TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-570-3p
miRNA Sequence: CGAAAACAGCAAUUACCUUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43402 3393 1034 652 --13314 1222
NM_000109chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_000112chr585557 5497 5333 4465 4416 4205 503 307 1542 45291 4244 1698 869 --
NM_000161chr1421818 1450 --31458 577 386 1626
NM_000163chr542107 784 698 663 ----1311
NM_000168chr783013 2779 2763 1322 475 463 368 70 1689 2488 80 12080
NM_000176chr533722 122 94 13438 13297 1111
NM_000208chr192504 495 --24673 277 1327
NM_000210chr272299 1711 1653 1614 1585 1439 361 --12309 22228 1880
NM_000216chrX84014 2914 2650 1587 1368 1070 974 313 23536 3129 43383 2847 1190 470 1265
NM_000248chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_000252chrX41195 1079 568 249 --1603 11243
NM_000259chr1544376 4342 2255 1008 66249 5996 2278 1690 1596 1440 15587 --
NM_000264chr963143 3129 2412 2268 1188 674 12757 23286 2329 --
NM_000304chr172345 325 --21067 331 --
NM_000314chr1042488 2129 1128 146 11004 22328 894 13041
NM_000332chr6127140 7073 6807 6678 6406 6368 6162 5988 5134 4374 2243 1794 21955 1576 55273 4385 2484 2472 1495 14773
NM_000333chr33365 287 151 1916 51112 1043 304 293 102 --
NM_000340chr321102 106 --21496 1368 157
NM_000346chr1741899 1538 1278 119 --51480 1391 125 107 99 --
NM_000390chrX31158 925 513 13420 1592 11025
NM_000397chrX42397 2127 1658 124 1418 --12374
NM_000408chr233097 768 263 --23333 1371 43187 2993 2940 914
NM_000411chr2173167 2395 2109 1300 980 161 149 1296 13220 2500 139
NM_000430chr1763701 3124 1508 1191 876 594 --53755 2528 982 885 347 11080
NM_000448chr1153042 2865 2522 2313 29 1379 --23205 1184
NM_000461chr344524 4441 3505 1672 --13096 14373
NM_000489chrX72491 2327 2298 2273 2181 2172 952 --21347 1161 32567 2524 246
NM_000495chrX2825 27 1421 11121 1849
NM_000523chr22357 259 2430 237 1131 1252
NM_000555chrX87308 6649 6221 6119 2985 2906 2039 1175 37249 1390 107 26697 4761 26741 901
NM_000599chr233935 725 235 --34215 4194 1011 24329 3838
NM_000610chr1152953 2854 2097 921 152 12863 71927 894 887 880 874 576 144 12224
NM_000618chr1264871 4598 2326 2072 726 455 --55099 4409 4403 2573 892 14878
NM_000618chr1264871 4598 2326 2072 726 455 --55099 4409 4403 2573 892 14878
NM_000633chr1864966 4941 4821 3440 1895 1833 34920 4085 1184 14997 23719 1842
NM_000719chr1296240 1880 1798 1673 1536 884 777 765 709 ----1853
NM_000788chr41114 1105 41219 1078 960 187 --
NM_000809chr478769 6812 6013 1584 1503 1289 1277 78341 7448 6990 6422 5717 1414 987 58921 5929 2153 1720 184 21648 65
NM_000811chr51656 --3776 58 42 1533
NM_000814chr1543966 596 429 314 172 13869 23342 580
NM_000826chr442323 855 517 207 11963 --12116
NM_000828chrX11872 --31690 875 545 21822 1707
NM_000868chrX22389 2137 ----2774 118
NM_000875chr1556756 6491 5552 2600 2448 26184 5577 26906 1507 16538
NM_000891chr1743219 3129 436 247 1241 32425 651 260 33231 2456 344
NM_000899chr1234003 2845 181 22936 1498 13846 13957
NM_000935chr321123 790 --1805 11174
NM_000950chrX42538 879 653 133 22272 1208 63638 3166 2440 2232 716 469 --
NM_000959chr133747 2750 2628 --43065 2886 666 194 --
NM_000990chr1153824 3645 3633 932 417 13775 --14050
NM_001001323chr1212448 --11267 22839 2442
NM_001001330chr102527 505 1253 1869 1149
NM_001001331chr372303 1687 922 475 389 368 250 --22278 407 12690
NM_001001389chr1152953 2854 2097 921 152 12863 71927 894 887 880 874 576 144 12224
NM_001001390chr1152953 2854 2097 921 152 12863 71927 894 887 880 874 576 144 12224
NM_001001391chr1152953 2854 2097 921 152 12863 71927 894 887 880 874 576 144 12224
NM_001001392chr1152999 2900 2143 967 198 12909 71973 940 933 926 920 622 190 12270
NM_001001396chr133288 3273 2845 23249 1170 33979 2832 756 --
NM_001001419chr584406 3995 1786 1010 580 472 384 44 1872 35208 2038 1754 --
NM_001001420chr584406 3995 1786 1010 580 472 384 44 1872 35208 2038 1754 --
NM_001001433chr2093010 2987 2862 2808 2373 2072 2021 1282 188 1427 32944 2598 194 --
NM_001001481chr873094 2204 1253 1235 1143 1049 632 22894 384 13381 12887
NM_001001484chr1032168 2153 658 11554 41990 1528 868 293 --
NM_001001549chr722561 2351 12705 --21763 417
NM_001001550chr722561 2351 12705 --21763 417
NM_001001555chr722561 2351 12705 --21763 417
NM_001001557chr822083 1656 1495 1273 21545 1340
NM_001001890chr2123392 687 33266 1019 544 2698 678 13428
NM_001001938chr923154 115 11068 21612 634 1369
NM_001001974chr1042067 1588 1497 925 21629 94 1903 --
NM_001002860chr1473897 3412 3076 1833 1311 535 129 24631 1577 54450 3906 3358 1534 179 11404
NM_001002926chr731970 1938 460 127 22106 667 167
NM_001003652chr18108691 7564 6937 6306 6150 2311 1658 1327 1048 658 38461 6249 2840 66125 3448 2807 2767 675 665 11224
NM_001003674chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_001003675chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_001003712chr1243953 3669 2672 629 13508 41593 1349 886 805 11236
NM_001004065chr953892 3442 3048 2618 2607 14011 23821 2507 12880
NM_001004317chr654238 3829 749 435 183 21021 553 13700 34346 4252 827
NM_001005242chr1221240 386 --21629 560 1542
NM_001005386chr262304 2188 1650 898 683 559 --31990 1640 777 --
NM_001005404chr1754349 3887 3721 3653 3301 34531 3778 3542 54355 4225 3601 3187 1141 24409 3295
NM_001005473chr544633 4042 2420 1183 14191 44594 4332 675 262 14796
NM_001005861chr331014 909 223 1306 3983 920 667 --
NM_001006600chr522388 884 32139 764 227 2426 270 22021 626
NM_001006657chr213186 --53013 1056 1019 264 231 22091 806
NM_001007024chr1744301 3039 2897 291 1239 24279 191 1212
NM_001007025chr1744301 3039 2897 291 1239 24279 191 1212
NM_001007097chr9105048 4132 4051 3551 3499 1827 1573 1472 785 123 24732 1084 14944 --
NM_001007257chr131143 547 375 --41407 945 541 315 --
NM_001007278chr1364332 4311 4292 2077 1316 25 44057 2018 2004 948 23355 938 15204
NM_001007466chr653495 1873 1766 1752 994 --84937 4705 1587 1581 1575 1568 1555 1542 13646
NM_001007559chr1861926 1596 1430 746 530 106 --31624 1610 1604 --
NM_001008239chr1873708 3467 3154 2676 1336 1327 346 23669 1451 43803 1348 1342 1317 13648
NM_001008392chr31145 --32535 858 151 22561 2378
NM_001008393chr472882 2372 2241 1051 327 148 139 12088 32928 2342 2070 12306
NM_001008408chr7105840 5509 4948 4749 4523 4232 4054 2188 260 249 1379 36201 926 824 1267
NM_001008495chr882178 1914 1869 1760 1728 1536 461 263 22266 123 21510 253 11904
NM_001008539chr875280 5251 5127 4403 1755 1056 311 --13421 --
NM_001008801chr191279 62004 801 550 466 196 111 21761 1468 21897 1637
NM_001008925chr483501 902 742 730 717 428 399 290 13224 ----
NM_001009183chr143397 352 326 --1343 --
NM_001009554chr433494 3124 419 14039 33949 3365 2984 13442
NM_001009554chr433494 3124 419 14039 33949 3365 2984 13442
NM_001009899chr346300 3972 1822 1322 31638 198 121 14722 14004
NM_001009909chr1153464 3212 3022 1491 729 --23334 2689 --
NM_001009959chr2----32464 2079 1725 11816
NM_001009993chr224313 208 24567 554 24285 1031 1837
NM_001010000chr1813444 13265 33274 2678 2451 13319
NM_001010853chr672949 2883 2236 2150 1235 521 428 --22925 83 --
NM_001010888chrX54412 3886 822 720 378 13369 --13519
NM_001010895chr961963 1897 351 321 104 44 --1414 --
NM_001011537chr342186 2050 352 139 --12316 11880
NM_001011666chr7115862 5414 4305 2556 2546 2519 2412 1750 669 606 241 --34980 2310 1958 24130 862
NM_001011713chr1461594 1259 1222 615 413 194 --11001 11415
NM_001012393chr1144054 3362 3129 1305 --63297 2072 1244 135 124 100 14114
NM_001012418chr61667 --34217 1393 691 13172
NM_001012420chr1532818 2546 930 --12056 1359
NM_001012423chr1532818 2546 930 --12056 1359
NM_001012754chr1341956 1859 1844 1347 11490 22097 130 11770
NM_001012761chr561986 1066 817 233 213 24 12512 --1169
NM_001013620chr12178142 7505 7382 7374 7238 7153 7098 6432 6397 6207 6077 3169 2525 1617 394 290 130 --48025 7441 5438 2830 28475 235
NM_001014380chr1394962 4784 4539 4395 3935 1876 1487 342 107 24030 1322 25812 1098 2929 761
NM_001014797chr1057387 6829 5197 1472 1157 1770 25741 496 --
NM_001015048chr1473012 2931 1045 987 752 516 32 32970 2124 254 23121 618 --
NM_001015049chr1473012 2931 1045 987 752 516 32 32970 2124 254 23121 618 --
NM_001015877chrX42473 2148 1046 156 1749 52479 2168 2047 1068 73 1973
NM_001017395chr373478 2293 1027 863 725 195 87 12430 1139 22619 922
NM_001017440chr738273 5882 1678 --58185 7426 2468 2153 231 11314
NM_001017930chrX61454 1334 1321 1222 1209 280 1592 1116 --
NM_001017999chr122167 316 1736 4527 363 357 351 --
NM_001017999chr122167 316 1736 4527 363 357 351 --
NM_001018000chr122167 316 1736 4527 363 357 351 --
NM_001018000chr122167 316 1736 4527 363 357 351 --
NM_001018001chr122167 316 1736 4527 363 357 351 --
NM_001018053chr141713 1688 1629 603 ----11236
NM_001018067chr195387 4807 4532 4379 1874 1667 1347 861 149 25254 3849 1367 21639 237
NM_001018068chr195387 4807 4532 4379 1874 1667 1347 861 149 25254 3849 1367 21639 237
NM_001018069chr195387 4807 4532 4379 1874 1667 1347 861 149 25254 3849 1367 21639 237
NM_001018074chr533722 122 94 13438 13297 1111
NM_001018075chr533722 122 94 13438 13297 1111
NM_001018076chr533722 122 94 13438 13297 1111
NM_001018077chr533722 122 94 13438 13297 1111
NM_001024094chr533722 122 94 13438 13297 1111
NM_001024649chr522707 517 1410 22957 880 1290
NM_001024688chr84754 729 229 112 21544 666 21795 788 2513 187
NM_001024948chr133175 2764 1146 11130 33254 1165 268 --
NM_001024956chr1155655 5428 4770 1220 488 ----35777 4588 1314
NM_001025076chr1095462 4234 3911 3818 2027 1501 1174 645 549 1523 55921 5879 4037 1299 1051 --
NM_001025077chr10136820 5592 5269 5176 4710 2859 2532 2003 1907 1322 656 568 254 34636 1881 669 67279 7237 5395 2657 2409 1395 --
NM_001025079chr383840 3813 3436 2817 2723 2639 1248 239 1166 32845 2832 696 13609
NM_001025108chr253936 1331 1266 835 57 14126 33049 1344 1277 --
NM_001025201chr2250 31 1653 1145 1570
NM_001025248chr155830 192 87 79 65 --21283 226 --
NM_001025249chr155830 192 87 79 65 --21283 226 --
NM_001025580chrX73921 3091 2996 461 370 251 198 1430 74055 3747 3738 611 482 351 310 --
NM_001029858chr643146 2770 2392 350 --148 23392 2286
NM_001029875chr53934 315 94 --42399 1980 1088 106 1220
NM_001031623chr631669 429 155 --2122 71 11238
NM_001031685chr12898 782 1932 2788 279 1358
NM_001031695chr2264663 4555 3729 3698 1708 675 --24741 4543 35449 3789 1721
NM_001031748chr122611 557 1235 --1621
NM_001031804chr1693339 3306 2843 1405 1088 726 626 493 239 11492 44063 3345 1291 314 --
NM_001032296chr1322613 784 12050 130 22328 253
NM_001033047chr442629 1786 647 146 22049 360 22603 582 --
NM_001033087chr201915 12981 --33076 2286 1292
NM_001033561chr173878 765 718 --3749 156 88 1680
NM_001033578chr821956 185 --42239 917 341 296 --
NM_001033925chr1032076 1566 186 --21930 1664 1363
NM_001034841chr16115461 5155 4983 4408 4017 3780 3575 3412 1042 974 418 31963 1052 362 45297 4029 4023 1545 --
NM_001034850chr52346 124 11106 11147 1274
NM_001034954chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_001034955chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_001034956chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_001034957chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_001035260chr1031386 1286 1148 --11506 1608
NM_001037164chr782015 1476 1421 673 656 334 122 38 --31773 1448 1440 11942
NM_001037165chr798820 8345 8331 7647 7525 7324 7309 2743 575 --38860 7315 1839 28719 1025
NM_001037954chr1163403 3070 2231 1405 1183 716 ----13417
NM_001039199chr2064952 4005 3042 1775 679 275 --34662 986 465 --
NM_001039538chr283689 3358 3350 3212 1454 1010 476 257 12302 23644 1295 --
NM_001039547chr347214 5943 2993 1733 16597 36326 2935 1401 21227 874
NM_001039569chr273380 3370 2722 884 705 426 75 --23285 624 1304
NM_001039585chr134004 3007 2885 12618 43322 3143 923 451 --
NM_001039590chrX93734 3719 3632 3422 3182 1499 1414 984 198 --33451 3274 1492 --
