TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-570-5p
miRNA Sequence: AAAGGUAAUUGCAGUUUUUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr12225 148 ----2616 587
NM_000037chr82877 425 --22411 808 --
NM_000038chr5102043 2004 1854 1843 1815 1638 1628 705 689 161 ------
NM_000044chrX4408 369 282 94 ----1375
NM_000051chr1183549 3500 3270 3238 2330 1352 1268 1066 182 62956 2320 2295 751 725 690 13540
NM_000052chrX93474 3257 3201 3079 2942 2347 967 157 140 22878 528 21372 66 --
NM_000059chr134881 780 186 130 2803 206 ----
NM_000067chr84588 270 130 72 ----1525
NM_000081chr151667 1295 1149 717 676 --11854 --
NM_000084chrX96494 6161 6079 5659 5281 4433 2443 2175 1437 --25919 1963 --
NM_000090chr21698 ------
NM_000092chr244017 1184 736 262 1508 13823 13576
NM_000103chr1531256 1149 1130 1467 ----
NM_000109chrX42515 1805 823 799 12633 --12207
NM_000112chr595476 5365 5177 5013 4904 4834 1760 1516 683 14268 15066 --
NM_000115chr1342490 1986 947 725 12567 12025 --
NM_000125chr693374 3360 3205 3027 2753 2701 2616 1594 372 1917 13247 --
NM_000138chr1562442 2358 1957 1017 549 223 ------
NM_000161chr1461536 751 719 614 331 188 --31849 1686 757 11208
NM_000163chr542282 2092 788 133 12197 ----
NM_000167chrX81841 1682 1460 1379 1321 1269 674 248 21510 1417 21427 713 --
NM_000168chr783297 2703 2608 1316 1225 860 779 763 22873 1101 12033 --
NM_000176chr543773 2786 497 353 ----126
NM_000194chrX2131 116 1144 ----
NM_000202chrX93911 3124 2965 2679 1321 723 571 361 304 23314 465 33880 3828 3294 12856
NM_000210chr242198 2080 1867 1722 --1433 --
NM_000214chr2021414 432 11315 11137 --
NM_000217chr1285370 5318 4522 3313 1657 1270 1140 579 1104 34583 4290 3345 --
NM_000232chr482532 2255 1145 1130 976 670 417 35 12172 ----
NM_000252chrX41271 1044 144 94 --11388 --
NM_000253chr44821 233 104 23 ------
NM_000254chr121861 115 22936 67 21847 21 --
NM_000255chr62441 107 1136 1323 1126
NM_000259chr15146037 5458 5437 4958 4940 4671 4395 4337 4125 4027 1315 1197 154 110 24904 1514 1200 --
NM_000264chr932988 743 379 --12417 --
NM_000266chrX----1373 --
NM_000267chr1752293 372 212 186 169 1691 22351 780 --
NM_000276chrX21708 181 ------
NM_000284chrX41900 713 227 27 11704 11842 --
NM_000291chrX2991 267 1603 ----
NM_000297chr442057 1835 1620 807 --21961 1626 1650
NM_000314chr1063253 2712 2623 2104 1265 224 --23007 2913 12432
NM_000317chr112338 315 ------
NM_000318chr872726 2658 2611 1125 1065 1056 842 --1926 12866
NM_000321chr1341314 452 343 109 --21105 348 --
NM_000325chr4----1643 --
NM_000332chr6106108 5225 5041 4840 2786 2598 2132 2067 1112 286 --24617 98 25005 1845
NM_000337chr5105273 5162 4960 4796 4518 1847 1459 696 603 407 11410 31704 1471 1452 11715
NM_000338chr15--169 2936 807 --
NM_000353chr1631115 833 450 --21189 1148 --
NM_000368chr974425 4123 4052 3124 1417 1055 228 --1281 --
NM_000378chr111196 ------
NM_000391chr1161662 1653 1493 1443 484 122 21342 207 ----
NM_000393chr261677 1641 1407 736 667 179 11967 ----
NM_000399chr1021202 864 --11039 1913
NM_000408chr293262 3180 2294 1308 868 543 482 414 108 1179 33118 2439 1356 22149 814
NM_000437chr162045 2025 1940 720 409 155 ------
NM_000441chr742203 1985 605 494 ----1784
NM_000448chr1183235 2694 2136 1234 777 480 432 228 1534 21052 816 --
NM_000461chr393418 3041 1678 1524 1462 1121 912 768 63 11478 --13848
NM_000462chr1531759 1429 465 --11223 --
NM_000480chr1161659 1645 1185 1086 464 353 21520 420 --11561
NM_000489chrX63009 2242 1321 1014 443 196 23265 2448 42405 775 568 139 1640
NM_000503chr82636 146 --21804 436 --
NM_000508chr4----3918 869 199 --
NM_000509chr42167 44 --127 --
NM_000523chr24741 227 201 148 --21064 401 1373
NM_000531chrX2341 273 ------
NM_000533chrX51785 1325 1243 653 115 --21339 88 11967
NM_000538chr1321288 1179 --2297 212 21813 39
NM_000544chr6_cox_hap1123343 3097 3030 2471 2461 2235 1357 1304 1205 1185 423 227 12491 43301 3121 2178 478 12941
NM_000555chrX75921 5884 5651 5159 4821 1286 859 --55898 5711 5639 5292 2415 --
NM_000575chr22912 412 --2863 405 --
NM_000582chr4----2424 396 --
NM_000585chr4------1216
NM_000596chr71116 ------
NM_000610chr1162766 2316 2173 1111 568 550 --22920 632 --
NM_000615chr1152246 920 785 473 420 --22546 150 --
NM_000618chr12116594 6356 6278 6116 5855 5660 4978 4324 4149 1063 67 1283 36047 5810 1904 26526 4426
NM_000618chr12116594 6356 6278 6116 5855 5660 4978 4324 4149 1063 67 1283 36047 5810 1904 26526 4426
NM_000621chr1321315 377 --21156 449 --
NM_000627chr2--1601 1888 --
NM_000633chr1885068 5034 4908 3699 3394 1913 1739 1563 25128 782 25040 1491 --
NM_000663chr1632470 2423 66 ------
NM_000676chr171355 ------
NM_000684chr1031104 981 66 ----11163
NM_000685chr32762 97 ----1866
NM_000685chr32762 97 ----1866
NM_000693chr1551640 1517 1270 1248 662 1725 11426 --
NM_000719chr1236674 1889 1038 --11747 --
NM_000724chr1061813 1633 1442 1431 1407 176 ----1496
NM_000788chr431360 551 58 --21406 523 --
NM_000800chr541629 1614 1372 263 11073 ----
NM_000809chr4259320 9057 8790 8371 8003 7075 6570 6399 6217 5768 5759 5720 5607 3557 3463 2927 2737 2697 2584 2062 1516 1457 793 781 576 36234 2196 1706 99076 8452 7472 6870 6609 6145 6018 2832 2303 13519
NM_000812chr42162 33 ------
NM_000813chr535194 447 422 1116 15364 --
NM_000814chr1583838 3825 1194 1124 1115 643 513 361 11643 12691 --
NM_000816chr52496 186 ------
NM_000817chr24965 143 118 37 1771 1319 --
NM_000826chr462414 1703 1023 813 405 250 22437 194 ----
NM_000829chr1142275 2212 2095 2050 127 1556 --
NM_000831chr166176 5525 5264 4031 2286 145 --15387 --
NM_000838chr632753 2122 1966 21979 157 21754 1013 --
NM_000844chr321113 991 ----1181
NM_000859chr531718 1660 676 --11530 --
NM_000860chr441262 461 277 63 1407 31687 1487 1299 11676
NM_000861chr352449 2439 1821 1766 857 1636 32482 2186 1945 --
NM_000868chrX21797 1047 22501 145 ----
NM_000872chr1021413 569 21037 124 ----
NM_000875chr1565948 5939 4829 4357 2620 1455 16023 42823 1733 508 502 --
NM_000885chr282148 1909 1778 1460 855 655 368 290 --11902 --
NM_000891chr1753263 2980 1204 786 683 1374 33224 2828 1416 133
NM_000899chr12114318 3824 3795 3248 3119 2821 1098 1044 702 661 125 14394 23662 28 --
NM_000901chr482510 2233 2175 1771 1730 961 866 639 11977 11953 22576 30
NM_000912chr853539 2384 1371 819 776 13498 23490 595 --
NM_000919chr51136 ------
NM_000944chr45759 721 642 231 99 --1694 --
NM_000945chr221878 786 --1452 1588
NM_000949chr51144 2877 854 1211 --
NM_000950chrX43202 3134 2588 1009 22521 516 21212 887 12974
NM_000956chr141347 11013 ----
NM_000958chr51871 1394 1996 --
NM_000963chr181875 1861 1752 903 516 422 261 91 ----1816
NM_000965chr341200 872 177 38 --11270 --
NM_000990chr1153705 2504 1486 1356 39 12833 ----
NM_001001132chr213214 168 133 --1967 1180
NM_001001323chr1263212 2911 2356 890 756 596 --22885 902 --
NM_001001330chr1041299 496 484 373 --21136 128 --
NM_001001344chrX42487 2433 2267 828 --11687 --
NM_001001389chr1162766 2316 2173 1111 568 550 --22920 632 --
NM_001001390chr1162766 2316 2173 1111 568 550 --22920 632 --
NM_001001391chr1162766 2316 2173 1111 568 550 --22920 632 --
NM_001001392chr1162812 2362 2219 1157 614 596 --32966 678 64 --
NM_001001395chr1242196 1796 843 787 --32403 1095 51 1881
NM_001001419chr5134681 3738 3688 3661 3470 3351 1901 1871 1156 1070 942 653 418 13935 24300 1020 35236 746 283
NM_001001420chr5134681 3738 3688 3661 3470 3351 1901 1871 1156 1070 942 653 418 13935 24300 1020 35236 746 283
NM_001001433chr2021194 889 ------
NM_001001436chr163820 609 578 --1869 --
NM_001001481chr863337 2964 2611 2487 1070 1025 --13146 1487
NM_001001484chr102616 92 --2860 144 1832
NM_001001521chr2--187 ----
NM_001001664chr264083 3921 3174 2852 2772 270 23675 250 53089 2588 1140 508 219 --
NM_001001668chr1974006 3409 3353 3150 2711 977 513 13907 ----
NM_001001701chr481847 1759 1722 1492 1484 745 632 623 --1870 --
NM_001001890chr2183652 3362 3207 3110 2836 1520 1377 775 ------
NM_001001928chr2267756 7613 1408 1233 1191 159 27937 7146 37418 6322 5145 18341
NM_001001933chr12434 403 ------
NM_001001971chr1041247 967 880 508 ------
NM_001001974chr1022150 865 12257 22355 2247 --
NM_001001995chrX31389 432 254 --11655 1763
NM_001002026chr322481 873 12440 ----
NM_001002233chr872096 2077 669 602 459 398 226 --174 --
NM_001002243chr21706 ------
NM_001002257chr243564 2310 1388 825 13146 12219 23324 1038
NM_001002811chr131555 1504 1351 --11615 --
NM_001002812chr131555 1504 1351 --11615 --
NM_001002812chr131555 1504 1351 --11615 --
NM_001002814chr893667 2982 2595 918 669 602 459 398 226 --23941 74 13694
NM_001002838chrX61879 1854 1716 1668 1592 1224 11409 21673 521 1119
NM_001002843chr1551191 1053 428 376 131 ------
NM_001002857chr153308 157 146 1294 ----
NM_001002858chr153308 157 146 1294 ----
NM_001002860chr1464474 4390 4097 2874 1228 383 --53835 3814 3617 1609 398 --
NM_001002906chrY1457 ------
NM_001002909chr1752184 1838 1814 1430 497 --52116 1648 1385 629 430 --
NM_001002919chr23207 75 46 --1387 --
NM_001003407chr1021872 310 14212 11663 1260
NM_001003408chr1021872 310 14212 11663 1260
NM_001003652chr18178650 7739 7640 7516 6672 6601 5996 3215 2907 2779 2707 2462 1829 1640 1344 999 553 35648 3308 3254 28636 7301 11867
NM_001003674chr18106979 6931 5627 5320 2690 2634 2511 1957 1710 1134 21048 591 36865 6242 5956 --
NM_001003675chr18106979 6931 5627 5320 2690 2634 2511 1957 1710 1134 21048 591 36865 6242 5956 --
NM_001003681chr2221975 175 1281 --1410
NM_001003688chr421167 908 --11233 --
NM_001003712chr1283872 3020 2957 2933 2790 2664 972 151 23361 1551 63642 3468 2890 1400 536 158 --
NM_001003792chr33949 436 349 1144 136 --
NM_001003793chr33949 436 349 1144 136 --
NM_001003800chr983610 3132 2912 2722 2505 1274 1171 1137 --23397 1241 13511
NM_001003895chrY----153 1305
NM_001004065chr973469 3446 3213 3012 2951 2929 944 11578 --12599
NM_001004125chr94988 780 127 112 --11090 1951
NM_001004196chr331091 347 200 --2502 495 --
NM_001004303chr11765 1318 1202 2676 527
NM_001004303chr11765 1318 1202 2676 527
NM_001004308chrX31480 1064 550 --1413 --
NM_001004317chr6104516 4281 4242 3694 3514 3418 3225 2744 1041 586 1647 24427 489 --
NM_001004342chr1105071 5029 5018 4501 2336 1867 1611 1233 604 452 --66051 5795 4191 4028 790 502 --
NM_001004360chr251832 1408 692 619 432 --22007 1263 --
NM_001004419chr1284157 4107 3695 636 552 464 264 240 --34613 711 542 --
NM_001005375chrY51305 706 550 538 345 --1700 1237
NM_001005386chr252430 1678 1654 667 349 1504 ----
NM_001005404chr1764285 4094 3997 3140 2797 754 13959 14120 --
NM_001005463chr1062563 2354 2186 1992 1646 97 11695 21044 658 --
NM_001005473chr5126493 5606 5422 5414 5343 5322 4941 2597 1548 1471 1279 304 26524 4516 36669 4904 2324 --
NM_001005474chr311234 11058 31469 1196 261 183
NM_001005476chr22626 218 ------
NM_001005502chr1294732 4096 3950 3331 2042 1992 1227 1042 219 --14757 --
NM_001005609chrX93225 3019 3000 2936 2443 1459 1221 1131 918 12460 ----
NM_001005739chr22859 734 1335 ----
NM_001005743chr143972 202 24 --11267 --
NM_001005744chr143972 202 24 --11267 --
NM_001005745chr143972 202 24 --11267 --
NM_001005753chr25904 727 552 305 284 1220 11840 --
NM_001005781chr24591 520 485 245 ------
NM_001005782chr251040 969 934 694 360 ------
NM_001005845chr821792 438 1762 176 --
NM_001005862chr17----1487 --
NM_001006600chr532097 974 442 12148 12152 --
NM_001006605chr131174 991 893 ----21165 326
NM_001006605chr131174 991 893 ----21165 326
NM_001006623chr252243 1962 1033 242 137 --12464 --
NM_001006657chr232891 2585 664 --32655 1238 258 --
NM_001006684chrX3586 435 68 --186 --
NM_001006945chr13470 216 201 ------
NM_001007024chr1754214 3860 3796 1512 731 --13134 --
NM_001007025chr1754214 3860 3796 1512 731 --13134 --
NM_001007102chr651330 1193 547 472 388 --2653 243 --
NM_001007156chr1551826 1667 1491 1444 258 ------
NM_001007237chr142007 1932 1860 296 12151 1530 --
NM_001007245chr71616 --1645 --
NM_001007466chr664543 4460 4027 1600 1461 1132 23321 426 65025 4965 4497 3949 1070 285 --
NM_001007527chr51516 2230 145 ----
NM_001007538chr1341891 1648 400 389 --41531 1432 1191 1179 --
NM_001007553chr13391 379 304 1412 41162 1111 497 334 --
NM_001007559chr1852044 1792 1385 634 355 --1773 --
NM_001007565chr31325 ------
NM_001008239chr1893384 3127 2392 1383 1190 1015 563 297 266 --23082 2369 --
NM_001008391chr111273 ------
NM_001008392chr333497 2816 404 ------
NM_001008393chr462922 2486 2077 1890 857 736 31033 869 213 52868 2743 2141 945 898 --
NM_001008401chr1931501 1419 538 --11509 --
NM_001008408chr776243 6225 4697 4677 4640 2198 1271 24373 1162 32559 1454 415 11966
NM_001008491chr251949 631 585 375 185 --11410 --
NM_001008492chr251949 631 585 375 185 --11410 --
NM_001008539chr875308 4248 4231 3868 3489 1266 1034 --45097 3966 1569 453 --
NM_001008541chr1031864 1780 1505 11479 ----
NM_001008541chr1031864 1780 1505 11479 ----
NM_001008566chr222324 173 1517 1385 1522
NM_001008660chr1131104 1080 63 --21545 436 --
NM_001008738chr552849 2106 1796 681 628 22462 774 22406 1103 --
NM_001008779chr21312 ------
NM_001008783chr6--1907 1275 --
NM_001008860chr151757 --1149 --
NM_001008892chr151757 --1149 --
NM_001008894chr151757 --1149 --
NM_001008895chr1331304 1055 181 11080 11434 --
NM_001008897chr62136 52 1173 ----
NM_001008925chr453554 2921 1324 1267 1228 ------
NM_001009185chr5----1581 --
NM_001009555chr451698 1648 1434 1413 689 1651 11654 1369
NM_001009814chr13----192 --
NM_001009899chr3105235 4992 4837 4784 4608 1826 1503 607 461 215 --86112 4505 4403 4267 4256 1760 189 129 25384 981
NM_001009959chr252529 2354 1791 495 389 182 3656 443 220 1968
NM_001009960chr722580 377 1294 1812 --
NM_001009993chr224335 3212 1487 13981 --
NM_001010000chr1832489 812 670 13215 12814 12436
NM_001010844chr6353 40 33 ------
NM_001010853chr683298 2980 2971 2753 1042 893 156 114 --13060 --
NM_001010861chr132587 2502 2466 2992 803 1973 1527
NM_001010862chrX22259 257 13333 2586 267 --
NM_001010877chr61165 --2130 24 --
NM_001010888chrX74235 4100 4011 3322 3263 1829 1223 23679 868 23835 1251 --
NM_001010891chr596688 6501 5402 2391 2284 1528 1130 709 443 35796 2457 272 24315 293 --
NM_001010895chr941983 1547 1475 121 --2135 82 --
NM_001010927chr61214 1546 143 --
NM_001010942chr1261279 1163 1063 908 339 202 1323 ----
NM_001010984chr182571 2544 2073 2014 1793 1713 644 289 --1747 11963
NM_001010986chrX52214 1599 560 357 349 --12494 --
NM_001010989chr16173 1421 --1514
NM_001010990chr16173 1421 --1514
NM_001011513chr444015 3190 3003 339 1394 53026 2533 983 447 205 33997 2633 839
NM_001011515chr45953 855 386 123 39 --31038 419 51 195
NM_001011516chr45953 855 386 123 39 --31038 419 51 195
NM_001011537chr342305 1897 678 88 --32055 1991 455 --
NM_001011645chrX4408 369 282 94 ----1375
NM_001011663chr105931 804 737 270 118 ------
NM_001011666chr755586 2054 498 322 256 14818 56051 5207 4751 2067 1505 --
NM_001011708chr2--22903 564 22515 946 --
NM_001011713chr142631 115 11622 ----
NM_001011720chr82568 203 11062 ----
NM_001012393chr11104351 4197 4159 3965 1850 872 856 504 447 266 --34135 3684 1068 --
NM_001012398chr164914 828 215 186 --1801 --
NM_001012410chr3------1356
NM_001012418chr694202 4056 3685 2585 1696 1641 1379 447 90 --24292 285 --
NM_001012420chr1572892 2649 925 651 503 211 87 12697 12032 --
NM_001012423chr1582892 2649 925 651 503 409 211 87 12697 12032 --
NM_001012478chr19----1647 --
NM_001012514chr221145 95 ------
NM_001012516chr221145 95 ------
NM_001012751chr1071866 1582 1575 1192 606 526 235 --11526 --
NM_001012754chr1322146 799 --31951 1854 492 11664
NM_001012761chr552732 2128 1765 874 398 12697 22313 603 --
NM_001012968chrX62433 2195 958 185 177 165 --62094 1819 887 338 197 143 --
NM_001013031chr10103326 2978 2221 1324 1175 1100 1081 1056 803 680 --13545 12984
NM_001013406chr711512 11209 31491 385 83 --
NM_001013438chr34927 747 368 327 1106 ----
NM_001013439chr34773 593 214 173 ------
NM_001013615chr12930 166 --11013 --
NM_001013620chr12207971 7871 7538 7421 7221 6736 5751 5432 5139 3330 2815 2579 2055 1979 1958 1534 1254 1187 955 908 28258 1947 42334 2155 1039 429 --
NM_001013699chr12149 ------
NM_001013843chr152359 60 ------
NM_001014283chr1362040 1943 1858 1468 715 680 ------
NM_001014286chr13172 ------
NM_001014380chr1395836 4620 4609 4377 4208 3655 1035 588 543 22176 1540 65821 5371 4891 1972 1911 1886 15074
NM_001014434chr13764 677 311 --1818 --
NM_001014797chr1057510 6176 3183 434 286 ----11114
NM_001014809chr41901 ------
NM_001015048chr1442316 1202 711 205 --13202 --
NM_001015049chr1442316 1202 711 205 --13202 --
NM_001015508chr82302 189 --1518 --
NM_001015877chrX42613 1147 1019 992 12194 32666 2011 927 12551
NM_001015880chr1051548 1278 1160 508 327 21604 546 146 21303 602
NM_001015887chr381860 1758 1694 1506 1426 673 616 145 --41833 1725 1253 1156 21685 1372
NM_001017368chr1762771 2735 2199 1915 494 468 129 22303 583 --
NM_001017369chr421056 967 1168 1143 --
NM_001017371chr24489 346 210 81 21346 147 1151 --
NM_001017395chr353279 2635 2485 396 73 --12657 --
NM_001017396chr251466 1417 1374 827 464 11438 ----
NM_001017405chr42685 244 ------
NM_001017415chr13783 616 518 --189 --
NM_001017416chr13783 616 518 --189 --
NM_001017423chr102778 60 --1255 --
NM_001017424chr161781 1225 693 597 456 246 1480 11610 1485
