TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5698
miRNA Sequence: UGGGGGAGUGCAGUGAUUGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5161 2273 180 ----
NM_000020chr1272209 2125 1913 551 444 216 183 21978 1503 32127 1879 234 11560
NM_000024chr51446 --1438 --
NM_000025chr841161 989 913 89 --2343 231 31175 857 235
NM_000037chr892515 2074 1967 1823 1659 922 597 552 182 12486 22169 611 32457 2196 2078
NM_000044chrX183 124 ----
NM_000053chr1341396 535 294 117 11306 ----
NM_000068chr194968 631 578 114 1353 --175
NM_000070chr15----1140 1144
NM_000074chrX4852 684 657 112 ----1664
NM_000075chr123217 187 103 ----1107
NM_000081chr11320 11612 2432 322 --
NM_000084chrX56600 5848 5562 5008 4815 25832 4225 35416 5414 1455 35867 2220 1210
NM_000088chr17101289 1266 1208 1172 1161 1128 867 419 406 48 --31218 394 28 11189
NM_000090chr21618 1773 1813 --
NM_000092chr253071 3013 2918 848 103 43961 3598 3123 884 1988 --
NM_000093chr972189 1617 968 726 541 414 106 --2112 108 --
NM_000110chr111046 ------
NM_000127chr8164 ------
NM_000129chr641361 1180 437 210 21421 382 ----
NM_000138chr1511782 169 ----
NM_000141chr101942 ----1185
NM_000153chr1421674 41 ------
NM_000168chr753238 2814 2640 767 593 12332 22112 770 22492 2156
NM_000170chr91478 180 143 --
NM_000175chr19254 25 --3192 58 37 --
NM_000176chr543518 3269 3083 406 ------
NM_000183chr21100 ------
NM_000188chr103486 204 31 1253 1489 --
NM_000189chr281923 1848 1467 282 269 73 45 37 1394 ----
NM_000192chr122570 299 --1312 --
NM_000202chrX93939 2716 2613 2491 2483 2451 2417 234 39 21565 1026 32762 2694 2494 --
NM_000212chr1741967 1927 617 547 2986 742 --1554
NM_000216chrX43824 3151 619 114 11435 --13178
NM_000217chr1275222 4936 3690 3654 1959 1615 641 --33680 3354 1604 21004 318
NM_000233chr21735 ------
NM_000238chr7----2129 64 1133
NM_000244chr113654 547 493 2220 56 1306 --
NM_000259chr1544884 4626 406 143 32417 2249 114 14546 22428 1917
NM_000264chr943133 2073 820 285 11175 11213 11089
NM_000267chr1773458 2590 2141 1124 883 81 63 --43476 2936 1127 889 --
NM_000268chr22103475 3345 2639 2368 1063 1015 979 838 729 282 2438 130 12606 1787
NM_000276chrX52129 1957 783 354 150 --1464 --
NM_000278chr1092224 1891 1662 1625 1595 1541 906 863 255 2770 564 92008 2006 1714 1643 1641 1612 1610 909 751 --
NM_000280chr111688 ------
NM_000304chr171386 --1413 --
NM_000314chr1022690 2424 ------
NM_000318chr832018 1892 1871 --12747 --
NM_000319chr1231046 986 65 2823 373 2991 69 --
NM_000322chr631161 236 66 41435 1207 643 98 4371 128 68 21 --
NM_000330chrX31992 1509 735 1195 1438 --
NM_000332chr676511 5908 5677 5480 662 610 498 16289 2443 34 12871
NM_000334chr1772033 1937 1869 1848 600 272 116 --92106 2087 1939 1804 1801 1794 702 413 54 --
NM_000335chr32734 522 --1848 11536
NM_000345chr42867 182 ------
NM_000346chr1721947 1921 ------
NM_000353chr164417 200 177 67 1147 1250 --
NM_000361chr2041812 440 109 49 1552 1573 11816
NM_000362chr22102884 1433 1393 1215 845 400 175 69 50 29 43547 3407 646 388 33008 2689 823 32680 417 373
NM_000367chr642118 1662 1568 1504 ------
NM_000368chr984357 4241 3810 1913 1158 1132 930 293 24369 3724 2717 197 --
NM_000378chr113322 311 72 --180 --
NM_000386chr172228 24 ------
NM_000389chr691386 1136 980 532 523 381 330 262 125 --31480 333 290 --
NM_000393chr221391 743 11937 ----
NM_000399chr102938 97 --2331 103 --
NM_000411chr2152814 2448 2243 1226 666 22743 90 43068 2044 255 253 12048
NM_000423chr122394 172 ----246 31
NM_000425chrX3589 550 119 1211 2713 57 --
NM_000430chr1743432 3040 1344 838 23619 2337 33062 28 25 --
NM_000435chr192746 284 1269 3998 717 632 2649 253
NM_000445chr85704 307 233 226 93 ----1774
NM_000448chr1131011 390 46 ------
NM_000449chr141357 1058 943 116 1538 ----
NM_000450chr121464 77 --1326 --
NM_000458chr172845 626 --3680 633 631 1226
NM_000461chr3104279 4133 3583 3340 2965 1313 1229 1156 1147 1095 1879 --13309
NM_000462chr1521287 167 ----1410
NM_000476chr981378 1269 1122 431 299 280 269 64 --11053 122
NM_000478chr15663 647 493 95 49 --2214 159 1174
NM_000484chr211294 ------
NM_000489chrX43067 3045 798 107 ------
NM_000493chr6----1152 --
NM_000500chr65428 416 379 372 318 1121 3508 74 69 --
NM_000503chr821386 1303 ------
NM_000516chr201232 --1122 --
NM_000522chr72990 838 --1139 --
NM_000523chr23867 268 90 --2270 142 --
NM_000530chr15848 358 305 270 244 2341 133 1281 1361
NM_000533chrX31831 756 256 21614 71 2177 175 --
NM_000544chr6_cox_hap183106 3084 2445 2288 1329 1151 998 920 ----11190
NM_000546chr1721132 858 2353 23 41122 57 53 51 --
NM_000555chrX136978 5840 5662 5033 4934 3024 2777 2701 2690 1959 711 496 177 23087 1620 87653 7002 6998 6996 5629 5627 4936 2703 12575
NM_000567chr14963 906 897 164 3891 410 134 2772 769 --
NM_000578chr231632 1308 464 41717 1548 1331 678 1466 21313 1300
NM_000594chr62732 24 --137 --
NM_000598chr721353 398 1530 11257 --
NM_000599chr2104314 4103 4050 3980 3482 3196 3189 2875 1458 611 43298 1229 773 26 52995 640 567 552 69 43534 3471 1680 1452
NM_000602chr781049 1016 616 599 540 244 197 170 21181 580 1618 --
NM_000609chr10102795 2782 2706 2485 2357 2347 2313 888 852 288 52993 2857 2303 986 628 184 32617 2082 1087
NM_000612chr11133676 3616 3314 2744 2356 700 693 628 521 499 167 150 110 --93630 3554 3552 2904 2902 2897 322 260 52 --
NM_000615chr1111177 --21845 894 12421
NM_000618chr12136347 5642 5599 5285 4787 4658 4222 4177 2613 2383 1051 533 498 35331 2332 133 ----
NM_000618chr12136347 5642 5599 5285 4787 4658 4222 4177 2613 2383 1051 533 498 35331 2332 133 ----
NM_000620chr12122135 2070 2024 1894 1867 1400 823 594 505 402 338 128 32079 721 386 21869 253 --
NM_000621chr1321433 1285 ------
NM_000625chr172426 143 2407 110 ----
NM_000633chr1854826 3379 3200 3183 561 ----11048
NM_000635chr1951580 601 504 291 22 --31400 449 447 --
NM_000660chr19--1197 4232 220 218 210 --
NM_000665chr7125 --2175 171 --
NM_000687chr20157 1109 160 --
NM_000719chr12226315 6306 6279 6192 5884 5780 5706 5672 5618 4826 4480 4473 4459 4226 4209 2506 2141 1853 1274 583 407 308 86431 6357 6333 6324 6064 5109 2113 1911 66460 6317 5330 5200 4442 4230 1253
NM_000721chr162655 1893 1687 434 312 190 22686 779 51835 1738 525 437 300 42121 2084 1817 441
NM_000723chr17101640 1295 1283 1100 676 494 361 274 250 106 3474 369 258 31288 277 108 31348 451 281
NM_000725chr125940 639 331 315 263 1833 1266 --
NM_000726chr221348 952 ------
NM_000738chr115915 903 780 112 23 --1784 --
NM_000757chr17883 329 320 217 90 79 37 2877 303 3893 785 736 --
NM_000767chr1941564 341 326 79 11070 1127 11399
NM_000791chr53953 731 33 1129 140 --
NM_000795chr118937 924 278 259 154 108 42 34 ------
NM_000801chr203995 201 28 --31066 965 192 1999
NM_000809chr4139272 8838 8440 7655 7532 6856 6829 5908 5762 3581 2647 2587 579 22844 1183 13199 26068 3607
NM_000810chr152391 82 ------
NM_000811chr51175 ------
NM_000813chr531168 362 39 13812 ----
NM_000814chr1553640 3382 3254 3140 956 --13940 --
NM_000826chr421862 959 ------
NM_000827chr592167 1841 1834 1613 1599 858 557 451 44 ----1631
NM_000831chr1165576 5405 5258 5006 4422 4101 4018 3842 1765 1184 1066 987 524 295 194 75 --45535 5533 3977 1623 21770 299
NM_000833chr1641388 1266 1171 1011 11227 --1597
NM_000834chr124897 317 208 188 --31299 217 191 --
NM_000836chr198993 933 854 792 741 725 698 366 1187 1629 --
NM_000837chr84382 365 208 133 --3413 408 86 --
NM_000842chr111656 ------
NM_000855chr111273 ----128
NM_000864chr1------2962 825
NM_000870chr551308 999 652 559 510 --2423 234 11012
NM_000876chr61556 11328 2381 379 --
NM_000883chr74628 619 516 177 --3529 485 70 --
NM_000883chr74628 619 516 177 --3529 485 70 --
NM_000891chr1713137 1664 12277 --
NM_000924chr1261132 969 865 468 320 168 2418 256 41144 1023 1020 471 2369 79
NM_000933chr201314 ------
NM_000935chr311067 ------
NM_000960chr192499 491 2516 269 ----
NM_000961chr2063728 3540 3333 1036 529 120 33409 476 133 23796 595 --
NM_000964chr1761262 1001 957 461 388 127 11175 31337 1264 412 1359
NM_000965chr31161 131 ----
NM_000966chr1271041 1021 988 769 738 299 170 3940 886 64 61043 1026 744 673 192 105 --
NM_001001132chr2161368 1289 1251 1031 542 21 1301 21371 1278 --
NM_001001323chr1222874 104 1163 --1173
NM_001001331chr372311 2217 2058 1905 1875 353 322 --2900 356 --
NM_001001395chr1232658 2559 963 11889 ----
NM_001001396chr1173983 3881 3502 3459 3427 3318 3262 1779 1755 1515 1368 1324 948 861 836 617 603 22913 1694 33545 3071 1686 23325 243
NM_001001433chr2032648 1143 42 22030 546 22697 148 --
NM_001001481chr8--13154 12616 --
NM_001001484chr1042358 1710 958 298 2500 275 ----
NM_001001522chr111320 --1160 137
NM_001001523chr13537 349 52 11205 21262 28 --
NM_001001549chr732022 1014 603 1542 1207 --
NM_001001550chr732022 1014 603 1542 1207 --
NM_001001555chr732022 1014 603 1542 1207 --
NM_001001557chr821588 171 11523 ----
NM_001001664chr232563 1212 1113 --11204 147
NM_001001684chr1731983 509 225 21998 329 ----
NM_001001740chr11200 --197 --
NM_001001740chr11200 --197 --
NM_001001890chr2174087 3993 2855 2812 2788 1111 973 --64169 2944 2861 2857 2800 2792 --
NM_001001924chr841870 1482 1386 464 21833 206 11484 21432 1390
NM_001001925chr841870 1482 1386 464 21833 206 11484 21432 1390
NM_001001931chr841870 1482 1386 464 21833 206 11484 21432 1390
NM_001001936chr101482 ------
NM_001002009chr72192 29 ------
NM_001002010chr72192 29 ------
NM_001002233chr842126 1863 775 114 21589 381 11448 1117
NM_001002243chr22357 52 ------
NM_001002252chr12187 ----132
NM_001002257chr253159 2479 666 422 325 --1456 --
NM_001002269chr91434 ------
NM_001002296chr8179 1436 ----
NM_001002762chr1082376 2301 2261 1185 981 530 262 240 32660 2164 2149 62038 2036 1188 826 517 250 12591
NM_001002838chrX41787 440 350 343 1104 1670 --
NM_001002860chr1454287 1547 1194 552 516 21864 621 11499 --
NM_001002909chr1762072 372 344 313 220 204 21593 640 4375 321 318 224 --
NM_001003406chr2263216 2654 1303 1253 1226 674 11030 62935 2861 2859 2328 1256 454 13135
NM_001003407chr1095048 4127 3833 3595 3124 1859 763 738 719 21489 1445 24873 4869 --
NM_001003408chr1095048 4127 3833 3595 3124 1859 763 738 719 21489 1445 24873 4869 --
NM_001003652chr1848305 7643 2864 1673 28496 6296 25566 2819 1207
NM_001003676chr117799 733 376 349 337 261 148 21043 782 3643 363 152 --
NM_001003677chr11176 1599 1199 --
NM_001003682chr151364 1274 1250 560 476 1539 1412 --
NM_001003694chr32146 46 1590 4436 432 52 49 --
NM_001003760chr621131 527 1676 --1288
NM_001003796chr224222 189 177 27 --4886 196 192 39 --
NM_001003799chr73642 561 251 1131 1243 1582
NM_001003800chr9102832 1512 1484 1417 1389 1356 1328 1224 1140 188 11108 --2576 352
NM_001003809chr18261 42 --480 78 50 47 --
NM_001003940chr1573855 3612 2762 2509 2386 1428 1247 22604 1177 42572 2390 1256 1032 23028 2400
NM_001003942chr1573855 3612 2762 2509 2386 1428 1247 22604 1177 42572 2390 1256 1032 23028 2400
NM_001003943chr1573859 3616 2766 2513 2390 1432 1251 22608 1181 42576 2394 1260 1036 23032 2404
NM_001004065chr933153 518 176 23352 1384 --22860 2561
NM_001004106chr53951 396 141 1149 1804 184
NM_001004127chr133848 692 637 --1762 1789
NM_001004317chr653742 1028 908 625 570 --11643 11225
NM_001004342chr1185553 4620 4504 4388 4162 1480 1432 1413 1315 1248 835 815 776 746 737 702 456 261 41999 1241 796 684 125829 5824 5820 5817 5562 1910 1907 1419 1416 839 708 704 --
NM_001004354chr99816 801 784 769 753 361 219 180 59 2920 894 6864 862 822 818 808 757 1825
NM_001004356chr451549 1367 1267 1127 221 11178 11269 11069
NM_001004358chr451549 1367 1267 1127 221 11178 11269 11069
NM_001004419chr1244363 4315 1331 490 23585 273 44369 4365 4335 4038 24372 4357
NM_001004439chr1551291 1075 943 508 131 21023 353 2923 153 2514 283
NM_001004720chr2--21043 150 177 --
NM_001004722chr2--21212 319 1246 --
NM_001005209chr23680 519 96 1507 1100 1683
NM_001005210chr1192524 2449 2381 2309 2270 1605 228 66 21 12369 ----
NM_001005242chr123670 548 126 11593 ----
NM_001005271chr1771121 988 738 342 303 276 149 --1855 2719 95
NM_001005273chr1771121 988 738 342 303 276 149 --1855 2719 95
NM_001005336chr95570 493 410 107 87 ----1157
NM_001005354chr122519 101 2421 25 1522 149
NM_001005366chr122883 770 ------
NM_001005375chrY11397 ------
NM_001005377chr19156 ------
NM_001005404chr1743198 2844 128 61 13375 22846 1337 11568
NM_001005463chr1021842 863 1716 --12435
NM_001005473chr576305 5640 4922 4836 2306 1476 1339 25845 5674 25464 372 --
NM_001005505chr341165 1139 98 78 11251 1260 1103
NM_001005609chrX123849 3633 3568 3447 3027 2417 2373 1542 1422 603 413 36 33670 3465 140 23450 1405 11325
NM_001005611chrX1150 --1362 --
NM_001005743chr1421207 367 --21178 250 --
NM_001005744chr1421207 367 --21178 250 --
NM_001005745chr1421207 367 --21178 250 --
NM_001005746chr221348 952 ------
NM_001005747chr221348 952 ------
NM_001005782chr22217 201 131 ----
NM_001005849chr171135 ----1143
NM_001005920chr1611003 1318 2822 274 21090 827
NM_001006115chr382250 2127 2019 1932 1750 407 208 35 3918 627 417 42354 1127 875 719 --
NM_001006605chr11946 1909 1112 --
NM_001006605chr11946 1909 1112 --
NM_001006641chr941567 1196 531 397 ------
NM_001006642chr941567 1196 531 397 ------
NM_001006643chr941567 1196 531 397 ------
NM_001006665chr12626 59 ----1174
NM_001006932chr6142692 2550 2531 2292 2185 2078 1342 1174 974 758 569 483 205 29 22736 225 ----
NM_001006946chr251645 1423 612 599 107 --31648 299 88 --
NM_001007024chr17123752 3736 3519 3116 1670 957 846 536 476 459 430 255 --7478 461 448 444 442 438 436 --
NM_001007025chr17123752 3736 3519 3116 1670 957 846 536 476 459 430 255 --7478 461 448 444 442 438 436 --
NM_001007026chr122536 390 --164 1442
NM_001007067chr8184 --21012 881 --
NM_001007068chr8184 --21012 881 --
NM_001007069chr8184 --21012 881 --
NM_001007070chr8184 --21012 881 --
NM_001007156chr1551699 1685 1643 422 199 21725 171 21763 1223 1433
NM_001007226chr1721420 1298 11032 ----
NM_001007227chr1721420 1298 11032 ----
NM_001007228chr1721420 1298 11032 ----
NM_001007229chr1721420 1298 11032 ----
NM_001007230chr1721420 1298 11032 ----
NM_001007237chr111939 21788 592 150 11942
NM_001007271chr103852 374 26 1700 1168 --
NM_001007277chr111428 1825 1779 --
NM_001007471chr9272 55 ------
NM_001007544chr12427 77 --1352 --
NM_001007553chr1289 77 --21115 79 --
NM_001007559chr18174 ------
NM_001007565chr31276 ------
NM_001008220chr5103781 3642 3253 2532 1032 313 304 167 142 124 43608 3412 1065 235 53906 3256 884 155 144 33317 594 158
NM_001008222chrX6999 937 927 379 300 282 11170 21017 1015 --
NM_001008239chr1883510 3219 2898 1400 1391 1009 593 140 22530 219 42505 792 790 149 12508
NM_001008272chr33290 226 94 ------
NM_001008273chr33290 226 94 ------
NM_001008392chr342639 341 316 77 23379 589 1319 13413
NM_001008407chr7--1100 --31451 655 23
NM_001008495chr81505 ------
NM_001008529chr1731295 443 83 --21221 445 --
NM_001008541chr1032256 708 94 ------
NM_001008541chr1032256 708 94 ------
NM_001008566chr222440 369 ------
NM_001008701chr19182750 2742 2665 2504 2478 2285 2027 2021 878 816 720 689 617 528 505 434 146 112 12868 72964 2936 2840 884 881 319 317 2891 325
NM_001008726chr1421692 1607 21665 1531 11651 --
NM_001008738chr532358 2346 1051 ------
NM_001008744chr1431249 274 85 ------
NM_001008777chr171232 ------
NM_001008800chr1146 --148 --
NM_001008883chr1146 --148 --
NM_001009184chr84382 365 208 133 --3413 408 86 --
NM_001009554chr433428 3420 1754 3888 658 176 ----
NM_001009554chr433428 3420 1754 3888 658 176 ----
NM_001009566chr151114 1065 292 166 121 21324 61 31118 1075 294 11121
NM_001009571chr721637 1557 11356 11559 --
NM_001009880chr22104332 3588 1943 1731 1088 887 828 503 366 191 21253 1108 74547 4373 1806 1568 1503 1500 197 23644 1571
NM_001009899chr325293 4406 25741 5024 ----
NM_001009955chr11112 --1121 --
NM_001009955chr11112 --1121 --
NM_001009958chr7269 35 ------
NM_001009993chr283768 3735 3659 2840 1661 1605 1463 1303 34382 1133 1036 34112 3737 2842 13193
NM_001009996chr3----2203 200 --
NM_001010861chr121774 173 1155 ----
NM_001010888chrX34094 4080 1408 --44104 4082 3746 3744 14495
NM_001010891chr525549 1368 ------
NM_001010895chr92639 376 --1456 --
NM_001010898chr1143435 3385 3095 3025 2797 1327 1106 1003 822 802 691 663 293 169 13034 133720 2463 2460 2457 2447 2443 960 955 349 343 142 31 29 33723 3374 776
NM_001010924chr103994 775 332 --1334 --
NM_001010926chr1279 55 ------
NM_001010934chr72237 32 1967 ----
NM_001011513chr443939 3220 2943 1523 ----1935
NM_001011553chr71765 ------
NM_001011645chrX183 124 ----
NM_001011663chr101289 ------
NM_001011666chr7125956 4759 4514 4493 4448 2466 1577 1417 1263 637 573 101 --32473 2468 576 14786
NM_001011708chr242656 2022 1156 1120 12562 22797 2794 11130
NM_001012264chr145764 633 391 226 113 2796 748 1785 2636 244
NM_001012267chr931976 1831 471 21567 298 21978 480 --
NM_001012300chr123215 44 31 ------
NM_001012329chr182154 1735 1583 1575 1555 493 343 331 11914 42156 2094 109 103 22161 1666
NM_001012338chr15262 41 --147 --
NM_001012393chr1134184 294 276 --34164 3212 958 11016
NM_001012415chr91730 --1218 --
NM_001012426chr6153290 3024 2996 2465 1362 1332 1243 1178 1060 494 456 259 248 66 42 33241 2449 1084 102875 1113 964 962 944 917 796 325 310 280 62396 1190 909 709 314 69
NM_001012427chr6153290 3024 2996 2465 1362 1332 1243 1178 1060 494 456 259 248 66 42 33241 2449 1084 102875 1113 964 962 944 917 796 325 310 280 62396 1190 909 709 314 69
NM_001012514chr26927 906 713 156 138 128 --277 71 --
NM_001012516chr26927 906 713 156 138 128 --277 71 --
NM_001012644chr20243 25 ------
NM_001012732chr4----2869 262 --
NM_001012751chr1021259 507 ------
NM_001012755chrX74572 4355 3568 2040 1377 214 45 43230 1441 1144 371 44598 4574 4412 986 14417
NM_001012968chrX2816 348 1399 3575 569 567 --
NM_001012977chrX81148 987 523 497 431 287 188 177 --10490 488 418 210 208 179 159 149 147 83 --
NM_001013031chr1042404 1304 865 816 --52417 685 236 234 229 --
NM_001013398chr721353 398 1530 11257 --
NM_001013415chr421426 48 --158 --
NM_001013620chr1277541 7202 5992 2338 1550 1022 753 22863 1695 ----
NM_001013624chr1751185 1152 982 908 353 41027 973 838 296 153 1911
NM_001013635chr1251216 1124 831 290 27 --61218 1151 1056 1050 1048 138 --
NM_001013690chr12122398 2121 1906 1619 876 528 486 463 374 363 335 37 32191 936 494 82401 2365 2363 2182 1808 906 475 409 21746 366
NM_001013693chr182631 2620 2451 2241 1973 733 429 201 --22247 236 12157
NM_001013693chr182631 2620 2451 2241 1973 733 429 201 --22247 236 12157
NM_001013839chr1772525 2318 2131 1644 1033 517 228 2531 176 32232 351 210 1388
NM_001014435chr164566 511 247 88 --2568 513 --
NM_001014443chr12173 59 1182 ----
NM_001014797chr10187729 7603 7236 5831 5645 3153 2769 2352 2342 2258 1807 1632 1460 1216 1058 1050 664 437 12943 37735 7732 2517 27449 2355
NM_001014831chr192625 583 --189 1254
NM_001014832chr192625 583 --189 1254
NM_001014834chr192625 583 --189 1254
NM_001014835chr192625 583 --189 1254
NM_001014839chr171036 905 773 425 106 95 65 1842 2407 318 21043 823
NM_001014841chr171036 905 773 425 106 95 65 1842 2407 318 21043 823
NM_001015048chr1433145 2667 976 1586 --12190
NM_001015049chr1433145 2667 976 1586 --12190
NM_001015053chr17131542 1408 1266 1235 1058 556 520 414 324 272 235 213 128 --81494 1241 1238 562 559 417 239 189 --
NM_001015881chrX2459 76 1904 ----
NM_001015882chr92789 155 ------
NM_001017368chr1792489 2320 2216 2203 929 444 407 309 163 --2410 338 --
NM_001017371chr211087 1876 ----
NM_001017392chr197988 869 370 334 270 249 215 1879 ----
NM_001017395chr322779 2763 22319 630 53084 3082 1049 962 418 --
NM_001017440chr7197959 7533 7449 7390 6921 6645 6552 3029 2649 2547 1995 1918 1853 1739 1629 1601 882 849 390 55583 2944 737 514 73 31603 1516 885 47616 2253 2096 1095
NM_001017916chr1761711 1703 1665 1569 430 166 1529 31393 773 704 1817
NM_001017917chr1761711 1703 1665 1569 430 166 1529 31393 773 704 1817
NM_001017920chr2----1128 --
NM_001017923chr14132 ----149
NM_001017926chr811571 11732 ----
NM_001017963chr142872 797 ------
NM_001017970chr1451897 1759 231 110 23 1640 169 --
NM_001017973chr5----121 --
NM_001017974chr5----121 --
NM_001017995chr5144231 3376 2955 1673 1624 1483 1429 1272 1166 937 735 552 317 190 13855 84596 4206 3132 3051 3029 1049 476 274 33630 608 558
NM_001017999chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_001017999chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_001018000chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_001018000chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_001018001chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_001018005chr15--123 133 --
NM_001018050chr2283252 3225 3015 2763 2738 2714 2693 1024 --32696 2615 177 22754 156
NM_001018052chr2283252 3225 3015 2763 2738 2714 2693 1024 --32696 2615 177 22754 156
NM_001018054chr111236 --1481 1486
NM_001018057chr114958 353 120 107 155 1355 1166
NM_001018064chr95284 227 100 40 28 --1781 --
NM_001018065chr9105855 5698 4836 4335 3963 758 621 603 575 243 --34610 1671 1076 25860 2123
NM_001018066chr9105855 5698 4836 4335 3963 758 621 603 575 243 --34610 1671 1076 25860 2123
NM_001018070chr113235 213 46 --2263 32 --
NM_001018074chr543518 3269 3083 406 ------
NM_001018075chr543518 3269 3083 406 ------
NM_001018076chr543518 3269 3083 406 ------
NM_001018077chr543518 3269 3083 406 ------
NM_001018108chr1561508 734 727 654 216 78 2907 511 62033 1827 1821 179 177 159 21830 1437
NM_001018111chr773236 1126 1056 611 586 130 119 33790 2676 1486 ----
NM_001020658chr121412 450 125 1129 2443 134
NM_001020658chr121412 450 125 1129 2443 134
NM_001023567chr1511720 1578 ----
NM_001023587chr311180 ------
NM_001024094chr543518 3269 3083 406 ------
NM_001024226chr12761 27 --1939 1942
NM_001024227chr12761 27 --1939 1942
NM_001024228chr12761 27 --1939 1942
NM_001024401chr16102550 2433 2268 2060 1929 960 587 475 444 363 42815 2522 2113 1095 92080 2078 2013 2011 1805 914 789 777 449 11880
NM_001024455chrX82694 2433 1770 1764 971 351 323 50 22596 2064 1973 --
NM_001024460chr64985 429 302 156 1269 --1988
NM_001024463chr152848 334 ------
NM_001024647chr12107419 6787 6407 6046 5196 5096 5069 1968 111 31 13085 14911 --
NM_001024649chr552223 2180 915 543 37 22198 465 346 43 39 --
NM_001024666chrX1490 ----1183
NM_001024680chr211470 ------
NM_001024807chr192346 219 --142 --
NM_001024808chr1282749 2543 2381 2364 1906 536 475 310 1865 52424 1039 734 732 539 --
NM_001024809chr1761262 1001 957 461 388 127 11175 31337 1264 412 1359
NM_001024858chr14182765 2703 2691 2630 2553 2505 2419 2283 2272 2220 2045 1990 693 678 626 302 238 70 22950 2740 82707 2694 2571 2104 887 885 695 316 32384 2048 307
NM_001024912chr193473 209 84 21829 1175 2417 407 --
NM_001024934chr62554 206 1128 ----
NM_001024935chr62554 206 1128 ----
NM_001024936chr62554 206 1128 ----
NM_001024937chr178718 643 586 565 511 201 82 63 --10712 705 701 698 609 517 281 247 47 45 1186