NM_001039591chrX93734 3719 3632 3422 3182 1499 1414 984 198 --33451 3274 1492 --
NM_001039618chr1185811 4117 4054 3972 2359 1610 1552 394 34919 1803 803 75686 4706 4693 4627 3923 1474 1340 --
NM_001039693chr253684 1207 1021 1014 698 11623 24050 1638 --
NM_001039762chr1062411 2011 1961 1597 1582 773 --21900 918 11913
NM_001039840chrX115615 5348 5338 5289 4809 4292 3895 2435 1835 713 195 --45094 4759 2372 1170 15560
NM_001040142chr231533 749 366 --12221 2638 112
NM_001040143chr231533 749 366 --12221 2638 112
NM_001040157chr442489 2103 1028 103 --32886 1034 320 12900
NM_001040181chr3------2467 83
NM_001040182chr3------2467 83
NM_001040183chr3------2467 83
NM_001040199chr3------2467 83
NM_001040200chr3------2467 83
NM_001040202chr452419 1590 813 585 92 ----22285 1936
NM_001040280chr651461 1258 1036 441 419 --21454 1072 11398
NM_001040284chr1685237 4362 4355 2311 2285 2128 1873 127 14311 52140 1936 877 688 458 35969 5564 2152
NM_001040402chr432542 1008 563 12874 11014 22744 1295
NM_001040441chr115464 24375 3582 44238 2144 2138 2126 11476
NM_001040633chr721034 1026 1271 21016 896 1206
NM_001040665chr765003 4093 4068 3716 229 148 13198 14932 13950
NM_001040708chr82968 325 1205 2374 176 1402
NM_001040712chr963490 1184 1002 840 647 506 --23234 846 --
NM_001040876chr411482 1269 1683 2586 490
NM_001042355chr1685225 4863 4668 1173 1064 743 547 223 --1606 --
NM_001042412chr1685225 4863 4668 1173 1064 743 547 223 --1606 --
NM_001042413chr933886 1059 208 --53879 3496 1463 615 62 --
NM_001042481chr1432382 1963 1849 12281 11075 22402 1625
NM_001042493chr64689 661 380 323 1524 31586 1580 263 21993 1631
NM_001042494chr1543872 3841 3590 652 --33828 719 33 11344
NM_001042495chr1543872 3841 3590 652 --33828 719 33 11344
NM_001042496chr1543872 3841 3590 652 --33828 719 33 11344
NM_001042497chr1543872 3841 3590 652 --33828 719 33 11344
NM_001042533chr353300 3238 2585 1029 401 12398 12268 13131
NM_001042537chrX41696 483 221 190 1944 22324 2170 12514
NM_001042550chr941657 1576 1414 498 --6691 685 392 236 121 35 --
NM_001042555chr1254341 3731 3233 852 776 2229 43 44303 3797 3442 808 23118 2960
NM_001042599chr277125 6161 2968 2372 1991 660 647 26396 4986 12962 1631
NM_001042601chr362893 2799 1269 883 207 103 22941 246 2341 144 --
NM_001042603chr1274278 2138 2009 1734 1664 1105 733 --54619 4295 4119 1946 1916 11145
NM_001042604chr394713 4375 4233 3486 3119 3075 1837 1196 521 --24369 1349 23565 1650
NM_001042683chr621744 1527 1751 11718 11834
NM_001042749chrX41788 1642 524 216 11471 21916 1845 21770 475
NM_001042750chrX41788 1642 524 216 11471 21916 1845 21770 475
NM_001042751chrX41788 1642 524 216 11471 21916 1845 21770 475
NM_001044385chr242842 2751 867 550 12862 12933 156
NM_001044387chr1911600 --34139 2580 782 24052 471
NM_001044388chr1911600 --34139 2580 782 24052 471
NM_001046chr552975 2316 1193 501 251 11969 --21042 415
NM_001050chr171933 ----21090 353
NM_001083620chr432321 854 516 11961 1206 12114
NM_001099678chr366181 6097 5495 4049 1947 1566 1248 11737 --
NM_001100108chr1108358 7522 5382 2909 2747 2490 2389 1934 1667 1394 11979 78223 3181 2404 2397 2379 1838 64 181
NM_001106chr3149704 9158 8638 8162 7460 6732 6257 5987 3640 2674 2266 533 329 67 1199 23249 1236 17216
NM_001113490chrX52606 2402 1038 429 76 1296 1114 13303
NM_001117chr1842187 1759 376 57 --1159 1341
NM_001144chr1631395 1176 952 11260 --11421
NM_001146chr832179 2112 2030 31616 778 706 --11962
NM_001160chr1262859 2750 2631 2110 1046 462 --2586 196 22118 1961
NM_001167chrX106659 6617 2442 2324 2212 1087 977 494 419 140 11390 45510 2366 1457 1046 34879 710 474
NM_001186chr2142978 2437 2375 249 --2990 101 12551
NM_001201chr443359 2572 1484 826 13822 43594 501 465 70 2784 278
NM_001204chr2107636 7428 7184 6291 5194 2451 1983 1362 499 419 26218 444 36668 1512 197 11726
NM_001206chr973079 2715 2471 2324 981 286 278 --41930 485 298 292 1165
NM_001256chr1712378 --32499 2210 261 1389
NM_001259chr785762 5018 4691 2334 1469 1360 1004 170 --75154 4761 4470 2076 2034 1617 968 22355 975
NM_001304chr1793601 3219 3128 3089 3074 1396 491 440 359 23763 904 13819 --
NM_001310chr1252771 2650 2215 622 385 --32473 1879 410 11988
NM_001356chrX1382 1853 22186 997 1723
NM_001396chr213451 441 279 42368 2094 2021 486 2398 54 138
NM_001412chrX62769 2667 2300 765 317 147 21202 603 52908 1152 1146 1139 1133 --
NM_001415chrX41933 672 310 300 --31559 316 289 --
NM_001419chr19104457 4392 4188 4170 2988 1219 1203 976 841 431 54621 2962 1534 393 139 31574 1225 1154 34257 4241 1166
NM_001432chr41149 33690 3445 3370 1394 23554 139
NM_001438chr123064 1026 12864 1841 12760
NM_001482chr15------2625 317
NM_001527chr643804 1787 173 141 --74801 3769 1443 1420 1306 147 64 --
NM_001543chr524579 3184 44434 4033 3598 1074 33613 3286 952 13547
NM_001546chr621079 387 2935 134 3989 983 272 --
NM_001609chr1054441 3657 3035 1320 163 1989 --31386 442 251
NM_001616chr2103370 3282 3078 2883 2759 1085 1010 840 752 665 --23086 801 22206 431
NM_001621chr742845 1092 437 29 --22924 1170 1905
NM_001621chr742845 1092 437 29 --22924 1170 1905
NM_001650chr1824158 1321 ----23483 823
NM_001655chr1141944 771 725 75 ----1715
NM_001660chr34768 732 324 290 1624 1300 --
NM_001668chr111814 --41820 1780 1672 366 154
NM_001682chr1212162 --31133 1122 981 22553 2156
NM_001683chr372303 1687 922 475 389 368 250 --22278 407 12690
NM_001684chr133005 2990 2562 22966 887 33696 2549 473 --
NM_001690chr322198 1951 --22179 148 11904
NM_001695chr873579 2861 1705 1629 1503 838 375 --12882 11497
NM_001709chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_001730chr1341501 1332 592 422 2502 312 --11285
NM_001730chr1341501 1332 592 422 2502 312 --11285
NM_001746chr522707 517 1410 22957 880 1290
NM_001754chr2123392 687 33266 1019 544 2698 678 13428
NM_001755chr1671889 1857 866 506 461 416 274 ----1534
NM_001759chr1271940 1932 1680 1664 1349 644 83 15143 55260 3517 1912 1884 69 12046
NM_001777chr383840 3813 3436 2817 2723 2639 1248 239 1166 32845 2832 696 13609
NM_001806chr1962809 1844 746 568 527 209 --3822 713 548 --
NM_001821chr194605 4434 4270 3860 3709 3565 1334 995 27 ------
NM_001822chr2250 31 1653 1145 1570
NM_001858chr694037 4023 3620 3545 3321 1813 1778 613 214 33971 1602 588 74988 4903 3954 3561 1848 829 487 12019
NM_001901chr61959 --21001 109 1690
NM_001948chr155830 192 87 79 65 --21283 226 --
NM_001949chr632224 2053 891 --22793 2787 32821 2266 638
NM_001980chr122788 751 11818 1537 12016
NM_001987chr1233865 2629 1454 --4393 328 322 316 --
NM_001992chr531409 1380 662 ----22213 599
NM_002006chr444715 3712 3557 1795 43619 1310 1264 957 45830 4873 3902 1748 --
NM_002009chr1541946 945 802 165 22692 1998 52558 2552 2290 930 61 --
NM_002015chr1332476 379 104 --3812 482 372 11108
NM_002017chr111310 21036 508 --21023 322
NM_002024chrX2455 346 --32169 748 742 42193 2112 862 392
NM_002025chrX97747 7220 5793 5750 3304 2574 1112 1046 293 39049 7676 6435 49201 5658 1119 734 25768 118
NM_002035chr1822487 2463 12913 52697 1511 909 809 101 12766
NM_002040chr2162893 2543 2358 2325 2116 831 12571 52824 2744 2556 1056 770 22424 2042
NM_002069chr73600 307 140 --1146 11704
NM_002092chr494519 4460 3439 3091 2030 1820 631 272 126 23108 1542 44159 4153 4147 1883 1296
NM_002126chr1753812 3557 1608 1543 1079 1439 53463 2621 1657 1171 705 11130
NM_002128chr1362382 2031 1627 417 312 21 1651 --1117
NM_002158chr273843 3746 2750 2630 2427 1260 134 1142 23240 2563 21413 692
NM_002210chr243021 838 598 381 2955 250 13160 1213
NM_002214chr745734 5589 4667 663 11564 54197 3545 1648 981 669 13788
NM_002264chr354624 3864 3420 3401 562 13496 24133 102 14101
NM_002267chr1362163 1725 985 767 215 115 12323 1938 11571
NM_002268chr311389 11501 21243 747 11231
NM_002270chr595575 4929 4911 4138 2134 2109 512 490 476 --55121 4771 3858 3807 2155 --
NM_002271chr1332262 2150 74 1826 31754 777 80 2963 716
NM_002285chr253936 1331 1266 835 57 14126 33049 1344 1277 --
NM_002296chr151591 1548 1519 626 412 --31731 446 353 11720
NM_002310chr566017 5814 5624 2393 567 357 25392 4352 75979 5352 2217 1482 1461 688 335 26560 4819
NM_002336chr1243586 1906 1277 950 --64556 4329 1156 1025 898 544 21369 1257
NM_002356chr632377 2055 1082 --52669 2064 978 308 164 1800
NM_002374chr283689 3358 3350 3212 1454 1010 476 257 12302 23644 1295 --
NM_002408chr142561 550 --1663 1631
NM_002430chr224643 358 209 126 --22598 821 1365
NM_002480chr121446 11048 3204 197 177 1537
NM_002481chr198002 7878 7557 6744 5418 5306 2853 1501 99 --57715 6451 5088 994 897 --
NM_002485chr84754 729 229 112 21544 666 21795 788 2513 187
NM_002499chr1522169 1581 --1543 12467
NM_002501chr1943992 2597 2578 1186 34008 2628 2572 23998 2550 --
NM_002515chr144204 163 89 28 21809 331 --1731
NM_002536chrX1208 --1453 2510 215
NM_002545chr1144054 3362 3129 1305 --63297 2072 1244 135 124 100 14114
NM_002577chr373931 3899 3554 3461 1555 1349 376 --32792 2483 1355 --
NM_002581chr933992 3868 1424 --45580 5567 3483 1412 15376
NM_002595chr1231855 1653 425 --11812 2447 162
NM_002610chr242338 2202 2182 312 22497 104 12786 22735 2267
NM_002612chr731792 1429 279 11685 22076 290 --
NM_002645chr1122643 223 1696 42304 749 361 333 --
NM_002657chr2043878 1395 922 29 33909 3807 552 23229 946 --
NM_002687chr1431262 1004 820 2523 503 1484 1883
NM_002709chr253611 3226 906 596 391 1842 33517 3106 397 33018 965 408
NM_002715chr511015 ----21035 119
NM_002718chr332308 1903 1752 --12690 2811 140
NM_002736chr771972 1651 681 485 476 339 109 12088 21940 810 --
NM_002737chr1746492 6302 4269 1196 25674 5479 34315 4290 4278 14854
NM_002740chr351952 1742 966 231 162 1240 12513 32744 2497 2430
NM_002748chr153407 295 47 1175 1133 21088 1075
NM_002821chr63771 761 234 1600 3791 785 777 1798
NM_002822chr1221729 34 --11553 2239 146
NM_002837chr1233396 2900 381 --22941 371 23219 55
NM_002839chr963490 1184 1002 840 647 506 --23234 846 --
NM_002840chr121435 442 --41586 665 650 448 11238
NM_002880chr32805 604 ----2835 99
NM_002886chr354468 1858 917 457 395 44954 4702 4513 1925 43754 1954 943 937 13288
NM_002892chr1441737 1417 1141 462 31386 1189 692 2446 249 --
NM_002940chr411482 1269 1683 2586 490
NM_002941chr321069 505 31060 168 123 --11562
NM_002956chr1211031 1208 2882 225 11043
NM_002958chr331014 909 223 1306 3983 920 667 --
NM_002959chr144233 1719 1395 1250 --31519 292 286 --
NM_002971chr31185 --3303 296 176 11138
NM_002998chr832252 1745 857 --186 194
NM_003010chr171355 ----2887 85
NM_003034chr1256380 6316 5965 450 50 --15282 16667
NM_003046chr875280 5251 5127 4403 1755 1056 311 --13421 --
NM_003082chr142474 37 124 21050 879 --
NM_003101chr131336 585 309 1596 2606 522 11065
NM_003107chr662441 2245 2189 598 477 424 ----12448
NM_003108chr287282 6741 6643 6020 5819 5708 5570 5050 26754 240 54847 1523 1067 1010 349 --
NM_003112chr763205 3040 2850 2348 2204 2131 --23093 1042 21126 107
NM_003113chr24805 732 304 21 --1133 1114
NM_003128chr252838 2662 2387 2379 652 --22421 2394 --
NM_003137chr61785 11811 32229 803 121 11821
NM_003144chr662143 2134 1619 818 811 199 11550 --12177
NM_003178chr312140 --2209 134 2670 318
NM_003182chr72440 175 ----2463 373
NM_003182chr72440 175 ----2463 373
NM_003184chr84781 733 726 194 --1739 1978
NM_003199chr1885675 5560 4213 2000 1980 1854 1781 462 --95171 4914 4414 4231 4225 4219 4207 3688 2006 24378 4238
NM_003247chr652033 1907 1764 1660 535 --51863 1410 1389 1383 1377 --
NM_003262chr345256 4401 3228 207 1452 33460 1697 1406 24719 835
NM_003274chr2122696 2020 12739 2922 799 32181 1137 171
NM_003298chr345124 4162 2493 197 15799 15203 12050
NM_003304chr371111 592 423 408 336 259 180 --2651 284 11185
NM_003338chr1041975 1429 644 51 1237 --31661 1349 329
NM_003359chr41935 --31123 110 100 1413
NM_003371chr982120 1897 1872 1857 1840 1651 1635 1620 22138 1959 11670 --
NM_003390chr1141110 975 884 873 --11059 1865
NM_003392chr373970 3310 2806 1579 1220 1212 73 22992 81 --13648
NM_003406chr831488 670 84 21399 151 11909 1206
NM_003409chr18----31197 576 566 11157
