417 1353 ----
NM_052886chr822157 1558 1774 ----
NM_052898chr821412 621 --11719 --
NM_052913chr621054 60 ------
NM_052918chr1053562 3275 2816 1407 403 --12649 --
NM_052927chr521991 159 ------
NM_052950chr132294 255 ------
NM_052958chr81727 ------
NM_052962chr611253 --11759 --
NM_053002chr34410 289 266 156 ------
NM_053016chr912585 11673 11011 17407
NM_053043chr786033 5980 4438 4035 2486 2047 1653 697 26420 2122 22195 204 15718
NM_053056chr1152712 2456 1175 278 62 ------
NM_053064chr1422649 735 ------
NM_053281chrX1328 ------
NM_054025chr1121442 277 ------
NM_054114chr6135 --1233 --
NM_057089chr71157 --150 --
NM_057157chr101380 ------
NM_057164chr22674 260 ----1174
NM_057165chr22674 260 ----1174
NM_057166chr22674 260 ----1174
NM_057167chr22674 260 ----1174
NM_057168chr711201 ----1541
NM_057175chr451962 1717 974 648 599 --12477 --
NM_057182chr192489 346 ------
NM_057749chr83365 304 91 ------
NM_058191chr213861 742 112 ------
NM_058241chr232000 197 128 ----12207
NM_058241chr232000 197 128 ----12207
NM_058243chr19161 ------
NM_078467chr631507 1046 223 ------
NM_078485chr63508 487 310 --1175 --
NM_078625chr62915 255 ------
NM_080422chr18--1211 ----
NM_080423chr18--1211 ----
NM_080546chr921616 918 ------
NM_080597chr1821081 22 ------
NM_080617chr20--1428 ----
NM_080629chr11328 11357 1281 --
NM_080630chr11328 11357 1281 --
NM_080645chr641453 1400 673 25 ------
NM_080679chr61624 ------
NM_080680chr61624 ------
NM_080681chr61624 ------
NM_080717chr1211165 ----1401
NM_080723chr62289 225 --1400 --
NM_080792chr201857 --1836 --
NM_080840chr201164 ------
NM_080841chr201164 ------
NM_080867chr1443824 3751 3234 213 1856 ----
NM_080872chr823955 822 --13940 --
NM_080927chr312162 --1175 --
NM_130391chr943624 2400 1388 380 --12818 --
NM_130392chr943624 2400 1388 380 --12818 --
NM_130393chr943624 2400 1388 380 --12818 --
NM_130436chr2142424 2324 395 51 ------
NM_130438chr2143001 2901 972 628 ------
NM_130439chr1022058 1809 11665 11904 --
NM_130439chr1022058 1809 11665 11904 --
NM_130795chr91771 ------
NM_130797chr761646 1578 1351 1204 1158 113 21622 1295 ----
NM_130831chr332489 2322 387 ------
NM_130832chr332489 2322 387 ------
NM_130833chr332489 2322 387 ------
NM_130834chr332489 2322 387 ------
NM_130835chr332489 2322 387 ------
NM_130836chr332489 2322 387 ------
NM_130837chr332489 2322 387 ------
NM_130838chr152461 267 11418 ----
NM_130839chr152461 267 11418 ----
NM_130846chr121383 ------
NM_133170chr2067888 7817 6692 5492 1511 691 18076 1353 --
NM_133264chr1721494 1009 13017 1775 --
NM_133265chrX2628 425 --21428 825 --
NM_133328chr191684 ------
NM_133334chr475200 5012 4490 2469 1549 1281 828 16373 26405 1178 --
NM_133468chr721678 277 1321 ----
NM_133473chr1921889 1695 ------
NM_133474chr411537 ------
NM_133476chr1241199 797 770 276 ------
NM_133477chr441266 1259 795 277 1414 --1515
NM_133486chrX1420 ------
NM_133494chr1------184
