TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5685
miRNA Sequence: ACAGCCCAGCAGUUAUCACGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1252420 2153 2049 539 39 --11734 1170
NM_000037chr852152 1903 1652 460 373 ----1145
NM_000084chrX46777 6297 6239 4438 ------
NM_000092chr253700 3459 3101 395 346 --11700 --
NM_000109chrX11877 --1365 11844
NM_000112chr524282 1861 13383 14031 13407
NM_000135chr161365 ------
NM_000138chr1531758 954 275 12499 --12677
NM_000161chr1421447 1415 1176 ----
NM_000165chr611294 ------
NM_000168chr723269 2325 ------
NM_000210chr2----1429 --
NM_000217chr1234680 3513 1738 ------
NM_000264chr932194 765 303 13204 ----
NM_000266chrX1278 ------
NM_000304chr171143 ------
NM_000314chr1022251 850 ------
NM_000319chr121227 198 --1491
NM_000332chr652515 2352 1996 822 378 15258 14877 16748
NM_000335chr352035 1954 1640 815 315 1554 11601 --
NM_000361chr2031886 1790 339 ------
NM_000368chr911052 11126 1397 --
NM_000399chr101301 1276 1908 --
NM_000408chr213024 --13070 --
NM_000428chr1422058 810 ------
NM_000430chr1722979 1188 --1237 --
NM_000448chr11----153 --
NM_000459chr9------1215
NM_000476chr951460 1441 1374 1201 427 ------
NM_000484chr211238 ------
NM_000489chrX2764 519 ------
NM_000533chrX11522 ------
NM_000542chr22767 333 ------
NM_000546chr172994 70 ------
NM_000555chrX67207 3120 2829 625 355 155 ----12835
NM_000598chr711532 --11250 --
NM_000599chr233590 3524 943 21607 1591 11736 --
NM_000611chr11106814 6212 5527 5246 4457 2058 1914 1860 635 302 --15662 --
NM_000618chr1225385 447 15223 11375 --
NM_000618chr1225385 447 15223 11375 --
NM_000634chr231123 354 104 1332 --1950
NM_000682chr251426 343 161 91 28 --11717 --
NM_000719chr1254737 4567 1131 1102 55 14744 22405 1197 --
NM_000721chr132674 2619 626 --12281 --
NM_000800chr51246 ------
NM_000813chr5----1159 --
NM_000831chr1136156 5705 4985 4684 1986 1743 1112 958 532 212 185 91 36 ----15959
NM_000845chr7----1434 --
NM_000859chr5140 ------
NM_000868chrX2868 434 ------
NM_000875chr1556529 4927 2597 2136 2051 ------
NM_000891chr1763546 3533 1176 1064 679 237 12925 2782 643 --
NM_000908chr5--160 ----
NM_000917chr101167 --1363 --
NM_000924chr1241077 905 482 150 ------
NM_000945chr221522 262 ------
NM_000963chr112147 --12420 --
NM_000964chr1731371 1324 1023 ----1213
NM_000966chr122254 33 1413 ----
NM_000983chr11367 ----21490 283
NM_000998chr2147 ------
NM_001001331chr321083 376 --1907 --
NM_001001396chr143518 2760 1320 1251 ------
NM_001001484chr1012404 ------
NM_001001502chr52211 72 ------
NM_001001520chr191125 ------
NM_001001522chr112395 283 ------
NM_001001549chr732347 1078 120 ------
NM_001001550chr732347 1078 120 ------
NM_001001555chr732347 1078 120 ------
NM_001001560chr223687 265 218 ------
NM_001001664chr233569 2497 650 ------
NM_001001740chr11114 ------
NM_001001740chr11114 ------
NM_001001787chr1----137 --
NM_001001852chr222772 736 ------
NM_001001890chr2153983 3947 3115 2993 1513 11149 ----
NM_001001924chr811817 ------
NM_001001925chr811817 ------
NM_001001931chr811817 ------
NM_001002026chr312344 12189 ----
NM_001002243chr21823 ------
NM_001002252chr12----181 --
NM_001002762chr1052171 2058 1068 859 46 12870 ----
NM_001002838chrX41818 1490 679 86 ------
NM_001002860chr1424217 610 11014 ----
NM_001002909chr171149 --21438 390 --
NM_001002914chr1721019 810 ------
NM_001003676chr112355 170 ------
NM_001003681chr2221303 305 ------
NM_001003688chr421187 448 ------
NM_001003698chr611378 ------
NM_001003699chr611378 ------
NM_001003792chr31470 ------
NM_001003793chr31470 ------
NM_001003794chr363004 2854 2694 2333 2045 573 ------
NM_001003800chr912529 --1941 --
NM_001004105chr5----124 --
NM_001004317chr644444 3352 2975 878 11096 11725 --
NM_001004360chr221716 227 ------
NM_001004419chr1224166 735 ------
NM_001005207chr17134 ------
NM_001005209chr22244 117 --2594 589 --
NM_001005266chr151605 ------
NM_001005267chr151605 ------
NM_001005268chr151605 ------
NM_001005269chr151605 ------
NM_001005290chr11101 ----1178
NM_001005367chr192407 144 1320 ----
NM_001005404chr1764346 4340 1801 1493 882 802 ----1651
NM_001005473chr555435 5144 4672 2646 116 --11998 --
NM_001005474chr31147 ------
NM_001005505chr34737 725 505 255 --11670 --
NM_001005609chrX83691 2941 1474 1005 642 590 404 42 ------
NM_001005743chr1411092 ------
NM_001005744chr1411092 ------
NM_001005745chr1411092 ------
NM_001005782chr21713 ------
NM_001006115chr341702 891 622 273 1521 32215 868 377 1589
NM_001006600chr51533 ------
NM_001006610chr161372 ------
NM_001006618chr9264 48 ------
NM_001006623chr21120 --22166 380 --
NM_001006624chr111973 ------
NM_001006932chr65844 504 491 456 48 13151 1781 --
NM_001006946chr221926 1220 ------
NM_001007024chr1723990 347 ----12992
NM_001007025chr1723990 347 ----12992
NM_001007097chr954973 4728 4208 1080 33 ------
NM_001007102chr611030 1575 ----
NM_001007156chr151190 ------
NM_001007237chr132121 1089 835 --22400 1845 --
NM_001007246chr2111779 ------
NM_001007257chr111328 ------
NM_001007277chr111753 ------
NM_001007466chr674652 3801 3770 3212 3176 1677 275 --14486 --
NM_001008220chr543521 2503 1227 775 --23210 1472 11342
NM_001008222chrX1448 --11235 --
NM_001008239chr1821521 337 ------
NM_001008392chr342783 2589 1380 225 ------
NM_001008401chr1911150 --11202 --
NM_001008540chr2------1458
NM_001008541chr1032262 1605 77 --12196 --
NM_001008541chr1032262 1605 77 --12196 --
NM_001008564chr1321818 723 ------
NM_001008701chr1972614 2134 2042 1932 836 778 24 12452 ----
NM_001008711chr821476 40 ------
NM_001008860chr152831 686 ------
NM_001008892chr152831 686 ------
NM_001008894chr152831 686 ------
NM_001008895chr1311262 ------
NM_001009554chr434205 416 44 1585 ----
NM_001009554chr434205 416 44 1585 ----
NM_001009899chr335902 2312 2067 --25597 170 --
NM_001009993chr224208 1635 1514 2523 186 --
NM_001010862chrX42330 1118 903 893 ------
NM_001010867chr185378 5231 4762 2577 727 382 291 249 --26449 193 --
NM_001010888chrX24409 2887 ------
NM_001010924chr1021075 947 ------
NM_001010926chr11244 --1560 --
NM_001010971chr12924 888 ------
NM_001010989chr161556 ------
NM_001010990chr161556 ------
NM_001011666chr722516 1889 ------
NM_001011708chr222976 843 11876 ----
NM_001012393chr1133645 183 87 14425 ----
NM_001012426chr643261 2283 2157 25 --11345 --
NM_001012427chr643261 2283 2157 25 --11345 --
NM_001012751chr1011356 11279 ----
NM_001013031chr1022829 2542 --12294 --
NM_001013398chr711532 --11250 --
NM_001013620chr1248095 5450 2917 760 --25961 2197 --
NM_001013635chr12243 33 ------
NM_001013690chr1232387 2252 97 1635 21984 281 --
NM_001013693chr162706 1163 1062 759 542 386 ------
NM_001013693chr162706 1163 1062 759 542 386 ------
NM_001013739chr71226 --1220 --
NM_001013839chr1741655 1041 859 779 --51906 1660 1624 733 81 --
NM_001013843chr151882 ------
NM_001014283chr1332130 1623 1398 --11594 --
NM_001014797chr1076815 6692 6605 5943 5134 2201 881 ----15064
NM_001014839chr13707 402 351 ------
NM_001014841chr13707 402 351 ------
NM_001014972chr21168 ------
NM_001015053chr1751144 1102 1054 632 26 11221 ----
NM_001015508chr81213 ------
NM_001015877chrX11963 ------
NM_001015887chr321207 310 1507 ----
NM_001017368chr17265 57 ------
NM_001017371chr21197 ------
NM_001017395chr372689 1244 1133 1107 876 860 405 --11238 --
NM_001017440chr756304 6224 468 203 162 --37715 6033 5110 --
NM_001017923chr1411623 ------
NM_001017926chr82551 381 ------
NM_001017962chr101167 --1363 --
NM_001018004chr15--1211 ----
NM_001018006chr15--1211 ----
NM_001018007chr15--1211 ----
NM_001018020chr15--1211 ----
NM_001018050chr2273204 2721 2682 2428 2120 807 538 11082 11018 --
NM_001018052chr2273204 2721 2682 2428 2120 807 538 11082 11018 --
NM_001018054chr1183 ----11050
NM_001018057chr1111139 ----180
NM_001018064chr921525 1363 151 ----
NM_001018065chr925536 540 1660 25796 5544 25065 1601
NM_001018066chr925536 540 1660 25796 5544 25065 1601
NM_001018108chr1542194 2080 818 316 1844 ----
NM_001023567chr1532239 2018 759 ------
NM_001023587chr32977 446 ------
NM_001024668chr123879 287 135 --1708 --
NM_001024688chr81657 ------
NM_001024809chr1731371 1324 1023 ----1213
NM_001024948chr133324 2447 920 ------
NM_001024959chr31881 --1108 --
NM_001024960chr31881 --1108 --
NM_001025076chr1035730 5130 4216 ------
NM_001025077chr1057088 6488 5574 1004 195 14916 ----
NM_001025079chr324001 614 ------
NM_001025108chr242952 2811 415 28 ------
NM_001025202chr71226 --1220 --
NM_001025203chr211117 ------
NM_001025204chr211117 ------
NM_001025205chr32331 184 ------
NM_001025580chrX21723 248 ------
NM_001025595chr411035 1254 ----
NM_001025778chr191257 ------
NM_001025780chr9127 ------
NM_001029858chr613151 ------
NM_001029863chr622743 2188 --12444 --
NM_001029875chr512959 ----11207
NM_001030006chr1732664 534 257 ------
NM_001030007chr1623431 455 ------
NM_001030272chr111451 ------
NM_001030273chr111451 ------
NM_001030287chr11461 ------
NM_001031677chr53456 72 51 ----1167
NM_001031679chr1222949 2394 ------
NM_001031690chr793024 2620 2561 2490 1081 935 797 499 268 11028 1262 --
NM_001031695chr2255259 4808 3362 1713 1702 14789 ----
NM_001031702chr32184 25 --4916 662 357 287 --
NM_001031711chr521837 453 ------
NM_001031716chr21106 ------
NM_001031717chr32893 114 --1246 --
NM_001031804chr1631463 1248 68 13129 ----
NM_001032279chr112368 79 ------
NM_001032282chr82148 103 ------
NM_001032289chrX1131 --1839 --
NM_001032296chr1332693 2107 615 --12287 --
NM_001033044chr121230 484 ------
NM_001033056chr121230 484 ------
NM_001033057chr321980 350 ------
NM_001033059chr62763 710 ------
NM_001034845chr421076 477 ------