NM_003410chrX43102 2823 2251 1930 12062 32391 2306 1194 11163
NM_003439chr723086 2641 1834 32853 1394 1087 12706
NM_003478chr1173035 2154 2063 721 689 638 217 ----1425
NM_003482chr1242682 2471 2359 708 22465 2299 31923 987 579 22771 840
NM_003483chr1212941 22055 1810 1287 21937 761
NM_003489chr2133415 2299 978 22756 860 33421 2325 2305 1824
NM_003506chr851317 1202 1111 894 67 11079 1907 --
NM_003566chr1243251 2856 1023 616 --22248 416 --
NM_003574chr1865670 5360 4389 4164 1507 543 34787 4769 4436 24185 1047 24050 820
NM_003576chr1322613 784 12050 130 22328 253
NM_003583chr1232590 703 452 23655 198 11278 42635 347 165 88
NM_003590chr242748 1087 600 373 11175 23686 260 21272 795
NM_003597chr272245 1499 468 336 222 215 208 31623 627 377 ----
NM_003615chr3103684 3646 3608 3281 3200 2846 1613 1282 529 250 2583 118 23614 2977 --
NM_003659chr22300 151 21055 50 --1135
NM_003663chr373485 2723 2254 1055 845 531 269 22377 1012 22522 2140 --
NM_003670chr331448 1158 70 1905 21327 1090 11181
NM_003692chr92727 178 ----21031 187
NM_003722chr352416 1943 1852 774 457 12459 --12613
NM_003749chr132237 99 11796 12216 1295
NM_003759chr443769 3378 3110 240 33691 2640 1398 23051 193 --
NM_003763chr2093010 2987 2862 2808 2373 2072 2021 1282 188 1427 32944 2598 194 --
NM_003772chr1141294 1056 905 409 ----2929 153
NM_003787chr1851706 1410 1353 574 232 --21187 512 --
NM_003800chr642250 1644 1529 580 --11659 11517
NM_003825chr154612 555 486 83 1236 2352 161 1258
NM_003831chr1821751 402 11314 21757 1575 11518
NM_003873chr1062341 2234 2224 1986 1602 591 --2602 517 22311 2064
NM_003884chr331781 649 68 --31714 1430 1317 --
NM_003887chr251551 1480 1415 778 131 1189 31564 1558 1445 21589 173
NM_003902chr12827 332 1790 1103 1217
NM_003909chr873081 2888 2380 2189 2093 863 628 22334 1874 1286 13021
NM_003913chr6123679 3595 3576 3356 3027 2654 1316 652 563 394 210 176 21391 859 54124 4087 3523 1375 988 11007
NM_003921chr131800 332 44 --11815 21265 1156
NM_003930chr732284 448 100 41890 1794 1680 255 12422 --
NM_003939chr1074141 4133 3760 3065 1305 357 309 --21294 1288 --
NM_003948chr422325 2064 11715 52647 2631 2509 2397 423 --
NM_003955chr1721387 1277 --51418 1302 1296 1290 1284 --
NM_003966chr567800 6893 6406 5670 5363 1328 22885 236 47364 6629 2663 281 1546
NM_003980chr621368 100 --1461 21378 1188
NM_003983chr1663704 3542 3247 1489 851 398 23794 3273 44165 3175 3108 1298 --
NM_003994chr1234003 2845 181 22936 1498 13846 13957
NM_004006chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004007chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004009chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004010chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004011chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004012chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004013chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004014chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004015chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004016chrX62453 2398 2199 2032 431 157 2582 35 12214 12411
NM_004017chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004018chrX62453 2398 2199 2032 431 157 2582 35 12214 12411
NM_004020chrX72539 2484 2285 2118 517 243 93 2668 121 12300 12497
NM_004021chrX62453 2398 2199 2032 431 157 2582 35 12214 12411
NM_004022chrX62453 2398 2199 2032 431 157 2582 35 12214 12411
NM_004023chrX62453 2398 2199 2032 431 157 2582 35 12214 12411
NM_004028chr1824158 1321 ----23483 823
NM_004035chr1744837 4470 1190 177 --34750 1196 954 34609 1053 368
NM_004040chr221347 1050 --21262 850 1967
NM_004061chr53592 256 248 --1262 --
NM_004080chr741421 601 546 128 1183 --11430
NM_004087chr311270 11251 32059 1581 1396 1656
NM_004096chr1022059 627 --31976 1894 307 22144 1403
NM_004117chr611660 11529 1459 12180
NM_004124chr14--12222 22566 1367 13228
NM_004133chr851875 1818 974 368 298 1424 --12479
NM_004171chr1179642 8911 8191 5998 2601 2501 886 26080 3434 99517 7364 6712 6700 5832 3835 3119 2392 1761 12783
NM_004229chrX3356 329 272 --2367 320 22209 1645
NM_004232chr1853810 3380 2445 1041 897 53510 3001 1266 669 498 12771 --
NM_004233chr651461 1258 1036 441 419 --21454 1072 11398
NM_004268chr111821 --1241 21239 109
NM_004338chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_004342chr73632 377 73 --1383 1880
NM_004392chr1382483 2295 2262 1816 897 687 553 167 --1321 22546 732
NM_004393chr311723 1493 22362 398 12330
NM_004397chr1174304 3724 3030 1006 541 420 87 1249 34213 2991 261 23200 2800
NM_004412chr1075701 4668 4428 3767 431 381 73 15476 55041 4091 3793 3759 711 --
NM_004430chr842240 2231 1884 1841 ----32787 2512 1821
NM_004437chr183135 2587 1303 1230 1027 918 269 251 1905 21310 630 --
NM_004440chr631605 629 454 --21890 1723 11265
NM_004457chr221619 563 1299 11577 11585
NM_004458chrX22501 1652 151 1284 22649 256
NM_004459chr17--1125 32081 1498 1333 22000 83
NM_004464chr424126 1723 --3428 414 160 1597
NM_004480chr142827 504 --5550 526 520 514 259 --
NM_004500chr1451858 1422 1408 729 688 1286 31717 1289 570 --
NM_004501chr153276 2942 2650 1072 557 --34085 3034 64 23325 1633
NM_004504chr252481 2048 1168 1052 586 --21112 640 --
NM_004535chr2021471 476 --21435 251 1484
NM_004537chr12--1250 3362 131 125 --
NM_004575chr421605 1255 11206 --21514 356
NM_004586chrX35311 4772 4382 55340 5087 4945 4876 1267 34231 3811 459 --
NM_004593chr33933 300 224 ----2210 162
NM_004600chr131513 614 366 --11457 1379
NM_004612chr994458 4211 3763 3528 1602 1465 786 768 478 11560 34048 774 269 13719
NM_004643chr143700 663 557 --5866 714 706 690 684 --
NM_004681chrY3739 207 136 1591 --1711
NM_004719chr1262691 2610 2181 2039 1875 142 1352 1642 --
NM_004726chrX105242 4951 4386 4295 3711 3599 1079 621 165 64 --94460 4256 3969 3540 1840 1833 1701 1568 345 13657
NM_004734chr13--11214 12048 33222 385 242
NM_004736chr171975 1918 1911 1553 620 250 35 1417 22147 1929 1796
NM_004760chr712389 11711 41974 1609 577 444 12399
NM_004774chr1733085 3047 366 12030 --2951 622
NM_004776chr2053245 3003 2328 2319 2101 --33179 2246 2125 1241
NM_004779chr521035 141 ----21316 164
NM_004808chr1012249 12885 1314 21309 1181
NM_004840chrX3987 847 99 --11904 12418
NM_004857chr1434160 3052 1010 24562 412 23939 2914 --
NM_004863chr1434012 3850 1827 1524 45186 5121 4394 3732 31964 1279 769
NM_004871chr1744301 3039 2897 291 1239 24279 191 1212
NM_004873chr1473012 2931 1045 987 752 516 32 32970 2124 254 23121 618 --
NM_004874chr81486 1191 1379 1184
NM_004896chr1031301 1201 1063 --11421 1523
NM_004904chr7115862 5414 4305 2556 2546 2519 2412 1750 669 606 241 --34980 2310 1958 24130 862
NM_004906chr63534 470 117 1608 2143 130 --
NM_004972chr93821 419 167 1376 3962 772 456 --
NM_004973chr671767 1714 1518 1255 1139 232 145 --11556 11381
NM_004985chr12114139 3997 3399 2961 2832 2772 1620 367 208 168 83 1427 44358 3815 3312 2861 14176
NM_004992chrX118287 8280 7453 7016 5425 5399 3057 1845 1407 1126 398 47041 2754 1969 1954 26636 187 --
NM_004992chrX118287 8280 7453 7016 5425 5399 3057 1845 1407 1126 398 47041 2754 1969 1954 26636 187 --
NM_004999chr653744 3170 2876 1033 449 11253 44387 3809 1714 1061 11627
NM_005056chr1264522 2253 1978 1908 1349 977 --54863 4539 4363 2190 2160 11389
NM_005065chr1453362 1400 783 672 505 15023 24127 3721 --
NM_005078chr1511429 --11442 11865
NM_005109chr332383 787 565 --32562 1832 478 1733
NM_005116chr2074324 3387 2804 1829 1507 1220 1106 24449 3246 44472 4418 4372 949 --
NM_005121chr1723379 138 33519 3152 459 --13299
NM_005135chr1543872 3841 3590 652 --33828 719 33 11344
NM_005156chr9105056 4931 4327 3406 3319 1414 1156 987 769 317 54970 4140 2005 1219 1202 33698 1142 583 1868
NM_005188chr11118247 7877 7831 7185 6092 2550 1749 1222 1137 865 187 25894 2535 47083 5982 5452 3280 --
NM_005197chr14125756 5285 4019 4010 1554 1547 1453 245 176 152 123 22 25145 3967 85337 4989 1527 1521 1514 1508 1502 111 --
NM_005207chr22153707 3577 3353 3277 2884 2659 1499 1221 1176 1123 1042 573 559 550 503 1914 33482 2686 584 --
NM_005230chr121540 --2226 169 2615 233
NM_005233chr322376 554 --1668 1660
NM_005235chr277125 6161 2968 2372 1991 660 647 26396 4986 12962 1631
NM_005238chr1133524 3470 463 --33430 2653 2172 2667 418
NM_005254chr1521248 216 --2927 289 11400
NM_005259chr241436 974 223 46 ----11541
NM_005277chr431901 1863 363 ----21270 553
NM_005311chr722561 2351 12705 --21763 417
NM_005328chr81275 ----2779 512
NM_005329chr1652346 2238 2128 1745 101 --11973 1231
NM_005339chr443203 3151 1063 881 1964 24349 1675 1413
NM_005342chrX--32494 670 383 21847 823 1685
NM_005359chr1844798 4270 1503 1110 12409 36551 4999 1440 14936
NM_005381chr23397 385 323 156 2335 329 --
NM_005398chr1031195 1186 911 --21212 1154 1459
NM_005406chr1841025 469 327 169 --41538 1198 448 133 --
NM_005426chr12898 782 1932 2788 279 1358
NM_005433chr1872719 2639 1893 814 553 484 448 11738 12114 1108
NM_005436chr1053465 3422 1404 1233 215 --33455 3443 1217 --
NM_005461chr20--11818 21967 1570 11868
NM_005497chr1765844 4727 2470 2247 1782 293 2561 472 35818 4714 1565 24998 3773
NM_005504chr1225897 1372 26115 5771 41462 544 502 450 16057
NM_005509chr541202 664 343 275 1546 2675 281 1111
NM_005530chr152394 208 --1240 1182
NM_005578chr345109 1716 1658 360 11671 14450 --
NM_005591chr1162196 1724 799 764 542 372 --52484 2016 982 436 165 22795 501
NM_005596chr965202 4379 2331 1959 1567 1004 12238 34949 1792 1769 --
NM_005610chr13776 657 309 --2638 154 2709 603
NM_005637chr1861926 1596 1430 746 530 106 --31624 1610 1604 --
NM_005638chrX21694 1508 --1686 21622 295
NM_005665chr1114947 3102 1843 1780 1485 1442 1184 1036 956 935 822 14756 34248 502 484 --
NM_005668chr574602 3878 3847 3493 1822 1687 509 14326 34565 1285 522 23754 1483
NM_005717chr141284 1004 330 319 --31255 1018 502 --
NM_005722chr262304 2188 1650 898 683 559 --31990 1640 777 --
NM_005738chr782015 1476 1421 673 656 334 122 38 --31773 1448 1440 11942
NM_005739chr1532407 2386 1649 22057 1920 31803 375 172 --
NM_005746chr721706 75 11013 42522 2502 1805 1775 1812
NM_005748chr1243074 2254 624 456 --63477 2626 2544 2295 886 559 --
NM_005752chr1611160 ----21226 301
NM_005759chr254423 4324 4059 3888 891 14519 11898 34028 3610 1754
NM_005776chr14------2707 178
NM_005789chr17--22112 622 2402 339 3607 296 123
NM_005798chr1364332 4311 4292 2077 1316 25 44057 2018 2004 948 23355 938 15204
NM_005808chr31145 --32535 858 151 22561 2378
NM_005822chr631719 1712 1470 --31960 876 817 --
NM_005839chr13914 690 329 --5892 696 682 367 341 --
NM_005840chrX26574 911 1411 2705 372 27059 2998
NM_005841chr42388 353 --6925 82 76 70 64 57 --
NM_005843chr221233 163 11449 41755 1487 1322 700 --
NM_005845chr1351674 1380 1350 328 50 11734 2432 206 1341
NM_005857chr12947 471 21114 976 --2208 77
NM_005862chr31338 --2269 111 1887
NM_005880chr1621071 543 11247 2563 551 --
NM_005895chr1233196 2640 111 13508 53517 3474 544 477 83 24024 2765
NM_005898chr1132894 2679 1052 --22211 950 23020 127
NM_005901chr18108691 7564 6937 6306 6150 2311 1658 1327 1048 658 38461 6249 2840 66125 3448 2807 2767 675 665 11224
NM_005902chr1524499 1530 --21503 145 14011
NM_005903chr584406 3995 1786 1010 580 472 384 44 1872 35208 2038 1754 --
NM_005907chr661614 1281 391 278 218 126 --21667 660 1232
NM_005909chr533426 564 168 --11505 11421
NM_005935chr4105153 4919 4857 4725 4694 4068 3959 3652 3638 3334 13497 23673 3646 11442
NM_005996chr1221524 1401 --21159 1046 1603
NM_006007chr953983 3812 1788 1182 885 31519 1323 792 54465 3803 3796 3626 1207 21253 36
NM_006016chr642114 1616 1433 773 11787 1515 11650
NM_006037chr2124786 4768 4427 4074 4005 3588 3391 1730 1577 891 716 503 21694 1502 44437 3500 1915 1352 11710
NM_006047chr2063515 3396 2321 628 618 309 22468 997 22686 67 --
NM_006095chr474471 4395 4356 3131 1375 1265 910 11427 43690 3643 3181 553 --
NM_006100chr31244 ----2557 228
NM_006106chr1193366 3289 2674 1353 880 854 723 712 536 188 33250 739 730 --
NM_006141chr1622553 99 32266 2221 982 --1887
