TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5695
miRNA Sequence: ACUCCAAGAAGAAUCUAGACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000090chr21125 ------
NM_000093chr941550 931 369 349 11624 11777 11952
NM_000111chr71128 ------
NM_000125chr663539 2837 2595 1185 893 306 11426 --23460 454
NM_000165chr631399 1357 1292 ------
NM_000194chrX125 ------
NM_000208chr1974722 3038 3024 1213 875 596 243 14443 ----
NM_000210chr251725 1657 1588 632 253 1471 --11814
NM_000216chrX33079 1062 325 ----2721 699
NM_000223chr171128 ------
NM_000252chrX4579 404 219 62 ------
NM_000264chr963045 3025 2891 2421 2262 91 ------
NM_000266chrX1376 ------
NM_000337chr5116014 5822 5226 4558 4476 2607 1673 1614 1483 1021 623 ------
NM_000362chr2283383 3338 3076 2646 2235 1270 121 55 ----13365
NM_000368chr944387 3282 166 136 13156 --23712 2961
NM_000369chr1411857 ------
NM_000390chrX3498 343 34 ------
NM_000396chr1171 ------
NM_000430chr1743352 3004 2593 1446 1393 ----
NM_000451chrX41981 748 623 355 ------
NM_000533chrX1168 ------
NM_000555chrX157688 7572 7204 6462 6198 5714 5295 2909 2826 2456 2278 2091 755 727 236 16893 ----
NM_000599chr263998 3118 3026 1854 1441 490 ------
NM_000611chr11106692 6105 5876 5380 1911 1715 1658 376 342 268 --27008 2614 --
NM_000618chr1276037 5463 4862 4182 2287 1244 80 ------
NM_000618chr1276037 5463 4862 4182 2287 1244 80 ------
NM_000633chr18114776 4505 4489 4125 4064 4014 3960 3316 1753 814 295 44874 4431 1403 440 11004 --
NM_000717chr171118 ------
NM_000735chr61200 ------
NM_000780chr82982 76 ------
NM_000808chrX2956 769 ------
NM_000809chr469230 7521 7003 6861 5778 2010 16461 ----
NM_000813chr564881 2148 1874 1356 302 74 11235 11728 --
NM_000814chr1563828 3720 3309 2792 2651 1390 22957 1593 23771 778 --
NM_000824chr41112 ------
NM_000831chr184215 1679 1649 1464 948 677 633 183 12101 14728 32053 1355 97
NM_000864chr12730 91 ----1884
NM_000868chrX22339 1037 ------
NM_000875chr15146552 6072 6009 5264 5097 4871 4534 4379 4361 1963 1819 1780 1606 785 15157 22182 929 --
NM_000899chr1284193 3475 3391 2961 2836 1582 441 266 12826 ----
NM_000926chr1167675 7274 6917 6393 3702 1750 26788 711 17578 --
NM_000945chr211656 ------
NM_000950chrX13097 --11222 --
NM_000961chr2032954 2442 884 ------
NM_000965chr3195 ------
NM_001001323chr1272736 2517 2318 703 482 389 273 ------
NM_001001419chr584221 3878 3804 3691 1847 1763 909 800 14049 ----
NM_001001420chr584221 3878 3804 3691 1847 1763 909 800 14049 ----
NM_001001481chr84953 788 515 283 ------
NM_001001521chr21259 ------
NM_001001557chr821824 335 --11394 --
NM_001001664chr263493 3092 2807 1445 1069 1021 22896 452 12984 13980
NM_001001665chr253230 2737 2246 991 223 ----13179
NM_001001668chr1994262 4042 3717 3524 3494 3331 3267 2845 1688 ------
NM_001001740chr11119 ------
NM_001001740chr11119 ------
NM_001001938chr9104131 3836 3487 3479 3167 1653 1578 530 377 334 --13528 12776
NM_001001971chr1021178 946 ------
NM_001001974chr101791 --1689 --
NM_001001995chrX31438 500 197 ------
NM_001002006chr23339 145 121 ------
NM_001002269chr92423 49 ------
NM_001002295chr101921 ------
NM_001002759chr101425 ------
NM_001002843chr1541209 1034 415 47 1434 ----
NM_001002906chrY2534 165 ------
NM_001003679chr12885 215 ------
NM_001003688chr411041 ------
NM_001004065chr9113868 3833 3449 3070 3015 2808 1365 1219 1043 252 37 ----1949
NM_001004317chr664374 3980 3432 3378 3350 1440 1117 ----
NM_001004329chr122444 109 ------
NM_001004440chr11498 ------
NM_001005335chr191320 ------
NM_001005366chr121172 ------
NM_001005404chr1723923 2805 --12884 --
NM_001005474chr311513 ------
NM_001005476chr21629 ------
NM_001005862chr171609 ------
NM_001006600chr522181 296 ------
NM_001006658chr12666 36 ------
NM_001006684chrX1151 ------
NM_001007466chr674748 4052 3785 3574 1699 331 137 1728 --1557
NM_001007559chr182272 109 ------
NM_001008408chr766409 6108 4445 4179 1874 1200 15814 26229 6008 --
NM_001008495chr811425 ------
NM_001008564chr1321564 1386 ------
NM_001008744chr146538 362 331 314 290 219 --1576 --
NM_001009554chr463695 3611 3344 3053 1745 1261 ------
NM_001009554chr463695 3611 3344 3053 1745 1261 ------
NM_001009899chr366451 5636 5594 5053 4774 284 15628 --12525
NM_001010853chr632995 2592 925 12617 ----
NM_001010862chrX132778 2711 2662 2241 2111 2095 1243 1149 907 441 330 270 155 1653 32881 2424 2157 --
NM_001010870chr61484 ------
NM_001010888chrX23823 1498 ------
NM_001010986chrX2953 381 11780 ----
NM_001011513chr484056 3974 3838 3535 3109 3050 2581 1310 13304 --12870
NM_001011515chr431014 377 289 ------
NM_001011516chr431014 377 289 ------
NM_001011537chr342320 1655 919 827 --1693 --
NM_001011666chr732154 1007 212 11993 16292 16069
NM_001011713chr1441455 1203 1069 1016 --11145 --
NM_001012643chr191394 ------
NM_001012751chr1031685 1382 1208 ------
NM_001012754chr1362126 2059 1739 1357 581 168 --1563 --
NM_001012980chrX129 ------
NM_001013031chr1032540 1178 326 ------
NM_001013399chr641045 293 207 35 ------
NM_001013438chr31278 ------
NM_001013439chr31124 ------
NM_001014380chr1375406 5108 3986 3706 1458 462 83 ------
NM_001015045chr462067 2004 1750 866 494 466 --188 --
NM_001015881chrX11235 ------
NM_001017371chr231294 214 107 ------
NM_001017395chr373290 2687 1235 868 475 242 212 ------
NM_001017405chr41192 ----1379
NM_001017424chr131443 1229 157 ------
NM_001017425chr131443 1229 157 ------
NM_001017440chr7137897 7780 7599 6959 6273 5661 5627 3180 2801 2787 1212 911 714 27677 1285 35958 1651 1073 --
NM_001017923chr1421577 354 ------
NM_001017977chr13286 148 108 ------
NM_001017989chr1921059 285 --126 --
NM_001018037chr911260 ------
NM_001018056chr91204 ------
NM_001018064chr91572 ------
NM_001018067chr165152 4659 3531 1670 1576 1093 1560 ----
NM_001018068chr165152 4659 3531 1670 1576 1093 1560 ----
NM_001018069chr165152 4659 3531 1670 1576 1093 1560 ----
NM_001018111chr744003 3664 3272 68 ------
NM_001023560chr651064 432 384 169 118 --1106 1921
NM_001024647chr12157230 7096 6891 6459 6310 5773 5639 5307 2981 2898 2310 2259 1063 949 695 32635 1641 1125 16682 --
NM_001024808chr1272678 2002 1000 803 704 675 90 --1742 1226
NM_001025077chr1097615 7295 7002 5571 4725 2878 2863 2007 193 15456 11230 --
NM_001025108chr264162 3818 1398 1133 812 60 ------
NM_001025580chrX33893 3032 1522 1783 ----
NM_001025780chr911243 ------
NM_001029863chr662678 2041 1020 789 758 701 ------
NM_001030chr1153 ------
NM_001030055chr1474710 4616 3750 1223 1079 509 33 ----1842
NM_001031684chr231386 1375 1312 ------
NM_001031732chr483597 3193 2944 2756 1286 684 337 230 ------
NM_001031801chr221173 ------
NM_001032283chr122885 187 ------
NM_001032284chr122885 187 ------
NM_001032367chr155266 255 210 190 78 ----1146
NM_001033059chr62824 525 ------
NM_001033117chr363894 3647 3633 3431 1637 1118 --23904 101 --
NM_001033506chr111416 ------
NM_001033925chr1051933 709 525 514 121 ------
NM_001034837chr53246 126 101 ------
NM_001034838chr53246 126 101 ------
NM_001034841chr1695476 4480 3966 3909 3806 3578 1773 1592 1253 25513 962 13604 11828
NM_001037334chr185957 803 661 191 117 11553 ----
NM_001037339chr131253 552 134 ------
NM_001037340chr131253 552 134 ------
NM_001037341chr131253 552 134 ------
NM_001037341chr131253 552 134 ------
NM_001037637chr52361 141 ------
NM_001039465chr142396 119 ------
NM_001039479chr1442192 2082 1760 847 --22263 1591 2792 396
NM_001039547chr397746 5813 5652 3181 2519 1569 1270 1135 952 11427 16114 --
NM_001039569chr212755 ------
NM_001039577chr184238 4012 3895 3649 3208 3175 1272 886 24360 4204 14114 --