NM_001034850chr521612 268 ------
NM_001035chr121026 953 ----1484
NM_001035511chr131813 277 180 11980 2321 289 --
NM_001035512chr131920 384 287 12087 2428 396 --
NM_001035513chr131920 384 287 12087 2428 396 --
NM_001037132chr721686 1400 ------
NM_001037133chr721686 1400 ------
NM_001037334chr18197 ------
NM_001037954chr1141316 1180 588 210 --1641 --
NM_001038707chr132286 496 155 ------
NM_001038707chr132286 496 155 ------
NM_001039350chr741512 671 653 489 ------
NM_001039465chr142173 129 --2139 134 --
NM_001039538chr22223 62 ----12952
NM_001039550chr2----1592 1848
NM_001039618chr1155653 5588 5106 2070 1799 --12267 --
NM_001039711chr13942 406 189 ------
NM_001039712chr13942 406 189 ------
NM_001039762chr1011890 ------
NM_001040057chr71492 ------
NM_001040102chr1011745 2141 47 ----
NM_001040103chr1011745 2141 47 ----
NM_001040142chr21476 ------
NM_001040143chr21476 ------
NM_001040153chr132723 51 ------
NM_001040202chr412590 1632 ----
NM_001040214chr62847 362 --11754 --
NM_001040402chr412539 --13004 --
NM_001040439chr1621284 993 21390 1056 ----
NM_001040446chr51246 ------
NM_001040458chr54637 429 236 172 1499 ----
NM_001040633chr721031 754 ------
NM_001040653chr3--12544 ----
NM_001040708chr821124 1056 --151 --
NM_001040712chr923262 3245 ------
NM_001040876chr41152 ------
NM_001042361chr10174 ------
NM_001042364chr10174 ------
NM_001042365chr10174 ------
NM_001042387chr10174 ------
NM_001042393chr10174 ------
NM_001042396chr10174 ------
NM_001042397chr10174 ------
NM_001042413chr91517 ------
NM_001042453chrX21591 1181 ------
NM_001042494chr1512599 ------
NM_001042495chr1512599 ------
NM_001042496chr1512599 ------
NM_001042497chr1512599 ------
NM_001042498chrX2268 106 --1976 --
NM_001042539chr162750 115 ------
NM_001042548chr22115 26 ------
NM_001042555chr1211031 ------
NM_001042599chr236492 6433 2702 17323 1234 --
NM_001042601chr34898 849 816 115 --1459 --
NM_001042603chr12104982 4093 3720 3577 3509 3451 3393 3335 1077 166 ------
NM_001042632chr203910 848 696 --1401 --
NM_001042633chr203910 848 696 --1401 --
NM_001042663chr131312 1149 269 11391 1377 --
NM_001042664chr131312 1149 269 11391 1377 --
NM_001042665chr131312 1149 269 11391 1377 --
NM_001042728chr122254 33 1413 ----
NM_001043318chr1453173 2698 258 136 39 1458 ----
NM_001043351chr12865 195 194 11439 --
NM_001044385chr222792 749 --12903 --
NM_001045478chr1134 --1369 --
NM_001049chr1431864 1551 986 ------
NM_001079874chr121515 797 ------
NM_001080418chr12192 154 ------
NM_001092chr1711611 11647 22305 567 --
NM_001095chr1241955 1566 1334 731 ------
NM_001100108chr186544 5884 2529 2142 1907 478 331 235 25457 2684 12952 26585 5058
NM_001106chr399032 8957 7997 7984 3701 3637 3320 3223 2945 12732 46634 3712 2291 1846 --
NM_001113490chrX63522 3445 3326 1439 1280 96 ------
NM_001116chr1632480 2073 263 --22878 637 --
NM_001121chr101694 ------
NM_001128chr1623431 455 ------
NM_001135chr153712 633 561 ------
NM_001146chr812124 ------
NM_001149chr1011294 ------
NM_001167chrX34992 4695 1945 ------
NM_001178chr111451 ------
NM_001200chr202928 265 1829 ----
NM_001204chr236242 5082 1254 ------
NM_001206chr932161 1112 275 ------
NM_001222chr10--1540 1305 --
NM_001257chr161345 ------
NM_001258chr172480 142 1133 1188 --
NM_001259chr736352 6294 1956 ------
NM_001265chr131256 1779 1830 1710
NM_001282chr1732664 534 257 ------
NM_001304chr1733206 2457 562 ------
NM_001329chr1021424 427 ------
NM_001331chr1131932 696 27 ------
NM_001346chr321880 625 ------
NM_001362chr143928 695 410 --136 --
NM_001364chr1111640 --12957 --
NM_001378chr21123 ------
NM_001383chr172307 201 ------
NM_001386chr821826 442 ------
NM_001387chr532755 593 429 12828 22967 750 --
NM_001390chr1833006 2769 2663 ------
NM_001396chr211482 ------
NM_001397chr162614 2583 2461 2394 2354 951 144 21700 251 21726 527
NM_001399chrX83691 2941 1474 1005 642 590 404 42 ------
NM_001407chr331415 533 526 21580 147 1298 --
NM_001408chr111180 ------
NM_001417chr1221948 1627 --11942 --
NM_001419chr1954249 3132 3094 1770 606 --11115 --
NM_001423chr1221985 608 ------
NM_001427chr72265 240 ------
NM_001430chr21739 ------
NM_001438chr123464 2786 ----12387
NM_001448chrX21754 327 ------
NM_001449chrX2947 832 ------
NM_001453chr611322 ------
NM_001454chr172712 101 --1918 --
NM_001458chr74757 290 280 179 ------
NM_001493chrX1156 ------
NM_001497chr952725 2400 2298 1713 638 11750 176 --
NM_001542chr132121 1089 835 --22400 1845 --
NM_001543chr574374 3151 1670 1352 1298 1066 141 21759 1184 24805 4397 11497
NM_001567chr113715 536 472 175 ----
NM_001610chr111767 --3689 103 46 --
NM_001614chr172449 38 --1517 --
NM_001614chr172449 38 --1517 --
NM_001634chr62763 710 ------
NM_001659chr1242324 1695 764 290 ------
NM_001662chr71279 ------
NM_001663chr1422108 1686 ------
NM_001668chr122205 845 ------
NM_001674chr11461 ------
NM_001678chr171237 11147 ----
NM_001679chr32511 126 ------
NM_001681chr121174 ------
NM_001683chr321083 376 --1907 --
NM_001694chr161382 ------
NM_001706chr31134 ------
NM_001718chr611325 ------
NM_001722chr82579 560 ------
NM_001740chr162506 169 ------
NM_001742chr7--11706 ----
NM_001754chr2153983 3947 3115 2993 1513 11149 ----
NM_001759chr1274616 4142 3753 3263 3241 1079 682 22124 1618 ----
NM_001773chr111088 11439 --11255
NM_001777chr324001 614 ------
NM_001789chr341438 1222 1114 675 ------
NM_001798chr124868 265 75 53 ------
NM_001895chr201407 ------
NM_001936chr741512 671 653 489 ------
NM_001938chr1----1446 --
NM_001939chrX73781 3275 2821 2621 1269 711 127 --23153 2347 --
NM_001944chr182155 90 ------
NM_001946chr121879 --2988 74 --
NM_001949chr642428 2335 1310 1141 --1352 --
NM_001954chr61695 --1145 --
NM_001955chr61829 ------
NM_001962chr52413 100 ------
NM_001965chr21424 --123 --
NM_001977chr41527 --11475 --
NM_001987chr1233784 1693 196 190 ----
NM_001995chr41303 ------
NM_002010chr132201 66 ------
NM_002017chr1111077 --11009 --
NM_002025chrX37672 7476 1572 ------
NM_002028chr1431298 439 162 --11203 --
NM_002039chr41311 ------
NM_002048chr93905 424 393 ------
NM_002063chrX3341 204 132 ------
NM_002065chr121230 484 ------
NM_002069chr721801 232 ----11526
NM_002076chr1273114 2925 2692 2643 1303 1111 924 --1114 --
NM_002077chr9181 ----135
NM_002092chr424617 131 --15056 --
NM_002106chr41239 ------
NM_002129chr41319 ------
NM_002130chr511616 ------
NM_002134chr162581 112 ------
NM_002137chr721652 24 ------
NM_002140chr91218 ------
NM_002193chr2154 11355 1117 195
NM_002196chr201427 ------
NM_002196chr201427 ------
NM_002198chr51187 ------
NM_002205chr121889 ------
NM_002247chr101402 ------
NM_002249chr12411 389 ------
NM_002252chr2176 ------
NM_002253chr421077 284 1426 ----
NM_002264chr323889 929 13487 ----
NM_002265chr171389 ------
NM_002267chr1322434 657 ------
NM_002285chr242952 2811 415 28 ------
NM_002309chr2282843 2586 2298 2275 2126 1983 876 115 --3262 167 162 --
NM_002355chr12--1417 ----
NM_002356chr612832 ------
NM_002359chr1774088 3912 3781 1271 578 482 416 1162 21658 1313 11458
NM_002373chr1531216 865 156 21113 80 1137 --
NM_002374chr22223 62 ----12952
NM_002387chr533814 716 391 ------
NM_002390chr1741691 1378 612 153 21621 424 12021 --
NM_002399chr15------1510
NM_002419chr111472 ------
NM_002436chrX183 1178 ----
NM_002442chr1231616 1462 636 ------
NM_002445chr841613 1074 360 290 ------
NM_002480chr121486 ------
NM_002485chr81657 ------
NM_002499chr1582376 1540 1002 831 809 802 533 148 ------
NM_002501chr1934004 1424 680 12667 ----
NM_002509chr201647 1241 ----
NM_002524chr11258 ------
NM_002537chr153349 326 127 ------
NM_002538chr51424 ----1186
NM_002545chr1133645 183 87 14425 ----
NM_002569chr1531019 400 87 --11460 --
NM_002581chr934412 3948 2098 11641 14378 --
NM_002586chr631123 659 382 --11265 --
NM_002595chr1211852 ------
NM_002601chr2135 ------
NM_002609chr541751 1642 1611 165 ------
NM_002636chr61120 ------
NM_002646chr131732 629 619 --2311 205 --
NM_002648chr631216 1014 529 ------
NM_002655chr824715 4459 ------
NM_002657chr2021535 104 12935 11099 --
NM_002660chr2031144 1136 66 --1736 --
NM_002698chr1911157 12070 32632 855 94 --
NM_002713chr121168 436 1163 ----
NM_002714chr631052 1033 143 ------
NM_002715chr521008 909 ------
NM_002730chr1931077 72 25 --1516 --
NM_002731chr1----1246 --
NM_002732chr93138 69 25 --1478 --
NM_002737chr1756240 5424 5013 4237 2422 ----25067 1747
NM_002745chr2244389 4059 3489 1585 ------
NM_002753chr4----1121 --
NM_002756chr173871 679 128 --1955 --
NM_002758chr172470 46 ------
NM_002824chr122431 24 ------
NM_002837chr1234337 3841 2842 1698 ----
NM_002839chr923262 3245 ------
NM_002840chr141504 536 426 310 ------
NM_002843chr1193216 3055 2812 2661 2563 2441 502 183 173 --12205 1377
NM_002855chr1133018 1074 745 ----23700 2397
NM_002858chr121048 275 ------
NM_002868chr1232281 789 123 ------
NM_002869chr11--11948 ----
NM_002874chr921001 81 ------
NM_002876chr17130 ------
NM_002881chr241419 387 195 48 --153 --
NM_002885chr1----3252 169 125 1669
NM_002895chr202729 107 ------
NM_002906chr111369 ------
NM_002918chr191862 --1174 --
NM_002940chr41152 ------
NM_002941chr31164 ------
NM_002955chr611378 ------
NM_002959chr174436 3623 3270 2882 1743 427 275 ------
NM_002977chr233207 2704 1327 ------
NM_002994chr421385 1240 ------
NM_002997chr221926 1220 ------
NM_003001chr131920 384 287 12087 2428 396 --
NM_003011chr941070 556 537 400 ------
NM_003028chr943787 2767 779 168 ----1882
NM_003029chr141005 377 135 94 --1569 --
NM_003030chr31252 ------
NM_003031chr161372 ------
NM_003047chr151187 1073 916 234 60 1565 ----
NM_003048chr21883 ------
NM_003070chr9----195 --
NM_003071chr321620 470 11476 ----