NM_006154chr1522755 359 12764 --21141 29
NM_006203chr554358 3497 1268 801 173 45609 1485 697 225 55422 4813 3960 1107 941 24420 1239
NM_006206chr431815 1100 774 --12912 12404
NM_006212chr145074 3558 3385 1972 21167 834 65394 5047 4591 3433 1468 457 11598
NM_006241chr331838 744 686 12005 61955 713 703 697 675 668 12288
NM_006251chr542986 2766 2457 1268 --31281 506 417 --
NM_006252chr1127020 6958 6591 5201 2996 2909 2038 1321 1256 1239 1224 531 36465 4739 2284 22143 2118 12247
NM_006256chr142693 2647 385 100 --12298 1117
NM_006275chr2041854 383 351 344 --21647 279 11916
NM_006282chr2034751 3358 878 11692 54482 3037 1058 994 310 24694 4366
NM_006306chrX44104 3630 1574 405 23830 1939 34599 1680 1661 22145 1806
NM_006315chr473963 3928 3893 2943 2936 1057 863 14548 53190 1495 1306 1203 851 12781
NM_006352chr151998 1801 1674 551 351 --61554 1495 366 359 213 127 --
NM_006359chrX41696 483 221 190 1944 22324 2170 12514
NM_006364chr1411081 1795 3902 827 816 --
NM_006371chr335315 5284 1791 --45290 4921 665 657 1552
NM_006375chrX2770 353 186 --21432 292
NM_006380chr1753687 3361 1514 522 78 --23829 3278 1276
NM_006386chr2241852 556 423 373 1892 42460 1830 1508 379 --
NM_006407chr331433 1153 83 1465 --11129
NM_006420chr2093413 3238 3164 3097 2991 695 559 447 294 12545 2552 484 --
NM_006434chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_006460chr1731791 639 235 --1219 1286
NM_006469chr141285 393 304 200 ----21579 476
NM_006482chr1232590 703 452 23655 198 11278 42635 347 165 88
NM_006489chr144204 163 89 28 21809 331 --1731
NM_006526chr2022213 2144 --21963 529 11641
NM_006534chr201791 22470 576 33199 243 194 23159 2546
NM_006538chr264094 3932 3470 1599 333 261 1898 44038 2763 1283 309 --
NM_006544chr1435503 4469 487 24127 441 65974 3800 2354 2026 387 335 55477 5086 4056 2281 284
NM_006546chr1776615 6397 6038 5771 5565 4879 364 --21722 408 --
NM_006547chr731351 759 655 1109 21669 1625 --
NM_006549chr121152 1290 22948 138 11052
NM_006561chr1095462 4234 3911 3818 2027 1501 1174 645 549 1523 55921 5879 4037 1299 1051 --
NM_006572chr1772281 2183 1190 706 566 60 22 --42747 66 50 41 1613
NM_006599chr1677929 6396 5622 2968 1688 1510 403 21903 1819 33131 1753 812 28182 6315
NM_006603chrX41788 1642 524 216 11471 21916 1845 21770 475
NM_006609chr262952 2880 2399 1842 894 220 1418 22512 2494 --
NM_006614chr373469 1392 941 751 622 358 198 11178 33068 1014 694 21156 214
NM_006620chr653032 663 412 385 354 24289 3101 1934 23761 107
NM_006628chr1564575 4562 1841 1275 309 165 14107 24568 3277 --
NM_006633chr52788 276 2764 510 --174
NM_006646chr1352921 2562 2495 685 439 12779 42797 2726 2039 451 --
NM_006654chr1254341 3731 3233 852 776 2229 43 44303 3797 3442 808 23118 2960
NM_006675chr1222144 974 ----23415 3404
NM_006717chr932928 2710 2121 --63153 2874 2718 2268 985 361 12738
NM_006722chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_006738chr1573952 3124 1608 822 799 616 403 --34556 3009 1641 11307
NM_006756chr841532 1433 1158 84 --1129 1234
NM_006777chrX52268 2187 1888 422 31 21078 224 12399 --
NM_006791chr153600 539 254 --3631 426 119 1217
NM_006815chr1241307 995 950 549 21205 282 1542 1309
NM_006823chr831322 1292 494 ----21126 449
NM_006873chr241301 940 325 237 --31375 636 189 11197
NM_006874chr441184 1132 1099 953 1336 1962 --
NM_006885chr16103848 3438 3430 2966 2887 1487 1468 603 567 542 --104032 2905 2899 2893 2689 2683 2572 1505 558 154 22775 529
NM_006908chr741489 1110 1042 606 11156 --11452
NM_006912chr162453 1755 1617 732 335 240 1131 1936 12118
NM_006915chrX31903 1649 689 2781 95 22496 2066 --
NM_006918chr1155655 5428 4770 1220 488 ----35777 4588 1314
NM_006922chr232037 505 107 --42050 2044 1859 1695 1213
NM_006924chr1773407 1678 1670 1272 712 91 47 --13995 34190 3970 818
NM_006940chr124466 442 406 398 11835 21298 448 21335 629
NM_006951chr101764 1792 1101 140
NM_006999chr542065 1338 747 428 --2468 222 11401
NM_007005chr91531 --2546 540 --
NM_007006chr1641306 945 674 90 11170 33210 2694 2467 12894
NM_007007chr12124394 4092 4039 3993 3823 3399 3179 3108 2990 1595 562 206 23200 3050 21778 329 41391 1320 955 700
NM_007011chr1566594 6577 4730 1183 553 204 11227 55188 4666 4654 1760 1194 15178
NM_007033chr131598 812 674 --22277 1990 1681
NM_007042chr362320 2017 1967 847 636 491 12391 2865 858 12618
NM_007054chr573719 3568 3552 2541 1506 559 382 11516 43562 3456 973 606 23594 3532
NM_007106chr1342126 1769 240 223 12094 11713 --
NM_007107chr322255 1799 --32182 754 162 22168 99
NM_007111chr135917 628 300 192 74 --1668 1248
NM_007124chr631570 1388 474 --1211 1187
NM_007125chrY41004 479 453 220 --1470 11046
NM_007136chr321083 31 11130 11185 2873 822
NM_007137chrX45445 5308 3764 1039 11911 34385 1310 715 --
NM_007146chr1732634 2318 756 11027 --21962 468
NM_007172chr2253293 2721 2478 659 74 22857 2638 33237 2897 2660 --
NM_007173chr113930 439 306 --41796 447 409 70 --
NM_007175chr883482 3415 2993 2750 2739 2541 1274 1193 --23239 725 32828 2584 1057
NM_007195chr1833175 3009 1177 13553 32829 2540 809 13641
NM_007200chr1573952 3124 1608 822 799 616 403 --34556 3009 1641 11307
NM_007203chr953892 3442 3048 2618 2607 14011 23821 2507 12880
NM_007212chr141965 1536 1443 444 --3827 606 247 21835 1526
NM_007218chr84754 741 363 133 --1640 1242
NM_007249chr13118909 8172 7963 7175 5931 3676 2806 2178 2157 1638 686 23589 2469 36208 665 252 29235 3419
NM_007276chr73733 158 124 --2972 374 1443
NM_007292chr1744837 4470 1190 177 --34750 1196 954 34609 1053 368
NM_007325chrX11872 --31690 875 545 21822 1707
NM_007331chr422486 120 --2852 825 12722
NM_007359chr1741702 1107 505 375 --21690 381 11397
NM_007373chr1061524 1329 533 518 395 196 --21492 221 --
NM_007375chr142386 1023 471 383 --2973 477 12756
NM_012081chr563153 2808 2741 1414 1273 282 13497 3890 882 874 --
NM_012096chr342650 1508 1472 1014 1868 23776 2928 11313
NM_012129chr722249 2045 1157 198 12214
NM_012160chr63525 416 86 ----2174 78
NM_012164chr9117071 6973 6478 5846 4909 4696 1368 970 659 181 142 47008 2941 2689 2510 25503 5458 25965 4859
NM_012207chr101826 --21098 164 1118
NM_012210chr911303 --1963 31515 1349 155
NM_012214chr265187 4993 4423 4133 4072 1956 --36002 1050 986 12302
NM_012215chr1031672 1662 1409 11540 1713 11227
NM_012234chr383755 3596 2895 2450 2443 1205 325 213 13261 23527 332 --
NM_012238chr1051754 1676 1594 1538 322 1355 21737 143 11624
NM_012243chr1126 --1125 1370
NM_012252chr765141 4824 4409 1218 1000 295 23659 940 54706 3381 819 250 208 --
NM_012262chr155015 4504 4120 1542 923 --33790 465 333 11709
NM_012272chr121437 --2450 443 --
NM_012290chr241315 629 523 384 11156 21520 83 --
NM_012300chr562269 1790 1005 562 315 32 --22050 1843 2989 945
NM_012382chr573870 3115 1663 1615 1389 607 359 11376 33040 1636 116 --
NM_012388chr1553082 2957 2030 200 179 --22018 22 12049
NM_012395chr763191 2462 2174 879 603 112 1342 43413 685 456 173 --
NM_012420chr1041573 455 181 33 --164 21900 1590
NM_012479chr752423 2346 2139 1968 543 1305 1442 12465
NM_013229chr1262859 2750 2631 2110 1046 462 --2586 196 22118 1961
NM_013257chr821956 185 --42239 917 341 296 --
NM_013302chr1664548 4508 3833 738 302 278 --44731 3839 1243 934 14454
NM_013372chr1542150 1217 1185 413 --42797 2637 581 333 1186
NM_013374chr352736 788 623 500 380 --32742 2627 1234 1585
NM_013390chr941753 1746 1656 1551 --31685 1570 1558 1295
NM_013437chr821382 1231 1473 --2348 257
NM_013446chr741281 1059 982 227 --21071 183 2483 286
NM_013449chr1232509 2481 276 1579 12609 11117
NM_013995chrX42492 2311 2100 182 12084 42540 2484 1723 1713 1287
NM_013996chr72440 175 ----2463 373
NM_013996chr72440 175 ----2463 373
NM_013997chr72440 175 ----2463 373
NM_013997chr72440 175 ----2463 373
NM_013998chr72440 175 ----2463 373
NM_013998chr72440 175 ----2463 373
NM_014011chr232366 2224 397 1255 --12267
NM_014021chr142797 1168 490 463 --33461 3303 3206 12392
NM_014048chr1674879 4856 4815 3952 1969 1552 581 169 25082 4182 24791 1233
NM_014057chr911184 --31342 1317 499 1273
NM_014112chr854736 4388 3585 2054 40 --14746 25402 630
NM_014117chr1632351 2001 899 1539 11825 1532
NM_014141chr7105110 4282 4152 3826 2061 1989 1007 826 344 207 2557 354 23820 1144 --
NM_014154chr321463 378 11118 --21075 116
NM_014155chr1187553 7042 5325 4729 3024 2565 2167 1071 11652 77547 7240 6520 5783 5508 732 301 66859 5082 2665 2251 2220 1188
NM_014181chr212026 --4479 473 467 460 --
NM_014211chr51462 1543 1394 11725
NM_014253chrX82266 1991 1758 834 730 595 454 76 1262 --145
NM_014294chr8------2454 256
NM_014309chr2264653 4545 3719 3688 1698 665 --24731 4533 35439 3779 1711
NM_014331chr456118 4967 3056 1319 986 26695 2118 36494 6456 690 37639 2725 420
NM_014333chr1132266 2150 459 --52578 2569 2358 305 95 12682
NM_014393chr832115 598 583 ----11635
NM_014423chr555208 5184 2016 1882 112 --23918 141 11901
NM_014456chr102103 75 11308 41824 340 188 170 --
NM_014554chr1241730 1510 1476 615 --21722 1657 1284
NM_014574chr1441412 1267 1248 310 1589 --1264
NM_014585chr251073 953 899 370 93 ----1105
NM_014606chr421570 1464 --3360 238 232 11431
NM_014615chr1652626 932 925 254 235 1734 1897 32587 1015 827
NM_014616chr343247 3153 2319 2269 23003 2231 23072 1364 --
NM_014636chr944002 2752 1414 1136 14041 24390 716 13705
NM_014637chr861506 1482 1352 1073 942 359 ----1446
NM_014667chr31821 11567 42397 622 616 159 --
NM_014674chr343716 3007 998 694 --42440 1501 1299 1010 --
NM_014682chr852135 2087 773 742 335 --32159 821 237 --
NM_014702chr652414 2406 906 727 214 13350 33448 2563 2330 22822 139
NM_014720chr1041769 1578 718 144 --31641 136 123 21387 156
NM_014721chr655333 2900 2791 2739 1280 17262 16088 27418 652
NM_014733chr541972 915 735 633 --11594 21698 709
NM_014735chrX62089 1530 1446 861 811 146 1171 --1823
NM_014739chr683915 3666 2833 2681 1117 352 255 136 --92728 2722 2716 2710 2704 2698 2692 2674 1032 171
NM_014743chr411054 12978 63078 2716 2366 2302 1265 589 32792 2417 2106
NM_014746chr214274 --34196 778 633 23558 454
NM_014755chr284084 3351 3295 3041 1680 1486 709 140 13585 31524 1083 589 23892 1073
NM_014757chr552369 2217 1995 848 269 1479 --123
NM_014761chr16----1745 21153 901
NM_014774chr123151 1246 --33119 2597 2122 12958
NM_014779chr32928 437 1423 21004 941 11084
NM_014803chr1042965 2803 2668 584 12749 12042 11186
NM_014824chr1131777 1653 1546 --31562 1316 68 1289
NM_014828chr1412056 --4918 911 902 64 --
NM_014829chr51510 1568 32379 2347 2119 1208
NM_014830chr1263380 3290 2769 2399 1272 837 33917 1464 397 33009 1514 240 --
NM_014839chr162030 739 642 382 290 227 12094 22456 790 --
NM_014840chr1223412 2436 23299 2841 12195 13425
NM_014860chr252321 192 119 57 22 2434 184 1548 --
NM_014868chr122807 37 1244 249 43 1699
NM_014873chr164370 4299 3855 3441 1650 216 24622 4327 44001 3891 3736 1792 --
NM_014877chr1796759 6581 6205 5181 2974 1466 950 103 33 57675 7592 6628 6213 2239 66273 5908 2206 1135 758 663 37735 5072 732
NM_014887chr133710 588 332 1866 1275 1196
NM_014893chrY31592 1481 932 --199 21923 683
NM_014899chr51234 --42646 2202 814 246 23140 1181
NM_014904chr1053810 3713 1543 901 744 22917 1134 13141 1541
NM_014906chr1723424 2657 --23823 798 1167
NM_014912chr1053438 2736 993 631 378 --12330 12149
NM_014913chr1821176 234 --2597 286 21496 227
NM_014918chr15111614 1375 1329 1248 1122 576 566 432 408 114 75 21104 30 2414 270 11457
NM_014924chr1442436 2196 470 122 22056 708 53187 2867 2741 608 484 1958
NM_014946chr212568 13108 1397 12156
NM_014947chr162985 2754 2277 2266 1956 396 1439 12244 --
NM_014982chr1465192 4320 3463 2051 385 286 --43945 3495 2034 1655 14351
NM_014988chr461892 1842 1782 350 190 183 --32557 2325 168 1522
NM_014989chr68819 513 474 459 430 413 128 112 ----1486
NM_014991chr422858 2404 --21193 564 12906
NM_014999chr1211155 --4242 232 221 211 --
NM_015000chr1283129 2952 2543 2258 2113 1931 978 415 --22881 2536 --
NM_015001chr13984 737 629 --1965 2765 327
NM_015002chr1252102 1902 712 658 615 ----12002