NM_001039585chr132862 1588 84 ----11366
NM_001039590chrX11341 --22567 1081 --
NM_001039591chrX11341 --22567 1081 --
NM_001039618chr11115893 5651 4194 3698 2362 2214 1738 1371 727 566 397 2913 621 ----
NM_001039937chr1373336 1284 1247 994 918 825 439 1385 ----
NM_001039938chr1331492 1059 593 ------
NM_001040110chr72152 99 ------
NM_001040153chr131978 ------
NM_001040157chr442448 2419 693 114 11066 ----
NM_001040429chr1312393 ------
NM_001040446chr542536 897 853 332 ------
NM_001040624chr872493 2176 1943 1068 895 659 315 ------
NM_001040625chr872493 2176 1943 1068 895 659 315 ------
NM_001040626chr872493 2176 1943 1068 895 659 315 ------
NM_001040627chr872493 2176 1943 1068 895 659 315 ------
NM_001040628chr872493 2176 1943 1068 895 659 315 ------
NM_001040629chr872493 2176 1943 1068 895 659 315 ------
NM_001040630chr872493 2176 1943 1068 895 659 315 ------
NM_001040633chr71713 ------
NM_001040712chr923399 849 12370 13351 --
NM_001042361chr1051165 1043 572 371 27 --1205 --
NM_001042364chr1051165 1043 572 371 27 --1205 --
NM_001042365chr1051165 1043 572 371 27 --1205 --
NM_001042387chr1051165 1043 572 371 27 --1205 --
NM_001042393chr1051165 1043 572 371 27 --1205 --
NM_001042396chr1051165 1043 572 371 27 --1205 --
NM_001042397chr1051165 1043 572 371 27 --1205 --
NM_001042414chr131298 ------
NM_001042453chrX31243 127 103 ------
NM_001042481chr1442391 782 288 154 ------
NM_001042510chr83881 201 151 ------
NM_001042511chr83881 201 151 ------
NM_001042533chr332690 1037 318 2771 713 ----
NM_001042543chr431380 1369 584 ------
NM_001042555chr1254751 4611 4248 1468 1004 14437 ----
NM_001042599chr2107722 7301 7089 6429 6050 5671 2644 2363 1491 1130 22731 2355 13108 --
NM_001042601chr353115 2472 2207 916 827 ------
NM_001042603chr12105312 5027 4622 3943 1755 1292 761 447 412 87 1437 15140 --
NM_001049chr1432357 773 613 ------
NM_001079874chr151995 1937 1700 762 459 ------
NM_001106chr3179646 9537 8810 7188 7087 6505 6395 6363 2215 1975 1852 1843 873 666 623 184 75 33587 3492 799 33900 2111 1020 13438
NM_001109977chr43640 534 335 ----1631
NM_001116chr1612964 ------
NM_001121chr1041497 538 417 101 ------
NM_001123chr101573 ------
NM_001146chr852033 1535 927 418 308 --1194 --
NM_001173chr1474710 4616 3750 1223 1079 509 33 ----1842
NM_001207chr52361 141 ------
NM_001215chr11371 ------
NM_001219chr712214 ------
NM_001220chr7142 ------
NM_001237chr43916 441 262 ------
NM_001237chr43916 441 262 ------
NM_001257chr1611507 ------
NM_001364chr1144196 2954 1337 1000 33743 1602 505 21447 74 --
NM_001378chr21181 ------
NM_001391chr1821075 77 ------
NM_001412chrX22873 55 13026 ----
NM_001422chr1121363 151 ------
NM_001429chr2221054 113 ------
NM_001446chr62269 24 ------
NM_001447chr51404 ------
NM_001449chrX1836 ------
NM_001526chr61139 ------
NM_001530chr14131 ------
NM_001533chr191320 ------
NM_001634chr62824 525 ------
NM_001650chr1844152 4063 3521 3093 ----12827
NM_001656chr52505 136 ------
NM_001660chr34818 771 566 205 ------
NM_001664chr32857 690 ------
NM_001682chr1262450 2231 2032 417 196 103 ------
NM_001703chr1167 ------
NM_001731chr122902 176 ----176
NM_001742chr71666 ------
NM_001792chr183777 181 26 1933 1461 --
NM_001806chr1972987 2129 1996 903 827 496 118 11927 11810 --
NM_001833chr9197 ------
NM_001850chr31136 ------
NM_001859chr983444 2981 2949 2892 1585 950 821 549 ------
NM_001904chr33989 976 163 ------
NM_001920chr121273 ------
NM_001938chr131631 1310 722 11445 ----
NM_001946chr122465 190 ------
NM_001969chr14103807 3455 3436 3318 1450 1287 1178 1001 803 258 --1398 1655
NM_002006chr475561 5458 3891 2082 1275 1093 104 --11067 --
NM_002025chrX98887 8444 7312 6854 3466 3423 3338 3152 2975 11373 11495 --
NM_002051chr101921 ------
NM_002056chr21713 ------
NM_002069chr741602 1459 638 365 ------
NM_002093chr3178 ------
NM_002106chr41275 ------
NM_002107chr11331 ------
NM_002126chr1773040 2720 2582 1493 947 395 28 13683 11602 --
NM_002137chr711854 ------
NM_002182chr342648 2207 1997 1965 ------
NM_002187chr5126 ------
NM_002196chr201195 ----146
NM_002196chr201195 ----146
NM_002207chr33711 484 70 1229 ----
NM_002210chr273397 3134 2909 2855 1101 503 400 13026 ----
NM_002222chr32240 163 ------
NM_002223chr1241561 1446 1212 601 ------
NM_002233chr111458 ----1188
NM_002247chr1031764 1732 1719 ------
NM_002264chr364937 1633 1378 998 791 501 1258 24064 3379 --
NM_002270chr595597 5580 5153 4408 4367 1761 1567 705 595 ----153
NM_002271chr1362324 1970 1542 1521 1497 699 ------
NM_002285chr264162 3818 1398 1133 812 60 ------
NM_002310chr576449 6399 6367 4702 2268 1691 1318 --184 --
NM_002336chr1254126 3694 3353 3195 527 11949 ----
NM_002408chr142592 564 ------
NM_002448chr41692 ------
NM_002480chr1211347 ----196
NM_002481chr1137780 7301 6599 6518 6323 6159 5782 5704 5533 5295 5247 3139 450 36312 3203 2619 16716 17499
NM_002482chr12702 66 --1159 --
NM_002500chr21157 ------
NM_002515chr1411704 ------
NM_002519chr111399 ------
NM_002538chr5177 ------
NM_002568chr81405 ------
NM_002570chr151283 ------
NM_002597chr11328 ------
NM_002600chr131253 552 134 ------
NM_002610chr252991 1902 797 402 52 ------
NM_002613chr1674143 3849 2072 1880 1461 1282 673 11901 --22095 881
NM_002645chr113208 120 24 ------
NM_002655chr874872 4457 3985 3429 1248 795 170 11627 12020 --
NM_002656chr62378 86 ------
NM_002657chr2083682 3539 2613 1083 914 827 363 152 1322 13775 1342
NM_002687chr1431332 514 124 --11026 --
NM_002711chr72188 56 ------
NM_002734chr171164 ------
NM_002737chr1776672 6467 5897 5011 2027 468 423 ----11673
NM_002745chr2284373 4341 4266 3244 2957 1795 1215 131 ----1584
NM_002748chr151893 ------
NM_002763chr1151 ------
NM_002819chr1911033 ------
NM_002834chr1293314 2884 2851 2725 1612 1512 1397 112 106 23150 410 --11527
NM_002839chr923399 849 12370 13351 --
NM_002848chr1221136 189 ------
NM_002869chr1122029 1819 --12161 --
NM_002874chr982309 2100 2060 1834 1742 844 122 79 1725 1564 --
NM_002886chr375122 4968 4347 2079 2014 596 122 53869 3817 3513 1658 93 --13249
NM_002938chr421988 326 --31716 1700 1574 --
NM_002951chr201282 ------
NM_002957chr993662 3534 3346 2814 1278 1162 307 119 111 --11332 --
NM_002959chr164425 4025 3440 1308 1235 1166 12969 1725 --
NM_002971chr31406 ------
NM_002977chr242400 1230 1043 399 ------
NM_002998chr831901 1499 482 ------
NM_003016chr1751249 737 523 386 61 ------
NM_003034chr1266780 6223 2964 1632 359 108 31987 1238 487 1168 28120 7175
NM_003036chr11157 ------
NM_003079chr172205 129 ----1946
NM_003111chr231294 214 107 ------
NM_003112chr74870 482 242 141 1659 ----
NM_003129chr84129 117 64 36 ------
NM_003133chr12403 204 ------
NM_003152chr1721253 28 --1880 --
NM_003157chr32768 85 ------
NM_003174chr104758 545 192 78 ------
NM_003176chr11345 ------
NM_003176chr11345 ------
NM_003184chr821092 452 ------
NM_003199chr1855306 4685 4101 1230 347 25424 3431 13461 --
NM_003203chr231850 1829 423 ------
NM_003211chr121171 ------
NM_003216chr22103183 2914 2736 2482 2403 2129 1212 870 510 264 13061 22368 600 --
NM_003236chr233544 2153 767 22246 938 1180 1600
NM_003246chr1511556 ------
NM_003263chr4151 ------
NM_003270chrX1382 ------
NM_003295chr132141 22 ------
NM_003298chr3115899 5812 5573 5561 5366 2420 1910 1126 986 380 228 11959 11028 --
NM_003299chr12283 21 ------
NM_003338chr1021942 248 ----11439
NM_003340chr421046 187 ------
NM_003380chr102315 122 ------
NM_003383chr91204 ------
NM_003385chr22880 120 ------
NM_003411chrY31532 1333 737 21476 392 ----
NM_003413chrX41755 1700 1427 775 ------
NM_003418chr31683 ------