NM_133496chr143341 1398 937 497 23166 1584 --11150
NM_133638chr51153 --1321 --
NM_134427chr91771 ------
NM_134442chr211147 1351 ----
NM_138357chr101302 ------
NM_138373chr1921711 1700 11445 --1597
NM_138375chr1821012 946 1230 ----
NM_138391chr1--1242 1259 --
NM_138396chr12190 ------
NM_138423chr1532152 698 36 22285 903 ----
NM_138426chr741842 839 745 412 12285 ----
NM_138437chrX167 ------
NM_138459chr611267 --12529 --
NM_138473chr1255102 4799 3430 1326 118 --23591 3174 13553
NM_138492chr52383 318 ------
NM_138555chr151540 ------
NM_138559chr221252 416 ------
NM_138569chr6------158
NM_138621chr251351 989 974 890 291 --13347 --
NM_138638chr14------12339
NM_138713chr1685737 5667 3088 2350 2309 1647 1364 1292 23253 2888 27342 1056 16697
NM_138714chr1685737 5667 3088 2350 2309 1647 1364 1292 23253 2888 27342 1056 16697
NM_138730chr62368 309 ------
NM_138731chr141412 ------
NM_138782chr511583 ------
NM_138927chr2111066 ------
NM_138931chr31978 ------
NM_138966chr181408 ------
NM_138970chr1422002 714 22031 962 1898 --
NM_139012chr642083 1768 801 146 ------
NM_139014chr642163 1848 881 226 ------
NM_139015chr1261691 1604 1406 1362 1265 1150 --1170 --
NM_139035chrX1608 ------
NM_139045chr92853 847 ------
NM_139057chr1552625 2401 2144 593 449 12559 22652 779 --
NM_139067chr121276 ------
NM_139135chr11115 11321 ----
NM_139157chr112710 254 ------
NM_139168chr5--1530 ----
NM_139201chr123579 300 46 1711 ----
NM_139207chr1211816 21781 542 --11363
NM_139283chr1252564 2459 2415 2225 275 162 ----
NM_139319chr1241861 1381 691 438 1565 ----
NM_139321chr2063416 2846 2759 1540 621 475 --14083 --
NM_144488chr91771 ------
NM_144489chr91771 ------
NM_144571chr476865 6570 6319 6039 5722 5681 2580 ------
NM_144579chr242758 2023 1954 806 --22572 2048 --
NM_144580chr11238 ------
NM_144590chr1032151 2003 407 --12829 --
NM_144595chr13156 ------
NM_144599chr1554797 3933 3417 1266 446 --199 --
NM_144635chr311243 ----11051
NM_144636chr31547 1278 ----
NM_144643chr41107 ------
NM_144657chrX1586 ------
NM_144664chr1122098 506 ------
NM_144671chr122694 324 --2588 167 11809
NM_144767chr1544326 4163 1510 724 14445 13304 --
NM_144949chr23204 120 87 22594 2408 ----
NM_144967chrX1744 --1243 --
NM_144973chr1245100 1097 815 211 --1344 --
NM_144979chr41666 1696 ----
NM_145005chr91147 --1185 --
NM_145049chr52397 85 1884 ----
NM_145055chr1833763 1511 742 ------
NM_145113chr1411051 ------
NM_145117chr1143077 2439 631 539 ----1529
NM_145185chr1931292 697 361 11796 ----
NM_145245chr1921137 1032 ------
NM_145259chr2--11153 --14637
NM_145274chr171185 ------
NM_145287chr18146 129 1173 --
NM_145296chr191156 ------
NM_145320chr733329 1286 1245 --1514 --
NM_145321chr733329 1286 1245 --1514 --
NM_145322chr733329 1286 1245 --1514 --
NM_145331chr6190 ------
NM_145647chr81138 ------
NM_145686chr222619 2489 33364 2093 444 2260 236 --
NM_145687chr222619 2489 33364 2093 444 2260 236 --