NM_015008chr373478 2293 1027 863 725 195 87 12430 1139 22619 922
NM_015025chr251963 642 602 353 180 --2967 52 --
NM_015026chr1244724 3992 3685 3322 13566 33126 892 386 14493
NM_015032chr1341989 1799 1180 1063 2861 815 21125 1090 1458
NM_015045chr1032245 1878 1872 --31889 1501 296 21996 1405
NM_015049chr243291 2573 1116 261 12682 12444 3867 807 619
NM_015051chr953370 2990 2297 2150 487 32126 469 131 ----
NM_015071chr554768 2075 2004 822 265 22209 1184 46255 4276 4159 1017 11945
NM_015074chr154813 4274 3784 1891 1821 --2888 426 21474 246
NM_015076chr643958 1806 1490 380 33968 928 473 23659 1500 --
NM_015092chr1654293 3728 3581 3317 2935 --54681 4268 3364 3357 1164 13879
NM_015094chr2234455 4422 1310 --53352 1226 906 634 615 11023
NM_015100chr13408 397 251 --32036 1598 1462 --
NM_015110chr911886 1727 11910 21530 953
NM_015115chr432542 1008 563 12874 11014 22744 1295
NM_015129chrX21750 1187 --21743 1737 11796
NM_015130chr421037 74 --11316 1133
NM_015137chr852620 2048 1038 289 253 --32545 412 315 12061
NM_015138chr1511025 --22799 281 22652 1057
NM_015144chr1643940 3271 2792 444 23934 692 23924 2680 13989
NM_015155chr1073244 1248 1129 972 793 347 135 12310 12069 --
NM_015156chr1443006 2741 1559 895 --23876 1581 13017
NM_015170chr832011 1660 1439 11916 32279 2056 1989 --
NM_015172chr11416 --21275 1182 11158
NM_015185chrX52155 717 510 292 216 --2436 207 --
NM_015192chr2042663 2524 2222 616 --22656 241 1339
NM_015199chr343022 802 574 460 --1589 12411
NM_015208chr1893759 3716 3543 3261 1320 1102 635 623 478 --22666 1540 1735
NM_015209chr122167 316 1736 4527 363 357 351 --
NM_015213chr114790 682 653 642 ----1712
NM_015215chr143129 2470 585 185 1633 43160 2114 1939 980 32257 66 54
NM_015216chr541477 1355 564 110 ----196
NM_015247chr1685225 4863 4668 1173 1064 743 547 223 --1606 --
NM_015265chr242541 140 107 71 11948 4146 99 93 86 --
NM_015271chr444059 3992 3669 830 192 24347 4010 23676 846
NM_015278chr653412 3348 2416 1230 787 1795 11083 12545
NM_015291chr123444 3198 13007 33463 3457 3141 22737 1185
NM_015310chr878302 7787 6344 5248 313 285 50 18338 26440 2021 18277
NM_015313chr1143366 3340 1467 397 14565 44170 3898 3119 787 11759
NM_015314chr752477 2169 1038 754 560 --21670 109 1652
NM_015315chr52884 722 --93053 2901 2467 2461 2455 2449 2238 960 890 --
NM_015321chr1954947 3579 3089 1572 912 13531 11689 1998
NM_015335chr1252190 2076 2038 632 618 12013 --21894 351
NM_015336chr1262455 2057 1964 1762 584 440 --1709 12545
NM_015344chr851970 1600 872 814 627 2748 454 1277 --
NM_015347chr1222529 1084 --2713 506 12764
NM_015349chr652942 508 495 471 298 12316 2963 304 --
NM_015355chr171776 --5782 746 526 349 76 31974 706 83
NM_015358chr2161270 972 888 234 177 78 --21104 301 11219
NM_015359chr822940 1910 --12168 11885
NM_015365chrX73921 3091 2996 461 370 251 198 1430 74055 3747 3738 611 482 351 310 --
NM_015385chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_015387chr23502 481 117 1205 32079 1392 384 12096
NM_015393chr443183 473 332 112 11327 32935 136 130 --
NM_015397chr941842 1482 179 101 11310 2595 192 11908
NM_015423chr113658 420 105 --21621 1390 11381
NM_015436chr483320 721 561 549 536 247 218 109 13043 ----
NM_015443chr1741159 486 170 158 1108 2190 176 --
NM_015455chr543277 2754 2545 1277 --12748 22620 717
NM_015458chr884280 3709 3232 1902 1282 1112 930 861 1756 31816 943 435 --
NM_015475chr241026 974 803 433 1332 --1340
NM_015550chr753537 2431 993 958 836 13050 1978 --
NM_015554chr1572950 2388 2372 1008 702 587 105 --32430 2424 1079 --
NM_015555chr631669 429 155 --2122 71 11238
NM_015569chr154572 4429 951 636 313 --13074 11909
NM_015570chr71163 --51624 1489 1279 743 730 --
NM_015575chr263568 3302 2435 2411 2344 845 --53443 3314 3308 671 381 --
NM_015578chr1961766 1496 780 388 319 125 11867 41359 808 142 131 11294
NM_015602chr131641 1385 262 --31424 676 529 21692 1463
NM_015640chr195387 4807 4532 4379 1874 1667 1347 861 149 25254 3849 1367 21639 237
NM_015691chrX72255 2008 2001 466 279 190 41 1270 22889 2019 11923
NM_015850chr831860 830 370 --11853 22030 794
NM_015866chr131143 547 375 --41407 945 541 315 --
NM_015878chr842216 2077 656 645 21500 342 1572 12203
NM_015879chr1858224 7241 3392 1139 394 --12268 48625 5812 2983 2548
NM_015886chr865429 4991 4173 3969 2056 1601 --35751 4547 114 --
NM_015888chr1----1407 22252 314
NM_015906chr144826 4703 897 833 24865 571 54676 1753 1031 538 461 --
NM_015912chr81157 --32507 539 249 12514
NM_015975chrX31308 710 87 --51494 1314 1237 257 172 --
NM_016009chr174784 1783 1705 1640 591 560 526 24446 729 2289 208 13787
NM_016021chr642660 2593 761 340 12577 22859 255 --
NM_016023chr841554 689 294 28 --1843 2322 143
NM_016025chr1611860 --32001 1691 359 2475 180
NM_016090chr112938 754 --1899 2996 26
NM_016132chr1563146 1321 929 366 313 37 1188 53368 3362 3333 2338 1327 2269 239
NM_016133chr251215 1021 650 575 107 ----11442
NM_016144chr51613 1314 2623 82 1272
NM_016203chr721034 1026 1271 21016 896 1206
NM_016206chr3168411 8307 8102 7382 7369 7359 5644 5441 3032 1582 1561 736 598 284 142 74 25868 2090 68069 7375 6239 5561 1041 604 46714 5934 988 659
NM_016216chr32724 34 --240 23 --
NM_016231chr173439 315 233 --31533 667 321 --
NM_016248chr1343554 2442 1606 1065 42712 1475 996 283 53623 3279 2755 1041 775 22646 494
NM_016255chr632927 708 389 2762 575 13046 22876 801
NM_016260chr2127173 6990 6819 5802 5464 5454 5169 2494 1063 875 592 384 37609 4959 786 55476 2669 2147 1561 698 27342 6704
NM_016277chr621534 1514 21431 87 11547 1646
NM_016289chr232178 872 122 --1142 12075
NM_016306chr3167 --181 2363 88
NM_016315chr221890 668 11833 21420 103 1432
NM_016322chr973237 3122 2143 1279 1254 1027 482 12179 11999 12303
NM_016356chr632623 976 207 22848 873 32749 987 950 --
NM_016374chr121248 1240 --21294 447 11077
NM_016374chr121248 1240 --21294 447 11077
NM_016396chr1592931 2816 2509 1157 955 603 577 552 452 --12830 12282
NM_016441chr231784 1711 899 21470 228 42362 2356 2139 210 --
NM_016472chr14----11174 21136 108
NM_016507chr1793108 2818 2661 2651 2087 995 450 442 293 --32267 2130 1001 --
NM_016530chr1593920 3226 3143 3001 2524 1519 1257 251 241 11214 24075 623 11127
NM_016544chr253614 3239 2949 2480 81 12656 22673 1186 --
NM_016562chrX21110 92 ----21046 66
NM_016569chr1221524 1401 --21159 1046 1603
NM_016587chr73733 158 124 --2972 374 1443
NM_016620chr141274 1062 575 422 --2550 327 1203
NM_016651chr1441134 1006 417 195 --3938 263 35 21081 79
NM_016652chr2021196 25 --31280 630 209 11451
NM_016654chr1521248 216 --2927 289 11400
NM_016937chrX21026 626 ----2980 955
NM_016953chr245957 1274 711 280 25984 1574 45665 1930 1558 1536 16138
NM_017420chr1443797 3321 2409 320 12368 53807 2419 967 737 397 --
NM_017437chr1461987 1772 625 452 254 80 --52000 1993 1978 1668 537 3869 796 517
NM_017447chr2183162 3135 3103 2989 2837 2784 624 93 11190 44059 3030 1561 707 21291 564
NM_017563chr366404 5673 4307 2244 2018 1256 11287 36369 5092 4814 14759
NM_017617chr951504 1046 637 277 209 ----21266 111
NM_017628chr475072 4849 4430 1158 1041 191 115 --64855 4842 3552 1652 1639 1632 --
NM_017633chr642453 1278 551 109 13101 --43360 3303 1157 1149
NM_017637chr9119262 9252 7557 3451 3316 3051 2513 2424 1817 1670 1564 --68165 7882 3659 2504 2430 2029 29276 717
NM_017643chr1722206 1165 22864 2601 22479 2463 12618
NM_017644chr385121 4443 4326 3656 3365 1041 840 520 21381 758 23977 1669 24688 626
NM_017645chr983166 3011 2657 2552 1996 830 816 359 --1107 13183
NM_017650chr775402 1808 1683 1339 1118 299 252 15946 65986 5565 2215 1837 1702 1346 --
NM_017655chr131407 498 357 1249 31298 318 80 --
NM_017658chr1473263 1443 1003 884 774 479 72 --14492 --
NM_017684chr1591992 1807 1416 1258 406 381 149 141 117 1166 21561 395 11816
NM_017705chr1533771 1251 660 12578 1711 11333
NM_017709chr184045 3212 3152 1469 1459 1066 973 898 --31624 1051 372 14019
NM_017736chr1642154 453 163 93 33107 357 337 33164 2967 488 32868 2749 2695
NM_017737chr141884 1473 525 362 --11963 1175
NM_017744chr122248 785 --42008 2001 1994 1988 --
NM_017745chrX--2586 193 1164 1257
NM_017758chr173350 97 64 --4117 110 103 79 --
NM_017769chr1453272 2827 2121 324 175 23110 2970 22430 2159 22520 542
NM_017778chr821110 295 --2288 94 1303
NM_017779chr1--2929 637 --2533 227
NM_017801chr362505 1005 729 512 434 401 --32217 980 960 21807 265
NM_017811chr923024 946 21254 1074 31010 1004 700 1334
NM_017813chr865653 5056 4563 1888 967 663 25438 5150 35513 5065 4076 65708 4805 3988 1821 1571 670
NM_017824chr1062503 2209 1931 782 334 58 11779 2558 376 42699 1716 1070 194
NM_017848chrX33143 450 362 13724 24378 460 24270 578
NM_017919chr925260 4203 --25693 5593 24376 4354
NM_017944chr1143120 2095 1184 171 ----1567
NM_017994chr762828 2225 1969 1002 564 556 12866 4591 584 576 570 1324
NM_018003chr1572399 1959 1943 1870 917 136 30 ----11925
NM_018011chr13174 --393 87 81 1590
NM_018017chr1092815 2603 2564 2342 2289 1847 615 604 114 1674 1206 12824
NM_018032chr163879 311 304 --1317 1344
NM_018061chr141621 709 356 281 1626 1243 1181
NM_018078chr431047 844 710 --1210 2977 965
NM_018084chr263054 893 770 516 373 314 --33249 2836 740 --
NM_018092chr161433 --31638 1552 1148 1148
NM_018115chr4----3638 632 623 1152
NM_018120chr82383 50 1108 21179 231 11415
NM_018121chr1022185 693 --13058 21077 595
NM_018133chr342222 2017 1468 1369 --21644 1521 22129 123
NM_018151chr23762 230 27 ----1723
NM_018178chr121894 1362 --21708 392 2413 88
NM_018181chr1841723 1296 1247 279 --21255 748 1431
NM_018191chr132778 278 --21964 114 11431
NM_018200chr1522538 403 --52584 2553 1905 1599 744 21643 42
NM_018227chr4----53216 2920 1062 957 948 23164 1089
NM_018247chr653077 1974 1090 1079 945 --12010 3926 864 726
NM_018254chr152421 1507 837 292 185 ----1304
NM_018257chr203704 537 140 --31900 1804 233 12108
NM_018293chr332363 2142 218 --31190 1075 437 12411
NM_018299chr873094 2204 1253 1235 1143 1049 632 22894 384 13381 12887
NM_018302chr432243 1836 1643 1572 --1787
NM_018312chr1131999 777 569 1409 41352 822 812 586 --
NM_018313chr352432 2093 366 344 325 --32445 2132 350 22549 2312
NM_018323chr451835 1675 1610 575 157 --21553 1243 149
NM_018339chr921629 657 11526 135 11843
NM_018351chr1264617 4467 4454 3160 1777 138 13345 33255 334 175 1693
NM_018362chr1173925 2678 2641 590 448 354 51 21484 657 53172 3166 3159 2672 2652 23478 236
NM_018364chr154097 3956 3500 3430 237 33969 3450 2723 33799 3571 3506 1373
NM_018374chr7114548 3427 1606 1597 1590 1557 1238 1172 1014 973 444 --21384 553 44524 1202 651 379
NM_018403chr374080 4065 3859 3515 2704 1490 207 31648 1509 490 53678 3491 3157 850 143 33835 607 275
NM_018440chr898436 7895 6883 3143 2759 2739 1081 525 391 22465 1260 48525 7343 1904 1826 68362 7020 6474 5391 3177 3057
NM_018444chr811740 2674 496 31653 1633 552 11640
NM_018448chr1231080 871 226 --1163 2792 444
NM_018452chr6_random33117 1447 193 --13478 1966
NM_018477chr142875 83 --1773 11064
NM_018489chr132277 694 328 --32035 1995 1742 1769
NM_018490chr1141880 1758 707 287 --11274 3657 605 529
NM_018566chr1124976 4965 4641 3659 3349 1798 1580 1384 1041 926 823 61 --24958 3971 24444 3148
NM_018590chr1051711 1140 1107 256 190 --11615 21657 602
NM_018638chr1295303 4517 4343 4304 3842 2265 2100 1022 380 14198 55373 1831 1225 854 326 53913 3622 1720 1042 749
NM_018650chr141596 1578 486 57 41961 1872 642 384 31984 1789 750 --
NM_018657chr31758 ----2715 166
NM_018695chr522388 884 32139 764 227 2426 270 22021 626
NM_018700chr521323 600 11229 21356 1197 1465
NM_018718chr761896 1497 572 358 310 303 1297 1316 --
NM_018834chr52201 116 ----2390 53
NM_018841chr123952 2835 12865 12954 13668
NM_018847chr931732 412 192 1312 21937 1715 1684
NM_018890chr741489 1110 1042 606 11156 --11452
NM_018932chr5--1667 2611 309 1285
NM_018958chr1523136 2971 --43423 3356 682 638 23791 3130
NM_018976chr1242889 1131 691 159 --1170 186
NM_018999chr1074705 4613 4438 4158 2993 1405 1205 13380 54837 4525 1915 1901 1894 14447
NM_019000chr52346 124 11106 11147 1274