NM_003076chr1221287 551 --1589 --
NM_003077chr173640 311 208 ------
NM_003085chr52211 72 ------
NM_003108chr256591 2796 2695 1900 48 17244 11952 --
NM_003110chr171722 ----11082
NM_003111chr21197 ------
NM_003113chr22769 226 ------
NM_003131chr641761 919 354 243 --1626 --
NM_003137chr651807 893 473 219 149 ------
NM_003145chr11442 ------
NM_003150chr1722005 1993 --22235 1718 --
NM_003161chr1723422 1211 ------
NM_003173chrX2524 149 1533 1212 --
NM_003178chr31236 --11736 --
NM_003183chr22583 285 ------
NM_003186chr112395 283 ------
NM_003189chr152412 821 349 164 60 ------
NM_003199chr1835463 3427 1350 ------
NM_003200chr1932002 1635 958 --21791 1480 1313
NM_003202chr541909 1700 1387 1208 ----1548
NM_003203chr221747 886 --12154 --
NM_003204chr1741491 1371 1105 55 ------
NM_003215chr421129 452 ------
NM_003221chr631655 1350 1044 --12547 --
NM_003234chr341866 1663 522 341 12336 ----
NM_003239chr143832 327 207 ------
NM_003255chr173945 349 264 ------
NM_003281chr194973 4278 3615 1981 1818 890 467 458 218 11617 33714 1771 1763 1769
NM_003286chr201720 ------
NM_003291chr13----1272 --
NM_003317chr142320 201 ------
NM_003336chrX1212 ------
NM_003341chr31271 ------
NM_003342chr1732407 2085 927 --23054 138 --
NM_003345chr161115 --1441 --
NM_003348chr1231508 1099 398 ------
NM_003352chr21713 ------
NM_003387chr231897 1074 848 ------
NM_003392chr334304 3493 527 --11599 11692
NM_003410chrX22248 593 ------
NM_003418chr31309 ------
NM_003427chr61632 ------
NM_003442chr11----1813 --
NM_003463chr632447 1014 172 ------
NM_003467chr2------1458
NM_003468chr212798 --23776 3167 --
NM_003470chr1621835 1783 --21828 320 --
NM_003482chr1261948 1853 1788 1034 111 105 --32437 2089 564 --
NM_003483chr121361 ------
NM_003488chr172181 50 ------
NM_003489chr2112292 ------
NM_003507chr21537 --11394 --
NM_003535chr6121 ------
NM_003559chr1773004 1280 1254 758 346 336 82 ------
NM_003566chr1253256 2465 705 515 186 ------
NM_003569chr61141 --1476 --
NM_003576chr1332693 2107 615 --12287 --
NM_003583chr1213651 11090 --162
NM_003589chr1311262 ------
NM_003590chr221515 605 ------
NM_003592chr71467 ------
NM_003607chr172887 2809 1185 1136 1089 390 110 ------
NM_003615chr311394 ------
NM_003629chr142694 2266 2157 327 --12248 --
NM_003633chr522391 2131 --42317 1815 842 496 --
NM_003644chr1786066 4788 4569 1814 1501 1072 1015 45 --1938 15537
NM_003666chr11149 --1176 --
NM_003671chr922888 2581 11271 23565 2870 --
NM_003713chr111152 11104 ----
NM_003737chr111368 ------
NM_003743chr2----12207 --
NM_003744chr1411092 ------
NM_003745chr161325 --199 --
NM_003769chr12----1270 --
NM_003779chr13466 162 48 ------
NM_003800chr621575 523 ------
NM_003818chr203352 234 148 ------
NM_003819chr11237 ------
NM_003822chr122525 688 ------
NM_003872chr242782 1202 234 50 ------
NM_003883chr51382 --156 --
NM_003885chr1711704 12333 ----
NM_003893chr101358 --1185 --
NM_003924chr42334 293 ------
NM_003930chr711862 ----11877
NM_003947chr341092 1074 182 112 ------
NM_003958chr633779 1221 492 ------
NM_003983chr1693974 1756 1703 1556 1407 919 619 381 332 1945 ----
NM_004006chrX11877 --1365 11844
NM_004007chrX11877 --1365 11844
NM_004009chrX11877 --1365 11844
NM_004010chrX11877 --1365 11844
NM_004011chrX11877 --1365 11844
NM_004012chrX11877 --1365 11844
NM_004013chrX11877 --1365 11844
NM_004014chrX11877 --1365 11844
NM_004015chrX11877 --1365 11844
NM_004016chrX11791 --1279 11758
NM_004017chrX11877 --1365 11844
NM_004018chrX11791 --1279 11758
NM_004020chrX11877 --1365 11844
NM_004021chrX11791 --1279 11758
NM_004022chrX11791 --1279 11758
NM_004023chrX11791 --1279 11758
NM_004050chr1441795 815 795 247 --2504 454 --
NM_004068chr32331 184 ------
NM_004093chr1342321 744 732 345 ------
NM_004100chr632704 875 224 ------
NM_004112chr1711452 1156 ----
NM_004114chrX11085 ------
NM_004119chr131632 ------
NM_004124chr14----1664 --
NM_004152chr19191 ------
NM_004157chr32862 705 --1753 --
NM_004165chr16144 --152 --
NM_004171chr1179265 8523 7681 5824 2289 2131 1490 --18374 --
NM_004180chr2149 ------
NM_004186chr31925 ----1144
NM_004187chrX31028 925 297 1906 1272 --
NM_004200chr1132826 2335 646 1684 1756 1745
NM_004225chr8--1564 --11299
NM_004229chrX12185 ------
NM_004232chr181175 ------
NM_004242chr6--124 ----
NM_004263chr231795 1678 165 ------
NM_004295chr172921 215 --1532 --
NM_004302chr1221155 172 ------
NM_004311chr1032400 1186 329 ----12604
NM_004319chr11636 --164 --
NM_004321chr222749 1012 13207 --22415 955
NM_004323chr932001 545 92 --2538 302 --
NM_004326chr12394 125 --1487 --
NM_004329chr101254 ------
NM_004331chr8----11061 --
NM_004342chr721661 102 ------
NM_004380chr1612189 ------
NM_004392chr131550 ------
NM_004393chr341944 1763 755 729 --12254 --
NM_004395chr52709 322 ------
NM_004397chr1173935 3178 3167 2949 1016 873 84 --13153 1770
NM_004411chr71250 ------
NM_004417chr53527 135 96 ------
NM_004418chr23581 106 64 ------
NM_004420chr1141920 1763 824 637 22044 667 12351 --
NM_004422chr172378 89 ------
NM_004423chr342758 2648 2125 828 ------
NM_004427chr121180 351 1886 ----
NM_004430chr821967 194 --1601 --
NM_004432chr91644 --1541 --
NM_004433chr12674 445 ----1591
NM_004437chr121393 1215 ------
NM_004440chr611631 --11447 --
NM_004441chr321338 837 --1315 --
NM_004450chr14235 26 ------
NM_004451chr113624 282 67 ------
NM_004459chr1741934 1778 1632 660 ------
NM_004463chrX2176 145 ------
NM_004486chr931117 972 40 1772 --1489
NM_004494chr121247 425 --1375 --
NM_004501chr143689 3095 1526 648 ----1141
NM_004516chr191101 ------
NM_004535chr2021488 713 ------
NM_004537chr121400 1973 ----
NM_004560chr93719 263 118 ------
NM_004566chr1032410 2094 249 ----1539
NM_004588chr1143280 2872 2472 577 1786 13481 --
NM_004598chr511297 ------
NM_004602chr202263 178 11134 ----
NM_004612chr9152 ------
NM_004630chr1121136 209 --1146 --
NM_004631chr1183 ----11050
NM_004637chr311123 ----11321
NM_004650chrX21286 569 ------
NM_004689chr141438 ------
NM_004690chr6--1559 ----
NM_004703chr1732107 2034 37 ------
NM_004709chrX----1395 --
NM_004723chr11400 --1891 --
NM_004734chr1331001 749 606 ------
NM_004736chr11576 ------
NM_004737chr2221070 877 --11279 --
NM_004739chr111141 ----128
NM_004742chr341756 1515 1441 1380 11425 ----
NM_004747chr1031497 1188 475 ------
NM_004756chr193465 281 92 --11373 --
NM_004758chr174996 922 195 43 ------
NM_004762chr1741497 542 478 217 ------
NM_004774chr1732226 2088 399 ------
NM_004783chr164643 593 556 156 ------
NM_004796chr143892 884 609 ------
NM_004798chr2033494 3289 2658 ------
NM_004801chr211344 ------
NM_004807chr242344 2030 875 160 12187 ----
NM_004808chr1023122 2167 ------
NM_004822chr1773938 3180 2487 1502 993 798 335 ------
NM_004834chr253203 2652 1261 634 136 ------
NM_004840chrX22317 1761 --1402 --
NM_004859chr1722040 241 ------
NM_004866chr544525 4032 1260 133 ------
NM_004871chr1723990 347 ----12992
NM_004879chr111631 ------
NM_004884chr1521730 1704 --1137 1234
NM_004897chr102151 139 ------
NM_004902chr201763 ------
NM_004904chr722516 1889 ------
NM_004906chr61435 ------
NM_004921chr1----1252 --
NM_004922chr103867 805 152 ------
NM_004924chr191141 --1175 1956
NM_004926chr141716 ------
NM_004937chr1722106 104 1365 ----
NM_004947chr362039 1808 1009 579 241 198 ------
NM_004956chr723700 3320 ------
NM_004976chr1144150 3257 3226 547 14352 34032 3481 1654 1715
NM_004979chrX2319 231 --3892 841 836 1913
NM_004985chr1224129 460 ------
NM_004992chrX127949 7583 7027 6929 6458 6030 5391 2750 1950 1939 1430 1136 ------
NM_004992chrX127949 7583 7027 6929 6458 6030 5391 2750 1950 1939 1430 1136 ------
NM_004998chr152627 620 --2632 163 --
NM_005010chr721686 1400 ------
NM_005027chr1911071 --1394 --
NM_005056chr12105226 4337 3964 3821 3753 3695 3637 3579 1321 410 ------
NM_005063chr1033205 3121 3094 ------
NM_005065chr1445265 5101 4516 590 ------
NM_005066chr11677 ------
NM_005067chr31188 ------
NM_005078chr1541268 1212 126 21 --11422 --
NM_005096chrX3877 343 218 ----1868
NM_005102chr22115 26 ------
NM_005109chr322380 643 --12027 --
NM_005113chr141326 ------
NM_005116chr2024413 334 --11345 --
NM_005120chrX2168 76 ------
NM_005121chr1723253 594 ------
NM_005133chr112368 79 ------
NM_005135chr1512599 ------
NM_005151chr18197 ------
NM_005156chr953499 3399 1503 1349 1123 ------
NM_005168chr21333 ------
NM_005197chr1424141 461 --12461 --
NM_005202chr161844 1570 915 730 227 183 --1920 --
NM_005207chr2232742 2557 910 --11200 --
NM_005219chr531432 452 360 ------
NM_005220chr1731350 1333 1079 ------
NM_005229chrX31179 1133 1116 ------
NM_005234chr192354 306 ------
NM_005235chr236492 6433 2702 17323 1234 --
NM_005238chr1112987 ------
NM_005249chr141136 ------
NM_005254chr151950 ------
NM_005270chr231514 386 114 11190 ----
NM_005273chr74290 237 76 68 ------
NM_005311chr732347 1078 120 ------
NM_005312chr922425 2106 --21931 1796 --
NM_005313chr15--1256 11271 --
NM_005324chr1741600 1346 409 370 ------
NM_005328chr83312 140 57 ------
NM_005329chr1652101 1550 774 282 211 ------
NM_005339chr414164 --14195 --
NM_005359chr1846318 6052 6033 5509 1120 26283 5156 16039
NM_005374chr1742213 2207 942 763 1794 42218 2015 950 466 --
NM_005376chr13737 167 139 ------
NM_005381chr22359 297 ------
NM_005388chr91666 1595 141 --
NM_005392chr911164 --1647 --
NM_005399chr184419 3761 3490 3409 3219 482 417 277 ------
NM_005458chr931506 924 595 ------
NM_005474chr1751144 1102 1054 632 26 11221 ----
NM_005477chr1542004 1815 428 298 --12121 --
NM_005477chr1542004 1815 428 298 --12121 --
NM_005479chr1051527 1149 1009 424 63 2574 170 11078 --
NM_005487chr2221303 305 ------
NM_005497chr1735018 1847 154 ----1160