NM_145698chr1041478 819 583 70 ------
NM_145719chr11--1348 ----
NM_145727chr62553 211 --2391 49 --
NM_145753chr321605 1383 11652 ----
NM_145808chr733164 1916 1227 ----1435
NM_145859chr31304 ------
NM_145860chr31304 ------
NM_145909chr61212 ------
NM_147127chr4167 ------
NM_147150chr973701 3436 3340 3098 977 467 33 ----13296
NM_147175chrX31991 1435 162 ------
NM_147223chr2135 ------
NM_148174chr831575 1460 858 ------
NM_148571chr1731697 1541 229 175 11821 --
NM_148898chr71393 1673 ----
NM_148899chr71393 1673 ----
NM_148904chr11534 ------
NM_148905chr11534 ------
NM_148906chr11534 ------
NM_148907chr11534 ------
NM_148908chr11534 ------
NM_148909chr11534 ------
NM_152133chr6135 --1233 --
NM_152227chr203753 715 483 ------
NM_152253chr2233668 2618 121 --1556 --
NM_152263chr155817 5514 5247 2014 1486 35189 4498 1618 15070 --
NM_152265chr11234 ------
NM_152267chr22169 ------
NM_152282chr311247 ----11303
NM_152400chr421673 114 ----21929 711
NM_152407chr563139 3049 2721 906 695 218 12700 ----
NM_152410chr62414 40 ------
NM_152422chr91284 1131 ----
NM_152423chrX11579 1186 1544 --
NM_152455chr1572690 2520 2056 2017 975 688 265 --12198 --
NM_152493chr111181 --1370 --
NM_152495chr131170 1146 396 ------
NM_152496chr13890 196 124 --1318 2190 29
NM_152515chr2130 ------
NM_152538chr341330 683 139 79 --11152 --
NM_152556chr721992 278 --12012 --
NM_152594chr1511611 12059 ----
NM_152608chr12742 681 ----11872
NM_152621chr4--1370 ----
NM_152622chr511244 32631 2248 996 12811 --
NM_152624chr5117425 6942 5996 4982 2916 2624 2452 2005 1266 1069 89 17107 --11544
NM_152636chr1142452 2286 1001 288 ------
NM_152641chr1232733 2593 1112 ------
NM_152665chr12438 309 ----1934
NM_152699chr343562 2947 2361 109 23626 1131 23642 3229 --
NM_152733chr676532 6371 4953 4676 4316 1148 509 --45854 5637 4041 2027 --
NM_152739chr71283 1268 ----
NM_152745chr71931 ------
NM_152754chr73680 389 338 ------
NM_152756chr544103 2647 675 482 ----13257
NM_152758chr821910 849 ------
NM_152780chrX131 ------
NM_152835chr112464 12662 --12627
NM_152838chr2052773 1081 983 665 363 22966 2417 ----
NM_152857chr6------1970
NM_152858chr6------1970
NM_152890chr121067 523 ------
NM_152896chr91565 1774 ----
NM_152903chr1322609 462 1220 ----
NM_152924chr1556707 6661 5816 5065 1379 ------
NM_152989chr1221826 412 ------
NM_152994chr21592 ------
NM_152999chr754630 3274 1603 930 684 33813 3306 1396 ----
NM_153013chr51866 2522 262 ----
NM_153020chr611640 ------
NM_153029chr1634155 1343 1150 --14030 13219
NM_153035chr122821 106 12617 1208 --
NM_153046chr141175 1563 1100 --
NM_153181chr181408 ------
NM_153184chr3--11981 11795 --
NM_153208chr16--1780 ----
NM_153261chr16--11220 ----
NM_153262chr132857 2169 429 ------
NM_153267chr9--1762 ----
NM_153273chr362734 2411 2300 2222 853 812 12517 ----
NM_153347chr1152472 1700 384 360 296 1449 --1892
NM_153365chr441087 1021 945 51 1789 ----