NM_003463chr683269 3244 2966 2451 2445 2206 1083 190 ------
NM_003478chr1153320 2758 92 50 41 12118 ----
NM_003483chr1212378 ------
NM_003489chr2162197 2151 1240 851 565 25 ------
NM_003507chr261990 645 636 201 171 155 ------
NM_003559chr1793349 2548 2509 1459 1341 1239 891 764 613 23793 518 43702 2922 1277 315 13226
NM_003566chr128821 647 558 279 184 137 92 75 ------
NM_003574chr1843854 3736 1269 714 ----1442
NM_003587chr6184 ------
NM_003590chr263019 2876 1513 1131 1090 31 ------
NM_003597chr241964 1786 552 171 ------
NM_003603chr432098 1425 609 1420 ----
NM_003617chr154378 4024 880 558 165 ------
NM_003620chr1731036 1002 125 ------
NM_003628chr21629 ------
NM_003651chr122430 147 ------
NM_003663chr332346 1249 362 11066 11354 --
NM_003688chrX2282 266 ------
NM_003692chr931004 157 98 ------
NM_003705chr21599 ------
NM_003710chr155266 255 210 190 78 ----1146
NM_003718chr71350 ------
NM_003750chr103892 793 369 ------
NM_003787chr1811606 ------
NM_003791chr161427 ------
NM_003796chr191580 ------
NM_003800chr642184 1573 744 584 ------
NM_003806chr121222 ----184
NM_003825chr1531169 534 304 ------
NM_003850chr131144 ------
NM_003873chr102389 334 ------
NM_003877chr121826 ------
NM_003895chr2131642 638 220 ------
NM_003909chr862982 2741 2063 578 244 164 ------
NM_003934chr92375 243 ------
NM_003945chr51502 ------
NM_003957chr111776 ------
NM_003961chr161191 ------
NM_003966chr5127442 7103 2584 2539 2201 1800 1298 871 749 527 342 98 25013 2871 --14805
NM_003983chr1633404 3030 1573 1222 11181 11002
NM_003994chr1284193 3475 3391 2961 2836 1582 441 266 12826 ----
NM_004028chr1844152 4063 3521 3093 ----12827
NM_004035chr1784951 4785 3820 3413 3386 1584 1292 746 --14225 23882 822
NM_004077chr121360 ------
NM_004089chrX11235 ------
NM_004093chr1342792 2723 2669 1105 --11000 --
NM_004124chr1443544 3306 2893 433 ------
NM_004169chr171136 ------
NM_004170chr951815 1728 577 266 146 ------
NM_004171chr1198659 8262 6214 3771 2565 2357 1788 1506 374 ------
NM_004205chr111520 ------
NM_004226chr2125 ------
NM_004229chrX22040 1720 ------
NM_004261chr11765 ------
NM_004267chr31400 ------
NM_004275chr62406 274 ----11423
NM_004290chr541336 1202 526 391 ------
NM_004293chr963617 3377 3317 3117 227 104 ------
NM_004299chrX136 ------
NM_004331chr862288 1726 1058 1044 920 588 12366 ----
NM_004342chr732079 2041 1881 ------
NM_004349chr811051 ------
NM_004373chr12151 ------
NM_004379chr231507 1210 570 ------
NM_004380chr1672658 2441 2414 995 282 262 40 --21706 1618 --
NM_004385chr52108 100 ------
NM_004397chr11114147 3780 3516 3432 3170 2867 1269 1060 103 60 38 1683 ----
NM_004437chr193284 2821 2459 2371 1293 1220 658 455 264 1883 12442 --
NM_004440chr621998 477 ------
NM_004447chr122971 216 ------
NM_004448chr171609 ------
NM_004498chr151298 ------
NM_004499chr5147 ------
NM_004505chr1711477 --1360 --
NM_004571chr2163404 2852 2503 1348 702 31 ------
NM_004575chr431351 1337 1264 ------
NM_004588chr1163848 3366 3354 1539 1028 923 --33875 655 521 13471
NM_004602chr20176 ------
NM_004622chr241826 765 615 163 12115 --12291
NM_004645chr17191 ------
NM_004654chrY11302 ------
NM_004663chr1521576 237 ------
NM_004673chr111328 ------
NM_004677chrY2534 165 ------
NM_004703chr1751685 873 712 556 354 ------
NM_004705chr11141 ------
NM_004709chrX11322 ------
NM_004726chrX105734 5640 5283 5071 4717 4463 3736 1414 1104 860 ------
NM_004727chr1521736 163 ------
NM_004730chr521960 238 1425 ----
NM_004745chr876842 5861 5789 5337 5141 5131 1855 ------
NM_004748chr1563252 2581 1401 900 841 331 1967 ----
NM_004760chr732506 1756 435 ------
NM_004766chr3183 ------
NM_004775chr1821700 1524 --154 --
NM_004787chr4128 ------
NM_004789chr91341 ------
NM_004796chr1422271 66 --12170 --
NM_004798chr2032533 528 431 --13577 --
NM_004804chr272767 2546 2536 2455 1853 266 130 11809 ----
NM_004822chr1793923 3760 3234 2864 1301 1111 938 930 886 1615 43410 1123 1086 706 12706
NM_004834chr262083 1014 667 660 615 59 13124 11331 --
NM_004859chr1742910 2230 239 150 ----22721 2625
NM_004865chr62445 149 ------
NM_004904chr732154 1007 212 11993 16292 16069
NM_004906chr61204 ------
NM_004932chr541757 1206 1195 1147 11724 ----
NM_004949chr184627 327 165 156 11993 ----
NM_004956chr773969 3954 1437 819 679 432 281 21522 259 12877 1418
NM_004973chr651681 1521 329 209 63 1376 ----
NM_004976chr1165158 4885 2078 1857 1586 368 14218 ----
NM_004999chr674002 3495 3388 2909 1132 496 178 11555 ----
NM_005011chr72152 99 ------
NM_005054chr2127 ------
NM_005056chr12105556 5271 4866 4187 1999 1536 1005 691 656 331 1681 15384 --
NM_005065chr14105384 4919 4602 4131 1527 864 693 508 315 82 ------
NM_005066chr11176 ------
NM_005067chr31206 ------
NM_005087chr31124 ------
NM_005095chr11362 ------
NM_005109chr342538 1003 724 409 1820 ----
NM_005116chr20124525 4405 4060 3869 3166 2833 1780 1771 936 632 624 274 ------
NM_005124chr64963 889 818 123 1842 ----
NM_005151chr185957 803 661 191 117 11553 ----
NM_005156chr975118 4474 3668 1486 1346 813 660 13324 ----
NM_005168chr21146 ------
NM_005180chr103291 285 219 ------
NM_005188chr1177101 5841 2441 2398 2205 1772 1740 ------
NM_005190chr641045 293 207 35 ------
NM_005197chr1476065 5317 4305 4269 3959 1658 179 23918 1610 --14294
NM_005207chr22103096 2858 2401 1203 1143 1111 517 425 225 146 13693 ----
NM_005235chr2107722 7301 7089 6429 6050 5671 2644 2363 1491 1130 22731 2355 13108 --
NM_005238chr1173075 2930 1376 1072 966 901 467 12972 ----
NM_005242chr531380 1365 1299 ------
NM_005249chr141213 ------
NM_005254chr151930 ------
NM_005261chr81278 ------
NM_005275chr6147 ------
NM_005339chr484213 3903 3225 3091 2783 1471 978 734 1136 ----
NM_005359chr1896314 6159 5976 5338 5276 4778 2467 1025 954 36427 6322 6056 26030 1121 --
NM_005369chrX2261 60 ------
NM_005386chr201644 ------
NM_005387chr113246 194 76 ----1529
NM_005397chr744003 3664 3272 68 ------
NM_005400chr232277 1109 264 168 ----
NM_005401chr11196 ------
NM_005430chr121722 ------
NM_005436chr1044002 3849 3838 90 ------
NM_005442chr31562 ------
NM_005497chr1786009 5722 5635 4719 4539 2175 1463 569 11302 ----
NM_005523chr731402 1350 1009 --2516 264 1429
NM_005544chr21976 ------
NM_005572chr1196 ------
NM_005578chr375081 4862 4377 4112 3882 1424 755 13805 --1515
NM_005593chr121584 ------
NM_005596chr976249 5748 4997 4494 2490 1815 936 25144 81 11109 --
NM_005603chr1831958 1353 144 ------
NM_005618chr61429 ------
NM_005637chr182272 109 ------
NM_005662chr81429 ------
NM_005665chr164067 3847 3535 3167 1673 68 13293 ----
NM_005682chr1631387 344 110 ----1190
NM_005684chr1146 ------
NM_005737chr242753 1086 883 799 --22628 493 --
NM_005748chr1253450 3434 3129 2619 2232 12363 ----
NM_005752chr1641205 962 927 375 --11078 --
NM_005759chr244766 3229 971 349 14243 1910 --
NM_005765chrX3832 530 272 ------
NM_005767chr13170 ------
NM_005778chr31447 ------
NM_005792chr161396 ------
NM_005839chr13867 842 644 ------
NM_005840chrX76639 5898 5876 5147 2266 906 387 25940 75 17493 --
NM_005842chr131539 ------
NM_005845chr1321629 53 ------
NM_005857chr11265 ------
NM_005868chr72925 22 11646 ----
NM_005871chr101715 ------
NM_005880chr1621026 491 11034 ----
NM_005882chr41192 ----1379
NM_005900chr411041 ------
NM_005903chr584221 3878 3804 3691 1847 1763 909 800 14049 ----
NM_005909chr523919 261 ------
NM_005920chr163410 3293 1303 1012 753 189 23344 204 12977 --
NM_005935chr464822 4728 4641 4062 1179 30 --25078 4150 1891
NM_005941chr82607 567 12620 ----
NM_005955chr185508 5274 4503 3473 1242 458 284 183 45121 5046 4624 4197 11687 1818
NM_005967chr121730 ------