NM_005502chr93832 347 294 ------
NM_005513chr321364 343 11042 11557 --
NM_005520chr5180 ------
NM_005529chr12988 668 --2394 135 --
NM_005539chr101413 --11013 --
NM_005542chr731234 463 256 1111 ----
NM_005544chr21341 ------
NM_005561chr133788 197 54 ------
NM_005578chr323737 3366 ------
NM_005585chr151374 ------
NM_005596chr914796 16020 36281 2212 2137 --
NM_005599chr12303 205 ------
NM_005603chr1811280 --21636 147 --
NM_005627chr61843 --1331 --
NM_005631chr731045 402 354 ----2422 114
NM_005650chr2211053 ------
NM_005655chr82148 103 ------
NM_005656chr2131166 484 51 ------
NM_005665chr124070 1371 --1706 13885
NM_005668chr5186 ------
NM_005704chr131077 894 134 1832 ----
NM_005718chr31881 --1108 --
NM_005719chr121169 ------
NM_005721chr21243 ------
NM_005730chr1243656 3512 2753 877 ----11188
NM_005737chr222714 540 --12198 --
NM_005742chr21323 --1628 --
NM_005748chr1223421 2585 --13314 12716
NM_005749chr171292 ------
NM_005779chr523349 1456 --22597 416 --
NM_005780chr131365 ------
NM_005808chr342783 2589 1380 225 ------
NM_005822chr612137 ------
NM_005826chr11205 ----1128
NM_005828chr1723680 754 1217 23810 1182 14466
NM_005839chr11615 ------
NM_005840chrX27430 2659 15627 12121 --
NM_005868chr712381 ------
NM_005880chr162487 471 ------
NM_005900chr421187 448 ------
NM_005911chr221260 177 ------
NM_005920chr132765 485 472 1787 ----
NM_005933chr1152237 775 589 427 310 ------
NM_005934chr1972221 2180 1062 684 340 239 203 11880 ----
NM_005935chr434747 4644 3627 ------
NM_005938chrX21334 918 --1470 --
NM_005941chr823119 143 1122 ----
NM_005943chr621133 261 ------
NM_005955chr123485 922 1658 11030 --
NM_005962chr1032262 1605 77 --12196 --
NM_005962chr1032262 1605 77 --12196 --
NM_005964chr1731372 1330 334 --1568 --
NM_005967chr121649 --1620 --
NM_005969chr1111041 1853 1939 --
NM_005986chr1341069 627 580 218 --1509 --
NM_006007chr943809 3438 1515 1022 --11082 --
NM_006009chr121185 ------
NM_006011chr1541471 1448 913 363 --12945 --
NM_006015chr111092 ------
NM_006016chr622111 1405 ------
NM_006022chr131380 ------
NM_006030chr34737 725 505 255 --11670 --
NM_006036chr221769 1568 ------
NM_006038chr2031528 851 682 --1135 --
NM_006095chr431352 1002 320 ------
NM_006106chr1142351 761 720 271 ------
NM_006108chr1122395 25 ------
NM_006113chr121515 797 ------
NM_006133chr1142071 2056 563 540 ------
NM_006136chr711358 --197 --
NM_006148chr1782880 2838 2412 2349 910 492 366 265 --22422 2417 12428
NM_006158chr8------11699
NM_006176chr112744 519 --1794 --
NM_006180chr921525 1363 151 ----
NM_006195chr911041 ------
NM_006201chrX41173 1163 1001 978 ------
NM_006203chr523532 3463 ----24584 4047
NM_006212chr174977 4881 4136 3997 1908 1015 904 35194 5151 303 --15209
NM_006239chr4----1158 --
NM_006245chr6--2899 738 11001 --
NM_006251chr52423 106 ------
NM_006257chr10173 ------
NM_006265chr8----1195 --
NM_006306chrX45685 5403 833 663 11888 11230 --
NM_006310chr172394 118 ------
NM_006311chr17--1245 ----
NM_006320chr421061 81 ------
NM_006345chr41852 ------
NM_006369chr12368 299 154 165 --
NM_006372chr61469 ------
NM_006375chrX11488 ----11849
NM_006380chr1741707 1407 1240 87 ------
NM_006389chr1141159 1052 86 74 ----1920
NM_006390chr1231127 587 88 ------
NM_006393chr1013168 ----1168
NM_006403chr611650 --1702 --
NM_006420chr201444 ------
NM_006449chr241608 885 510 104 1324 ----
NM_006451chr5----1748 --
NM_006454chr442596 2362 884 582 --2789 136 --
NM_006459chr10--11822 --1768
NM_006469chr131379 390 164 ------
NM_006472chr12974 232 ----11273
NM_006474chr111973 ------
NM_006480chr51473 ------
NM_006482chr1213651 11090 --162
NM_006496chr121857 1291 ------
NM_006526chr2031875 1790 1335 --1354 --
NM_006532chr1941924 1819 1716 216 ------
NM_006544chr1426093 4391 ------
NM_006548chr31443 ------
NM_006549chr1242530 1923 518 52 ------
NM_006561chr1035730 5130 4216 ------
NM_006565chr16--11245 139 --
NM_006575chr143994 530 110 ------
NM_006593chr21741 ------
NM_006599chr1687713 6369 5723 3083 2691 2259 1256 676 ------
NM_006601chr12--2804 169 ----
NM_006609chr212348 1457 ----
NM_006614chr343393 2656 1084 355 ------
NM_006624chr10--1534 ----
NM_006650chr543521 2503 1227 775 --23210 1472 11342
NM_006653chr6197 ------
NM_006654chr1211031 ------
NM_006690chr203635 535 181 --11891 --
NM_006699chr11751 ------
NM_006703chr61206 ------
NM_006717chr932957 2370 2070 12246 ----
NM_006726chr42376 202 ------
NM_006732chr1932092 1882 852 11731 1404 --
NM_006734chr631530 1182 1098 ------
NM_006736chr241399 1390 663 375 1189 21602 301 11858
NM_006754chr71119 ------
NM_006756chr821060 116 ------
NM_006758chr211117 ------
NM_006763chr11672 --11394 11824
NM_006766chr82191 175 ------
NM_006775chr622986 2944 ------
NM_006795chr1131367 1320 508 ------
NM_006805chr541736 1616 1235 377 ------
NM_006807chr17141 ------
NM_006815chr1211038 ------
NM_006823chr8--1373 ----
NM_006827chr1442577 2459 369 305 --11256 --
NM_006852chr1752754 2488 990 772 390 ------
NM_006861chr1252003 1628 1471 801 475 11637 ----
NM_006868chr1832851 2735 1130 --23064 1963 --
NM_006874chr41349 ------
NM_006884chr31252 ------
NM_006885chr1612884 --33456 3094 149 13246
NM_006888chr1452770 2212 1217 993 402 --1301 --
NM_006896chr71778 ------
NM_006901chr152423 62 ------
NM_006912chr12552 245 ------
NM_006920chr221857 313 ------
NM_006924chr1724181 105 ------
NM_006925chr142173 129 --2139 134 --
NM_006965chr18--1995 ----
NM_006981chr92404 204 --11194 --
NM_006988chr212382 51 ------
NM_007011chr1556591 6139 5969 2742 2334 --1927 1915
NM_007040chr1921125 120 ------
NM_007042chr362538 2209 844 764 591 161 ------
NM_007050chr2076590 6019 2639 2588 2336 1471 81 --25374 1826 27204 801
NM_007067chr172572 511 --11398 --
NM_007078chr1032005 782 488 --1835 --
NM_007124chr611437 --11514 --
NM_007129chr131740 ------
NM_007136chr3128 ------
NM_007144chr1731219 1201 898 ------
NM_007172chr224750 480 435 342 --1592 --
NM_007182chr32729 235 ------
NM_007185chr12297 104 ------
NM_007222chr82551 381 ------
NM_007249chr1387529 6341 6304 2154 2093 1665 1635 930 168 18747 --
NM_007283chr363004 2854 2694 2333 2045 573 ------
NM_007284chr35351 156 115 81 41 ------
NM_007285chr161334 ------
NM_007345chr1831936 1881 698 ------
NM_007350chr1224283 1393 11434 ----
NM_007358chr111425 ------
NM_007372chr17176 --181 --
NM_007375chr112030 --12000 --
NM_012069chrX32420 2382 1006 ------
NM_012074chr142880 763 --1401 --
NM_012090chr121033 323 ------
NM_012095chr1023458 2966 ------
NM_012111chr142165 139 ------
NM_012156chr2021212 219 11123 21105 640 --
NM_012164chr972917 2299 2061 1845 1396 274 44 --11529 --
NM_012175chr112171 133 ------
NM_012180chr41647 ------
NM_012193chr1165174 4962 4407 4378 4019 468 ------
NM_012197chr921351 594 --21161 1102 --
NM_012199chr133364 552 393 13343 24104 3156 --
NM_012207chr101926 ----1288
NM_012215chr1041436 445 268 222 ------
NM_012232chr1732170 1759 314 ------
NM_012249chr233355 2970 2447 ------
NM_012259chr611171 ------
NM_012262chr131335 782 410 ----14987
NM_012287chr311327 ----1759
NM_012290chr221182 1173 ------
NM_012296chr1143699 3347 411 339 --11409 --
NM_012300chr511700 --1871 1898
NM_012308chr1132345 2294 2173 21866 706 ----
NM_012316chr165368 4303 1671 964 235 207 ------
NM_012329chr17------11334
NM_012330chr1011409 ------
NM_012333chr121649 1109 ------
NM_012384chr2052008 1881 1852 87 38 --11846 --
NM_012414chr11583 ------
NM_012429chr2231380 1188 1107 --1106 --
NM_012482chr1------2578 513
NM_013227chr153712 633 561 ------
NM_013231chr142658 270 14303 ----
NM_013236chr221399 ------
NM_013247chr24539 383 223 139 ------
NM_013253chr1111139 ----180
NM_013260chr171981 1353 ----
NM_013264chr11159 ------
NM_013269chr1224093 662 ------
NM_013279chr1132088 1692 298 11593 1671 --
NM_013281chr20136 ------
NM_013286chr32918 106 11507 1529 --
NM_013300chr12151 ------
NM_013341chr222976 843 11876 ----
NM_013352chr61341 ------
NM_013365chr223687 265 218 ------
NM_013382chr1442246 2220 2064 1813 --2785 234 12167
NM_013411chr142299 1982 374 116 --12637 --
NM_013449chr1222207 2196 ------
NM_013952chr242215 2065 1632 684 --12596 1678
NM_013953chr242215 2065 1632 684 --12596 1678
NM_013992chr242215 2065 1632 684 --12596 1678
NM_013993chr61695 --1145 --
NM_013994chr61695 --1145 --
NM_013995chrX31786 1708 549 ------
NM_014023chr1041948 1809 874 419 ------
NM_014043chr331332 1257 369 ------
NM_014079chr34415 342 228 207 ------
NM_014089chr1321818 723 ------
NM_014110chr121168 436 1163 ----
NM_014112chr834414 2063 947 ------
NM_014154chr31102 ------
NM_014155chr1122351 1340 --1164 --
NM_014157chr1653402 3196 968 581 331 1507 ----
NM_014181chr222592 1870 ------
NM_014216chr1431345 1220 406 --21450 615 --
NM_014240chr353812 3489 3351 3011 48 --11636 --
NM_014250chr2221303 305 ------
NM_014253chrX21988 614 ------
NM_014267chr111154 ------
NM_014271chrX1327 ------
NM_014284chr13707 402 351 ------
NM_014293chr2231211 1155 710 23095 1347 1809 --
NM_014309chr2255249 4798 3352 1703 1692 14779 ----
NM_014310chr2241958 1343 1306 293 ------
NM_014319chr1221402 520 ------
NM_014331chr447588 7144 6192 366 --15663 --
NM_014335chr15167 ------
NM_014351chr2221339 1161 ------
NM_014360chr142638 349 ------
NM_014405chr1741722 687 447 185 --22351 143 --
NM_014415chr31161 --1116 --
NM_014423chr524936 2175 ------
NM_014426chr201247 ------
NM_014445chr322428 2271 --12349 --
NM_014447chr411034 1254 ----
NM_014494chr16------1371
NM_014497chr21168 ------
NM_014564chr94349 199 111 66 1164 ----
NM_014571chr112073 1806 12313 --
NM_014577chr221905 ------
NM_014591chr1031318 1042 115 1529 ----
NM_014606chr4----1109 --