NM_153367chr1053685 2466 861 175 66 --11034 --
NM_153619chr1532444 1253 977 --11453 --
NM_153620chr721319 1189 21776 1130 ----
NM_153633chr121260 ------
NM_153649chr131800 922 586 ----12271
NM_153675chr202654 95 ------
NM_153689chr221634 59 ------
NM_153693chr121787 ------
NM_153705chr11--12367 --12128
NM_153757chr4----1299 21268 225
NM_153810chr1024915 3128 ------
NM_153836chr231482 613 27 ------
NM_170606chr721837 449 ------
NM_170665chr1264565 4328 3977 3873 3449 1287 ------
NM_170674chr15------11431
NM_170675chr15------11107
NM_170676chr15------11107
NM_170677chr15------11431
NM_170696chr1521744 1296 ------
NM_170697chr1521744 1296 ------
NM_170719chr1321270 589 ------
NM_170725chr11169 ------
NM_170768chr1121777 1305 --21135 458 --
NM_171998chrX3567 485 176 ----12322
NM_172070chr221911 148 ------
NM_172071chr12852 504 25294 4796 ----
NM_172078chr7138 ------
NM_172079chr7138 ------
NM_172080chr7138 ------
NM_172081chr7138 ------
NM_172082chr7138 ------
NM_172083chr7138 ------
NM_172084chr7138 ------
NM_172103chr62682 177 ------
NM_172105chr62682 177 ------
NM_172127chr411929 ------
NM_172128chr411885 ------
NM_172159chr321699 871 --21787 68 --
NM_172160chr321699 871 --21787 68 --
NM_172169chr102735 205 --21587 692 --
NM_172170chr102735 205 --21587 692 --
NM_172171chr102735 205 --21587 692 --
NM_172173chr102735 205 --21587 692 --
NM_172240chr1221254 107 ------
NM_172315chr15------11431
NM_172316chr15------11431
NM_172337chr141364 ------
NM_173076chr23986 790 135 ------
NM_173078chrX1110 ------
NM_173156chr142034 1730 1421 717 --1756 --
NM_173198chr91625 22949 2607 ----
NM_173200chr91625 22949 2607 ----
NM_173214chr1685737 5667 3088 2350 2309 1647 1364 1292 23253 2888 27342 1056 16697
NM_173354chr2132038 693 122 11425 ----
NM_173468chr436040 3731 281 --12273 --
NM_173475chr161477 1547 ----
NM_173495chrX12095 ------
NM_173500chr1511313 ------
NM_173505chr181881 2439 424 ----
NM_173510chr2212376 12545 12926 --
NM_173515chr61686 --1198 --
NM_173552chr33539 505 97 1871 ----
NM_173562chr612553 22738 1236 1252 --
NM_173576chr10144 ------
NM_173582chr1146309 5844 814 80 ------
NM_173595chr1224719 1807 --15007 --
NM_173602chr1223314 2679 23801 952 ----
NM_173618chr16186 ------
NM_173642chr146960 6942 966 534 17526 ----
NM_173647chr21294 1987 ----
NM_173667chr55951 890 541 497 23 11793 11893 --
NM_173683chr821686 1284 ----2483 407
NM_173694chrX31603 586 320 1650 ----
NM_173698chrX3609 243 47 22047 1393 ----
NM_173808chr113112 147 ----
NM_173812chr121502 ------
NM_173829chr565622 4277 1863 1250 290 171 14461 ----
NM_174890chr101803 1253 ----
NM_174916chr1531919 361 223 ------
NM_174938chr91102 ------
NM_175061chr731696 1353 675 ----1232
NM_175634chr811122 ----11087
NM_175635chr811122 ----11087
NM_175636chr811122 ----11087
NM_175733chr112760 214 ----1436
NM_175767chr51307 ------
NM_175848chr2021074 237 --11209 --
NM_175848chr2021074 237 --11209 --