NM_001024948chr121273 412 ----12426
NM_001024959chr34842 797 228 76 1754 3845 779 30 1850
NM_001024960chr34842 797 228 76 1754 3845 779 30 1850
NM_001025076chr1085926 5237 5216 4917 4341 4266 394 21 --75120 4903 4736 4277 4275 2257 2252 25003 4283
NM_001025077chr10137284 6595 6574 6275 5699 5624 1752 1295 1212 1162 1128 222 21 11173 76478 6261 6094 5635 5633 1164 164 36361 5641 226
NM_001025079chr363537 1108 781 737 661 631 --21137 1132 13097
NM_001025081chr1851279 1033 1003 627 307 --21193 248 1109
NM_001025090chr1851279 1033 1003 627 307 --21193 248 1109
NM_001025092chr1851279 1033 1003 627 307 --21193 248 1109
NM_001025101chr1851279 1033 1003 627 307 --21193 248 1109
NM_001025107chr1102428 2045 1942 1728 1667 884 803 685 631 504 1216 1453 --
NM_001025107chr1102428 2045 1942 1728 1667 884 803 685 631 504 1216 1453 --
NM_001025108chr242824 2790 1087 709 22646 518 1645 --
NM_001025205chr33296 113 29 --395 92 66 3358 71 44
NM_001025233chr1232707 1034 625 32089 1928 145 ----
NM_001025242chrX--2843 25 1333 --
NM_001025243chrX--2843 25 1333 --
NM_001025266chr3124320 3967 3959 1900 1832 1609 1347 697 502 489 455 159 24028 893 41902 1280 1278 495 14401
NM_001025366chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025366chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025367chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025367chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025368chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025368chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025369chr661722 1520 1512 1504 1168 261 --31433 624 622 144
NM_001025369chr661722 1520 1512 1504 1168 261 --31433 624 622 144
NM_001025370chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025370chr651706 1504 1496 1488 245 --31417 608 606 128
NM_001025579chr1741127 819 478 43 11178 5766 763 28 25 22 2481 124
NM_001025580chrX94026 3205 1388 392 383 364 333 319 48 23933 3148 13258 23606 3208
NM_001025603chr141357 1058 943 116 1538 ----
NM_001029858chr622996 2843 1133 2841 238 13351
NM_001029859chr1192306 1829 1745 1663 1574 874 643 563 136 --3921 465 462 21667 878
NM_001029860chr8186 ----125
NM_001029863chr642938 992 976 431 ------
NM_001029864chr2052464 2412 2118 820 266 22087 1735 42451 2449 373 371 11880
NM_001029869chr53115 42 30 --121 --
NM_001029882chr12157 72 --1159 1184
NM_001029882chr12157 72 --1159 1184
NM_001029883chr253050 2510 2382 990 749 11988 32701 992 752 --
NM_001029976chr8384 52 44 ------
NM_001030007chr1653087 2716 1061 185 82 33634 2837 547 22821 769 1189
NM_001030055chr141835 14033 --11481
NM_001031677chr5141 1430 1389 --
NM_001031679chr1253154 2726 1249 358 301 12361 12660 --
NM_001031695chr22145348 5201 5093 4940 4932 4923 4379 3906 3475 3299 2043 1873 1609 601 44986 3646 1296 952 35083 5081 4468 15097
NM_001031702chr32594 89 --191 --
NM_001031720chr41162 ------
NM_001031732chr412892 62997 2914 2785 2770 1180 496 1659 --
NM_001031738chr2------1206
NM_001031801chr221119 --1147 --
NM_001031804chr1624167 1148 --33596 3265 447 --
NM_001031812chr52944 559 ------
NM_001032221chr9121846 1590 1503 1463 1408 1391 1281 696 669 304 98 57 1738 41595 1505 1495 1465 1673
NM_001032279chr113293 51 41 --1340 --
NM_001032280chr661191 1110 454 227 201 154 11524 11476 --
NM_001032288chr2041234 1056 408 381 --4625 383 35 29 1579
NM_001032289chrX4773 336 234 221 --4339 172 108 72 --
NM_001032293chr171119 ------
NM_001032296chr1352847 2280 840 708 53 11945 32175 391 56 --
NM_001033025chr131251 1243 1233 --11225 --
NM_001033026chr193450 161 51 --1164 --
NM_001033044chr111452 --41794 1779 1776 62 170
NM_001033047chr451862 628 429 77 68 1299 11935 12294
NM_001033056chr111452 --41794 1779 1776 62 170
NM_001033057chr31334 11787 1664 --
NM_001033059chr62667 650 1359 1656 1670
NM_001033081chr13695 613 243 --6455 193 191 68 66 62 --
NM_001033082chr13695 613 243 --6455 193 191 68 66 62 --
NM_001033085chr21238 ------
NM_001033117chr3124700 4436 4404 4301 4111 3479 1569 1479 1457 1318 292 82 24332 545 44282 3471 1344 1329 --
NM_001033507chr131774 1504 313 ------
NM_001033551chr17123365 3134 2877 2689 1435 1375 1069 1035 678 596 256 23 1330 93821 3741 3192 1646 1129 1088 432 223 221 23691 3625
NM_001033561chr173824 808 799 1299 3833 339 335 1317
NM_001033602chr1362426 2402 2300 506 136 42 ------
NM_001033723chr832465 2196 953 12265 21996 767 --
NM_001033756chr651640 1438 1430 1422 179 --31351 542 540 --
NM_001033756chr651640 1438 1430 1422 179 --31351 542 540 --
NM_001033925chr1011748 --2442 437 --
NM_001033952chr112295 243 1222 ----
NM_001034025chr121349 ------
NM_001034837chr54742 715 290 263 ------
NM_001034838chr54742 715 290 263 ------
NM_001034954chr1021027 265 2540 516 2436 271 --
NM_001034955chr1021027 265 2540 516 2436 271 --
NM_001034956chr1021027 265 2540 516 2436 271 --
NM_001034957chr1021027 265 2540 516 2436 271 --
NM_001035235chr52242 69 1464 ----
NM_001035254chr992395 2123 1989 1579 748 661 228 143 79 1832 32454 731 646 21947 121
NM_001035511chr15747 714 660 170 81 11449 3754 750 118 11878
NM_001035512chr15854 821 767 277 188 11556 3861 857 225 11985
NM_001035513chr15854 821 767 277 188 11556 3861 857 225 11985
NM_001035521chr24737 227 132 87 --2206 204 --
NM_001037131chr22405 98 1176 2124 103 1234
NM_001037132chr711690 12229 11698 --
NM_001037133chr711690 12229 11698 --
NM_001037165chr7228928 7529 6559 6449 6251 5617 5542 2864 2307 2127 1823 1635 1520 1427 1068 890 717 501 285 270 254 170 11749 46074 2217 274 256 13243
NM_001037317chr121774 173 1155 ----
NM_001037332chr5102253 2171 1791 558 491 481 334 259 144 125 1522 3580 346 261 1171
NM_001037333chr5102253 2171 1791 558 491 481 334 259 144 125 1522 3580 346 261 1171
NM_001037553chr21134920 3333 1821 1799 1703 1266 1216 1147 786 462 433 312 269 --21870 1286 --
NM_001037954chr1133397 1346 44 --11348 --
NM_001038493chr261099 343 310 223 208 39 ------
NM_001038707chr171540 840 635 515 441 433 84 --3454 173 164 11434
NM_001038707chr171540 840 635 515 441 433 84 --3454 173 164 11434
NM_001039140chr205414 403 199 184 56 --1177 1191
NM_001039350chr711097 --41283 239 174 75 21102 278
NM_001039459chr74465 458 328 226 ------
NM_001039469chr114227 218 124 107 --4281 231 126 109 1234
NM_001039479chr1431836 1656 177 11634 31838 377 123 1862
NM_001039538chr211375 --21033 925 --
NM_001039548chr11------171
NM_001039550chr22749 88 --4755 752 90 56 --
NM_001039570chr22134437 4198 4154 4036 3951 3420 3346 1321 1206 575 192 66 33 23980 3605 84387 4200 3532 1838 137 106 104 95 11826
NM_001039571chr22134437 4198 4154 4036 3951 3420 3346 1321 1206 575 192 66 33 23980 3605 84387 4200 3532 1838 137 106 104 95 11826
NM_001039574chr15951 892 688 337 302 1139 2915 904 --
NM_001039577chr1164489 3876 3764 3526 3393 3386 3074 2875 2785 2756 1336 1285 876 737 676 78 21447 832 11287 --
NM_001039580chr424527 4494 11847 14497 24513 3549
NM_001039582chrX271 51 --2225 88 177
NM_001039583chr222130 123 1498 2224 220 --
NM_001039584chr222130 123 1498 2224 220 --
NM_001039585chr133857 1611 48 13646 11412 13447
NM_001039590chrX23838 2879 ----23619 2882
NM_001039591chrX23838 2879 ----23619 2882
NM_001039618chr113510 307 47 14635 ----
NM_001039690chr1652161 1941 1586 1493 589 31518 912 449 12218 --
NM_001039711chr12828 170 1161 41049 896 747 194 1904
NM_001039712chr12828 170 1161 41049 896 747 194 1904
NM_001039762chr1031952 1559 933 2708 284 ----
NM_001039771chr1431031 887 859 1325 41055 979 315 97 --
NM_001039802chr141319 1139 427 368 --1177 --
NM_001039840chrX46001 5946 5924 889 ------
NM_001039877chr197812 763 660 650 615 247 162 1152 1743 1182
NM_001039888chr11790 1664 ----
NM_001039916chr1221021 847 --1241 --
NM_001039917chr1221021 847 --1241 --
NM_001039918chr1221021 847 --1241 --
NM_001039919chr1221021 847 --1241 --
NM_001039920chr1221021 847 --1241 --
NM_001039937chr1333701 2862 1100 2290 247 --11497
NM_001039960chr1251418 455 394 302 253 --1516 --
NM_001040002chr1751345 1061 932 205 106 21251 1069 2363 328 189
NM_001040020chr72527 489 11502 ----
NM_001040031chr192263 56 ------
NM_001040057chr731513 984 450 --11253 --
NM_001040100chr321056 358 ------
NM_001040144chr1652161 1941 1586 1493 589 31518 912 449 12218 --
NM_001040146chr1652161 1941 1586 1493 589 31518 912 449 12218 --
NM_001040151chr11164390 4262 3928 3830 3566 3231 3221 2892 1840 1119 774 649 313 270 185 110 31824 1644 1488 54265 3774 3765 361 315 --
NM_001040152chr723132 343 23428 1795 15022 --
NM_001040159chr4------182
NM_001040167chr721047 734 --11027 198
NM_001040172chr551308 999 652 559 510 --2423 234 11012
NM_001040173chr551308 999 652 559 510 --2423 234 11012
NM_001040214chr632217 345 206 1279 ----
NM_001040272chr972344 1453 837 455 286 271 102 32154 952 704 21517 289 2462 138
NM_001040424chr2152672 2091 911 474 145 --2932 281 12883
NM_001040429chr1333508 376 65 11210 ----
NM_001040439chr1651428 1310 553 376 347 11365 21352 1122 --
NM_001040441chr121937 1623 23959 3945 31939 1625 1282 --
NM_001040624chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040625chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040626chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040627chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040628chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040629chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040630chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_001040709chr1122283 1633 909 889 829 820 751 742 476 187 94 80 11681 2427 83 3916 101 87
NM_001040712chr922674 430 --12529 --
NM_001040715chr163793 455 182 1808 2815 373 --
NM_001042361chr103256 179 85 ------
NM_001042364chr103256 179 85 ------
NM_001042365chr103256 179 85 ------
NM_001042387chr103256 179 85 ------
NM_001042388chr181111 ------
NM_001042393chr103256 179 85 ------
NM_001042396chr103256 179 85 ------
NM_001042397chr103256 179 85 ------
NM_001042404chr141934 1323 502 390 11608 11754 --
NM_001042413chr9104060 3822 2756 1594 1124 1104 1091 1000 512 266 12981 11596 13170
NM_001042424chr4112777 2290 1273 1074 652 635 344 288 242 149 131 22571 2528 12292 --
NM_001042425chr661191 1110 454 227 201 154 11524 11476 --
NM_001042437chr23879 680 154 ------
NM_001042472chr204558 460 421 231 155 3561 507 43 --
NM_001042486chr2061561 1528 1224 573 408 170 1417 31136 582 578 --
NM_001042492chr1773458 2590 2141 1124 883 81 63 --43476 2936 1127 889 --
NM_001042494chr1573497 3331 1250 1108 1003 902 596 2210 54 23641 904 --
NM_001042495chr1573497 3331 1250 1108 1003 902 596 2210 54 23641 904 --
NM_001042496chr1573497 3331 1250 1108 1003 902 596 2210 54 23641 904 --
NM_001042497chr1573497 3331 1250 1108 1003 902 596 2210 54 23641 904 --
NM_001042498chrX4910 371 358 100 1128 3309 245 209 --
NM_001042506chrX7987 523 497 431 287 188 177 --111158 490 488 418 210 208 179 159 149 147 83 --
NM_001042510chr831407 1343 146 ------
NM_001042511chr831407 1343 146 ------
NM_001042533chr321087 130 ----1499
NM_001042537chrX52029 1678 1533 833 583 ------
NM_001042539chr1681040 982 933 420 400 364 239 162 --4939 245 243 120 1989
NM_001042555chr12104774 4168 4145 4134 3198 3190 2984 1856 1845 534 33540 1237 1177 23037 3034 11214
NM_001042599chr2117611 6716 5766 5543 5512 5473 2981 2809 2600 2526 113 57624 6330 5979 540 51 --27593 693
NM_001042601chr31504 --1662 --
NM_001042603chr1254179 3910 1789 1546 129 24848 4371 11367 11372
NM_001042604chr324147 3465 ------
NM_001042632chr2072257 1928 1903 1780 1662 886 533 11807 42318 2316 1616 122 --
NM_001042633chr2072257 1928 1903 1780 1662 886 533 11807 42318 2316 1616 122 --
NM_001042663chr12347 235 --11332 21078 525
NM_001042664chr12347 235 --11332 21078 525
NM_001042665chr12347 235 --11332 21078 525
NM_001042681chr162618 2427 2399 2250 268 204 1221 12156 --
NM_001042682chr162618 2427 2399 2250 268 204 1221 12156 --
NM_001042682chr162618 2427 2399 2250 268 204 1221 12156 --
NM_001042728chr1271041 1021 988 769 738 299 170 3940 886 64 61043 1026 744 673 192 105 --
NM_001042729chr11543 ------
NM_001042747chr11543 ------
NM_001043318chr1493711 3253 3197 3167 1488 1272 728 502 226 33393 3282 1671 61095 1064 888 819 816 809 --
NM_001044385chr253805 3717 3608 1205 880 --33807 1333 415 --
NM_001044722chr52944 559 ------
NM_001044723chr52944 559 ------
NM_001048183chr153772 3718 3041 1123 86 --1320 --
NM_001069chr61137 ------
NM_001077628chr11480 --1487 1185
NM_001079874chr151867 1494 306 270 124 --1127 --
NM_001080418chr13611 240 213 --3579 542 540 --
NM_001083620chr421860 958 ------
NM_001087chr22401 328 --1147 --
NM_001092chr1751841 1566 845 622 494 2478 351 1465 --
NM_001094chr171202 --4667 583 579 28 1343
NM_001095chr1291857 1724 1494 1250 588 368 261 96 74 --41669 1282 1273 1223 41226 468 279 265
NM_001096chr17----149 --
NM_001100108chr1138240 7470 6817 6754 6443 5850 2483 1571 1221 1153 1102 938 793 36653 2201 708 37853 2152 1563 27474 1232
NM_001106chr399709 8001 7477 7172 6274 2817 2248 1838 498 27146 6926 52962 517 513 509 500 --
NM_001111chr1102428 2045 1942 1728 1667 884 803 685 631 504 1216 1453 --
NM_001113490chrX33479 655 56 13574 ----
NM_001117chr1832024 741 607 11718 1760 --
NM_001122631chr111438 1446 ----
NM_001122679chr5161 2273 180 ----
NM_001124chr112561 74 ----1565
NM_001127chr226985 708 451 366 123 76 --1875 --
NM_001128chr1653087 2716 1061 185 82 33634 2837 547 22821 769 1189
NM_001130chr192627 199 --5634 335 211 208 205 --
NM_001140chr175464 209 193 115 99 ------
NM_001144chr16----1200 --
NM_001146chr831936 1673 103 11759 ----
NM_001148chr411412 21660 323 ----
NM_001163chr991002 893 862 812 326 216 158 92 38 --21016 1005 --
NM_001167chrX22539 400 15725 16286 --
NM_001173chr141835 14033 --11481
NM_001174chrX6908 425 404 155 134 115 --1117 --
NM_001175chr123418 97 72 --176 --
NM_001177chr1221989 386 --249 21 --
NM_001186chr2153218 849 704 645 441 ------
NM_001188chr661249 1085 1067 979 329 92 21052 445 2850 238 2983 242
NM_001190chr192276 65 ------
NM_001191chr204945 443 331 59 --51339 1335 1118 570 453 21401 382
NM_001194chr194475 417 256 187 --1508 --
NM_001198chr651902 845 827 310 123 2960 753 2808 806 --
NM_001204chr275372 5215 4790 1489 1187 686 93 1609 15217 --
NM_001206chr932782 2348 213 12202 1152 --
NM_001221chr41104 --1107 --
NM_001222chr1031804 1316 1261 11420 11613 --
NM_001232chr14934 890 478 138 1326 1449 1483
NM_001256chr1742503 602 273 63 2800 548 ----
NM_001257chr161189 --1192 --
NM_001259chr766080 5989 4516 1127 922 63 11515 ----
NM_001265chr132317 72 --2320 90 1192
NM_001273chr12171 --173 --
NM_001277chr115809 757 750 694 66 --3863 766 683 --
NM_001283chr74190 163 108 65 --1167 --
NM_001299chr19127 1104 188 1324
NM_001300chr101129 ------
NM_001304chr1743594 2495 1200 170 124 --23303 2940
NM_001310chr1252442 2339 2100 1240 1062 11973 12102 --
NM_001315chr631875 786 67 2491 108 21894 1892 1789
NM_001319chr1931079 414 231 1950 2416 234 --
NM_001331chr1182187 2020 1748 1732 742 622 501 216 1229 31101 932 202 2925 209
NM_001351chr311371 ------
NM_001352chr19134 --137 --
NM_001356chrX----1239 --
NM_001358chr41178 ------
NM_001364chr11154373 4300 4035 3709 3341 3314 3263 3188 3173 3121 3070 1920 933 392 295 --33127 3124 855 --
NM_001365chr172323 162 --299 88 --
NM_001383chr171557 --1254 --
NM_001387chr593001 2925 2913 2580 2570 2297 1236 804 559 22772 615 32927 227 222 --
NM_001389chr211165 ------
NM_001390chr1843259 2680 1126 27 11057 12428 12864
NM_001396chr213643 427 418 --1699 1242
NM_001397chr182368 2275 2234 2046 928 730 512 185 32260 1795 999 72559 2291 2286 2023 2021 1826 497 21041 506
NM_001399chrX123849 3633 3568 3447 3027 2417 2373 1542 1422 603 413 36 33670 3465 140 23450 1405 11325
NM_001400chr13483 464 319 ------
NM_001401chr91385 --158 --
NM_001406chr1791517 1158 1148 534 451 440 410 305 274 --51306 581 536 454 126 2501 54
NM_001407chr371653 1546 1505 1442 422 379 106 11317 1425 11660
NM_001408chr1121497 1485 1296 1287 1122 1102 402 393 362 210 96 34 --71499 1487 1302 1299 1265 352 197 2601 45
NM_001417chr1271794 1776 1741 1302 1202 522 37 11469 11780 11783
NM_001419chr1993843 3603 3577 3051 3033 1739 1454 835 278 11867 11744 13616
NM_001420chr19122941 2831 2813 2709 2523 2510 2148 1207 410 221 209 32 12669 62583 2581 2558 2556 2531 2529 11156
NM_001421chrX61684 1669 1352 694 610 128 11262 61615 1469 1444 1439 1436 1360 --
NM_001423chr1241568 525 242 218 1696 ----
NM_001426chr22593 58 ----1596
NM_001427chr771726 829 810 759 752 745 736 21403 295 11835 832 816 813 799 796 793 768 720 716 688 --
NM_001429chr221907 --1237 --
NM_001430chr251516 661 470 253 61 11283 3472 302 300 --
NM_001432chr422437 1409 ----12893
NM_001438chr15428 321 269 220 23 1162 2435 383 --
NM_001439chr131251 1243 1233 --11225 --
NM_001447chr561240 1032 938 527 483 304 1158 21244 1226 --
NM_001448chrX1503 ----1212
NM_001449chrX1101 1134 ----
NM_001453chr641259 367 353 146 --31522 369 359 11262
NM_001454chr174912 874 266 216 --2379 220 1391
NM_001465chr531873 1618 307 --11877 --
NM_001478chr122888 242 1376 2972 245 1222
NM_001489chr9121 ------
NM_001493chrX3732 211 49 --2230 76 1738
NM_001494chr10----1139 --
NM_001495chr861034 981 923 907 824 224 --4916 913 909 143 1403
NM_001497chr951123 1105 484 115 83 11976 22269 487 11114
NM_001518chr71807 ------
NM_001520chr162520 190 2578 207 2227 25 --
NM_001521chr24737 227 132 87 --2206 204 --
NM_001542chr111939 21788 592 150 11942
NM_001543chr5174722 4527 4441 4219 3870 3707 3459 3216 1922 1875 1804 1602 1284 1210 636 347 327 54829 3580 3472 398 304 41570 1395 707 215 11398
NM_001555chrX2205 32 1190 ----
NM_001560chrX52425 1763 1692 623 50 11749 22170 1708 --
NM_001569chrX--2843 25 1333 --
NM_001584chr11----21027 1025 11033
NM_001587chrX52129 1957 783 354 150 --1464 --
NM_001604chr111688 ------
NM_001616chr242554 833 824 270 11124 11371 1580
NM_001619chr1131023 975 357 --41005 977 269 134 --
NM_001634chr62667 650 1359 1656 1670
NM_001635chr74954 432 400 271 ------
NM_001654chrX2415 395 2116 109 1397 --
NM_001655chr1131541 300 271 11891 ----
NM_001658chr12761 27 --1939 1942
NM_001659chr1292627 2077 2016 1815 1685 748 672 388 83 --52579 2501 416 156 147 21818 891
NM_001660chr33513 337 236 ------
NM_001662chr73106 94 75 ----1110
NM_001663chr1422695 23 1766 1542 --
NM_001664chr34993 943 924 222 ------
NM_001665chr111485 --2426 39 --
NM_001668chr142123 596 500 148 1109 32268 2109 96 --
NM_001678chr17121730 1699 1232 1206 1188 638 581 497 320 304 71 29 21609 206 41328 1193 562 445 176
NM_001681chr122237 126 ------
NM_001682chr1212588 ------
NM_001683chr372311 2217 2058 1905 1875 353 322 --2900 356 --
NM_001684chr1173700 3598 3219 3176 3144 3035 2979 1496 1472 1232 1085 1041 665 578 553 334 320 22630 1411 33262 2788 1403 13042
NM_001686chr12131 ------
NM_001690chr322293 649 --2543 208 --
NM_001693chr821139 191 ----1341
NM_001701chr921296 82 ----185
NM_001702chr84555 518 426 407 ------
NM_001706chr3----1185 1192
NM_001707chr72794 628 1758 ----
NM_001717chr1521479 529 1977 1533 --
NM_001730chr1321516 32 ----143
NM_001730chr1321516 32 ----143
NM_001731chr12169 1277 ----
NM_001741chr112295 243 1222 ----
NM_001742chr721215 84 1202 ----
NM_001743chr22151 90 1139 ----
NM_001746chr552223 2180 915 543 37 22198 465 346 43 39 --
NM_001753chr721408 731 11764 11214 --
NM_001754chr2174087 3993 2855 2812 2788 1111 973 --64169 2944 2861 2857 2800 2792 --
NM_001759chr12104936 4364 4119 4094 4026 3998 3702 3324 1419 1059 13550 63575 3375 3373 2131 1038 1035 --
NM_001760chr65816 802 730 112 63 1830 2216 213 1807
NM_001773chr141230 1100 565 62 21275 86 71236 1233 1102 249 78 72 49 31305 479 122
NM_001774chr192263 56 ------
NM_001777chr363537 1108 781 737 661 631 --21137 1132 13097
NM_001783chr192385 68 1121 2345 263 --
NM_001788chr71765 ------
NM_001789chr341277 213 47 37 --21467 1465 --
NM_001791chr141319 1139 427 368 --1177 --
NM_001796chr16----162 --
NM_001805chr14134 ------
NM_001806chr191298 31057 553 229 ----
NM_001810chr203691 554 223 --4804 697 694 126 --
NM_001825chr51132 ------
NM_001830chrX73508 3381 3052 2823 2694 2456 1043 --1741 --
NM_001838chr173851 597 88 1257 2124 122 136
NM_001842chr93459 428 199 --3491 464 434 1203
NM_001844chr122321 149 --1151 --
NM_001852chr16603 590 567 533 100 56 --1491 1103
NM_001854chr11253 ------
NM_001859chr943527 3264 394 96 ----13009
NM_001893chr173325 120 84 --1300 --
NM_001894chr2241094 933 905 793 --2940 253 --
NM_001895chr2061052 1015 1004 363 277 54 31022 792 384 1279 --
NM_001915chr1761711 1703 1665 1569 430 166 1529 31393 773 704 1817
NM_001920chr12----1656 --
NM_001921chr4----2869 262 --
NM_001923chr112200 34 1137 161 --
NM_001924chr1182 ------
NM_001927chr25682 144 130 106 56 1513 3699 694 109 --
NM_001932chr171654 --1825 162
NM_001933chr144904 462 66 58 --2189 187 --
NM_001936chr711097 --41283 239 174 75 21102 278
NM_001937chr131010 904 118 --11013 --
NM_001940chr122536 390 --164 1442
NM_001945chr52990 255 11058 21003 276 --
NM_001949chr671145 1129 731 318 311 208 22 33047 2091 99 ----
NM_001951chr81129 ------
NM_001954chr67821 590 525 279 270 204 177 --2179 94 2529 27
NM_001964chr52333 131 --2186 134 1193
NM_001965chr2165 --190 --
NM_001969chr1432939 2542 964 151 ----
NM_001970chr177579 536 400 243 236 189 63 1144 4594 477 245 106 --
NM_001971chr12128 ------
NM_001975chr124823 119 93 44 3795 546 248 1767 --
NM_002006chr485839 5437 1844 1754 1730 1419 728 198 22312 1465 15439 --
NM_002009chr1532396 1061 870 ------
NM_002010chr13----1191 --
NM_002014chr125604 574 561 208 49 1216 1279 --
NM_002015chr1353060 2326 2192 1322 94 ----12353
NM_002025chrX47560 7545 6814 3055 58787 6645 6485 5693 412 48688 7530 7528 6816 --
NM_002026chr221022 1014 ------
NM_002035chr1821408 1378 ----11206
NM_002037chr6286 53 ------
NM_002045chr3----258 38 --
NM_002048chr941068 195 160 121 --3227 224 184 --
NM_002062chr641563 467 150 22 51577 1157 1072 552 325 31539 1053 500 11279
NM_002065chr111452 --41794 1779 1776 62 170
NM_002068chr194619 504 217 91 1680 ----
NM_002071chr183453 256 152 ------
NM_002072chr92788 33 --2393 373 --
NM_002074chr1----1113 --
NM_002077chr942062 1918 1837 152 --21561 1549 --
NM_002080chr16----2835 223 --
NM_002082chr53914 359 104 1112 1767 147
NM_002086chr17101941 1852 1807 1793 1694 1663 1602 1424 250 243 22037 500 21943 1878 --
NM_002087chr174206 118 96 69 --181 --
NM_002092chr474807 4793 3251 2009 1874 880 729 13933 24813 3759 --
NM_002094chr161332 1359 1103 --
NM_002103chr194773 262 244 21 --2817 775 --
NM_002105chr113752 130 36 --5686 684 146 141 135 --
NM_002126chr1763497 2799 1043 987 343 320 33300 995 314 22781 325 13805
NM_002139chrX1132 --2613 602 --
NM_002145chr171145 ----173
NM_002146chr1741367 1114 412 144 --1150 --
NM_002147chr172244 68 2947 309 4801 356 354 166 --
NM_002149chr24738 694 495 185 --3188 157 99 1162
NM_002160chr91172 ------
NM_002161chr9136 155 ----
NM_002167chr1173 ------