NM_005977chr131832 --1938 --
NM_006007chr973434 3213 3082 1533 1066 1043 477 24014 3383 ----
NM_006047chr2073324 2920 2889 2548 2456 1096 824 12309 ----
NM_006076chr733122 1991 617 --1131 1102
NM_006106chr11102881 2342 2244 1370 1346 1250 1093 834 292 267 ------
NM_006107chr173436 347 57 ------
NM_006108chr1132137 2098 742 11940 21758 1632 --
NM_006113chr151995 1937 1700 762 459 ------
NM_006135chr12577 551 ------
NM_006136chr71925 ------
NM_006157chr112164 150 ------
NM_006180chr91572 ------
NM_006190chr231080 692 284 1210 ----
NM_006197chr831384 324 298 ------
NM_006206chr422016 410 1242 --12667
NM_006246chr144966 957 856 192 ------
NM_006252chr136531 5745 75 15841 ----
NM_006256chr12408 276 ------
NM_006267chr241472 1262 393 343 ------
NM_006282chr2084770 4590 4459 4417 4392 2921 2895 1267 ------
NM_006306chrX85850 4755 4230 3786 3733 875 606 299 1397 ----
NM_006315chr484403 3910 3062 2977 1410 1267 642 45 13726 --11468
NM_006325chr122216 193 ------
NM_006352chr131885 1677 627 --11765 --
NM_006357chr21131 ------
NM_006366chr621159 1082 ------
NM_006393chr1054085 3972 3492 1167 365 ----11605
NM_006431chr12128 ------
NM_006457chr484056 3974 3838 3535 3109 3050 2581 1310 13304 --12870
NM_006469chr131377 237 172 ------
NM_006489chr1411704 ------
NM_006516chr111412 ------
NM_006529chr431371 1360 575 ------
NM_006537chr151114 ------
NM_006544chr1495402 5164 4489 4031 1839 1599 1348 1091 181 11003 ----
NM_006546chr17136578 6548 6388 6210 5483 5455 4762 4649 4079 1912 1117 760 432 36043 4061 1180 --15040
NM_006547chr712006 ------
NM_006582chr1139 ------
NM_006595chr1121645 257 ------
NM_006599chr1647717 5916 1955 1920 1524 16986 --
NM_006628chr1554480 3789 1844 556 404 11112 ----
NM_006654chr1254751 4611 4248 1468 1004 14437 ----
NM_006706chr51157 ------
NM_006713chr52567 106 ------
NM_006718chr62378 86 ------
NM_006721chr101573 ------
NM_006734chr631170 363 355 ------
NM_006738chr15103910 3711 3671 3661 3487 3129 2825 406 375 300 ------
NM_006754chr72972 371 ------
NM_006759chr21259 ------
NM_006761chr17162 ------
NM_006775chr632475 2089 979 ------
NM_006805chr571320 1169 471 451 380 325 270 --2151 120 --
NM_006814chr2062212 2172 1721 1012 867 348 11628 ----
NM_006838chr1241651 1552 307 145 ------
NM_006852chr1762594 1781 994 936 186 71 12042 1817 --
NM_006857chr22795 324 ------
NM_006868chr1852778 2184 508 480 360 ------
NM_006895chr242035 1441 161 115 ------
NM_006922chr222572 2493 ------
NM_006924chr17124011 3748 3410 3348 2969 2928 2749 1734 1640 1411 399 297 21418 1277 11445 --
NM_006925chr142396 119 ------
NM_006948chr2142022 1922 1740 728 1197 ----
NM_006951chr103244 133 26 ------
NM_006981chr962414 2017 294 227 201 74 11098 ----
NM_006997chr103477 331 21 ------
NM_007005chr93619 569 219 ------
NM_007006chr1682913 2662 2625 2572 1316 1014 896 400 12449 12862 --
NM_007011chr15116675 6014 5420 4632 4597 4282 4273 1968 1005 742 469 36385 6002 1293 --14800
NM_007026chr172571 215 ------
NM_007042chr362589 2205 2098 1071 354 22 2482 236 ----
NM_007045chr61551 ------
NM_007050chr20127443 6825 6506 5757 5320 5000 3083 1138 914 849 797 280 --1449 --
NM_007078chr1072967 2700 2474 2417 1910 588 126 --11892 --
NM_007084chr1321228 961 ------
NM_007096chr9197 ------
NM_007111chr132782 728 ------
NM_007146chr1732542 2067 866 1656 ----
NM_007173chr1171781 1718 1583 940 542 536 264 ------
NM_007195chr1843210 3072 1498 1489 33540 1182 831 ----
NM_007197chr121789 ------
NM_007200chr15103910 3711 3671 3661 3487 3129 2825 406 375 300 ------
NM_007202chr172743 562 ------
NM_007203chr9113868 3833 3449 3070 3015 2808 1365 1219 1043 252 37 ----1949
NM_007214chr62903 59 ------
NM_007249chr1399428 8792 7808 5795 3698 3607 2766 1294 385 12581 --11363
NM_007292chr1784951 4785 3820 3413 3386 1584 1292 746 --14225 23882 822
NM_007345chr1822357 68 ------
NM_007347chr1523176 433 --1657 --
NM_007350chr1241391 1296 129 80 14602 11430 1431
NM_007358chr131992 1885 665 1380 ----
NM_012081chr543268 2759 2354 410 2335 253 1517 --
NM_012095chr1043529 2971 1251 234 ------
NM_012113chr11398 ------
NM_012141chr1373336 1284 1247 994 918 825 439 1385 ----
NM_012193chr1185197 4757 4444 3889 3514 1947 194 57 --1281 11595
NM_012199chr163890 3877 3787 3674 1836 1296 1832 23258 2858 --
NM_012214chr2106092 5731 4379 4277 2154 1811 1588 1431 563 140 14598 ----
NM_012245chr141426 ------
NM_012249chr243522 2960 2451 1224 ------
NM_012255chr201409 ------
NM_012287chr374250 4168 3436 3319 3096 1325 120 ------
NM_012297chr442610 2016 1928 82 21898 401 --1216
NM_012309chr1164738 4322 1874 1510 667 201 --13915 --
NM_012316chr1105388 5366 4866 4784 2178 1801 1325 737 545 439 ------
NM_012330chr1051585 1400 1366 278 266 1714 ----
NM_012406chr1221041 26 ------
NM_012417chr171515 ------
NM_012464chr442515 753 544 446 ------
NM_013230chrY41724 1384 601 569 ------
NM_013238chr1311241 ----2598 480
NM_013263chr162127 113 ------
NM_013314chr10190 ------
NM_013352chr63861 223 164 ------
NM_013374chr342928 2266 2146 1031 1913 ----
NM_013386chr111741 ------
NM_013444chrX1372 ------
NM_013445chr21131 ------
NM_013943chr163267 3192 2542 2134 811 445 1244 ----
NM_014003chr161388 ------
NM_014011chr23933 717 451 11893 ----
NM_014016chr32449 32 ------
NM_014023chr1052689 2627 2436 1946 598 --12201 --
NM_014028chr643351 2427 2247 187 1887 ----
NM_014043chr31201 ------
NM_014048chr1631933 1518 614 ------
NM_014071chr203428 392 29 ------
NM_014089chr1321564 1386 ------
NM_014155chr1197033 5938 4765 4579 1922 1841 1203 735 305 11180 26182 149 158
NM_014178chr141108 ------
NM_014183chr202226 99 ----1295
NM_014217chr131443 1229 157 ------
NM_014236chr11240 ------
NM_014238chr1751426 1281 1213 1144 630 --21195 1066 11153
NM_014253chrX11654 ------
NM_014278chr41123 ------
NM_014279chr91707 ------
NM_014294chr831055 909 474 1286 ----
NM_014305chr131105 ------
NM_014319chr122313 210 ------
NM_014332chrX1351 ------
NM_014333chr1171765 834 403 263 255 172 136 ------
NM_014368chr951375 862 682 403 217 --11780 --
NM_014415chr311605 --192 --
NM_014423chr5105321 5099 4708 4134 3492 2271 2124 1265 430 336 35623 5534 5089 --23942 1961
NM_014435chr41180 ------
NM_014494chr1632279 724 285 --12311 --
NM_014503chr121425 ------
NM_014515chr122770 704 --142 --
NM_014516chr191244 ------
NM_014521chr211824 ------
NM_014574chr1461176 1038 572 407 360 38 ------
NM_014592chr53246 126 101 ------
NM_014612chr91124 ------
NM_014616chr353384 3093 2755 2415 948 ------
NM_014637chr831451 1135 376 11267 1576 --
NM_014660chr751152 1123 405 210 179 ------
NM_014666chr511173 ------
NM_014671chr721482 527 1638 ----
NM_014682chr821710 186 ------
NM_014701chr1532859 2392 2370 ------
NM_014705chr731953 529 230 --11986 1379
NM_014717chr191664 ------
NM_014720chr1031599 1506 721 1295 ----
NM_014729chr831858 1762 231 ------
NM_014730chr1294829 4435 3561 3389 1830 1737 1595 1073 871 34393 3612 745 --13796
NM_014730chr1294829 4435 3561 3389 1830 1737 1595 1073 871 34393 3612 745 --13796
NM_014733chr561748 1688 1443 1403 556 517 ------
NM_014741chr1142123 1952 1603 155 1204 1728 2867 228
NM_014747chr1114852 4737 4654 4470 4322 4152 3583 2080 1524 1320 1086 11058 34561 1701 1685 --
NM_014767chr1033407 3128 2993 ----23600 997
NM_014802chr122910 144 ------
NM_014819chr522127 876 ------
NM_014820chr321737 1678 --11921 --
NM_014830chr1211487 ------
NM_014841chr63336 287 221 154 ----
NM_014850chr363894 3647 3633 3431 1637 1118 --23904 101 --
NM_014877chr1797814 7636 6753 5566 3063 2330 1575 1469 706 16806 27683 6601 --