NM_175849chr2021074 237 --11209 --
NM_175849chr2021074 237 --11209 --
NM_175850chr2021074 237 --11209 --
NM_175850chr2021074 237 --11209 --
NM_175854chr1332743 2713 2383 1815 ----
NM_175856chr51160 ------
NM_175866chr11260 ------
NM_175895chr122814 246 1300 ----
NM_175902chr17--1317 ----
NM_175907chr1811778 1193 --1127
NM_175921chr544249 3924 2921 1597 23947 786 ----
NM_176783chr141100 ------
NM_176812chr201623 ------
NM_176814chr7----166 --
NM_176863chr1731853 399 393 ------
NM_176871chr842708 2130 2118 420 12885 ----
NM_177398chr131602 704 639 --11581 --
NM_177399chr131602 704 639 --11581 --
NM_177401chr1911419 ------
NM_177524chr71253 1363 --11076
NM_177525chr71253 1363 --11076
NM_177535chrX1182 ------
NM_177972chr1123212 2792 13610 ----
NM_177974chr1532152 698 36 22285 903 ----
NM_177985chr222000 45 11395 ----
NM_177995chr91284 1131 ----
NM_178010chr1221826 412 ------
NM_178011chr102523 443 ------
NM_178037chr1242899 2473 1082 815 --11135 --
NM_178038chr1242899 2473 1082 815 --11135 --
NM_178039chr1242534 2108 717 450 --1770 --
NM_178040chr1242534 2108 717 450 --1770 --
NM_178123chr2------1313
NM_178140chr512488 ------
NM_178151chrX46859 5185 264 95 27757 2638 37740 6868 621 16433
NM_178152chrX46859 5185 264 95 27757 2638 37740 6868 621 16433
NM_178153chrX46859 5185 264 95 27757 2638 37740 6868 621 16433
NM_178191chr121612 477 ------
NM_178313chr262169 1974 1964 1771 754 363 ------
NM_178517chr17--189 ----
NM_178565chr841619 430 163 97 1242 ----
NM_178578chr2052109 2053 1707 1067 326 ------
NM_178585chr432192 2116 2058 1127 12390 --
NM_178586chr1411780 22147 781 ----
NM_178812chr8------11543
NM_178860chr1721026 815 ------
NM_180976chr64964 843 754 189 ------
NM_180977chr64964 843 754 189 ------
NM_181332chrX61702 1022 694 580 329 188 ------
NM_181357chr1441529 1250 473 291 ------
NM_181358chr141389 1239 647 400 11501 ----
NM_181442chr201893 1340 ----
NM_181443chr2012711 ------
NM_181457chr211120 1175 ----
NM_181458chr221253 915 1308 ----
NM_181459chr211019 174 ----
NM_181481chr1857006 5403 4944 1888 965 --14991 --
NM_181482chr1857006 5403 4944 1888 965 --14991 --
NM_181483chr1857006 5403 4944 1888 965 --14991 --
NM_181486chr1211165 ----1401
NM_181521chr1631773 860 450 45187 1419 938 868 12332 --
NM_181532chrX1229 ------
NM_181659chr2073196 2907 2320 809 522 290 225 ------
NM_181659chr2073196 2907 2320 809 522 290 225 ------
NM_181672chrX1749 ------
NM_181673chrX1749 ------
NM_181702chr81254 ------
NM_181714chr621358 267 21514 358 ----
NM_181782chr622301 592 ------
NM_181783chr123679 358 270 ------
NM_181787chr843321 3111 2606 1265 13170 ----
NM_181836chr51378 ------
NM_181839chr841117 481 470 110 ------
NM_181876chr42899 756 22331 1986 ----
NM_182485chr4----1615 13511
NM_182493chr1645033 2129 1960 374 1460 ----
NM_182511chr1831118 1050 962 ------
NM_182526chr1443142 438 182 161 --22539 620 --