NM_002181chr24511 496 241 119 2683 171 1637 --
NM_002193chr2----11822 1566
NM_002196chr205855 739 221 178 76 --1311 1232
NM_002196chr205855 739 221 178 76 --1311 1232
NM_002204chr1761337 1294 1263 360 228 195 1934 21341 215 21206 219
NM_002205chr125838 270 179 116 44 2945 846 2183 120 --
NM_002214chr764671 3561 1409 1044 645 333 ----11897
NM_002221chr162248 2230 709 587 432 45 12291 22888 48 --
NM_002223chr1243944 3223 3066 2752 --11328 11331
NM_002226chr143883 719 688 1762 ----
NM_002228chr11198 --2946 943 1950
NM_002229chr19----1366 --
NM_002230chr176867 830 430 339 85 45 --1987 2307 139
NM_002232chr13216 207 140 --2146 142 --
NM_002233chr11----128 --
NM_002240chr21132 --2252 34 --
NM_002241chr172342 2095 2088 608 227 186 93 42269 1070 652 110 2391 117 22194 199
NM_002247chr1061960 1745 1738 664 102 91 22081 52 --11842
NM_002249chr12446 61 ------
NM_002253chr4--1208 1997 --
NM_002254chr2112252 2242 2054 883 841 798 771 648 533 512 319 1410 --31823 1728 296
NM_002264chr321020 310 24409 3371 31266 1259 343 1617
NM_002265chr1721052 306 150 ----
NM_002267chr131225 1451 ----
NM_002268chr31756 --11623 --
NM_002270chr575450 5057 4210 4040 1982 1408 573 ----14043
NM_002271chr1321935 639 1784 ----
NM_002285chr242824 2790 1087 709 22646 518 1645 --
NM_002286chr12154 ------
NM_002293chr152708 969 378 102 30 22164 1737 1350 12415
NM_002296chr111119 ------
NM_002309chr2293004 2818 2753 2729 2595 2382 2002 1125 727 32923 2289 484 32732 2490 716 12444
NM_002310chr551975 1840 1046 972 505 55446 5421 2407 2275 2260 22465 1885 --
NM_002313chr1095048 4127 3833 3595 3124 1859 763 738 719 21489 1445 24873 4869 --
NM_002315chr111106 ------
NM_002319chr72310 301 --5747 328 323 303 190 2815 23
NM_002333chr1931266 1077 822 --2259 257 1984
NM_002334chr1161751 1515 1309 769 688 104 31990 737 318 5691 311 113 110 107 11518
NM_002336chr1224961 2036 1864 --1748
NM_002355chr1221369 166 3571 91 39 --11374
NM_002356chr631945 176 41 12611 2178 43 --
NM_002359chr17123939 3826 3757 3073 3045 2787 2759 1120 385 124 97 72 13472 43323 2833 2827 100 1109
NM_002373chr1561321 1287 978 504 269 162 2497 483 31310 336 333 3926 38 22
NM_002374chr211375 --21033 925 --
NM_002375chr3171830 1758 1702 1578 657 540 534 368 350 341 292 182 166 63 54 43 32 22154 2142 71705 626 624 80 69 56 34 --
NM_002382chr1441040 942 118 55 --21309 492 2347 184
NM_002383chr1611863 805 756 370 350 328 300 243 223 187 62 --3762 68 66 1812
NM_002385chr1851279 1033 1003 627 307 --21193 248 1109
NM_002387chr55873 752 425 417 210 24571 3593 3754 295 293 --
NM_002399chr15--1885 1119 --
NM_002406chr57933 858 834 767 356 170 95 --2414 409 --
NM_002430chr2282201 1935 1740 1729 842 826 306 23 --51742 454 62 45 43 --
NM_002442chr12101728 1712 1567 1290 1275 437 343 306 205 146 --61573 1294 610 310 243 106 41576 1331 1297 193
NM_002465chr123236 45 30 ------
NM_002473chr226995 417 276 195 152 137 --7450 447 211 207 117 82 55 --
NM_002499chr1532047 1644 215 11996 21636 176 --
NM_002501chr19164120 4054 3919 3885 3198 3094 3007 2987 2972 1559 1224 1215 870 571 355 185 33611 542 122 283921 3903 3900 3891 3872 3689 3654 3201 3107 3103 3099 3061 1549 1546 1495 1409 1394 1392 1336 619 593 589 585 581 577 553 551 358 43533 1413 1340 189
NM_002506chr1255 42 --123 --
NM_002507chr1761745 1585 1486 1277 238 119 31602 1397 289 41908 1826 1531 1280 31271 796 482
NM_002508chr141570 1270 538 360 31955 156 146 ----
NM_002509chr203779 683 217 1828 1295 --
NM_002515chr1421374 1273 --11741 --
NM_002516chr194234 207 106 34 --6237 68 65 62 47 37 --
NM_002522chr17113046 2885 2846 2733 2536 1340 1126 976 875 843 835 191 32582 673 82 22625 1238
NM_002524chr13237 195 72 1960 --1134
NM_002526chr61580 ------
NM_002530chr15262 41 --147 --
NM_002537chr152919 85 ------
NM_002542chr31211 253 30 265 42 --
NM_002544chr17----138 --
NM_002545chr1134184 294 276 --34164 3212 958 11016
NM_002546chr8------1173
NM_002547chrX43979 3933 340 215 23921 1292 23944 3937 1267
NM_002556chr1151981 1841 1577 732 302 11951 31773 340 304 --
NM_002569chr15111416 1405 1344 1326 1279 1182 436 362 354 129 35 1468 1987 11410
NM_002576chr112226 127 31124 330 106 ----
NM_002577chr3123124 1622 1529 1494 1488 906 896 809 793 780 411 335 --31627 1501 1496 --
NM_002578chrX2369 30 --1326 2157 33
NM_002581chr973767 2270 1588 1443 961 789 96 2810 599 --11481
NM_002585chr11261 ----174
NM_002586chr671571 1437 1103 1095 376 306 128 11300 41164 324 322 215 3402 388 329
NM_002588chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_002594chr2032428 807 310 11595 134 --
NM_002595chr121413 ------
NM_002601chr2--2113 74 1328 --
NM_002607chr721011 890 --21118 132 --
NM_002608chr2271511 1489 1343 621 563 263 96 --41399 340 189 143 11360
NM_002609chr551712 486 438 351 116 1250 3555 321 38 --
NM_002612chr71656 21361 91 ----
NM_002616chr17--1117 1383 1375
NM_002622chr54218 162 85 27 1634 ----
NM_002628chr31462 ------
NM_002632chr143572 562 132 1784 1574 --
NM_002636chr63428 337 68 --170 --
NM_002641chrX1601 ------
NM_002644chr161673 395 382 147 92 22 --2411 399 --
NM_002645chr112905 638 ----1927
NM_002646chr162155 2148 1882 1855 1352 798 --379 66 64 --
NM_002648chr661073 983 975 195 73 22 --2220 25 --
NM_002649chr71144 ------
NM_002650chr22176 ------
NM_002651chr13867 212 47 1560 --1652
NM_002653chr53930 847 148 --1140 --
NM_002655chr823914 566 ------
NM_002657chr20193656 3609 3417 3243 3212 2903 2860 2646 2517 2491 1546 1463 1346 1147 1032 802 616 530 292 33166 1040 74 33658 3206 2372 12477
NM_002698chr19182792 2599 2378 2340 2322 2301 2282 2263 2222 2035 1195 1142 1131 1123 1015 1009 214 187 22607 1934 182330 2309 2288 2285 2269 2266 2113 1134 1074 1070 1067 1033 1017 755 315 220 217 190 1224
NM_002699chr1101088 1078 954 530 500 423 385 346 284 158 11142 21366 428 --
NM_002705chr163293 260 46 1229 182 --
NM_002707chr2----2156 154 --
NM_002714chr62983 850 2194 100 ----
NM_002716chr1163559 3521 3508 3494 2558 406 22496 2443 13523 --
NM_002717chr82652 465 --1492 --
NM_002718chr352569 894 650 357 216 ----1183
NM_002719chr1421706 180 1318 ----
NM_002721chr9--1202 1357 --
NM_002730chr1961267 1250 1030 925 910 204 3977 870 249 21164 195 41167 1133 1113 227
NM_002734chr1741979 915 31 22 --135 --
NM_002745chr2264179 4172 1312 320 198 60 34012 3483 507 1323 21324 390
NM_002746chr165594 491 248 207 147 --2192 59 --
NM_002753chr4----121 2301 51
NM_002776chr1951630 737 325 159 86 31577 697 178 41938 161 108 106 --
NM_002791chr14----1112 1105
NM_002821chr65560 506 309 157 87 --1311 1549
NM_002823chr22157 68 ------
NM_002824chr125392 381 160 136 93 1333 1462 2384 313
NM_002829chr93347 273 45 ----1854
NM_002833chr1551288 1116 414 366 325 31309 357 122 31427 317 313 --
NM_002836chr203534 434 414 --2425 418 1440
NM_002837chr1233914 2894 608 --24535 2920 13918
NM_002839chr922674 430 --12529 --
NM_002840chr131218 371 61 ----1597
NM_002843chr1173269 2423 2108 1110 747 738 256 12886 32219 2217 702 11118
NM_002846chr24520 461 78 42 --2483 406 --
NM_002847chr761370 1334 1092 1002 635 545 11348 1121 --
NM_002850chr1991058 973 965 942 795 359 309 237 197 --1394 1363
NM_002854chr221122 ----1116
NM_002855chr11223633 3280 3196 2759 2670 2639 2284 2259 1497 1409 1341 1034 898 829 813 700 572 432 326 255 191 50 21479 1455 73553 458 455 352 200 194 37 1211
NM_002859chr1291609 1442 667 638 412 243 236 160 121 --101355 1352 1192 600 541 464 415 219 206 203 31715 1339 33
NM_002865chr8162 --165 --
NM_002866chr193495 30 23 2233 170 3499 187 49 141
NM_002868chr1292234 2172 2106 1982 1494 913 745 415 330 1776 72178 2174 419 371 317 314 234 22414 2162
NM_002869chr1151781 1771 1754 1713 381 1859 1444 11775
NM_002874chr91886 1894 1874 --
NM_002880chr32562 71 2873 238 1225 --
NM_002881chr251401 938 240 231 94 11266 2233 102 --
NM_002885chr15807 334 306 148 139 --1898 --
NM_002886chr394601 4594 3362 1874 1131 1092 270 244 154 34915 1350 1120 11300 14152
NM_002892chr142147 22 11225 ----
NM_002903chr17123 --2257 26 --
NM_002904chr62190 83 1184 ----
NM_002906chr111776 ------
NM_002907chr121423 ------
NM_002912chr61305 ------
NM_002918chr193764 319 305 157 41061 1057 784 145 --
NM_002938chr451994 1472 1285 682 499 --1595 --
NM_002942chr33942 476 273 1978 ----
NM_002945chr172132 60 1683 1253 --
NM_002953chr12626 59 ----1174
NM_002956chr1231272 1018 166 ------
NM_002957chr9123737 3692 3229 2996 2710 2656 1567 1451 1339 807 777 264 23522 1004 32638 1370 484 12792
NM_002959chr1144173 4058 3957 3490 3327 3103 3069 3061 2914 1586 895 678 547 60 11435 11589 14150
NM_002966chr11212 --279 25 --
NM_002971chr31368 ------
NM_002973chr12136 --140 --
NM_002984chr17190 1202 --175
NM_002997chr251645 1423 612 599 107 --31648 299 88 --
NM_003001chr15854 821 767 277 188 11556 3861 857 225 11985
NM_003009chr191277 ----1267
NM_003010chr1772377 1959 1847 1819 1685 1543 935 11910 --11822
NM_003011chr94661 381 310 99 ------
NM_003012chr842994 2714 1067 155 --11084 --
NM_003013chr4--184 1128 --
NM_003016chr1731851 1688 277 1356 21857 772 --
NM_003026chr92426 28 1468 ----
NM_003028chr9133588 3385 3127 2920 2389 2373 2357 1542 1494 989 773 342 234 --63777 3320 2628 2626 2481 1066 --
NM_003030chr341407 1343 133 114 1141 ----
NM_003039chr13200 138 44 1248 ----
NM_003042chr34693 541 470 417 11871 --11715
NM_003045chr13124866 3119 1609 1289 801 493 423 365 339 279 253 78 13062 44945 3416 3121 803 1283
NM_003047chr1111343 1180 1173 980 412 322 275 258 206 187 31 --111245 1162 1062 506 325 309 306 163 160 111 74 11267
NM_003051chr111807 21645 1549 1736 --
NM_003070chr92746 44 --147 --
NM_003072chr19----1357 --
NM_003074chr361919 1392 733 255 145 138 --1257 --
NM_003075chr12187 --4319 68 25 23 --
NM_003076chr12151680 1655 1603 1524 1434 1406 1371 1334 1067 1037 679 479 449 202 188 --51416 1043 666 505 241 11324
NM_003077chr174647 224 121 22 --1332 --
NM_003079chr173982 403 370 ------
NM_003081chr2051156 1147 978 269 150 ----125
NM_003091chr202200 192 ------
NM_003099chr15106056 5943 5923 5242 5076 775 555 529 118 58 35934 5860 5472 21462 1137 26063 62
NM_003107chr65926 674 663 446 210 1203 5666 529 448 368 344 --
NM_003108chr2166369 6311 5499 2918 2814 2776 2660 2273 1962 1877 1865 1834 1816 1038 276 270 --26503 1855 25063 1859
NM_003110chr175697 413 402 164 52 140 4849 845 842 200 --
NM_003111chr211087 1876 ----
NM_003112chr71276 1218 ----
NM_003118chr532065 1772 634 159 31986 747 45 1422
NM_003128chr242873 2823 1948 404 --21941 1939 --
NM_003131chr6111964 1917 842 798 674 654 369 330 249 209 189 --112206 1434 1431 817 677 667 656 601 527 525 202 21926 193
NM_003137chr62279 74 12025 153 --
NM_003139chr113715 678 151 2618 38 3815 766 234 1221
NM_003145chr13361 45 23 --1370 250 28
NM_003146chr113125 80 52 ------
NM_003150chr1752201 1880 1679 1645 310 --21599 1580 --
NM_003155chr872448 2327 2094 323 275 225 122 32427 1038 538 42439 2083 2077 284 --
NM_003156chr1171330 1231 1157 1019 391 58 40 21149 280 61179 868 400 379 376 244 --
NM_003165chr9111945 1689 1602 1562 1507 1490 1380 768 403 197 156 --41694 1604 1594 1564 1772
NM_003170chr173551 387 198 --168 1390
NM_003173chrX21379 183 1479 1390 31207 1049 60
NM_003178chr352170 1663 450 404 155 1434 2413 410 21668 273
NM_003179chrX81446 1420 1362 909 373 288 281 68 1417 91364 1225 1221 1208 1201 394 385 383 191 21451 1125
NM_003184chr841052 261 232 109 ------
NM_003185chr202490 468 --4526 517 512 474 --
NM_003186chr111320 --1160 137
NM_003189chr152838 831 675 275 249 22157 259 11257 --
NM_003194chr61488 1373 --128
NM_003199chr18----11383 --
NM_003200chr1981827 1762 1610 1563 1519 917 773 191 --92080 2078 2035 2018 1890 1829 935 933 228 --
NM_003202chr55607 581 516 116 24 21200 591 --2584 63
NM_003204chr1721421 1335 ------
NM_003205chr153569 302 52 1848 1733 --
NM_003214chr651193 1008 160 135 45 ----11022
NM_003216chr22143214 3137 2337 2258 2077 2042 1312 1238 1022 779 469 312 200 62 12088 52346 1314 1072 532 340 21118 343
NM_003220chr661191 1110 454 227 201 154 11524 11476 --
NM_003223chr16----2547 24 2583 554
NM_003234chr322145 1885 2389 232 1693 --
NM_003239chr144749 719 698 61 --4848 839 735 733 --
NM_003250chr172176 143 152 --1296
NM_003255chr17102317 2091 1648 1015 949 838 760 489 280 210 1341 4644 552 213 142 11020
NM_003257chr1511062 ------
NM_003281chr1215365 5341 5081 4983 4868 4475 3948 3698 3414 2126 1737 952 902 894 884 722 684 547 140 119 98 43512 982 795 309 84874 2072 2054 1132 939 918 751 107 1110
NM_003285chr15558 536 464 223 205 --1207 --
NM_003286chr201433 ----1446
NM_003292chr11528 --1179 --
NM_003300chr14141 ------
NM_003304chr321482 1408 11015 ----
NM_003317chr143543 183 48 ------
NM_003322chr6176 --4342 337 279 154 --
NM_003325chr222212 151 --1216 --
NM_003336chrX3928 161 66 ------
NM_003337chr51486 ------
NM_003339chr531498 1405 626 --1112 --
NM_003340chr4----1137 193
NM_003342chr1762718 2535 2257 2188 2098 854 1827 1560 --
NM_003348chr1271428 1396 1318 592 407 251 55 1271 11399 --
NM_003349chr2041234 1056 408 381 --4625 383 35 29 1579
NM_003352chr22217 201 131 ----
NM_003359chr41188 --1917 --
NM_003363chr33633 555 460 148 1453 --
NM_003367chr191202 --1452 3183 97 60
NM_003369chr1152618 2043 1949 802 525 --22582 685 --
NM_003370chr197739 553 259 244 217 161 124 --4741 590 571 231 --
NM_003371chr951980 1711 860 612 76 --1630 1623
NM_003373chr1051498 1258 735 500 353 --11751 --
NM_003374chr51798 --1801 --
NM_003376chr651706 1504 1496 1488 245 --31417 608 606 128
NM_003376chr651706 1504 1496 1488 245 --31417 608 606 128
NM_003381chr63687 633 39 ------
NM_003385chr22797 268 1276 ----
NM_003387chr282801 2420 1859 941 930 401 373 85 12770 173 --
NM_003390chr114825 803 733 364 --2827 23 --
NM_003392chr353417 1104 1049 628 512 1104 --1518
NM_003403chr14175 ------
NM_003404chr2021753 1444 21497 1365 ----
NM_003405chr221211 ------
NM_003406chr841888 1747 1678 1650 11624 ----
NM_003407chr193562 279 121 --1149 --
NM_003409chr18----1249 --
NM_003410chrX42903 2415 2045 2001 1401 12907 --
NM_003412chr352712 1173 1115 1105 1097 ------
NM_003413chrX----1249 1290
NM_003439chr72598 30 --1723 --
NM_003442chr111335 ------
NM_003457chr171119 ------
NM_003458chr3214000 3849 3820 3813 3737 3556 3534 3449 3240 2967 2555 1489 1303 1289 966 832 777 551 407 369 332 33932 2975 724 104004 3832 3826 3823 3210 978 976 939 937 448 13295
NM_003459chr23659 652 293 1141 2119 117 --
NM_003463chr632745 2668 985 42778 2637 515 261 ----
NM_003466chr292379 2303 967 957 712 694 475 437 134 2621 198 2852 586 1506
NM_003468chr243259 1127 886 596 12642 53491 1086 1079 1072 957 --
NM_003470chr1631733 1723 502 --31872 1269 543 21737 547
NM_003473chr102149 109 --1183 --
NM_003481chr12--1484 2396 391 1365
NM_003482chr1292490 2474 977 727 531 503 391 52 34 12401 72650 2648 2512 2492 979 755 509 2758 202
NM_003483chr1232777 2068 485 --21059 1057 --
NM_003485chr1451270 1243 1224 883 81 --31097 897 889 --
NM_003489chr2112192 11174 1747 --
NM_003502chr163532 219 163 ------
NM_003505chr751666 1567 698 601 562 2778 53 3587 571 469 --
NM_003507chr25599 568 364 327 105 11944 3574 571 107 --
NM_003559chr1783882 3094 2985 2578 2504 1128 417 247 83495 2887 2789 2737 2638 2476 644 600 53541 3539 3099 2746 1008 --
NM_003562chr172391 291 --1394 --
NM_003563chr1721420 1298 11032 ----
NM_003564chr12537 240 1430 1171 2200 174
NM_003574chr1865134 5017 4143 1979 1689 475 15146 21697 1695 --
NM_003575chr771369 1199 1082 1035 623 514 269 2976 153 ----
NM_003576chr1352847 2280 840 708 53 11945 32175 391 56 --
NM_003581chr2--21043 150 177 --
NM_003591chr101280 --1282 --
NM_003592chr71108 ------
NM_003593chr172464 217 3699 552 112 1600 --
NM_003595chr222440 369 ------
NM_003603chr441626 389 371 197 --1373 1392
NM_003607chr1114330 3951 3689 3463 1424 1148 1102 71 53 38 31 23657 1291 13783 --
NM_003615chr311516 ----13701
NM_003617chr184559 4545 4524 3619 3247 1480 553 84 3890 199 45 13108 --
NM_003620chr171770 ------
NM_003624chr1951163 913 447 382 238 11203 3555 245 241 1935
NM_003629chr111102 --32865 629 439 23473 1047
NM_003631chr10----2180 26 --
NM_003632chr174761 355 130 88 3227 124 46 160 2679 63
NM_003633chr552438 1758 1025 551 525 11929 11595 --
NM_003634chr2251018 925 855 794 35 1907 4866 215 211 28 2928 38
NM_003635chr102428 41 --1101 --
NM_003636chr161873 1816 1726 510 406 40 4528 296 275 146 11189 1585
NM_003637chr171440 1214 626 348 233 113 29 2430 362 1239 --
NM_003642chr21238 ------
NM_003644chr17226337 6324 6154 6021 5977 5673 5565 5169 4685 2520 2467 2181 2134 2123 1350 1258 1192 787 713 599 368 95 56363 4492 4295 1039 357 55567 4899 4501 957 738 24505 171
NM_003654chr112500 140 --191 196
NM_003655chr173576 228 162 --5587 578 541 239 82 --
NM_003656chr31125 --161 --
NM_003660chr196755 640 532 508 62 43 --4632 544 540 538 --
NM_003663chr312126 --1582 --
NM_003664chr52358 183 ------
NM_003671chr982911 2755 2709 2674 2419 1072 923 852 12743 33093 2758 2299 --
NM_003685chr194805 791 767 618 --1793 --
NM_003705chr22730 692 ------
NM_003713chr1165 11177 1580 --
NM_003714chr552767 2459 2369 2276 1988 22496 33 ----
NM_003716chr31719 ------
NM_003735chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_003736chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_003737chr113338 145 131 ------
NM_003740chr621679 671 --143 --
NM_003743chr222005 477 11602 --12009
NM_003744chr1421207 367 --21178 250 --
NM_003749chr1321663 913 --11848 --
NM_003759chr463221 2843 697 598 345 42 13148 ----
NM_003762chr121360 170 11268 ----
NM_003763chr2032648 1143 42 22030 546 22697 148 --
NM_003768chr161575 1554 1545 309 301 50 3318 246 64 2325 55 --
NM_003774chr1231268 960 835 ------
NM_003779chr15408 340 185 72 57 --2442 138 1141
NM_003791chr161239 ------
NM_003800chr611847 ----11810
NM_003822chr132644 2538 2277 2736 425 1490 22555 1172
NM_003831chr182397 127 ------
NM_003840chr811929 133 --11898
NM_003842chr831774 843 32 2506 437 --31743 879 128
NM_003861chr1422345 143 11054 12031 --
NM_003870chr1562049 2009 1991 1984 673 149 11815 11994 --
NM_003872chr242433 1024 876 834 --22751 2174 1881
NM_003873chr1021838 308 --2316 314 --
NM_003877chr123892 363 206 1179 ----
NM_003885chr1722649 1693 11993 32021 2019 127 1424
NM_003888chr1571252 1237 1229 1151 397 382 46 --1416 --
NM_003893chr101329 --2462 418 --
NM_003896chr23879 680 154 ------
NM_003901chr1042716 2302 1871 1714 21897 1840 12696 --
NM_003906chr21----132 --
NM_003908chr2011096 ------
NM_003916chrX21360 60 ------
NM_003922chr15125 --133 136
NM_003924chr421378 230 --1631 --
NM_003927chr181776 2324 36 ----
NM_003930chr7193 1795 11953 --
NM_003931chr62554 206 1128 ----
NM_003936chr291096 751 420 399 362 311 289 246 28 --7987 774 427 423 392 390 291 --
NM_003938chr197927 770 729 394 225 201 76 1760 --1257
NM_003939chr1083418 3328 3145 1499 735 655 556 479 23430 1395 73991 3822 3808 1529 1502 286 276 2904 668
NM_003941chr71201 ------
NM_003944chr1127 ------
NM_003947chr33242 199 165 1885 1305 --
NM_003948chr462676 2519 2367 927 692 209 ------
NM_003949chr17141881 1874 1787 1684 1599 1347 1263 574 514 310 293 249 113 24 1302 81859 1857 1801 1797 1793 1791 578 271 --
NM_003955chr1741486 604 535 54 --91492 1489 1140 607 539 297 153 142 57 --
NM_003958chr673218 3169 3104 3071 1005 884 515 11498 ----
NM_003968chr31150 ------
NM_003975chr1----168 --
NM_003983chr16134424 4328 4300 4049 3242 3180 2698 1599 1411 1302 1218 473 83 13435 64330 4302 3610 2716 1240 1235 13781
NM_003987chr1092224 1891 1662 1625 1595 1541 906 863 255 2770 564 92008 2006 1714 1643 1641 1612 1610 909 751 --
NM_003988chr1082301 1968 1739 1702 1672 1618 940 332 2847 641 82085 2083 1791 1720 1718 1689 1687 828 --
NM_003989chr1092160 1827 1598 1561 1531 1477 842 799 191 2706 500 101944 1942 1650 1579 1577 1548 1546 875 845 687 --
NM_003990chr1092160 1827 1598 1561 1531 1477 842 799 191 2706 500 101944 1942 1650 1579 1577 1548 1546 875 845 687 --
NM_004036chr22516 122 ------
NM_004050chr1482561 2469 2070 869 756 613 592 554 --21876 596 22006 874
NM_004061chr51524 ------
NM_004068chr33296 113 29 --395 92 66 3358 71 44
NM_004077chr1261101 1057 997 852 192 179 11236 21047 197 1476
NM_004081chrY11397 ------
NM_004082chr22298 25 --1226 --
NM_004086chr141640 ------
NM_004087chr331593 1544 1399 ------
NM_004089chrX2459 76 1904 ----
NM_004093chr1382983 2376 1311 1294 593 416 204 60 --31300 269 130 1599
NM_004094chr1422296 2078 12037 12943 --
NM_004096chr10121762 1733 1677 1540 1510 1340 695 573 452 204 189 130 11521 2792 455 11513
NM_004097chr26717 357 283 267 209 90 ------
NM_004102chr1----1584 1494
NM_004103chr83744 269 116 --4771 759 143 58 --
NM_004113chr331634 54 23 11723 140 --
NM_004114chrX--1989 --1335
NM_004117chr671686 872 823 624 539 145 46 31930 1408 62 2825 613 11629
NM_004134chr51584 ------
NM_004162chr31184 11041 21009 1007 --
NM_004171chr11118654 8503 8243 6513 6426 3525 3325 2806 1169 291 37 36897 6863 301 49035 7772 6570 477 16429
NM_004185chr12215 26 182 ----
NM_004187chrX71094 979 559 452 417 352 213 11010 8982 464 458 454 423 420 365 355 11069
NM_004193chr102195 35 ----1393
NM_004199chr5----121 --
NM_004200chr11133017 2901 2570 2293 2217 2103 2073 1215 992 916 832 791 772 52587 1112 1097 341 184 51064 793 785 782 385 32750 2341 1209
NM_004203chr16----150 --
NM_004205chr11249 25 --131 --
NM_004210chr1062126 1413 1352 548 264 113 1316 3550 244 234 21638 675
NM_004225chr811198 1243 11290 --
NM_004227chr732511 1213 834 12477 32517 2514 2200 --
NM_004228chr191121 ------
NM_004229chrX1590 11557 ----
NM_004231chr74268 208 192 29 --2194 48 --
NM_004232chr181278 ------
NM_004235chr9173 ------
NM_004255chr15------122
NM_004263chr211672 --41610 1244 725 242 1504
NM_004272chr52588 344 2767 718 --1122
NM_004274chr1432783 303 80 53034 2760 1223 261 145 22982 330 --
NM_004277chr621623 178 ----11203
NM_004283chr194634 122 104 33 --2877 681 --
NM_004293chr973465 2988 2747 2437 1512 221 54 12450 12864 --
NM_004296chr14113951 3709 3398 3344 3224 2766 2711 1588 1087 897 451 52673 2594 2470 843 505 63815 2745 2688 1090 899 366 11388
NM_004302chr1282528 2457 2237 1788 858 763 576 477 11113 52307 861 779 777 483 2865 784
NM_004305chr2--1149 146 --
NM_004308chr1191734 1460 749 608 560 453 382 241 58 11819 3738 385 124 21634 127
NM_004311chr10132910 2788 2760 2734 2552 2479 2322 2256 2136 2050 2028 1190 426 --62741 2737 2563 2487 2482 2328 --
NM_004316chr122899 434 ------
NM_004321chr2103395 3387 3353 3287 3156 2857 2713 1400 89 44 43318 2931 781 482 12552 33124 2860 50
NM_004326chr171151 1143 1011 978 834 783 764 1358 11154 --
NM_004330chr15----1858 --
NM_004349chr8----1288 --
NM_004364chr1951119 1086 381 216 155 21240 1201 --1490
NM_004370chr631773 813 520 --1803 --
NM_004371chr141264 616 65 41 1625 184 --
NM_004379chr22263 199 --1201 --
NM_004380chr1621724 1701 51856 1806 1658 1017 519 ----
NM_004384chr52944 559 ------
NM_004387chr5298 52 ------