NM_019001chr394713 4375 4233 3486 3119 3075 1837 1196 521 --24369 1349 23565 1650
NM_019004chr731505 744 405 21960 1795 --1917
NM_019022chr1823145 2876 --33217 2837 2194 12596
NM_019027chr441759 883 288 166 31823 1652 157 3917 910 300 12501
NM_019050chr441834 1805 1756 1664 21576 692 1573 --
NM_019063chr22680 569 --2350 129 12205
NM_019084chr1022354 448 22623 1783 11801 1832
NM_019087chr531509 1157 462 --1621 11728
NM_019094chr1232646 469 296 22362 121 31246 372 139 --
NM_019114chr942042 961 439 196 ----1811
NM_019116chr1622538 576 11015 43156 2384 449 355 13654
NM_019590chr103957 346 179 --21239 1071 172
NM_019885chr222820 2701 --32856 2071 311 12780
NM_019891chr111304 ----3453 292 249
NM_019895chr3------2467 83
NM_020122chr285561 4280 1289 1222 1175 1070 827 381 35322 1768 782 36036 4175 1636 1900
NM_020159chr421238 252 --31603 638 421 21245 1193
NM_020193chr1131286 1063 415 11193 1434 11017
NM_020198chr1731459 1321 1186 --1479 1579
NM_020205chr143479 2951 2555 2307 23497 3294 13328 22698 2650
NM_020228chr1142354 1871 464 201 1472 12369 12279
NM_020245chr663401 2007 1779 1672 1658 900 --84843 4611 1493 1487 1481 1474 1461 1448 13552
NM_020337chr463113 3046 2824 2803 2290 2048 --22161 1201 42722 2275 2181 2099
NM_020338chr1013239 --11016 23251 3089
NM_020342chr242510 762 739 409 11898 32567 745 166 --
NM_020390chr31310 33835 730 236 64726 4164 4075 3215 856 785 1123
NM_020416chr432480 2202 1644 --21655 557 12495
NM_020425chr64689 661 380 323 1524 31586 1580 263 21993 1631
NM_020432chr731983 1773 1648 --21725 1558 11760
NM_020440chr123316 1251 --43358 1167 663 234 1541
NM_020443chr166639 6559 5746 5016 983 908 1834 46715 6480 5728 5157 1845
NM_020453chr411327 1411 2639 88 11473
NM_020466chr673920 3744 3737 3280 3184 3048 44 24281 1902 15004 --
NM_020640chr371938 1867 922 875 866 652 509 1321 11996 --
NM_020651chr251696 1565 316 86 59 11493 21378 284 1661
NM_020654chr361642 1625 1575 1472 1199 304 --31545 1531 1174 --
NM_020662chr641767 695 626 28 ----1245
NM_020673chr2087750 7693 7069 7063 2748 2345 2327 2231 31394 1012 86 27602 2917 17624
NM_020711chr2----32464 2079 1725 11816
NM_020718chr1696476 5729 4551 4407 2379 2047 1491 90 23 46338 6231 2216 1667 35719 5703 4435 15909
NM_020727chr2153803 2911 2643 327 320 23772 3449 --23632 2725
NM_020734chr1252893 1199 1128 948 753 --43356 1326 557 334 33318 2811 1228
NM_020742chrX2996 582 --32674 191 117 21990 698
NM_020766chrX63756 1750 1447 1321 769 66 --34579 651 417 11626
NM_020768chr552366 1181 1090 432 337 12746 --1957
NM_020771chr641517 1366 1359 144 11413 2354 173 --
NM_020772chr17138566 8393 7866 7682 7195 6801 3389 2594 2213 1618 1611 286 268 11206 65664 2922 2135 2127 964 955 55573 3248 1124 1078 293
NM_020774chr1865326 4922 2148 1854 1442 851 11486 64948 3984 2004 623 192 185 45251 2211 1746 817
NM_020779chr213186 --53013 1056 1019 264 231 22091 806
NM_020782chr1294686 4298 3967 3960 1525 984 758 407 43 14870 23928 3889 34630 3213 1154
NM_020794chr111538 --31127 255 249 1262
NM_020796chr512769 12010 32469 2107 1994 22366 1968
NM_020801chr552670 2655 2586 883 657 --22661 897 11675
NM_020810chr1432955 755 497 23191 90 23006 669 2677 462
NM_020821chr1591992 1807 1416 1258 406 381 149 141 117 1166 21561 395 11816
NM_020825chr1643762 3634 2781 731 --23041 721 13831
NM_020830chr233280 2832 151 --23270 3117 11017
NM_020841chr1243953 3669 2672 629 13508 41593 1349 886 805 11236
NM_020871chrX3921 743 471 ----12194
NM_020918chr1053663 2776 1318 908 818 --33362 2471 2295 1614
NM_020921chr1473202 2841 2792 846 315 300 139 11036 13658 11403
NM_020935chr274644 4603 4568 4539 4456 3573 627 34062 1799 1521 34613 1451 762 --
NM_020940chr1042928 2186 994 726 --12080 42704 2397 1839 187
NM_020948chr183628 3559 3478 3254 3122 3103 1009 831 ------
NM_020951chr1962102 464 310 256 227 23 --12400 1113
NM_021007chr231533 749 366 --12221 2638 112
NM_021030chr191247 --3267 260 253 --
NM_021033chr1363423 3109 3054 2631 1258 1196 21294 192 23125 555 13145
NM_021038chr323324 1269 11355 13018 1719
NM_021083chrX63348 2271 944 862 509 352 1406 12729 23070 2611
NM_021097chr253083 1202 914 356 285 --33039 367 291 23077 304
NM_021132chr1021310 998 --21037 345 1841
NM_021140chrX4894 847 234 74 ----1332
NM_021148chr761760 822 794 750 692 97 --1845 32313 2129 1740
NM_021163chr793557 3493 3082 2740 1212 1012 685 588 510 3762 715 453 1915 --
NM_021190chr121013 430 21320 540 2108 102 --
NM_021205chr11752 12383 --32844 2491 874
NM_021215chr2082237 2118 2098 2092 1949 1801 1678 273 --42349 2335 2251 2243 --
NM_021229chr1221067 981 --21028 221 11245
NM_021255chr1454027 3360 1467 942 301 1290 ----
NM_021622chr1042067 1588 1497 925 21629 94 1903 --
NM_021629chr354332 3478 1430 1257 1094 13590 14753 24827 1528
NM_021644chr101826 --21098 164 1118
NM_021647chr433494 3124 419 14039 33949 3365 2984 13442
NM_021648chr622475 674 --22314 2241 12774
NM_021809chr2061787 914 890 703 629 82 --32508 986 500 --
NM_021813chr675633 5024 2339 2229 2063 1577 1564 45790 5646 5443 1273 115519 4287 4281 4275 4268 2235 818 812 806 800 771 --
NM_021912chr1543966 596 429 314 172 13869 23342 580
NM_021954chr13--12734 33281 2385 853 12773
NM_021961chr1197156 6812 6145 4774 2863 2454 1660 1536 433 14622 37047 6097 1612 17392
NM_021964chr3126564 5875 5625 5605 4188 4121 2197 2185 2119 1882 376 230 32381 2219 1917 21343 576 56334 5587 4510 2321 1803
NM_022048chr1544810 4706 839 761 24605 356 54766 4615 4597 4583 1619 26239 1656
NM_022049chr12510 242 1603 1338 11337
NM_022080chr201236 1753 --22196 316
NM_022118chr13------2402 243
NM_022130chr551148 260 115 74 52 ----2926 196
NM_022166chr1645781 4770 4763 1599 35850 5678 1147 44051 4045 1877 1630 26329 5825
NM_022351chr833830 2834 608 13570 33518 1205 956 13693
NM_022459chr13106041 4857 4698 4247 2486 2432 1897 1878 1506 933 --55695 5596 4385 2423 1826 --
NM_022474chr1441876 930 894 635 ----21962 291
NM_022491chr1283353 3249 2977 1170 416 233 68 57 1776 22788 304 12731
NM_022495chr14----1510 2531 41
NM_022552chr22508 320 --41133 493 486 474 --
NM_022574chr741518 350 336 196 --1342 --
NM_022739chr17------2793 755
NM_022753chr131875 244 79 12471 32778 2306 254 11837
NM_022756chr141522 488 435 363 --2451 443 1466
NM_022763chr383210 2995 2887 2233 1263 594 145 111 --53059 2567 752 265 91 1301
NM_022770chr1611243 ----21264 871
NM_022780chr23757 708 259 --41505 729 722 550 --
NM_022781chr982713 2389 2348 1329 1170 813 602 267 --33092 2763 2734 --
NM_022817chr252107 1626 869 148 124 11673 32069 1633 478 1207
NM_022832chr452589 1656 1607 697 333 --12068 1157
NM_022841chr1542675 2433 956 370 --22768 2546 12780
NM_022843chr1321003 34 1147 --21465 449
NM_022845chr1671843 1811 820 460 415 370 228 ----1488
NM_022893chr232752 2743 995 --33133 348 191 13026
NM_022894chr231224 356 143 --3371 362 67 --
NM_022897chr511028 ----21049 223
NM_022898chr1474141 3064 1572 1033 822 603 568 11295 31866 609 340 --
NM_022912chr223051 1039 1433 21954 358 12552
NM_022918chr1131760 753 130 --22093 136 21782 834
NM_022977chrX22501 1652 151 1284 22649 256
NM_023000chr1441737 1417 1141 462 31386 1189 692 2446 249 --
NM_023001chr1441737 1417 1141 462 31386 1189 692 2446 249 --
NM_023015chr1----3743 733 721 1782
NM_023105chr831860 830 370 --11853 22030 794
NM_023106chr831860 830 370 --11853 22030 794
NM_023110chr831860 830 370 --11853 22030 794
NM_023111chr831860 830 370 --11853 22030 794
NM_024007chr552755 2246 1935 1193 370 12347 12436 1387
NM_024052chr1732811 1252 786 1872 21258 1027 23007 243
NM_024341chr1911600 --34139 2580 782 24052 471
NM_024408chr132925 2744 2716 12597 21410 861 13165
NM_024416chr911184 --31342 1317 499 1273
NM_024429chr721034 1026 1271 21016 896 1206
NM_024496chr144700 652 577 559 --2706 570 --
NM_024524chr392880 2526 2487 1072 1040 933 880 340 326 12691 --32061 903 487
NM_024546chr1331233 910 251 --4993 337 293 281 --
NM_024590chr431937 1324 537 --21544 595 2769 119
NM_024613chr861677 1636 1425 717 288 89 ----21867 318
NM_024665chr3144468 3935 3812 3294 3188 3162 2861 1355 1012 995 926 765 485 325 14502 74150 3833 3824 1143 1023 797 758 24339 1254
NM_024692chr221846 310 --1316 21836 1160
NM_024715chr551885 559 425 407 170 ----1230
NM_024721chr852513 2484 2169 1822 1769 --22327 134 --
NM_024740chr1123686 3529 --22674 280 12693
NM_024749chr13612 562 433 --41629 719 713 497 --
NM_024751chr432059 1924 421 1215 21758 428 11633
NM_024761chr985141 4491 3867 3663 1746 1470 1268 422 1469 14986 --
NM_024818chr351492 1465 1360 1005 273 ----11279
NM_024834chr1031256 210 84 11438 41699 1570 419 404 --
NM_024896chr951990 1983 1027 770 677 --21002 690 22385 1936
NM_024930chr53766 732 537 --62796 2066 229 223 217 211 --
NM_024947chr3178520 8217 8065 8056 8042 6466 6311 6216 3779 3322 3157 2428 1856 1522 640 628 408 49159 3828 2530 2031 28913 8709 47676 2715 1529 916
NM_024949chr444360 3554 844 95 --176 11846
NM_024953chr1272342 2335 946 623 612 485 403 --22352 2318 --
NM_024989chr266193 5145 5012 518 288 185 27350 2845 77539 5914 5737 3181 2191 1659 599 28075 5261
NM_024991chr1083004 2997 2964 2822 2254 2108 2047 853 --32083 872 716 --
NM_024993chr211282 ----21451 1049
NM_025073chr154691 4649 4588 964 810 --23681 3162 24037 275
NM_025113chr1351180 252 239 222 82 --21271 921 --
NM_025133chr24896 831 744 204 ----1297
NM_025134chr1642464 975 652 536 12133 --1643
NM_025146chr332646 1925 1715 22414 441 4927 692 199 121 --
NM_025154chr721207 1104 11148 1553 21173 261
NM_025191chr152883 2753 2449 2395 1133 --42455 2432 1139 1061 11146
NM_025208chr1122392 764 22082 2044 42401 821 697 297 11793
NM_025235chr101465 --41986 848 200 182 --
NM_030579chr1643027 2468 1282 1199 --63739 2261 1431 1254 974 894 --
NM_030621chr1463624 2984 723 624 479 206 --34219 4126 318 13133
NM_030627chr563680 3318 1214 434 243 159 53898 3790 3721 2631 343 --13451
NM_030629chr1641708 1674 1667 1478 --11680 11694
NM_030647chr776237 6096 5692 4421 2150 2131 985 35836 1408 452 25073 629 12060
NM_030648chr495478 4961 3969 3762 3698 3688 518 357 332 11867 33889 1329 1260 --
NM_030664chr1032168 2153 658 11554 41990 1528 868 293 --
NM_030674chr1265806 5702 1071 1031 926 291 25880 4906 25402 1968 --
NM_030755chr1431099 736 565 1610 52390 2384 2378 2235 879 --
NM_030780chr8--11204 1161 21511 1443
NM_030791chr1451820 1393 670 639 175 --1354 1554
NM_030806chr167738 7704 5878 1916 1892 806 --23475 2439 1766
NM_030816chr143416 2742 1342 177 23407 2655 --51296 922 708 479 296
NM_030881chr2241852 556 423 373 1892 42460 1830 1508 379 --
NM_030885chr331527 913 863 2604 390 21884 310 32249 2236 444
NM_030915chr241919 1834 154 126 1746 2289 59 1442
NM_030920chr142111 2004 1616 1479 11498 --21299 744
NM_030938chr1741144 1084 1063 824 --41120 1010 391 217 --
NM_030939chr651055 930 802 358 50 1895 2823 62 --
NM_030949chr63356 196 106 --1112 1538
NM_031216chr1831587 474 32 1704 41879 1570 1556 1504 --
NM_031296chr462594 2352 2198 2016 603 566 1192 31986 652 434 12375
NM_031314chr1451858 1422 1408 729 688 1286 31717 1289 570 --
NM_031371chr121248 1240 --21294 447 11077
NM_031371chr121248 1240 --21294 447 11077
NM_031431chr1311168 --21471 180 11853
NM_031445chr242973 2367 978 455 --23203 2770 12832
NM_031453chr1032377 2357 336 12505 --22548 762
NM_031468chr738273 5882 1678 --58185 7426 2468 2153 231 11314
NM_031469chr643599 2687 2611 566 --33834 2594 139 22907 2724
NM_031844chr153276 2942 2650 1072 557 --34085 3034 64 23325 1633
NM_031845chr283689 3358 3350 3212 1454 1010 476 257 12302 23644 1295 --
NM_031847chr283689 3358 3350 3212 1454 1010 476 257 12302 23644 1295 --
NM_032042chr521098 471 12540 1102 32732 1971 618
NM_032047chr311738 2821 810 --2689 26
NM_032102chr1163104 2489 1236 1180 1060 299 13134 42987 1001 665 570 --
NM_032116chr1394962 4784 4539 4395 3935 1876 1487 342 107 24030 1322 25812 1098 2929 761
NM_032145chr661697 1487 1426 787 408 127 --41906 1863 465 341 21729 593
NM_032160chr1844265 646 308 148 13523 1604 14209