NM_014883chr462067 2004 1750 866 494 466 --188 --
NM_014887chr131764 --167 --
NM_014897chr1722169 2126 ------
NM_014910chr191139 ------
NM_014947chr162648 2316 2288 2101 2057 248 12022 1672 --
NM_014949chr11820 ------
NM_014950chr141182 ------
NM_014962chr2032439 346 324 11897 ----
NM_014970chr1167 ------
NM_014978chr101688 ------
NM_014982chr1444937 4009 3332 2043 ------
NM_014988chr432284 647 588 ------
NM_014991chr42349 68 ------
NM_014992chr141739 ------
NM_014996chr3184 ------
NM_015002chr1242224 2105 1581 1556 ------
NM_015008chr373290 2687 1235 868 475 242 212 ------
NM_015025chr252273 877 570 476 271 ------
NM_015027chr1622022 1328 ------
NM_015032chr1332935 655 39 22423 499 ----
NM_015035chr20126637 6499 6432 5782 5048 2659 2122 2104 1953 1259 1069 873 24161 1869 16541 14586
NM_015039chr174063 2867 1653 1040 524 213 184 ----21594 262
NM_015042chr1584314 3933 3888 3340 3196 1629 1421 555 --1982 32771 1049 973
NM_015045chr1032181 1788 125 ------
NM_015051chr962622 2168 2095 1168 539 446 12629 --12159
NM_015068chr733194 3044 1045 ------
NM_015071chr596141 5373 4225 1965 1958 1556 1408 1333 938 11973 ----
NM_015072chr141593 ------
NM_015074chr174841 4795 4014 1883 1244 662 487 13664 --11113
NM_015092chr1644611 2910 972 346 13957 ----
NM_015110chr932400 110 25 ------
NM_015149chr13889 614 603 ------
NM_015156chr1452522 1460 843 504 357 ------
NM_015172chr121481 1454 --1466 1123
NM_015191chr111962 ------
NM_015200chr45991 947 820 522 69 ------
NM_015213chr111144 ------
NM_015265chr222450 160 ------
NM_015267chr1221390 357 ------
NM_015271chr464227 3302 2646 1630 961 523 ------
NM_015278chr652782 2674 2454 2241 957 ------
NM_015285chr1822355 1894 ------
NM_015288chr562467 2373 1515 1429 983 435 ----23284 3006
NM_015315chr592792 2367 2255 1377 1247 1016 893 873 622 11281 13209 --
NM_015328chr743064 2297 954 438 ------
NM_015344chr82301 199 --1109 --
NM_015361chr2172 ------
NM_015365chrX33893 3032 1522 1783 ----
NM_015387chr221942 606 ------
NM_015435chr82556 47 ------
NM_015455chr564111 3224 3035 1109 509 112 ------
NM_015492chr1521052 240 ------
NM_015514chr142561 59 ------
NM_015525chr61831 ------
NM_015534chr12818 78 ------
NM_015548chr61837 ------
NM_015554chr1542117 894 869 521 --1825 --
NM_015565chr213906 196 58 ------
NM_015571chr621952 102 ------
NM_015575chr262746 1483 1448 1322 931 63 33324 3190 2458 1228 --
NM_015605chr1051165 1043 572 371 27 --1205 --
NM_015640chr165152 4659 3531 1670 1576 1093 1560 ----
NM_015678chr1311632 ------
NM_015879chr1898375 8308 8227 7804 6079 5925 5321 2078 278 16792 ----
NM_015886chr875404 5370 1732 1497 1290 1036 965 25599 1931 ----
NM_015888chr173163 2275 1333 1074 1000 594 567 1223 --13020
NM_015902chr81853 ------
NM_015904chr22294 94 ------
NM_015905chr72397 121 ------
NM_015906chr154112 3275 3109 3013 391 13849 ----
NM_015975chrX2501 461 ------
NM_016039chr14169 ------
NM_016042chr91242 ------
NM_016045chr2051796 659 543 343 266 ------
NM_016047chr2124 ------
NM_016072chr1222309 707 ----11717
NM_016076chr152561 2084 1246 789 566 --12521 12327
NM_016096chr83881 201 151 ------
NM_016127chr8142 ------
NM_016152chr3195 ------
NM_016203chr71713 ------
NM_016213chr15172 ------
NM_016217chr6113552 3351 3119 2590 2400 1355 1052 685 405 397 231 13001 ----
NM_016224chr631926 1707 238 --150 --
NM_016257chr163543 2215 1413 728 482 302 ------
NM_016258chr11694 ------
NM_016260chr276689 6116 4941 2282 2219 1638 1322 57279 7062 6666 2674 1667 11376 --
NM_016262chr6180 ------
NM_016271chr1811529 ------
NM_016302chr33308 231 61 --1132 --
NM_016315chr211555 ------
NM_016320chr112773 69 ------
NM_016322chr963240 2751 2574 2488 1125 490 22830 876 ----
NM_016357chr1241036 365 127 115 11064 ----
NM_016374chr111276 ------
NM_016374chr111276 ------
NM_016376chr17104162 4105 3787 3466 3362 3266 3096 2785 1186 311 1761 ----
NM_016396chr15154 ------
NM_016403chr113758 480 166 ------
NM_016422chr1132380 2241 590 --1782 --
NM_016424chr1741941 1852 1562 255 ------
NM_016542chrX31243 127 103 ------
NM_016575chr1275092 3694 3356 2149 1603 1021 89 15337 14135 --
NM_016620chr111065 ------
NM_016628chr10194 ------
NM_016631chr211977 ------
NM_016654chr151930 ------
NM_016734chr931897 1645 574 1689 --31999 1303 1290
NM_016824chr1041497 538 417 101 ------
NM_017426chr42565 113 ------
NM_017447chr2174380 4258 3170 1588 1427 846 604 1204 13662 --
NM_017452chr20176 ------
NM_017453chr20176 ------
NM_017454chr20176 ------
NM_017544chrX1767 ------
NM_017551chr10112700 2617 2255 2243 2102 1072 974 968 805 609 496 --12021 --
NM_017553chr1521108 69 1521 ----
NM_017554chr321931 200 ------
NM_017563chr365427 4310 2026 1756 267 117 --190 --
NM_017599chr1262072 1646 1519 775 521 261 ------
NM_017629chr11768 ------
NM_017633chr653928 3798 3785 3036 2621 ------
NM_017637chr978605 8341 8147 7356 5704 3025 1463 39388 8796 2181 189 --
NM_017643chr1773008 2454 2114 2064 1142 614 261 22501 764 ----
NM_017646chr1124 ------
NM_017658chr1453073 1512 972 637 449 ------
NM_017661chr1541209 1034 415 47 1434 ----
NM_017694chr221814 1497 ----1458
NM_017742chr1821701 1408 ------
NM_017755chr53660 522 177 ------
NM_017780chr81603 ------
NM_017848chrX73523 3166 2935 1820 1555 1465 1302 24550 1410 13699 --
NM_017875chr32701 267 ------
NM_017902chr1095547 2160 2130 1953 1086 702 463 185 148 23653 1754 ----
NM_017915chr121871 ------
NM_017988chr122769 707 --183 --
NM_018011chr131243 ------
NM_018061chr141482 1453 535 446 11302 ----
NM_018084chr232947 1322 1073 ------
NM_018086chr221431 158 ------
NM_018126chr411315 ------
NM_018133chr342179 1741 1438 832 ------
NM_018155chr333271 3013 2254 ------
NM_018199chr1421197 190 ------
NM_018200chr1512516 ------
NM_018206chr161602 ------
NM_018247chr663146 3058 1960 1151 907 717 ------
NM_018287chr1031246 416 84 ------
NM_018293chr342800 1868 1852 116 ------
NM_018299chr84953 788 515 283 ------
NM_018319chr146538 362 331 314 290 219 --1576 --
NM_018327chr2041235 689 536 168 ------
NM_018332chr163869 204 145 --1502 --
NM_018334chr71497 ------
NM_018354chr202271 235 ------
NM_018365chr151108 ------
NM_018416chr1231828 1673 526 21874 679 --2861 396
NM_018439chr1822432 2190 --11792 1463
NM_018440chr866700 6654 2690 2094 1805 910 28129 125 11290 --
NM_018442chr13286 148 108 ------
NM_018444chr831674 1456 938 22354 1487 --1659
NM_018471chr21486 ------
NM_018509chr1731717 1392 43 --2257 37 --
NM_018557chr211338 ------
NM_018569chr431440 644 487 ------
NM_018695chr522181 296 ------
NM_018698chrX21708 158 ------
NM_018708chr1921514 1246 ------
NM_018712chr1131395 1028 439 1528 --11168
NM_018834chr521035 305 ------
NM_018934chr51289 ------
NM_018945chr662466 2405 1112 644 567 122 ------
NM_018951chr721021 814 --1305 --
NM_018957chr221349 ------
NM_018963chr211109 ------
NM_018994chr1268 43 --1400 --
NM_018999chr1033856 1484 90 ----14534
NM_019004chr721931 429 ------
NM_019006chr151282 ------
NM_019022chr1853126 706 409 311 170 ------
NM_019072chr534271 3586 857 ------
NM_019074chr151931 ------
NM_019116chr1663362 1429 1007 707 442 421 ------
NM_019594chr91258 ------
NM_019600chr151789 ------
NM_019843chr222442 96 ------
NM_019891chr111256 ------
NM_019903chr1041497 538 417 101 ------
NM_020122chr295901 5424 1971 1292 1271 1185 1179 350 72 ------
NM_020123chr1051087 981 366 216 27 ------
NM_020159chr431732 1370 1305 ------
NM_020199chr541202 487 445 131 ------
NM_020225chr4180 ------
NM_020243chr22174 ------
NM_020245chr674654 3958 3691 3480 1605 237 43 1634 --1463
NM_020337chr433154 2655 2293 ------