NM_004391chr392035 1751 1703 1420 1294 805 617 327 229 21488 1361 91589 1586 1507 1503 1501 1437 1434 154 104 1377
NM_004393chr341816 1801 1681 165 11831 52241 1853 1851 1545 738 --
NM_004395chr56685 518 504 302 274 147 ------
NM_004397chr1143752 600 401 72 13001 11355 13040
NM_004405chr26406 380 286 216 107 76 --3418 292 80 --
NM_004408chr94494 417 334 31 ----181
NM_004416chr126763 747 690 234 199 23 1741 11087 --
NM_004418chr24560 254 116 89 --3551 547 69 --
NM_004420chr11142418 2320 2212 2200 2102 2090 1875 1803 1618 1587 841 835 426 294 11644 51888 1881 450 442 428 22133 2023
NM_004422chr171160 1171 2343 163 1347
NM_004423chr3132717 2526 2456 2443 1008 915 785 524 420 390 379 248 60 --62596 2594 2590 2348 1011 302 2789 364
NM_004426chr1261573 1316 664 519 462 42 11288 1465 --
NM_004427chr15813 796 460 412 336 31158 305 257 4462 290 114 41 1154
NM_004429chrX6942 459 338 301 139 56 --3318 210 80 --
NM_004430chr861071 962 810 391 111 31 3979 383 221 5964 955 393 208 137 1624
NM_004431chr13321 115 62 1335 1118 --
NM_004432chr91394 12166 11840 --
NM_004433chr191486 548 536 472 429 314 272 197 188 ----1553
NM_004436chr11519 --139 --
NM_004437chr141113 742 634 450 52665 2420 2274 374 39 52411 792 642 640 436 --
NM_004438chr243203 1014 901 356 ------
NM_004440chr621787 1775 ------
NM_004442chr1101558 1450 1387 1362 1355 1271 1152 672 468 359 132 41681 1603 1158 368 11592
NM_004443chr33264 231 162 ------
NM_004444chr74550 345 286 38 2278 233 ----
NM_004446chr1132 ------
NM_004451chr113560 474 158 --2164 161 1538
NM_004454chr352240 1727 1645 1508 665 1573 12034 --
NM_004456chr7126 ------
NM_004458chrX11690 ------
NM_004463chrX3464 411 77 ----1475
NM_004468chr14603 221 163 133 --2251 88 --
NM_004472chr51191 ----189
NM_004474chr13392 377 38 --148 1408
NM_004475chr1781094 479 464 398 353 241 192 163 1280 2181 46 --
NM_004480chr141633 ------
NM_004484chrX----1316 1119
NM_004485chr1133992 3803 3379 3208 2770 2755 2725 2699 1415 1169 1030 875 48 11203 43381 2789 1061 1032 13272
NM_004487chr32112 93 --41150 1084 1079 31 11090
NM_004493chrX131 ------
NM_004494chr16956 817 507 351 242 116 1345 21240 1013 21174 973
NM_004496chr143409 319 310 1155 1284 --
NM_004499chr51150 1135 ----
NM_004500chr1441479 367 136 120 1742 21925 87 190
NM_004501chr133588 3545 1250 32655 1507 849 41551 1262 1256 349 --
NM_004503chr124257 217 47 38 --5208 205 59 40 30 3332 172 62
NM_004504chr233020 2888 56 12761 ----
NM_004514chr1792880 2681 2614 2023 1197 1060 1023 994 270 1335 32807 2321 1882 --
NM_004516chr19--152 21264 1258 --
NM_004521chr10195 ------
NM_004525chr231257 1192 573 ------
NM_004527chr1751345 1061 932 205 106 21251 1069 2363 328 189
NM_004529chr91237 ------
NM_004530chr1641133 978 887 33 1753 3219 203 168 --
NM_004537chr1221155 55 ------
NM_004543chr2171 ------
NM_004555chr161179 --179 --
NM_004556chr64891 647 353 40 ------
NM_004574chr17----134 --
NM_004575chr421473 54 ------
NM_004576chr51158 ------
NM_004583chr174540 526 260 251 --2263 35 1279
NM_004586chrX44054 3897 2173 1950 44517 1877 1212 673 ----
NM_004588chr1174074 3247 3196 2762 1098 1083 92 1152 64076 3217 462 459 44 41 62974 2948 2648 1088 943 425
NM_004598chr572986 2398 1320 1176 633 589 486 12581 12924 11333
NM_004599chr222534 66 --5538 517 435 53 51 --
NM_004602chr2041405 1301 339 283 ------
NM_004603chr751115 841 388 343 134 1738 51051 974 919 916 116 --
NM_004606chrX2267 33 166 ----
NM_004608chr162308 46 192 151 --
NM_004609chr201489 --1396 --
NM_004612chr931697 149 25 14202 ----
NM_004615chrX1247 1753 3127 125 121 --
NM_004630chr1171055 1047 941 307 272 258 213 --2863 283 --
NM_004631chr111236 --1481 1486
NM_004634chr32146 46 1590 4436 432 52 49 --
NM_004637chr361236 1174 1001 864 444 72 11164 1450 --
NM_004642chr122117 64 --166 --
NM_004643chr141632 --1638 --
NM_004647chr194248 70 61 52 --1250 173
NM_004654chrY----1406 --
NM_004660chrY--11495 1235 --
NM_004674chr83608 176 112 187 ----
NM_004685chr1312321 ------
NM_004687chr172389 130 ----1393
NM_004690chr6----1610 --
NM_004698chr12183 25 --2150 28 --
NM_004714chr19182 --1333 146
NM_004723chr11239 --1422 1860
NM_004730chr51608 ----1592
NM_004734chr13164 1169 274 31 193
NM_004739chr112541 67 --2552 547 --
NM_004742chr341675 1257 1243 432 2465 46 ----
NM_004745chr8156247 6221 6091 5908 5727 4624 2198 1666 1484 625 609 512 487 420 123 56924 4908 4736 1946 1680 56137 536 92 89 23 --
NM_004746chr18261 42 --480 78 50 47 --
NM_004747chr1041146 621 548 397 ------
NM_004750chr192274 27 ------
NM_004758chr173844 418 182 21091 758 ----
NM_004759chr152102 1328 725 431 229 11780 52023 1976 1575 1512 731 22026 1920
NM_004762chr1761481 1236 760 593 520 55 --11571 --
NM_004772chr521401 377 --31407 1405 988 11371
NM_004774chr1732852 1170 341 --42862 2859 2854 2374 12099
NM_004779chr51240 1882 --2218 75
NM_004783chr164484 242 220 133 --2244 122 --
NM_004789chr9----2366 364 --
NM_004798chr2073131 982 374 335 327 309 105 11328 52311 1148 317 311 293 13135
NM_004807chr292417 2252 2167 1968 1775 690 485 412 284 1377 2893 617 1550
NM_004808chr1042843 2540 2180 1210 ------
NM_004814chr12192 96 ------
NM_004815chr164549 4431 4355 4106 4061 3991 1285 14434 14439
NM_004818chr123567 131 76 ----1573
NM_004822chr17103711 3703 3528 2649 1489 1447 551 529 519 303 --63739 3736 3730 3715 1573 171 33072 2881 587
NM_004824chr631292 440 69 ------
NM_004831chr192821 763 2302 172 ----
NM_004834chr233403 2867 2734 1310 2145 143 --
NM_004836chr21363 --1796 --
NM_004841chr131162 880 47 1195 31153 923 921 --
NM_004845chrX93912 3719 3273 3205 1660 1633 1084 506 169 1369 --14105
NM_004850chr22521 145 ------
NM_004857chr1454379 3454 1719 1227 1014 ----13596
NM_004859chr1742660 2601 767 529 21942 611 1254 --
NM_004860chr174507 368 228 24 --2372 189 1235
NM_004863chr1455019 3736 716 449 332 1601 2418 33 2339 36
NM_004871chr17123752 3736 3519 3116 1670 957 846 536 476 459 430 255 --7478 461 448 444 442 438 436 --
NM_004872chr1152 ------
NM_004873chr1433145 2667 976 1586 --12190
NM_004879chr111306 1703 1657 --
NM_004884chr1551571 1123 549 226 106 11579 41670 1666 623 569 1661
NM_004890chr171242 ----1264
NM_004898chr422745 2276 1876 22278 476 1465
NM_004904chr7125956 4759 4514 4493 4448 2466 1577 1417 1263 637 573 101 --32473 2468 576 14786
NM_004922chr102967 846 2342 208 ----
NM_004924chr195842 375 190 156 112 176 2994 901 --
NM_004925chr92118 21 1247 ----
NM_004926chr1481459 681 573 559 547 531 233 72 3519 133 90 5553 550 163 161 157 --
NM_004930chr15285 276 221 92 76 --3530 177 147 --
NM_004943chr1981143 1073 1006 849 466 308 125 61 1209 --21225 1147
NM_004947chr392582 2084 867 848 788 719 690 281 207 22591 78 1380 --
NM_004952chr16915 844 669 335 285 71 1873 4701 325 163 104 1724
NM_004956chr743463 3213 1793 442 ----13570
NM_004961chrX41406 517 304 33 2128 42 3556 240 170 1173
NM_004966chr102735 361 ------
NM_004973chr631677 1602 630 ------
NM_004975chr203369 316 151 ------
NM_004976chr11214842 4828 4763 4645 4454 4422 4334 3601 3576 3230 3169 1889 1826 1747 1503 1356 1312 1253 846 567 410 44392 4155 3718 3287 84864 4846 4765 4722 4678 3309 2009 1737 44868 4852 4316 1334
NM_004978chr181614 1555 1351 1259 1117 530 523 503 21285 182 21578 1567 11273
NM_004979chrX41057 813 389 189 --121059 1021 1018 1015 1012 801 798 795 395 392 313 310 21025 287
NM_004991chr3--2401 355 1130 --
NM_004992chrX227887 7691 6785 6353 6173 6131 6008 5975 5921 5823 5776 5380 3418 3089 3070 1818 1509 1490 1378 1282 1222 92 87784 7753 2623 2609 1276 1064 762 345 148086 7976 7793 7467 7461 6978 6973 5280 2815 1809 1285 1224 439 324 66176 5914 2978 2570 450 431
NM_004992chrX227887 7691 6785 6353 6173 6131 6008 5975 5921 5823 5776 5380 3418 3089 3070 1818 1509 1490 1378 1282 1222 92 87784 7753 2623 2609 1276 1064 762 345 148086 7976 7793 7467 7461 6978 6973 5280 2815 1809 1285 1224 439 324 66176 5914 2978 2570 450 431
NM_004995chr1461263 382 209 195 136 108 --2172 168 11319
NM_005008chr224222 189 177 27 --4886 196 192 39 --
NM_005010chr711690 12229 11698 --
NM_005022chr173178 55 32 --1164 --
NM_005023chr511427 ------
NM_005027chr1981114 978 335 287 271 226 183 161 --31032 911 185 2250 168
NM_005032chrX4721 339 256 183 --1259 --
NM_005045chr7151 1708 ----
NM_005052chr172283 236 ----1239
NM_005053chr195469 211 203 183 157 1408 1214 --
NM_005055chr11128 --2158 143 --
NM_005056chr1254423 4154 2033 1790 373 25092 4615 11611 11616
NM_005057chr13673 480 186 1371 21747 484 --
NM_005060chr13537 349 52 11205 21262 28 --
NM_005063chr1063361 1423 1201 679 455 235 --22989 993 --
NM_005065chr1464539 3573 2033 1858 1646 635 24833 1461 ----
NM_005078chr1571709 1653 1521 1235 1147 502 328 2350 294 71178 1176 1149 232 229 226 223 --
NM_005080chr22--3834 355 281 1742 --
NM_005095chr132213 1835 1582 1897 ----
NM_005096chrX3881 814 435 3896 226 61 --21021 451
NM_005099chr121335 132 11028 ----
NM_005105chr121764 744 1760 21805 1528 --
NM_005109chr3102528 2476 2280 2136 1957 986 865 632 240 156 2382 251 ----
NM_005114chr41516 ------
NM_005119chr131284 1208 404 1167 31307 1170 1168 --
NM_005121chr1753476 2388 1523 1463 1337 ------
NM_005122chr1------123
NM_005133chr113293 51 41 --1340 --
NM_005134chr181111 ------
NM_005135chr1573497 3331 1250 1108 1003 902 596 2210 54 23641 904 --
NM_005146chr114352 309 224 70 --2226 55 --
NM_005155chr62450 31 2597 119 --3514 211 185
NM_005156chr964957 4705 4559 3527 1524 167 24732 3703 ----
NM_005161chr11172086 2015 1978 1963 1909 1520 1497 1393 694 483 461 444 366 331 140 117 41 2740 392 31647 485 467 12193
NM_005166chr192346 219 --142 --
NM_005168chr2----11419 --
NM_005182chr164566 511 247 88 --2568 513 --
NM_005184chr1991321 1281 1158 1147 328 289 280 195 182 --31348 1309 80 41189 433 332 312
NM_005186chr115561 509 226 139 131 --3146 39 34 --
NM_005187chr1651653 1319 1306 524 165 11626 71645 1616 1496 1432 526 361 359 1600
NM_005188chr11247928 7880 7582 7367 7262 6715 6637 6620 6494 5721 5490 5458 3132 3094 2981 2365 2274 1838 1578 1374 1364 1290 1143 931 27753 618 56784 5724 5496 3096 547 15715
NM_005197chr1475503 4998 4547 4276 3831 3820 516 46159 5493 2440 308 15506 --
NM_005202chr181803 895 887 623 360 349 319 148 2482 203 71601 1598 897 724 431 38 35 2423 399
NM_005203chr101164 ------
NM_005206chr17175 ----1904
NM_005219chr55490 461 366 287 29 --21627 1613 --
NM_005220chr1771304 1290 1097 469 449 115 109 41433 1132 269 135 41253 471 200 196 --
NM_005225chr2081141 1134 1015 954 926 795 119 82 ----1905
NM_005229chrX5990 796 345 335 55 2358 220 3994 808 806 41232 943 338 171
NM_005232chr7287 75 ------
NM_005233chr31885 1174 11002 --
NM_005234chr192313 110 ------
NM_005235chr2117611 6716 5766 5543 5512 5473 2981 2809 2600 2526 113 57624 6330 5979 540 51 --27593 693
NM_005238chr1112477 11193 22891 2547 --
NM_005240chr13803 709 588 --1548 --
NM_005242chr5--1173 1147 --
NM_005248chr11543 ------
NM_005252chr14185 ------
NM_005254chr1521283 980 1455 ----
NM_005257chr1821356 1175 ------
NM_005263chr18961 870 372 324 257 95 78 56 --2378 149 --
NM_005264chr102953 733 ------
NM_005273chr7----199 --
NM_005275chr6125 ----1120
NM_005277chr41321 1666 ----
NM_005311chr732022 1014 603 1542 1207 --
NM_005312chr982580 2269 2141 1950 966 955 945 662 12194 101859 1857 1006 970 901 541 382 323 300 298 1906
NM_005333chrX1860 167 --1795
NM_005336chr272153 2079 1879 1458 867 731 26 --31853 419 115 41926 1800 477 172
NM_005337chr122423 338 ------
NM_005339chr444352 4308 3635 603 11681 11032 --
NM_005342chrX62852 2179 2122 1930 938 268 12656 12682 12014
NM_005348chr142872 797 ------
NM_005349chr41143 ----1489
NM_005354chr196581 575 254 160 113 36 --1550 --
NM_005370chr1921167 833 1391 11249 --
NM_005374chr1792371 2263 2081 1781 841 732 389 372 61 1661 32265 2130 426 12376
NM_005376chr14777 442 385 90 ----2782 262
NM_005382chr8--187 1159 --
NM_005386chr206814 591 583 198 108 98 --1881 --
NM_005397chr773236 1126 1056 611 586 130 119 33790 2676 1486 ----
NM_005398chr1031432 952 270 144 ----
NM_005399chr174010 3580 3453 2791 1514 405 44 ------
NM_005400chr23421 405 291 12805 3167 164 99 --
NM_005401chr11190 --182 --
NM_005402chr711749 ------
NM_005406chr1811311 ------
NM_005407chr1481582 1508 1393 1383 408 273 265 202 1450 31246 310 293 --
NM_005410chr5125 ------
NM_005412chr125489 423 398 140 43 --149 1426
NM_005413chr2183 --798 74 53 39 33 24 21 2102 43
NM_005415chr21230 --162 --
NM_005417chr2041806 1752 1568 1430 11583 3755 261 250 1370
NM_005418chr114697 691 579 94 1118 ----
NM_005430chr12141039 923 852 844 823 815 800 668 415 308 167 151 115 35 11033 41042 387 241 237 2143 50
NM_005433chr1811122 2322 161 ----
NM_005436chr101416 23797 2509 1863 12569
NM_005438chr112123 21 --359 54 51 --
NM_005439chr122496 57 1359 4468 464 462 132 --
NM_005453chr62475 229 188 2457 192 --
NM_005458chr921670 1623 --21796 31 11802
NM_005461chr2041518 1225 288 47 --21228 738 --
NM_005474chr17131542 1408 1266 1235 1058 556 520 414 324 272 235 213 128 --81494 1241 1238 562 559 417 239 189 --
NM_005476chr92148 31 1169 ----
NM_005477chr1541901 1588 1045 747 --62286 1908 1904 862 798 41 --
NM_005477chr1541901 1588 1045 747 --62286 1908 1904 862 798 41 --
NM_005502chr932970 2142 642 ------
NM_005505chr125639 382 329 281 80 2792 689 --191
NM_005507chr115452 423 325 203 175 --3444 328 177 --
NM_005515chr72185 59 1624 ----
NM_005517chr12387 356 ------
NM_005522chr721434 247 11027 2381 379 --
NM_005523chr721501 408 --2603 353 --
NM_005527chr6153 ----1159
NM_005529chr12656 295 ----2807 661
NM_005542chr741712 639 276 195 ------
NM_005569chr2241149 1078 309 145 --1500 11121
NM_005576chr152115 56 --234 32 --
NM_005581chr194390 350 126 91 --2339 111 --
NM_005596chr964942 4138 2500 2202 2189 995 1850 ----
NM_005599chr121046 295 ----1485
NM_005604chr65744 676 583 124 81 11969 244 38 --
NM_005605chr8----1296 --
NM_005610chr12897 102 --135 --
NM_005614chr71671 --2910 135 --
NM_005618chr6----1146 --
NM_005625chr8184 --21012 881 --
NM_005626chr11219 ----1113
NM_005627chr61178 1945 ----
NM_005637chr18174 ------
NM_005644chr11353 --1359 --
NM_005652chr1641110 1003 989 173 1915 11200 --
NM_005656chr2121419 460 --3194 177 64 --
NM_005665chr124369 3843 13613 ----
NM_005668chr511391 --14122 --
NM_005669chr512288 --1334 --
NM_005677chr331510 1042 407 21342 244 11061 --
NM_005678chr151945 1999 2807 129 2887 764
NM_005686chr171453 1428 1136 337 284 171 32 --21245 1075 41251 1211 1140 417
NM_005688chr32888 79 --21062 1060 --
NM_005697chr151184 --2153 21 --
NM_005698chr12230 181 --1105 --
NM_005700chr111358 ------
NM_005704chr11700 11031 1147 --
NM_005708chr131145 ------
NM_005716chr193549 473 175 1228 2532 423 --
NM_005718chr34842 797 228 76 1754 3845 779 30 1850
NM_005725chr112356 166 1550 11566
NM_005730chr12153498 3459 3404 3244 3204 3135 2959 2785 2594 2512 1458 731 654 344 326 --22355 1085 --
NM_005736chr1041559 1535 1421 341 --1265 11424
NM_005740chr224622 320 194 25 --2342 196 --
NM_005748chr1233440 3425 3361 ------
NM_005754chr52899 173 1325 3166 164 160 --
NM_005759chr263392 3295 3051 3024 1115 47 43803 1274 661 142 1360 13298
NM_005768chr122507 52 1521 2543 509 --
NM_005777chr3----136 --
NM_005779chr55849 770 732 268 28 --13632 1271
NM_005782chr17255 46 ------
NM_005786chr1811120 ------
NM_005789chr1792147 1951 1896 1420 792 519 486 303 208 11804 92149 1919 1575 1511 795 706 315 313 305 --
NM_005796chr16135 --241 38 170
NM_005801chr173754 327 319 1198 167 --
NM_005807chr11222 --2230 228 --
NM_005808chr342639 341 316 77 23379 589 1319 13413
NM_005811chr123118 97 68 --187 127
NM_005813chr232019 1909 304 --1998 --
NM_005814chr1101122 1095 935 540 523 349 283 98 66 50 ----1132
NM_005819chr162482 1348 1273 812 493 29 --1391 23461 161
NM_005822chr63373 54 35 --1709 1723
NM_005828chr17154752 4279 4153 3872 3731 1927 1854 1785 1541 1101 736 559 530 236 204 1586 44155 3756 1319 562 34593 3883 1322
NM_005840chrX186877 6524 6468 6414 6295 5495 4840 2154 1831 1095 916 591 576 531 498 464 327 201 --1593 --
NM_005843chr231327 458 91 21941 763 ----
NM_005851chr115349 319 282 130 63 1295 --1322
NM_005852chr1771121 988 738 342 303 276 149 --1855 2719 95
NM_005862chr311018 ------
NM_005864chr145568 498 284 162 112 --3164 31 28 --
NM_005876chr24787 744 703 622 1566 ----
NM_005877chr2231590 161 43 3605 175 52 ----
NM_005880chr161243 ----11591
NM_005883chr1952943 2769 2428 2204 703 32857 2219 88 42544 964 296 34 --
NM_005884chr192625 583 --189 1254
NM_005885chr51168 11266 130 --
NM_005895chr1293838 3708 3627 2979 2741 1299 1276 613 401 21668 1356 13217 22675 1536
NM_005901chr1848305 7643 2864 1673 28496 6296 25566 2819 1207
NM_005904chr184975 593 473 74 --1597 1600
NM_005907chr621203 351 11211 ----
NM_005909chr564253 4088 3926 3529 3250 2703 23409 3222 33332 3329 3323 --
NM_005910chr17143780 3686 3666 3573 3185 3070 2850 2835 1509 1125 907 868 628 106 23223 1635 93212 3207 3204 3072 2768 1427 1424 871 316 --
NM_005911chr21493 2345 22 2945 484 --
NM_005920chr1213588 3492 3417 3285 3225 2716 2521 2513 2436 2422 2415 1501 1490 1267 1139 978 872 831 224 67 31 --103508 3494 3227 3142 3086 2375 1469 1464 1153 83 43597 2439 1132 837
NM_005933chr11143047 2707 2422 2416 2248 2241 1953 1082 811 735 720 710 696 515 11857 --1703
NM_005934chr19102394 2129 1704 1650 938 740 718 479 158 72 22157 1986 92045 1784 1782 1727 926 504 244 170 76 12251
NM_005935chr484608 3926 3564 2118 2106 1157 883 650 11813 12123 --
NM_005937chr17163844 3339 3276 3129 2580 1272 1108 1044 943 921 824 614 516 464 295 201 23418 1293 73577 3037 2586 1193 1050 827 520 33751 3535 1460
NM_005938chrX41313 1044 82 25 1278 21290 1083 11319
NM_005941chr834193 3322 860 11452 --1841
NM_005943chr671318 1262 1244 514 397 211 160 3149 36 28 ----
NM_005955chr184244 3987 3872 2174 2083 1934 1702 1622 22098 1381 --24361 2180
NM_005957chr1154891 3624 3562 3219 3207 3168 1364 1188 1162 1147 1035 904 865 87 51 13416 54455 3513 1807 1525 698 3122 102 55
NM_005962chr1032256 708 94 ------
NM_005962chr1032256 708 94 ------
NM_005964chr1741392 1047 432 130 1612 1180 --
NM_005967chr124557 273 124 67 1536 1457 2638 280
NM_005982chr143232 202 194 ------
NM_005984chr225477 441 161 109 100 ------
NM_005985chr203205 105 25 1664 --155
NM_005996chr1221537 344 --1141 1347
NM_005998chr1146 --148 --
NM_006007chr924136 2958 13510 1212 --
NM_006015chr151246 912 159 146 128 --6915 225 180 175 162 21 --
NM_006020chr1411306 --1382 1457
NM_006022chr134418 399 350 322 --2429 426 --
NM_006030chr341165 1139 98 78 11251 1260 1103
NM_006034chr11121958 1806 1750 853 785 762 687 515 419 151 95 65 22377 1911 32385 1789 498 1737
NM_006035chr1421085 947 1264 11077 11132
NM_006036chr251961 1576 845 292 179 --31967 849 428 --
NM_006037chr264194 3767 3336 3246 3092 1919 ------
NM_006038chr205686 570 546 258 251 --1706 2563 488
NM_006039chr174770 420 392 311 --1385 --
NM_006040chr1661394 1245 1091 568 508 454 1970 4571 511 117 114 1924
NM_006047chr2023205 920 --12748 --
NM_006048chr131214 1084 422 --2430 428 --
NM_006054chr11--1142 11421 --
NM_006067chr161773 1250 ----
NM_006070chr31276 ------
NM_006089chrX11345 ----1210
NM_006091chr15121672 1647 1397 1289 713 607 564 472 367 280 66 36 1497 31719 1716 252 21752 636
NM_006094chr822387 2108 --1809 --
NM_006095chr464271 3974 2848 2841 1775 1695 11180 ----
NM_006096chr861562 1288 1260 402 267 177 --3273 270 56 1279
NM_006099chr14816 724 687 85 134 1588 --
NM_006113chr151867 1494 306 270 124 --1127 --
NM_006133chr11102360 2273 2157 1935 1656 1571 1543 977 964 702 --42159 1731 1608 1590 22164 373
NM_006134chr2141465 1186 1118 269 --1600 --
NM_006135chr11494 --1496 --
NM_006142chr12487 90 143 --193
NM_006145chr191334 1455 1407 --
NM_006148chr17112868 2651 2611 2598 2212 2125 935 608 407 342 329 32576 782 417 112873 2600 2257 972 926 553 543 319 317 197 180 1892
NM_006156chr141216 --196 --
NM_006158chr821655 38 --1628 --
NM_006160chr1771257 395 328 281 270 229 134 11444 101237 1234 1040 460 340 334 331 233 215 191 2299 242
NM_006161chr5287 28 ----136
NM_006162chr183677 205 26 ------
NM_006166chr1222592 2206 ------
NM_006167chr82946 346 22173 204 22034 2032 146
NM_006176chr115628 592 300 74 54 1603 2724 596 1149
NM_006177chr145789 763 743 435 205 --2934 210 --
NM_006178chr1761499 1396 1288 269 232 156 1509 1994 21179 997
NM_006180chr95284 227 100 40 28 --1781 --
NM_006185chr113659 75 61 --1229 1555
NM_006186chr211051 ------
NM_006191chr125788 203 151 119 44 1140 1790 --
NM_006195chr911260 ------
NM_006198chr212231 217 ------
NM_006201chrX5880 866 823 134 80 11100 11093 --
NM_006203chr534198 2202 1272 15344 --15439
NM_006206chr42715 448 1916 12238 --
NM_006211chr8--153 144 --
NM_006224chr1762408 2376 2141 1632 767 276 1310 31966 864 225 --
NM_006228chr82289 178 166 --1124
NM_006237chr134768 738 699 591 41510 550 181 145 22149 81 --
NM_006244chr114589 489 127 48 --1459 --
NM_006245chr68374 343 333 276 200 178 171 77 1266 3390 388 376 --
NM_006247chr193451 197 138 --2405 325 1329
NM_006251chr553172 798 746 600 493 13188 21166 497 --
NM_006252chr146243 6177 5811 977 25346 2462 26326 2642 --
NM_006255chr142767 81 ------
NM_006256chr11179 ------
NM_006265chr821389 482 ------
NM_006268chr117981 855 323 253 87 47 22 --21106 370 151
NM_006275chr2022486 2376 --1191 --
NM_006279chr11935 --1735 --
NM_006282chr2023410 104 54641 3428 1541 403 319 1546 --
NM_006293chr151121 --1866 --
NM_006301chr122447 143 --1450 --
NM_006305chr15161 --268 66 --
NM_006306chrX84472 4398 3948 1528 971 727 267 47 --34575 270 83 152
NM_006312chr121867 --3874 870 363 190
NM_006317chr56609 128 115 101 90 47 1597 --1361
NM_006320chr42391 53 1949 ----
NM_006321chr341846 878 235 51 ----11422
NM_006328chr114589 471 255 233 ----2583 139
NM_006330chr81153 ------
NM_006333chr21154 --145 --
NM_006336chr951428 1420 1241 1232 1060 21388 535 21350 1348 11127
NM_006337chr123215 44 31 ------
NM_006347chr1129 ------
NM_006350chr5--1257 1246 --
NM_006352chr12388 336 --31292 1290 1278 --
NM_006357chr21147 ------
NM_006358chr225870 452 414 75 51 --1374 1377
NM_006359chrX52029 1678 1533 833 583 ------
NM_006361chr17101938 1693 1641 1386 1311 1295 767 745 572 123 --21746 575 1749
NM_006367chr13965 783 31 ------
NM_006369chr14359 310 283 134 --1288 --
NM_006371chr375036 4820 3676 3476 3218 776 109 25145 4623 15211 1596
NM_006373chr1771341 1084 381 358 314 271 158 --61262 450 148 146 116 112 --
NM_006375chrX21273 221 --21579 224 --
NM_006377chr951101 1019 975 313 306 1912 ----
NM_006383chr157588 489 482 465 235 191 79 ------
NM_006386chr2292242 2233 1979 1778 1686 791 639 630 128 --2641 287 --
NM_006389chr114535 503 399 230 31129 899 548 61009 879 855 506 215 42 2541 414
NM_006390chr121157 11392 31498 662 549 --
NM_006405chr14160 --134 --
NM_006411chr65923 405 123 102 44 --5875 270 109 104 23 --
NM_006420chr2042702 1033 689 344 ------
NM_006421chr82256 37 ------
NM_006422chr12282 23 --184 --