NM_001017425chr161781 1225 693 597 456 246 1480 11610 1485
NM_001017923chr1461663 1609 1108 529 323 248 --1610 --
NM_001017963chr143938 356 25 2171 124 ----
NM_001017992chr551457 1422 456 442 228 11042 ----
NM_001017995chr5124591 4465 4101 3791 3675 1904 1729 789 659 486 346 134 34798 3171 261 --13176
NM_001018004chr15----190 --
NM_001018006chr15----190 --
NM_001018007chr15----190 --
NM_001018020chr15----190 --
NM_001018054chr111295 1326 ----
NM_001018056chr92524 122 --1166 --
NM_001018065chr9135979 5840 4811 4792 4782 4473 3838 3817 3710 1476 1384 1281 94 --75585 4725 4638 4569 1184 570 167 --
NM_001018066chr9135979 5840 4811 4792 4782 4473 3838 3817 3710 1476 1384 1281 94 --75585 4725 4638 4569 1184 570 167 --
NM_001018067chr185317 4690 3496 2060 1601 1242 274 144 14323 55167 5148 1571 1119 735 --
NM_001018068chr185317 4690 3496 2060 1601 1242 274 144 14323 55167 5148 1571 1119 735 --
NM_001018069chr185317 4690 3496 2060 1601 1242 274 144 14323 55167 5148 1571 1119 735 --
NM_001018074chr543773 2786 497 353 ----126
NM_001018075chr543773 2786 497 353 ----126
NM_001018076chr543773 2786 497 353 ----126
NM_001018077chr543773 2786 497 353 ----126
NM_001023560chr61686 ------
NM_001023567chr1542284 2083 1598 87 --1506 12367
NM_001023587chr321142 953 ------
NM_001024094chr543773 2786 497 353 ----126
NM_001024226chr11988 --11039 --
NM_001024227chr11988 --11039 --
NM_001024228chr11988 --11039 --
NM_001024380chr832479 1615 320 --32497 2335 179 --
NM_001024381chr832479 1615 320 --32497 2335 179 --
NM_001024401chr1622878 2328 ----11904
NM_001024460chr631116 890 326 ------
NM_001024647chr1296736 6610 6446 5760 2149 1399 1182 456 70 13004 35635 2978 1952 --
NM_001024649chr572475 2431 2151 1801 1099 1043 887 12677 22873 1975 --
NM_001024688chr842180 1951 549 472 1801 12068 --
NM_001024847chr33788 368 190 --2999 816 --
NM_001024912chr1951823 1712 594 450 29 11598 11568 --
NM_001024916chr9--1108 --185
NM_001024947chr53926 845 190 1897 1751 --
NM_001024948chr172922 2558 754 728 521 340 223 32670 2169 276 12973 --
NM_001024956chr11125754 5264 5154 4647 4351 3913 3677 3565 2281 1718 1489 247 --44516 3549 2333 344 --
NM_001025068chr391713 1633 1591 1462 1416 590 265 187 161 --1486 1667
NM_001025069chr391713 1633 1591 1462 1416 590 265 187 161 --1486 1667
NM_001025076chr10124913 4208 2470 2153 1841 1657 1648 1568 1261 866 727 77 16004 15960 --
NM_001025077chr10126271 5566 3015 3006 2926 2619 2224 2085 1435 1098 912 200 17362 27318 278 --
NM_001025079chr393913 3443 3309 3215 1253 1226 745 677 302 12610 ----
NM_001025105chr531361 1255 120 ------
NM_001025107chr142214 1865 1805 823 --22380 248 --
NM_001025107chr142214 1865 1805 823 --22380 248 --
NM_001025108chr284179 4116 3251 3037 2689 1494 1449 1001 --23335 495 --
NM_001025201chr21541 --1738 1584
NM_001025233chr1232698 324 240 22005 1818 1792 --
NM_001025252chr853205 2630 1108 475 165 12875 ----
NM_001025253chr853205 2630 1108 475 165 12875 ----
NM_001025266chr394918 4017 3685 3666 3290 3192 832 545 52 --23705 221 --
NM_001025366chr611346 11878 11445 --
NM_001025366chr611346 11878 11445 --
NM_001025367chr611346 11878 11445 --
NM_001025367chr611346 11878 11445 --
NM_001025368chr611346 11878 11445 --
NM_001025368chr611346 11878 11445 --
NM_001025369chr611362 11894 11461 --
NM_001025369chr611362 11894 11461 --
NM_001025370chr611346 11878 11445 --
NM_001025370chr611346 11878 11445 --
NM_001025389chr1161659 1645 1185 1086 464 353 21520 420 --11561
NM_001025390chr1161659 1645 1185 1086 464 353 21520 420 --11561
NM_001025580chrX84084 3857 3477 3047 1273 872 799 442 --54300 3943 3880 3356 326 --
NM_001025616chr451743 1669 1608 717 505 ------
NM_001025777chr241413 1249 395 385 --31189 1132 1022 --
NM_001029858chr662363 2149 2129 868 558 546 1442 32982 996 696 --
NM_001029860chr8144 1261 ----
NM_001029863chr652099 786 483 148 103 21135 727 22783 1093 12765
NM_001029875chr552816 2378 2331 1887 665 1593 22218 125 --
NM_001029882chr11239 ------
NM_001029882chr11239 ------
NM_001029884chr662283 2178 2162 641 256 129 22580 2361 12646 --
NM_001030006chr1772331 937 908 543 514 416 250 1765 ----
NM_001030007chr1651043 1005 932 529 222 22441 1198 33154 2860 2678 --
NM_001030055chr1484436 3909 3446 3206 1733 1057 576 565 --23649 1613 31585 1388 1360
NM_001031623chr631739 673 471 ------
NM_001031679chr1223368 2313 --13422 23455 72
NM_001031684chr211450 11144 11172 --
NM_001031695chr2255020 3715 1057 204 150 --34345 3569 1047 --
NM_001031710chr721094 1034 1335 11039 --
NM_001031711chr521368 51 ----11415
NM_001031716chr241140 882 322 286 ------
NM_001031732chr453562 2837 945 793 502 23705 1112 1784 --
NM_001031738chr22500 52 ------
NM_001031804chr1663800 3164 2913 1095 1082 906 --22734 527 --
NM_001031812chr552290 1564 1530 128 33 2811 336 ----
NM_001032221chr931333 486 94 1214 1590 11731
NM_001032279chr111397 ------
NM_001032282chr831321 1180 918 11315 2485 324 1320
NM_001032288chr2031603 1209 376 --11072 1146
NM_001032296chr1342798 2721 1961 801 --42294 572 567 245 --
NM_001032380chr10----1150 1399
NM_001032393chrX1493 1660 1159 --
NM_001032394chr682827 2745 2717 2655 1728 935 799 223 --22415 596 --
NM_001032395chr672694 2612 2584 2522 802 666 90 --22282 463 --
NM_001032730chr13547 134 37 --1615 1689
NM_001032999chr2075278 4999 3816 1605 1448 1177 918 1688 14211 --
NM_001033025chr151509 1502 1476 1105 96 --1163 1305
NM_001033045chr253692 1623 1386 868 382 33403 2952 1781 12841 14402
NM_001033047chr41576 --32517 2200 242 --
NM_001033049chr212786 94 --1352 --
NM_001033057chr32224 84 --11581 --
NM_001033059chr631419 455 188 ------
NM_001033087chr2063079 2231 1321 1015 735 161 --13262 13009
NM_001033117chr384756 4229 3910 3167 1560 1475 1423 518 24810 3809 13544 --
NM_001033503chr51363 2456 409 ----
NM_001033566chr172645 40 ----1109
NM_001033568chr172645 40 ----1109
NM_001033576chr1732289 788 684 12540 12602 --
NM_001033723chr852606 2567 2409 481 334 --1454 --
NM_001033756chr611280 11812 11379 --
NM_001033756chr611280 11812 11379 --
NM_001033925chr1041916 1485 615 175 --21743 331 --
NM_001034841chr1695219 3936 3631 1689 1493 1250 985 799 431 13530 ----
NM_001034850chr511546 1505 11555 1114
NM_001034852chr1421788 148 1803 ----
NM_001034915chr831565 470 308 41456 987 576 168 1172 11303
NM_001035260chr1051264 1037 477 344 322 ----21341 221
NM_001035511chr182132 1868 1853 1846 1783 1474 1442 138 22118 1730 1651 --
NM_001035512chr192239 1975 1960 1953 1890 1581 1549 245 74 22225 1837 1758 --
NM_001035513chr192239 1975 1960 1953 1890 1581 1549 245 74 22225 1837 1758 --
NM_001035521chr23818 809 581 ------
NM_001037132chr792062 1879 1783 1404 839 680 610 371 199 --11952 11987
NM_001037133chr792062 1879 1783 1404 839 680 610 371 199 --11952 11987
NM_001037164chr782007 1907 1900 1317 1303 1292 606 87 --2691 155 --
NM_001037165chr788886 8852 8763 8147 7381 2201 662 167 ------
NM_001037174chr2102046 1808 1801 1776 1500 1437 1428 599 430 55 ------
NM_001037317chr132587 2502 2466 2992 803 1973 1527
NM_001037334chr1892202 1778 1771 1575 904 598 371 323 284 12270 31656 896 187 1432
NM_001037339chr15702 685 625 404 125 --31304 582 195 --
NM_001037340chr15702 685 625 404 125 --31304 582 195 --
NM_001037341chr15702 685 625 404 125 --31304 582 195 --
NM_001037341chr15702 685 625 404 125 --31304 582 195 --
NM_001037535chrX41458 1360 458 54 11388 21025 249 --
NM_001037536chrX41458 1360 458 54 11388 21025 249 --
NM_001037540chrX41458 1360 458 54 11388 21025 249 --
NM_001037553chr2154211 4133 3524 1457 1447 --1354 --
NM_001037954chr1163196 3158 3080 2144 847 333 13034 ----
NM_001038628chr351692 638 546 476 40 1394 11870 --
NM_001039091chrX21188 300 --1467 --
NM_001039348chr2----11059 157
NM_001039349chr2----11059 157
NM_001039395chr932352 2011 292 --42460 2332 2287 1704 --
NM_001039538chr252924 2587 2557 1402 1151 --22592 297 --
NM_001039547chr3127209 7161 6812 6777 6583 6573 6472 5810 2357 2051 1496 223 33221 3081 614 47789 6301 944 832 --
NM_001039570chr2234641 4071 3367 1665 24672 4111 --
NM_001039571chr2234641 4071 3367 1665 24672 4111 --
NM_001039577chr153678 3447 1709 450 277 --1774 --
NM_001039590chrX53808 1136 754 372 142 13511 43544 3470 1513 597 --
NM_001039591chrX53808 1136 754 372 142 13511 43544 3470 1513 597 --
NM_001039618chr11185599 5447 5260 5004 4877 4716 4518 4456 4243 4191 4182 3988 3799 2369 2308 2240 1901 793 1341 25671 4500 21537 70
NM_001039693chr274119 4106 3948 3739 2694 1127 759 ----13651
NM_001039709chr2075278 4999 3816 1605 1448 1177 918 1688 14211 --
NM_001039840chrX146058 5563 5251 5057 4328 4172 3870 2358 1762 1690 804 567 55 31 23686 321 25330 3850 14453
NM_001039888chr12548 255 ------
NM_001039937chr1393831 2907 2609 1649 1598 1583 1233 845 36 1795 33559 693 371 --
NM_001039938chr1341513 1355 1180 1161 --11403 --
NM_001040001chr641646 1507 1437 233 --21714 793 1180
NM_001040020chr721431 1081 1383 21094 428 1475
NM_001040057chr771484 1400 536 470 461 284 176 ------
NM_001040058chr4----2424 396 --
NM_001040060chr4----2424 396 --
NM_001040135chr71698 1631 ----
NM_001040142chr242251 2065 1617 618 22403 1818 ----
NM_001040143chr242251 2065 1617 618 22403 1818 ----
NM_001040152chr744743 3407 1467 1246 --23352 1436 --
NM_001040153chr133274 181 59 1808 ----
NM_001040158chr5----1475 --
NM_001040159chr431348 979 568 --174 11210
NM_001040167chr72374 348 --1897 1893
NM_001040179chr61701 2879 46 1821 --
NM_001040202chr432408 2382 300 --22475 1708 11596
NM_001040284chr1675079 5057 4688 2350 1437 820 561 25416 4413 45977 5868 5200 3943 24779 1270
NM_001040409chr21116 2806 758 1878 --
NM_001040429chr1363616 3057 2894 2777 566 405 --32724 1159 306 --
NM_001040440chr51448 ------
NM_001040441chr141414 814 709 291 1347 23329 255 1276
NM_001040446chr5122568 2449 2108 2042 883 802 733 625 538 500 343 229 --22506 960 11967
NM_001040450chr15102681 2303 2242 2186 1971 1834 891 875 333 142 --32519 588 556 --
NM_001040453chr15102681 2303 2242 2186 1971 1834 891 875 333 142 --32519 588 556 --
NM_001040458chr561908 1812 1754 1317 104 31 1264 ----
NM_001040653chr382560 2533 2353 2138 2089 1665 994 312 1528 11984 --
NM_001040665chr784808 3845 3437 3409 3367 1855 1822 1310 34956 1510 951 34853 3954 1914 1267
NM_001040697chr112526 63 --1104 1616
NM_001040708chr81329 --3301 163 157 --
NM_001040709chr162234 1837 894 815 536 270 2800 255 ----
NM_001040712chr9103525 3463 3064 3015 2828 2757 2461 2362 679 669 ------
NM_001040875chr842329 1699 454 343 ------
NM_001040876chr451454 1295 537 374 258 11721 ----
NM_001042355chr1645211 4963 4054 3278 14181 34830 1315 419 --
NM_001042357chr1041108 584 481 190 --1961 --
NM_001042358chr1041108 584 481 190 --1961 --
NM_001042360chr1041108 584 481 190 --1961 --
NM_001042363chr1041108 584 481 190 --1961 --
NM_001042388chr181141 --1204 1200
NM_001042389chr1041108 584 481 190 --1961 --
NM_001042390chr1041108 584 481 190 --1961 --
NM_001042392chr1041108 584 481 190 --1961 --
NM_001042395chr1041108 584 481 190 --1961 --
NM_001042399chr122486 87 ------
NM_001042403chr126385 331 234 218 181 46 --1791 --
NM_001042404chr121962 31 11285 11249 --
NM_001042412chr1645211 4963 4054 3278 14181 34830 1315 419 --
NM_001042413chr942532 927 794 282 --23199 2602 --
NM_001042414chr13372 60 52 ------
NM_001042437chr2192 ------
NM_001042459chr31103 1312 ----
NM_001042473chr1021631 310 1471 21658 319 --
NM_001042479chrX62033 1538 504 366 294 59 --1328 --
NM_001042480chrX62033 1538 504 366 294 59 --1328 --
NM_001042481chr1452500 1967 977 92 80 11868 22694 2686 11777
NM_001042492chr1752293 372 212 186 169 1691 22351 780 --
NM_001042493chr672041 1911 1274 729 373 228 179 11370 ----
NM_001042506chrX11292 --1452 --
NM_001042510chr842067 1586 536 305 1545 --21487 372
NM_001042511chr842067 1586 536 305 1545 --21487 372
NM_001042517chr131927 ----1364
NM_001042537chrX41964 1829 467 318 21973 910 1234 --
NM_001042548chr21333 1700 ----
NM_001042555chr1263513 3153 3029 1300 1157 310 34626 4018 690 54431 3372 1067 844 559 1889
NM_001042599chr2147822 7772 7570 7391 7158 7103 7076 6621 6136 5117 2655 1962 991 155 21570 794 46290 5412 1290 855 --
NM_001042601chr342675 602 188 61 11231 --11259
NM_001042603chr1285369 5021 4820 4656 4109 3936 1970 472 24237 856 31149 968 645 --
NM_001042604chr3144686 4422 4032 3293 1781 1627 1568 1472 1444 1343 1240 868 540 47 24555 1727 13404 --
NM_001042663chr121130 1061 ------
NM_001042664chr121130 1061 ------
NM_001042665chr121130 1061 ------
NM_001042669chr451743 1669 1608 717 505 ------
NM_001042681chr142529 2445 2151 102 11890 ----
NM_001042682chr142529 2445 2151 102 11890 ----
NM_001042682chr142529 2445 2151 102 11890 ----
NM_001042683chr651518 710 442 418 299 11621 --1701
NM_001042784chr4181 ------
NM_001044305chr641545 1365 1052 613 11499 ----
NM_001044385chr243872 3354 2513 584 23161 1511 --1295
NM_001044722chr552290 1564 1530 128 33 2811 336 ----
NM_001044723chr552290 1564 1530 128 33 2811 336 ----
NM_001045556chr82591 57 31653 1138 484 ----
NM_001045557chr82591 57 31653 1138 484 ----
NM_001046chr542899 2266 664 336 --32487 2292 403 --
NM_001076chr4--1166 1123 --
NM_001076chr4--1166 1123 --
NM_001079874chr192075 2066 1987 1728 1553 642 502 313 197 ------
NM_001083620chr462412 1702 1022 812 404 249 22435 194 ----
NM_001083621chr174420 4288 4072 2867 963 760 729 --21169 1059 --
NM_001099678chr3146231 5686 5536 5397 5069 4483 2473 1966 1855 1485 1070 1001 499 287 45116 1321 1179 693 86434 6251 5190 4274 2396 1710 887 93 --
NM_001100108chr1146813 6771 6532 6349 6045 6022 5792 5069 3057 2991 2945 2565 1093 410 --16834 11848
NM_001106chr3138995 7989 7360 7291 7208 6481 6106 2898 2798 1972 1005 832 458 --49777 6059 2546 124 15910
NM_001107chr142216 142 ------
NM_001109977chr42542 148 198 1768 2679 578
NM_001111chr142214 1865 1805 823 --22380 248 --
NM_001113490chrX93655 3270 3237 3127 2924 2849 2232 1206 1023 ------
NM_001117chr1832320 2066 197 ------
NM_001121chr1041883 1818 1210 286 ------
NM_001123chr102174 90 --1287 --
NM_001126chr13925 791 775 --2998 311 1806
NM_001128chr1651043 1005 932 529 222 22441 1198 33154 2860 2678 --
NM_001144chr1631013 928 178 --21348 1127 --
NM_001148chr421685 396 ------
NM_001153chr25887 838 626 282 85 --1275 --
NM_001156chr103591 533 477 1427 --1165
NM_001160chr122255 183 --22795 2305 --
NM_001167chrX66356 5992 5915 4849 1758 838 21811 1370 21112 883 --
NM_001173chr1484436 3909 3446 3206 1733 1057 576 565 --23649 1613 31585 1388 1360
NM_001177chr1242356 2347 563 476 42420 1550 588 370 1403 --
NM_001186chr2163102 2520 2086 839 537 192 --1952 22668 2250
NM_001198chr642143 1703 1595 329 12369 12347 --
NM_001201chr463788 3068 1518 1367 946 362 --23747 2482 23238 424
NM_001204chr2217590 7413 7116 6904 6320 6264 6004 5922 5787 5557 5165 2129 1950 1829 1729 1478 1416 1270 1168 1131 615 11767 74798 2086 1610 1373 1321 678 473 12276
NM_001206chr972719 2364 2345 2164 2136 776 668 --42652 2583 2369 492 --
NM_001237chr43830 320 167 --21193 141 --
NM_001237chr43830 320 167 --21193 141 --
NM_001241chr241963 1728 1712 279 --3834 674 132 --
NM_001241chr241963 1728 1712 279 --3834 674 132 --
NM_001254chr1741052 310 169 113 ------
NM_001256chr1732121 740 490 12677 42413 1957 1017 316 1530
NM_001257chr161285 --11182 --
NM_001259chr7215781 5211 5204 4631 4588 4581 4299 4180 4173 2200 2082 1905 1709 1539 1444 1336 1096 1079 834 751 394 11654 65347 4840 2540 1401 1328 480 15343
NM_001260chr131252 ------
NM_001262chr1128 136 1247 --
NM_001263chr43464 343 163 --1363 --
NM_001270chr52220 125 ----173
NM_001271chr1533249 819 80 --12040 --
NM_001277chr112352 341 --1905 --
NM_001278chr1041054 828 335 312 --1290 --
NM_001280chr19----1251 --
NM_001282chr1772331 937 908 543 514 416 250 1765 ----
NM_001290chr4168 ------
NM_001304chr1793711 3508 2799 2434 2416 1386 865 777 462 --32976 2784 1458 --
NM_001310chr1252660 2251 2116 1960 497 1983 --11939
NM_001313chr41901 ------
NM_001315chr61460 1611 --11397
NM_001316chr202442 433 ------
NM_001331chr11122719 2699 2208 2061 1763 1128 1119 1079 1065 972 145 39 ----12435
NM_001332chr531334 1038 643 --1476 --
NM_001343chr53318 145 123 11578 11391 1132
NM_001351chr331279 531 249 --1604 1149
NM_001356chrX42549 1771 315 75 --22242 1641 --
NM_001363chrX3690 156 135 --1639 --
NM_001364chr1174534 4063 3095 1439 1213 929 656 24799 3435 ----
NM_001385chr82434 300 1265 1392 --
NM_001390chr181974 --23331 2691 11152
NM_001392chr18147 ------
NM_001399chrX93225 3019 3000 2936 2443 1459 1221 1131 918 12460 ----
NM_001400chr121008 39 1507 --21138 500
NM_001401chr911016 1578 1533 --
NM_001402chr641935 1660 527 225 ------
NM_001407chr32417 230 1641 21150 1065 --
NM_001412chrX33158 2781 405 12694 32940 2831 335 2686 178
NM_001415chrX31920 1710 1498 --1806 1117
NM_001417chr1261904 1867 1787 1381 444 397 --1124 --
NM_001418chr113570 472 210 ------
NM_001418chr113570 472 210 ------
NM_001419chr1951612 1319 1101 1035 1021 13186 34409 1236 1170 --
NM_001420chr1933168 2187 2087 ------
NM_001423chr1241710 1588 1543 208 --21915 1908 --
NM_001429chr2231092 1036 310 ------
NM_001430chr24767 615 212 122 12018 ----
NM_001431chr6----31142 955 298 --
NM_001432chr411090 13824 12756 12624