NM_020338chr1053127 3073 978 846 241 --22671 489 2794 706
NM_020351chr31136 ------
NM_020357chr331300 1122 89 ------
NM_020374chr1241975 1871 594 296 ----11398
NM_020390chr344007 3582 1627 1298 23046 1884 ----
NM_020416chr452596 2475 2026 870 561 ------
NM_020432chr72477 391 ------
NM_020443chr1106241 6176 5320 5270 5068 5044 2651 2392 1780 940 35751 991 258 ----
NM_020453chr432070 255 122 ------
NM_020466chr654351 3830 3498 1987 471 ------
NM_020642chr111593 ------
NM_020644chr112995 784 ------
NM_020718chr16106093 5475 5282 4706 2601 1656 1225 849 756 327 25275 4096 --11036
NM_020737chr62300 243 ------
NM_020739chr1563252 2581 1401 900 841 331 1967 ----
NM_020747chr51609 ------
NM_020748chr173698 195 107 ------
NM_020766chrX43661 1219 871 195 1242 --1755
NM_020774chr1845988 4732 1261 907 25532 1344 ----
NM_020778chr1574857 1978 1532 1318 1263 1079 1042 14335 1706 1125
NM_020792chr332797 2180 57 ----1748
NM_020794chr11981 ------
NM_020801chr52949 592 1937 --180
NM_020826chr1163709 3532 2535 2359 812 29 ----1884
NM_020839chr341449 1122 1059 654 11087 ----
NM_020854chr1841328 504 307 180 --1986 --
NM_020856chr191228 ------
NM_020935chr273529 1764 1757 1106 716 147 86 1396 ----
NM_020948chr143173 2953 2530 28 ------
NM_020973chr43570 187 42 ------
NM_020981chr23826 594 144 ------
NM_020993chr1272678 2002 1000 803 704 675 90 --1742 1226
NM_021033chr1323512 3316 ------
NM_021069chr432098 1425 609 1420 ----
NM_021083chrX73499 3421 3276 2713 2288 1191 147 1618 ----
NM_021090chr2274012 4004 1805 1086 742 589 92 11319 --11383
NM_021116chr7108647 8158 7291 6184 6094 3635 2822 2073 1430 1260 26944 5798 13384 --
NM_021167chr752687 2422 2374 2285 2250 ------
NM_021179chr1148 ------
NM_021191chr1232187 2147 579 12349 ----
NM_021194chr11221 ------
NM_021203chr32151 49 --1632 --
NM_021239chr1411383 ------
NM_021622chr101791 --1689 --
NM_021629chr343912 1400 814 667 1950 ----
NM_021638chr463777 1515 1180 814 613 400 --23383 931 11173
NM_021647chr463695 3611 3344 3053 1745 1261 ------
NM_021738chr104758 545 192 78 ------
NM_021813chr6105709 5065 5009 2327 1985 1844 1623 1331 1175 784 --11559 --
NM_021911chr564881 2148 1874 1356 302 74 11235 11728 --
NM_021912chr1563828 3720 3309 2792 2651 1390 22957 1593 23771 778 --
NM_021931chr2031054 862 797 ------
NM_021945chr673348 2436 2222 1392 1007 189 45 13548 --1675
NM_021956chr621062 399 ------
NM_021964chr395828 5268 4166 2519 2257 2122 1597 1471 1063 ------
NM_021998chrX31393 1044 53 ------
NM_021999chr131567 ------
NM_022090chr51484 ------
NM_022114chr164706 3938 3083 1727 1310 932 ------
NM_022130chr52539 323 ----11043
NM_022133chr811761 ------
NM_022138chr651481 1413 1217 480 229 ------
NM_022166chr1665337 4538 3971 1867 1377 702 12463 1973 11858
NM_022337chr111508 ------
NM_022366chr1143 ------
NM_022456chr12157230 7096 6891 6459 6310 5773 5639 5307 2981 2898 2310 2259 1063 949 695 32635 1641 1125 16682 --
NM_022457chr11119 ------
NM_022576chr11328 ------
NM_022652chr122465 190 ------
NM_022716chr152862 2448 2440 1986 1250 ------
NM_022739chr1721206 823 ------
NM_022753chr12146 98 --152 --
NM_022781chr933308 3096 2612 ------
NM_022843chr1331101 248 47 ------
NM_022898chr1474581 3978 3690 1827 825 613 421 1971 14555 --
NM_022900chr71840 ------
NM_023037chr132883 95 ------
NM_023929chr8261 37 ------
NM_024086chr1732969 753 47 1994 ----
NM_024315chr7169 ------
NM_024332chrX41445 610 467 447 --185 --
NM_024345chr955973 5426 5070 4659 1098 ------
NM_024408chr182392 2377 954 760 671 446 325 252 42707 2586 2409 280 1607 --
NM_024423chr1854095 3451 722 625 171 ------
NM_024429chr71713 ------
NM_024482chr1139 ------
NM_024522chr14177 171 165 153 --11295 --
NM_024548chr321636 74 ------
NM_024576chr61154 ------
NM_024582chr41255 ------
NM_024586chr11575 ------
NM_024645chr851508 292 217 199 153 ------
NM_024665chr334156 328 262 ------
NM_024674chr1102807 2749 2469 2178 887 637 623 542 121 88 --11978 --
NM_024675chr16160 ------
NM_024721chr821895 261 ------
NM_024740chr1183891 3586 3512 2578 2540 1507 1418 829 1803 ----
NM_024761chr985341 4970 4915 4867 3611 2113 444 21 ------
NM_024835chr171372 ------
NM_024926chr71225 ------
NM_024949chr464323 3685 1536 1174 696 463 ------
NM_024969chr24836 661 318 106 ------
NM_024989chr277086 6264 3146 3123 2048 2001 780 21061 101 ----
NM_024993chr221498 1065 ------
NM_025040chr1931993 1786 1515 ----11551
NM_025133chr2162 ------
NM_025160chr182916 1641 1081 833 729 373 145 63 ----12879
NM_025212chr4134 ------
NM_030621chr1443916 1279 711 184 13781 ----
NM_030625chr1042329 2150 920 587 ------
NM_030647chr775873 5698 4270 2305 1272 398 185 25755 36 ----
NM_030667chr1221136 189 ------
NM_030668chr1221136 189 ------
NM_030669chr1221136 189 ------
NM_030670chr1232168 1780 596 11607 ----
NM_030671chr1232168 1780 596 11607 ----
NM_030674chr1255144 4418 4164 2025 1909 1693 --14645
NM_030791chr1421157 642 1248 ----
NM_030799chr541872 1759 1705 122 ------
NM_030806chr178871 8030 7424 6904 6473 2205 1468 47244 1763 1152 504 28535 7953 --
NM_030816chr122550 976 ------
NM_030820chr63725 198 189 ------
NM_030877chr20183 ------
NM_030918chr165181 4379 4005 3769 1436 354 13838 14636 --
NM_030939chr631144 1116 933 ------
NM_030953chr531622 1459 500 ------
NM_030979chr131430 ------
NM_031216chr1831952 805 370 ------
NM_031243chr711854 ------
NM_031266chr5147 ------
NM_031267chr71350 ------
NM_031268chr1674143 3849 2072 1880 1461 1282 673 11901 --22095 881
NM_031283chr21861 ------
NM_031284chr152723 76 ------
NM_031296chr422597 1734 ------
NM_031371chr111276 ------
NM_031371chr111276 ------
NM_031407chrX2426 360 ------
NM_031419chr311513 ------
NM_031422chr182492 221 ------
NM_031442chrX22397 2071 ----1621
NM_031468chr7137897 7780 7599 6959 6273 5661 5627 3180 2801 2787 1212 911 714 27677 1285 35958 1651 1073 --
NM_031885chr16172 ------
NM_031914chr142843 165 ------
NM_031990chr1911033 ------
NM_031991chr1911033 ------
NM_032041chr872493 2176 1943 1068 895 659 315 ------
NM_032047chr332246 1871 339 ------
NM_032105chr1127913 7434 6732 6651 6456 6292 5915 5837 5666 5428 5380 583 26445 2752 16849 17632
NM_032116chr1375406 5108 3986 3706 1458 462 83 ------
NM_032182chr1041393 1146 1044 174 --11200 --
NM_032186chr111065 ------
NM_032217chr42256 42 ------
NM_032239chr471326 1206 995 510 452 362 325 ------
NM_032288chr342320 1655 919 827 --1693 --
NM_032291chr12107 24 ----11204
NM_032329chr294442 4391 4196 3338 3076 3064 3022 1279 608 22834 1037 1666 --
NM_032410chr821112 786 ------
NM_032446chr552773 2504 1267 1172 120 12534 ----
NM_032457chr423740 2713 ------
NM_032458chrX12145 ------
NM_032574chr2193 ------
NM_032582chr1711500 --1371 --
NM_032626chr161361 ------
NM_032635chr19174 ------
NM_032638chr341470 1129 1004 985 1242 --1369
NM_032689chr191273 ------
NM_032717chr42928 314 ------
NM_032778chr332690 1037 318 2771 713 ----
NM_032800chr172531 2389 2242 2161 773 225 131 --22123 1071 --
NM_032833chr162371 2227 2142 584 330 119 --11641 --
NM_032873chr1143300 799 717 36 34309 1195 233 13132 1409
NM_032884chr1393 64 37 ------
NM_032967chrX1389 ------
NM_032971chrY1416 ------
NM_032972chrY1416 ------
NM_032978chr1821075 77 ------
NM_032979chr1821075 77 ------
NM_032981chr1821075 77 ------
NM_033020chr154112 3275 3109 3013 391 13849 ----
NM_033117chr92263 140 ------
NM_033138chr732079 2041 1881 ------
NM_033139chr732079 2041 1881 ------
NM_033140chr732079 2041 1881 ------
NM_033143chr421015 328 ------
NM_033157chr732079 2041 1881 ------
NM_033253chr23339 145 121 ------
NM_033285chr863523 1754 849 744 598 260 --13984 --