NM_014607chr2------1145
NM_014612chr911477 ------
NM_014613chr54988 803 676 637 ------
NM_014614chr221057 441 ----11266
NM_014634chr2263510 3268 2810 982 632 473 --23334 2969 --
NM_014636chr93439 423 312 --34130 1508 817 --
NM_014647chr1632185 738 65 ------
NM_014655chr142106 1697 381 225 ------
NM_014661chr1083739 3703 2967 2940 1305 1130 373 25 --11370 --
NM_014663chr12848 54 1233 ----
NM_014665chr842668 1428 507 230 1398 22884 496 --
NM_014670chr22327 169 ------
NM_014671chr721402 382 1416 11226 --
NM_014682chr821504 450 ------
NM_014685chr161556 ------
NM_014690chr793024 2620 2561 2490 1081 935 797 499 268 11028 1262 --
NM_014701chr1542493 572 406 43 ------
NM_014705chr71518 ------
NM_014712chr162123 83 --1568 --
NM_014720chr10127 ----11759
NM_014726chr171314 11080 1251 --
NM_014730chr1285138 3942 3726 3608 2073 1870 1752 1739 --35199 4405 1598 --
NM_014730chr1285138 3942 3726 3608 2073 1870 1752 1739 --35199 4405 1598 --
NM_014739chr634052 3245 869 ------
NM_014742chr203594 406 141 --1228 --
NM_014743chr4----11030 12292
NM_014747chr194975 4704 4472 4221 2243 1526 1148 985 129 11008 15012 22021 256
NM_014751chr821453 324 ------
NM_014755chr222954 2607 13334 14214 --
NM_014766chr732544 1116 607 12779 ----
NM_014770chr121877 11053 21173 855 --
NM_014772chr1833626 3464 1400 1965 ----
NM_014774chr122926 2793 ------
NM_014779chr32751 453 ------
NM_014786chr112313 125 11021 --1250
NM_014798chr1761567 1254 1187 395 312 65 ------
NM_014810chr162789 1195 725 704 227 207 ------
NM_014820chr331924 1463 323 ------
NM_014826chr172887 2809 1185 1136 1089 390 110 ------
NM_014828chr142495 81 1293 22415 2171 --
NM_014830chr1233503 3352 1442 12492 ----
NM_014839chr111024 --11893 --
NM_014840chr1262452 1379 1316 1041 176 62 --1378 --
NM_014841chr61909 --11195 --
NM_014851chr1102273 2144 2039 1953 1789 1716 1002 595 544 93 1446 12281 --
NM_014864chr144377 3363 581 246 ------
NM_014872chr921849 79 1232 ----
NM_014873chr154748 4618 4296 4144 3539 ------
NM_014877chr1746833 6612 947 406 ------
NM_014893chrY31968 1750 408 ------
NM_014900chr2------1461
NM_014921chr1972614 2134 2042 1932 836 778 24 12452 ----
NM_014925chr121352 158 ----
NM_014934chr1333070 2901 1066 ------
NM_014935chr143433 2843 2387 334 11005 22580 163 --
NM_014939chr1821376 54 ------
NM_014950chr1421721 349 ------
NM_014952chr1561538 1446 1343 780 161 154 11350 ----
NM_014970chr1----154 --
NM_014974chr101375 --11295 --
NM_014978chr101684 --1323 --
NM_014982chr1435210 5189 4939 ------
NM_015008chr372689 1244 1133 1107 876 860 405 --11238 --
NM_015017chr11315 ------
NM_015020chr1653760 1516 478 198 43 1441 ----
NM_015023chr111604 ----1187
NM_015024chr81446 ------
NM_015025chr212591 ------
NM_015039chr144173 3354 1445 210 14139 11208 --
NM_015042chr1533594 3360 559 ------
NM_015045chr1022242 641 ------
NM_015049chr232433 440 111 ------
NM_015061chr92714 74 --140 --
NM_015071chr531960 690 392 --11156 --
NM_015075chrX52204 1935 527 398 104 --12114 --
NM_015080chr111312 1214 --1272
NM_015090chr153976 2347 1996 945 645 --15532 --
NM_015091chr142804 552 ------
NM_015092chr1614099 ----1509
NM_015094chr2274002 3729 3136 2935 1758 1691 1307 23295 685 21763 274 13181
NM_015100chr131958 1710 394 ------
NM_015107chrX42184 2111 1963 1943 ------
NM_015115chr412539 --13004 --
NM_015125chr192384 196 --1479 --
NM_015133chr1621284 993 21390 1056 ----
NM_015138chr1531811 242 232 --189 --
NM_015141chr332193 2089 57 ----2924 515
NM_015172chr111626 ------
NM_015180chr143835 795 129 ------
NM_015185chrX22538 2249 --12857 --
NM_015199chr32816 581 --1998 --
NM_015200chr422210 1026 ----12495
NM_015215chr122269 346 ------
NM_015219chr1741655 1041 859 779 --51906 1660 1624 733 81 --
NM_015225chr9--180 11078 --
NM_015229chr1711038 ------
NM_015245chr632715 2217 1966 --1808 --
NM_015246chr1662012 1449 1385 296 290 59 ----1277
NM_015250chr91831 ------
NM_015254chr862597 2214 1122 574 251 140 --22942 1141 --
NM_015263chr151352 ------
NM_015265chr21104 ------
NM_015270chr1262288 2228 1605 1462 822 237 1380 ----
NM_015271chr422766 623 ------
NM_015282chr242901 2884 2463 893 12473 ----
NM_015284chr151511 1445 553 529 460 ------
NM_015296chr132885 473 ------
NM_015299chr1444017 1525 577 263 --23633 3601 --
NM_015305chr1431791 669 527 ------
NM_015315chr543048 2324 1012 158 ------
NM_015326chr132767 716 316 ------
NM_015327chr131085 1001 328 2885 31 ----
NM_015328chr732534 2252 473 12267 --1229
NM_015332chr743407 2827 2553 657 --11414 --
NM_015335chr1221837 427 --11888 --
NM_015336chr121270 ------
NM_015344chr821468 600 ------
NM_015346chr1421547 416 11870 ----
NM_015349chr622854 468 --12169 --
NM_015365chrX21723 248 ------
NM_015374chr2251068 1002 390 363 328 ------
NM_015387chr21129 ------
NM_015404chr9296 90 --1249 --
NM_015416chr123879 287 135 --1708 --
NM_015457chr1111043 ------
NM_015462chr17------1247
NM_015470chr231186 146 29 --11044 --
NM_015475chr211023 ------
NM_015483chr71826 ------
NM_015493chr192283 191 1267 ----
NM_015509chr121652 ------
NM_015520chr332678 1741 1048 ------
NM_015525chr61840 ------
NM_015537chr951099 883 872 156 62 --11005 --
NM_015541chr321054 78 ------
NM_015542chr102873 352 ------
NM_015548chr61865 ------
NM_015549chr142560 78 ------
NM_015554chr1512717 --1174 1228
NM_015557chr172907 2772 2586 2286 1038 890 426 12314 43473 2421 1267 846 --
NM_015564chr51570 ----13086
NM_015567chr1311028 ------
NM_015568chr2062947 1713 947 408 272 108 ------
NM_015575chr243369 3330 2503 1444 1589 21319 1144 12916
NM_015576chr332592 2436 2338 155 12776 --
NM_015578chr191122 ------
NM_015584chr1721420 976 --11369 --
NM_015601chr101791 ------
NM_015605chr10174 ------
NM_015609chr182872 2746 2167 2118 960 782 225 66 --12737 --
NM_015630chr22994 931 ------
NM_015652chr101229 ------
NM_015678chr1321353 634 1625 ----
NM_015691chrX32252 2099 455 ------
NM_015702chr2------151
NM_015719chr191170 --1535 --
NM_015726chr131812 1399 33 --1350 --
NM_015866chr111328 ------
NM_015872chr141654 1605 1368 1131 ------
NM_015878chr821620 304 ------
NM_015881chr1111139 ----180
NM_015898chr1942323 1983 428 274 --1382 --
NM_015906chr1----11748 --
NM_015915chr141310 ------
NM_015993chr16--132 --1520
NM_015995chr1565050 4927 3765 1708 1321 548 --11388 14227
NM_016022chr14755 717 213 189 ------
NM_016025chr1621628 1441 ------
NM_016032chrX1448 --11235 --
NM_016061chr21382 --31467 657 309 --
NM_016073chr151960 ------
NM_016076chr113189 --12454 --
NM_016083chr612936 12499 --13407
NM_016132chr1573095 3041 2688 2278 2110 1048 184 ------
NM_016169chr1033188 1039 633 12968 32699 2368 650 --
NM_016203chr721031 754 ------
NM_016206chr347124 6248 1353 438 --12918 --
NM_016210chr321009 989 21243 121 ----
NM_016252chr21353 ------
NM_016255chr622272 71 ------
NM_016256chr161397 ------
NM_016257chr133095 1173 592 ------
NM_016260chr235451 2858 549 ------
NM_016272chr222762 238 --1943 --
NM_016287chr131597 808 606 ------
NM_016289chr232066 268 199 ------
NM_016320chr11----197 --
NM_016322chr941988 1250 1082 99 ------
NM_016337chr141181 ------
NM_016396chr151387 --11014 --
NM_016410chr91461 ------
NM_016440chr191257 ------
NM_016472chr1421005 27 ------
NM_016519chr41459 ------
NM_016522chr1121635 1204 ------
NM_016542chrX21591 1181 ------
NM_016577chr344449 4068 2900 651 1732 --11557
NM_016605chr522392 545 2889 383 ----
NM_016614chr6121 ------
NM_016621chr1144190 3974 452 332 13887 23798 2867 --
NM_016626chr1821134 719 1554 ----
NM_016631chr21------1714
NM_016654chr151950 ------
NM_016824chr101694 ------
NM_016830chr122195 69 ------
NM_016929chr644158 1277 844 252 ------
NM_016936chr1642131 2055 1588 663 ------
NM_016938chr111384 ------
NM_017415chr543372 1660 663 255 ------
NM_017423chr41743 --12206 --
NM_017450chr17----1102 --
NM_017452chr202263 178 11134 ----
NM_017453chr202263 178 11134 ----
NM_017454chr202263 178 11134 ----
NM_017456chr1741497 542 478 217 ------
NM_017522chr1183 ----11050
NM_017526chr11101 ------
NM_017530chr161125 ------
NM_017548chr32643 483 1330 ----
NM_017551chr1032052 970 859 1568 2524 511 --
NM_017590chr2251741 924 898 566 343 1789 1222 --
NM_017593chr42455 396 ------
NM_017602chrX----1647 --
NM_017626chr103337 242 221 11708 ----
NM_017628chr454125 1817 1677 1290 565 ------
NM_017633chr622695 319 ------
NM_017637chr948788 8623 8607 7358 15888 ----
NM_017643chr1732746 2456 760 ------
NM_017650chr734198 4063 1021 ------
NM_017657chr21823 ------
NM_017660chr1972732 2418 1367 1118 308 243 189 12160 ----
NM_017694chr222015 717 ------
NM_017709chr123918 1534 1304 ----
NM_017730chr31218 ------
NM_017736chr16127 ------
NM_017737chr112033 ------
NM_017739chr13404 100 27 --1379 --
NM_017744chr142406 2090 273 91 1283 ----
NM_017752chrX1167 ----1689
NM_017758chr172326 312 1164 11076 --
NM_017769chr1422671 2016 ------
NM_017772chr61254 ------
NM_017778chr8------1976
NM_017786chr8--1496 145 --
NM_017798chr2011231 1101 ----
NM_017824chr1032131 1940 260 ------
NM_017848chrX11240 13717 11305 --
NM_017893chr1031438 385 142 --1513 --
NM_017902chr10105698 5598 5435 4929 4244 4167 4123 3796 2275 1432 --1484 --
NM_017919chr935663 925 327 --13912 1205
NM_017953chr12470 375 --168 --
NM_017993chr13185 ------
NM_017994chr722862 111 1362 ----
NM_017998chr9--1914 --11290
NM_018010chr321601 36 ------
NM_018026chr1111431 ------
NM_018028chr1921134 982 --195 --
NM_018032chr163164 118 94 --1198 --
NM_018043chr1121386 107 ------
NM_018050chr121223 ------
NM_018063chr102341 65 ------
NM_018077chr7160 --133 --
NM_018084chr222066 837 ------
NM_018086chr211806 --11382 11699
NM_018110chr1661089 198 167 87 53 38 ------