NM_001438chr1103644 3311 3026 2380 2357 1417 1212 351 334 191 ------
NM_001439chr151509 1502 1476 1105 96 --1163 1305
NM_001448chrX31676 1427 1163 ----2522 459
NM_001451chr162969 426 --21275 451 --
NM_001463chr23647 140 50 --1332 --
NM_001482chr151686 --1154 --
NM_001497chr962807 2349 2166 1850 1843 222 12096 22767 2212 --
NM_001518chr751151 1107 147 127 102 ------
NM_001521chr23818 809 581 ------
NM_001542chr142007 1932 1860 296 12151 1530 --
NM_001543chr553714 1936 1624 659 564 --13748 --
NM_001550chr71616 --1645 --
NM_001553chr43230 69 59 ------
NM_001554chr12661 214 ------
NM_001557chr221358 1334 ------
NM_001560chrX32064 1704 68 --123 --
NM_001564chr41143 ------
NM_001584chr1121017 81 --11146 --
NM_001587chrX21708 181 ------
NM_001608chr26652 630 598 275 258 106 1591 --1794
NM_001609chr1084030 3727 3591 3194 1775 1630 646 81 1737 ----
NM_001614chr172523 240 ------
NM_001614chr172523 240 ------
NM_001616chr273316 3255 3148 3127 2868 2802 885 --43164 2627 2578 994 1570
NM_001621chr752655 709 628 465 371 1805 22286 934 --
NM_001621chr752655 709 628 465 371 1805 22286 934 --
NM_001634chr631419 455 188 ------
NM_001642chr111888 11350 ----
NM_001647chr3140 --1141 --
NM_001649chrX42192 1992 889 498 --1838 --
NM_001650chr1893006 2996 2932 1302 947 550 508 312 252 --33333 1338 261 --
NM_001655chr1121917 306 --22094 762 --
NM_001656chr52428 154 1591 --1521
NM_001658chr11988 --11039 --
NM_001659chr1292202 2179 2073 2026 1875 1831 1067 781 142 1824 22345 397 --
NM_001660chr33754 233 78 ------
NM_001663chr1442555 1867 1096 990 --21047 996 --
NM_001664chr33361 102 91 1335 ----
NM_001668chr162264 2200 897 875 654 161 --2636 346 --
NM_001677chr11317 1403 2820 717 --
NM_001681chr121290 ----1647
NM_001682chr1262926 2625 2070 604 470 310 --22599 616 --
NM_001690chr352566 2540 2487 413 219 ------
NM_001693chr841119 972 328 289 ------
NM_001695chr853682 3518 3456 525 79 --23708 1697 --
NM_001701chr92553 223 ------
NM_001704chr6--199 --1394
NM_001709chr1131795 423 47 --12283 --
NM_001714chr12--1430 ----
NM_001730chr1351126 1074 529 405 315 --11301 --
NM_001730chr1351126 1074 529 405 315 --11301 --
NM_001743chr23554 501 74 --153 1159
NM_001744chr5149 --1449 --
NM_001746chr572475 2431 2151 1801 1099 1043 887 12677 22873 1975 --
NM_001748chr121121 112 11066 4936 923 887 284 1932
NM_001753chr761642 1546 1505 1431 661 561 1584 41667 1599 233 113 --
NM_001754chr2183652 3362 3207 3110 2836 1520 1377 775 ------
NM_001755chr1611894 1774 32300 1588 294 22238 1868
NM_001759chr12105219 5203 4716 4505 4298 3501 3475 3432 1987 1597 24735 3816 11530 --
NM_001777chr393913 3443 3309 3215 1253 1226 745 677 302 12610 ----
NM_001792chr1841111 811 255 245 --1457 --
NM_001797chr162570 183 ------
NM_001801chr51427 --153 2493 31
NM_001806chr1922051 723 32796 2233 866 21806 964 --
NM_001822chr21541 --1738 1584
NM_001827chr9----1249 --
NM_001830chrX53080 2906 2752 1595 600 --53471 2777 1574 1097 491 13619
NM_001839chr12567 116 --2181 81 1133
NM_001844chr12157 ------
NM_001851chr6--1613 2122 97 --
NM_001854chr151081 573 410 145 43 --11100 11242
NM_001858chr674286 3755 2062 1982 1961 1917 497 15014 33499 2055 403 14372
NM_001874chr1294732 4096 3950 3331 2042 1992 1227 1042 219 --14757 --
NM_001875chr22258 53 2358 131 31055 285 120 --
NM_001880chr21117 ------
NM_001892chr531361 1255 120 ------
NM_001894chr2231200 1084 902 --11141 --
NM_001895chr2041197 1071 994 238 --1768 --
NM_001903chr5------1797
NM_001904chr32145 51 --11007 --
NM_001914chr182376 328 1345 ----
NM_001918chr1129190 9127 8888 8382 6545 6507 3127 3094 2923 2879 1756 679 46411 3574 1273 1026 18482 --
NM_001935chr221025 59 --1130 1197
NM_001938chr131746 1599 78 ------
NM_001939chrX61473 1362 605 539 322 261 13403 --12503
NM_001945chr531424 1259 913 --1303 --
NM_001946chr122982 937 1810 1814 --
NM_001949chr652746 2107 908 424 90 --1879 12454
NM_001951chr84499 146 138 28 ------
NM_001968chr43859 829 317 1359 ----
NM_001969chr1472820 2759 2618 1326 1191 990 512 --23495 779 1358
NM_001977chr431775 539 280 2503 303 2648 583 --
NM_001981chr181575 1551 913 863 671 315 285 267 2955 454 11937 --
NM_002006chr475236 3578 3550 1572 1500 1075 237 14268 1975 14417
NM_002009chr153824 744 330 12277 ----
NM_002010chr131485 ------
NM_002013chr142248 199 ------
NM_002015chr1332716 2321 832 ------
NM_002024chrX72234 2096 1931 1585 835 561 550 2663 199 11429 --
NM_002025chrX169041 7047 6936 6254 3487 3401 3216 3190 3111 2283 1532 1518 1141 1125 199 135 1826 37424 3028 2517 15727
NM_002028chr1431309 861 132 ------
NM_002035chr1873999 3444 3056 2823 1603 1429 365 13958 23569 2517 --
NM_002039chr4--2371 327 ----
NM_002040chr2152849 2596 2329 1043 977 22500 951 52295 2061 955 170 67 --
NM_002056chr23777 599 171 --1866 --
NM_002069chr741684 634 501 384 1682 11168 --
NM_002092chr4104862 4392 1794 1414 1364 1273 1023 937 541 391 --21155 636 13843
NM_002107chr11426 ------
NM_002126chr1794141 3662 3571 3190 3131 1120 1065 622 370 23149 2738 1556 --
NM_002128chr1331596 1019 216 --11744 --
NM_002130chr541547 1328 1082 393 ----11134
NM_002131chr631321 1058 823 ------
NM_002137chr752224 2003 1883 245 113 --21762 957 1212
NM_002140chr931171 780 103 ------
NM_002141chr72541 37 ------
NM_002146chr1741411 1175 1161 917 --11400 1391
NM_002158chr2103301 3192 2964 2820 1332 1082 883 781 695 107 33229 3016 1224 22789 479 12611
NM_002163chr1621232 472 1113 2480 117 --
NM_002182chr362774 2675 2282 2253 2005 359 ----1419
NM_002203chr553945 3467 3364 2856 1516 ----12689
NM_002207chr33681 301 59 ------
NM_002210chr263454 3006 2185 1169 1135 992 1292 21300 465 --
NM_002211chr1041101 1041 909 242 1761 21005 940 --
NM_002214chr775531 4833 4819 4316 4164 2025 877 35161 4356 1140 54852 4638 1568 1039 655 21923 917
NM_002222chr341340 1128 888 233 --131 --
NM_002223chr1243971 611 598 441 --2900 646 --
NM_002224chr6--1249 --2762 241
NM_002247chr1042236 1619 942 905 ----1948
NM_002250chr19131 --1537 --
NM_002264chr3114996 4879 3868 3766 3331 3242 1294 1139 1048 507 471 --54296 3073 1953 404 134 --
NM_002265chr173482 300 272 ------
NM_002267chr1352077 1850 1708 801 638 --12093 --
NM_002268chr331705 1619 1224 ----11406
NM_002269chr61402 ------
NM_002270chr5145204 5095 4937 4661 4464 3971 3959 3781 2183 1767 1397 1201 1110 966 --41661 847 697 570 --
NM_002285chr284179 4116 3251 3037 2689 1494 1449 1001 --23335 495 --
NM_002290chr62412 230 --11313 --
NM_002293chr152667 2537 1687 200 66 22486 235 --12687
NM_002310chr5166547 6444 6354 5119 4736 4329 2455 2264 1934 1878 1556 1376 1350 1080 440 266 24006 1968 65881 5871 5038 4356 1390 1251 --
NM_002312chr133780 406 301 198 1201 --
NM_002313chr1021872 310 14212 11663 1260
NM_002336chr1255010 3430 1335 1055 682 1286 24807 735 --
NM_002351chrX21541 559 2271 26 ----
NM_002354chr23372 350 339 ------
NM_002355chr123508 495 163 ------
NM_002356chr672639 2387 1976 1941 681 317 262 22365 1757 1136 --
NM_002372chr53664 550 46 ------
NM_002374chr252924 2587 2557 1402 1151 --22592 297 --
NM_002382chr1421005 449 ------
NM_002395chr661462 1057 987 461 454 384 --1195 21120 115
NM_002397chr562235 2074 1516 757 155 145 161 ----
NM_002398chr211345 ------
NM_002399chr1511235 --21357 444 --
NM_002408chr142299 224 ------
NM_002444chrX61953 1433 808 670 462 286 11879 --11498
NM_002449chr551253 1198 1070 957 944 ------
NM_002478chr112518 452 ------
NM_002480chr1241120 1004 369 135 ------
NM_002481chr1117213 6596 6443 6289 2960 2744 2468 1677 1311 831 320 15460 57267 1619 1253 913 75 --
NM_002485chr842180 1951 549 472 1801 12068 --
NM_002486chr922490 544 142 2520 155 1738
NM_002487chr152246 141 1594 ----
NM_002499chr1562074 2007 1763 866 222 172 --21521 408 --
NM_002500chr23815 298 153 --2913 420 --
NM_002515chr1441473 437 218 72 --11700 --
NM_002519chr1141229 1100 618 182 --1431 --
NM_002522chr1733564 3059 527 --11328 --
NM_002527chr12------136
NM_002536chrX2316 228 ------
NM_002545chr11104351 4197 4159 3965 1850 872 856 504 447 266 --34135 3684 1068 --
NM_002546chr84715 630 220 95 2751 302 ----
NM_002547chrX63773 2971 2646 1309 944 304 --3922 457 418 --
NM_002553chr71311 ------
NM_002556chr1131761 1620 645 ----22124 182
NM_002577chr333963 1266 890 --42945 2806 631 297 22872 1334
NM_002581chr995087 4271 2278 2190 1655 844 801 603 132 25663 931 1821 --
NM_002583chr124511 242 214 195 ------
NM_002590chr132478 401 1103 2455 417 --
NM_002591chr201476 --2582 23 --
NM_002594chr2011694 ------
NM_002595chr1221614 775 ----11240
NM_002600chr15702 685 625 404 125 --31304 582 195 --
NM_002601chr21357 --165 --
NM_002607chr731254 1244 1180 ------
NM_002610chr242969 2270 783 331 191 12360 13062
NM_002618chr22347 46 137 ----
NM_002628chr34368 219 177 100 11048 ----
NM_002641chrX31983 758 657 11839 21732 1344 --
NM_002645chr11113091 3022 2850 2832 2738 2330 2155 2001 1080 793 771 23041 622 --12838
NM_002648chr661251 1196 845 501 492 447 --1830 --
NM_002655chr884309 3681 3361 3207 1427 759 358 197 181 34403 1206 311 --
NM_002657chr2053852 3259 2595 1488 474 --33128 2472 244 13361
NM_002687chr141163 193 31204 511 68 --
NM_002709chr233532 827 517 13268 23588 3340 --
NM_002713chr111041 --1750 --
NM_002715chr511067 --1269 --
NM_002716chr1153567 3286 2285 996 859 12258 23280 2348 --
NM_002718chr372566 1721 945 566 540 328 191 --31856 1848 751 --
NM_002719chr1442377 2094 1755 748 ----1725
NM_002721chr92146 81 --1121 --
NM_002726chr63438 354 332 --1156 --
NM_002731chr173178 3077 2735 2659 986 234 95 12175 ----
NM_002734chr1772253 1845 1745 1730 698 672 636 --12051 --
NM_002737chr1786350 5435 5135 5093 2204 910 694 321 --11467 1194
NM_002740chr382801 2731 2320 2178 1721 627 447 123 --42820 1772 501 272 --
NM_002745chr2284500 3824 3598 3503 3219 1659 1458 532 --34505 3518 1352 --
NM_002748chr1551213 840 781 488 86 --2316 23 1939
NM_002750chr101197 ------
NM_002753chr42612 530 ------
NM_002764chrX4854 671 329 199 --1661 --
NM_002765chrX21188 300 --1467 --
NM_002786chr11180 ------
NM_002814chrX1157 --124 --
NM_002815chr17199 ------
NM_002822chr1261806 1209 433 374 335 110 --1676 --
NM_002823chr2--1249 ----
NM_002825chr72458 98 ------
NM_002835chr72652 270 1151 --2214 119
NM_002837chr1232964 2907 2837 34361 3156 1216 63592 3546 2981 1365 1224 1200 --
NM_002839chr9103525 3463 3064 3015 2828 2757 2461 2362 679 669 ------
NM_002843chr1143194 2906 523 411 22357 99 11339 --
NM_002844chr61348 1164 ----
NM_002845chr18--1437 ----
NM_002847chr731541 1501 258 ------
NM_002848chr1221016 136 --11222 --
NM_002849chr121894 ----1762
NM_002851chr75715 656 191 168 87 ------
NM_002860chr102778 60 --1255 --
NM_002868chr1262261 2231 1843 827 671 305 11623 32401 2139 247 --
NM_002869chr1131695 1657 434 1374 11405 --
NM_002871chr151977 1637 411 257 92 --1553 --
NM_002874chr962239 2185 2177 1847 939 758 ------
NM_002886chr395203 5021 4881 4030 3605 1757 1331 1049 781 --13244 11803
NM_002890chr531030 966 293 ------
NM_002892chr1421176 121 --1242 --
NM_002894chr18------1212
NM_002902chr15----161 1125
NM_002906chr1182425 1665 1629 1560 737 707 447 234 ----1637
NM_002907chr123333 292 136 1380 ----
NM_002912chr63387 302 114 1710 ----
NM_002922chr11648 ------
NM_002923chr11648 ------
NM_002927chr12558 503 ------
NM_002940chr451454 1295 537 374 258 11721 ----
NM_002941chr311264 21138 244 11170 --
NM_002945chr174764 719 566 259 ------
NM_002948chr331169 466 173 ----1214
NM_002956chr1231257 1210 533 21424 318 21163 349 --
NM_002957chr931467 1275 747 23412 3387 ----
NM_002973chr12----1535 --
NM_002977chr242972 1304 389 305 --53272 2190 1201 688 421 --
NM_002994chr441921 1850 585 255 1650 4712 681 654 456 --
NM_002995chr1--1692 1129 --
NM_002998chr841699 606 450 388 --31814 1495 376 11916
NM_003001chr192239 1975 1960 1953 1890 1581 1549 245 74 22225 1837 1758 --
NM_003010chr1772437 2145 1884 1814 1800 1783 904 1958 3629 498 465 12290
NM_003011chr941197 1163 469 176 ------
NM_003013chr45859 742 708 539 135 1682 1766 --
NM_003014chr731039 962 62 11057 21080 398 --
NM_003016chr1721964 1713 --31470 1410 779 1691
NM_003017chr62528 40 --31217 567 373 1223
NM_003022chrX51309 1256 430 398 252 21150 942 21222 946 11178
NM_003026chr931224 1097 949 ------
NM_003027chr152416 29 ------
NM_003034chr12188115 7921 6945 6873 6842 6690 6529 6082 6039 5928 5724 3209 3174 2959 2115 1948 1629 1062 37003 2215 205 23161 152 --
NM_003035chr11310 ------
NM_003038chr252504 2300 426 145 24 ----12673
NM_003042chr332141 390 82 11897 ----
NM_003045chr1355028 4582 4363 1330 139 14992 1346 14884
NM_003046chr875308 4248 4231 3868 3489 1266 1034 --45097 3966 1569 453 --
NM_003048chr272786 2632 2535 2190 341 270 203 ----12455
NM_003069chrX--1504 ----
NM_003071chr331570 344 292 --22102 244 --
NM_003074chr341864 1840 1673 1529 --31653 405 397 --
NM_003079chr174639 415 321 33 --1716 --
NM_003081chr203450 161 75 ------
NM_003095chr122352 294 ------
NM_003099chr15106155 5930 5028 2615 2497 2075 1827 1629 192 41 16041 26520 2144 22002 1872
NM_003108chr2126566 6047 5765 5721 5701 5653 5423 5359 4852 2587 1557 1517 --46807 6347 5001 782 11266
NM_003111chr24489 346 210 81 21346 147 1151 --
NM_003112chr753082 2866 2632 2285 368 --1646 --
NM_003115chr12462 310 ------
NM_003128chr272040 1907 1751 1738 836 412 180 --136 --
NM_003130chr711116 1248 31208 360 71 1136
NM_003133chr1148 185 1200 1151
NM_003135chr51281 ------
NM_003144chr631491 400 33 --1879 11859
NM_003146chr111363 --2259 32 --
NM_003150chr1752242 1920 1769 208 145 12388 ----
NM_003161chr1773385 3345 3249 2522 1140 1113 387 23515 1411 11390 --
NM_003162chr211019 --1909 --
NM_003176chr1189 --1226 --
NM_003176chr1189 --1226 --
NM_003183chr22743 242 1642 ----
NM_003185chr2031367 1263 1079 --21287 461 --
NM_003189chr183296 2645 2574 2305 642 552 386 225 --32491 691 391 --
NM_003198chr11254 ------
NM_003199chr1875294 5130 5094 4508 3831 1169 1095 --15633 24130 68
NM_003202chr531899 1366 566 11748 ----
NM_003206chr62424 312 ------
NM_003217chr1241892 1854 632 122 --1595 --
NM_003221chr674050 3739 3607 3185 2919 2743 2725 --23415 2999 --
NM_003222chr202404 111 1117 1458 --
NM_003234chr352343 2072 1778 1559 955 --42154 2135 1674 376 --
NM_003238chr11234 ------
NM_003242chr33788 368 190 --2999 816 --
NM_003243chr111120 ----21202 1188
NM_003247chr641267 425 335 167 --11677 --
NM_003253chr2131609 711 221 11392 ----
NM_003257chr1521050 83 --11010 --
NM_003262chr375057 3813 3799 2058 1213 771 272 45277 4159 3635 1995 14046 --
NM_003264chr41510 ------
NM_003272chr11245 ------
NM_003274chr2162660 2455 2184 1987 567 404 --22701 1844 --
NM_003281chr1105320 4730 4681 4645 4302 3633 3466 2019 1670 1021 11824 11690 --
NM_003292chr152290 2190 1410 578 453 --11601 --
NM_003298chr3105802 5425 5160 4790 2181 1627 814 462 205 133 --45728 2029 1941 1043 14403
NM_003304chr351069 1024 1011 479 265 --1614 --
NM_003320chr1194421 4120 4099 4078 3357 3082 1735 165 50 13149 ----
NM_003336chrX31006 989 216 1296 --190
NM_003337chr581633 1489 1131 699 304 172 158 51 21449 325 ----
NM_003338chr1011888 --21391 478 --
NM_003339chr53254 205 129 11040 21490 1337 --
NM_003341chr32532 164 1585 ----
NM_003342chr1783071 2976 2565 865 638 579 572 538 --13105 --
NM_003348chr1231124 1087 686 ------
NM_003349chr2031603 1209 376 --11072 1146
NM_003350chr83907 787 375 ------
NM_003352chr251040 969 934 694 360 ------
NM_003368chr13783 616 518 --189 --
NM_003372chrX1233 --1320 147
NM_003374chr53259 71 53 ------
NM_003375chr10----1412 --
NM_003376chr611346 11878 11445 --
NM_003376chr611346 11878 11445 --
NM_003380chr102226 87 164 ----
NM_003383chr92524 122 --1166 --
NM_003390chr111994 --187 --
NM_003392chr374350 4343 3892 3593 3534 1701 1622 11334 ----
NM_003400chr21248 ------
NM_003404chr2041915 1630 822 765 ------
NM_003406chr8101819 1722 1675 1521 1430 737 615 273 199 116 1417 11480 --
NM_003407chr19------1657
NM_003410chrX52283 2017 1114 498 129 22264 276 52066 605 315 306 233 --
NM_003411chrY21580 652 --1663 --
NM_003412chr333023 2874 2787 2991 694 31112 827 591 --
NM_003413chrX31378 1275 240 --1576 --
NM_003418chr31119 ------
NM_003442chr111845 ------
NM_003463chr662442 2309 2256 2170 1057 490 12996 23301 802 12244
NM_003468chr244209 3483 3158 221 24008 3004 2301 89 --
NM_003469chr22104 26 --1174 --
NM_003470chr1671667 1648 1604 1327 714 433 352 --21557 1176 --
NM_003471chr352176 1873 911 515 302 --2654 211 --
NM_003472chr631334 1103 341 --1141 --
NM_003478chr1112200 33018 2522 126 22865 416 1131
NM_003483chr1282847 2374 2061 1818 1134 1111 569 536 ------
NM_003489chr2163441 3191 2969 2619 2272 341 2729 356 1780 --
NM_003498chr1632436 897 264 ------
NM_003506chr83947 389 116 11093 31347 1272 330 --
NM_003507chr231880 1556 746 --11987 11737
NM_003559chr1783221 3189 3121 1375 1023 887 311 291 ------
NM_003566chr1272632 2169 2136 698 688 496 353 23304 2638 33308 1120 205 1581
NM_003569chr64626 569 270 119 ------
NM_003574chr18135738 5142 5051 4855 4802 3882 1841 1557 1211 1010 372 359 67 14284 41488 977 483 138 --
NM_003576chr1342798 2721 1961 801 --42294 572 567 245 --
NM_003580chr8----1464 --
NM_003583chr1273142 2819 1550 1298 294 204 119 33951 3063 533 11253 --
NM_003589chr1331304 1055 181 11080 11434 --
NM_003590chr243699 2626 1605 928 13654 32943 1238 454 --