NM_182551chr243561 2622 2177 755 ----13101
NM_182643chr821474 39 ------
NM_182646chr4----1615 13511
NM_182663chr112037 ------
NM_182664chr112167 ------
NM_182665chr112037 ------
NM_182691chr711417 1902 ----
NM_182692chr711417 1902 ----
NM_182729chr121656 ----1393
NM_182742chr121656 ----1393
NM_182743chr121656 ----1393
NM_182758chr15----23439 2931 --
NM_182762chr745838 5151 3805 358 45954 5565 1415 717 ----
NM_182763chr1--32494 1936 381 11723 --
NM_182797chr201654 11201 ----
NM_182894chr1421719 1651 --162 --
NM_182898chr734138 451 227 36435 6243 1744 26268 1812 --
NM_182899chr734138 451 227 36435 6243 1744 26268 1812 --
NM_182920chr321413 586 11217 1432 --
NM_182948chr12349 332 12907 ----
NM_182964chr1143077 2439 631 539 ----1529
NM_182970chr2033858 3621 1670 --1835 --
NM_182972chr142493 2153 1007 623 11053 11094 --
NM_182975chr1----1390 1140
NM_182976chr1------1272
NM_183004chr1443440 3280 3184 3004 11056 ----
NM_183238chr1253875 3213 2672 1178 491 23746 2377 ----
NM_183381chr32692 347 --1203 --
NM_183383chr32692 347 --1203 --
NM_183384chr32692 347 --1203 --
NM_183397chr2045053 4881 1469 1425 --43197 3185 331 89 --
NM_183416chr1151 11768 ----
NM_194071chr744908 4673 4665 4559 14679 ----
NM_194247chr241612 1130 795 455 ------
NM_194271chr121726 1662 ----
NM_194272chr151342 ------
NM_194282chr431205 1144 333 11915 ----
NM_194286chr1256249 5826 4913 4298 1808 --14871 --
NM_194292chr1150 21683 1621 ----
NM_194301chr141762 ------
NM_194314chr155637 4529 4090 3586 744 1238 14008 --
NM_194328chr963089 2760 2526 1295 569 34 12028 ----
NM_194329chr963089 2760 2526 1295 569 34 12028 ----
NM_194330chr963089 2760 2526 1295 569 34 12028 ----
NM_194332chr963089 2760 2526 1295 569 34 12028 ----
NM_194434chr1865666 5237 1538 1044 638 21 ------
NM_194442chr121687 1133 21530 1402 ----
NM_194454chr721504 1266 ------
NM_194455chr721504 1266 ------
NM_194456chr721504 1266 ------
NM_194463chrX2982 420 --11297 --
NM_197941chr521189 200 1734 --12085
NM_197970chr231341 341 116 1239 ----
NM_197977chr91276 --1637 --
NM_198128chr1811662 1456 ----
NM_198175chr171151 ------
NM_198182chr231502 190 43 ------
NM_198195chr32178 172 --1528 --
NM_198220chr201321 --136 --
NM_198225chr101637 11252 ----
NM_198261chr122733 99 --1165 1482
NM_198262chr122733 99 --1165 1482
NM_198268chr141389 1239 647 400 11501 ----
NM_198269chr141389 1239 647 400 11501 ----
NM_198337chr731232 444 23 ------
NM_198391chr2011461 ------
NM_198395chr5--1144 11215 --
NM_198400chr1552749 2037 2020 585 501 12046 ----
NM_198513chr821559 396 11740 ----
NM_198581chr286674 5730 5402 2359 2106 1901 1051 736 11499 ----
NM_198595chr474559 4480 3647 1093 858 752 256 --13823 --
NM_198700chr111422 ------
NM_198715chr115310 16243 ----
NM_198794chr1411181 ------
NM_198859chr344558 2057 1492 972 ------
NM_198902chr151116 ------
NM_198935chr2032628 2497 2292 22997 2774 1213 12455
NM_199050chr2163410 3122 3095 2986 913 435 1746 ----