NM_006434chr1021027 265 2540 516 2436 271 --
NM_006439chr42368 356 --2513 510 --
NM_006440chr222105 50 ------
NM_006449chr231981 1733 1575 11704 12127 21580 1485
NM_006454chr4102887 2422 2336 2141 2008 945 803 554 206 87 12601 32860 2844 1986 12076
NM_006455chr172844 829 1919 ----
NM_006457chr443939 3220 2943 1523 ----1935
NM_006458chr114344 332 283 262 1291 1137 --
NM_006459chr1041897 1535 360 119 1515 ----
NM_006465chr15122268 2187 2177 1941 1784 1768 831 823 751 594 358 34 52005 804 553 282 272 52142 1997 1425 423 362 --
NM_006483chr19182 --1333 146
NM_006484chr19182 --1333 146
NM_006489chr1421374 1273 --11741 --
NM_006497chr171648 1629 2753 305 --
NM_006500chr114981 257 50 22 --1110 1215
NM_006509chr192380 90 --1334 --
NM_006516chr141472 1336 523 483 --11475 --
NM_006517chrX112075 1971 1789 1499 1466 627 614 581 518 268 182 --3575 219 41 --
NM_006520chrX----1460 --
NM_006521chrX11076 31224 356 79 21282 1104 2511 194
NM_006526chr2031481 726 52 ------
NM_006527chr4--1278 137 --
NM_006532chr1941463 585 220 182 1577 3588 425 241 --
NM_006540chr81267 11080 ----
NM_006544chr1435391 5297 211 ------
NM_006546chr17266519 6277 6217 6069 5995 5959 5538 5514 5216 5159 5065 4864 4390 4351 4118 4095 2645 2504 2152 2142 1682 1549 1417 785 599 277 35912 5797 749 116280 6002 5961 5952 4220 4214 1420 959 789 423 65 26019 768
NM_006547chr71275 21872 330 ----
NM_006548chr31287 ------
NM_006555chr741961 1893 620 467 --11717 --
NM_006557chr931147 1104 487 ----21128 500
NM_006558chr81494 ------
NM_006559chr131134 138 129 164 ----
NM_006561chr1085926 5237 5216 4917 4341 4266 394 21 --75120 4903 4736 4277 4275 2257 2252 25003 4283
NM_006562chr102293 94 --1114 --
NM_006563chr193361 125 26 ------
NM_006565chr164447 362 340 72 --1301 --
NM_006572chr1733522 3399 2188 --11260 --
NM_006574chr3166 ------
NM_006577chr22953 342 ------
NM_006593chr25755 649 281 270 80 --2287 90 167
NM_006595chr1142040 1641 1352 439 11897 11906 --
NM_006599chr16107547 7390 7184 5731 5152 2578 1758 1154 1082 773 11044 57559 7557 7553 7549 5565 12581
NM_006608chr1----227 25 --
NM_006612chr172454 375 --1460 177
NM_006618chr1--11485 21594 430 --
NM_006621chr111344 21445 603 --21609 244
NM_006622chr52124 33 ------
NM_006624chr1031601 850 95 --1171 --
NM_006628chr1554236 3855 3192 1739 1176 24247 4021 13194 14222
NM_006650chr5103781 3642 3253 2532 1032 313 304 167 142 124 43608 3412 1065 235 53906 3256 884 155 144 33317 594 158
NM_006651chr471508 1300 560 497 427 203 56 --21476 44 2963 150
NM_006653chr62135 83 ------
NM_006654chr12104774 4168 4145 4134 3198 3190 2984 1856 1845 534 33540 1237 1177 23037 3034 11214
NM_006662chr162134 126 1273 145 --
NM_006688chr173423 108 49 133 1373 --
NM_006690chr2082071 2012 1981 1687 1641 464 433 243 4930 563 487 403 32284 1986 937 1789
NM_006694chr14362 283 272 110 1118 --1261
NM_006695chr172238 97 ----1241
NM_006698chr2041125 422 414 395 ------
NM_006708chr63992 304 130 --11085 --
NM_006709chr6156 1237 2108 23 --
NM_006720chr1095048 4127 3833 3595 3124 1859 763 738 719 21489 1445 24873 4869 --
NM_006726chr421107 825 ------
NM_006729chrX64870 4814 4051 4017 1037 926 15455 34897 4872 170 --
NM_006735chr71113 ------
NM_006736chr261759 1435 600 554 439 131 --91765 1762 748 745 742 616 533 530 117 --
NM_006742chr1682010 1781 1713 1457 1317 714 440 318 51792 1497 810 425 339 41459 785 781 222 --
NM_006749chr83981 185 131 ------
NM_006750chr16157522 7305 5469 3186 3177 3045 2745 1744 1722 605 578 430 372 110 91 36059 3153 1999 48000 7159 1805 580 --
NM_006751chr22750 335 ------
NM_006756chr821300 1290 ------
NM_006761chr17170 --6739 736 726 713 706 45 1629
NM_006763chr1102004 1742 1722 1622 1431 1301 562 461 431 203 --21683 1606 1434
NM_006766chr8102653 2628 2620 2587 2102 1796 1647 627 618 371 1448 --1658
NM_006769chr12671 152 ------
NM_006772chr6161693 1680 1647 1577 1437 1325 1309 1285 1270 1206 676 668 321 205 119 107 21409 1222 71649 1559 1073 670 588 458 433 --
NM_006775chr632010 1995 813 1177 11210 22070 1214
NM_006777chrX42872 2837 355 196 22693 2651 1548 --
NM_006778chr621317 23 1189 ----
NM_006795chr1161409 1371 1120 1096 566 541 --41244 522 486 266 --
NM_006801chr193517 118 24 1549 1519 --
NM_006802chr12397 44 31143 375 71 ----
NM_006803chr851753 1506 786 119 99 1685 ----
NM_006805chr52667 104 --2192 190 --
NM_006807chr171361 ------
NM_006809chr201120 1264 1697 1367
NM_006814chr20112433 2252 2132 970 834 569 271 261 180 142 32 1686 2244 241 --
NM_006818chr13250 243 45 --197 --
NM_006819chr112382 23 ----1275
NM_006822chr17135 ------
NM_006826chr221104 409 ------
NM_006827chr1443035 2870 2265 2238 33201 827 349 122 --
NM_006838chr1221708 219 ------
NM_006852chr1762565 2481 2455 2366 1996 589 22227 726 41143 694 597 595 --
NM_006854chr732028 1557 1541 1422 2684 681 11544
NM_006856chr123370 363 75 21050 225 51160 1158 882 877 874 --
NM_006861chr12111513 1312 565 495 388 376 201 164 152 114 40 --2220 155 145
NM_006874chr411221 ------
NM_006875chrX3876 215 191 --2799 769 --
NM_006884chr341407 1343 133 114 1141 ----
NM_006885chr1683442 2935 2871 2821 1365 1042 970 303 33513 1128 1106 32938 2825 1044 --
NM_006888chr1443206 3175 999 27 1195 12384 --
NM_006889chr33577 444 153 --1134 1295
NM_006892chr2051078 901 572 368 130 ----11034
NM_006892chr2051078 901 572 368 130 ----11034
NM_006896chr721138 232 ----1469
NM_006898chr22586 225 --2172 100 --
NM_006906chr114773 396 101 92 --2119 104 --
NM_006913chr63380 347 327 --1339 --
NM_006920chr211956 ------
NM_006922chr222307 661 12600 ----
NM_006924chr1774028 3780 3766 3756 1379 694 138 11338 2990 699 --
NM_006930chr541859 1780 1232 641 ------
NM_006931chr1242058 1664 1574 291 1355 249 24 152
NM_006937chr171135 ----1143
NM_006940chr1231598 1250 555 ------
NM_006943chr20133040 2827 2816 847 800 671 454 373 330 287 223 137 101 --92842 2625 2623 1034 379 376 309 204 163 33059 979 742
NM_006946chr11----3489 34 30 1232
NM_006950chrX3688 634 103 2620 298 2866 169 1731
NM_006955chr1032358 1349 1235 ------
NM_006958chr8384 52 44 ------
NM_006981chr962920 2789 2694 740 654 32 --12792 --
NM_006987chr1761230 1125 904 176 145 28 --5489 485 483 250 65 11035
NM_006990chr172492 2155 1876 1782 613 330 239 22083 164 2660 187 --
NM_006996chr11698 ------
NM_007005chr931034 152 134 --31006 387 34 --
NM_007011chr15256469 5848 5076 5069 5039 5032 4999 4992 4961 4882 4875 4646 4581 2715 2679 1983 1890 1560 1241 1086 643 491 83 54 37 22658 77 24538 647 44179 2378 1113 86
NM_007013chr8----1416 --
NM_007024chr31468 --132 --
NM_007026chr173475 104 51 --166 1107
NM_007036chr51823 ------
NM_007038chr215913 425 401 299 233 23831 2240 1301 --
NM_007039chr14----32065 2059 2053 --
NM_007040chr197921 888 390 348 305 243 71 5936 911 724 423 46 4990 165 146 128 1364
NM_007042chr332493 1944 403 ----12497
NM_007052chrX2388 123 ------
NM_007054chr5--1878 13606 --
NM_007067chr1751571 1280 1209 306 125 --31437 1119 1081 31535 1296 1123
NM_007084chr1331236 565 75 ----11201
NM_007107chr332311 875 432 ------
NM_007122chr11244 --1588 --
NM_007124chr61219 ------
NM_007125chrY1407 ------
NM_007126chr91377 --1382 --
NM_007129chr132290 56 --4376 366 26 22 --
NM_007144chr17299 39 190 2484 472 --
NM_007146chr1722788 380 12189 12668 1939
NM_007158chr1289 77 --21115 79 --
NM_007159chr3131 --21778 34 --
NM_007162chr62511 378 --4241 125 121 69 1473
NM_007170chr13784 261 85 1343 --1275
NM_007172chr2243141 2283 707 427 12294 1187 --
NM_007174chr123806 223 26 41555 1527 950 631 31847 1843 694 1787
NM_007181chr19--1146 --1108
NM_007185chr16809 682 221 197 75 53 ----2435 343
NM_007192chr1411001 2415 37 11004 --
NM_007202chr172648 605 --3686 684 651 --
NM_007203chr933153 518 176 23352 1384 --22860 2561
NM_007207chr13798 276 33 --1278 --
NM_007212chr13908 418 154 2832 258 1358 --
NM_007222chr811571 11732 ----
NM_007232chr202976 328 193 2723 720 123
NM_007236chr1592394 1891 1715 834 505 436 374 93 59 21582 101 --1256
NM_007245chr166769 613 366 181 170 130 1622 ----
NM_007247chr172834 100 --1717 --
NM_007249chr13149407 8147 7880 7410 7271 6861 6670 5822 5751 2673 2081 1384 1323 75 45760 2822 2599 396 26214 1200 --
NM_007271chr6--1648 21171 639 --
NM_007275chr32916 451 1818 --1245
NM_007278chr172143 101 --277 74 --
NM_007286chr572036 722 693 618 574 472 287 1664 22026 476 11318
NM_007294chr1741277 1161 195 82 ------
NM_007295chr1741277 1161 195 82 ------
NM_007296chr1741277 1161 195 82 ------
NM_007297chr1741277 1161 195 82 ------
NM_007298chr1741277 1161 195 82 ------
NM_007299chr1741277 1161 195 82 ------
NM_007300chr1741277 1161 195 82 ------
NM_007302chr1741277 1161 195 82 ------
NM_007303chr1741277 1161 195 82 ------
NM_007304chr1741277 1161 195 82 ------
NM_007305chr1741277 1161 195 82 ------
NM_007308chr41182 ------
NM_007320chr191238 --2245 241 --
NM_007322chr193447 382 238 --1555 --
NM_007327chr95953 917 851 296 21 --31115 756 34 3891 832 130
NM_007345chr182589 250 --1262 --
NM_007350chr1234321 3190 102 23555 1735 ----
NM_007365chr1121709 1659 1598 1424 843 832 729 595 586 484 302 154 21918 657 1708 32046 487 56
NM_007371chr91640 ------
NM_007375chr11492 12040 21082 494 --
NM_012064chr1251030 458 334 214 207 ----11152
NM_012069chrX62702 2566 623 403 273 232 ------
NM_012074chr146955 824 158 150 110 39 --6961 774 771 768 729 162 --
NM_012081chr542275 694 191 160 12649 ----
NM_012090chr11861 ------
NM_012098chr951389 1191 333 188 84 ------
NM_012102chr162618 2427 2399 2250 268 204 1221 12156 --
NM_012104chr1183466 3388 2452 2398 2382 1521 116 32 42643 1430 1391 1024 11444 --
NM_012104chr1183466 3388 2452 2398 2382 1521 116 32 42643 1430 1391 1024 11444 --
NM_012110chr4169 ------
NM_012134chr131592 1240 204 ----11231
NM_012141chr1333701 2862 1100 2290 247 --11497
NM_012158chr1321603 1529 ------
NM_012166chr961463 1314 1101 456 444 425 --41020 446 96 90 --
NM_012168chr11110 --2113 22 295 25
NM_012183chr13446 181 142 --1127 --
NM_012193chr1174902 4804 4617 3604 2134 1624 333 24730 4422 35151 4633 3692 24997 3579
NM_012199chr1104450 4080 4055 3598 1787 1607 1306 1153 1085 782 23131 216 54114 1528 1478 673 601 23831 605
NM_012214chr223952 2518 1154 12422 --
NM_012218chr1951926 834 717 274 43 21078 593 ----
NM_012232chr1772054 1887 1806 1797 1621 1455 116 --41893 1849 334 322 --
NM_012234chr321504 1283 12690 ----
NM_012242chr10----1177 --
NM_012244chr14141658 1633 1368 1290 1198 625 576 555 521 496 344 55 35 28 31649 1497 1192 51661 1505 1428 290 38 11431
NM_012249chr232855 743 384 23326 2459 --12275
NM_012250chr1121107 59 ------
NM_012257chr71773 1872 ----
NM_012259chr6--142 1178 --
NM_012261chr202466 215 ----138
NM_012281chr732151 1762 1667 ------
NM_012282chrX5770 665 196 85 36 --1198 --
NM_012284chr124282 229 212 89 --1231 --
NM_012287chr354151 3449 1552 553 442 2766 345 11318 --
NM_012288chr6174790 4744 4641 4522 4153 4047 3935 3878 2262 2229 2019 1912 1863 1257 768 226 73 44683 2011 1243 441 74895 3638 2021 1823 1263 228 82 44953 4898 3939 2233
NM_012294chr7----122 --
NM_012296chr11173360 3247 3004 2962 2916 2714 2488 1526 1497 857 419 396 192 99 86 61 54 23378 2629 83363 3192 1529 159 75 70 68 63 33433 2848 850
NM_012297chr411837 22086 167 4812 809 806 427 --
NM_012300chr542074 1817 1660 187 2691 250 1213 --
NM_012301chr751772 1549 1532 1463 317 --11774 --
NM_012306chr12173543 3409 3317 3305 3168 3125 2405 2346 2297 2270 2229 1227 1180 434 374 266 60 33520 2922 28 32409 2276 64 22263 1161
NM_012307chr182175 79 ------
NM_012308chr1181673 908 803 455 191 119 68 50 1548 9590 578 576 471 350 197 195 109 41 3971 911 459
NM_012309chr1183975 3816 3799 1501 1410 1400 1050 316 54196 4088 3372 1171 600 24170 608 11504
NM_012316chr1165352 3878 3689 2053 1872 1641 1567 902 820 754 745 697 605 402 380 154 23796 2207 33559 705 701 13692
NM_012323chr2241104 1077 1040 1011 --150 11016
NM_012325chr2021107 71 --11259 11262
NM_012326chr23776 763 271 1866 3706 48 37 --
NM_012333chr1----11298 --
NM_012334chr543968 3868 440 360 13080 ----
NM_012340chr20--1193 1266 --
NM_012384chr2062204 2031 1783 786 513 219 11994 2617 222 22187 559
NM_012395chr783002 2355 2293 2108 1378 1164 312 123 --62357 2334 2323 2319 2315 2295 --
NM_012398chr19102784 2541 2512 2289 2278 1894 919 730 165 131 22843 2326 52761 2649 2371 2018 134 22281 737
NM_012399chr2241801 1547 1521 1445 ----11552
NM_012402chr113416 317 278 --1378 --
NM_012406chr1221201 979 11133 ----
NM_012407chr222130 123 1498 2224 220 --
NM_012410chr163484 467 123 --2101 42 --
NM_012416chr93820 437 98 1250 ----
NM_012421chr11175 ------
NM_012428chr151145 --290 88 --
NM_012446chr51440 --2147 145 --
NM_012448chr1762164 2041 1828 1720 541 241 11840 52167 692 690 547 243 1550
NM_012456chr11265 44 ------
NM_012461chr146660 474 269 253 191 50 --1466 --
NM_012464chr432230 2026 1171 ------
NM_012465chr1052788 2335 668 660 641 ------
NM_012473chr223555 239 217 1266 2674 89 --
NM_012475chr12173 59 1182 ----
NM_012478chr175408 297 270 189 101 1681 3834 299 103 3346 327 233
NM_012479chr732188 1768 108 --1939 12209
NM_013230chrY21518 589 ----137
NM_013231chr1483302 3237 3198 1689 1200 1125 789 700 21535 1155 23239 1202 13439
NM_013233chr23968 88 57 --170 --
NM_013243chr152339 165 ------
NM_013245chr163226 120 64 1290 1262 --
NM_013246chr111825 --2162 28 --
NM_013252chr722669 476 11857 ----
NM_013253chr114958 353 120 107 155 1355 1166
NM_013259chr33290 226 94 ------
NM_013261chr433014 2875 64 11416 ----
NM_013269chr1244290 4242 1258 417 23512 200 44296 4292 4262 3965 24299 4284
NM_013277chr123178 165 24 --1167 --
NM_013279chr11112220 2197 2140 2096 2058 2043 1641 1621 1538 612 361 1929 52098 1623 502 500 372 --
NM_013305chr18253 42 --2118 116 --
NM_013309chr1542145 2032 1818 827 ------
NM_013316chr74801 134 81 55 --157 --
NM_013323chr175991 964 838 312 259 --31119 1116 1096 --
NM_013341chr242656 2022 1156 1120 12562 22797 2794 11130
NM_013354chr831354 101 77 --1375 --
NM_013357chr81203 ----1870
NM_013372chr1561342 935 472 464 392 227 1949 2478 475 --
NM_013373chr225936 830 812 375 68 ------
NM_013382chr1482058 2021 1817 1772 1752 1599 828 40 12119 72025 1775 1760 1755 1630 562 241 --
NM_013388chr22254 72 ------
NM_013392chr23165 141 106 --2171 74 --
NM_013399chr162352 59 1119 21246 25 --
NM_013403chr197812 763 660 650 615 247 162 1152 1743 1182
NM_013417chr9136 155 ----
NM_013433chr1981932 1924 1878 1430 1346 1284 714 477 --21947 142 21881 1257
NM_013434chr281939 1742 1298 798 696 606 586 249 --61748 1744 1644 698 452 442 --
NM_013434chr281939 1742 1298 798 696 606 586 249 --61748 1744 1644 698 452 442 --
NM_013438chr911296 21607 642 --11303
NM_013443chr941046 986 360 353 2144 110 1988 --
NM_013444chrX4225 210 180 158 21002 174 3238 234 162 --
NM_013448chr141681 ------
NM_013449chr12162993 2717 2374 2006 1991 865 844 748 727 627 532 340 324 195 176 37 21103 646 5630 346 343 327 39 22117 834
NM_013951chr292379 2303 967 957 712 694 475 437 134 2621 198 2852 586 1506
NM_013952chr282456 2380 1034 789 771 552 514 211 2698 275 2929 663 1583
NM_013953chr282456 2380 1034 789 771 552 514 211 2698 275 2929 663 1583
NM_013958chr8143 --145 --
NM_013959chr8143 --145 --
NM_013961chr8143 --145 --
NM_013962chr8143 --145 --
NM_013992chr282456 2380 1034 789 771 552 514 211 2698 275 2929 663 1583
NM_013993chr67821 590 525 279 270 204 177 --2179 94 2529 27
NM_013994chr67821 590 525 279 270 204 177 --2179 94 2529 27
NM_013999chr1761382 1098 969 242 143 24 21288 1106 2400 365 1126
NM_014000chr1051498 1258 735 500 353 --11751 --
NM_014002chr13486 479 168 --2631 117 2634 291
NM_014010chr9137 ------
NM_014015chr16227 21 1119 3699 161 136 --
NM_014021chr133349 2328 129 --21319 139 --
NM_014023chr1021051 655 ------
NM_014028chr642731 2581 1286 553 ------
NM_014030chr17101139 986 944 858 811 803 416 352 245 128 1208 51123 870 479 247 227 1748
NM_014038chr71126 --1292 --
NM_014079chr32712 267 1335 1717 2348 86
NM_014109chr82474 412 --1453 --
NM_014112chr834739 1223 904 ------
NM_014117chr1682271 1967 1943 1782 1053 1044 748 94 12324 11036 --
NM_014149chr73594 201 96 ------
NM_014155chr1165657 2782 1490 1074 115 82 12118 11493 --
NM_014157chr16132997 2974 2866 2685 2488 1434 1271 981 922 628 554 277 77 23934 3270 1545 13179
NM_014166chr131809 1837 ----
NM_014178chr141243 ------
NM_014182chr123624 472 241 --1726 1245
NM_014188chr12302 269 --2312 308 --
NM_014190chr471721 1359 1333 699 478 105 76 --3741 592 63 --
NM_014203chr193306 218 134 --2267 264 --
NM_014212chr124943 931 899 387 --1790 --
NM_014225chr195406 342 145 100 61 --2151 130 1317
NM_014231chr1272028 1956 1948 1843 1699 1485 133 3269 167 99 21712 235 21805 85
NM_014232chr1791620 1345 1253 1151 413 384 341 278 134 2363 63 91635 1494 1213 1034 1031 437 423 97 41 144
NM_014232chr1791620 1345 1253 1151 413 384 341 278 134 2363 63 91635 1494 1213 1034 1031 437 423 97 41 144
NM_014233chr1791781 1724 1711 1631 1372 1361 417 219 75 --41527 529 527 48 41636 223 110 78
NM_014234chr61172 ------
NM_014238chr173570 187 39 --1247 --
NM_014240chr3113364 2868 1598 1378 1052 683 636 447 369 307 299 12782 1451 --
NM_014243chr42169 58 ------
NM_014251chr74818 811 693 60 --1311 --
NM_014252chr131126 ------
NM_014253chrX31571 632 554 ------
NM_014263chr1021311 85 11252 11179 --
NM_014275chr57892 873 826 792 782 751 740 ----1754
NM_014283chr11355 ------
NM_014284chr171036 905 773 425 106 95 65 1842 2407 318 21043 823
NM_014289chrX51257 1181 1066 447 354 1142 1356 11245
NM_014292chr22111782 1760 1680 1669 1578 1570 1413 1231 669 549 322 --41613 503 500 94 21798 1496
NM_014293chr22204001 3981 3738 3522 3471 3447 3366 3279 3230 1364 1292 1088 580 570 277 183 133 97 69 28 22749 397 104005 3794 3722 769 767 563 541 490 487 421 11386
NM_014299chr19102041 1758 861 832 653 579 432 399 143 52 1714 --11762
NM_014305chr13----1257 --
NM_014309chr22145338 5191 5083 4930 4922 4913 4369 3896 3465 3289 2033 1863 1599 591 44976 3636 1286 942 35073 5071 4458 15087
NM_014331chr447537 6460 5162 2697 12234 22177 503 --
NM_014333chr113441 359 336 1396 2850 362 11990
NM_014335chr151990 --11000 --
NM_014342chr1111322 11482 21328 190 --
NM_014345chr62394 179 1276 1947 --
NM_014360chr144630 207 103 91 ----1200
NM_014368chr941899 231 210 165 1374 11617 --
NM_014376chr5102253 2171 1791 558 491 481 334 259 144 125 1522 3580 346 261 1171
NM_014388chr196032 4988 4802 4238 4150 3742 3707 3687 2327 45805 4876 4391 1167 23935 3865 --
NM_014397chr911407 2331 122 ----
NM_014400chr194477 421 393 25 2446 124 --1415
NM_014405chr17122141 1944 1861 858 632 528 520 383 338 262 216 119 --82268 2264 2262 1960 902 539 537 35 --
NM_014408chr12560 535 --167 --
NM_014409chr12143 116 --4853 851 110 107 --
NM_014415chr321163 557 ----11386
NM_014417chr191381 ------
NM_014421chr432141 1755 1392 11706 ----
NM_014423chr544527 1654 1003 117 13994 11658 --
NM_014426chr202667 252 ------
NM_014431chr103422 361 22 21598 114 2461 363 1323
NM_014437chr1154 ----166
NM_014445chr322206 458 ------
NM_014458chr121274 256 21282 883 ----
NM_014469chr112653 295 ------
NM_014494chr1642074 1849 414 315 2958 135 12052 11912
NM_014501chr19248 40 --153 --
NM_014515chr1221075 31 ------
NM_014516chr19149 --3200 197 33 --
NM_014517chr331266 1235 165 ----11460
NM_014521chr221494 509 21693 1668 1603 1159
NM_014554chr1222295 1606 1554 11411 --
NM_014567chr164379 348 187 54 ------
NM_014575chr31430 ------
NM_014587chr1631472 432 263 --41509 1253 200 196 --
NM_014591chr1041071 943 107 80 2377 289 31047 387 348 11284
NM_014592chr54742 715 290 263 ------
NM_014601chr1981701 1298 1203 651 529 126 98 36 21630 1240 31468 463 128 --
NM_014604chr174819 558 196 151 1159 1539 --
NM_014607chr221953 829 2620 517 ----
NM_014613chr562310 2167 2133 1908 705 22 --1976 --
NM_014614chr22588 406 ------
NM_014620chr121193 --4693 199 197 47 --
NM_014621chr21173 --128 --
NM_014623chr6195 ------
NM_014630chr15113820 3458 3202 3071 2684 2471 930 849 473 417 384 42910 2506 558 160 2983 532 23435 3278
NM_014632chr11394 78 25 --366 63 27 --
NM_014634chr2273579 2741 2443 1108 642 449 33 43624 3093 2417 121 53202 1115 1110 53 27 156
NM_014636chr994123 3460 1730 1357 886 872 837 667 650 --53137 2875 2714 1365 980 21101 845
NM_014641chr62526 23 ------
NM_014646chr18102493 2219 2116 2086 861 645 240 148 137 37 ----197
NM_014647chr1631556 1547 712 11447 ----
NM_014657chr203343 322 35 ----2284 40
NM_014659chr152848 334 ------
NM_014663chr11972 1220 11057 --
NM_014665chr873501 3315 2582 2348 1161 831 705 32757 2471 2444 63296 2372 1222 1218 367 154 --
NM_014666chr511258 ------
NM_014667chr322314 2282 ------
NM_014670chr2193 ------
NM_014674chr383649 3506 3205 3184 3177 3165 2874 177 --33171 3168 641 --
NM_014676chr121412 450 125 1129 2443 134
NM_014677chr831058 1035 499 --11037 --
NM_014682chr8--1143 1539 --
NM_014686chr1932178 1852 414 --2420 417 1425
NM_014701chr1543240 1385 1365 374 --13243 13247
NM_014702chr622953 2462 13109 ----
NM_014711chr1611775 1432 ----
NM_014712chr164521 412 179 40 --1414 --
NM_014726chr1751239 979 395 154 40 1495 41252 288 286 210 11154
NM_014729chr82435 216 ------
NM_014730chr12154824 4768 4761 3743 3732 3679 3650 3600 3445 3242 1903 1483 1474 814 627 44869 4448 3838 2047 63749 3323 1926 1312 925 816 --
NM_014730chr12154824 4768 4761 3743 3732 3679 3650 3600 3445 3242 1903 1483 1474 814 627 44869 4448 3838 2047 63749 3323 1926 1312 925 816 --
NM_014731chr2061355 1251 701 274 144 65 21481 1423 71443 499 497 482 480 147 70 2578 86
NM_014735chrX42123 1419 575 405 11668 11453 11456
NM_014739chr642740 1539 1096 336 14014 12742 12654
NM_014742chr2051448 680 576 569 258 31472 1188 706 41452 1254 1119 473 1588
NM_014747chr1205141 4931 4863 4440 4118 4107 3989 3958 3770 3684 3647 2104 1595 1465 1226 1024 901 815 637 63 13726 135420 5417 5144 4919 4453 4448 4444 3968 3690 2050 720 485 66 14121
NM_014751chr812147 3848 769 397 22149 2092 --
NM_014755chr283440 3047 2875 1544 1528 1436 1237 496 24126 1565 31535 1532 1003 --
NM_014757chr571955 1908 1804 1635 944 831 750 31835 1763 1722 4723 720 717 714 --
NM_014761chr162305 284 --1137 21059 160
NM_014764chr123979 515 192 ------
NM_014765chr132532 721 543 12078 ----
NM_014766chr7103476 2838 1275 1254 627 578 173 75 39 21 1401 43523 2829 1266 792 12832
NM_014767chr10123556 2712 2562 2534 2326 2250 1286 1082 1067 701 583 490 31334 407 394 62842 2746 1166 1040 492 446 11401
NM_014770chr122225 92 --3994 184 180 41152 1103 1042 967
NM_014771chr164814 690 383 287 1349 2886 62 --
NM_014774chr123025 2644 4954 729 594 94 22205 2203 1867
NM_014776chr1262624 2383 1244 906 325 23 --22643 768 21062 771
NM_014779chr3------1307
NM_014784chr13805 388 204 --8976 742 738 437 432 391 95 39 1814
NM_014786chr114885 853 419 192 1379 161 --
NM_014798chr1791782 1692 1510 1401 1288 672 240 185 109 11745 31791 1279 196 11797
NM_014800chr74465 458 328 226 ------
NM_014803chr1032097 395 355 1833 --1647
NM_014806chr92140 69 ------