NM_032186chr141274 1062 575 422 --2550 327 1203
NM_032199chr1012630 --53783 2503 2412 700 689 21483 1309
NM_032208chr242895 2600 2223 983 --42731 1007 1000 912 12698
NM_032228chr11103257 2963 2821 2626 2617 2607 2353 1303 818 769 --32973 704 454 --
NM_032250chr93868 788 326 ----1771
NM_032256chr1211015 1828 51042 1036 1029 686 162 1332
NM_032268chr163980 555 529 --1351 1812
NM_032288chr342186 2050 352 139 --12316 11880
NM_032373chr1065126 3864 2023 1948 1739 479 64880 4820 3664 1461 1328 374 24836 1753 --
NM_032410chr831059 936 165 1182 1450 1441
NM_032433chr1931588 1275 534 21556 1360 21295 1289 --
NM_032435chr141778 1710 1703 807 --3425 296 184 195
NM_032439chr1021531 1134 --2171 88 1266
NM_032440chr1042915 2628 1902 1798 12076 2333 314 1355
NM_032458chrX42803 2478 1376 486 11079 52809 2498 2377 403 168 11303
NM_032505chr331815 1787 640 --32561 2441 1793 21800 502
NM_032509chr82805 90 12409 149 2206 130
NM_032510chr1852486 2323 2165 1705 934 1472 193 2367 317
NM_032557chr4------2401 140
NM_032558chr921127 947 11463 1165 1998
NM_032632chr1471967 1721 1422 1258 682 437 117 11896 1823 --
NM_032682chr31692 --23550 3443 22302 726
NM_032778chr353300 3238 2585 1029 401 12398 12268 13131
NM_032784chr621029 350 --1894 1338
NM_032804chr1052497 2345 1804 420 340 22168 1651 11949 1464
NM_032828chr1931633 1208 1192 11949 33454 1507 613 1309
NM_032859chr1322837 155 12698 53932 2823 698 675 571 13761
NM_032873chr1111610 --23033 1146 11622
NM_032900chr1073935 3825 2447 809 477 429 420 13839 42493 2423 492 456 1401
NM_032905chr101164 --1386 11247
NM_032968chrX53461 3095 2862 1359 501 --24253 587 2495 298
NM_032969chrX53461 3095 2862 1359 501 --24253 587 2495 298
NM_032973chrY63457 3427 3090 2857 1359 501 1495 24245 587 1298
NM_033014chr911184 --31342 1317 499 1273
NM_033020chr144826 4703 897 833 24865 571 54676 1753 1031 538 461 --
NM_033030chr261593 1506 1319 508 273 229 21098 591 11344 --
NM_033055chr13398 249 174 150 --11039
NM_033135chr1122392 764 22082 2044 42401 821 697 297 11793
NM_033138chr73632 377 73 --1383 1880
NM_033139chr73632 377 73 --1383 1880
NM_033140chr73632 377 73 --1383 1880
NM_033143chr414457 124 3759 745 491 1928
NM_033157chr73632 377 73 --1383 1880
NM_033222chr931173 141 118 2391 52 --31433 1261 967
NM_033224chr722191 2105 42875 1836 1625 1471 67409 7145 3141 2394 2157 712 --
NM_033225chr832699 1989 953 1202 31137 1126 427 13006
NM_033285chr853895 3823 2956 1121 569 24474 3381 64275 4075 4050 3920 2781 1569 24303 1622
NM_033290chrX43426 1523 830 524 12679 13194 11510
NM_033326chr113354 180 153 --32321 2204 214 22475 419
NM_033360chr12114260 4118 3520 3082 2953 2893 1741 488 329 289 204 1548 44479 3936 3433 2982 14297
NM_033380chrX2825 27 1421 11121 1849
NM_033381chrX2825 27 1421 11121 1849
NM_033389chr1764670 4574 3931 3002 1826 633 --44010 3540 290 146 14826
NM_033425chr1163403 3070 2231 1405 1183 716 ----13417
NM_033430chr484121 3464 3255 839 608 346 313 198 11584 33102 1524 354 1164
NM_033437chr484121 3464 3255 839 608 346 313 198 11584 33102 1524 354 1164
NM_033505chr232247 2068 1803 14835 36554 5548 2505 34610 381 316
NM_033551chr52884 722 --93053 2901 2467 2461 2455 2449 2238 960 890 --
NM_033624chr1252102 1902 712 658 615 ----12002
NM_033637chr1074141 4133 3760 3065 1305 357 309 --21294 1288 --
NM_033644chr562269 1790 1005 562 315 32 --22050 1843 2989 945
NM_033645chr562269 1790 1005 562 315 32 --22050 1843 2989 945
NM_033656chr21115879 5284 4728 4541 4411 3678 2331 1156 1053 705 612 12200 25574 1679 15838
NM_052811chr1364332 4311 4292 2077 1316 25 44057 2018 2004 948 23355 938 15204
NM_052818chr1331858 1421 56 --22058 1490 1697
NM_052851chr1321516 419 1928 12161 11509
NM_052867chr1331286 1062 45 --31241 1075 1069 --
NM_052879chr1243961 3282 1451 73 22900 184 1271 24077 3431
NM_052885chr1274130 3417 1865 1812 1281 874 453 43679 1407 1185 786 34881 3877 1260 1679
NM_052905chr251848 1477 1422 1357 412 11368 11716 --
NM_052907chr1253995 1086 660 651 590 14307 53759 2828 816 714 44 --
NM_052937chr852447 1981 1079 818 220 --21918 785 22109 1868
NM_053016chr931328 1259 1104 25167 1749 25157 5120 21266 440
NM_053043chr7105840 5509 4948 4749 4523 4232 4054 2188 260 249 1379 36201 926 824 1267
NM_053056chr1172646 2142 2101 2063 2057 1081 918 22445 322 21054 140 --
NM_053064chr1463085 2943 2272 1919 969 816 22044 59 ----
NM_057175chr441824 400 141 133 1666 12547 1279
NM_058237chr141108 --1967 194
NM_080664chr1421396 787 --5604 304 298 290 31 --
NM_080676chr201915 12981 --33076 2286 1292
NM_080759chr1382483 2295 2262 1816 897 687 553 167 --1321 22546 732
NM_080760chr1382483 2295 2262 1816 897 687 553 167 --1321 22546 732
NM_080764chr2273315 3153 2482 2381 684 603 460 22973 200 23108 2659 --
NM_080867chr1464623 4172 1975 1009 874 221 44941 4766 4548 1262 11089 1228
NM_080927chr373109 2493 2313 2264 2088 2061 1111 22299 2204 53120 3100 2115 2047 1265 23326 511
NM_130391chr963490 1184 1002 840 647 506 --23234 846 --
NM_130392chr963490 1184 1002 840 647 506 --23234 846 --
NM_130393chr963490 1184 1002 840 647 506 --23234 846 --
NM_130436chr213451 441 279 42368 2094 2021 486 2398 54 138
NM_130438chr2131028 1018 856 42945 2671 2598 1063 2975 631 1615
NM_130440chr121435 442 --41586 665 650 448 11238
NM_130798chr154612 555 486 83 1236 2352 161 1258
NM_130809chr532656 2452 2084 1109 --2999 542
NM_133265chrX52606 2402 1038 429 76 1296 1114 13303
NM_133334chr445444 4267 1838 888 --24509 2302 22534 108
NM_133445chr953714 2753 2724 2387 1524 2396 322 2588 207 --
NM_133468chr71356 --11572 22533 281
NM_133493chr674508 4007 3644 3079 1297 105 60 --43009 1753 272 66 24040 1382
NM_133496chr143212 1675 1123 663 33520 595 259 74464 2898 2890 1444 976 310 304 53491 3077 1211 676 326
NM_133631chr321069 505 31060 168 123 --11562
NM_133647chr1543872 3841 3590 652 --33828 719 33 11344
NM_138270chrX72491 2327 2298 2273 2181 2172 952 --21347 1161 32567 2524 246
NM_138286chr1944146 3308 2895 1631 23818 2912 23787 3505 22995 2656
NM_138316chr1061063 1003 533 503 476 209 --1526 --
NM_138348chr541515 1441 1000 652 25839 4890 35181 4685 1870 25065 1537
NM_138357chr101719 21681 106 --21270 377
NM_138423chr1532253 2227 911 --41781 1629 1584 1493 12218
NM_138444chr1374373 4353 3510 1795 1281 1207 490 23925 1828 54907 4422 3999 3991 3381 31886 1852 1802
NM_138459chr653706 2662 2404 2333 286 23250 2708 23234 2900 --
NM_138468chr244700 1305 512 477 1444 46132 5999 616 585 14666
NM_138473chr1265196 5104 4914 1754 1468 757 13608 51823 1501 1357 763 654 --
NM_138576chr1474141 3064 1572 1033 822 603 568 11295 31866 609 340 --
NM_138621chr264094 3932 3470 1599 333 261 1898 44038 2763 1283 309 --
NM_138713chr1677929 6396 5622 2968 1688 1510 403 21903 1819 33131 1753 812 28182 6315
NM_138714chr1677929 6396 5622 2968 1688 1510 403 21903 1819 33131 1753 812 28182 6315
NM_138727chr122248 785 --42008 2001 1994 1988 --
NM_138728chr122248 785 --42008 2001 1994 1988 --
NM_138731chr1463900 3762 3751 3635 3624 2941 11210 --22904 657
NM_138771chr72526 371 --21555 1549 11562
NM_138782chr53629 589 259 ----11991
NM_138959chr1116790 5349 5315 5272 5118 4346 4230 2663 2227 1836 899 12718 35900 1088 601 --
NM_139076chr4------2108 70
NM_139207chr122558 179 --3805 799 83 11476
NM_139281chr593429 2809 2278 2194 1183 1159 1034 1021 333 --42901 2753 1189 1045 11438
NM_139321chr2023805 655 1845 33946 2574 1525 33420 1021 440
NM_144571chr4156572 6388 6321 4929 4788 2711 2586 2163 2151 2132 1635 1407 1372 678 656 15022 56734 6451 6256 1292 319 21365 230
NM_144578chr1473942 3779 3553 1603 1527 1379 815 1236 25479 4413 1680
NM_144600chr1631475 1108 386 --1230 1211
NM_144664chr1182285 1903 1043 742 645 450 355 348 1398 32367 545 361 2702 467
NM_144669chr12--1276 11514 31842 1279 1238
NM_144767chr1573952 3124 1608 822 799 616 403 --34556 3009 1641 11307
NM_144778chr1342719 1793 1095 780 12573 21944 1930 --
NM_144949chr232366 2224 397 1255 --12267
NM_144963chr832635 2533 2087 --22482 149 22527 829
NM_144973chr1255306 3771 3715 2058 549 13426 45177 3981 3640 1026 --
NM_145055chr1873708 3467 3154 2676 1336 1327 346 23669 1451 43803 1348 1342 1317 13648
NM_145212chr2----21658 613 41325 84 68 41
NM_145259chr257058 6868 5301 2436 2352 46341 6035 2182 316 32273 962 72 12785
NM_145320chr753537 2431 993 958 836 13050 1978 --
NM_145321chr753537 2431 993 958 836 13050 1978 --
NM_145322chr753537 2431 993 958 836 13050 1978 --
NM_145341chr102103 75 11308 41824 340 188 170 --
NM_145690chr831488 670 84 21399 151 11909 1206
NM_145735chr1362809 2590 2257 1135 277 258 --165 --
NM_145799chrX23081 2518 21131 599 23074 3068 13127
NM_145808chr753118 2901 2010 1918 171 --12816 11934
NM_147128chr741520 397 387 28 11664 2426 403 11391
NM_147150chr953892 3442 3048 2618 2607 14011 23821 2507 12880
NM_147175chrX21810 1727 11464 --21845 1560
NM_147189chr842374 2310 821 494 11797 1828 2313 123
NM_148174chr842216 2077 656 645 21500 342 1572 12203
NM_148894chr471175 1139 1122 1035 998 936 147 --1985 --
NM_148977chr1061063 1003 533 503 476 209 --1526 --
NM_148978chr1061063 1003 533 503 476 209 --1526 --
NM_152265chr141587 257 243 236 --2990 265 --
NM_152280chr12692 534 --42526 1319 540 187 21183 816
NM_152330chr1432382 1963 1849 12281 11075 22402 1625
NM_152332chr1482596 2194 1933 1034 949 731 543 203 2845 838 2703 318 --
NM_152388chr242842 2751 867 550 12862 12933 156
NM_152400chr431473 577 122 21707 731 --21677 1603
NM_152407chr593076 2312 2305 2298 2291 1317 1156 493 108 22881 302 62762 2337 2283 2093 1167 499 --
NM_152409chr563407 2380 1262 551 459 128 11256 1115 11304
NM_152417chr821303 1005 --2465 169 11017
NM_152424chrX43879 1076 238 150 21449 139 13798 13430
NM_152470chr1833885 3544 532 --3732 708 657 1715
NM_152551chr632343 876 253 12114 1207 22337 96
NM_152557chr731362 1109 247 1340 3267 260 253 --
NM_152588chr1221713 594 --31680 1616 1598 11816
NM_152594chr152893 194 21952 1560 42024 932 904 472 1653
NM_152624chr586846 6219 5182 2504 2268 1218 387 91 --57092 5138 2672 1882 1860 16204
NM_152629chr933886 1059 208 --53879 3496 1463 615 62 --
NM_152630chrX41464 1327 983 373 11310 1213 189
NM_152641chr1272482 1898 1102 993 715 547 521 12319 12921 --
NM_152680chr422410 393 12006 31692 1608 23 12191
NM_152705chr131989 21416 307 21375 508 1129
NM_152734chr643773 2199 1929 930 25490 1853 33758 1144 1080 13526
NM_152754chr753154 266 259 186 59 --42707 2499 1399 695 33482 3215 1501
NM_152756chr573781 3318 3047 1170 706 527 293 --34283 1074 647 --
NM_152758chr832615 2210 1056 31992 411 155 22443 2195 12827
NM_152787chrX22910 598 33568 2853 799 --1780
NM_152835chr132019 510 289 --42711 2467 1085 604 12734
NM_152838chr2063515 3396 2321 628 618 309 22468 997 22686 67 --
NM_152903chr1352408 2315 1979 386 64 --32016 1916 501 157
NM_152924chr1566594 6577 4730 1183 553 204 11227 55188 4666 4654 1760 1194 15178
NM_152989chr124466 442 406 398 11835 21298 448 21335 629
NM_152999chr765003 4093 4068 3716 229 148 13198 14932 13950
NM_153035chr12882 781 --22836 809 11228
NM_153042chr641801 1652 1525 637 --31740 1172 412 --
NM_153182chr353300 3238 2585 1029 401 12398 12268 13131
NM_153184chr331861 563 339 1311 21307 475 --
NM_153188chr595575 4929 4911 4138 2134 2109 512 490 476 --55121 4771 3858 3807 2155 --
NM_153207chr1273770 3613 3535 3225 3044 859 768 33249 1533 1498 21147 870 14087
NM_153256chr1011865 --2571 502 21350 712
NM_153262chr132921 2330 522 --1269 11959
NM_153321chr172345 325 --21067 331 --
NM_153322chr172345 325 --21067 331 --
NM_153365chr452366 2255 1939 1690 302 1439 --12586
NM_153607chr583074 2796 2542 2429 1244 900 125 75 --23013 709 1396
NM_153619chr1553556 3121 979 442 37 13634 12622 12580
NM_153634chr1221122 99 11138 11369 1321
NM_153645chr2253293 2721 2478 659 74 22857 2638 33237 2897 2660 --
NM_153686chr441987 1775 714 171 --1159 11749
NM_153759chr22508 320 --41133 493 486 474 --
NM_170606chr781765 1442 1369 628 330 323 291 104 --41774 297 285 98 1500