NM_018126chr4169 --11150 --
NM_018131chr102899 311 ------
NM_018133chr332014 1588 1538 ------
NM_018151chr21759 ------
NM_018157chr1232359 1309 1143 11264 ----
NM_018181chr182389 284 ------
NM_018184chr332165 2034 1584 1790 ----
NM_018206chr161663 ------
NM_018244chr201193 1447 ----
NM_018275chr73438 232 74 1379 ----
NM_018287chr1011065 ------
NM_018293chr322563 382 ------
NM_018313chr31363 ------
NM_018320chr1131171 370 179 --11272 --
NM_018364chr11999 ------
NM_018373chr1436104 2046 1540 --11017 --
NM_018387chr91554 --1463 --
NM_018413chr12180 ------
NM_018424chr921876 469 ------
NM_018426chr61559 ------
NM_018445chr15--1109 ----
NM_018452chr6_random32883 1529 663 --13106 12448
NM_018462chr32669 149 ------
NM_018482chr81425 --11800 --
NM_018553chr1711496 1708 21864 1364 --
NM_018557chr221181 147 ------
NM_018566chr1158 122 11035 --
NM_018650chr11380 ------
NM_018660chr872612 2499 2358 1134 1128 615 120 --21201 633 --
NM_018667chr1672137 1896 1866 1841 1085 571 290 ------
NM_018688chr82649 310 ------
NM_018695chr51533 ------
NM_018710chr8----1870 --
NM_018711chr1221183 52 ------
NM_018715chr132041 2029 1878 21831 804 ----
NM_018717chr452644 1836 1764 1113 769 ------
NM_018840chr201164 ------
NM_018841chr123224 243 ------
NM_018947chr724964 4346 1455 ----
NM_018951chr72505 153 --1288 --
NM_018959chr192628 498 ------
NM_018963chr211141 ------
NM_018970chr712323 ------
NM_018976chr1222442 1868 ------
NM_018977chrX2871 738 ------
NM_018979chr1222250 440 12155 ----
NM_019000chr521612 268 ------
NM_019004chr732075 1628 741 1124 11577 --
NM_019006chr152660 288 ------
NM_019024chr2187 ------
NM_019027chr41880 1572 ----
NM_019050chr421795 919 ------
NM_019063chr212031 ------
NM_019071chr7----2568 164 --
NM_019084chr1022347 601 ------
NM_019116chr1633203 641 494 --1892 --
NM_019557chr11572 --2782 593 1873
NM_019592chr92831 202 ------
NM_019593chr2033005 949 95 --12988 1509
NM_019606chr71509 ------
NM_019610chr122074 1861 ------
NM_019613chr1741053 103 94 57 ----1337
NM_019843chr22285 74 ------
NM_019849chr192220 160 ------
NM_019885chr252157 956 501 370 179 1923 ----
NM_019903chr101694 ------
NM_020039chr1241955 1566 1334 731 ------
NM_020122chr285029 4835 4668 4504 1275 1169 1067 74 ------
NM_020123chr1041132 1051 515 96 ------
NM_020150chr1021965 736 ------
NM_020159chr421734 1703 ------
NM_020163chr361561 1449 824 745 324 164 11766 2908 34 --
NM_020182chr2043147 1317 28 22 ------
NM_020198chr1721318 1179 ------
NM_020205chr142304 1386 201 182 --13096 --
NM_020226chr4----1280 --
NM_020239chr132286 496 155 ------
NM_020245chr674558 3707 3676 3118 3082 1583 181 --14392 --
NM_020310chr173991 867 726 ------
NM_020336chr2043338 2973 188 171 1869 ----
NM_020342chr222117 1894 ------
NM_020346chr1111202 ------
NM_020348chr1011774 ------
NM_020354chr10----1943 --
NM_020362chr11180 --1241 --
NM_020374chr1211629 ----11979
NM_020381chr61624 ------
NM_020390chr31137 1711 ----
NM_020429chr732193 2100 124 ------
NM_020440chr162822 2357 2279 1086 801 340 --12330 --
NM_020443chr156840 4333 2113 980 315 --1943 --
NM_020463chr21333 ------
NM_020474chr18145 --1772 --
NM_020475chr852089 1840 1589 397 310 ----182
NM_020476chr852089 1840 1589 397 310 ----182
NM_020477chr852089 1840 1589 397 310 ----182
NM_020478chr852152 1903 1652 460 373 ----1145
NM_020480chr852089 1840 1589 397 310 ----182
NM_020631chr131312 1149 269 11391 1377 --
NM_020640chr32433 189 32234 1504 124 ----
NM_020644chr114925 919 75 65 ------
NM_020647chr8----12144 --
NM_020651chr221585 56 ------
NM_020673chr2077054 6633 6479 5129 626 498 64 --17524 --
NM_020689chr2041653 620 571 480 ------
NM_020699chr185098 3945 3698 2004 1947 792 694 655 14354 --25030 4996
NM_020708chr2022431 1948 1162 11933 --
NM_020713chr2042915 2901 296 249 12647 2415 201 --
NM_020728chr722534 1091 ------
NM_020742chrX32652 2036 1816 ------
NM_020747chr51622 ------
NM_020749chr811817 ------
NM_020755chr62655 250 ------
NM_020760chr211636 ------
NM_020766chrX13670 --11137 --
NM_020768chr53607 451 334 --12975 --
NM_020772chr1757308 2456 2374 1608 1202 ------
NM_020774chr1875949 4896 2482 2245 2145 1877 871 --1132 --
NM_020795chr1731900 1661 1544 ------
NM_020796chr522168 438 ------
NM_020801chr521967 34 ------
NM_020804chr672495 2096 2052 1981 1882 1002 703 ------
NM_020808chr12390 302 ------
NM_020809chr11142 ------
NM_020818chr14151 ------
NM_020831chr22134 2957 373 --11007
NM_020832chr12546 181 ------
NM_020850chr1663126 2682 2349 1056 293 49 --22152 1157 --
NM_020854chr1811498 ------
NM_020858chr1532392 724 337 ------
NM_020868chr221716 227 ------
NM_020870chr432099 713 185 ------
NM_020871chrX22033 981 ------
NM_020895chr192274 129 ------
NM_020897chr111362 ------
NM_020899chr173849 684 524 12068 ----
NM_020922chrX41818 1490 679 86 ------
NM_020927chr1622006 258 ------
NM_020940chr1012818 ----1808
NM_020946chr941666 1471 686 269 1492 2646 514 --
NM_020948chr133187 634 69 163 ----
NM_020956chr19114710 4217 3551 3360 3354 3146 3059 2891 1398 1160 1029 23635 3126 13409 13935
NM_020962chr1522187 813 --1471 --
NM_020983chr1262288 2228 1605 1462 822 237 1380 ----
NM_020987chr1011294 ------
NM_021007chr21476 ------
NM_021033chr1353311 2774 2319 1109 174 ------
NM_021038chr311232 12395 13313 --
NM_021079chr1711347 1644 43273 2308 2100 177 --
NM_021097chr23431 385 241 ------
NM_021120chrX42041 1227 1179 594 ----22735 1185
NM_021135chr65844 504 491 456 48 13151 1781 --
NM_021136chr14------1608
NM_021140chrX------1318
NM_021148chr71819 ------
NM_021159chr431409 1372 1259 --11646 --
NM_021183chrX----193 --
NM_021188chr14----2528 223 --
NM_021189chr13406 247 210 ------
NM_021192chr23336 329 88 ------
NM_021215chr202835 424 --1399 --
NM_021218chr91963 ------
NM_021224chr9161 ----172
NM_021238chr121210 ----1370
NM_021242chrX2151 123 --1369 1269
NM_021249chr1421280 32 ------
NM_021252chr1011367 ------
NM_021255chr1453110 604 377 286 114 ------
NM_021627chr33897 179 76 ------
NM_021643chr2--11245 ----
NM_021644chr101926 ----1288
NM_021647chr434205 416 44 1585 ----
NM_021648chr642139 2057 560 402 ------
NM_021813chr625394 2226 ------
NM_021814chr621490 204 ------
NM_021905chr64525 449 144 132 --122 --
NM_021911chr5----1159 --
NM_021943chr621349 1343 1162 1530 --
NM_021954chr133374 298 247 ----13440
NM_021956chr61229 ------
NM_021959chr62344 176 ------
NM_021961chr1156988 6895 5905 2608 2460 --16961 --
NM_021962chr1711611 11647 22305 567 --
NM_022048chr1566045 4684 4575 2062 1944 254 14540 21402 476 --
NM_022060chr1431375 1005 237 ------
NM_022062chr1131392 775 702 ----1741
NM_022079chr101791 ------
NM_022085chr6181 --11092 --
NM_022114chr133020 1842 1339 --1781 --
NM_022118chr131535 ------
NM_022123chr141588 ------
NM_022129chr1021213 73 ------
NM_022130chr51265 ------
NM_022143chr7--1635 2352 118 --
NM_022152chr26972 300 220 81 57 34 ------
NM_022160chr91133 ------
NM_022166chr1675238 4028 2373 1463 1452 553 60 --15404 1706
NM_022169chr113592 447 168 --1422 --
NM_022170chr721422 180 --1339 --
NM_022361chr6----1387 --
NM_022457chr11114 ------
NM_022465chr1222109 1095 --11074 --
NM_022474chr14------21736 550
NM_022475chr41718 ------
NM_022491chr1232983 644 44 12925 ----
NM_022497chr343592 2369 407 383 --122 --
NM_022552chr24984 505 334 186 --1469 --
NM_022574chr732067 1352 839 --128 --
NM_022648chr254195 3964 1142 1079 710 --12948 --
NM_022652chr121879 --2988 74 --
NM_022719chr2293471 3284 3240 1098 1037 622 578 271 143 21227 1133 32908 2898 791 13004
NM_022728chr7------175
NM_022735chr1133 --11348 --
NM_022745chr132279 1908 419 ----1931
NM_022748chr722484 1122 --2723 592 --
NM_022750chr73733 504 180 ------
NM_022755chr962240 1820 1723 1685 1616 795 --11661 --
NM_022756chr111519 21431 1059 ----
NM_022767chr1541280 509 194 28 ------
NM_022780chr21705 ------
NM_022781chr933321 2721 2710 ------
NM_022802chr1021424 427 ------
NM_022831chr121146 1135 ----1433
NM_022842chr333218 2431 298 --1545 --
NM_022893chr212551 --1991 --
NM_022898chr1443964 2964 1464 240 1179 --1954
NM_022912chr231201 1165 554 ------
NM_022913chr5----1221 --
NM_023076chr1632503 2477 843 1728 ----
NM_023079chr1731540 1473 417 ------
NM_023112chr1442893 2706 2475 475 --21843 1146 --
NM_023927chr511361 --1972 --
NM_024019chr4140 ------
NM_024046chr311281 1856 1492 --
NM_024085chr23798 328 159 --1904 --
NM_024102chr13402 378 165 --11117 --
NM_024293chr21228 ------
NM_024423chr1824205 928 --1120 --
NM_024429chr721031 754 ------
NM_024522chr121437 454 11934 --141
NM_024528chrX155 ------
NM_024536chr23316 157 95 --1321 --
NM_024539chrX2911 391 ------
NM_024541chr104648 452 258 83 --156 --
NM_024546chr132808 258 ------
NM_024586chr11484 ------
NM_024615chr5----1247 --
NM_024624chr221224 329 ------
NM_024639chr61574 ------
NM_024665chr31992 ------
NM_024671chr161333 --1178 --
NM_024698chr112575 51 --1308 --
NM_024721chr812397 ------
NM_024742chr1631368 1326 702 --11421 --
NM_024749chr12430 219 ------
NM_024755chr151882 ------
NM_024834chr10----21694 437 --
NM_024887chr141981 1843 1735 1656 --1168 --
NM_024900chr422208 447 --1130 --
NM_024900chr422208 447 --1130 --
NM_024917chrX1835 ------
NM_024922chr1631640 1476 1304 11555 1312 --
NM_024947chr378469 8394 7895 7325 6427 758 745 17395 ----
NM_024949chr434657 4095 1366 --24737 3052 --
NM_024953chr1252809 2332 1912 1043 211 ------
NM_025054chr821569 978 ------
NM_025073chr134732 3954 1101 --13553 --
NM_025090chr172610 453 1967 2372 127 --
NM_025138chr131396 ------
NM_025146chr31437 --3973 740 671 --
NM_025160chr112732 --13587 --
NM_025164chr1121514 164 11499 ----
NM_025182chr92965 217 ----1971