NM_003595chr222324 173 1517 1385 1522
NM_003597chr252160 1972 1590 531 188 --11447 --
NM_003603chr461943 1803 1632 852 541 484 2527 95 12133 --
NM_003615chr3103954 3788 2648 2498 1339 1029 822 754 342 289 --21140 969 21160 955
NM_003617chr164494 1165 668 237 174 81 14943 24919 995 --
NM_003618chr22331 302 --2978 111 --
NM_003626chr1131335 1250 247 --21129 252 --
NM_003628chr22626 218 ------
NM_003629chr143468 3224 2370 2236 --11335 --
NM_003630chr62515 480 --2728 41 --
NM_003633chr511866 11772 ----
NM_003660chr191270 ------
NM_003663chr3113293 3247 2948 2496 992 818 564 535 488 359 351 --31361 904 252 1980
NM_003664chr54538 439 179 68 ------
NM_003670chr331422 1287 422 --21204 484 --
NM_003671chr973319 3243 3231 1361 1248 1067 457 1637 11028 --
NM_003672chr151515 1316 630 226 108 --11921 21797 117
NM_003681chr2196103 5888 5279 5124 4903 2348 1406 1239 470 24976 81 1529 --
NM_003692chr9--1693 1379 --
NM_003701chr134943 807 772 432 --11048 11023
NM_003702chr82842 189 ------
NM_003704chr41632 ------
NM_003705chr22844 596 ------
NM_003714chr542356 1019 257 53 ------
NM_003718chr73513 451 35 ------
NM_003722chr362672 2268 1773 1732 452 151 1887 22476 2132 1892
NM_003725chr124419 393 125 111 ------
NM_003744chr143972 202 24 --11267 --
NM_003745chr162307 61 ------
NM_003749chr1332151 932 735 11766 32301 1687 812 12162
NM_003750chr102748 334 --1315 --
NM_003759chr453957 3036 2709 786 432 22986 691 24004 2656 --
NM_003762chr131336 940 926 --1165 --
NM_003763chr2021194 889 ------
NM_003764chr63758 620 599 ------
NM_003766chr172452 169 ----129
NM_003774chr1273074 2520 2400 2182 1302 1026 661 22569 205 11309 11000
NM_003781chr351692 638 546 476 40 1394 11870 --
NM_003787chr1831390 674 596 31239 1139 204 2615 537 11322
NM_003794chr32849 391 ----1438
NM_003796chr192419 231 1182 2242 114 --
NM_003799chr1894575 3904 3562 3023 2881 1826 1558 532 256 --21123 717 11310
NM_003816chr821406 52 1376 ----
NM_003822chr153079 3035 2882 2066 2012 12895 12193 --
NM_003840chr831466 859 587 --31976 577 41 1546
NM_003842chr841656 889 709 254 --31821 701 43 --
NM_003858chr142535 94 ----1279
NM_003861chr1462869 2849 2507 2323 2139 407 --11852 --
NM_003870chr1532044 1663 246 --22096 538 --
NM_003877chr123913 298 187 --1303 --
NM_003884chr311557 --1409 --
NM_003887chr242343 1437 903 547 --32199 1511 790 --
NM_003888chr1531724 1500 106 --11672 --
NM_003895chr212382 112 2536 263 1744 --
NM_003896chr2192 ------
NM_003902chr13579 311 296 ------
NM_003909chr862749 2284 1965 1072 965 83 32963 2686 1136 2688 295 1830
NM_003913chr613755 13273 21103 777 --
NM_003927chr184985 728 145 86 2972 418 ----
NM_003930chr72718 114 --42220 1748 1708 119 --
NM_003934chr931039 484 467 ------
NM_003939chr1083803 3300 3201 2821 1489 1230 631 244 --12693 13338
NM_003941chr73361 321 55 --21623 123 --
NM_003943chr421128 1009 ----1295
NM_003948chr451740 1734 1035 634 542 --21705 229 22431 2086
NM_003953chr152763 2663 1936 1855 262 ----2626 335
NM_003958chr6103647 3404 3356 3275 3097 2829 2711 2679 782 422 --3715 508 157 --
NM_003968chr32578 45 --1501 --
NM_003971chr171245 ----1516
NM_003972chr101309 1347 ----
NM_003983chr1664391 3451 3169 875 698 287 --13285 13189
NM_003994chr12114318 3824 3795 3248 3119 2821 1098 1044 702 661 125 14394 23662 28 --
NM_003998chr4--1631 1677 --
NM_004006chrX42515 1805 823 799 12633 --12207
NM_004007chrX42515 1805 823 799 12633 --12207
NM_004009chrX42515 1805 823 799 12633 --12207
NM_004010chrX42515 1805 823 799 12633 --12207
NM_004011chrX42515 1805 823 799 12633 --12207
NM_004012chrX42515 1805 823 799 12633 --12207
NM_004013chrX42515 1805 823 799 12633 --12207
NM_004014chrX42515 1805 823 799 12633 --12207
NM_004015chrX42515 1805 823 799 12633 --12207
NM_004016chrX42429 1719 737 713 12547 --12121
NM_004017chrX42515 1805 823 799 12633 --12207
NM_004018chrX42429 1719 737 713 12547 --12121
NM_004020chrX42515 1805 823 799 12633 --12207
NM_004021chrX42429 1719 737 713 12547 --12121
NM_004022chrX42429 1719 737 713 12547 --12121
NM_004023chrX42429 1719 737 713 12547 --12121
NM_004028chr1893006 2996 2932 1302 947 550 508 312 252 --33333 1338 261 --
NM_004034chr103591 533 477 1427 --1165
NM_004035chr1754975 4948 4910 1542 1289 --24967 3410 14756
NM_004039chr153308 157 146 1294 ----
NM_004052chr102686 41 1792 ----
NM_004056chr82874 170 --1776 1820
NM_004067chr731530 1494 506 --1563 11142
NM_004075chr12156 ------
NM_004080chr731317 526 219 ------
NM_004081chrY51305 706 550 538 345 --1700 1237
NM_004093chr1342688 2011 1271 163 --12426 --
NM_004094chr1492968 2917 2596 2542 2486 2259 2088 671 665 --2747 489 --
NM_004096chr1031607 1346 707 --1557 --
NM_004099chr941977 1834 1385 828 1421 ----
NM_004100chr632028 1939 963 22662 657 22191 2117 --
NM_004105chr2----11059 157
NM_004109chr1132251 311 38 12276 ----
NM_004112chr173458 451 283 ----11429
NM_004113chr311790 ----1352
NM_004114chrX3908 276 42 ------
NM_004124chr1493333 2737 871 797 536 517 349 228 97 11325 12236 11049
NM_004133chr862366 2289 1962 834 612 488 1565 22518 1919 11665
NM_004134chr52609 597 ------
NM_004162chr3----1932 --
NM_004170chr92505 231 --11725 --
NM_004171chr11179475 8956 8458 8288 7830 6675 6638 6510 6338 3437 3227 2897 2667 1724 1687 1372 116 23298 651 56361 3282 1109 841 554 13303
NM_004172chr5----12023 --
NM_004185chr11683 ------
NM_004202chrY4564 546 70 61 --1617 --
NM_004215chr83596 426 157 ------
NM_004225chr841380 1285 1208 978 1947 1455 --
NM_004227chr742579 2291 579 546 1867 ----
NM_004232chr1873484 3205 2462 1314 901 876 580 --2755 661 1511
NM_004235chr93896 625 553 1715 158 1755
NM_004237chr52831 112 --1902 1898
NM_004241chr102132 46 ------
NM_004242chr61433 ------
NM_004244chr12129 ----1433
NM_004253chr92948 332 --1365 1282
NM_004261chr11108 ----138
NM_004263chr261633 649 439 288 184 127 ------
NM_004272chr541729 547 373 230 --1675 --
NM_004274chr1482723 2666 2169 1298 1127 746 491 325 --12973 --
NM_004293chr973665 3643 3457 3085 2814 2395 95 1783 23507 622 21449 246
NM_004301chr3125 ----1355
NM_004311chr1032972 2250 2233 ------
NM_004316chr1241096 828 800 252 1809 11073 1957
NM_004326chr12267 166 ----1496
NM_004329chr104438 408 323 240 11046 1402 --
NM_004331chr842156 1989 1648 314 --11788 --
NM_004338chr18106979 6931 5627 5320 2690 2634 2511 1957 1710 1134 21048 591 36865 6242 5956 --
NM_004342chr762219 1942 1698 1623 335 201 --32140 552 111 1444
NM_004349chr831223 225 155 ------
NM_004354chr43283 256 121 1214 1297 2705 334
NM_004359chr19131 1530 ----
NM_004370chr651820 1625 1585 867 745 12164 41825 1723 1557 576 11949
NM_004371chr141506 1487 958 135 11392 21295 228 --
NM_004374chr82136 38 ------
NM_004384chr552290 1564 1530 128 33 2811 336 ----
NM_004386chr191628 11850 21901 1502 --
NM_004388chr12423 90 ------
NM_004392chr1332466 1632 581 ------
NM_004397chr11134316 3697 3609 3568 3460 3384 3034 1695 1417 1265 1159 443 185 1462 ----
NM_004404chr251949 631 585 375 185 --11410 --
NM_004407chr42992 860 ------
NM_004411chr73274 263 208 1715 ----
NM_004415chr6129 1644 1176 --
NM_004423chr342465 2377 2059 634 22606 2534 21090 82 --
NM_004430chr832097 1752 872 12535 ----
NM_004432chr982414 1767 831 730 611 327 230 190 --21886 253 --
NM_004433chr141697 1552 667 261 ----11322
NM_004438chr282239 2073 839 739 540 236 84 43 ------
NM_004440chr631672 735 521 ------
NM_004441chr321304 1135 ----11283
NM_004447chr1251101 1075 856 443 384 ----1235
NM_004448chr17----1487 --
NM_004450chr14--1298 ----
NM_004454chr362236 1937 1473 378 305 119 ------
NM_004457chr22412 115 --11391 1217
NM_004458chrX22570 2426 32202 1863 533 41700 936 770 483 1168
NM_004459chr1731642 1485 764 1499 31796 692 208 --
NM_004464chr443752 3565 2657 900 --33016 883 466 11400
NM_004480chr141265 ------
NM_004481chr132659 2595 933 ------
NM_004482chr22938 139 ------
NM_004496chr141419 ----1176
NM_004500chr1441901 716 97 45 ------
NM_004501chr174143 4092 3948 3910 3503 2804 261 23228 938 ----
NM_004504chr282876 1857 1200 1163 1085 935 661 407 ----11146
NM_004505chr1732010 1970 667 ----11489
NM_004506chr64476 281 228 79 ------
NM_004516chr192450 378 --1189 1340
NM_004520chr5----2554 249 --
NM_004521chr102390 342 1328 ----
NM_004523chr1021227 1094 ----11484
NM_004525chr24423 210 156 121 191 11490 --
NM_004537chr123524 224 46 ------
NM_004569chr144670 625 548 210 1216 ----
NM_004571chr2111165 --1578 --
NM_004586chrX135315 5213 3956 3945 2151 1909 1456 1374 1309 842 822 667 517 25302 3730 --14981
NM_004598chr573257 2498 2442 2222 1059 686 480 22888 730 23348 3032 22532 2232
NM_004607chr5--1196 ----
NM_004612chr9154769 4101 4040 3893 3867 3132 1791 1563 1423 1095 955 824 743 619 242 1995 44620 3495 3238 516 --
NM_004622chr212106 --22183 298 1717
NM_004631chr111295 1326 ----
NM_004642chr122704 287 ----1267
NM_004654chrY41037 567 558 371 ------
NM_004655chr1741352 1251 1065 349 ------
NM_004660chrY21703 337 ------
NM_004661chr541214 1087 897 54 --2194 150 --
NM_004663chr1541525 1506 1113 102 1523 1259 --
NM_004670chr1051548 1278 1160 508 327 21604 546 146 21303 602
NM_004677chrY1457 ------
NM_004680chrY----153 1305
NM_004681chrY1273 1200 --2677 180
NM_004686chr851749 1638 306 285 273 1116 1537 --
NM_004689chr14----1351 --
NM_004696chr13848 805 721 1551 3835 792 762 --
NM_004703chr1782257 2185 2178 945 584 397 286 132 12198 1548 1544
NM_004705chr112813 89 ------
NM_004709chrX41306 1141 640 168 11707 ----
NM_004715chr181196 ------
NM_004717chr731370 982 427 11376 ----
NM_004718chr23533 520 88 --1652 --
NM_004726chrX85514 5280 3733 2212 1691 817 776 396 14372 24394 3796 --
NM_004730chr521438 693 31806 356 94 1270 --
NM_004734chr1343059 1263 585 250 ------
NM_004735chr21156 --1691 1315
NM_004736chr151510 538 520 226 80 22156 273 --11471
NM_004742chr351317 666 618 372 92 ----11834
NM_004745chr8116596 6165 5884 5732 5723 5677 5661 5261 2576 1156 798 15976 26832 1752 --
NM_004747chr102607 358 --11596 --
NM_004748chr1574058 2983 1418 1303 733 581 234 --53262 2853 1151 613 466 21441 201
NM_004760chr762428 2191 2008 1791 581 424 --1850 --
NM_004764chr12--1470 3202 90 72 --
NM_004768chr12962 828 1801 ----
NM_004773chr17----1253 --
NM_004774chr1743076 2443 860 611 ------
NM_004775chr1892334 2112 1753 1728 1712 1600 958 669 418 22172 1516 12392 --
NM_004776chr2052709 2402 2280 706 640 --21119 523 --
NM_004779chr53910 344 253 --170 --
NM_004781chr171546 487 387 208 146 94 84 1444 ----
NM_004781chr171546 487 387 208 146 94 84 1444 ----
NM_004788chr1172720 2704 2538 2374 2049 1978 534 --22110 1692 12482
NM_004789chr92338 329 1312 2440 49 --
NM_004792chr2121 ------
NM_004796chr1432013 551 377 11937 ----
NM_004798chr2053545 2478 1108 925 597 --41469 687 301 42 --
NM_004799chr11323 ------
NM_004801chr2150 11149 2971 77 --
NM_004805chr24995 902 414 361 --1907 --
NM_004808chr1093337 3240 2840 2403 2328 2070 1187 632 267 ------
NM_004817chr91261 ------
NM_004834chr252718 2156 1150 962 717 ------
NM_004835chr32762 97 ----1866
NM_004835chr32762 97 ----1866
NM_004836chr24610 276 213 124 ------
NM_004840chrX3864 326 32 12085 2919 347 1956
NM_004841chr121122 66 --1288 --
NM_004842chr631241 133 125 1374 11310 --
NM_004857chr1464043 3752 3709 1196 1071 472 11805 --13915
NM_004859chr1762907 2268 2220 2181 2056 562 ------
NM_004862chr1641603 1593 1081 306 ----3496 456 394
NM_004866chr584893 4733 4517 3768 3743 3360 1949 41 13489 34650 3663 28 1167
NM_004869chr1851733 1516 1434 167 154 11411 11586 --
NM_004871chr1754214 3860 3796 1512 731 --13134 --
NM_004873chr1442316 1202 711 205 --13202 --
NM_004888chr94977 408 205 184 ------
NM_004893chr5----1475 --
NM_004896chr1041179 392 259 237 ----21256 136
NM_004898chr431988 759 622 --32291 2027 508 --
NM_004902chr203767 534 223 --2130 66 --
NM_004904chr755586 2054 498 322 256 14818 56051 5207 4751 2067 1505 --
NM_004906chr6176 1661 2226 92 --
NM_004912chr711512 11209 31491 385 83 --
NM_004915chr212608 564 ------
NM_004924chr1921000 402 ----1779
NM_004929chr81987 --11490 11121
NM_004938chr931197 457 300 --1232 --
NM_004946chr52336 122 1424 ----
NM_004947chr352435 1997 1677 843 785 ------
NM_004956chr754349 4237 3966 3737 272 --44470 3809 429 266 12943
NM_004958chr1--151 ----
NM_004973chr621597 705 --11724 --
NM_004976chr1133815 1600 603 --35013 3262 665 --
NM_004985chr1294254 4191 4073 3356 3007 1451 371 289 93 12811 23273 1225 23836 135
NM_004992chrX66999 5196 3195 2027 2014 1238 12105 1943 28547 8302
NM_004992chrX66999 5196 3195 2027 2014 1238 12105 1943 28547 8302
NM_004993chr142457 34 ------
NM_004999chr674396 3130 2886 1754 1313 350 101 2472 292 11491 --
NM_005006chr22746 355 --1295 --
NM_005010chr792062 1879 1783 1404 839 680 610 371 199 --11952 11987
NM_005023chr511199 21367 319 21378 287 --
NM_005028chr1082163 1693 1676 1643 1551 907 836 822 ------
NM_005036chr2267756 7613 1408 1233 1191 159 27937 7146 37418 6322 5145 18341
NM_005037chr3----1171 --
NM_005045chr72884 116 1681 ----
NM_005054chr231677 1158 462 --21700 1163 11530
NM_005056chr1285613 5265 5064 4900 4353 4180 2214 716 24481 1100 31393 1212 889 --
NM_005057chr141791 1639 769 416 --1379 --
NM_005063chr1053789 3735 3262 276 171 12941 1467 --
NM_005065chr14165260 4351 4283 4008 3315 1831 1598 1366 1123 893 686 494 308 186 158 47 --75027 4374 4265 4181 2158 935 466 --
NM_005066chr13721 261 93 ------
NM_005068chr621360 366 ------
NM_005069chr2121717 673 --21102 296 --
NM_005077chr91136 --1336 --
NM_005079chr853205 2630 1108 475 165 12875 ----
NM_005080chr222765 628 ----1635
NM_005087chr34773 593 214 173 ------
NM_005088chrX1755 ------
NM_005093chr2075278 4999 3816 1605 1448 1177 918 1688 14211 --
NM_005095chr131918 1709 391 ------
NM_005102chr21333 1700 ----
NM_005105chr161908 1894 1666 1374 674 468 --1175 --
NM_005109chr342108 1985 973 228 ----21819 315
NM_005112chr421030 651 1641 1855 --
NM_005114chr42512 494 ------
NM_005116chr2044351 2808 2799 469 13476 13120 --
NM_005119chr121247 1183 --31215 1091 864 --
NM_005121chr1753796 2733 1406 528 122 12563 33014 1344 79 --
NM_005124chr64805 688 86 71 ------
NM_005126chr342054 1543 600 516 11684 42024 1906 1659 1585 11839
NM_005133chr111397 ------
NM_005134chr181141 --1204 1200
NM_005151chr1892202 1778 1771 1575 904 598 371 323 284 12270 31656 896 187 1432
NM_005156chr9135381 5332 4072 3933 1749 1407 1104 1037 852 638 403 369 90 11058 24777 4243 13465
NM_005164chr1242563 1025 975 758 22048 895 ----
NM_005171chr1221195 1006 1132 1379 --
NM_005180chr1041540 1215 1137 55 --21520 424 --
NM_005181chr85695 574 342 154 64 --1173 --
NM_005188chr11237886 7852 7550 7460 7268 7192 7122 6633 6578 6246 6131 6008 5809 5350 3027 2865 2775 2682 2271 2230 2183 2170 1126 16079 57857 6186 5582 2237 961 --
NM_005197chr1495383 4918 4736 4655 2058 1833 1680 1637 265 --32450 2159 1186 --
NM_005201chr321152 296 --1955 --
NM_005222chr73943 227 181 --2267 244 --
NM_005229chrX21227 165 ------
NM_005230chr12169 --1545 1567
NM_005231chr111163 ------
NM_005233chr34967 881 680 517 32384 493 141 --22497 2209
NM_005235chr2147822 7772 7570 7391 7158 7103 7076 6621 6136 5117 2655 1962 991 155 21570 794 46290 5412 1290 855 --
NM_005238chr1143231 3103 870 501 22818 2327 1119 --
NM_005241chr321349 1312 2857 94 ----
NM_005243chr22--1128 ----
NM_005252chr143703 193 121 ------
NM_005254chr1561366 1343 1293 1212 1081 870 --131 1171
NM_005256chr113812 736 611 ------
NM_005259chr221429 1338 --21384 1005 --
NM_005261chr831018 993 856 1643 ----
NM_005263chr151014 458 192 161 86 ------
NM_005264chr104771 751 376 54 ------
NM_005274chr11132 ------
NM_005277chr431953 635 389 --3758 730 618 11625
NM_005296chrX2852 729 --1801 --
NM_005318chr2221238 397 ------
NM_005324chr1731645 683 49 ------
NM_005328chr81710 --1565 --
NM_005339chr473858 3254 2803 444 121 108 35 3403 282 213 11162 11447
NM_005347chr921656 391 ------
NM_005348chr143938 356 25 2171 124 ----
NM_005359chr18216480 5383 5324 5251 5075 4872 4828 4180 4023 2275 1862 1834 1718 1552 1392 1275 1147 1117 741 324 138 12396 75353 5232 4225 4015 1631 1614 105 14070
NM_005373chr131502 1469 482 --1232 --
NM_005375chr641191 1158 295 214 21094 256 ----
NM_005376chr1--1196 --1347
NM_005378chr21738 1598 196 1683
NM_005382chr81357 --1116 --
NM_005385chr352661 1719 604 345 267 2313 27 ----
NM_005398chr1051408 1134 1103 971 248 ------
NM_005399chr1104215 4028 3996 3710 3112 2859 1009 876 397 74 11732 ----
NM_005400chr252865 2138 2003 1882 590 --12105 --
NM_005402chr73541 396 221 1600 127 2163 93
NM_005410chr51588 --1527 --
NM_005413chr21340 ------
NM_005414chr33304 210 90 ------
NM_005415chr22272 138 ------
NM_005433chr1822777 1984 ------
NM_005436chr10103938 3932 3579 2770 2744 1240 653 359 219 117 23662 3205 21517 972 --
NM_005450chr171236 ------
NM_005455chr161610 455 445 375 221 181 31469 639 36 1673 11417
NM_005460chr52584 525 1209 ----
NM_005466chr14--186 ----
NM_005479chr101404 --1414 --
NM_005486chr171256 ------
NM_005487chr2221975 175 1281 --1410
NM_005497chr1765058 4899 2287 1123 378 317 24044 1496 41954 1935 437 100 1919
NM_005502chr982906 2704 2240 2108 1038 952 248 191 --12395 --
NM_005504chr1286074 4246 4003 2174 1900 1589 776 430 26250 678 24366 948 3848 223 218
NM_005506chr442297 1964 690 94 ----12454
NM_005509chr551466 1214 294 193 33 2616 154 11394 11473