NM_014807chr114617 610 583 343 2265 45 4625 621 600 53 1717
NM_014810chr152816 2609 2585 1415 1359 1890 ----
NM_014812chr141934 1323 502 390 11608 11754 --
NM_014819chr521959 273 --1610 --
NM_014820chr321905 1659 ------
NM_014824chr1111396 --2501 154 --
NM_014826chr1114330 3951 3689 3463 1424 1148 1102 71 53 38 31 23657 1291 13783 --
NM_014827chr12684 256 ------
NM_014829chr532168 2067 1720 1672 12071 --
NM_014830chr1292623 2615 2483 2475 1574 927 736 498 75 33843 3433 2880 33669 2802 2580 1305
NM_014839chr1------11823
NM_014840chr1252740 2590 2298 2289 832 32364 1264 1148 12301 --
NM_014841chr61402 ------
NM_014846chr8147 ------
NM_014849chr1111105 989 978 912 888 356 307 280 225 111 104 11174 31262 282 63 1346
NM_014850chr3124700 4436 4404 4301 4111 3479 1569 1479 1457 1318 292 82 24332 545 44282 3471 1344 1329 --
NM_014869chr371240 1185 986 512 369 225 213 ------
NM_014871chr12----132 --
NM_014872chr942042 1931 1785 1555 11625 ----
NM_014873chr141726 854 370 139 11841 11176 --
NM_014876chr2251935 1603 1530 690 116 --21605 21 193
NM_014877chr1735585 958 901 --17003 --
NM_014888chr72527 489 11502 ----
NM_014893chrY42166 1575 882 28 11799 ----
NM_014897chr1773153 2292 1100 905 539 340 97 23082 924 42300 2298 2294 100 --
NM_014901chr581585 1574 1407 748 713 492 284 261 --51889 754 752 263 199 1325
NM_014902chr2061561 1528 1224 573 408 170 1417 31136 582 578 --
NM_014903chr121706 1522 ----
NM_014905chr22670 193 --1195 --
NM_014906chr1731465 295 257 31503 1019 453 132 33375 1372 35
NM_014909chr14133962 3943 3822 3730 3377 3359 3226 3195 3088 3072 2477 918 774 33168 2660 413 32940 2775 2772 13831
NM_014914chr22405 98 1176 2124 103 1234
NM_014920chr622534 2417 2641 55 12537 --
NM_014921chr19182750 2742 2665 2504 2478 2285 2027 2021 878 816 720 689 617 528 505 434 146 112 12868 72964 2936 2840 884 881 319 317 2891 325
NM_014923chr1332270 474 242 --12272 11716
NM_014924chr1433115 984 309 33142 618 51 ----
NM_014925chr123809 655 239 --1184 1765
NM_014926chr33797 745 78 --2177 175 --
NM_014931chr194590 124 52 40 --2668 664 --
NM_014934chr1323527 3230 ------
NM_014935chr1133776 3744 3465 3398 2816 2785 2438 1349 1243 1165 909 861 96 12372 23822 918 --
NM_014938chr1291936 1916 1682 718 497 401 252 111 47 1601 32018 2016 499 --
NM_014941chr22----125 --
NM_014944chr151114 1065 292 166 121 21324 61 31118 1075 294 11121
NM_014947chr142596 2506 526 205 ------
NM_014950chr1421777 658 ------
NM_014952chr1552035 1373 712 586 245 --31800 448 386 11483
NM_014961chr43824 732 190 ------
NM_014962chr203876 405 308 22544 952 ----
NM_014963chr196585 434 418 225 85 48 --2420 228 3468 425 51
NM_014969chr13735 427 412 ------
NM_014974chr1031434 1367 1307 11477 11413 --
NM_014977chr141158 --2408 209 --
NM_014982chr1493754 2140 1413 1136 1107 897 664 150 36 ------
NM_014989chr631356 619 562 --22026 1358 --
NM_014990chr142107 96 ------
NM_014991chr432145 255 46 1536 ----
NM_014994chr15112210 2039 1962 886 838 783 678 631 363 146 135 2792 518 31471 633 467 11956
NM_014996chr351003 271 210 147 126 ----1846
NM_015000chr1222263 2220 12124 11910 --
NM_015001chr12724 35 --1927 --
NM_015002chr122342 194 1797 --21665 170
NM_015008chr322779 2763 22319 630 53084 3082 1049 962 418 --
NM_015020chr1643299 1133 610 354 23704 2798 ----
NM_015023chr1131715 1674 1637 1449 1436 1425 1271 1216 1209 612 438 196 116 --131693 1544 1427 1239 1231 1222 1220 1149 1138 1136 1127 508 460 21244 93
NM_015024chr831378 908 266 11125 1269 2976 149
NM_015025chr221007 897 12199 --1900
NM_015026chr1254742 4542 4468 3528 864 1958 14474 --
NM_015027chr1651985 1504 1239 532 379 1633 1673 --
NM_015032chr1332555 1820 517 11949 ----
NM_015033chr992695 2412 2222 894 799 505 395 153 141 --52698 2424 2157 859 250 --
NM_015039chr183699 1428 512 438 359 320 88 63 24115 283 2589 398 23854 3261
NM_015042chr15173671 3661 3643 3442 3109 2894 2837 2708 1742 1490 1481 1342 961 856 739 609 489 31361 833 342 34058 3847 1492 23664 1435
NM_015045chr10----1289 --
NM_015049chr243186 2741 2553 497 ------
NM_015051chr922808 144 1981 22851 786 --
NM_015052chr751233 494 198 90 64 ------
NM_015063chr19121270 938 446 383 346 294 217 208 186 124 104 87 --61348 940 500 389 220 141 21351 878
NM_015064chr1283023 2698 2612 2251 2233 1321 1098 141 33112 1408 991 32729 2255 2225 --
NM_015068chr731439 1316 1103 1647 13874 --
NM_015069chr16126 ------
NM_015074chr1103716 3448 3145 1910 1676 1451 1405 861 561 121 34590 3154 158 64750 4748 3128 1453 150 123 --
NM_015075chrX82246 2073 2047 1987 368 180 108 90 --72099 2097 2093 856 820 809 359 11730
NM_015079chr1573178 2776 2731 2434 2348 464 450 --42547 2316 2310 2267 11197
NM_015080chr114911 402 223 176 --3621 98 72 1920
NM_015082chr572504 2093 1650 678 656 484 315 22399 1851 2486 437 12096
NM_015085chr17154118 4068 4051 3790 3474 3395 3343 1656 1390 1377 1218 1015 832 252 40 21462 1106 53792 3639 1699 1392 1017 13643
NM_015086chr1281587 1442 1391 1372 1231 1170 1003 558 21050 957 11005 169
NM_015087chr1332670 2554 432 22254 1833 ----
NM_015090chr1115723 5710 4847 4598 4306 1742 1557 963 758 750 462 45870 5209 5200 2100 75753 2088 1383 1126 761 598 386 1465
NM_015092chr1674321 3910 3818 3194 992 944 677 13623 22838 657 12847
NM_015093chr62524 322 ------
NM_015094chr22154639 4471 4321 3934 3146 2958 1589 1119 815 780 741 481 245 220 41 33605 1858 1519 34154 2867 485 24335 3478
NM_015097chr332294 1475 293 --21524 1522 12309
NM_015099chr175566 460 283 179 170 --5463 292 143 139 136 --
NM_015100chr161349 828 748 629 363 154 31608 1567 806 1132 11721
NM_015103chr32858 194 ----1254
NM_015107chrX42442 1885 1865 319 2873 465 31662 1657 1632 1178
NM_015113chr1751954 1915 733 554 106 11686 12052 11884
NM_015125chr196503 451 211 155 136 107 1375 3213 168 82 2524 218
NM_015132chr721784 1767 ------
NM_015133chr1651428 1310 553 376 347 11365 21352 1122 --
NM_015138chr1582782 2326 2111 939 842 812 389 61 22585 187 32603 2600 199 2794 205
NM_015144chr1693341 3263 3233 2458 968 822 658 552 285 23789 958 --1665
NM_015150chr31127 ----1290
NM_015155chr1043229 976 904 156 22333 853 1158 162
NM_015156chr144636 627 323 194 21567 177 2629 285 --
NM_015157chr1131108 408 321 1928 31101 775 260 --
NM_015163chr1431832 508 180 --1183 --
NM_015171chr16--2112 78 1416 1148
NM_015172chr131288 592 425 ------
NM_015185chrX102741 2660 2625 2389 2323 2176 942 559 515 311 22472 2452 52326 2211 960 944 382 --
NM_015187chr4122 ------
NM_015191chr1122730 169 21051 552 1101 --
NM_015199chr3--12233 12195 --
NM_015200chr431993 710 235 11864 2243 237 --
NM_015203chr11181 --1184 1209
NM_015205chr13133972 3955 3933 1332 1282 1259 1250 1221 1192 1163 1142 764 38 23722 422 34416 4123 4085 --
NM_015206chr1553884 3088 3051 2644 2614 22800 2655 --12647
NM_015208chr182843 796 1943 ----
NM_015209chr151958 1438 537 475 369 21501 1477 5388 383 380 186 184 --
NM_015213chr111299 --1264 --
NM_015219chr1772525 2318 2131 1644 1033 517 228 2531 176 32232 351 210 1388
NM_015230chr4122 ------
NM_015233chr1362426 2402 2300 506 136 42 ------
NM_015234chr621133 198 --2208 202 --
NM_015235chr1031876 839 109 --1113 12010
NM_015236chr42230 201 1986 11275 --
NM_015250chr91253 1159 156 --
NM_015252chr24596 323 154 49 1867 1157 127
NM_015254chr8122911 2767 2743 2491 2448 2248 932 923 633 408 215 151 ----1100
NM_015261chr11289 63 --1134 --
NM_015263chr15----1400 --
NM_015264chr22104332 3588 1943 1731 1088 887 828 503 366 191 21253 1108 74547 4373 1806 1568 1503 1500 197 23644 1571
NM_015270chr1291927 1895 1870 1579 1481 533 396 350 244 11543 22222 2030 1514
NM_015271chr432923 2860 1008 11683 ----
NM_015272chr1641726 1605 187 33 11931 ----
NM_015282chr262581 2479 2411 2341 931 411 22489 66 32505 934 664 --
NM_015284chr192090 1933 1874 1810 1572 1534 413 337 188 11586 --1567
NM_015285chr1862494 2459 2224 903 855 744 --12007 --
NM_015286chr1541621 1573 260 103 --1105 --
NM_015288chr5103869 3392 2800 2599 2578 1133 1113 1076 706 40 --42836 2752 992 639 43395 3297 2582 1154
NM_015291chr132579 2188 271 33284 578 232 --1412
NM_015292chr123282 273 266 ------
NM_015293chr61280 ----1131
NM_015299chr14113815 3781 3747 3592 3554 3428 3287 1319 918 414 76 --53714 3301 3271 1594 374 23919 3447
NM_015305chr1461981 1421 1290 764 605 110 --3290 263 119 11295
NM_015310chr8107836 7559 6598 6587 6257 6225 2731 2491 2111 1517 --77224 7157 7155 6754 6228 5474 1716 --
NM_015313chr1163344 3242 2976 1623 685 230 1219 --23543 3474
NM_015315chr572940 2664 1333 863 672 549 196 --73170 3168 869 650 641 402 201 --
NM_015317chr212518 ------
NM_015319chr124402 153 111 72 --1159 --
NM_015321chr19184740 4179 4035 3863 3506 3392 3201 1958 1727 1643 1445 1410 691 673 311 266 78 49 34672 3042 454 54761 4339 4181 3395 280 24764 1279
NM_015326chr1112784 2709 2689 2202 2072 1016 782 665 541 332 134 2793 142 42092 2074 202 179 22300 786
NM_015327chr161255 1214 963 504 55 45 --41127 1124 481 272 --
NM_015328chr762734 2694 2684 2547 2287 359 32325 673 283 32700 2697 421 --
NM_015335chr1251914 999 508 111 41 ------
NM_015338chr2061852 1430 1262 767 404 239 --21265 125 11518
NM_015344chr831926 1766 127 ------
NM_015346chr1471431 1224 531 464 436 390 150 31595 608 82 ----
NM_015349chr642258 2071 1953 649 --1547 22091 1013
NM_015355chr1711532 ------
NM_015359chr86927 820 740 489 309 221 ----2931 827
NM_015361chr2136 ----148
NM_015365chrX94026 3205 1388 392 383 364 333 319 48 23933 3148 13258 23606 3208
NM_015367chr2231663 539 509 1419 ----
NM_015374chr2251446 513 235 210 199 --165 1476
NM_015378chr153018 2656 2383 1814 931 --32325 2323 1826 22766 2712
NM_015385chr1021027 265 2540 516 2436 271 --
NM_015387chr211925 21564 462 ----
NM_015393chr462972 2560 2380 1128 675 140 23536 282 3677 167 143 --
NM_015397chr951507 1279 753 738 195 11497 1779 --
NM_015401chr122722 256 --1258 1801
NM_015417chr20--1445 2629 494 --
NM_015443chr1731016 478 216 --3968 541 431 1326
NM_015455chr5----1402 --
NM_015457chr113797 228 22 175 187 1852
NM_015460chr322082 566 ------
NM_015470chr281050 969 780 428 417 396 122 60 2373 255 61116 952 290 128 126 63 31123 1096 1057
NM_015472chr31100 --1123 --
NM_015472chr31100 --1123 --
NM_015475chr23984 745 214 ------
NM_015481chr1281073 878 845 418 227 106 93 33 --91088 1076 1012 930 813 315 231 112 82 2933 234
NM_015488chr2111683 1556 1347 1181 684 639 536 525 291 124 33 11430 61685 1601 1516 1507 407 296 11574
NM_015493chr1952106 1690 147 103 78 21452 492 4205 139 137 62 --
NM_015503chr161537 2617 43 --1449
NM_015508chr321558 1242 ------
NM_015509chr1221157 93 21542 1140 1167 --
NM_015520chr341032 646 461 361 12485 1530 1411
NM_015537chr97757 750 715 454 296 147 80 11164 142 --
NM_015541chr31576 ------
NM_015550chr783601 3571 2730 2634 861 844 820 643 12278 --1379
NM_015553chr695054 4628 4123 3406 1489 314 174 121 23 11692 13607 11243
NM_015554chr1562673 2610 1175 1045 951 753 ------
NM_015557chr1123295 2789 2779 2757 2660 1424 1344 1255 1090 1069 700 656 23434 520 43550 2801 2711 1289 13076
NM_015560chr332493 1878 948 --12304 --
NM_015564chr543251 2666 2401 393 --1928 --
NM_015569chr154501 3873 1443 621 482 ------
NM_015575chr282698 2516 2259 709 625 398 250 28 1311 53151 3135 2995 711 523 --
NM_015576chr322716 620 1293 ----
NM_015577chr541370 1321 551 124 1153 --1297
NM_015589chr142125 115 --1129 --
NM_015605chr103256 179 85 ------
NM_015609chr192760 2602 2504 2443 2171 2092 1085 190 134 --72458 2448 2102 867 735 192 182 --
NM_015635chr911609 --1881 --
NM_015642chr31224 --1226 --
NM_015649chr194372 140 117 73 --1290 --
NM_015651chr9122282 2121 2012 1744 542 444 412 399 304 285 200 66 --11793 --
NM_015652chr102625 484 ------
NM_015670chr173107 96 59 ------
NM_015680chr24608 575 116 109 1594 ----
NM_015686chrX62383 2232 1763 792 444 136 32372 1798 405 32421 2090 79 155
NM_015694chr71140 --2144 124 --
NM_015695chr67801 761 738 663 618 443 133 21676 222 51825 1730 1724 462 99 1708
NM_015711chr196684 269 223 148 100 30 --6670 659 657 225 35 23 --
NM_015716chr178718 643 586 565 511 201 82 63 --10712 705 701 698 609 517 281 247 47 45 1186
NM_015719chr198739 712 596 575 523 274 245 201 --3580 252 247 --
NM_015726chr151870 1745 1690 1137 335 11851 2489 249 --
NM_015831chr77874 769 591 363 106 100 39 1343 4919 915 594 352 --
NM_015840chr1102428 2045 1942 1728 1667 884 803 685 631 504 1216 1453 --
NM_015841chr1102428 2045 1942 1728 1667 884 803 685 631 504 1216 1453 --
NM_015850chr871960 1718 272 244 184 94 22 32445 1822 877 31931 175 173 --
NM_015855chr112575 196 --2199 143 --
NM_015864chr6147 139 ----
NM_015872chr191709 1703 1455 1388 1156 586 432 185 132 1204 61775 1757 1413 1410 732 717 11792
NM_015874chr41143 ----1489
NM_015881chr114958 353 120 107 155 1355 1166
NM_015892chr1052358 2166 2149 439 203 --21869 729 --
NM_015898chr19182444 2307 2254 2118 1743 1659 1652 1595 1573 943 602 589 577 529 441 239 215 195 11728 152493 2316 2314 1917 1846 1662 1583 886 884 630 579 444 253 248 217 1901
NM_015904chr21711 --1235 3698 286 242
NM_015906chr154199 3722 3499 3349 761 13647 44511 4508 3662 432 --
NM_015913chr14588 545 306 223 ------
NM_015926chr3381 67 55 ------
NM_015974chr13128 ------
NM_015980chr531474 1466 1126 11339 --11477
NM_015981chr5163012 2968 2602 2502 2372 2349 2085 2035 1223 1190 584 552 460 421 407 201 32202 103 78 4465 281 227 225 42797 2355 538 412
NM_015982chr171346 --2300 93 --
NM_015999chr13297 225 35 ------
NM_016021chr662386 2187 2165 1905 1894 451 --12075 --
NM_016022chr14872 744 730 315 --3879 320 271 --
NM_016025chr1632006 1981 240 --1751 22009 542
NM_016032chrX6999 937 927 379 300 282 11170 21017 1015 --
NM_016037chr13867 455 163 --1165 --
NM_016040chr152637 1986 1866 736 509 ----1740
NM_016057chr1261123 1104 899 890 374 284 21058 76 1995 1160
NM_016063chr61570 ------
NM_016076chr12830 621 --1110 1113
NM_016081chr411467 ------
NM_016096chr831407 1343 146 ------
NM_016099chr8179 1436 ----
NM_016107chr5----1276 --
NM_016120chrX11222 ------
NM_016129chr41324 ------
NM_016131chr231975 795 769 --2948 797 --
NM_016147chr114359 240 84 23 11186 2270 224 1209
NM_016151chr164360 344 320 164 153 1365 --
NM_016152chr31161 131 ----
NM_016169chr10113013 2479 1172 1125 779 730 595 453 416 261 47 11304 22540 643 --
NM_016201chr322003 231 21504 107 72277 2161 772 717 327 40 38 --
NM_016206chr388558 7492 6465 3374 3360 2355 1607 244 21596 787 17281 18627
NM_016210chr391497 1364 1218 431 390 291 99 68 61 41143 606 305 249 ----
NM_016227chr11355 ------
NM_016248chr1343465 1246 1085 757 34002 627 554 61300 1293 1286 1273 1268 1266 11321
NM_016250chr141175 1786 2239 236 2243 46
NM_016257chr163001 2881 2681 2332 1404 143 1199 1146 1440
NM_016260chr276590 5637 5611 5554 5075 1493 1171 25975 5358 36592 6256 565 15614
NM_016269chr43482 344 322 --1324 --
NM_016272chr22112564 2452 2426 1941 1737 883 715 571 440 363 347 42435 1863 1816 774 62428 1955 1769 1741 622 355 1793
NM_016277chr611571 --11563 --
NM_016281chr124978 894 882 186 183 4984 905 885 189 --
NM_016284chr162796 732 ----2955 799
NM_016287chr141802 1606 520 107 ----2277 111
NM_016293chr12----123 --
NM_016320chr112803 360 2288 145 1119 --
NM_016322chr972798 2405 793 383 323 242 213 12896 ----
NM_016333chr163142 135 99 1429 2451 146 166
NM_016340chr51128 ----11037
NM_016376chr17104222 3306 3261 3203 2871 1718 1078 370 324 44 24206 1726 23013 279 --
NM_016418chr22123535 3405 2699 2428 2334 2320 1123 1075 1039 898 789 342 2498 190 12666 1847
NM_016422chr112164 145 22414 109 --12198
NM_016429chr17123 144 ----
NM_016436chr2042015 1987 408 231 --1784 --
NM_016453chr33671 453 22 --1456 --
NM_016456chr18677 645 588 305 138 131 104 82 --1684 --
NM_016463chr5129 ------
NM_016472chr141481 ----1940
NM_016483chr31323 --2232 224 155
NM_016485chr622244 782 1458 --12249
NM_016486chr1------1186
NM_016489chr72192 29 ------
NM_016492chr172124 98 ------
NM_016506chr113130 65 42 ------
NM_016507chr1763066 2272 2124 685 557 195 22342 598 12276 12282
NM_016513chr622534 2417 2641 55 12537 --
NM_016519chr42164 43 ------
NM_016522chr1121672 1541 --11547 --
NM_016525chr93712 604 261 --1796 --
NM_016530chr1543099 2498 1023 186 ------
NM_016531chr441588 755 181 33 --1184 --
NM_016544chr252852 1218 1160 1103 87 --53800 1443 1256 1253 1168 --
NM_016547chr12641 255 ----1548
NM_016559chr321124 326 --1328 11466
NM_016569chr1221537 344 --1141 1347
NM_016574chr118937 924 278 259 154 108 42 34 ------
NM_016577chr3124381 4369 4072 4032 2963 2770 1476 1354 973 698 438 24 --64371 3743 2967 1496 1494 396 --
NM_016588chr61730 --2737 734 --
NM_016596chr122722 256 --1258 1801
NM_016603chr51222 1810 ----
NM_016604chr561155 984 834 510 132 24 2914 502 1836 --
NM_016605chr5112535 2520 2171 1920 1878 1863 1682 933 909 723 395 12061 52538 2349 1880 1866 1745 --
NM_016607chrX2485 295 ------
NM_016618chr21155 123 ----
NM_016621chr11204351 4293 4254 4233 4116 4042 3791 3747 3459 3318 3263 3129 3036 3018 1538 1524 767 722 673 657 13155 23132 659 14324
NM_016623chr81131 ------
NM_016628chr101626 ------
NM_016631chr212745 278 ------
NM_016652chr20--11285 --11782
NM_016654chr1521283 980 1455 ----
NM_016733chr2241149 1078 309 145 --1500 11121
NM_016819chr33518 410 71 2360 126 3372 349 192 --
NM_016829chr33254 176 164 --2310 308 2236 180
NM_016830chr123390 205 61 --174 1167
NM_016834chr17143780 3686 3666 3573 3185 3070 2850 2835 1509 1125 907 868 628 106 23223 1635 93212 3207 3204 3072 2768 1427 1424 871 316 --
NM_016835chr17143780 3686 3666 3573 3185 3070 2850 2835 1509 1125 907 868 628 106 23223 1635 93212 3207 3204 3072 2768 1427 1424 871 316 --
NM_016841chr17143780 3686 3666 3573 3185 3070 2850 2835 1509 1125 907 868 628 106 23223 1635 93212 3207 3204 3072 2768 1427 1424 871 316 --
NM_016929chr683973 3727 1514 1115 1064 383 187 76 24014 1457 13993 152
NM_016931chr111299 ------
NM_016936chr1651753 1490 575 428 359 162 21821 1817 --
NM_016946chr182935 1268 948 565 552 527 289 172 1241 1187 --
NM_016950chr4------182
NM_017409chr123516 139 87 2617 590 354 42 21 --
NM_017410chr1271108 1064 954 785 478 420 177 1897 1289 --
NM_017413chrX82166 1815 968 675 392 295 278 240 1941 22048 157 21672 54
NM_017415chr594216 3805 2778 1792 1730 1586 1228 189 126 22883 1698 34224 4219 1254 24210 1065
NM_017420chr1432870 2789 2470 ------
NM_017447chr211791 23984 46 --13951
NM_017449chr1101558 1450 1387 1362 1355 1271 1152 672 468 359 132 41681 1603 1158 368 11592
NM_017450chr1731198 1069 73 1163 3499 200 51 --
NM_017452chr2041405 1301 339 283 ------
NM_017453chr2041405 1301 339 283 ------
NM_017454chr2041405 1301 339 283 ------
NM_017455chr151145 --290 88 --
NM_017456chr1761481 1236 760 593 520 55 --11571 --
NM_017457chr191121 ------
NM_017482chr251225 1077 1053 977 211 --121 --
NM_017488chr241294 376 369 260 21307 394 3382 379 359 1263
NM_017515chr1121150 616 128 ----
NM_017519chr631277 449 115 ------
NM_017522chr111236 --1481 1486
NM_017544chrX2866 743 1230 ----
NM_017551chr1012559 1473 ----
NM_017553chr1531155 813 487 ------
NM_017559chr17--1273 2243 239 1247
NM_017563chr3156139 5393 5311 5096 5055 4968 4748 4525 1590 1182 1163 726 185 146 68 25355 57 55178 4527 2188 1165 47 --
NM_017575chr1781588 1523 1394 1149 640 514 303 166 21474 1023 31539 309 305 --
NM_017580chr1032040 1962 1497 ------
NM_017582chr151505 642 509 96 23 --126 21512 101
NM_017590chr22112680 2437 2176 2106 2083 1644 830 542 407 248 150 --5634 423 410 394 231 --
NM_017594chr912770 23066 887 1525 32796 528 53
NM_017596chr1234315 4241 4219 4153 4084 4003 3969 3083 1856 1783 1746 1492 1364 977 840 751 726 697 378 340 170 56 26 74548 1763 1301 987 745 510 66 71285 755 715 711 708 312 40 14424
NM_017602chrX5372 139 126 83 52 131 3130 116 114 --
NM_017607chr191475 --2357 63 --
NM_017628chr475023 3320 3267 1270 1250 1230 155 13615 --11233
NM_017633chr612950 --23725 3723 --
NM_017634chr821273 549 --1501 --
NM_017637chr9148825 8767 8707 8209 7508 7108 6374 6299 6282 6143 6034 5749 3104 210 48869 3543 2449 1575 99031 9029 8715 8713 7510 6606 6301 6272 6270 49036 8319 3107 372
NM_017640chr62147 82 2578 235 ----
NM_017643chr1731896 851 492 ----12659
NM_017650chr754090 4076 1585 932 68 --1863 172
NM_017657chr22357 52 ------
NM_017658chr141356 1264 ----
NM_017666chrX41561 686 489 234 11422 ----
NM_017668chr163613 255 50 --2700 99 --
NM_017679chr172549 464 1561 140 1115
NM_017694chr22376 44 --190 --
NM_017709chr142932 1580 966 846 --12934 --
NM_017714chr202933 281 ------
NM_017715chr75691 275 186 53 42 --1188 --
NM_017719chr3--12503 1694 --
NM_017730chr31197 ------
NM_017736chr1652957 2380 1939 742 269 ----1261
NM_017737chr11347 ----1617
NM_017739chr13513 157 62 ------
NM_017740chr1631385 544 423 --21387 1255 --
NM_017744chr151890 1675 1539 987 778 --11664 --
NM_017753chr9----1737 1385
NM_017754chr6104821 3969 3273 1139 1027 947 893 720 436 391 44740 4393 3535 1093 --24312 3276
NM_017758chr173957 546 213 1434 11087 --
NM_017761chr121128 1098 11562 ----
NM_017766chr13486 362 33 ------
NM_017772chr691794 1612 1593 1474 1384 1323 1153 461 435 --21797 1212 11669
NM_017778chr821219 1192 ------
NM_017797chr195988 962 896 704 351 2248 109 2768 29 --
NM_017811chr972891 2873 2500 2145 1977 968 799 --33080 2707 140 23162 2059
NM_017824chr1022059 876 21819 581 ----
NM_017848chrX104399 4331 4162 3977 3861 1814 1768 764 280 147 --14177 --
NM_017849chr2143086 2951 2873 2086 2047 2012 1038 968 947 931 898 540 217 55 3717 287 82 21260 1258 3913 130 40
NM_017893chr1071241 926 318 222 173 87 69 41483 357 284 117 21451 1448 31323 1235 241
NM_017895chr202178 49 ------
NM_017902chr10155382 5111 5064 4638 4601 4503 4154 3980 1981 1891 1544 1314 1171 986 469 14553 45440 4450 4357 3801 15391
NM_017907chr112321 31 --1367 --
NM_017915chr121394 --1303 --
NM_017921chr17102055 1691 1636 799 729 394 273 246 170 139 11826 62237 1712 1593 1591 577 538 11778
NM_017953chr11211 ------
NM_017954chr721637 1557 11356 11559 --
NM_017957chr1741592 1346 1262 365 --21408 1091 --
NM_017966chr1181373 1076 1016 960 401 203 106 28 --1403 --
NM_017982chr131017 355 27 1921 ----
NM_017983chr173169 157 34 ------
NM_017984chr7131 --121 --
NM_017987chr1051463 851 712 486 84 12125 2494 488 2794 172
NM_017988chr124800 733 247 218 ------
NM_018003chr15--1852 --12418
NM_018008chr32354 26 ------
NM_018010chr311458 11096 11613 --
NM_018026chr11141349 1336 1267 1091 1075 1059 973 401 281 226 219 164 99 27 2963 296 81108 1022 979 975 228 204 175 170 31340 1328 405
NM_018027chr1062245 872 365 306 245 36 22292 2046 3850 249 39 22252 2008
NM_018028chr1981234 1198 1001 887 508 360 270 35 1537 71219 1216 1200 1026 523 514 342 2893 318
NM_018030chr181429 11131 1432 --
NM_018036chr1423787 3258 --24087 3337 --
NM_018045chr133069 2374 1967 12344 42545 2455 2257 2255 1699
NM_018061chr1195 31717 1189 64 1105 --
NM_018070chr11112 --1121 --
NM_018071chr147657 340 321 258 177 107 38 2767 605 --1720
NM_018072chr11182 ------