NM_025222chr352668 2662 2108 740 651 --1102 --
NM_025235chr10----1241 --
NM_025250chr763033 2937 1867 1065 933 833 22947 841 ----
NM_030594chr1521264 949 1886 ----
NM_030627chr52339 218 ------
NM_030629chr1611604 --1291 --
NM_030648chr413564 24592 430 12051 --
NM_030650chr211529 --23432 1137 --
NM_030664chr1012404 ------
NM_030761chr152604 1838 1658 1016 905 ------
NM_030786chr121915 439 ------
NM_030790chr161204 ------
NM_030795chr81441 ------
NM_030796chr7--1259 22057 97 --
NM_030806chr137735 2276 1423 27957 2745 26279 3192 --
NM_030810chr6181 --11092 --
NM_030885chr332133 1463 23 1456 ----
NM_030918chr185227 5112 4601 1916 1616 486 466 73 --24704 1484 --
NM_030920chr111983 ------
NM_030922chr152831 686 ------
NM_030939chr611100 ------
NM_030962chr111144 ------
NM_030964chr552382 1342 1148 1142 797 11014 ----
NM_030981chr113912 343 126 --21102 478 --
NM_031216chr1831644 313 295 ------
NM_031243chr721652 24 ------
NM_031262chr91161 ------
NM_031263chr91218 ------
NM_031419chr31147 ------
NM_031426chr921976 1895 1249 ----
NM_031438chr51120 ------
NM_031445chr252441 2356 928 544 279 --22799 2326 --
NM_031450chr11149 1173 ----
NM_031468chr756304 6224 468 203 162 --37715 6033 5110 --
NM_031478chr16177 165 1536 --
NM_031483chr2022758 2434 13213 ----
NM_031844chr143689 3095 1526 648 ----1141
NM_031845chr22223 62 ----12952
NM_031847chr22223 62 ----12952
NM_031866chr101342 ----182
NM_031890chr2252953 2803 1040 1017 256 ----134
NM_031992chr721422 180 --1339 --
NM_032012chr945133 3382 3280 175 11310 ----
NM_032028chr52473 463 ------
NM_032051chr221220 2620 25 ----
NM_032052chr2231076 469 303 ------
NM_032102chr111248 12573 ----
NM_032105chr147916 7910 2020 1086 26296 6214 11326 --
NM_032121chrX32265 1084 869 ------
NM_032144chr2--11804 ----
NM_032153chr331840 528 448 1554 ----
NM_032160chr1834158 3949 698 ------
NM_032195chr21----1154 --
NM_032199chr1021208 969 --11109 --
NM_032221chr2011340 --1413 --
NM_032228chr1143014 2614 672 474 ------
NM_032229chr131837 ------
NM_032239chr411366 ------
NM_032242chr352959 2735 2641 756 685 2331 316 22043 379 --
NM_032246chr151470 ------
NM_032289chr51308 --11820 --
NM_032291chr11561 ------
NM_032316chr332419 2395 2255 --1351 1357
NM_032325chr1142047 1470 1352 57 --1165 1269
NM_032345chr121383 ------
NM_032373chr1025853 4337 ------
NM_032434chr231538 1385 1148 ------
NM_032438chr611030 1575 ----
NM_032440chr1021993 1891 ------
NM_032457chr422732 2709 --12888 --
NM_032458chrX12293 ------
NM_032491chr122218 112 ------
NM_032501chr2031395 1112 228 ----1154
NM_032505chr312317 --12034 --
NM_032539chrX1773 ------
NM_032547chr421274 1126 ------
NM_032552chr931400 1394 625 --11846 --
NM_032564chr112912 91 ------
NM_032595chr1781458 1396 1235 1073 394 362 273 263 1243 ----
NM_032631chr191125 ------
NM_032632chr143298 139 114 ------
NM_032646chr1731690 630 615 1482 ----
NM_032682chr3--11407 11226 --
NM_032711chr1774088 3912 3781 1271 578 482 416 1162 21658 1313 11458
NM_032737chr1972605 2454 1875 1718 581 393 295 12401 12593 --
NM_032775chr224495 404 386 42 1346 ----
NM_032786chr122151 42 --1471 --
NM_032800chr142526 1989 1793 405 ------
NM_032801chr1121992 252 ------
NM_032808chr154950 802 620 319 --1688 --
NM_032812chr101318 ------
NM_032833chr131687 447 407 ------
NM_032837chr1721979 1657 ------
NM_032859chr1333347 2894 537 ------
NM_032876chr143837 590 365 ------
NM_032900chr10103768 3627 3460 2990 2978 2576 982 501 417 283 11116 11416 --
NM_032947chr53829 184 72 ------
NM_032951chr73625 504 43 ------
NM_032953chr73625 504 43 ------
NM_032961chr41481 ------
NM_032975chr1833006 2769 2663 ------
NM_032980chr1833006 2769 2663 ------
NM_032998chr13942 406 189 ------
NM_033018chrX41173 1163 1001 978 ------
NM_033020chr1----11748 --
NM_033036chr1131615 273 63 1310 1501 1174
NM_033044chr121033 323 ------
NM_033102chr14211 174 86 78 ----11028
NM_033102chr14211 174 86 78 ----11028
NM_033105chr81126 ------
NM_033132chr132266 191 --1486 --
NM_033133chr17112935 2868 2790 1471 1305 1151 991 830 599 485 421 --13671 --
NM_033138chr721661 102 ------
NM_033139chr721661 102 ------
NM_033140chr721661 102 ------
NM_033157chr721661 102 ------
NM_033181chr612936 12499 --13407
NM_033201chr16--1106 ----
NM_033207chr1011745 2141 47 ----
NM_033224chr767877 7815 4959 2871 2480 824 ------
NM_033225chr842426 1088 357 217 ------
NM_033226chr163194 186 76 1137 ----
NM_033260chr61550 ------
NM_033285chr822953 1461 --14438 --
NM_033300chr1183 ----11050
NM_033315chr173780 67 22 ------
NM_033331chr922888 2581 11271 23565 2870 --
NM_033360chr1224250 581 ------
NM_033407chr1--1467 ----
NM_033420chr191471 --1292 --
NM_033425chr1141316 1180 588 210 --1641 --
NM_033449chr561966 1400 1383 665 373 274 --21451 378 --
NM_033542chr2011655 --155 --
NM_033551chr543048 2324 1012 158 ------
NM_033631chr153143 2671 2502 448 136 --1350 --
NM_033642chrX11085 ------
NM_033644chr511700 --1871 1898
NM_033645chr511700 --1871 1898
NM_052827chr124868 265 75 53 ------
NM_052828chr6136 --1508 --
NM_052840chr1531017 537 227 --1179 --
NM_052869chr1731690 630 615 1482 ----
NM_052876chr1972297 1072 1005 856 749 513 313 --1828 --
NM_052885chr122792 673 ------
NM_052898chr821344 56 ------
NM_052899chr53763 125 108 ------
NM_052900chr81348 ------
NM_052904chr611213 ------
NM_052906chr22144870 4857 4732 4218 3696 3607 3347 3145 1748 1419 1333 1041 309 41 21318 696 23178 1184 --
NM_052925chr192239 33 --187 --
NM_052937chr812235 11007 1483 --
NM_052958chr81248 ------
NM_052965chr1--2111 92 ----
NM_052968chr112707 145 --1563 --
NM_053016chr947870 6336 3207 2958 16818 ----
NM_053023chr1141193 913 719 585 1988 ----
NM_053025chr31446 ----1135
NM_053026chr31446 ----1135
NM_053027chr31446 ----1135
NM_053028chr31446 ----1135
NM_053031chr31446 ----1135
NM_053032chr31446 ----1135
NM_053046chr192198 192 1348 1478 --
NM_053279chr832147 272 28 11964 147 --
NM_054027chr521975 1710 ------
NM_054111chr6133 --1844 --
NM_057175chr412264 1474 ----
NM_057178chr17265 57 ------
NM_058164chr193132 47 22 ------
NM_058167chr14998 350 216 164 ------
NM_080392chr11504 ------
NM_080430chr221130 ------
NM_080491chr1143699 3347 411 339 --11409 --
NM_080546chr921562 924 ------
NM_080599chr102873 352 ------
NM_080607chr201840 --11035 --
NM_080616chr202288 259 --1547 --
NM_080664chr141125 ------
NM_080669chr1774073 3350 1872 1790 1297 646 359 --23209 714 --
NM_080671chr242013 1612 491 364 1806 ----
NM_080679chr62752 671 ------
NM_080680chr62752 671 ------
NM_080681chr62752 671 ------
NM_080732chr192198 192 1348 1478 --
NM_080743chr632318 1785 1746 --12053 --
NM_080759chr131550 ------
NM_080760chr131550 ------
NM_080836chr2054097 3746 2994 1301 166 --44668 4150 1431 584 --
NM_080881chr52709 322 ------
NM_130385chr1122192 1236 22794 2317 ----
NM_130391chr923262 3245 ------
NM_130392chr923262 3245 ------
NM_130393chr923262 3245 ------
NM_130436chr211482 ------
NM_130438chr2111059 1516 ----
NM_130439chr1032262 1605 77 --12196 --
NM_130439chr1032262 1605 77 --12196 --
NM_130440chr141504 536 426 310 ------
NM_130781chr53456 72 51 ----1167
NM_130797chr741512 671 653 489 ------
NM_130830chr383974 3246 2880 2514 2437 1065 260 23 --23753 3421 --
NM_133170chr2076590 6019 2639 2588 2336 1471 81 --25374 1826 27204 801
NM_133177chr131077 894 134 1832 ----
NM_133178chr131077 894 134 1832 ----
NM_133264chr1743486 3034 1440 1071 12512 12832 --
NM_133265chrX63522 3445 3326 1439 1280 96 ------
NM_133329chr211575 ------
NM_133457chr72589 99 --21216 257 --
NM_133486chrX------1458
NM_133496chr11591 ------
NM_133631chr31164 ------
NM_133642chr2221070 877 --11279 --
NM_133647chr1512599 ------
NM_134325chr111528 1703 ----
NM_138270chrX2764 519 ------
NM_138281chr171107 --182 --
NM_138300chr131161 484 305 ------
NM_138316chr10------1974
NM_138335chr42673 177 ------
NM_138338chr2273204 2721 2682 2428 2120 807 538 11082 11018 --
NM_138385chr431367 1340 1199 --21361 238 --
NM_138396chr123785 618 369 ------
NM_138423chr1522327 502 ------
NM_138444chr1333108 3026 1523 13865 1192 --
NM_138456chr112843 38 1367 2388 22 --
NM_138457chr643261 2283 2157 25 --11345 --
NM_138473chr1264942 4545 4445 3288 1188 467 13766 ----
NM_138479chr121708 598 --1290 --
NM_138558chr121168 436 1163 ----
NM_138576chr1443964 2964 1464 240 1179 --1954
NM_138713chr1687713 6369 5723 3083 2691 2259 1256 676 ------
NM_138714chr1687713 6369 5723 3083 2691 2259 1256 676 ------
NM_138727chr142406 2090 273 91 1283 ----
NM_138728chr142406 2090 273 91 1283 ----
NM_138730chr6--149 ----
NM_138732chr111312 1214 --1272
NM_138734chr111312 1214 --1272
NM_138735chr211326 ------
NM_138811chr721137 1000 ------
NM_138931chr31134 ------
NM_138970chr143892 884 609 ------
NM_138981chr4----1121 --
NM_138992chr211767 --1450 --
NM_139045chr9----195 --
NM_139048chr31783 --167 1271
NM_139071chr1221287 551 --1589 --
NM_139132chr11----197 --
NM_139135chr111092 ------
NM_139161chr193337 142 48 ------
NM_139276chr1722005 1993 --22235 1718 --
NM_139280chr172202 184 1117 21247 282 1296
NM_139283chr121564 1900 12553 --
NM_144568chr142637 217 --1627 --
NM_144571chr444926 2473 2160 181 11167 ----
NM_144574chr14--1526 ----
NM_144578chr1414962 ----13801
NM_144582chr242518 1763 781 585 ------
NM_144586chr23875 506 400 1785 ----
NM_144589chr10392 36 23 ------
NM_144595chr132723 51 ------
NM_144635chr35477 337 227 178 76 --2348 183 1507
NM_144691chr19140 ------
NM_144703chr2011122 ------
NM_144732chr1921125 120 ------
NM_144967chrX----1908 --
NM_144973chr1265303 4937 2068 1468 1005 326 ------
NM_144979chr41672 ------
NM_144982chr121568 ------
NM_145012chr102393 77 ----1838
NM_145025chr62306 151 ------