NM_005513chr321551 525 21451 1072 --1543
NM_005517chr1----1101 --
NM_005522chr72523 358 --2542 81 --
NM_005524chr32323 147 --1118 --
NM_005525chr1273 61 1271 ----
NM_005540chr121365 25 174 ----
NM_005542chr721385 1249 --31946 1262 79 --
NM_005544chr21116 ----1164
NM_005563chr1----1669 --
NM_005569chr2251446 1231 618 230 141 ----11365
NM_005573chr52596 49 ------
NM_005575chr51262 1837 ----
NM_005576chr151241 ------
NM_005578chr394830 4726 3980 3150 1763 1619 1472 1026 431 24173 3933 43430 1958 1084 946 2796 125
NM_005584chr131582 --1787 --
NM_005585chr15----1318 --
NM_005587chr1541000 873 194 26 1776 1952 --
NM_005593chr123552 525 191 --1135 --
NM_005595chr11827 1158 ----
NM_005596chr9116271 6168 4911 4583 3964 2564 1863 1676 1489 1404 507 1430 11494 --
NM_005598chr151590 1241 674 659 95 ------
NM_005602chr33924 913 377 ----1185
NM_005604chr632562 2476 1952 --1734 11555
NM_005607chr8--1367 11036 --
NM_005611chr1631099 1088 938 ------
NM_005637chr1852044 1792 1385 634 355 --1773 --
NM_005638chrX61709 1488 1359 1183 678 170 --1160 --
NM_005639chr1211258 ------
NM_005644chr11374 ------
NM_005655chr831321 1180 918 11315 2485 324 1320
NM_005665chr1134924 4917 4615 4381 3645 3287 3041 1940 1861 1607 930 797 160 --44467 3858 476 173 --
NM_005668chr553827 3023 2800 1756 640 24204 1265 12822 --
NM_005669chr552237 2080 856 237 39 2604 322 3923 158 100 --
NM_005684chr1195 ------
NM_005715chr6122731 2573 2402 2324 2315 2077 1790 1751 800 741 354 30 11865 ----
NM_005717chr12846 22 1871 21059 115 --
NM_005721chr23398 389 61 ------
NM_005722chr252430 1678 1654 667 349 1504 ----
NM_005725chr142251 2234 1823 1733 11690 1805 --
NM_005730chr1273632 3531 3227 680 615 468 58 11444 12917 --
NM_005733chr51195 ------
NM_005738chr782007 1907 1900 1317 1303 1292 606 87 --2691 155 --
NM_005739chr1542231 1495 471 142 1111 32301 1734 393 --
NM_005746chr732568 766 692 12436 21761 492 --
NM_005748chr1243202 2426 2120 608 --22647 2397 12643
NM_005754chr551218 979 802 487 78 1947 3813 278 131 11094
NM_005756chrX41282 439 389 304 --3325 214 60 --
NM_005759chr294605 3624 3256 1835 1670 968 396 56 24 14415 64301 4289 3679 3614 3556 3140 --
NM_005762chr191133 ------
NM_005765chrX2821 64 196 ----
NM_005776chr143724 668 242 ----1117
NM_005779chr532553 1263 95 --33141 2957 2635 --
NM_005789chr1762120 1925 1912 1650 730 170 1568 156 12051
NM_005802chr91545 2776 737 ----
NM_005806chr2111299 ------
NM_005808chr333497 2816 404 ------
NM_005828chr1765073 4276 4235 3878 1850 492 --21802 634 --
NM_005832chr351291 1268 549 492 250 --11170 --
NM_005833chr93175 115 23 --135 --
NM_005840chrX107139 6457 5069 4798 3013 2484 2379 1573 383 170 25686 2370 34696 1399 560 1881
NM_005857chr161453 1435 1408 1040 1019 999 --41212 1080 434 226 --
NM_005871chr101317 --148 --
NM_005877chr2252056 886 552 375 39 --22575 94 12383
NM_005882chr42685 244 ------
NM_005885chr51658 ----11585
NM_005891chr6------1145
NM_005895chr12104017 3243 3231 3202 2733 940 471 458 451 265 11560 51050 996 912 428 116 --
NM_005896chr2--1802 2806 131 --
NM_005898chr11113162 2697 2535 2290 2126 1227 1147 1028 764 169 81 1284 22620 1264 --
NM_005900chr421167 908 --11233 --
NM_005901chr18178650 7739 7640 7516 6672 6601 5996 3215 2907 2779 2707 2462 1829 1640 1344 999 553 35648 3308 3254 28636 7301 11867
NM_005902chr1523918 1617 24524 1485 14434 --
NM_005903chr5134681 3738 3688 3661 3470 3351 1901 1871 1156 1070 942 653 418 13935 24300 1020 35236 746 283
NM_005904chr1821286 55 ------
NM_005907chr631308 1078 247 150 ----
NM_005909chr573589 3068 2826 1658 1173 231 114 --23727 1289 1943
NM_005924chr731127 1060 819 1843 1884 --
NM_005926chr152464 365 1373 ----
NM_005927chr521126 186 --21077 338 --
NM_005930chr143820 632 70 ------
NM_005933chr1142225 1869 658 285 --32793 2788 672 11074
NM_005935chr4115104 5050 4005 3918 3478 3410 1980 1720 1220 658 27 13297 24751 1426 13285
NM_005941chr874127 4076 3299 2983 2683 1463 1217 --24115 1378 23615 3135
NM_005944chr331091 347 200 --2502 495 --
NM_005955chr174860 3653 1707 1334 1315 1234 883 15471 64370 3722 3601 1683 1576 756 --
NM_005957chr184540 4371 3821 3543 1553 887 854 706 14586 ----
NM_005962chr1031864 1780 1505 11479 ----
NM_005962chr1031864 1780 1505 11479 ----
NM_005966chr242277 410 390 91 32055 1603 708 ----
NM_005999chr141435 1409 292 224 1184 31231 319 261 --
NM_006011chr1584182 4154 4004 3770 3689 3409 3273 2910 13350 43664 1196 1139 1048 --
NM_006016chr662091 1880 1711 1620 869 69 32197 1659 658 12061 12207
NM_006024chr76771 644 588 244 210 138 ------
NM_006029chr14147 ------
NM_006036chr252390 2200 1983 889 56 --32528 2013 539 --
NM_006037chr2104920 4304 4102 3948 3884 3757 3399 1428 1183 676 1740 34893 4229 1681 --
NM_006043chr161694 ------
NM_006047chr2043492 2211 754 518 --22440 1019 11293
NM_006048chr111189 ------
NM_006054chr114484 448 276 65 2255 206 --11295
NM_006060chr754164 3529 1091 832 236 ----13391
NM_006067chr166931 801 353 332 130 83 --1880 --
NM_006070chr31325 ------
NM_006080chr752905 959 943 295 43 12129 ----
NM_006095chr494539 3921 3781 3564 1400 1277 599 259 33 34151 3074 1769 54373 4011 3666 1486 1463 --
NM_006099chr11133 --1870 --
NM_006106chr1163438 3258 3019 2938 1200 910 22292 133 33351 1332 541 11362
NM_006108chr1131661 1485 862 ------
NM_006113chr192075 2066 1987 1728 1553 642 502 313 197 ------
NM_006122chr1532024 1685 868 --12787 12424
NM_006135chr131439 962 186 --1377 --
NM_006136chr72918 460 ------
NM_006154chr1582009 1895 1106 865 751 628 588 331 2536 469 1898 --
NM_006155chr251949 631 585 375 185 --11410 --
NM_006158chr881788 1515 1401 1115 696 614 560 457 1472 ----
NM_006159chr121528 --1652 --
NM_006161chr5--1568 124 --
NM_006164chr21362 188 ----
NM_006166chr123823 468 99 --3893 434 343 --
NM_006167chr842143 1700 1603 41 11803 ----
NM_006178chr1761490 1374 1348 1235 532 113 --1229 --
NM_006191chr12--1223 ----
NM_006197chr861633 878 863 698 317 305 11880 ----
NM_006203chr5115429 4910 4849 4781 4540 3904 1888 1684 979 747 23 13470 44352 1967 887 596 --
NM_006206chr452707 2478 551 403 196 ------
NM_006211chr81279 --2241 99 --
NM_006224chr1732506 1693 356 --32480 2418 1839 --
NM_006226chr241200 1028 445 165 ------
NM_006232chr3----1238 --
NM_006237chr1352156 1429 387 169 76 11557 12141 --
NM_006241chr331753 859 321 1205 42277 2226 1523 250 --
NM_006246chr14----1982 1978
NM_006247chr19----1116 --
NM_006251chr562954 2235 1100 451 381 257 --32734 2685 2197 --
NM_006252chr1207395 7192 7011 6749 6725 6425 6172 5212 4708 2189 1972 1924 1571 1414 1360 807 788 382 231 177 16899 67150 2904 1466 899 653 71 52096 1946 1169 683 67
NM_006256chr182728 2478 2265 1900 820 773 721 272 12415 21710 614 --
NM_006258chr1051309 981 349 114 27 --21359 591 11531
NM_006264chr43565 529 501 2186 126 ----
NM_006275chr2072447 2419 2388 2183 1858 748 669 11755 --21738 501
NM_006282chr2084267 3324 2968 1531 741 452 209 65 21893 802 11336 --
NM_006283chr874980 4427 3276 1986 1756 1126 456 13870 4940 319 291 65 171
NM_006290chr61744 11791 ----
NM_006306chrX92331 2276 1880 1768 1700 939 702 521 510 ------
NM_006315chr473683 3434 3059 1776 1695 805 78 --32754 793 473 11540
NM_006321chr352175 859 737 429 84 1623 2899 831 --
NM_006328chr112178 93 ------
NM_006330chr8----21539 1046 --
NM_006333chr22562 147 2544 466 1169 --
NM_006338chr13569 193 45 ------
NM_006346chr13--1182 ----
NM_006348chr72378 144 1163 --1893
NM_006352chr131783 1374 499 --11774 --
NM_006359chrX41964 1829 467 318 21973 910 1234 --
NM_006364chr1431312 1041 76 --21029 894 --
NM_006366chr631188 956 822 --31044 398 200 --
NM_006371chr3105141 4113 3814 3517 1545 612 457 209 177 168 14216 14855 --
NM_006375chrX41929 1469 1346 194 ------
NM_006379chr721744 248 --22006 743 --
NM_006380chr1764023 1354 795 750 529 149 14087 23374 28 --
NM_006393chr1063967 3621 3457 1159 901 75 34235 3819 1616 ----
NM_006401chr9----1339 --
NM_006403chr621336 83 ------
NM_006413chr101138 1220 ----
NM_006416chr62703 632 ------
NM_006420chr2053242 3197 2687 2304 2126 --13278 --
NM_006451chr53896 848 321 ----1683
NM_006457chr444015 3190 3003 339 1394 53026 2533 983 447 205 33997 2633 839
NM_006459chr1031998 1687 549 ------
NM_006464chr274564 4534 1602 1520 1051 990 573 11448 41381 1220 982 508 --
NM_006469chr151560 1118 991 209 157 --2527 232 --
NM_006482chr1273142 2819 1550 1298 294 204 119 33951 3063 533 11253 --
NM_006489chr1441473 437 218 72 --11700 --
NM_006492chr11333 ------
NM_006504chr1052730 2565 2040 652 91 2247 126 22941 522 --
NM_006517chrX22153 277 ------
NM_006520chrX31675 1180 1048 --21728 554 --
NM_006526chr2032139 1712 71 ------
NM_006527chr4----1147 1143
NM_006534chr2062711 2549 1016 859 795 327 --33351 2566 2328 --
NM_006536chr12899 402 1721 31021 681 376 --
NM_006538chr284133 4087 3892 2672 845 675 546 163 1471 33227 2718 1667 --
NM_006540chr841478 1404 1357 442 ------
NM_006544chr1495304 4028 3942 3830 1678 1669 537 506 349 2753 98 45136 4913 4249 158 14936
NM_006546chr1765683 5569 4450 4210 2222 1655 12633 35672 1101 494 --
NM_006547chr742119 715 485 112 2630 176 11983 --
NM_006558chr81139 --1361 --
NM_006561chr10124913 4208 2470 2153 1841 1657 1648 1568 1261 866 727 77 16004 15960 --
NM_006572chr17102860 2614 2259 1367 962 441 404 307 140 30 13248 1740 12687
NM_006574chr32296 62 ------
NM_006575chr1431346 1283 942 1134 1579 1332
NM_006577chr231225 1199 270 --1105 --
NM_006591chr1131659 1334 736 --21648 205 --
NM_006595chr1141465 206 187 157 --11857 --
NM_006599chr16188049 7921 7591 6765 6461 6147 5996 5710 5635 5615 5515 5293 5038 2449 2188 1581 1221 723 26774 2531 47841 5118 867 370 2891 79
NM_006602chr205702 646 573 340 171 ------
NM_006608chr13398 369 48 ------
NM_006609chr232217 2029 903 42564 1898 1886 1875 12290 --
NM_006614chr363401 2847 816 307 157 54 13477 43541 2786 2252 843 12782
NM_006618chr141169 1079 550 330 --11452 --
NM_006620chr644055 3764 1515 1001 34845 3657 636 44293 882 253 226 1892
NM_006624chr103798 486 413 --11821 --
NM_006625chr121141 841 --1420 --
NM_006625chr121141 841 --1420 --
NM_006625chr121141 841 --1420 --
NM_006626chr992651 2302 2249 2133 1952 753 601 512 416 32701 616 212 11004 --
NM_006628chr15174557 4009 3801 3608 3199 3115 3074 3033 1682 1671 1093 1001 650 553 323 248 60 --1399 --
NM_006636chr21116 2806 758 1878 --
NM_006646chr1333017 1962 591 23031 2117 ----
NM_006654chr1263513 3153 3029 1300 1157 310 34626 4018 690 54431 3372 1067 844 559 1889
NM_006670chr6----1597 --
NM_006690chr2021869 1753 ------
NM_006699chr122647 1864 --62640 2501 2305 1026 1004 829 12089
NM_006704chr132119 94 ----1318
NM_006713chr52596 136 --1201 --
NM_006717chr962897 2542 2365 2099 2062 782 13381 32237 1054 372 --
NM_006720chr1021872 310 14212 11663 1260
NM_006721chr102174 90 --1287 --
NM_006727chr51124 ------
NM_006729chrX125652 5371 5270 5077 4494 3784 1961 1609 1587 1184 1034 567 2778 765 24730 3442 22035 1190
NM_006731chr9115779 4942 4803 4741 4663 4479 2236 2141 1457 626 456 21434 1234 25740 994 --
NM_006734chr63246 220 130 1621 31535 493 257 --
NM_006738chr1554233 4059 3739 1744 365 13341 44600 3744 3224 1556 --
NM_006745chr421056 967 1168 1143 --
NM_006746chrX41458 1360 458 54 11388 21025 249 --
NM_006748chr82591 57 31653 1138 484 ----
NM_006750chr16168088 7207 7176 7052 6345 5769 5546 2925 2639 2400 2194 1846 859 179 165 107 --37042 671 666 --
NM_006754chr731265 314 157 --1277 11212
NM_006759chr2--187 ----
NM_006766chr872670 2644 2576 2529 2308 1043 967 --32358 348 302 --
NM_006775chr682793 2726 2517 999 932 856 585 94 22914 1160 12053 12687
NM_006777chrX82896 2484 2241 2176 1930 894 676 111 12615 --12407
NM_006800chrX1596 --2567 214 --
NM_006803chr82327 51 1533 21560 758 --
NM_006805chr531627 267 169 --21513 398 --
NM_006806chr21------1332
NM_006807chr17----1994 --
NM_006815chr1231114 536 528 1361 11015 --
NM_006822chr17------1275
NM_006826chr221082 838 ------
NM_006827chr1463117 3107 2865 1320 512 272 12083 13139 --
NM_006828chr62476 77 --3212 197 89 --
NM_006837chr8--122 ----
NM_006838chr1281911 1597 1567 1239 524 332 302 115 11869 11375 --
NM_006851chr1272947 2593 2487 1951 1888 1140 522 11010 32747 2704 837 12119
NM_006852chr1722471 2205 12136 12516 12804
NM_006854chr7----22020 193 1189
NM_006873chr283239 3091 2926 2455 1238 546 538 455 ------
NM_006877chr6------1355
NM_006885chr1673325 2981 2735 1607 1447 1286 1145 1442 23862 2586 --
NM_006888chr1462321 1242 1040 476 144 59 1245 ----
NM_006896chr7172 1848 ----
NM_006908chr731294 1255 322 ----11078
NM_006912chr122285 24 --2829 748 --
NM_006914chr92515 399 1333 3616 597 345 --
NM_006915chrX62543 2191 2058 548 368 157 --1402 --
NM_006918chr11125754 5264 5154 4647 4351 3913 3677 3565 2281 1718 1489 247 --44516 3549 2333 344 --
NM_006920chr211541 --21525 1493 --
NM_006922chr252401 2368 1835 1665 572 --121 --
NM_006924chr1764228 3574 3190 1375 1248 973 --34240 3855 341 22794 315
NM_006930chr521530 1300 31738 316 80 21971 447 --
NM_006939chr1451055 890 446 358 92 1840 2895 207 --
NM_006940chr122685 549 1578 1766 1108
NM_006948chr2151817 1601 870 396 107 21665 819 167 --
NM_006963chr1041208 962 437 281 ------
NM_006965chr183964 465 264 --2909 163 --
NM_006980chr72701 225 --1130 --
NM_006981chr962874 2826 2251 2223 1856 555 --22497 2150 --
NM_006988chr21193 11101 --1435
NM_006991chr321006 859 ------
NM_007005chr931324 1257 1061 11302 11142 --
NM_007006chr1653051 471 452 224 102 23278 1091 1206 --
NM_007007chr1241199 945 703 180 11228 44819 4720 4201 1406 --
NM_007008chr22239 164 --2586 292 --
NM_007011chr1586909 6040 5784 4370 2605 2059 1807 1532 11542 66820 6760 2672 1994 1253 1144 --
NM_007013chr831001 791 377 1174 2740 364 --
NM_007023chr221100 1077 1869 1978 --
NM_007034chr14809 716 333 318 1872 11003 --
NM_007039chr144836 656 79 67 21755 365 1507 --
NM_007040chr193986 446 272 ------
NM_007042chr362523 1760 1666 835 394 284 ------
NM_007052chrX3160 60 47 ------
NM_007054chr564001 3781 3263 2641 943 932 --2948 783 1869
NM_007078chr1033057 3041 1888 --11068 --
NM_007099chr22665 620 ----1136
NM_007106chr1352554 2456 2419 1792 1719 12323 32740 1875 282 --
NM_007107chr311935 12283 ----
NM_007114chr382831 2569 2416 1166 1067 868 712 669 22083 451 13106 1275
NM_007118chr53837 610 587 ------
NM_007124chr631340 676 440 1602 --11780
NM_007137chrX53704 3673 879 709 442 11835 23609 3507 13547
NM_007144chr1721324 85 ------
NM_007145chr1921236 1217 ------
NM_007146chr1752844 2137 1862 1082 863 --1527 --
NM_007157chrX52531 2330 2301 690 437 --22252 37 --
NM_007158chr13391 379 304 1412 41162 1111 497 334 --
NM_007159chr32498 94 11415 11384 --
NM_007166chr1131104 1080 63 --21545 436 --
NM_007173chr1142198 689 232 138 22255 617 ----
NM_007174chr1222123 1517 1367 32332 2159 672 --
NM_007175chr8133561 3358 3317 3137 3106 3048 3033 2506 2240 833 362 337 88 ------
NM_007195chr1893528 3459 3155 3142 2636 1136 926 816 203 --43535 3411 914 232 --
NM_007200chr1554233 4059 3739 1744 365 13341 44600 3744 3224 1556 --
NM_007202chr172763 172 --1718 --
NM_007203chr973469 3446 3213 3012 2951 2929 944 11578 --12599
NM_007212chr142030 1838 1407 464 --178 --
NM_007214chr63524 293 163 --1529 11310
NM_007218chr82973 178 ------
NM_007220chrX114875 4459 4325 3841 3834 1863 1292 687 418 390 218 23736 332 13128 --
NM_007236chr1542463 625 371 160 22440 2347 1594 --
NM_007245chr16----1914 --
NM_007249chr13109355 8955 7618 7418 6976 6624 6477 6378 2212 530 1334 17404 --
NM_007270chr711380 11452 11118 --
NM_007276chr7----1182 11094
NM_007279chr19----1647 --
NM_007282chr33655 396 162 ------
NM_007292chr1754975 4948 4910 1542 1289 --24967 3410 14756
NM_007324chr11323 ------
NM_007345chr1872205 2131 2029 1569 563 132 120 ------
NM_007347chr1543044 2559 1244 869 ----23169 3014
NM_007358chr162004 1634 1624 432 189 87 --21680 1324 --
NM_007373chr102322 60 --11203 --
NM_007374chr141419 ------
NM_007375chr152251 2238 2160 1780 245 --11948 --
NM_009585chr32762 97 ----1866
NM_009585chr32762 97 ----1866
NM_012062chr123940 741 308 ------
NM_012069chrX2136 45 ----11813
NM_012081chr593415 3392 3383 3342 2971 2734 1242 1111 914 23275 2998 2153 134 2639 460
NM_012082chr81394 1724 1792 --
NM_012090chr131302 1096 193 1132 1340 11231
NM_012096chr363447 3409 2573 2503 2397 583 11372 12619 --
NM_012097chr2102046 1808 1801 1776 1500 1437 1428 599 430 55 ------
NM_012102chr142529 2445 2151 102 11890 ----
NM_012104chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_012104chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_012108chr43435 81 31 --166 1167
NM_012120chr662990 2040 1073 885 424 75 --52409 2131 2046 924 520 --
NM_012124chr112824 607 ------
NM_012129chr762302 1690 1638 912 753 383 --1533 12432
NM_012137chr1102858 2485 2311 2294 2235 2020 1813 1170 552 452 --2487 481 --
NM_012141chr1393831 2907 2609 1649 1598 1583 1233 845 36 1795 33559 693 371 --
NM_012153chr1152388 2276 665 184 90 1718 ----
NM_012156chr2043120 2883 1023 653 --1619 --
NM_012158chr1351786 1645 1563 1445 114 --21749 1208 --
NM_012161chr44987 925 791 191 ----1767
NM_012164chr9126433 6332 6107 6026 6019 5888 2453 2037 1153 607 348 135 12904 12514 12199
NM_012174chr1262785 917 813 537 472 390 --22728 2218 1761