NM_018084chr222330 2028 ----12333
NM_018085chr1117763 7471 7121 6656 5934 2377 1493 815 574 249 214 46841 6734 5998 823 1627 1776
NM_018086chr221814 1312 --21324 1321 --
NM_018095chr113130 65 42 ------
NM_018110chr164964 939 930 277 1385 1942 1300
NM_018114chr3----2203 200 --
NM_018116chr11465 ------
NM_018121chr1082715 2555 2237 2213 2033 652 450 301 --12239 --
NM_018128chr172986 226 ----1523
NM_018133chr331992 677 576 ------
NM_018150chr14833 652 572 74 2614 103 --1577
NM_018155chr323044 237 1272 ----
NM_018156chr153018 2656 2383 1814 931 --32325 2323 1826 22766 2712
NM_018171chr122893 682 --1897 1887
NM_018178chr141647 641 191 29 2804 258 --1663
NM_018182chr17112133 2121 2065 1999 1827 1637 798 778 260 233 174 32175 1651 766 82071 2069 1841 1772 694 427 421 177 --
NM_018195chr1131783 1776 172 12003 ----
NM_018198chr141403 908 490 476 2983 594 11226 --
NM_018200chr1522267 1945 1565 1246 --
NM_018205chr1052256 1957 744 320 307 1697 22031 1991 --
NM_018207chr151637 1497 524 324 256 1567 21157 326 11208
NM_018208chr161100 916 879 736 304 100 ----1105
NM_018214chr64323 195 117 66 2361 146 1326 --
NM_018218chr241775 395 139 38 21264 521 21273 1207 --
NM_018223chr1241202 827 764 180 1914 --1892
NM_018227chr443101 3083 1256 1233 ------
NM_018231chr166903 751 645 341 193 182 2765 380 4963 960 651 253 2655 260
NM_018239chr1052256 1957 744 320 307 1697 22031 1991 --
NM_018240chr15839 676 209 116 93 2348 146 1843 1707
NM_018244chr204891 844 426 271 1258 41035 960 228 213 21040 964
NM_018246chr822344 1773 12251 ----
NM_018247chr632886 2003 152 ------
NM_018250chr8123 143 ----
NM_018263chr221801 385 --12102 11039
NM_018275chr73359 211 23 --3367 363 84 --
NM_018299chr8--13154 12616 --
NM_018312chr1121668 1611 1454 11702 --
NM_018313chr332037 1989 1974 --22465 2463 11978
NM_018315chr421426 48 --158 --
NM_018319chr1431249 274 85 ------
NM_018322chr62928 544 11226 ----
NM_018327chr20185 --287 51 --
NM_018330chr1011718 11554 ----
NM_018334chr7----1351 --
NM_018362chr1113497 22708 863 23500 3324 --
NM_018364chr163636 3071 2936 1275 1246 329 ----12940
NM_018371chr821029 389 1551 11119 --
NM_018383chr211336 --1720 --
NM_018400chr11164390 4262 3928 3830 3566 3231 3221 2892 1840 1119 774 649 313 270 185 110 31824 1644 1488 54265 3774 3765 361 315 --
NM_018403chr353926 3713 3506 3231 775 --23234 400 13238
NM_018409chr443092 2983 2926 2861 1726 12986 22940 2864
NM_018412chr7150 ------
NM_018416chr12102515 2499 2291 2273 2224 2000 1987 1635 990 951 32011 1817 1036 22297 86 --
NM_018424chr91429 1451 11350 --
NM_018426chr62411 102 1245 1155 1158
NM_018440chr8127916 7131 7109 6960 5994 5536 5472 1782 1166 577 443 242 66896 6557 5964 2455 771 147 36499 5272 705 36502 5608 2029
NM_018449chr92551 247 --1690 --
NM_018452chr6_random32563 1382 856 193 1901 --
NM_018457chr122519 101 2421 25 1522 149
NM_018462chr32615 311 ------
NM_018469chr171351 123 --1361
NM_018489chr151557 1500 618 605 532 ------
NM_018509chr1751452 689 671 388 141 21519 623 11327 11455
NM_018534chr22162 80 ------
NM_018553chr1721565 592 --21567 78 --
NM_018557chr211117 ------
NM_018566chr121895 1096 21954 996 --14333
NM_018584chr131165 1151 202 --21157 835 --
NM_018638chr1224358 1691 34068 3466 2213 ----
NM_018640chr1232658 2559 963 11889 ----
NM_018644chr11121396 835 705 579 539 518 424 416 302 292 206 76 21671 1607 32092 58 25 1740
NM_018649chr102223 155 ----1159
NM_018650chr12357 101 ------
NM_018653chr173356 328 74 --4136 90 87 84 --
NM_018660chr8102448 2440 2292 2261 2237 2064 1919 870 780 211 31029 621 160 52442 2264 2015 2009 2004 12018
NM_018667chr1662759 1016 719 602 329 67 --52151 2148 980 788 531 42273 2092 983 739
NM_018674chr23561 493 136 --4673 671 508 139 --
NM_018699chr42322 295 ------
NM_018712chr11----2954 290 1293
NM_018717chr451882 1848 913 757 728 22097 453 1936 --
NM_018718chr731962 1927 133 21804 1685 4651 234 160 158 --
NM_018837chr201700 1346 --1285
NM_018841chr161027 977 674 516 32 22 --11518 11084
NM_018847chr9----2398 52 --
NM_018896chr17----3120 61 58 --
NM_018898chr52285 210 12060 1264 160
NM_018899chr52285 210 12060 1264 160
NM_018900chr52285 210 12060 1264 160
NM_018901chr52285 210 12060 1264 160
NM_018902chr52285 210 12060 1264 160
NM_018903chr52285 210 12060 1264 160
NM_018904chr52285 210 12060 1264 160
NM_018905chr52285 210 12060 1264 160
NM_018906chr52285 210 12060 1264 160
NM_018907chr52285 210 12060 1264 160
NM_018908chr52285 210 12060 1264 160
NM_018909chr52285 210 12060 1264 160
NM_018910chr52285 210 12060 1264 160
NM_018911chr52285 210 12060 1264 160
NM_018912chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018913chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018914chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018915chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018916chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018917chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018918chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018919chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018920chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018921chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018922chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018923chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018924chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018925chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018926chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018927chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018928chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018929chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_018933chr52232 131 171 ----
NM_018944chr21141 --144 --
NM_018945chr663402 3387 3354 1039 137 29 --3260 155 32 12636
NM_018951chr74884 107 49 34 --2110 54 --
NM_018952chr175449 414 232 144 114 ----1439
NM_018963chr212146 93 ------
NM_018970chr722768 2734 --12770 --
NM_018976chr12------12108
NM_018977chrX2436 294 --241 37 1767
NM_018979chr1252329 1982 1659 446 174 1394 2462 176 1402
NM_018992chr1641670 1296 1187 548 ------
NM_018999chr1084927 4602 4228 3545 3213 1849 1122 998 23177 1346 11851 23549 1858
NM_019001chr324147 3465 ------
NM_019008chr2253148 2965 1509 1292 604 22779 1101 21189 607 --
NM_019009chr1172485 782 748 450 266 242 60 1423 52470 2468 2454 2171 207 --
NM_019022chr182377 148 1398 ----
NM_019027chr472302 2062 2038 1796 780 696 637 --1785 --
NM_019042chr7157 ------
NM_019053chr1021008 981 ------
NM_019063chr211902 2906 767 ----
NM_019064chr174783 596 241 60 --2598 47 --
NM_019071chr71276 ------
NM_019072chr513312 1838 182 --
NM_019087chr511356 --1245 --
NM_019096chr63979 908 135 1832 ----
NM_019102chr72325 81 ------
NM_019102chr72325 81 ------
NM_019106chr22103183 2992 2801 2561 2394 1381 757 749 684 233 32375 1317 766 42400 1250 786 784 23031 263
NM_019114chr962117 1856 1656 1645 988 879 --22437 2429 --
NM_019116chr1653324 2819 2775 2303 1366 22601 760 1646 --
NM_019592chr95843 329 242 146 77 1125 ----
NM_019593chr2022186 2127 12768 22866 2130 --
NM_019600chr151106 ------
NM_019606chr72479 361 --1164 1493
NM_019610chr121553 617 --1611 --
NM_019624chr122227 21 --1746 --
NM_019625chr122227 21 --1746 --
NM_019850chr23634 210 97 ----2541 261
NM_019854chr122293 142 --2303 190 1654
NM_019859chr101342 1588 ----
NM_019884chr191149 --2492 461 1154
NM_019885chr2122344 2178 1815 699 692 651 640 527 333 219 205 122 --101998 1045 1042 934 825 822 424 421 188 131 1553
NM_019891chr1----21081 1079 --
NM_020039chr1291857 1724 1494 1250 588 368 261 96 74 --41669 1282 1273 1223 41226 468 279 265
NM_020062chr202253 39 --3880 164 41 1385
NM_020063chr14227 197 190 98 --174 2230 36
NM_020122chr2105522 5391 5300 5151 4969 3907 1589 1411 1002 256 15788 15269 --
NM_020123chr102635 259 ------
NM_020126chr193568 546 476 --1514 --
NM_020131chr181617 1485 1371 600 433 212 104 89 11335 336 31 29 31630 1139 107
NM_020132chr21134920 3333 1821 1799 1703 1266 1216 1147 786 462 433 312 269 --21870 1286 --
NM_020134chr261020 920 877 206 140 58 --61166 1062 1052 932 926 428 1432
NM_020137chrX----231 28 --
NM_020141chr121862 333 ------
NM_020142chr121166 --7597 584 572 508 505 169 67 --
NM_020150chr102375 97 21922 1850 1549 --
NM_020155chr11191 ------
NM_020166chr3144 ------
NM_020168chr1561329 1251 1143 524 474 103 --3191 189 87 1478
NM_020177chr532371 2167 400 --23265 2170 --
NM_020178chr1731149 91 74 1103 ----
NM_020180chr1831355 1187 21 --1975 --
NM_020182chr20103435 3358 3025 2978 2603 2246 1448 1430 875 130 23005 1324 53361 3027 1412 1237 119 12359
NM_020184chr272035 1568 904 870 732 464 44 --81951 906 479 476 473 470 467 457 --
NM_020205chr163428 2887 1370 1353 1100 1077 13485 23360 523 --
NM_020211chr1551297 1019 615 456 282 11250 81383 1379 1324 1305 1299 346 243 161 149
NM_020229chr112321 154 ------
NM_020239chr171540 840 635 515 441 433 84 --3454 173 164 11434
NM_020245chr6113772 3571 2001 1749 1667 1536 1382 1091 1041 747 509 14823 --1387
NM_020248chr182154 1735 1583 1575 1555 493 343 331 11914 42156 2094 109 103 22161 1666
NM_020309chr196821 426 268 232 158 89 2895 221 2930 123 1795
NM_020310chr17102500 2481 2194 2033 1752 796 433 412 336 326 22047 55 82502 2253 1966 1947 789 783 338 282 12197
NM_020336chr2023554 772 --22593 2590 1995
NM_020337chr41939 22839 2439 11115 --
NM_020338chr10152908 2645 2444 2402 2329 1429 1394 1071 1044 1029 1001 406 330 322 26 12930 31181 430 137 11335
NM_020341chr201185 ------
NM_020342chr2------12633
NM_020348chr1052239 1721 346 164 119 41699 1016 528 394 32675 1711 81 12247
NM_020357chr321572 374 ------
NM_020360chr176586 476 227 194 141 72 192 --1519
NM_020382chr1271461 1411 1260 1063 991 276 23 1472 2545 383 --
NM_020383chr10297 79 --1107 --
NM_020384chrX51715 1649 1633 1523 488 31881 1476 1235 31730 1635 244 21735 1614
NM_020390chr324609 2978 --14262 11698
NM_020403chr132230 218 ------
NM_020408chr64851 686 348 253 --1255 1922
NM_020416chr492048 1937 989 880 834 797 601 424 160 1914 --1427
NM_020420chrY11397 ------
NM_020429chr782942 2818 2773 2380 2271 606 193 133 12116 ----
NM_020440chr162945 2894 2864 2487 711 196 1284 --13143
NM_020441chr113235 213 46 --2263 32 --
NM_020443chr1106846 6361 6300 5459 4813 1120 456 433 243 98 55661 5447 4442 2774 858 86977 6731 6543 5648 486 72 70 64 1490
NM_020444chr51948 --153 --
NM_020452chr181439 1332 1322 576 475 370 111 104 ------
NM_020457chr164446 235 163 75 --1426 --
NM_020463chr241318 1189 339 171 ------
NM_020473chrX1601 ------
NM_020475chr892452 2011 1904 1760 1596 859 534 489 119 12423 22106 548 32394 2133 2015
NM_020476chr892452 2011 1904 1760 1596 859 534 489 119 12423 22106 548 32394 2133 2015
NM_020477chr892452 2011 1904 1760 1596 859 534 489 119 12423 22106 548 32394 2133 2015
NM_020478chr892515 2074 1967 1823 1659 922 597 552 182 12486 22169 611 32457 2196 2078
NM_020480chr892452 2011 1904 1760 1596 859 534 489 119 12423 22106 548 32394 2133 2015
NM_020526chr161767 1653 1441 687 575 112 1222 51494 1492 1210 1192 690 --
NM_020530chr225889 395 356 336 101 1223 1843 1169
NM_020631chr12347 235 --11332 21078 525
NM_020638chr1291763 1641 1387 1317 717 684 320 261 55 137 21320 719 1293
NM_020644chr111826 ------
NM_020647chr822249 192 ------
NM_020651chr211252 --31245 1243 563 --
NM_020654chr31373 ------
NM_020663chr142184 106 ------
NM_020672chr1170 --1463 2399 135
NM_020673chr2031819 1339 1101 22404 1373 36537 6484 2301 --
NM_020689chr2031207 337 106 --5513 341 218 157 155 1177
NM_020692chr142774 229 --1839 1232
NM_020693chr111371 --2386 375 --
NM_020695chr194760 745 727 28 --2774 318 --
NM_020698chr1292565 2492 2443 1973 1938 906 497 334 213 22925 758 11993 --
NM_020699chr1175140 4824 4126 3900 3877 3840 3822 3768 3395 3364 3273 1890 1823 1317 985 946 381 74983 4857 4114 3908 1805 1670 64 2411 185 53790 3374 1953 1751 949
NM_020706chr211143 ------
NM_020713chr2092868 2469 1040 816 607 585 366 258 210 3703 101 86 62421 2390 1271 640 169 146 22838 820
NM_020717chrX134145 4037 4006 3298 1878 1537 1362 1277 1109 1084 1065 242 146 23289 1144 11880 --
NM_020728chr721143 40 11252 ----
NM_020732chr631277 449 115 ------
NM_020737chr62120 21 ------
NM_020742chrX51845 945 811 445 28 11865 ----
NM_020749chr841870 1482 1386 464 21833 206 11484 21432 1390
NM_020760chr211780 21337 1239 ----
NM_020764chr16101277 1266 1068 1032 1020 922 897 231 215 43 1473 11035 --
NM_020765chr1285 63 --2119 65 --
NM_020766chrX54563 4237 2835 1003 521 23408 2994 --11468
NM_020769chrX--1725 1789 --
NM_020771chr611053 ------
NM_020772chr17118362 6725 6719 5982 3447 3083 2298 2285 1527 928 481 27946 2532 26727 491 --
NM_020774chr1821891 1449 34595 3989 2296 15117 --
NM_020776chr1882678 2539 2478 2151 1067 948 392 94 32493 1158 957 --12855
NM_020778chr15124415 3062 1792 1758 1340 1258 1214 990 778 771 675 666 24239 4182 31742 643 315 53754 1844 1347 1025 846
NM_020783chr181668 2965 461 1670 --
NM_020791chr17181 ------
NM_020792chr372130 2006 1909 1885 735 101 93 12260 11912 --
NM_020794chr11347 ------
NM_020795chr17151944 1809 1791 1529 1337 1320 1275 1259 823 813 588 559 228 143 37 3791 424 412 81948 446 442 440 435 432 230 25 --
NM_020796chr542761 2527 2000 136 42931 2776 322 238 1655 --
NM_020807chr1691508 1396 1370 1167 1156 547 375 338 78 --11559 --
NM_020808chr11805 ------
NM_020810chr1423236 24 ----12747
NM_020813chr1992030 1055 914 863 765 669 582 440 328 21961 46 1330 1335
NM_020826chr1122957 22 --11128 --
NM_020830chr242175 710 622 59 22716 719 --1248
NM_020832chr14221 174 121 71 1517 ----
NM_020836chr145268 140 128 95 36 1179 3247 146 77 --
NM_020839chr341536 1256 1129 299 11427 ----
NM_020843chr151110 ------
NM_020845chr12112453 2332 2062 2035 1936 1885 1878 742 383 351 153 1277 21850 1716 21948 1869
NM_020850chr16102927 2767 2753 2453 2392 2038 1230 912 890 133 23166 1193 6883 616 200 198 140 117 12041
NM_020856chr1921382 265 11319 ----
NM_020858chr151369 ------
NM_020861chr62121 51 1492 1127 --
NM_020870chr42653 473 --2484 481 11459
NM_020871chrX21685 992 12121 ----
NM_020886chr1111229 ----11064
NM_020888chr162007 1738 1523 1461 1397 545 1428 21744 1742 11749
NM_020896chr1131020 783 427 --31027 1022 44 11031
NM_020898chr125755 651 639 239 177 1538 3776 743 281 --
NM_020899chr17112033 1700 1662 1607 916 619 427 203 78 69 43 32368 944 219 1350 2653 537
NM_020918chr1033092 168 146 1891 23095 148 --
NM_020919chr21910 ------
NM_020920chr142385 270 ------
NM_020922chrX41787 440 350 343 1104 1670 --
NM_020924chr91354 1484 --1188
NM_020935chr244350 4328 3713 939 ------
NM_020939chr671334 1317 1232 1061 399 155 75 --31383 1234 912 2374 251
NM_020946chr93423 384 249 --6507 368 333 144 141 72 1395
NM_020949chr31110 1196 ----
NM_020951chr1952308 1868 1739 564 93 1389 195 --
NM_020952chr9272 55 ------
NM_020956chr19134411 3659 3106 1618 1540 1479 1405 1295 1135 698 607 575 498 44256 1086 954 305 63276 846 843 583 287 103 14445
NM_020962chr153927 918 745 2678 324 51723 1720 638 562 170 2782 695
NM_020963chr1----1144 --
NM_020964chr1894664 4290 3965 3668 3092 3083 1561 1343 786 23360 436 23670 1370 --
NM_020967chr20239 31 --31057 49 22 --
NM_020971chr194763 676 211 36 --6682 679 611 608 605 38 --
NM_020972chr44885 444 301 168 --1784 --
NM_020974chr11----1497 --
NM_020977chr411412 21660 323 ----
NM_020980chr1551481 1384 688 244 227 1193 ----
NM_020983chr1291927 1895 1870 1579 1481 533 396 350 244 11543 22222 2030 1514
NM_020993chr1282749 2543 2381 2364 1906 536 475 310 1865 52424 1039 734 732 539 --
NM_021012chr1792462 2410 2364 2152 1195 1071 875 839 562 11125 42464 2250 1073 583 11200
NM_021020chr8193015 2852 2613 2573 2305 2178 1266 1210 1123 1070 1033 954 873 387 276 221 160 108 67 --62350 1213 357 315 313 56 33106 3027 322
NM_021025chr5----1383 --
NM_021032chr331634 54 23 11723 140 --
NM_021035chr2031228 537 58 --11123 --
NM_021064chr61575 --21129 1126 --
NM_021069chr441626 389 371 197 --1373 1392
NM_021090chr22164528 4289 4271 1913 1596 1113 1073 994 962 796 703 619 558 531 204 176 2903 504 51500 1376 533 207 185 --
NM_021096chr2263216 2654 1303 1253 1226 674 11030 62935 2861 2859 2328 1256 454 13135
NM_021097chr252573 2430 847 462 251 21159 867 --1475
NM_021101chr341736 938 789 241 2960 874 ----
NM_021115chr222150 50 ------
NM_021120chrX52253 2198 424 112 49 --43097 1991 63 60 --
NM_021135chr6142692 2550 2531 2292 2185 2078 1342 1174 974 758 569 483 205 29 22736 225 ----
NM_021136chr142288 95 --1103 --
NM_021144chr91117 --1124 --
NM_021148chr722292 954 ------
NM_021149chr164238 165 158 50 --1240 --
NM_021155chr19112904 2445 2378 2266 2235 1961 1075 302 146 94 40 32473 1129 439 52238 1855 1214 1171 947 12405
NM_021156chr20152 ------
NM_021159chr451440 1327 1306 148 42 153 ----
NM_021174chr82665 495 --1667 --
NM_021177chr61224 --227 21 --
NM_021188chr142555 489 --1557 --
NM_021189chr141037 979 758 113 --2950 889 11041
NM_021191chr1232543 2450 2377 11676 ----
NM_021192chr23129 66 51 --1275 --
NM_021198chr251448 1213 1168 267 135 1947 91390 1314 1274 1173 496 481 423 225 54 31396 229 138
NM_021215chr2082327 2194 2148 1750 1502 732 541 149 2356 241 11760 11763
NM_021220chr20----173 --
NM_021235chr193123 47 30 ------
NM_021238chr1241964 1829 516 165 2660 379 --11784
NM_021239chr142319 167 ------
NM_021245chr10133 --1193 --
NM_021248chr203165 113 76 --1168 1104
NM_021249chr141130 21432 207 ----
NM_021253chr641379 1346 202 61 11135 11382 --
NM_021260chr1471333 1120 565 526 489 472 110 1138 31349 358 80 --
NM_021267chr193447 100 60 --4318 315 312 122 --
NM_021569chr95953 917 851 296 21 --31115 756 34 3891 832 130
NM_021627chr331016 478 21 --1770 --
NM_021635chr641570 1438 1302 285 --11990 --
NM_021637chrX31098 543 442 ----21101 174
NM_021638chr4154223 3735 3377 3156 3147 1966 1945 1848 1796 1778 1272 1100 898 540 525 41650 1524 1046 152 105048 3715 3469 3256 3254 3190 1930 1039 809 806 25051 1399
NM_021639chr11176 ------
NM_021643chr231791 643 235 --11797 11800
NM_021647chr433428 3420 1754 3888 658 176 ----
NM_021648chr652124 1924 1728 990 48 22726 341 71114 1112 1107 1104 1101 1097 1095 --
NM_021724chr172224 64 --3239 200 194 2227 204
NM_021809chr2052280 2057 1929 182 117 12350 22070 2043 --
NM_021813chr655415 1751 1655 1648 158 --45086 1827 1359 1085 24334 38
NM_021828chr102332 142 --1454 156
NM_021905chr672276 2081 2011 1976 1872 1600 1433 32069 1942 1399 41603 1502 647 50 --
NM_021907chr21103 --3271 231 84 --
NM_021911chr531168 362 39 13812 ----
NM_021912chr1553640 3382 3254 3140 956 --13940 --
NM_021914chr143806 264 99 ------
NM_021923chr451549 1367 1267 1127 221 11178 11269 11069
NM_021939chr17--1300 4527 524 313 93 1506
NM_021943chr652014 1895 1874 1864 1626 ----1551
NM_021945chr6103389 2878 2764 2642 2521 826 793 371 308 273 --32524 279 277 22882 800
NM_021946chrX81332 1301 1050 958 414 192 70 21 --41235 1063 1053 51 21067 940
NM_021947chr171469 ------
NM_021949chrX2496 292 51887 1149 627 254 170 ----
NM_021950chr1152217 2112 1967 1938 1447 11494 ----
NM_021960chr132347 1843 178 12534 ----
NM_021961chr11116615 6047 2790 2750 2707 2036 1961 1752 1596 1100 71 12926 36471 5368 5365 42625 2145 1875 1589
NM_021962chr1751841 1566 845 622 494 2478 351 1465 --
NM_021964chr325570 5300 24953 2527 25373 5367 15376
NM_021973chr43539 193 186 --2195 153 --
NM_021980chr10121 155 ----
NM_021984chrX41406 517 304 33 2128 42 3556 240 170 1173
NM_021987chrX41406 517 304 33 2128 42 3556 240 170 1173
NM_021988chr2041234 1056 408 381 --4625 383 35 29 1579
NM_021990chrX41406 517 304 33 2128 42 3556 240 170 1173
NM_021991chr176570 533 301 212 133 42 1271 1690 --
NM_022003chr1151030 862 803 198 151 3168 140 111 2453 381 --
NM_022036chr173356 328 74 --4136 90 87 84 --
NM_022042chr43369 331 83 1267 4827 761 713 35 --
NM_022048chr15106246 5040 4222 4061 1783 1078 587 376 269 89 45966 4162 1444 235 56248 4064 1643 593 335 26127 2216
NM_022055chr2133 ------
NM_022058chr211509 31719 188 23 ----
NM_022059chr177967 860 771 761 743 702 79 1373 1811 2747 724
NM_022060chr1441317 878 423 53 1434 1904 1427
NM_022062chr11101683 1589 1568 1337 1325 1261 675 598 206 167 11848 21514 1328 31592 1521 122
NM_022064chr3176 ------
NM_022066chr176954 420 290 215 127 84 --164 1812
NM_022067chr143652 225 38 ------
NM_022075chr14360 237 128 60 --3677 658 131 1283
NM_022085chr641256 1182 252 25 ------
NM_022095chr20145 --179 --
NM_022114chr1144347 3727 3617 3596 3230 3153 3130 1896 1866 1607 1461 974 116 106 43103 1096 1060 898 33730 3506 1303 23515 1327
NM_022117chrX2447 200 2543 40 2560 65 1428
NM_022130chr52550 305 ------
NM_022143chr711353 ----11360
NM_022166chr16205813 5169 5067 5009 4928 4727 4484 4296 4253 2397 2103 1952 1766 1442 1413 1332 1014 463 434 118 45061 5047 5037 818 65451 1955 1911 1909 1356 278 --
NM_022169chr11131453 1420 1398 1270 1076 541 525 317 254 243 216 195 116 --51082 986 531 528 119 41405 1232 1221 132
NM_022170chr721475 113 1419 --1239
NM_022336chr262094 1968 1900 1537 500 25 --21902 1869 --
NM_022340chr353320 2345 1466 1280 1162 22573 1117 42407 1164 541 539 --
NM_022351chr833287 3247 1209 ------
NM_022369chr153119 80 63 --383 69 66 --
NM_022442chr2041234 1056 408 381 --4625 383 35 29 1579
NM_022456chr12107419 6787 6407 6046 5196 5096 5069 1968 111 31 13085 14911 --
NM_022457chr11200 --197 --
NM_022458chr752863 2836 2442 918 753 1866 ----
NM_022459chr1386318 5623 4255 4166 4104 1835 613 531 11916 --24171 1313
NM_022462chr19133500 3293 3245 3145 3104 2859 1416 1203 1003 871 863 690 112 13547 103677 3674 3670 3565 2861 2580 1324 523 240 32 23363 36
NM_022465chr12142913 2825 2394 2252 1951 1884 1874 847 775 748 655 527 403 144 31903 710 689 52919 2894 2827 1134 750 52492 2258 1887 990 319
NM_022473chr1544071 3098 1100 79 11719 --23556 906
NM_022474chr1442760 2403 2209 780 1788 12211 --
NM_022475chr41479 ------
NM_022477chr2021421 241 ----1278
NM_022552chr231040 262 251 --31150 991 265 --
NM_022553chr65383 226 177 109 100 --2503 501 --
NM_022557chr172179 168 ------
NM_022572chr2111683 1556 1347 1181 684 639 536 525 291 124 33 11430 61685 1601 1516 1507 407 296 11574
NM_022574chr792212 2181 2150 2133 2121 1942 1844 1445 83 32188 1487 809 72051 2017 1735 1629 1447 1427 1369 11930
NM_022644chr173449 438 184 199 ----
NM_022658chr123369 338 38 --1178 --
NM_022716chr133005 454 196 12320 2202 199 --
NM_022719chr22113908 3880 3066 2837 2638 2621 2483 1478 538 290 278 31359 857 656 ----
NM_022726chr62514 269 11588 1271 --
NM_022728chr7----140 --
NM_022730chr27723 423 299 260 128 113 73 --6837 402 301 181 167 76 2820 189
NM_022737chr1991264 1031 964 944 929 402 356 250 146 1974 31033 254 149 21203 885
NM_022739chr1721227 748 --1106 --
NM_022744chr1621068 249 1400 2429 222 21314 961
NM_022745chr152464 2221 2056 431 67 22915 2850 ----
NM_022748chr721035 476 52697 2035 1114 959 463 12355 --
NM_022749chr831214 952 481 --41414 1375 559 84 11205