NM_170709chr821956 185 --42239 917 341 296 --
NM_170731chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_170732chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_170733chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_170734chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_170735chr1172879 2575 2260 889 586 560 450 --32586 592 568 12904
NM_172071chr197069 6733 6471 1919 1818 1193 1021 958 374 16049 86751 6482 5719 5684 5161 2998 2991 252 47081 5459 5371 682
NM_172127chr451417 1296 722 457 441 --31900 750 647 --
NM_172128chr441373 678 413 397 --31856 706 603 --
NM_172216chr121152 1290 22948 138 11052
NM_172373chr13------21288 1152
NM_173082chr641481 1264 572 542 2530 488 11455 11571
NM_173156chr132165 2159 803 --52192 2185 2171 2046 1744 --
NM_173214chr1677929 6396 5622 2968 1688 1510 403 21903 1819 33131 1753 812 28182 6315
NM_173354chr2182108 2017 1983 1930 1725 629 148 124 --32189 1993 1936 --
NM_173468chr485969 5538 5448 5330 3886 1633 1258 263 11404 76043 5336 5249 5019 4071 1281 94 64231 2131 2086 378 233 80
NM_173470chrX82163 2134 1048 1014 476 391 305 271 42339 1776 984 527 22887 2756 1975
NM_173473chr1032460 897 190 ----2451 205
NM_173510chr2272652 2447 2425 2305 874 620 213 12945 32844 2643 2359 11127
NM_173511chr283321 3236 3124 2826 2464 921 574 273 --3751 700 279 1542
NM_173536chr4105096 4656 4630 3486 1837 1599 862 498 360 305 34975 3672 1525 1432 11009
NM_173562chr633077 2682 376 --22556 366 11027
NM_173570chr331940 1392 79 --1836 22101 1609
NM_173582chr1186176 5695 5011 4299 2235 2203 1114 305 --15970 12161
NM_173607chr142534 38 11520 1139 21850 202
NM_173642chr177567 6303 3599 1430 1219 949 536 2868 174 37576 3329 823 19224
NM_173644chr2071956 1916 1898 1888 1517 591 280 ----11985
NM_173797chr53960 296 117 ----2242 111
NM_173812chr122607 597 11160 21375 975 31474 582 506
NM_173825chr353060 2161 745 407 45 32180 1239 334 1827 --
NM_173829chr5105750 5463 4163 2321 1772 1753 1219 783 499 419 45953 1816 1741 1017 1672 24968 44
NM_175056chr351822 701 461 428 298 1883 32153 2019 525 --
NM_175607chr331148 295 59 --1126 1608
NM_175612chr331148 295 59 --1126 1608
NM_175624chr1287578 6912 6806 6255 4754 1443 759 27 35553 2634 1234 36287 4787 557 26223 4745
NM_175625chr1287578 6912 6806 6255 4754 1443 759 27 35553 2634 1234 36287 4787 557 26223 4745
NM_175629chr22508 320 --41133 493 486 474 --
NM_175748chr1462034 1966 1893 598 350 288 1272 2557 513 --
NM_175854chr1372592 2315 2052 1038 870 577 404 22356 2340 52403 2386 1971 1860 273 22765 2249
NM_175861chr1254841 1837 1667 1421 1083 15247 24493 2333 13867
NM_176081chr1075701 4668 4428 3767 431 381 73 15476 55041 4091 3793 3759 711 --
NM_176083chr1075701 4668 4428 3767 431 381 73 15476 55041 4091 3793 3759 711 --
NM_176814chr721506 1084 --2314 149 11185
NM_176863chr17--22112 622 2402 339 3607 296 123
NM_177401chr1941621 1506 1225 681 --21627 1577 11513
NM_177424chr11303 1447 11432 21456 35
NM_177438chr1463624 2984 723 624 479 206 --34219 4126 318 13133
NM_177925chr1223073 2239 12438 22562 2229 12954
NM_177966chr3--11308 6336 330 324 318 303 191 --
NM_177974chr1532253 2227 911 --41781 1629 1584 1493 12218
NM_178006chr1321516 419 1928 12161 11509
NM_178007chr1321516 419 1928 12161 11509
NM_178010chr124466 442 406 398 11835 21298 448 21335 629
NM_178011chr1072928 2706 2197 1152 658 476 172 --12024 --
NM_178135chr451250 879 871 262 191 --41260 907 900 206 11307
NM_178151chrX87308 6649 6221 6119 2985 2906 2039 1175 37249 1390 107 26697 4761 26741 901
NM_178152chrX87308 6649 6221 6119 2985 2906 2039 1175 37249 1390 107 26697 4761 26741 901
NM_178153chrX87308 6649 6221 6119 2985 2906 2039 1175 37249 1390 107 26697 4761 26741 901
NM_178154chr142827 504 --5550 526 520 514 259 --
NM_178155chr142827 504 --5550 526 520 514 259 --
NM_178156chr142827 504 --5550 526 520 514 259 --
NM_178157chr142827 504 --5550 526 520 514 259 --
NM_178313chr231891 868 800 --21967 1402 11650
NM_178426chr111914 --41920 1880 1772 466 1154
NM_178427chr111814 --41820 1780 1672 366 154
NM_178565chr8133 11322 139 11484
NM_178585chr422858 2404 --21193 564 12906
NM_178812chr81422 ----21330 1037
NM_178815chr1042596 2391 1702 1691 22329 1753 --22091 230
NM_180989chr1362443 2398 1849 1580 634 185 ----12150
NM_181332chrX2996 582 --32674 191 117 21990 698
NM_181358chr1103661 3614 2781 1578 1550 1241 1014 992 580 149 13429 22920 2677 12715
NM_181481chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_181482chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_181483chr1874836 1993 1980 622 573 475 373 26153 5926 25434 4725 14977
NM_181504chr594211 4159 3187 2844 1199 1091 1022 884 776 --11519 33986 3321 3259
NM_181521chr16137163 6984 5582 4704 4669 2701 2615 2541 2020 1283 1267 1219 58 12648 44914 4854 2895 706 25954 1302
NM_181523chr594211 4159 3187 2844 1199 1091 1022 884 776 --11519 33986 3321 3259
NM_181524chr594211 4159 3187 2844 1199 1091 1022 884 776 --11519 33986 3321 3259
NM_181581chr72875 127 ----2706 333
NM_181645chr111297 ----2725 530
NM_181659chr201791 22470 576 33199 243 194 23159 2546
NM_181659chr201791 22470 576 33199 243 194 23159 2546
NM_181714chr651916 1770 1744 1712 1533 --21950 1274 --
NM_181783chr1211535 ----2606 194
NM_181787chr863419 3396 1209 790 685 52 --23791 835 --
NM_181836chr522625 1670 --1569 12590
NM_181839chr831322 1292 494 ----21126 449
NM_181861chr1262859 2750 2631 2110 1046 462 --2586 196 22118 1961
NM_181868chr1262859 2750 2631 2110 1046 462 --2586 196 22118 1961
NM_181869chr1262944 2835 2716 2195 1131 547 --2671 281 22203 2046
NM_181876chr432480 2202 1644 --21655 557 12495
NM_181897chr332308 1903 1752 --12690 2811 140
NM_182314chrX2770 353 186 --21432 292
NM_182485chr473521 3148 2604 2535 2499 2456 295 1366 43196 2546 236 169 --
NM_182493chr1644065 2167 1547 191 13646 23741 1051 14947
NM_182503chr645535 3742 1897 1218 --25519 5457 1104
NM_182515chr1944395 2662 1714 1526 15539 11725 24902 2514
NM_182565chr172208 195 ----1220
NM_182641chr17--1125 32081 1498 1333 22000 83
NM_182646chr473521 3148 2604 2535 2499 2456 295 1366 43196 2546 236 169 --
NM_182896chr321750 452 --21598 611 11584
NM_182898chr7115862 5414 4305 2556 2546 2519 2412 1750 669 606 241 --34980 2310 1958 24130 862
NM_182899chr7115862 5414 4305 2556 2546 2519 2412 1750 669 606 241 --34980 2310 1958 24130 862
NM_182943chr321123 790 --1805 11174
NM_182972chr152296 2038 1750 978 663 --1670 --
NM_182976chr11129 1197 1517 1710
NM_183227chr621534 1514 21431 87 11547 1646
NM_183416chr11648 --21513 1389 1321
NM_194247chr284476 3513 1721 1564 1467 751 651 407 11103 34353 3630 938 --
NM_194314chr185354 4866 4844 4677 4659 3800 1401 666 --2779 95 45436 5410 4723 4109
NM_194318chr1392063 1860 1791 865 803 697 608 282 232 11024 1877 --
NM_194328chr982713 2389 2348 1329 1170 813 602 267 --33092 2763 2734 --
NM_194329chr982713 2389 2348 1329 1170 813 602 267 --33092 2763 2734 --
NM_194330chr982713 2389 2348 1329 1170 813 602 267 --33092 2763 2734 --
NM_194332chr982713 2389 2348 1329 1170 813 602 267 --33092 2763 2734 --
NM_194434chr1865670 5360 4389 4164 1507 543 34787 4769 4436 24185 1047 24050 820
NM_194442chr151591 1548 1519 626 412 --31731 446 353 11720
NM_197970chr261593 1506 1319 508 273 229 21098 591 11344 --
NM_198158chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_198159chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_198177chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_198178chr393082 2210 1035 1006 907 813 736 709 81 12234 11142 12761
NM_198240chr1211031 1208 2882 225 11043
NM_198243chr151135 1156 --2759 621
NM_198268chr1103661 3614 2781 1578 1550 1241 1014 992 580 149 13429 22920 2677 12715
NM_198269chr1103661 3614 2781 1578 1550 1241 1014 992 580 149 13429 22920 2677 12715
NM_198270chrX53039 2422 1326 988 314 22315 1152 23050 222 13345
NM_198273chr522878 2092 13117 11135 2723 120
NM_198281chr453438 2818 2787 2527 80 1274 --13106
NM_198329chr351492 1465 1360 1005 273 ----11279
NM_198390chr1641708 1674 1667 1478 --11680 11694
NM_198400chr1522755 359 12764 --21141 29
NM_198401chr81393 --11257 2631 412
NM_198468chr643939 1788 930 405 --93861 3313 3226 1740 1320 1305 496 452 280 --
NM_198504chr32893 880 --2740 94 2900 77
NM_198549chr122577 2250 --12759 22457 337
NM_198581chr256939 1180 1053 907 60 --57152 6059 5140 4846 767 12363
NM_198715chr165615 5519 5194 4500 1269 755 --65371 4893 4048 2169 1025 216 24142 388
NM_198793chr383836 3809 3432 2813 2719 2635 1244 235 1162 32841 2828 692 13605
NM_198829chr741489 1110 1042 606 11156 --11452
NM_198859chr375131 4888 4578 4137 3205 947 69 --23409 1924 --
NM_199040chr1232646 469 296 22362 121 31246 372 139 --
NM_199054chr1992111 2069 1995 1352 1344 172 158 145 60 --11767 11959
NM_199132chr191279 62004 801 550 466 196 111 21761 1468 21897 1637
NM_199188chr1243961 3282 1451 73 22900 184 1271 24077 3431
NM_199189chr52201 116 ----2390 53
NM_199190chr1243961 3282 1451 73 22900 184 1271 24077 3431
NM_199229chr22589 416 --21743 387 21570 231
NM_199324chr453661 3071 2825 849 200 --32600 1156 948 12359
NM_199327chr42388 353 --6925 82 76 70 64 57 --
NM_199421chr1464623 4172 1975 1009 874 221 44941 4766 4548 1262 11089 1228
NM_199436chr212568 13108 1397 12156
NM_199437chr1142354 1871 464 201 1472 12369 12279
NM_199438chr1142354 1871 464 201 1472 12369 12279
NM_199439chr1142354 1871 464 201 1472 12369 12279
NM_199482chr23502 481 117 1205 32079 1392 384 12096
NM_201269chr141274 1062 575 422 --2550 327 1203
NM_201437chr841532 1433 1158 84 --1129 1234
NM_201568chr132165 2159 803 --52192 2185 2171 2046 1744 --
NM_201569chr132165 2159 803 --52192 2185 2171 2046 1744 --
NM_201591chr431901 1863 363 ----21270 553
NM_201592chr431901 1863 363 ----21270 553
NM_201999chr441184 1132 1099 953 1336 1962 --
NM_203327chr2074324 3387 2804 1829 1507 1220 1106 24449 3246 44472 4418 4372 949 --
NM_203342chr183135 2587 1303 1230 1027 918 269 251 1905 21310 630 --
NM_203343chr183135 2587 1303 1230 1027 918 269 251 1905 21310 630 --
NM_203364chr111986 --1234 21087 282
NM_203372chr221619 563 1299 11577 11585
NM_203390chr841846 690 162 66 --2223 80 --
NM_203406chr532262 887 324 --32783 316 170 --
NM_203458chr133643 2413 757 11371 42902 2762 1269 122 1587
NM_203459chr162612 2545 2395 1043 350 216 --12552 22186 758
NM_203463chr224745 3579 --44781 4310 3525 745 11066
NM_205768chr151998 1801 1674 551 351 --61554 1495 366 359 213 127 --
NM_206594chr123064 1026 12864 1841 12760
NM_206595chr123064 1026 12864 1841 12760
NM_206839chr153600 539 254 --3631 426 119 1217
NM_206853chr673692 3671 3029 1006 994 988 934 --32641 717 696 --
NM_206854chr694953 4932 4290 3733 3540 3428 517 188 89 --43902 1978 1957 379 13756
NM_206855chr6135918 5897 5255 4698 4505 4393 3946 1482 1153 1054 724 435 113 --34867 3937 1344 14721
NM_206866chr2142978 2437 2375 249 --2990 101 12551
NM_206876chr253611 3226 906 596 391 1842 33517 3106 397 33018 965 408
NM_206907chr542986 2766 2457 1268 --31281 506 417 --
NM_206909chr878302 7787 6344 5248 313 285 50 18338 26440 2021 18277
NM_207171chr13408 397 251 --32036 1598 1462 --
NM_207292chr323324 1269 11355 13018 1719
NM_207293chr323324 1269 11355 13018 1719
NM_207294chr323324 1269 11355 13018 1719
NM_207295chr323324 1269 11355 13018 1719
NM_207296chr323324 1269 11355 13018 1719
NM_207303chr1073424 3296 3234 2809 2630 384 37 1213 ----
NM_207304chr1342606 1680 982 667 12460 21831 1817 --
NM_207352chr442615 2389 678 506 ----22424 1873
NM_207361chr1365967 5782 1743 725 646 437 25167 489 24637 4187 12172
NM_207406chr476420 5427 4667 2222 1633 1408 1356 --76369 4673 2047 1987 1921 595 446 14986
NM_212460chr782015 1476 1421 673 656 334 122 38 --31773 1448 1440 11942
NM_212558chr964208 3095 1436 741 544 278 --43683 3513 3272 3021 23201 831
NM_213589chr265012 4831 4057 3707 2183 838 --45553 5449 5435 523 15569
NM_213590chr1364332 4311 4292 2077 1316 25 44057 2018 2004 948 23355 938 15204
NM_213654chr321463 378 11118 --21075 116