NM_012193chr1184686 3511 2109 2025 1131 927 872 598 11692 21562 1443 11568
NM_012199chr1104560 3951 3680 3308 2943 1457 822 779 666 122 1403 44338 4075 2919 1119 --
NM_012207chr1041092 271 236 189 ------
NM_012214chr2116352 5974 5893 5825 5458 1236 931 650 509 349 67 15180 45341 4862 1967 1871 24765 747
NM_012215chr101601 --21777 1327 --
NM_012223chr2121 --11333 --
NM_012224chr441230 900 361 187 1236 11111 --
NM_012234chr373129 2948 2576 2461 2339 1116 266 33148 3105 2654 13399 --
NM_012238chr1041742 1703 235 75 21279 1217 21193 621 --
NM_012242chr102817 227 --1325 --
NM_012243chr1----1267 1375
NM_012247chr103963 703 278 --2748 165 --
NM_012249chr242900 2875 1351 560 42590 2422 1391 219 23068 2326 33173 3086 2988
NM_012250chr1161044 945 866 423 216 84 ------
NM_012252chr7105037 4646 4320 3786 3553 2150 1958 1609 1204 526 25345 5313 1456 --
NM_012255chr201106 ------
NM_012257chr721094 952 1787 --1220
NM_012259chr611356 --11405 --
NM_012262chr184657 4283 4242 1276 880 459 393 383 --43757 3689 3178 1547 11816
NM_012281chr731991 954 798 12383 ----
NM_012287chr374266 3607 3546 3019 839 817 166 24116 614 54488 4400 3071 2959 1539 --
NM_012288chr653948 2176 1302 1008 353 14323 54870 4782 4327 3666 372 1328
NM_012290chr22582 28 1676 ----
NM_012297chr462044 1974 1689 1027 899 591 1245 22013 411 --
NM_012300chr552527 2325 910 741 641 ------
NM_012304chr532454 985 545 ----11576
NM_012307chr182878 353 --1835 --
NM_012308chr1141995 818 665 180 --12038 --
NM_012309chr11114853 4813 4790 4735 4312 4145 4075 3616 3523 3289 1914 13105 13305 14277
NM_012316chr194176 3555 1754 1638 1575 1131 1074 891 654 14399 45288 1508 436 388 11743
NM_012319chr183927 833 186 ------
NM_012322chr7----1295 --
NM_012323chr22------11175
NM_012325chr2021126 663 21641 401 21057 192 --
NM_012327chr1841477 1261 984 153 21316 553 21578 1571 --
NM_012328chr751494 547 484 314 239 --21160 52 --
NM_012329chr1751709 1314 1041 434 117 --31291 1192 389 --
NM_012330chr1061531 1152 404 342 213 64 --2541 228 --
NM_012333chr121319 673 ----2520 250
NM_012334chr553953 998 591 355 159 2300 249 33561 3387 1317 23618 731
NM_012345chr1351830 1753 1696 1365 1292 41849 1769 1629 1414 11853 --
NM_012382chr5114259 3546 3306 3231 2841 1772 1239 991 878 830 44 23590 3029 43010 1438 1281 918 13204
NM_012388chr1532503 597 143 42846 2661 2309 86 53016 2951 428 417 380 --
NM_012399chr2241955 708 327 111 --1652 --
NM_012406chr122306 65 1532 --1910
NM_012416chr92166 29 --1181 --
NM_012420chr1031577 507 291 1150 ----
NM_012421chr11373 ------
NM_012426chr162374 313 ------
NM_012428chr152862 319 1133 1694 --
NM_012430chr3----3764 527 25 --
NM_012431chr763001 2873 1208 968 441 91 1936 21301 303 --
NM_012434chr641446 607 323 67 1216 ----
NM_012443chr102866 117 1151 1625 --
NM_012444chr201197 2462 363 2453 326 --
NM_012454chr61214 1546 143 --
NM_012463chr1221279 494 1111 11288 --
NM_012464chr482858 2563 2467 1953 1828 764 514 443 --21932 138 22797 2274
NM_012465chr1032826 2447 2169 12859 ----
NM_012470chr71477 ------
NM_012471chrX----31896 197 181 --
NM_012479chr732172 643 410 --11940 --
NM_013229chr122255 183 --22795 2305 --
NM_013230chrY41391 1339 1170 322 ------
NM_013231chr14104389 3805 3268 3052 1704 1594 1452 1116 861 179 ----13657
NM_013233chr221131 1034 1429 11339 --
NM_013235chr52238 31 ------
NM_013236chr224903 868 788 476 --1217 --
NM_013237chr5--171 ----
NM_013242chr162362 271 ----194
NM_013255chr7178780 8077 7100 6929 6791 6705 6146 5554 5491 3312 2588 1625 1504 500 450 426 228 47685 7181 3101 845 58685 7247 7037 916 272 26411 268
NM_013261chr443384 2968 2826 2622 23582 107 23137 2738 --
NM_013262chr631348 1264 330 --1411 11277
NM_013263chr16139 ------
NM_013269chr1284084 4034 3622 563 479 391 191 167 --34540 638 469 --
NM_013272chr151256 ------
NM_013277chr1241047 672 95 21 ------
NM_013281chr2021320 1220 --21108 294 --
NM_013283chr51812 196 ----
NM_013286chr3123679 3634 3277 3220 3025 2983 2437 1474 956 872 822 98 1630 1497 --
NM_013309chr1531982 714 350 31943 587 29 21927 1743 12642
NM_013341chr2--22903 564 22515 946 --
NM_013346chrX130 ------
NM_013354chr871295 1142 1107 528 133 96 62 ------
NM_013357chr82711 548 --1766 --
NM_013358chr131729 670 529 ------
NM_013372chr1563267 2876 2760 1282 1034 80 ------
NM_013374chr332925 474 303 1656 22214 660 13107
NM_013381chr1252175 1798 971 816 767 ------
NM_013386chr161794 1736 1712 1516 1498 1190 2476 229 1233 --
NM_013390chr971672 1603 1421 1273 1111 588 548 --1299 --
NM_013392chr21438 ------
NM_013396chr2121037 604 21142 1029 3298 287 59 --
NM_013436chr2153 --143 179
NM_013437chr831432 1298 322 1363 11422 --
NM_013438chr931529 1320 704 ------
NM_013444chrX2977 207 135 21085 91 --
NM_013447chr1973091 2878 2367 1492 801 539 247 ------
NM_013943chr122525 1196 --53263 2754 1123 730 618 1157
NM_013958chr81141 ------
NM_013959chr81141 ------
NM_013961chr81141 ------
NM_013962chr81141 ------
NM_013986chr22--1128 ----
NM_013995chrX92593 2580 2530 2450 2415 818 591 492 169 ------
NM_014011chr252105 948 478 231 150 12060 ----
NM_014016chr341326 433 170 105 21261 674 31356 1309 678 --
NM_014021chr183371 2950 2878 2592 835 449 378 87 12647 11315 --
NM_014023chr1052661 1797 955 470 397 --21178 190 --
NM_014028chr673344 2687 2424 2060 627 317 220 33043 2588 799 33160 666 593 --
NM_014031chr51303 ------
NM_014034chr621229 386 --11549 --
NM_014043chr32286 30 1604 11146 --
NM_014048chr1685105 4512 1930 1706 1556 986 856 285 1625 15070 --
NM_014053chr11116 ------
NM_014055chr123446 417 30 ------
NM_014057chr941583 1567 1492 1351 --31574 645 362 --
NM_014079chr36949 264 256 248 163 80 --11066 --
NM_014106chr1552787 2229 1015 953 254 22995 2212 32755 2626 1073 --
NM_014109chr841035 776 463 394 21100 1081 ----
NM_014110chr111041 --1750 --
NM_014112chr833664 1834 433 1112 --14039
NM_014117chr1651953 1772 1739 990 762 12135 32198 2179 1818 --
NM_014149chr73804 721 40 1856 1343 --
NM_014154chr331444 1058 308 ------
NM_014155chr11137362 6964 6702 6217 6136 5177 4986 4698 2231 1849 1023 875 799 27569 2993 34715 2360 413 16318
NM_014159chr32541 187 ----1607
NM_014171chr22776 49 --2652 42 --
NM_014181chr232585 1130 1044 1616 12775 --
NM_014182chr122759 298 ------
NM_014217chr161781 1225 693 597 456 246 1480 11610 1485
NM_014220chr32527 118 ------
NM_014243chr451965 1847 755 434 116 --2763 587 --
NM_014245chr3----1176 11124
NM_014246chr2231882 707 471 11601 ----
NM_014250chr2221975 175 1281 --1410
NM_014253chrX62485 2460 2405 2341 911 130 --32356 1698 424 --
NM_014258chr204652 626 566 480 126 ----
NM_014263chr1031508 338 70 --11365 --
NM_014267chr112819 805 --1921 --
NM_014268chr1821286 1120 --11380 --
NM_014278chr4--1343 ----
NM_014294chr831035 213 57 --21485 399 --
NM_014296chr33641 308 183 31534 1014 595 11271 --
NM_014309chr2255010 3705 1047 194 140 --34335 3559 1037 --
NM_014319chr1261953 1850 1672 1549 1259 763 11493 --11210
NM_014331chr4117810 7402 6108 5881 5790 5581 5481 5100 2817 720 63 ----16769
NM_014333chr1141018 731 411 299 --22519 465 --
NM_014335chr1561220 1115 1099 432 303 60 --1971 11283
NM_014342chr1131473 240 142 --1421 --
NM_014345chr631067 158 85 --1704 --
NM_014350chr51404 --21032 378 1739
NM_014352chr1141392 1012 255 66 --3961 268 88 --
NM_014363chr1321280 965 11140 11184 11055
NM_014372chr131722 1578 778 ----1532
NM_014382chr321146 1126 21632 331 11361 --
NM_014393chr852106 2073 1682 333 82 --32181 866 417 1504
NM_014397chr951473 1432 904 538 441 ----146
NM_014399chr71283 1115 1673 1833
NM_014411chr721999 581 --1753 11589
NM_014415chr341380 1354 638 274 --11564 31560 1396 350
NM_014423chr5145317 5178 4899 4719 4382 4131 1979 1969 1334 1150 451 443 427 22 21423 1389 21434 970 --
NM_014432chr61126 2620 598 122 11230
NM_014445chr361997 1986 1910 1541 638 194 11652 11546 --
NM_014452chr641193 1089 481 351 --1308 11014
NM_014454chr621024 793 ------
NM_014456chr1051880 1274 1246 277 253 ------
NM_014458chr111040 --31073 947 304 --
NM_014494chr1631783 513 503 1519 11500 --
NM_014496chrX199 ----1295
NM_014504chr721511 1334 --2538 312 12012
NM_014517chr351692 1357 1201 638 399 --31932 783 372 --
NM_014547chr151195 1667 ----
NM_014547chr151195 1667 ----
NM_014548chr1531655 1499 1389 --21556 163 --
NM_014570chr221112 --1642 --
NM_014572chr1351723 1532 1196 693 121 --11786 --
NM_014575chr31174 ------
NM_014584chr1421102 600 1211 ----
NM_014585chr241114 1023 342 120 ----11120
NM_014587chr1661517 1375 1366 1357 1308 209 ------
NM_014597chr1148 ------
NM_014607chr231393 557 336 --11877 1668
NM_014612chr931296 1108 1029 ------
NM_014613chr522706 1015 13057 --12177
NM_014614chr231257 1227 334 --11109 --
NM_014615chr1683387 2804 2787 2746 2530 1132 610 47 --32543 524 60 1835
NM_014616chr363209 2930 2523 2513 2449 881 --22246 427 --
NM_014620chr121735 ------
NM_014630chr1593482 3145 3118 3012 2880 2741 748 427 367 --23273 2831 --
NM_014635chr221121 426 --21678 1126 11502
NM_014636chr974273 3454 3037 1725 1349 1260 1023 24347 699 14372 --
NM_014637chr821000 346 1551 2532 434 --
NM_014647chr1652221 2113 661 588 127 ----11676
NM_014660chr74950 720 233 207 --1161 --
NM_014666chr521254 355 ------
NM_014670chr211199 --21600 250 --
NM_014671chr731261 1181 505 21448 244 ----
NM_014674chr383979 2600 2434 1292 894 860 705 442 32810 2740 1117 11240 13414
NM_014677chr831027 890 357 ------
NM_014679chr1141391 464 294 69 ------
NM_014682chr832114 1618 1433 --21701 341 --
NM_014683chr1781860 1759 1561 1398 789 781 673 50 31791 279 187 22157 1365 11391
NM_014685chr16173 1421 --1514
NM_014689chr21122 --1628 --
NM_014700chr1611379 ------
NM_014701chr1563296 2676 1201 729 293 140 --23187 56 13055
NM_014702chr663507 3353 2884 2148 2125 468 12444 32117 1041 159 12736
NM_014705chr741726 1343 749 266 11564 12032 --
NM_014707chr731983 810 277 1614 22270 656 --
NM_014709chr22427 24 ------
NM_014711chr1652077 2013 425 223 109 --22032 305 --
NM_014713chr22365 348 ------
NM_014717chr192772 66 --1858 --
NM_014720chr1051794 1596 1284 574 361 --11400 --
NM_014721chr6137384 7310 7235 7115 7024 6842 6326 6009 5909 5305 2305 2210 888 17049 16163 15527
NM_014730chr1264336 3641 3383 3318 556 388 --44847 4370 3791 2116 --
NM_014730chr1264336 3641 3383 3318 556 388 --44847 4370 3791 2116 --
NM_014733chr521808 201 --1577 --
NM_014735chrX52138 2037 1817 1733 1534 1553 2380 35 --
NM_014739chr674090 4007 3771 2878 153 95 57 23279 930 11192 --
NM_014741chr1172185 2116 1379 547 520 509 353 --1805 --
NM_014743chr42734 466 --2835 136 --
NM_014746chr254259 3536 1449 1301 551 11076 21545 767 1100
NM_014752chr1151820 1595 1575 787 639 21931 304 ----
NM_014755chr274147 2930 2872 1561 690 427 165 21703 406 34268 3826 95 --
NM_014757chr531641 1538 78 --22360 2178 --
NM_014764chr123456 424 44 ----11137
NM_014766chr753554 2757 1303 1007 224 --33187 2495 142 --
NM_014774chr1123146 3110 2616 2308 2149 2044 1045 964 184 115 70 48 --52606 2528 2133 862 308 1374
NM_014776chr1283071 3026 2748 2575 2555 2511 2046 622 --22267 2135 1189
NM_014779chr34887 790 410 263 ------
NM_014781chr84907 512 325 288 --1144 --
NM_014783chr1531542 1116 181 --31108 537 260 --
NM_014787chr122057 1991 --12332 --
NM_014790chr51144 ------
NM_014795chr23879 479 53 1275 ----
NM_014803chr103818 458 230 --32762 2382 1949 142
NM_014810chr1113303 2907 2742 2684 2664 2540 2394 1381 1299 913 299 33674 3168 1469 22958 179 --
NM_014812chr121962 31 11285 11249 --
NM_014819chr532124 1919 1842 ----12204
NM_014820chr342049 1999 1631 1373 ------
NM_014827chr13394 138 76 ----1184
NM_014828chr1461961 1680 671 567 329 35 --1207 --
NM_014829chr56823 758 659 362 106 25 --12283 --
NM_014830chr1243362 1265 554 204 --21088 101 1909
NM_014832chr1311438 --11376 21814 672
NM_014835chr2012189 --2586 479 --
NM_014836chr10----1150 1399
NM_014839chr131869 725 313 22236 550 32377 1818 753 12293
NM_014841chr641310 1210 1045 893 1183 1414 1900
NM_014850chr384756 4229 3910 3167 1560 1475 1423 518 24810 3809 13544 --
NM_014860chr272086 1048 703 556 521 344 334 11980 41639 674 309 169 --
NM_014870chr174420 4288 4072 2867 963 760 729 --21169 1059 --
NM_014872chr972014 1974 876 627 542 363 73 ------
NM_014873chr184677 4648 4538 4408 3446 1585 841 671 13229 23348 3299 --
NM_014877chr17157800 7653 7329 7294 6924 6585 6398 5248 5082 4998 2719 2192 1704 1642 1348 35004 2622 979 57618 6637 6390 5039 4976 --
NM_014880chr292538 2086 2041 712 703 465 416 319 309 --1533 --
NM_014885chr4273 35 --1166 --
NM_014887chr133811 714 304 ------
NM_014888chr721431 1081 1383 21094 428 1475
NM_014890chr31103 1312 ----
NM_014897chr1753097 2500 2277 2094 170 12761 ----
NM_014898chr1942043 933 269 259 ------
NM_014899chr532562 1042 588 23041 2613 ----
NM_014900chr21106 11050 --1204
NM_014903chr1221534 950 1827 22464 1817 --
NM_014904chr10112989 2817 2694 1630 1487 990 921 567 496 304 140 22869 2707 43910 3332 3073 1086 --
NM_014906chr1783725 3467 3072 3062 2955 2769 993 406 --23746 999 14123
NM_014912chr1043098 2601 1157 873 1259 ----
NM_014913chr1831486 1292 132 ------
NM_014918chr1541583 1150 399 37 11442 1174 --
NM_014920chr643077 2688 1255 49 12343 1632 11272
NM_014923chr1342006 739 652 265 ------
NM_014927chrX--1103 ----
NM_014932chr321461 226 ------
NM_014934chr1373750 2707 2679 2425 1287 1256 70 195 33700 2507 784 --
NM_014935chr143888 3648 3309 1131 1404 ----
NM_014936chr682792 2436 2266 2117 1158 752 738 94 32093 1849 1107 51111 1090 917 479 138 --
NM_014937chr1021306 407 --11267 --
NM_014939chr1821564 124 ------
NM_014942chr672438 2298 2054 1963 1790 828 778 1593 21014 108 --
NM_014946chr263058 2763 2633 1134 424 36 22776 2346 4954 640 622 212 --
NM_014947chr153029 2574 1116 842 174 --41972 1219 126 39 --
NM_014949chr12983 227 ------
NM_014950chr1431762 1731 701 --1320 --
NM_014953chr13134206 4116 3989 3784 3162 2848 1017 1010 951 909 718 711 333 --1100 1938
NM_014962chr2031799 1035 58 22639 1067 22427 460 12271
NM_014964chr1751664 1528 650 599 326 1845 1966 --
NM_014969chr121011 333 --1446 11042
NM_014982chr14144973 4859 4748 4633 4587 4571 4511 4394 4331 1987 1831 1622 1155 300 --54563 4006 996 646 413 1518
NM_014988chr462626 2009 851 644 579 104 --1584 --
NM_014989chr651994 1856 759 116 39 --22084 731 --
NM_014991chr462941 2512 2433 2234 859 587 12571 1964 --
NM_014996chr31743 ----1422
NM_014997chr732705 2550 137 1288 11123 12738
NM_014999chr1211105 21563 1071 11145 11213
NM_015000chr1232871 2199 2072 --32163 2083 971 --
NM_015002chr1251803 814 515 136 42 --31963 1424 620 --
NM_015008chr353279 2635 2485 396 73 --12657 --
NM_015009chr34639 311 247 197 ------
NM_015020chr1653641 3502 2766 739 634 23769 2778 ----
NM_015026chr12124699 4538 4132 4076 4068 3852 1586 1027 625 457 330 138 11261 1637 --
NM_015032chr1332763 315 262 22436 530 22602 137 22385 663
NM_015039chr141696 1519 1355 585 --32795 973 435 --
NM_015040chr283379 3328 2950 2280 745 596 453 386 --22672 584 --
NM_015042chr15104258 3764 3193 2848 1500 1459 1277 1078 907 876 --23529 3306 --
NM_015044chr1672882 2834 2794 2562 1004 820 401 1671 149 --
NM_015045chr1052280 2125 1854 1623 1422 --2661 267 --
NM_015046chr921788 701 --32469 2210 1832 11811
NM_015051chr922860 567 ------
NM_015052chr73503 347 167 --1911 --
NM_015059chr1563966 2729 1571 1058 907 580 ------
NM_015060chr71219 ------
NM_015061chr9----1591 --
NM_015068chr763595 1516 1502 1264 319 98 --1288 --
NM_015069chr161425 ------
NM_015070chr1341490 1297 646 227 --11615 --
NM_015071chr5116184 6045 5633 5379 4915 4879 4207 2157 1657 1474 1110 --24999 1664 --
NM_015074chr174831 3647 3573 1907 442 348 54 ------
NM_015076chr674197 4075 3588 1578 1335 906 559 2790 538 23123 347 --
NM_015087chr1382667 2433 2245 2216 2146 1029 585 573 12029 ----
NM_015092chr16114632 4412 3576 3346 3297 3288 2963 1217 1177 685 612 13512 64425 4131 3772 3205 1310 1053 --
NM_015093chr641842 1803 1771 315 ------
NM_015097chr351830 1629 794 433 285 ------
NM_015107chrX61563 1514 788 734 294 205 --32473 635 44 --
NM_015116chr1361651 1589 1518 563 115 66 --21639 80 11167
NM_015120chr21280 --169 --
NM_015125chr192485 77 ------
NM_015135chr71183 ------
NM_015137chr862426 1643 362 184 122 76 1626 32483 2014 234 --
NM_015141chr362702 2361 1860 636 502 37 --22506 1803 32070 1733 772
NM_015143chr431432 263 31 --11328 --
NM_015144chr1683950 3736 3283 3149 1135 954 851 815 12799 1120 --
NM_015155chr1022739 1017 ----11322
NM_015156chr1493870 3783 3531 3522 2815 1249 854 723 398 1157 --11322
NM_015161chr1631541 1507 1300 --11437 11433
NM_015163chr1441427 504 478 38 --11667 11680
NM_015170chr8102308 2175 1938 1842 1579 1532 1443 896 613 123 ----1804
NM_015172chr131617 1105 1033 --11281 --
NM_015176chr13682 420 402 11523 1198 --
NM_015185chrX52938 2369 1185 1026 401 --1526 --
NM_015192chr2062580 2470 2416 1999 1001 960 --42845 2774 2484 470 12245
NM_015199chr342873 2671 1898 513 --22532 978 --
NM_015200chr461813 1778 1740 558 151 128 ------
NM_015206chr1551150 1134 912 501 234 33628 1412 58 ----
NM_015208chr1893481 3134 2682 2672 1514 962 460 93 71 33292 2826 1344 ----
NM_015210chr182976 28 ------
NM_015215chr152434 2123 2092 917 840 --1819 1815
NM_015216chr521533 479 ------
NM_015225chr952095 1199 324 289 187 --3925 765 89 12439
NM_015231chr112951 295 1979 1866 --