NM_022753chr132764 602 188 --1608 --
NM_022755chr942401 1669 891 875 22645 2329 42235 942 894 444 --
NM_022756chr141033 298 277 47 ----2301 113
NM_022758chr6113132 2988 2588 2333 2206 2063 1229 901 717 616 399 1407 42860 2536 2488 2486 22863 2448
NM_022763chr312504 --21197 70 --
NM_022780chr231748 342 320 ------
NM_022781chr943028 2668 675 97 --22310 2308 --
NM_022821chr1177 --2189 137 1394
NM_022822chr115813 652 295 229 142 --5834 773 639 575 355 199
NM_022824chr521701 677 ----11829
NM_022832chr432493 2299 144 32407 2349 1729 1902 185
NM_022841chr15--12668 1994 1987
NM_022893chr2187 --159 265 24
NM_022894chr211320 11619 ----
NM_022898chr1483858 3619 3544 3524 3425 3098 1286 834 13559 23530 3208 13623
NM_022912chr222711 230 12840 3838 201 199 --
NM_022917chr951219 975 947 802 312 1102 ----
NM_022918chr111502 21373 199 ----
NM_022970chr101942 ----1185
NM_022977chrX11690 ------
NM_023000chr142147 22 11225 ----
NM_023001chr142147 22 11225 ----
NM_023004chr22162 ------
NM_023009chr14278 226 190 147 2629 170 3155 153 126 --
NM_023019chr22298 25 --1226 --
NM_023033chr121489 2213 141 ----
NM_023037chr132991 109 --1111 --
NM_023067chr381110 420 411 218 203 188 178 141 11145 2999 243 --
NM_023074chr1931222 951 77 ------
NM_023076chr1622227 855 --22635 53 22524 2405
NM_023079chr1781739 1630 1286 656 501 485 307 91 --81447 1268 663 658 516 93 56 25 --
NM_023105chr871960 1718 272 244 184 94 22 32445 1822 877 31931 175 173 --
NM_023106chr871960 1718 272 244 184 94 22 32445 1822 877 31931 175 173 --
NM_023110chr871960 1718 272 244 184 94 22 32445 1822 877 31931 175 173 --
NM_023111chr871960 1718 272 244 184 94 22 32445 1822 877 31931 175 173 --
NM_023923chr153772 3718 3041 1123 86 --1320 --
NM_023929chr821946 668 1662 ----
NM_023930chr111749 2831 236 1838 --
NM_024003chrX3589 550 119 1211 2713 57 --
NM_024007chr52784 715 12852 11964 1949
NM_024015chr1731075 910 326 ----2992 125
NM_024016chr174595 525 213 140 --4544 542 317 263 1599
NM_024017chr1761476 1449 1212 1144 1059 26 --21452 154 21462 40
NM_024019chr4----4340 337 78 71 1907
NM_024029chr191262 --1275 --
NM_024038chr194227 212 125 85 --3277 273 270 --
NM_024046chr341237 1118 915 321 2427 354 21027 327 2384 108
NM_024061chr7269 35 ------
NM_024085chr22418 85 ------
NM_024086chr1763733 2987 1068 968 653 165 1145 33787 3186 153 13396
NM_024094chr81123 ------
NM_024095chr122270 260 1194 2273 158 1263
NM_024103chr19111853 1689 1581 1530 1383 1349 1275 722 402 249 21 31426 352 31 21695 1692 1536
NM_024104chr191108 2282 58 ----
NM_024107chr175566 332 308 187 51 --1158 1125
NM_024122chrX1236 ------
NM_024293chr24761 283 262 68 ------
NM_024294chr6113132 2988 2588 2333 2206 2063 1229 901 717 616 399 1407 42860 2536 2488 2486 22863 2448
NM_024295chr872042 1556 522 349 271 45 27 11468 1273 1392
NM_024297chr173379 173 79 --1426 --
NM_024306chr1641010 864 450 50 --1822 --
NM_024323chr193393 377 101 ----160
NM_024328chr145681 610 165 111 104 --5221 219 132 77 75 --
NM_024344chr15----1140 1144
NM_024348chr92139 52 --1315 --
NM_024408chr182688 2632 2326 1019 925 593 581 490 --32635 441 438 --
NM_024422chr1831712 746 610 ------
NM_024424chr113322 311 72 --180 --
NM_024425chr113322 311 72 --180 --
NM_024426chr113322 311 72 --180 --
NM_024491chr32421 119 1462 ----
NM_024494chr12215 26 182 ----
NM_024496chr14141 --290 86 166
NM_024507chr162255 22 ------
NM_024511chr442749 694 555 289 1743 1560 --
NM_024522chr141911 1535 1205 85 11323 31783 1331 324 31786 1714 1540
NM_024536chr24402 378 132 54 1369 --157
NM_024540chr1----123 --
NM_024551chr1262448 2181 1717 745 363 63 --12454 --
NM_024551chr1262448 2181 1717 745 363 63 --12454 --
NM_024554chr131357 612 205 11228 21514 208 --
NM_024567chr81227 ----1234
NM_024572chr2144 ------
NM_024594chr551417 1349 1326 1270 1262 21485 547 ----
NM_024595chr11798 1309 ----
NM_024602chr17872 718 679 627 224 76 45 1802 1795 1876
NM_024612chr1711031 ----11034
NM_024626chr131551 1026 593 --1319 --
NM_024631chr11156 ------
NM_024639chr611968 12637 ----
NM_024646chr124001 76 2757 685 ----
NM_024657chrX----260 58 165
NM_024665chr334666 3838 354 --1356 --
NM_024674chr143204 2339 619 145 13062 ----
NM_024676chr12318 166 1840 41114 982 545 216 21143 190
NM_024698chr1161242 1107 1059 505 444 97 1874 11147 1464
NM_024700chr121141 968 ------
NM_024704chr201291 1718 1102 176
NM_024713chr1511092 ------
NM_024742chr1641746 1704 393 204 --11196 --
NM_024749chr111439 32143 524 233 ----
NM_024751chr441979 313 230 162 ------
NM_024761chr9175038 4941 4367 4357 4013 3874 3645 3587 3545 2125 1705 1084 1077 1020 587 577 43 24286 151 21062 595 --
NM_024770chr286283 5687 5656 4918 4798 2223 1905 399 1509 14861 1759
NM_024779chr1281608 1601 1336 1167 1028 477 223 212 21330 1061 51486 1484 1480 1283 1020 1274
NM_024811chr1191912 1808 1619 1558 600 374 180 97 52 41889 1628 393 106 1122 --
NM_024830chr581963 1859 804 732 713 698 227 89 1299 ----
NM_024857chr171292 ------
NM_024874chr181259 1112 1101 1018 854 417 314 55 2861 160 5967 472 274 269 266 --
NM_024881chr1983022 2936 2392 1219 1046 739 583 119 2747 319 141 --
NM_024887chr141319 863 535 356 1212 81587 1442 1358 807 691 525 522 58 1571
NM_024889chr10141223 1212 1161 1101 730 701 686 671 657 643 616 601 586 325 171 11176 61199 1184 1148 1133 717 632
NM_024896chr951879 1564 718 446 60 ------
NM_024909chr6111570 1555 1547 1437 1409 1321 1102 601 519 491 484 21418 1226 61473 562 524 460 458 421 11558
NM_024927chr17125 ------
NM_024939chr1641038 574 463 55 2179 157 1455 --
NM_024944chr211907 --1123 --
NM_024947chr3119135 8967 8954 8685 7556 3066 2659 2324 2085 1141 362 28158 3547 16881 --
NM_024949chr434168 4126 4003 11215 14895 --
NM_024953chr1232462 278 57 ----12252
NM_024954chr102424 253 --2491 100 --
NM_024971chr9272 55 ------
NM_024991chr1021027 265 2540 516 2436 271 --
NM_025027chr1921145 987 1111 1242 --
NM_025057chr142270 150 --1152 --
NM_025058chr111777 681 605 555 548 209 145 131 105 94 36 --1557 197
NM_025061chr19--1961 2389 316 1431
NM_025076chr2----1169 --
NM_025083chr1581821 1498 1488 1433 630 495 412 35 1424 61832 1823 620 618 532 414 11885
NM_025115chr8140 ------
NM_025129chr19----3202 163 161 --
NM_025133chr21999 ----11003
NM_025134chr1621930 1811 --11933 --
NM_025140chr121557 --2453 421 --
NM_025146chr342096 1888 104 68 12585 1106 22640 72
NM_025151chr842126 1863 775 114 21589 381 11448 1117
NM_025160chr163310 1564 1457 1444 1293 879 33791 2840 235 21299 1297 --
NM_025164chr1141822 1615 479 102 11405 31824 788 444 --
NM_025179chr1104722 4209 3315 3264 3060 3009 480 456 145 111 44694 3651 3298 473 64600 4484 4437 3550 3188 149 33554 1817 961
NM_025182chr95831 741 423 307 207 1923 2747 414 --
NM_025187chr1661341 1328 1300 1225 550 525 ------
NM_025222chr352933 928 799 465 129 1981 ----
NM_025224chr2092207 2177 2149 1923 1678 1486 932 724 113 21814 1459 32070 453 122 1459
NM_025230chr1431188 161 68 --259 56 1700
NM_025236chr64680 673 632 308 3566 266 71 2683 232 2748 235
NM_025237chr173986 393 21 --1990 --
NM_025248chr17113269 3197 3188 555 388 370 311 144 97 57 33 22961 339 73190 2075 2072 607 449 379 59 140
NM_025251chr881047 812 471 452 433 392 340 147 --4481 477 475 70 1124
NM_025256chr6156 1237 2108 23 --
NM_025261chr6_qbl_hap24372 155 142 74 1405 397 56 28 --
NM_030576chr1772535 2468 1721 1669 910 397 175 --3674 669 250 2362 300
NM_030594chr1531327 1016 100 --11215 --
NM_030621chr1463368 3340 1395 1107 932 418 ------
NM_030623chr231403 1191 33 1622 --11426
NM_030627chr543174 3167 984 889 2661 440 ----
NM_030629chr1661859 1720 1432 1386 1216 614 --31438 1394 1392 --
NM_030634chr162309 2244 2087 883 472 100 1328 --1185
NM_030640chr121232 1326 1870 --
NM_030645chr161013 468 121 106 95 76 1344 4971 315 189 183 1984
NM_030647chr784754 4557 3915 1990 722 710 78 28 35078 1983 811 24761 4756 --
NM_030648chr465200 5182 4887 4779 1687 918 ----14312
NM_030651chr65773 699 656 555 335 144 1781 1560
NM_030661chr751626 1552 249 153 36 --31632 1396 38 --
NM_030664chr1042358 1710 958 298 2500 275 ----
NM_030674chr12114290 4029 3889 3878 3867 1386 1292 872 764 301 181 35603 4554 1488 24687 1247 35113 3893 1304
NM_030761chr142562 708 450 189 52661 1759 955 810 71 32223 2194 2096 21900 1036
NM_030784chr6175 ------
NM_030786chr121888 1723 --11725 --
NM_030802chr174681 97 70 58 4756 653 289 252 ----
NM_030806chr1209219 9171 8604 8428 8349 8245 7879 7745 7384 7182 6400 3457 3268 3160 2091 877 721 435 428 328 37059 2548 786 68324 7747 7435 1880 1030 1028 --
NM_030808chr1731041 733 392 11092 --2395 38
NM_030809chr1242463 2116 950 708 21749 616 11740 21826 374
NM_030810chr641256 1182 252 25 ------
NM_030881chr2292242 2233 1979 1778 1686 791 639 630 128 --2641 287 --
NM_030884chr3171830 1758 1702 1578 657 540 534 368 350 341 292 182 166 63 54 43 32 22154 2142 71705 626 624 80 69 56 34 --
NM_030913chr16268 261 217 174 129 112 --1527 1309
NM_030914chr98782 672 256 224 108 91 83 60 1122 4924 921 851 131 1786
NM_030915chr2112195 1930 1872 1819 1759 1703 1517 953 796 774 540 --31881 1706 877 --
NM_030918chr1145076 4981 4675 4253 3436 2124 1400 1123 832 741 538 509 161 97 45018 4277 4212 1727 44790 4096 4094 1330 13440
NM_030920chr121403 792 --1810 --
NM_030923chr2----1226 --
NM_030926chr26927 906 713 156 138 128 --277 71 --
NM_030935chr74338 294 155 135 ------
NM_030939chr61342 ------
NM_030948chr6------185
NM_030952chr141021 907 386 77 1921 11276 2320 80
NM_030958chr82202 192 ------
NM_030962chr112208 131 ------
NM_030964chr5103563 2681 2408 1060 695 648 636 361 345 125 32578 2554 178 41381 371 367 363 1508
NM_030981chr11101136 1038 1020 971 884 843 390 349 316 130 1818 4809 84 82 78 --
NM_031216chr1831681 1509 80 11637 41693 1690 1687 1684 2107 87
NM_031231chr20----2101 48 --
NM_031232chr20----2101 48 --
NM_031266chr51150 1135 ----
NM_031289chr123970 944 56 1737 ----
NM_031309chr881481 1470 745 678 454 399 344 104 2693 248 52219 1755 589 223 218 1390
NM_031314chr1441479 367 136 120 1742 21925 87 190
NM_031372chr421368 473 ------
NM_031407chrX----1183 1151
NM_031411chr52285 210 12060 1264 160
NM_031426chr9112206 2195 2104 1780 1023 336 311 234 218 203 29 12167 41071 227 208 45 --
NM_031432chr931024 242 30 --11027 --
NM_031439chr871463 1259 1230 183 157 93 41 41545 1326 271 247 --1189
NM_031445chr283313 2390 2128 1272 853 409 387 75 12403 --1254
NM_031450chr117565 487 249 232 145 68 57 --133 --
NM_031468chr7197959 7533 7449 7390 6921 6645 6552 3029 2649 2547 1995 1918 1853 1739 1629 1601 882 849 390 55583 2944 737 514 73 31603 1516 885 47616 2253 2096 1095
NM_031469chr612768 ----1875
NM_031477chr163351 278 66 --1314 --
NM_031478chr162571 462 2687 615 2187 24 --
NM_031483chr2032409 2360 482 1152 1484 --
NM_031492chr112180 77 --1543 --
NM_031844chr133588 3545 1250 32655 1507 849 41551 1262 1256 349 --
NM_031845chr211375 --21033 925 --
NM_031847chr211375 --21033 925 --
NM_031849chr52285 210 12060 1264 160
NM_031857chr52285 210 12060 1264 160
NM_031860chr52285 210 12060 1264 160
NM_031866chr1031044 389 323 1223 4753 751 391 245 1947
NM_031886chr1952450 2361 2271 1019 36 2451 418 ----
NM_031890chr22112467 2391 2252 2164 2008 1212 956 700 583 341 213 22080 1103 52634 2173 2146 959 656 --
NM_031911chr432328 1733 1726 ------
NM_031935chr11246 ------
NM_031953chr4----1120 --
NM_031954chr1291050 995 910 895 450 380 97 46 28 32701 796 473 --1927
NM_031992chr721475 113 1419 --1239
NM_032012chr933577 1812 630 24765 511 14315 --
NM_032013chr2021421 241 ----1278
NM_032017chr1111834 1764 1515 1379 1336 1288 734 715 616 480 377 11453 101867 1600 1385 1382 848 783 670 439 433 97 3584 450 344
NM_032028chr51162 --2134 132 1232
NM_032040chr191265 --135 --
NM_032041chr852449 2350 394 136 112 41915 1864 512 457 1529 1539
NM_032042chr542132 411 107 56 --2610 385 12514
NM_032051chr222478 236 --2646 119 --
NM_032052chr222287 267 2912 548 ----
NM_032088chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_032092chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_032104chr1130 ----137
NM_032105chr1187698 7110 6979 6960 6813 6798 6588 5332 5057 2860 2121 2111 1831 1737 990 763 737 30 67364 7238 6631 6606 6023 1038 66815 6802 5653 2124 1739 1050 67766 7020 6694 852 767 37
NM_032108chr193983 884 110 --2897 178 1972
NM_032109chr591188 488 434 316 299 244 228 221 143 1443 4462 424 347 191 1147
NM_032120chr71112 ------
NM_032121chrX42569 1797 760 227 1897 2594 591 12059
NM_032139chr192721 193 1403 2342 339 --
NM_032153chr342731 2279 2148 721 12222 ----
NM_032154chr101289 ------
NM_032160chr1871540 1518 1503 874 756 738 204 11316 1321 33347 2870 2691
NM_032174chr151188 490 288 200 146 11002 --1232
NM_032181chr22747 242 ------
NM_032182chr1031583 1431 1215 ------
NM_032192chr173709 701 532 3681 231 53 2552 93 --
NM_032195chr211194 ------
NM_032199chr1033513 433 215 21348 608 ----
NM_032204chr22176 --2325 243 --
NM_032207chr1951255 1052 1033 800 59 ------
NM_032208chr223433 939 ------
NM_032217chr41244 1183 1250 --
NM_032242chr3143198 3058 2922 2826 2267 2163 2106 1082 925 918 880 823 743 385 12153 72912 2833 2829 2546 671 140 136 --
NM_032246chr154456 116 87 55 169 1105 --
NM_032268chr16133251 2871 2601 2199 2126 662 569 535 492 355 158 151 26 --3571 472 223 11087
NM_032281chr19122941 2831 2813 2709 2523 2510 2148 1207 410 221 209 32 12669 62583 2581 2558 2556 2531 2529 11156
NM_032283chr171713 1587 1536 1374 525 177 68 --1705 --
NM_032291chr111630 21348 153 ----
NM_032294chr1741840 1548 1539 227 ----1130
NM_032298chr191454 ----140
NM_032312chr21939 ------
NM_032316chr342439 2325 2199 1534 21511 464 --21998 332
NM_032320chr11157 ------
NM_032325chr1151365 1287 517 236 119 21905 1859 --1598
NM_032345chr124392 179 169 157 2403 141 --1160
NM_032352chr1421242 992 ------
NM_032353chr171380 177 3353 350 347 --
NM_032364chr1251005 747 645 195 77 1215 181 185
NM_032375chr192788 229 1117 ----
NM_032379chr11------124
NM_032387chr17127 --1245 130
NM_032389chr1121166 216 2345 313 31070 990 759 11084
NM_032403chr52646 483 21397 1365 91653 1487 718 503 361 357 176 132 39 1316
NM_032408chr73997 990 139 --31113 160 141 --
NM_032410chr81151 ------
NM_032420chr53282 260 79 3367 198 159 5758 235 219 183 181 133
NM_032430chr193404 373 349 --3376 365 362 --
NM_032431chr112982 226 1139 2300 83 --
NM_032434chr251042 274 174 154 131 --2251 182 21364 1226
NM_032445chr1542120 1929 1601 900 --22294 1603 --
NM_032449chr141091 844 526 515 --32100 716 528 --
NM_032452chr14101451 1305 1247 1227 1150 623 513 489 223 77 1552 51454 1443 1312 1308 1074 21353 229
NM_032458chrX3988 288 261 ------
NM_032499chr15----4427 423 421 362 --
NM_032510chr1822085 38 ----12075
NM_032511chr6144 1382 ----
NM_032550chr101482 ------
NM_032552chr941504 1244 787 170 11657 61859 1856 1795 1685 159 107 1281
NM_032560chr141216 ----161
NM_032569chr1651841 1787 1366 429 36 1477 41475 792 440 168 --
NM_032575chr1671950 1440 512 460 399 306 281 22025 247 71531 1358 1349 714 711 418 296 41363 363 328 311
NM_032576chrY194 ------
NM_032580chr173398 368 214 1380 ----
NM_032581chr741896 1307 237 212 122 1132 --
NM_032582chr171203 ------
NM_032595chr1761367 1293 1180 466 400 53 11120 71185 474 472 118 85 60 56 41172 549 373 142
NM_032622chr411488 ------
NM_032632chr1441621 1545 813 130 11434 21498 817 --
NM_032638chr351215 493 484 399 124 1171 ----
NM_032645chr11128 --2158 143 --
NM_032673chr2----131 --
NM_032682chr323304 2961 --21268 1170 --
NM_032711chr17123939 3826 3757 3073 3045 2787 2759 1120 385 124 97 72 13472 43323 2833 2827 100 1109
NM_032741chr65923 405 123 102 44 --5875 270 109 104 23 --
NM_032758chr222146 22 --2150 25 --
NM_032772chr102209 194 --1188 --
NM_032778chr321087 130 ----1499
NM_032781chr114773 396 101 92 --2119 104 --
NM_032786chr122178 102 --122 181
NM_032789chr8266 33 --1118 --
NM_032800chr192628 2613 2512 2296 2276 1963 810 375 300 12468 32404 1709 382 1972
NM_032808chr155764 140 123 84 74 --2125 93 --
NM_032826chr775106 4488 3775 1616 1223 612 566 34442 537 420 24878 3366 --
NM_032829chr1251061 1001 450 436 199 ------
NM_032832chr641094 592 447 415 --1389 --
NM_032836chr1961029 957 923 891 799 689 --21033 652 --
NM_032839chr31379 ------
NM_032840chr1281157 1141 1026 975 810 296 73 30 1305 3884 880 733 1402
NM_032875chr172567 70 --1707 --
NM_032876chr143674 556 378 --1558 1569
NM_032906chr42726 190 ------
NM_032918chr1231113 119 56 --145 11116
NM_032943chr11------124
NM_032960chr141475 419 309 98 11153 41396 1349 948 104 21399 1293
NM_032961chr42282 237 ------
NM_032968chrX64087 3509 3292 2626 524 232 ----12629
NM_032969chrX64087 3509 3292 2626 524 232 ----12629
NM_032973chrY64079 3505 3287 2625 524 232 ----12628
NM_032975chr1843259 2680 1126 27 11057 12428 12864
NM_032980chr1843259 2680 1126 27 11057 12428 12864
NM_032982chr772138 2079 1961 1905 1671 917 431 32423 319 122 31850 934 841 12141
NM_032983chr792952 2893 2775 2719 2485 1245 826 478 280 43237 2352 1133 936 12664 12955
NM_032998chr12828 170 1161 41049 896 747 194 1904
NM_032999chr71807 ------
NM_033000chr71807 ------
NM_033001chr71807 ------
NM_033016chr2271511 1489 1343 621 563 263 96 --41399 340 189 143 11360
NM_033018chrX5880 866 823 134 80 11100 11093 --
NM_033020chr154199 3722 3499 3349 761 13647 44511 4508 3662 432 --
NM_033023chr73987 866 518 --21094 108 --
NM_033027chr33725 296 67 190 2775 211 --
NM_033036chr1171134 669 452 419 231 143 118 2591 480 31478 400 398 --
NM_033044chr11861 ------
NM_033058chr81102 ------
NM_033071chr61280 ----1131
NM_033082chr12149 ------
NM_033089chr2061077 935 326 304 237 46 --2503 347 21136 510
NM_033102chr14988 951 185 54 31088 1072 1055 21004 196 1479
NM_033102chr14988 951 185 54 31088 1072 1055 21004 196 1479
NM_033129chr20101770 1703 1461 1396 530 325 233 203 152 38 2551 469 101975 1972 1711 1709 1558 1503 1480 1332 327 299 22016 194
NM_033133chr1783733 3115 2598 1359 1297 979 612 158 23720 1515 63519 2621 2617 1361 725 178 --
NM_033136chr561221 691 592 541 463 159 1572 1161 --
NM_033137chr561221 691 592 541 463 159 1572 1161 --
NM_033147chr21103 --3271 231 84 --
NM_033148chr21103 --3271 231 84 --
NM_033150chr122321 149 --1151 --
NM_033161chr951627 1462 471 387 100 --31336 389 106 1246
NM_033201chr165464 355 275 212 89 1412 --2482 279
NM_033211chr51785 ------
NM_033224chr787545 6849 6222 2937 2466 911 242 45 25416 2765 ----
NM_033225chr852610 2312 1287 1111 957 2775 374 32858 576 85 --
NM_033226chr16184 1725 ----
NM_033228chr52430 223 ------
NM_033244chr1571160 1095 389 198 118 103 88 ----1882
NM_033254chr31584 ------
NM_033259chr31736 1897 2592 331 --
NM_033267chr53602 194 48 --1563 --
NM_033274chr5153343 3136 3000 2911 2352 1377 1079 1046 822 584 424 408 166 146 22 1939 63181 3115 824 810 596 106 33349 287 118
NM_033278chr114344 332 283 262 1291 1137 --
NM_033285chr863194 1579 1089 824 804 317 34016 1166 574 --11198
NM_033290chrX31205 1017 156 13023 --1929
NM_033300chr111236 --1481 1486
NM_033309chr1631013 271 84 1840 ----
NM_033312chr1158 ------
NM_033315chr1782207 2072 2018 1381 666 645 491 451 --41992 1809 1785 1389 21815 1638
NM_033326chr1122299 51 11822 22302 1902 --
NM_033331chr982911 2755 2709 2674 2419 1072 923 852 12743 33093 2758 2299 --
NM_033334chr9121 ------
NM_033360chr121972 --34224 4222 703 --
NM_033375chr1761416 1342 512 464 446 147 1130 4467 58 55 52 --
NM_033387chr9101968 879 862 852 644 459 333 256 154 109 22544 985 4854 764 762 448 --
NM_033389chr1774689 4618 4455 4073 3161 838 408 14140 1807 11004
NM_033396chr112117 21 --1181 --
NM_033419chr17121546 1323 1224 1171 1164 1015 601 504 413 307 64 58 --31205 322 66 1440
NM_033420chr194986 955 429 241 --2463 356 1406
NM_033425chr1133397 1346 44 --11348 --
NM_033429chr1582877 2824 2515 2125 2111 903 332 300 --126 --
NM_033430chr411188 24018 1546 ----
NM_033437chr411188 24018 1546 ----
NM_033449chr551876 1677 1425 675 151 52146 1494 1365 731 323 21878 1640 11461
NM_033496chr103486 204 31 1253 1489 --
NM_033497chr103486 204 31 1253 1489 --
NM_033498chr103486 204 31 1253 1489 --
NM_033500chr103486 204 31 1253 1489 --
NM_033503chr1573855 3612 2762 2509 2386 1428 1247 22604 1177 42572 2390 1256 1032 23028 2400
NM_033505chr285642 5617 5437 4560 4308 2441 720 521 21026 59 25633 931 --
NM_033512chr882965 2064 1196 1167 1147 1004 862 254 32299 1139 337 31211 1170 1150 --
NM_033540chr3------11006
NM_033551chr572940 2664 1333 863 672 549 196 --73170 3168 869 650 641 402 201 --
NM_033624chr122342 194 1797 --21665 170
NM_033626chrX3689 458 407 21754 511 1395 --
NM_033631chr1103529 3473 3330 984 791 680 510 432 411 240 21376 998 23921 974 1217
NM_033632chr421426 48 --158 --
NM_033637chr1083418 3328 3145 1499 735 655 556 479 23430 1395 73991 3822 3808 1529 1502 286 276 2904 668
NM_033642chrX--1989 --1335
NM_033644chr542074 1817 1660 187 2691 250 1213 --
NM_033645chr542074 1817 1660 187 2691 250 1213 --
NM_052818chr1322039 1844 ------
NM_052834chr1862494 2459 2224 903 855 744 --12007 --
NM_052837chr12230 181 --1105 --
NM_052840chr1551515 1458 1111 567 88 --11606 1583
NM_052845chr1272922 2649 2326 2163 2086 219 33 --22629 900 1211
NM_052851chr1322130 495 --22132 686 --
NM_052854chr118518 475 455 257 201 167 132 105 1430 1457 --
NM_052868chr1162 --3182 87 85 --
NM_052876chr19152622 2594 2396 2272 2119 1852 1689 1648 1020 877 647 627 342 256 89 22423 157 72510 2498 2399 1858 1856 869 35 11998
NM_052879chr1263696 1236 1224 825 814 38 --11238 --
NM_052880chr223914 482 342 --1111 1334
NM_052885chr1231816 978 592 ------
NM_052896chr152160 1991 1974 1957 342 2424 60 62529 2057 1996 1962 1937 83 --
NM_052897chr124682 652 589 113 1265 3684 655 142 1296
NM_052898chr841874 1378 504 237 --1256 --
NM_052899chr571004 890 875 628 242 80 48 --1192 1634
NM_052900chr811720 1693 ----
NM_052901chr941567 1196 531 397 ------
NM_052905chr21157 ------
NM_052906chr22154979 4935 4774 4533 4492 4435 4044 3557 3374 1860 1248 1176 986 593 442 55003 4258 4238 3599 586 74995 4784 4780 4690 3856 3612 1698 --
NM_052910chr1371730 1626 1497 1450 1342 426 399 11404 1182 21815 52
NM_052918chr1032603 1064 1015 12276 52616 884 435 433 428 --
NM_052925chr197972 856 765 736 714 706 664 --131000 998 989 984 891 887 883 862 771 722 718 672 669 --
NM_052926chrX11047 --128 --
NM_052927chr5------11815
NM_052934chr191858 1834 1426 767 701 555 158 145 130 1110 51747 772 148 138 136 21750 502
NM_052936chrX1260 --1196 --
NM_052939chr13151 83 60 1176 1153 --
NM_052978chr14199 11788 11238 --
NM_053016chr9117317 7157 7093 7048 5833 5821 5302 5199 2859 200 43 17017 37079 4933 1037 35592 4893 1353
NM_053023chr11112793 2700 2156 1023 648 577 562 321 179 171 164 --4620 405 193 181 12364
NM_053024chr321001 137 --2334 176 --
NM_053025chr33707 543 529 1454 1419 --
NM_053026chr33707 543 529 1454 1419 --
NM_053027chr33707 543 529 1454 1419 --
NM_053028chr33707 543 529 1454 1419 --
NM_053031chr33707 543 529 1454 1419 -