NM_199072chr712701 124 ----
NM_199144chr202503 201 --11222 --
NM_199188chr12--43051 1443 1137 1103 14094 --
NM_199189chr51157 1151 ----
NM_199190chr12--43051 1443 1137 1103 14094 --
NM_199203chr202503 201 --11222 --
NM_199320chr41181 ------
NM_199320chr41181 ------
NM_199324chr463433 2654 2613 2607 1369 1261 13575 ----
NM_199342chr1149 ------
NM_199414chr152876 198 --11039 --
NM_199421chr1443824 3751 3234 213 1856 ----
NM_199437chr1112539 12526 ----
NM_199438chr1112539 12526 ----
NM_199439chr1112539 12526 ----
NM_199462chr165028 4862 3589 1528 267 115 24759 367 ----
NM_199478chrX1735 11349 ----
NM_199482chr21584 11879 ----
NM_201266chr212050 ------
NM_201269chr121147 337 ------
NM_201279chr212050 ------
NM_201280chr631546 566 447 ------
NM_201413chr2131088 741 139 ------
NM_201414chr2131088 741 139 ------
NM_201428chr111134 ------
NM_201429chr111134 ------
NM_201430chr11160 ------
NM_201437chr8--11370 ----
NM_201568chr142034 1730 1421 717 --1756 --
NM_201569chr142034 1730 1421 717 --1756 --
NM_201570chr1021306 193 ------
NM_201571chr1021306 193 ------
NM_201572chr1021306 193 ------
NM_201590chr1021306 193 ------
NM_201591chr431262 329 43 ------
NM_201592chr431262 329 43 ------
NM_201593chr1021306 193 ------
NM_201596chr1021306 193 ------
NM_201597chr1021306 193 ------
NM_201995chr11----1720 --
NM_201998chr11----1785 --
NM_203350chr111749 191 ----
NM_203351chr172397 379 --11926 --
NM_203364chr1111097 1776 ----
NM_203390chr811796 1485 ----
NM_203406chr532826 881 56 --11137 --
NM_203434chr92945 283 ------
NM_203458chr11437 1648 ----
NM_203459chr152567 2263 752 666 245 --1573 --
NM_203487chr1371711 1153 690 681 479 411 128 1520 ----
NM_203488chr14--1291 ----
NM_203494chr151133 ------
NM_203504chr42965 345 12530 ----
NM_203505chr42965 345 12530 ----
NM_205768chr11210 22080 1701 ----
NM_205846chr52383 318 ------
NM_205848chr111881 ------
NM_205862chr21673 177 ----
NM_206594chr133271 2408 958 ----12628
NM_206595chr133271 2408 958 ----12628
NM_206809chr6------1801
NM_206852chr141297 ------
NM_206857chr141297 ------
NM_206876chr221104 171 ------
NM_206907chr533156 355 341 ------
NM_206914chr1222080 591 --1133 --
NM_206943chr21263 ----1663
NM_206944chr9------1138
NM_206945chr9------1138
NM_206946chr9------1138
NM_206947chr9------1138
NM_207123chr42785 165 1842 ----
NM_207311chr1221184 301 ------
NM_207325chr192761 686 ------
NM_207361chr1334184 3974 780 15142 --1320
NM_207404chr32739 274 --12121 1225
NM_207406chr456483 6378 4546 4275 2113 1394 11200 --
NM_207445chr1521923 677 1186 ----
NM_207481chr211365 --11143 --
NM_207660chr142571 197 21420 1138 ----
NM_207661chr142571 197 21420 1138 ----
NM_207662chr142571 197 21420 1138 ----
NM_212471chr171252 12245 ----
NM_212472chr171252 12245 ----
NM_213589chr251305 805 460 274 80 25005 763 1985 14487
NM_213618chr112710 254 ------
NM_213651chr121401 315 ------