NM_015235chr1072109 1984 1487 1459 777 740 603 --21873 1586 1222
NM_015247chr1645211 4963 4054 3278 14181 34830 1315 419 --
NM_015250chr931912 1434 807 --11699 11813
NM_015251chr1631941 405 224 12016 2235 139 12323
NM_015252chr2--2133 122 1984 --
NM_015256chr5----1581 --
NM_015263chr152749 143 1178 ----
NM_015265chr262615 2254 2020 1970 1029 311 --22307 1999 --
NM_015271chr453497 3341 891 758 727 --21044 520 13576
NM_015272chr165853 493 389 242 160 ------
NM_015275chr1242115 683 220 180 11326 ----
NM_015277chr1841854 588 188 64 1538 1367 --
NM_015278chr632581 2466 621 21369 1221 13146 32944 2550 597
NM_015285chr181479 11918 --11846
NM_015291chr152883 2358 1401 1309 813 --22607 1141 --
NM_015294chr1731062 116 36 --11127 --
NM_015296chr13--11104 ----
NM_015299chr1443952 2508 1194 583 ----21394 233
NM_015310chr8137675 7423 6740 6120 3139 2885 2579 2206 2180 1978 1843 1708 825 --47777 7371 2392 706 13048
NM_015313chr1174679 3813 3721 3469 1715 1678 1049 --24493 392 13456
NM_015314chr722486 636 ----21959 1818
NM_015315chr533089 2297 1200 --13289 1920
NM_015316chr141200 ------
NM_015317chr232526 2405 2038 12237 32607 2068 316 --
NM_015321chr1974905 1909 1126 1020 983 793 434 ------
NM_015328chr7102681 2385 2356 2166 2070 1203 925 886 775 503 22260 1920 22613 2459 22338 1925
NM_015335chr1242650 2628 2180 431 1931 11781 --
NM_015336chr1222442 2398 11791 --11639
NM_015344chr832103 1691 226 ------
NM_015347chr1292793 2781 2694 2272 2153 780 690 678 182 32225 531 71 22538 2490 1404
NM_015349chr642873 2815 2006 426 --12404 --
NM_015353chr1752439 1727 979 675 211 1355 11129 --
NM_015355chr1741788 1595 1567 356 1224 ----
NM_015358chr2121226 861 11308 21097 415 1171
NM_015365chrX84084 3857 3477 3047 1273 872 799 442 --54300 3943 3880 3356 326 --
NM_015367chr221455 11587 --11533
NM_015375chr133177 3092 1146 13525 21436 1123 --
NM_015381chr2221316 461 --11759 --
NM_015382chr14----2702 108 1227
NM_015387chr251579 1499 448 224 154 1745 3733 399 135 --
NM_015393chr432694 2638 502 --23604 347 22587 1142
NM_015397chr96589 520 504 338 221 124 ------
NM_015409chr1232694 1824 43 1453 ----
NM_015429chr33851 350 315 --31072 447 368 --
NM_015436chr453373 2740 1143 1086 1047 ------
NM_015446chr151614 1569 1507 1301 1107 --11336 --
NM_015449chr1--1569 1511 --
NM_015453chr341812 1405 1367 738 2837 537 ----
NM_015455chr543991 3536 3032 655 1395 --14064
NM_015463chr22265 49 ------
NM_015475chr22764 316 --1255 --
NM_015477chr1531043 964 92 2717 194 ----
NM_015483chr72265 107 ------
NM_015484chr12239 113 --1797 --
NM_015508chr311045 11029 ----
NM_015509chr1251408 1221 1147 206 179 11121 11352 --
NM_015520chr32922 782 --12279 --
NM_015525chr61436 --1855 --
NM_015530chr2----1790 --
NM_015541chr321282 247 2959 376 11342 --
NM_015550chr773484 3105 2931 2219 1146 468 461 21059 342 150 1662
NM_015553chr664716 4033 4015 1113 899 536 13232 23440 514 --
NM_015554chr1552322 2270 1988 821 349 11895 32441 935 251 --
NM_015555chr631739 673 471 ------
NM_015559chr1841067 737 729 714 ------
NM_015564chr563577 2678 2543 1014 416 241 13587 12574 --
NM_015565chr2131518 1394 167 --21584 103 --
NM_015569chr174703 3790 3596 789 470 274 259 --44595 4469 3550 843 --
NM_015570chr741393 1318 532 229 --1460 --
NM_015571chr632278 541 29 --1761 --
NM_015575chr243387 1407 1260 820 13635 23025 1060 --
NM_015576chr342954 809 415 374 --32604 2464 2198 1177
NM_015577chr52723 710 1561 41719 1533 1284 420 --
NM_015578chr1931469 1341 361 --1176 12034
NM_015595chr351065 919 772 702 202 --1126 --
NM_015601chr101109 ------
NM_015602chr121738 167 1222 11821 --
NM_015607chr1----1165 --
NM_015626chr172347 80 1930 11155 11170
NM_015630chr251140 785 377 224 181 1844 ----
NM_015635chr942094 1897 739 468 1863 12011 11846
NM_015640chr185317 4690 3496 2060 1601 1242 274 144 14323 55167 5148 1571 1119 735 --
NM_015642chr3----1112 --
NM_015646chr1261279 1163 1063 908 339 202 1323 ----
NM_015657chr23906 675 87 1293 1305 --
NM_015675chr191558 ------
NM_015678chr1341547 1409 464 428 --1162 --
NM_015691chrX31847 427 358 12969 22350 671 --
NM_015726chr121248 741 11212 11318 --
NM_015833chr212786 94 --1352 --
NM_015840chr142214 1865 1805 823 --22380 248 --
NM_015841chr142214 1865 1805 823 --22380 248 --
NM_015852chr742823 2765 2513 2451 --12621 13303
NM_015869chr3----1171 --
NM_015878chr811775 1889 12221 --
NM_015879chr18128454 7986 7967 7737 7159 6856 6076 5492 5351 2364 2236 2075 11726 18590 --
NM_015885chr111357 ------
NM_015888chr16980 826 804 538 498 71 --21061 997 --
NM_015902chr84914 888 668 327 1117 2928 277 --
NM_015906chr194092 4042 3990 3904 3773 3699 3194 3031 1503 33048 1133 496 11604 11854
NM_015926chr31295 ------
NM_015938chr32738 75 1895 --158
NM_015975chrX51683 1601 1333 399 275 1375 1335 193
NM_015984chr12463 420 ------
NM_015994chr141126 --3698 233 151 --
NM_015999chr13685 527 268 ------
NM_016002chr1----2740 642 --
NM_016009chr1144574 4462 4252 3773 3762 3265 3230 1461 1451 948 709 519 259 82 ------
NM_016018chr842125 2068 1821 610 11832 21751 904 --
NM_016021chr642941 975 624 297 22318 1979 33008 2303 1126 --
NM_016023chr831726 849 407 1105 11992 11662
NM_016025chr1622029 1405 11235 --11360
NM_016028chr114982 896 217 23 ------
NM_016037chr121091 769 ------
NM_016038chr72492 114 --1530 --
NM_016040chr162656 2275 2027 1850 620 440 ----11770
NM_016072chr1252444 2425 2390 1825 1735 12219 1517 1972
NM_016076chr173235 3173 2140 2047 999 928 285 11292 12067 --
NM_016079chr25904 727 552 305 284 1220 11840 --
NM_016081chr4112182 2056 1733 1685 858 716 535 524 350 300 183 1811 1251 21490 768
NM_016083chr683950 3763 3739 3520 1411 944 672 329 12786 33666 2790 770 --
NM_016090chr111770 --1314 --
NM_016096chr842067 1586 536 305 1545 --21487 372
NM_016097chr182990 150 185 2838 58 --
NM_016098chr62437 195 1174 ----
NM_016101chr1631198 977 313 --11085 11291
NM_016103chr51363 2456 409 ----
NM_016107chr531365 1169 1127 --1427 --
NM_016122chr122486 87 ------
NM_016129chr41377 ------
NM_016132chr1542200 2099 968 765 22266 2253 ----
NM_016133chr221546 481 ----11655
NM_016152chr341200 872 177 38 --11270 --
NM_016166chr15----1186 185
NM_016200chr72271 177 1282 ----
NM_016205chr421036 78 --1396 11255
NM_016206chr3188947 8817 8532 7995 7631 6873 5493 2617 2141 1975 1912 1850 1652 1238 981 855 588 543 38845 6110 5634 68416 7893 6357 3550 2071 256 17076
NM_016213chr15--1180 ----
NM_016217chr662844 2632 2486 2442 1396 59 33197 2970 1122 32493 2325 117 148
NM_016218chr56902 837 514 379 196 171 1815 --1441
NM_016224chr611745 --1414 --
NM_016226chr121387 --1374 --
NM_016248chr1373691 3682 3348 3105 2957 200 176 23019 736 13934 23969 907
NM_016255chr673200 3147 2764 969 565 277 257 --22642 2127 --
NM_016257chr163200 3122 3060 2860 1149 859 --23294 1035 --
NM_016260chr2207475 7331 7139 6585 6439 5896 5665 5589 5383 5301 4758 2703 2550 2338 2101 1696 1319 851 561 99 11789 55862 4995 2863 1362 748 25389 2940
NM_016271chr1832208 2077 905 22064 265 1269 1343
NM_016272chr2222195 119 11933 12486 --
NM_016275chr362771 2252 1813 1783 974 675 1467 32586 2018 1999 --
NM_016277chr61430 --11539 --
NM_016281chr1241087 975 877 829 ------
NM_016282chr92589 526 11581 31714 1381 118 21330 657
NM_016289chr232216 858 465 1707 1693 --
NM_016299chr10185 ------
NM_016301chr122414 407 ------
NM_016306chr32124 56 ------
NM_016315chr251471 1187 1175 279 210 31634 1487 370 --21737 72
NM_016322chr963134 2794 1113 955 443 62 23207 370 42925 1119 607 576 11053
NM_016338chr511043 1391 31118 1034 303 --
NM_016340chr531186 954 255 ------
NM_016351chr7141 --1584 --
NM_016357chr1251230 803 486 206 112 ------
NM_016374chr121269 1042 11224 ----
NM_016374chr121269 1042 11224 ----
NM_016376chr1754260 3913 3478 3136 1575 23451 3393 11183 --
NM_016377chr631241 133 125 1374 11310 --
NM_016395chr1531283 468 124 1559 163 1164
NM_016396chr1562976 2540 947 833 655 168 12497 32004 1933 124 1411
NM_016401chr111267 ------
NM_016410chr9124 --166 --
NM_016422chr1163185 2771 2328 545 355 229 ----12368
NM_016424chr1761805 1774 1403 789 758 467 --1531 --
NM_016436chr2021070 608 1985 22516 1094 1877
NM_016441chr232389 1511 251 --22257 1997 --
NM_016447chr7199 ----1202
NM_016448chr151806 1616 1248 1231 122 --11904 --
NM_016451chr111117 ------
NM_016467chr231364 1157 533 --11020 --
NM_016475chr143488 383 216 1120 11173 --
NM_016485chr631729 1532 64 --1379 1656
NM_016486chr13421 387 373 --1338 --
NM_016507chr1763129 2560 2159 620 308 225 1238 1924 --
NM_016513chr643077 2688 1255 49 12343 1632 11272
NM_016516chr22859 734 1335 ----
NM_016519chr43182 67 24 ------
NM_016526chr1162442 2184 2152 1539 752 251 ------
NM_016530chr1593687 3096 2762 1352 798 666 605 477 258 --63766 2890 1322 1177 291 278 --
NM_016531chr463865 3798 3625 1266 412 72 24156 3462 ----
NM_016544chr223054 1564 --13364 --
NM_016547chr1------1733
NM_016559chr311435 1987 ----
NM_016562chrX51406 1098 1049 1031 202 ----11585
NM_016584chr121278 ------
NM_016587chr7----1182 11094
NM_016589chr31193 ------
NM_016599chr411475 21446 1045 --1186
NM_016603chr521560 248 11831 22135 414 --
NM_016604chr521247 267 --21204 856 --
NM_016605chr5----12127 --
NM_016607chrX31609 1350 218 --31322 1314 1282 --
NM_016620chr1181 --1971 --
NM_016621chr1153877 2816 1303 869 401 --11044 --
NM_016623chr81496 ------
NM_016626chr1841773 686 534 428 --11339 --
NM_016631chr211220 --1348 --
NM_016644chr51549 ------
NM_016654chr1561366 1343 1293 1212 1081 870 --131 1171
NM_016733chr2251446 1231 618 230 141 ----11365
NM_016818chr212608 564 ------
NM_016824chr1041883 1818 1210 286 ------
NM_016831chr162378 1505 948 425 278 177 ----21878 657
NM_016929chr694516 4440 4205 4140 4034 3566 334 155 90 --44318 3244 2847 1502 --
NM_016946chr163217 2786 2575 2337 1323 378 23424 94 12797 22707 39
NM_016950chr431348 979 568 --174 11210
NM_016952chr1164093 3307 2685 1482 1379 821 2183 150 11289 --
NM_016953chr2146130 5607 5534 5246 5128 4858 4661 4571 4267 3837 1722 851 536 437 ------
NM_016954chrX4494 486 478 441 1148 1573 --
NM_017412chr831381 1216 427 --21008 61 --
NM_017415chr584463 3888 3794 3720 1835 1591 1565 941 1575 22967 2909 --
NM_017420chr1483212 3110 2564 2511 1181 994 987 913 13610 33438 807 406 --
NM_017423chr451902 1785 772 633 271 22195 1778 1872 1209
NM_017426chr41558 --1700 1230
NM_017437chr143620 292 187 --1465 22449 60
NM_017440chr125631 487 139 106 23 ------
NM_017447chr2194444 4029 3433 3292 2963 1193 1167 893 443 11768 43723 2671 1583 577 44234 3059 1680 1401
NM_017455chr152862 319 1133 1694 --
NM_017491chr421030 651 1641 1855 --
NM_017516chr112232 161 1811 21107 245 --
NM_017522chr111295 1326 ----
NM_017526chr13635 220 113 --1596 --
NM_017545chr202576 52 ------
NM_017549chr741409 1398 1325 1121 --41338 1134 1091 345 --
NM_017554chr352217 1553 1500 839 607 1448 21709 182 --
NM_017563chr384911 4512 4037 2123 1220 387 368 173 36377 4895 1191 36199 5154 4273 --
NM_017569chr131109 --152 --
NM_017580chr1041801 953 631 441 1730 ----
NM_017594chr942525 1031 603 382 --32908 1190 650 --
NM_017599chr1221702 167 21369 323 51913 1628 1472 1315 772 --
NM_017610chr1531900 1331 83 21767 427 22121 717 --
NM_017613chr211350 ----1340
NM_017626chr1041424 1223 542 361 ------
NM_017628chr4145189 4827 4647 4500 4420 3892 3312 3264 1592 1432 1406 1382 750 228 1712 24547 383 --
NM_017629chr141468 512 244 145 1567 1215 1572
NM_017632chr41314 ------
NM_017633chr643112 2987 2687 161 --1832 12778
NM_017634chr841420 723 269 244 --1587 --
NM_017635chr1121471 191 21334 37 ----
NM_017637chr9129228 8992 8727 7963 6132 5926 5736 3121 2940 2439 1701 406 28413 8201 39320 5957 2259 --
NM_017638chr1139 --1897 --
NM_017643chr1742061 1903 982 649 ------
NM_017644chr3115197 5112 4030 3591 1229 1165 347 301 246 225 130 34739 4487 1904 24860 3223 34540 4359 3388
NM_017645chr9102914 2872 2652 2560 2206 2017 1229 770 494 135 --52965 2346 1975 1935 1219 --
NM_017650chr795795 4566 3673 1657 1632 1516 1468 1048 574 22261 1199 45281 3886 2067 701 35465 2142 1479
NM_017657chr21706 ------
NM_017658chr14104524 4509 3502 1346 1316 717 676 562 516 147 --23129 1251 24350 4298
NM_017661chr1551191 1053 428 376 131 ------
NM_017666chrX42235 2028 1752 245 1204 3874 276 182 --
NM_017693chr1341665 1612 1040 535 ------
NM_017694chr251936 1767 701 595 443 12068 ----
NM_017709chr174233 3913 3856 3422 3015 2872 851 11035 33402 2948 1691 --
NM_017714chr20----3956 853 87 --
NM_017719chr342211 2194 1866 967 --21596 122 --
NM_017721chr191330 ------
NM_017724chr33730 714 242 ------
NM_017739chr12202 110 ------
NM_017742chr1831892 1264 755 11806 11862 --
NM_017745chrX1260 --1221 --
NM_017752chrX102146 2033 1813 1612 591 517 478 467 267 230 22109 1891 191 --
NM_017762chr1531932 1590 652 11541 22464 447 --
NM_017769chr1483133 3065 3050 2843 2621 2402 1182 503 --11045 12945
NM_017770chr632986 2227 986 12910 1827 --
NM_017779chr1102472 2167 2068 1827 1798 727 400 345 279 218 --22734 2573 1571
NM_017780chr83791 737 166 ----1765
NM_017799chr1431691 1479 663 ----11861
NM_017801chr342593 1712 221 25 ------
NM_017811chr993056 2805 2335 2291 2053 1984 1967 1933 745 ------
NM_017812chr72731 288 ------
NM_017813chr8135814 5627 5441 5329 5239 5177 5166 4888 1156 942 917 448 345 35203 3885 1494 45721 5661 1530 952 --
NM_017819chr31216 ------
NM_017824chr1062660 2564 2240 1749 531 214 ----1242
NM_017831chr1864259 3203 1471 1427 1082 230 11159 ----
NM_017845chr43778 648 252 ------
NM_017848chrX104481 4186 4022 3193 2863 1279 1266 984 514 276 --23880 51 --
NM_017856chrX62033 1538 504 366 294 59 --1328 --
NM_017869chr161588 ------
NM_017896chr2093487 3427 2603 2586 2511 2339 1106 118 54 ------
NM_017902chr1055618 3997 1824 1646 205 25150 4093 21015 612 --
NM_017913chr9--1436 ----
NM_017919chr9115851 5658 5193 4998 3920 3761 3726 1729 1557 1102 532 14367 31804 1531 1169 25335 1401
NM_017922chr141501 --2506 208 --
NM_017925chr941621 1491 371 256 --31916 1806 161 11530
NM_017934chr6122 ------
NM_017938chrX32027 1442 408 ----21947 1857
NM_017943chr14--11027 ----
NM_017944chr1142076 1898 989 441 12725 12384 --
NM_017946chr711047 --1267 --
NM_017952chr273581 1555 1502 909 854 680 370 14001 23893 954 --
NM_017957chr1711583 ------
NM_017969chr21172 ------
NM_017974chr221314 976 --2963 252 --
NM_017982chr131108 874 57 ------
NM_017987chr1041574 645 501 36 --42094 446 268 124 1264
NM_017988chr122958 813 --1281 --
NM_017990chr16124038 3857 3772 3294 3175 3132 2769 1569 1479 555 121 107 1153 23001 791 --
NM_017994chr731032 516 53 1549 198 --
NM_017996chr153431 56 25 ------
NM_017998chr921388 411 ------
NM_018004chr31259 --1381 1308
NM_018010chr371643 1564 1039 584 472 450 232 --1360 --
NM_018014chr221332 312 1941 ----
NM_018017chr10102835 2426 2284 2007 1809 1058 732 681 610 591 1803 12828 12295
NM_018018chr1231684 1575 1491 --174 --
NM_018027chr1023275 2823 --12201 1174
NM_018045chr192515 2502 2371 2239 2224 901 535 429 133 ------
NM_018048chr1252051 1927 1314 599 163 1369 1820 --
NM_018061chr141625 1450 1444 150 --31411 581 532 --
NM_018062chr21364 ------
NM_018078chr4----2934 904 --
NM_018084chr263186 2427 2295 1033 565 258 12963 32809 2281 1061 --
NM_018086chr231557 741 382 --21496 774 1720
NM_018098chr33973 225 167 ------
NM_018105chr82847 98 --31211 1170 504 --
NM_018112chr93707 408 46 ------
NM_018115chr43746 712 509 1695 1805 --
NM_018117chr102283 249 1697 1508 --
NM_018121chr1043044 2632 2208 969 1788 22489 327 --
NM_018128chr1741110 1042 597 435 ------
NM_018133chr331796 818 428 11983 ----
NM_018151chr21785 ----1250
NM_018155chr3123445 3430 3375 2956 2759 2558 1392 1221 871 547 223 166 11232 1767 --
NM_018157chr1232376 2109 1229 --11055 --
NM_018159chrX21695 256 --11517 --
NM_018169chr12----1534 --
NM_018177chr42710 194 1728 2304 52 --
NM_018182chr1731682 758 475 1823 --11514
NM_018195chr1141487 1456 706 518 11935 11829 --
NM_018200chr1572394 2366 1737 1593 409 300 45 ------
NM_018211chr121369 627 166 21388 405 --
NM_018214chr631087 420 23 1158 1517 --
NM_018222chr1121634 1317 21646 74 11177 --
NM_018227chr4103138 2557 2498 2341 2199 2165 1281 1099 767 556 --22786 1974 --
NM_018241chr441022 904 723 48 ------
NM_018243chr473862 3359 3141 3017 1227 645 288 13782 13364 --
NM_018247chr633165 1969 897 21105 759 1596 12910
NM_018257chr2092320 2141 2099 2016 1728 1663 1026 776 736 --32531 1852 1606 12029
NM_018263chr222051 130 --22245 310 22433 549
NM_018279chr1231205 1072 616 --32354 914 742 1682
NM_018287chr1031204 391 355 ------
NM_018290chr44948 941 820 34 21033 296 ----
NM_018293chr332558 2070 955 --22883 1996 --
NM_018299chr863337 2964 2611 2487 1070 1025 --13146 1487
NM_018302chr412267 --3903 669 412 --
NM_018307chr172645 40 ----1109
NM_018313chr322638 292 21709 522 21067 285 --
NM_018314chr113678 494 215 --2256 27 1768
NM_018321chr5168 --1151 136
NM_018323chr451539 1506 1351 1258 544 --1606 2736 466
NM_018327chr2031802 386 58 --21757 1203 --
NM_018330chr1031625 1575 512 --11513 --
NM_018339chr921773 1660 ------
NM_018348chr163337 306 283 --11129 --
NM_018351chr12124683 4654 4421 4279 4209 3845 3583 1702 1153 572 507 212 24702 286 --21266 342
NM_018361chr853687 3448 941 935 420 12556 ----
NM_018362chr1184016 3958 3560 947 739 602 529 317 11303 22977 2887 --