NM_033305chr911260 ------
NM_033430chr453670 1459 1361 787 384 21369 1292 --22987 324
NM_033437chr453670 1459 1361 787 384 21369 1292 --22987 324
NM_033505chr2114506 2000 1917 1782 1328 1313 856 389 161 151 118 25907 2469 11096 --
NM_033512chr872931 2918 2427 2206 2072 1938 110 ------
NM_033551chr592792 2367 2255 1377 1247 1016 893 873 622 11281 13209 --
NM_033624chr1242224 2105 1581 1556 ------
NM_033631chr1123841 3822 3663 3414 3263 2985 2956 2937 2754 2370 1407 835 --21428 516 --
NM_033656chr2195640 5577 5550 5005 4654 4251 2101 1682 221 ------
NM_052834chr1822355 1894 ------
NM_052845chr1262548 2206 1026 942 523 425 1186 2231 25 --
NM_052857chr172387 159 ------
NM_052879chr1283926 3171 2723 1263 770 333 138 76 ------
NM_052905chr221295 452 ------
NM_052911chr181823 ----1675
NM_052927chr571597 1404 776 598 343 314 76 ------
NM_052958chr81719 ------
NM_053016chr956763 6621 3023 2152 2017 15022 16193 12234
NM_053023chr1142083 1092 885 692 12967 11289 --
NM_053043chr766409 6108 4445 4179 1874 1200 15814 26229 6008 --
NM_053064chr1422220 374 ------
NM_058229chr8170 ------
NM_080546chr952208 2144 2122 1985 922 ------
NM_080617chr201198 ------
NM_080654chr1121282 185 ------
NM_080664chr1431983 1399 123 ------
NM_080678chr21574 ------
NM_080867chr1455052 4291 4113 3502 78 1944 ----
NM_080872chr863422 2865 1087 254 222 92 11579 --142
NM_100264chr10194 ------
NM_100486chr10194 ------
NM_130387chr311074 ------
NM_130391chr923399 849 12370 13351 --
NM_130392chr923399 849 12370 13351 --
NM_130393chr923399 849 12370 13351 --
NM_130798chr1531169 534 304 ------
NM_133170chr20127443 6825 6506 5757 5320 5000 3083 1138 914 849 797 280 --1449 --
NM_133329chr231838 660 363 ------
NM_133367chr651257 1214 688 464 200 149 ----
NM_133370chr483597 3193 2944 2756 1286 684 337 230 ------
NM_133450chr161375 ------
NM_133493chr674409 3631 3051 1810 1732 1523 259 ------
NM_133496chr144471 4359 3119 1095 11368 ----
NM_133503chr121273 ------
NM_133504chr121273 ------
NM_133505chr121273 ------
NM_133506chr121273 ------
NM_134428chr91127 ------
NM_134442chr231507 1210 570 ------
NM_134447chr191580 ------
NM_138319chr151283 ------
NM_138323chr153670 162 110 ------
NM_138444chr1374173 3982 1761 1322 333 323 208 ------
NM_138459chr642960 2369 1450 1045 1239 12351 --
NM_138468chr2105859 5778 5136 4301 3892 596 480 434 342 187 16059 ----
NM_138479chr151808 1769 1711 801 778 ----1152
NM_138554chr912112 ------
NM_138569chr6145 ------
NM_138576chr1474581 3978 3690 1827 825 613 421 1971 14555 --
NM_138713chr1647717 5916 1955 1920 1524 16986 --
NM_138714chr1647717 5916 1955 1920 1524 16986 --
NM_138771chr741504 1167 982 375 ------
NM_138782chr512312 ------
NM_138959chr1136822 5789 4889 4805 4798 4780 4598 4578 4206 2450 1638 294 160 25516 1216 2970 249 --
NM_138966chr181394 ------
NM_138970chr1422271 66 --12170 --
NM_139131chr113246 194 76 ----1529
NM_139132chr112773 69 ------
NM_139201chr121721 ------
NM_144571chr475887 5711 4924 2783 1072 650 471 26919 4380 12605 15853
NM_144574chr141135 ------
NM_144578chr1455415 5358 1416 510 157 --15316 --
NM_144595chr131978 ------
NM_144604chr16160 ------
NM_144632chr242438 2057 1858 1492 ------
NM_144658chrX153 ------
NM_144685chr191199 ------
NM_144703chr2061183 1120 848 162 146 116 1195 ----
NM_144723chr51777 ------
NM_144726chr531208 776 495 ------
NM_144767chr15103910 3711 3671 3661 3487 3129 2825 406 375 300 ------
NM_144949chr23933 717 451 11893 ----
NM_144973chr12124935 4810 3526 3323 3245 1018 625 588 329 322 120 64 --1463 --
NM_145000chr52567 500 ------
NM_145014chr111372 ------
NM_145049chr51360 ------
NM_145052chrX4880 852 299 122 ------
NM_145176chr653130 2685 2511 1342 59 ------
NM_145247chr101425 ------
NM_145290chr42261 114 ------
NM_145307chr1033796 1320 759 1330 ----
NM_145686chr262083 1014 667 660 615 59 13124 11331 --
NM_145687chr262083 1014 667 660 615 59 13124 11331 --
NM_145753chr321668 345 --1472 --
NM_145808chr751204 1032 703 622 174 --1979 --
NM_147150chr9113868 3833 3449 3070 3015 2808 1365 1219 1043 252 37 ----1949
NM_148177chr8170 ------
NM_148904chr11575 ------
NM_148905chr11575 ------
NM_148906chr11575 ------
NM_148907chr11575 ------
NM_148908chr11575 ------
NM_148909chr11575 ------
NM_148918chr171136 ------
NM_152261chr1231923 885 92 11902 ----
NM_152267chr2242156 1993 879 153 ------
NM_152277chr531501 1352 308 ------
NM_152298chr12702 66 --1159 --
NM_152305chr33396 375 210 ----1502
NM_152330chr1442391 782 288 154 ------
NM_152373chr12218 103 ------
NM_152407chr543061 624 448 111 12535 ----
NM_152450chr1521511 470 ------
NM_152622chr522565 686 ------
NM_152624chr5157466 7184 7035 6950 6465 5843 5491 4895 2533 2130 1715 1672 1253 905 382 12805 --16880
NM_152641chr1221848 1045 ------
NM_152688chr61735 ------
NM_152707chr101263 ------
NM_152736chr651064 432 384 169 118 --1106 1921
NM_152753chr631310 334 106 ------
NM_152754chr743408 2939 2355 276 2878 543 ----
NM_152756chr574091 3716 3428 3306 2941 1206 900 --13889 --
NM_152758chr812153 ------
NM_152774chr772697 2614 2555 2492 2420 2343 1854 ------
NM_152787chrX83643 2934 2843 1439 1432 1408 915 506 ------
NM_152836chr811761 ------
NM_152837chr811761 ------
NM_152838chr2073324 2920 2889 2548 2456 1096 824 12309 ----
NM_152896chr9141 ------
NM_152924chr15116675 6014 5420 4632 4597 4282 4273 1968 1005 742 469 36385 6002 1293 --14800
NM_153020chr621262 211 ------
NM_153026chr121193 ------
NM_153035chr133166 2806 2329 12800 ----
NM_153038chr21696 1285 --1278
NM_153040chr153491 143 32 ------
NM_153050chr2274012 4004 1805 1086 742 589 92 11319 --11383
NM_153051chr2274012 4004 1805 1086 742 589 92 11319 --11383
NM_153181chr181394 ------
NM_153182chr332690 1037 318 2771 713 ----
NM_153184chr34750 566 509 289 1576 ----
NM_153188chr595597 5580 5153 4408 4367 1761 1567 705 595 ----153
NM_153223chr511429 ------
NM_153255chr61884 ------
NM_153257chr192885 399 ------
NM_153333chrX1151 ------
NM_153341chr1154 ------
NM_153371chr1362284 2175 1912 1782 963 193 ----12045
NM_153374chr15145 ------
NM_153447chr191279 ------
NM_153686chr41944 ----12037
NM_153689chr252281 885 460 196 109 ------
NM_153705chr1132661 454 446 ----2597 251
NM_153715chr721021 814 --1305 --
NM_153809chr9154 ------
NM_153810chr1064829 3967 3926 3272 2012 1437 1801 1203 --
NM_170606chr721848 1372 ------
NM_170706chr174063 2867 1653 1040 524 213 184 ----21594 262
NM_170753chr10189 ------
NM_170768chr1121497 1462 1415 ----
NM_171998chrX41839 1567 930 103 ------
NM_172069chr231573 462 394 ------
NM_172071chr1147427 7321 7032 6673 6525 5005 2760 2542 2456 2392 1721 580 296 287 12211 ----
NM_172078chr7142 ------
NM_172079chr7142 ------
NM_172080chr7142 ------
NM_172081chr7142 ------
NM_172082chr7142 ------
NM_172083chr7142 ------
NM_172084chr7142 ------
NM_172164chr12702 66 --1159 --
NM_172193chr1411256 ------
NM_172240chr1211147 ------
NM_172344chr231838 660 363 ------
NM_173082chr62603 138 ------
NM_173083chr121065 1005 ------
NM_173198chr962414 2017 294 227 201 74 11098 ----
NM_173200chr962414 2017 294 227 201 74 11098 ----
NM_173214chr1647717 5916 1955 1920 1524 16986 --
NM_173359chr331306 718 46 ----1468
NM_173463chr474121 3538 3412 2775 1704 721 23 ----24139 3318
NM_173468chr475453 4430 3961 2440 1783 1130 109 159 ----
NM_173470chrX72720 2472 962 367 356 59 52 ------
NM_173475chr1661768 1500 1488 1246 209 75 ----1596
NM_173503chr171119 ------
NM_173508chr12477 274 ------
NM_173510chr2242828 2822 2320 132 1459 --1334
NM_173511chr223610 1303 1256 ----
NM_173552chr352382 2058 1839 215 90 ------