NM_145055chr1821521 337 ------
NM_145056chr192587 21 ------
NM_145065chr111421 --1133 --
NM_145074chr24539 383 223 139 ------
NM_145109chr173871 679 128 --1955 --
NM_145113chr1411035 ------
NM_145117chr1122528 1079 ------
NM_145166chr362573 2182 1992 1846 659 396 --11970 --
NM_145185chr1931718 736 602 ------
NM_145206chr1022966 1080 --22707 183 1134
NM_145277chr1--1153 ----
NM_145296chr192601 106 --2274 39 --
NM_145303chr6131 ------
NM_145307chr1023681 1735 ------
NM_145313chr103585 529 49 --2508 460 173
NM_145349chr1721612 336 ------
NM_145686chr253203 2652 1261 634 136 ------
NM_145687chr253203 2652 1261 634 136 ------
NM_145808chr713064 ------
NM_145913chr123802 745 670 ------
NM_147156chr101545 --1409 --
NM_147175chrX21673 219 ------
NM_147223chr2----12390 --
NM_147233chr2----12207 --
NM_148174chr821620 304 ------
NM_148904chr11484 ------
NM_148905chr11484 ------
NM_148906chr11484 ------
NM_148907chr11484 ------
NM_148908chr11484 ------
NM_148909chr11484 ------
NM_148977chr10------1974
NM_148978chr10------1974
NM_152227chr201247 ------
NM_152233chr1421280 32 ------
NM_152265chr1----11148 --
NM_152271chr81336 ------
NM_152272chr81991 1962 ----
NM_152280chr13744 415 269 --11276 --
NM_152335chr151238 ------
NM_152388chr222792 749 --12903 --
NM_152409chr52294 99 ------
NM_152423chrX31522 628 50 ------
NM_152424chrX104741 4352 3610 3193 1842 1068 779 274 88 61 ------
NM_152440chr1241022 745 297 210 --11146 --
NM_152462chr17126 1270 ----
NM_152470chr1853857 3647 3397 2604 172 11178 12825 --
NM_152538chr321207 310 1507 ----
NM_152542chr42820 312 ------
NM_152588chr12------11865
NM_152608chr142025 1773 670 149 ------
NM_152622chr512495 ------
NM_152629chr91517 ------
NM_152652chr161209 ----1184
NM_152671chr21111 ------
NM_152682chr421425 53 ------
NM_152688chr61392 ------
NM_152716chr1131111 628 145 ------
NM_152733chr675700 5435 4720 4425 1796 176 34 25445 1611 26307 2015 --
NM_152734chr654743 1525 891 319 98 ------
NM_152756chr543002 1675 1463 1109 ------
NM_152758chr812967 ------
NM_152772chr12--1413 ----
NM_152789chr71492 ------
NM_152793chr744928 3153 1088 72 --15060 --
NM_152835chr122548 507 ------
NM_152860chr123306 146 31 ------
NM_152890chr11871 ------
NM_152924chr1556591 6139 5969 2742 2334 --1927 1915
NM_153029chr1633852 156 36 ------
NM_153207chr1233715 3245 68 1650 ----
NM_153273chr341702 891 622 273 1521 32215 868 377 1589
NM_153321chr171143 ------
NM_153322chr171143 ------
NM_153350chr1631227 1145 470 11468 ----
NM_153367chr1043726 2905 124 79 ------
NM_153371chr131559 ------
NM_153464chr191194 ------
NM_153499chr1242628 2021 616 150 ------
NM_153500chr1242628 2021 616 150 ------
NM_153616chr1532392 724 337 ------
NM_153617chr1532392 724 337 ------
NM_153618chr1532392 724 337 ------
NM_153619chr1513630 ------
NM_153620chr721558 1193 --1436 --
NM_153645chr224750 480 435 342 --1592 --
NM_153649chr12865 195 194 11439 --
NM_153715chr72505 153 --1288 --
NM_153756chr121928 332 ------
NM_153757chr411198 ------
NM_153759chr24984 505 334 186 --1469 --
NM_153809chr91521 ------
NM_153810chr1035059 3417 83 ------
NM_170606chr721843 313 ------
NM_170665chr1234009 1464 705 ------
NM_170674chr15------1510
NM_170675chr15------1186
NM_170676chr15------1186
NM_170677chr15------1510
NM_170706chr144173 3354 1445 210 14139 11208 --
NM_170711chr192804 674 ------
NM_170712chr32729 235 ------
NM_170713chr32729 235 ------
NM_170714chr32729 235 ------
NM_170719chr131396 ------
NM_170721chr172419 32 --175 --
NM_170782chr12411 389 ------
NM_171998chrX32288 932 494 ------
NM_172103chr632704 875 224 ------
NM_172105chr632704 875 224 ------
NM_172127chr4------11685
NM_172128chr4------11641
NM_172169chr10--1540 1305 --
NM_172170chr10--1540 1305 --
NM_172171chr10--1540 1305 --
NM_172173chr10--1540 1305 --
NM_172216chr1242530 1923 518 52 ------
NM_172226chr1242628 2021 616 150 ------
NM_172315chr15------1510
NM_172316chr15------1510
NM_172344chr211575 ------
NM_172373chr1321103 1018 ------
NM_173084chr331626 835 30 ------
NM_173156chr142177 1736 1517 54 --1761 --
NM_173163chr162187 115 ------
NM_173165chr16168 ------
NM_173172chr2--1150 ----
NM_173191chr1031318 1042 115 1529 ----
NM_173192chr1031318 1042 115 1529 ----
NM_173193chr1031318 1042 115 1529 ----
NM_173194chr1031318 1042 115 1529 ----
NM_173195chr1031318 1042 115 1529 ----
NM_173198chr92404 204 --11194 --
NM_173200chr92404 204 --11194 --
NM_173214chr1687713 6369 5723 3083 2691 2259 1256 676 ------
NM_173354chr2131556 878 312 ------
NM_173359chr33363 184 117 ------
NM_173463chr41648 13456 ----
NM_173468chr424964 128 ----25615 1883
NM_173475chr1611107 ------
NM_173500chr1531168 931 334 --11292 --
NM_173511chr223512 1083 ------
NM_173519chr811718 ------
NM_173546chr32632 152 ------
NM_173562chr642546 2463 771 358 ----12469
NM_173595chr1295308 5150 4667 4425 4409 3491 2056 1264 689 13501 11311 11719
NM_173609chr151605 ------
NM_173624chr17------125
NM_173642chr186428 6300 6249 6099 5788 3348 2404 864 17918 13595 --
NM_173644chr2021913 662 --11262 --
NM_173648chr21711 ----1280
NM_173683chr8------11346
NM_173794chrX1329 ------
NM_173822chr211507 ------
NM_173824chr3143 ------
NM_174902chr112423 30 ------
NM_174911chr882488 1001 951 550 427 393 344 312 ------
NM_174916chr1521664 83 --12188 --
NM_174921chr421063 431 ------
NM_174934chr1193257 3063 2827 2687 1152 1102 701 644 268 1488 1454 12745
NM_174937chr10--134 ----
NM_174938chr92460 90 ------
NM_175069chr92804 376 --1256 --
NM_175629chr24984 505 334 186 --1469 --
NM_175709chr2232011 755 41 1511 32362 450 74 --
NM_175733chr111159 --11916 --
NM_175736chr1245712 1041 948 92 11414 ----
NM_175747chr62943 888 ------
NM_175852chr152186 1129 1033 295 221 12761 --12672
NM_175854chr1321947 418 --1446 --
NM_175866chr1150 ------
NM_176871chr893257 3070 3048 2911 2606 990 798 485 42 12532 ----
NM_177414chr111152 11104 ----
NM_177559chr201407 ------
NM_177560chr201407 ------
NM_177968chr241553 1543 810 557 ------
NM_177974chr1522327 502 ------
NM_177996chr2021212 219 11123 21105 640 --
NM_177999chr963466 2679 2565 2437 1049 911 ------
NM_178138chr94349 199 111 66 1164 ----
NM_178151chrX67207 3120 2829 625 355 155 ----12835
NM_178152chrX67207 3120 2829 625 355 155 ----12835
NM_178153chrX67207 3120 2829 625 355 155 ----12835
NM_178313chr222089 48 ------
NM_178426chr122305 945 ------
NM_178427chr122205 845 ------
NM_178496chr321466 1425 ------
NM_178554chr323347 1073 1331 1432 --
NM_178568chr17195 ------
NM_180976chr6--2899 738 11001 --
NM_180977chr6--2899 738 11001 --
NM_181077chr1522016 759 ------
NM_181302chr14--1526 ----
NM_181308chr14--1526 ----
NM_181332chrX32652 2036 1816 ------
NM_181349chr732193 2100 124 ------
NM_181356chr6----3823 194 115 --
NM_181458chr21994 ------
NM_181489chr362651 2452 2088 583 353 33 --25124 4355 --
NM_181492chr221991 ------
NM_181521chr16107039 6934 5534 5471 2698 2004 1817 524 333 207 11692 37065 6331 1583 --
NM_181532chrX1236 ------
NM_181552chr72951 94 ------
NM_181598chr141310 ------
NM_181670chr121232 ------
NM_181698chr102393 77 ------
NM_181706chr1142132 1909 716 409 ----11675
NM_181710chr19165 ------
NM_181762chrX1212 ------
NM_181777chrX1212 ------
NM_181782chr6142 ------
NM_181784chr221681 391 ------
NM_181839chr8--1373 ----
NM_182314chrX11488 ----11849
NM_182485chr423203 362 1496 ----
NM_182493chr1645323 4960 3516 1813 ------
NM_182498chr192258 71 157 ----
NM_182503chr645600 3978 1115 466 ----14455
NM_182507chr122882 548 --2703 158 --
NM_182509chr1441663 1301 1236 502 11565 21168 1119 --
NM_182527chr2231993 1780 1509 1903 11679 --
NM_182557chr111212 21793 883 ----
NM_182565chr172702 50 1590 127 --
NM_182577chr194377 172 93 36 --1481 --
NM_182580chr162405 1987 1780 899 353 315 --22035 843 --
NM_182620chr1731405 896 102 ------
NM_182641chr1741934 1778 1632 660 ------
NM_182646chr423203 362 1496 ----
NM_182663chr122261 1513 ------
NM_182664chr122391 1643 ------
NM_182665chr122261 1513 ------
NM_182666chr31271 ------
NM_182715chr71119 ------
NM_182789chr5----1748 --
NM_182811chr2031144 1136 66 --1736 --
NM_182898chr722516 1889 ------
NM_182899chr722516 1889 ------
NM_182910chr143835 795 129 ------
NM_182913chr143835 795 129 ------
NM_182914chr143835 795 129 ------
NM_182948chr1----1246 --
NM_182964chr1122528 1079 ------
NM_182970chr2084070 3234 3204 3151 2878 2604 1627 977 --24254 3134 14012
NM_183078chr633685 1127 398 ------
NM_183323chr5----1748 --
NM_183376chr1532618 1685 726 ------
NM_183380chr61865 ------
NM_183422chr131380 ------
NM_183425chr2041559 1539 1499 192 --1373 --
NM_184234chr201763 ------
NM_194248chr24970 775 724 132 ------
NM_194259chr161115 --1441 --
NM_194260chr161115 --1441 --
NM_194261chr161115 --1441 --
NM_194278chr1453173 2698 258 136 39 1458 ----
NM_194314chr123464 79 11340 ----
NM_194315chr14998 350 216 164 ------
NM_194322chr24970 775 724 132 ------
NM_194328chr933321 2721 2710 ------
NM_194329chr933321 2721 2710 ------
NM_194330chr933321 2721 2710 ------
NM_194332chr933321 2721 2710 ------
NM_194452chr1131171 370 179 --11272 --
NM_194453chr1131171 370 179 --11272 --
NM_194457chr14998 350 216 164 ------
NM_194458chr14998 350 216 164 ------
NM_194463chrX2911 391 ------
NM_198040chr121180 351 1886 ----
NM_198056chr352035 1954 1640 815 315 1554 11601 --
NM_198086chr143837 590 365 ------
NM_198123chr81348 ------
NM_198124chr81348 ------
NM_198243chr151132 ------
NM_198270chrX22847 2448 ------
NM_198334chr113870 845 163 1154 ----
NM_198335chr113870 845 163 1154 ----
NM_198336chr731146 375 168 123 ----
NM_198390chr1611604 --1291 --
NM_198391chr20136 ------