NM_173562chr693257 2715 2544 1316 1045 784 718 356 30 ------
NM_173582chr1135433 4048 3867 15776 --14459
NM_173642chr1158675 8552 8255 7347 6282 5774 3553 3367 3306 2857 1317 1195 970 440 338 --29010 2891 1889
NM_173648chr21664 ------
NM_173694chrX21019 447 11846 ----
NM_173807chr1134 ------
NM_173851chr843732 3476 2966 1033 ------
NM_174887chr171364 ------
NM_174911chr873604 3401 2639 397 347 214 128 ----11283
NM_174934chr11103626 3481 3412 3336 2365 2226 1431 1100 1084 439 11156 --21406 787
NM_175607chr321047 197 ------
NM_175612chr321047 197 ------
NM_175623chr12157230 7096 6891 6459 6310 5773 5639 5307 2981 2898 2310 2259 1063 949 695 32635 1641 1125 16682 --
NM_175624chr12157325 7191 6986 6554 6405 5868 5734 5402 3076 2993 2405 2354 1158 1044 790 32730 1736 1220 16777 --
NM_175625chr12157325 7191 6986 6554 6405 5868 5734 5402 3076 2993 2405 2354 1158 1044 790 32730 1736 1220 16777 --
NM_175634chr811051 ------
NM_175635chr811051 ------
NM_175636chr811051 ------
NM_175747chr61403 ------
NM_175847chr1911033 ------
NM_175854chr1352678 2390 2010 1054 200 ----11787
NM_175861chr1255840 5269 3970 1441 446 ------
NM_175873chr531174 562 493 ------
NM_176814chr7131 ------
NM_176871chr863035 2963 2838 2663 931 126 ----11001
NM_177401chr1931594 1228 1131 ------
NM_177424chr161879 1793 1647 792 411 148 11558 ----
NM_177438chr1443916 1279 711 184 13781 ----
NM_177538chr286863 6835 2662 2450 2022 1240 1199 138 1342 --17789
NM_178151chrX157688 7572 7204 6462 6198 5714 5295 2909 2826 2456 2278 2091 755 727 236 16893 ----
NM_178152chrX157688 7572 7204 6462 6198 5714 5295 2909 2826 2456 2278 2091 755 727 236 16893 ----
NM_178153chrX157688 7572 7204 6462 6198 5714 5295 2909 2826 2456 2278 2091 755 727 236 16893 ----
NM_178335chr31373 ------
NM_178566chr911795 ------
NM_178578chr2062212 2172 1721 1012 867 348 11628 ----
NM_178585chr42349 68 ------
NM_181054chr143851 177 133 ------
NM_181302chr141135 ------
NM_181308chr141135 ------
NM_181354chr85452 390 235 149 64 ------
NM_181356chr62906 381 ------
NM_181443chr2032439 346 324 11897 ----
NM_181504chr563439 3307 2743 1084 671 122 ------
NM_181521chr16137068 6858 6188 5611 4959 4659 2586 1891 1599 1115 1104 320 204 ------
NM_181523chr563439 3307 2743 1084 671 122 ------
NM_181524chr563439 3307 2743 1084 671 122 ------
NM_181552chr71744 ------
NM_181642chr155266 255 210 190 78 ----1146
NM_181645chr112501 279 ------
NM_181671chr171826 ------
NM_181672chrX21942 593 ------
NM_181673chrX21942 593 ------
NM_181689chr201644 ------
NM_181702chr81278 ------
NM_181704chr21128 ------
NM_181723chr822146 422 ------
NM_181876chr452596 2475 2026 870 561 ------
NM_181886chr421046 187 ------
NM_181887chr421046 187 ------
NM_181888chr421046 187 ------
NM_181889chr421046 187 ------
NM_181890chr421046 187 ------
NM_181891chr421046 187 ------
NM_181892chr421093 234 ------
NM_181893chr421046 187 ------
NM_182484chr21128 ------
NM_182485chr483432 3345 3236 3139 2905 2598 2387 1407 12342 ----
NM_182503chr663976 3869 2089 2024 784 363 21902 1727 --11595
NM_182528chr21113 ------
NM_182540chrX1708 ------
NM_182646chr483432 3345 3236 3139 2905 2598 2387 1407 12342 ----
NM_182678chr21131 ------
NM_182715chr72972 371 ------
NM_182717chr101116 ------
NM_182720chr101116 ------
NM_182721chr101116 ------
NM_182722chr101116 ------
NM_182723chr101116 ------
NM_182757chr693453 3310 3077 3047 2828 2595 2237 883 236 --13317 --
NM_182759chr11538 ------
NM_182767chr1221840 168 ------
NM_182853chr101116 ------
NM_182898chr732154 1007 212 11993 16292 16069
NM_182899chr732154 1007 212 11993 16292 16069
NM_182901chr111593 ------
NM_182972chr152100 1968 1822 1111 658 ----1951
NM_182975chr1148 ------
NM_183004chr14103807 3455 3436 3318 1450 1287 1178 1001 803 258 --1398 1655
NM_183011chr101116 ------
NM_183012chr101116 ------
NM_183013chr101116 ------
NM_183043chr131832 --1938 --
NM_183044chr131832 --1938 --
NM_183380chr61837 ------
NM_183398chr541336 1202 526 391 ------
NM_183399chr541336 1202 526 391 ------
NM_183400chr541336 1202 526 391 ------
NM_183401chr541336 1202 526 391 ------
NM_183416chr131270 483 210 ------
NM_183419chr82556 47 ------
NM_194247chr254240 4039 1671 1391 1303 13695 ----
NM_194285chr1153279 3134 2618 2340 102 ------
NM_194286chr12115970 4667 2225 1601 1581 1512 1387 1222 1186 1170 1129 ----14279
NM_194314chr184778 4448 4175 2227 575 518 173 30 15103 ----
NM_194318chr1331814 854 681 ------
NM_194328chr933308 3096 2612 ------
NM_194329chr933308 3096 2612 ------
NM_194330chr933308 3096 2612 ------
NM_194332chr933308 3096 2612 ------
NM_194429chr61551 ------
NM_194434chr1843854 3736 1269 714 ----1442
NM_194449chr181343 ------
NM_198057chrX11235 ------
NM_198077chr12231 54 ------
NM_198081chr641917 874 845 756 --12460 12886
NM_198128chr1811529 ------
NM_198273chr532481 2236 258 ------
NM_198324chr121360 ------
NM_198381chr1121363 151 ------
NM_198465chrX2283 274 ------
NM_198468chr683701 3597 3026 1660 1351 941 690 201 ------
NM_198504chr3144 ------
NM_198506chr4281 70 ------
NM_198511chrX21621 1497 ------
NM_198513chr811858 ------
NM_198516chr11186 ------
NM_198581chr287308 7101 6016 5932 5105 4740 2685 629 17280 16326 --
NM_198595chr463777 1515 1180 814 613 400 --23383 931 11173
NM_198844chr173872 354 129 ------
NM_198889chr42256 42 ------
NM_198896chr1122029 1819 --12161 --
NM_199051chr1174 ------
NM_199160chr951316 803 623 344 158 1820 11721 --
NM_199168chr101398 ------
NM_199188chr1283926 3171 2723 1263 770 333 138 76 ------
NM_199189chr521035 305 ------
NM_199190chr1283926 3171 2723 1263 770 333 138 76 ------
NM_199321chr173872 354 129 ------
NM_199421chr1455052 4291 4113 3502 78 1944 ----
NM_199454chr164706 3938 3083 1727 1310 932 ------
NM_199461chr1093588 3560 3307 2956 2681 1259 1164 785 355 ------
NM_199478chrX1168 ------
NM_199482chr221942 606 ------
NM_201269chr111065 ------
NM_201524chr1631387 344 110 ----1190
NM_201525chr1631387 344 110 ----1190
NM_203301chr1411400 ------
NM_203327chr20124525 4405 4060 3869 3166 2833 1780 1771 936 632 624 274 ------
NM_203329chr11106692 6105 5876 5380 1911 1715 1658 376 342 268 --27008 2614 --
NM_203330chr11106692 6105 5876 5380 1911 1715 1658 376 342 268 --27008 2614 --
NM_203331chr11106692 6105 5876 5380 1911 1715 1658 376 342 268 --27008 2614 --
NM_203341chr11838 ------
NM_203342chr193284 2821 2459 2371 1293 1220 658 455 264 1883 12442 --
NM_203343chr193284 2821 2459 2371 1293 1220 658 455 264 1883 12442 --
NM_203364chr115866 489 322 138 38 ------
NM_203406chr532662 2437 425 ------
NM_203446chr2122452 1030 ------
NM_203459chr132374 1719 163 ------
NM_203463chr243692 3539 3069 1585 34332 956 601 ----
NM_203504chr442610 2016 1928 82 21898 401 --1216
NM_203505chr442610 2016 1928 82 21898 401 --1216
NM_205768chr131885 1677 627 --11765 --
NM_206853chr673363 3200 3139 2737 1643 1178 474 21260 1094 --1509
NM_206854chr674624 4461 4400 3998 3686 3432 1735 ----21770 1020
NM_206855chr685589 5426 5365 4963 4651 4397 3869 727 ----11985
NM_206860chr103477 331 21 ------
NM_206861chr103477 331 21 ------
NM_206862chr103477 331 21 ------
NM_207012chr1043529 2971 1251 234 ------
NM_207303chr1053724 3695 1448 1295 75 ------
NM_207406chr4146493 6215 6000 5829 5411 5380 5208 5064 4572 1724 1704 1232 1165 194 26546 1372 12100 --
NM_207422chrX2235 119 ------
NM_207469chr201172 ------
NM_207481chr22555 198 ------
NM_207645chr111949 ------
NM_212471chr171164 ------
NM_212472chr171164 ------
NM_212557chr41271 ------
NM_213609chr31408 ------
NM_213651chr111741 ------