NM_018364chr1113899 3861 3417 3398 3028 2984 2670 1192 230 150 102 1188 43237 1486 347 342 --
NM_018367chr1152503 2030 1807 1744 369 11642 --1196
NM_018372chr13470 216 201 ------
NM_018373chr1496135 6089 2533 2509 2449 1411 1183 579 319 --25876 485 14651
NM_018374chr794972 4168 3782 3436 1568 1505 1178 581 205 14857 11160 24018 2095
NM_018375chr1421907 1292 1411 31533 1324 226 --
NM_018387chr91135 ------
NM_018388chrX------1396
NM_018398chr31325 ------
NM_018409chr483089 2714 2707 2680 2413 2389 1277 134 23193 1078 12579 --
NM_018416chr1252323 1910 595 583 508 --22671 385 --
NM_018429chr512819 --12659 12556
NM_018439chr1852293 1734 797 317 32 --21670 407 --
NM_018440chr8138258 7998 7890 7737 6985 3427 3190 3100 2573 2514 2115 1544 1309 28594 2329 67545 7317 5466 3005 2783 1223 --
NM_018441chr2267 38 2798 781 1245 --
NM_018448chr1221136 849 11185 ----
NM_018452chr6_random73070 2560 2475 1360 1199 1079 572 11010 22441 2423 13835
NM_018464chr102308 45 1287 ----
NM_018482chr8112575 2422 2203 828 816 704 680 512 478 172 53 ------
NM_018489chr112062 1295 11956 --
NM_018490chr1141529 1203 423 410 ----21405 518
NM_018534chr23595 541 57 ----1626
NM_018557chr231685 1304 99 11716 31225 112 53 --
NM_018566chr1134980 4607 4307 4066 3749 3730 3232 1948 1940 1729 1445 1152 887 24567 1536 22050 1167 11257
NM_018569chr441474 1324 498 198 11360 2325 253 --
NM_018590chr1031418 426 61 --11640 1132
NM_018638chr12135646 4899 4804 4130 2017 1961 1937 1757 1557 1369 1064 958 833 24386 2001 2447 111 1394
NM_018640chr1242196 1796 843 787 --32403 1095 51 1881
NM_018650chr152070 1783 1725 846 396 1803 2679 564 11607
NM_018658chr1772234 2213 2191 1994 1901 1573 272 --42056 1704 245 45 1258
NM_018660chr853123 2424 2373 2288 767 --32908 2539 428 --
NM_018682chr72198 77 ------
NM_018685chr72833 149 ------
NM_018691chr51441 11257 21232 148 --
NM_018693chr2198 ------
NM_018695chr532097 974 442 12148 12152 --
NM_018698chrX41449 1391 403 318 1203 21993 1211 --
NM_018700chr551276 1152 1103 578 180 2420 53 --1262
NM_018704chr12806 678 ------
NM_018710chr831372 989 320 ------
NM_018717chr442760 2563 919 904 --32445 2081 1982 --
NM_018834chr52928 235 --2679 397 --
NM_018841chr1113566 3485 3320 3111 2686 2628 1397 1191 1024 557 471 22962 297 32530 1079 74 12880
NM_018847chr951917 1705 1439 393 66 ------
NM_018890chr731294 1255 322 ----11078
NM_018898chr542200 2044 1961 1498 ------
NM_018899chr542200 2044 1961 1498 ------
NM_018900chr542200 2044 1961 1498 ------
NM_018901chr542200 2044 1961 1498 ------
NM_018902chr542200 2044 1961 1498 ------
NM_018903chr542200 2044 1961 1498 ------
NM_018904chr542200 2044 1961 1498 ------
NM_018905chr542200 2044 1961 1498 ------
NM_018906chr542200 2044 1961 1498 ------
NM_018907chr542200 2044 1961 1498 ------
NM_018908chr542200 2044 1961 1498 ------
NM_018909chr542200 2044 1961 1498 ------
NM_018910chr542200 2044 1961 1498 ------
NM_018911chr542200 2044 1961 1498 ------
NM_018931chr5131 --1318 --
NM_018945chr663647 3511 1418 1036 479 146 --12267 --
NM_018951chr721199 890 ------
NM_018970chr763189 2894 2634 2111 1165 833 --33088 941 597 22019 822
NM_018972chr842329 1699 454 343 ------
NM_018976chr1272192 2183 1099 715 620 343 185 --2592 482 --
NM_018979chr1252419 1788 909 776 260 12196 12608 --
NM_018992chr1641621 1613 1345 142 ------
NM_018993chr2041433 1377 1370 409 --156 --
NM_018999chr1094889 4757 4639 4354 4037 3370 3263 1820 926 13944 24417 4195 --
NM_019000chr511546 1505 11555 1114
NM_019001chr3144686 4422 4032 3293 1781 1627 1568 1472 1444 1343 1240 868 540 47 24555 1727 13404 --
NM_019004chr742428 1864 620 484 --21639 961 --
NM_019008chr2253594 2791 402 354 342 --43580 3515 2813 453 12928
NM_019018chr52675 619 --1656 --
NM_019022chr1853123 2681 2337 2205 228 --32468 1087 574 12090
NM_019027chr452366 1789 1753 375 235 1736 ----
NM_019030chr5162 1153 ----
NM_019035chr461947 1830 1636 747 590 510 1211 ----
NM_019044chr274746 4715 4666 3685 3451 742 580 --33988 3247 39 --
NM_019050chr441978 851 499 121 2798 272 42230 1560 914 860 11617
NM_019053chr10--1860 21016 833 --
NM_019058chr10--2536 280 1823 --
NM_019063chr271708 1481 865 840 626 415 338 --1549 --
NM_019072chr563942 3646 3574 3530 2896 487 1882 34037 854 549 --
NM_019083chr131452 1163 157 184 1348 --
NM_019084chr1072117 2071 1918 1865 791 765 380 ------
NM_019087chr521299 471 --21552 241 --
NM_019091chr21151 --21033 169 --
NM_019094chr1243403 3167 3029 343 41154 823 662 226 --11107
NM_019098chr831868 238 146 ------
NM_019106chr2252691 1367 899 318 279 1836 ----
NM_019113chr19180 ------
NM_019114chr952533 2128 1947 965 39 11863 12156 --
NM_019116chr1673339 3073 2809 1317 1283 1126 162 ----13173
NM_019117chrX43045 2255 1363 409 1905 43128 2244 984 676 --
NM_019555chr33143 99 42 11458 1263 --
NM_019556chrX51377 1096 435 68 62 ----11503
NM_019590chr1041347 1284 1177 188 ------
NM_019593chr2053045 2248 862 172 88 12569 32833 2039 1228 --
NM_019597chrX1493 1660 1159 --
NM_019600chr152786 517 ------
NM_019605chr11625 1682 1686 1693
NM_019610chr131856 1549 808 --2574 112 --
NM_019843chr22----193 --
NM_019859chr1021444 600 21068 155 ----
NM_019860chr1021492 648 21116 203 ----
NM_019903chr1041883 1818 1210 286 ------
NM_020066chr1----2795 652 --
NM_020116chr431460 469 116 11563 11686 --
NM_020120chr241413 1249 395 385 --31189 1132 1022 --
NM_020122chr2106030 5199 4632 4261 3863 2003 652 237 183 69 15930 45997 5898 999 786 1362
NM_020123chr1041321 1065 1007 115 --1449 --
NM_020132chr2154211 4133 3524 1457 1447 --1354 --
NM_020141chr152299 1695 818 663 613 --22200 522 --
NM_020144chr742008 1945 1663 26 11467 11754 --
NM_020147chr152206 63 ------
NM_020150chr1061888 1640 796 576 402 33 ------
NM_020159chr421677 670 1395 11571 --
NM_020177chr533138 2768 1182 42929 2786 415 330 31217 1208 525 --
NM_020180chr1811152 ------
NM_020193chr1141160 1030 956 194 ------
NM_020198chr1721287 983 --11512 11427
NM_020199chr541217 296 175 168 --2939 120 1225
NM_020204chr13764 677 311 --1818 --
NM_020205chr121204 1113 --12292 --
NM_020225chr41117 ------
NM_020228chr112884 776 --4984 459 302 260 --
NM_020245chr664449 4366 3933 1506 1367 1038 23227 332 74931 4871 4403 3855 2034 976 191 --
NM_020315chr221950 ------
NM_020336chr2093889 3750 3463 2886 2559 1419 1151 1139 377 --22928 2635 --
NM_020337chr462788 2359 1152 1140 468 170 ----23127 135
NM_020338chr1043601 3377 3259 2903 13518 ----
NM_020340chr631872 1764 649 21521 863 22071 1655 --
NM_020341chr203559 483 351 --22070 1362 --
NM_020342chr212279 --12076 1752
NM_020346chr1131224 677 577 11127 11359 11616
NM_020357chr351141 651 382 270 85 ----11511
NM_020381chr631799 1458 1389 ------
NM_020382chr123244 142 109 ------
NM_020386chr3------1150
NM_020390chr364706 4598 3330 1737 1707 1083 44856 3223 1901 1666 1549 24381 1369
NM_020403chr1321192 642 --11612 11494
NM_020420chrY51305 706 550 538 345 --1700 1237
NM_020425chr672041 1911 1274 729 373 228 179 11370 ----
NM_020432chr732173 1602 749 --1736 1364
NM_020440chr143068 2246 1239 1150 --2728 380 12716
NM_020443chr1117026 6075 5267 2518 1692 1464 1446 1037 865 817 167 34240 2307 56 25931 1492 --
NM_020444chr531532 1411 560 --21174 61 --
NM_020445chr71698 1631 ----
NM_020449chrX4735 286 258 133 ----1306
NM_020455chr682827 2745 2717 2655 1728 935 799 223 --22415 596 --
NM_020456chr1372322 2062 1741 910 632 617 70 1174 ----
NM_020466chr654998 4304 3487 957 452 21407 333 23152 3147 1153
NM_020473chrX31983 758 657 11839 21732 1344 --
NM_020474chr1832040 1978 329 --22007 798 --
NM_020475chr82814 362 --22348 745 --
NM_020476chr82814 362 --22348 745 --
NM_020477chr82814 362 --22348 745 --
NM_020478chr82877 425 --22411 808 --
NM_020480chr82814 362 --22348 745 --
NM_020529chr141466 ------
NM_020532chr22239 164 --2586 292 --
NM_020546chr552755 1259 1237 680 659 1941 1325 --
NM_020548chr22192 55 ----1223
NM_020631chr121130 1061 ------
NM_020644chr113759 286 90 --1272 --
NM_020647chr841816 1570 1419 866 1416 1834 --
NM_020651chr261833 1541 1446 1354 605 269 1438 1419 --
NM_020654chr321453 1357 ------
NM_020673chr2087677 7442 7315 7277 6533 5282 1232 1098 11696 35821 1720 1317 --
NM_020686chr1632470 2423 66 ------
NM_020689chr20------11468
NM_020696chr3129 ------
NM_020699chr174445 3860 3814 1152 842 832 269 --34700 3331 1359 --
NM_020711chr252529 2354 1791 495 389 182 3656 443 220 1968
NM_020717chrX54285 3964 453 392 298 11901 24309 612 --
NM_020718chr16165899 5562 4601 4140 2646 2628 2543 2303 2064 1978 1678 1621 1354 1149 97 27 --25510 1052 --
NM_020728chr732457 2427 814 22556 120 ----
NM_020734chr1243203 2545 880 303 12604 22079 176 12522
NM_020739chr1574058 2983 1418 1303 733 581 234 --53262 2853 1151 613 466 21441 201
NM_020742chrX32085 1738 843 12471 12031 12686
NM_020747chr54867 859 778 605 2939 94 2378 255 --
NM_020748chr173817 330 203 11765 ----
NM_020752chr1052848 2756 2079 846 477 12309 11157 1426
NM_020762chr121244 ------
NM_020766chrX104544 4522 4279 3158 1764 1754 1575 1267 819 535 11169 23532 1476 --
NM_020768chr532792 1165 242 2265 148 22907 1190 13215
NM_020772chr17188612 8305 8070 8012 7700 7250 6654 6448 6194 5770 5536 2777 2324 1962 1697 1556 549 420 21168 639 88036 7794 7591 6640 5307 3479 2250 1009 1515
NM_020774chr18166113 5641 4762 4050 4006 3928 2344 1979 1719 1565 1477 1292 1230 1064 974 862 11189 64545 4341 2415 2391 773 243 --
NM_020778chr1584850 4235 4000 3610 1747 520 503 429 24523 1948 44826 4458 3806 1866 --
NM_020779chr232891 2585 664 --32655 1238 258 --
NM_020782chr12114703 4191 3382 3185 1685 1665 1268 1106 539 160 147 23574 3084 44272 1111 880 867 --
NM_020783chr1852183 898 789 376 100 --2404 381 --
NM_020791chr1731132 1004 513 11326 11010 --
NM_020792chr32945 317 --22631 647 1246
NM_020794chr121153 381 2585 528 31394 1313 1245 11439
NM_020796chr533027 2816 968 --22370 2267 --
NM_020800chr331255 281 185 --132 --
NM_020801chr54750 629 531 75 --32356 779 108 --
NM_020808chr11307 1439 1858 --
NM_020809chr1122163 2133 1175 11886 --
NM_020810chr1453632 2442 1456 186 110 --12960 1116
NM_020819chr651206 1078 860 109 34 --4231 220 212 171 --
NM_020825chr1673687 2622 2498 1108 1014 941 361 --21217 1020 --
NM_020830chr241326 1290 858 232 12136 12707 12350
NM_020834chr1451837 1810 1605 450 432 --2504 92 --
NM_020839chr341252 1221 1119 322 11379 1133 --
NM_020841chr1283872 3020 2957 2933 2790 2664 972 151 23361 1551 63642 3468 2890 1400 536 158 --
NM_020843chr15--2414 136 ----
NM_020850chr1672248 1135 976 960 909 875 339 12407 13190 --
NM_020854chr1851533 1449 994 499 413 --178 --
NM_020856chr1931269 1180 397 --11344 --
NM_020858chr1572387 2348 2262 1792 785 411 195 32331 274 75 ----
NM_020861chr62504 48 ------
NM_020866chr132124 33 ----1767
NM_020868chr251832 1408 692 619 432 --22007 1263 --
NM_020870chr431981 422 221 21791 1691 ----
NM_020871chrX52246 2206 1892 1021 989 11734 22431 1944 1104
NM_020872chr331790 1656 1295 1183 11758 --
NM_020873chr3----2717 564 1704
NM_020890chr32117 54 --1197 --
NM_020901chr112428 405 --2434 277 --
NM_020909chr2113977 3969 3904 3369 2801 2652 2636 795 704 453 232 1617 24028 2886 12974
NM_020918chr1063509 1341 1236 483 417 141 ------
NM_020919chr24479 402 266 31 11209 11177 --
NM_020921chr1463650 3504 3215 890 880 668 12330 12638 --
NM_020922chrX61879 1854 1716 1668 1592 1224 11409 21673 521 1119
NM_020927chr1641537 1492 621 529 12251 11734 --
NM_020935chr294561 4433 3806 3370 3065 3040 1858 1221 756 ----11732
NM_020940chr1052940 2932 2680 2420 1875 --12194 --
NM_020946chr93650 526 245 --11128 11148
NM_020948chr182917 2773 629 493 326 264 248 155 --121 2175 75
NM_020967chr202205 58 --11291 --
NM_020977chr421685 396 ------
NM_021005chr151431 11024 ----
NM_021007chr242251 2065 1617 618 22403 1818 ----
NM_021032chr311790 ----1352
NM_021033chr1333021 2810 825 12644 22717 1164 --
NM_021038chr31199 12060 13271 --
NM_021069chr461943 1803 1632 852 541 484 2527 95 12133 --
NM_021072chr521832 298 --1966 --
NM_021088chr251466 1417 1374 827 464 11438 ----
NM_021090chr2254632 3760 3492 215 193 23534 2006 34861 3479 755 --
NM_021097chr242135 757 570 101 --42506 2400 2255 1224 --
NM_021101chr342272 1012 949 508 --31990 1546 191 11912
NM_021110chr83720 710 90 --1734 --
NM_021116chr7119073 8924 7695 7612 7368 7254 5979 3233 2798 2352 1944 15584 28246 7618 27464 3440
NM_021127chr1861400 1374 1232 1159 982 294 --1481 --
NM_021132chr101901 --11241 --
NM_021136chr141584 --2670 282 --
NM_021148chr732316 1996 321 1177 --12058
NM_021156chr2021130 258 1994 ----
NM_021167chr752178 2003 1853 984 184 --12282 --
NM_021183chrX92479 899 832 572 514 452 439 386 374 ------
NM_021190chr131274 1228 1053 2548 307 11070 --
NM_021192chr21430 ------
NM_021202chr2082861 2326 2184 2106 1984 1130 897 591 ------
NM_021205chr162681 2232 1983 576 478 157 12820 ----
NM_021219chr211243 ------
NM_021222chr1--11439 ----
NM_021224chr9133 1418 ----
NM_021229chr1241022 345 147 138 ------
NM_021249chr1431383 1217 36 --2399 336 1589
NM_021252chr1051692 1356 620 368 231 ------
NM_021253chr651428 1399 1273 957 923 --11391 --
NM_021255chr1483530 3515 3401 3017 2653 1499 1480 237 --31226 904 75 1638
NM_021619chr921304 1203 ------
NM_021622chr1022150 865 12257 22355 2247 --
NM_021627chr31428 ------
NM_021639chr12898 184 ------
NM_021643chr241815 1543 1334 84 1751 ----
NM_021644chr1041092 271 236 189 ------
NM_021648chr672714 2614 683 586 552 296 168 2491 412 1116 --
NM_021722chr7253 41 --1543 --
NM_021723chr7141 --1584 --
NM_021813chr635530 4627 1461 15339 35703 3578 187 --
NM_021814chr621726 1316 21363 418 --21534 271
NM_021818chr1441411 1082 336 309 --11170 --
NM_021905chr661866 1857 1833 1561 1484 1469 --1619 --
NM_021911chr535194 447 422 1116 15364 --
NM_021912chr1583838 3825 1194 1124 1115 643 513 361 11643 12691 --
NM_021914chr14102445 2131 2047 1528 648 618 609 452 344 222 --2866 198 --
NM_021935chr34784 419 58 44 --3794 185 135 --
NM_021940chr641545 1365 1052 613 11499 ----
NM_021943chr642119 2073 604 489 ------
NM_021949chrX42782 2728 2562 1123 --11982 --
NM_021951chr91848 3372 170 97 1342 --
NM_021956chr621207 109 --11570 --
NM_021960chr162699 2586 2162 1792 941 559 ----1586
NM_021961chr11167527 7424 7148 6974 6640 6623 6442 5433 5096 5006 4929 2995 2528 2439 2253 660 24672 4661 47195 4942 4607 508 --
NM_021964chr394959 4783 4716 4702 4587 1849 1059 660 225 2420 190 45817 2480 1184 1174 35886 896 644
NM_021970chr4185 128 132 --
NM_021977chr653654 3568 3088 1135 66 11185 13170 --
NM_021979chr141414 1369 135 --
NM_021980chr1051210 1065 866 531 101 --21317 964 --
NM_021988chr2031603 1209 376 --11072 1146
NM_021998chrX31271 1208 183 1297 11366 --
NM_021999chr133330 286 126 ----1161
NM_022037chr231024 151 69 --3748 218 209 --
NM_022041chr1642735 2619 2093 795 ----21809 631
NM_022048chr1555687 4454 2373 2258 1301 22018 1412 56189 5838 4327 1569 829 --
NM_022049chr121500 1224 ------
NM_022051chr11546 ------
NM_022068chr182633 163 1605 --1610
NM_022079chr101109 ------
NM_022085chr651602 613 532 392 131 11422 ----
NM_022091chr632120 1733 588 12300 1932 1958
NM_022100chr12493 146 --1189 --
NM_022118chr134192 151 70 60 ------
NM_022130chr561458 1451 1024 278 255 89 ----1917
NM_022132chr52422 126 1135 ----
NM_022133chr861714 1358 1161 747 722 297 21671 664 21856 1846 --
NM_022137chr1421788 148 1803 ----
NM_022143chr7------1476
NM_022144chrX1118 ------
NM_022166chr1696364 6120 5609 5521 4657 2260 1853 1672 183 16187 45729 4796 4603 2100 24599 1655
NM_022170chr7------1379
NM_022171chr351448 1221 1006 214 202 1224 ----
NM_022173chr231024 151 69 --3748 218 209 --
NM_022343chr951100 412 316 308 219 ------
NM_022351chr883284 3272 2537 1330 514 369 78 54 --12772 --
NM_022361chr61475 ------
NM_022373chr73965 766 387 1900 1712 --
NM_022442chr2031603 1209 376 --11072 1146
NM_022456chr1296736 6610 6446 5760 2149 1399 1182 456 70 13004 35635 2978 1952 --
NM_022458chr743147 2044 662 365 1385 --1806
NM_022459chr13115658 5196 5120 4654 4469 4004 2394 2079 1801 1397 313 --15172 1895
NM_022461chr361193 1131 1111 298 273 41 ----11290
NM_022465chr1232443 1121 459 1504 2279 225 --
NM_022469chr111199 --11034 12347
NM_022473chr1594471 4152 3883 3511 3487 2880 818 747 625 --53596 3472 3046 1092 824 --
NM_022474chr1452151 1860 559 504 220 --12627 --
NM_022476chr164914 828 215 186 --1801 --
NM_022482chr2041728 433 417 296 2396 215 1900 --
NM_022483chr531578 1536 267 21252 1211 ----
NM_022488chr31163 ------
NM_022497chr363820 3581 2934 2450 1334 551 --21497 68 --
NM_022650chr531030 966 293 ------
NM_022652chr122982 937 1810 1814 --
NM_022658chr1221340 468 --1167 --
NM_022659chr81148 ------
NM_022716chr163136 2873 2766 2299 1072 400 2920 439 ----
NM_022726chr611581 1317 --1401
NM_022735chr141927 1736 712 180 --21846 74 21779 104
NM_022739chr1721119 248 --41189 917 831 797 --
NM_022753chr172665 2424 2228 2153 742 630 357 --4774 720 480 461 --
NM_022756chr151467 1385 1083 517 500 ----2471 197
NM_022757chr33981 797 416 ------
NM_022763chr342999 2844 1245 1120 32388 1021 580 2972 288 --
NM_022771chr121180 --1857 --
NM_022780chr241521 1348 1259 1149 --2354 290 --
NM_022781chr923049 936 1371 12991 --
NM_022789chr142511 414 ------
NM_022818chr161263 ------
NM_022826chr231116 960 398 1450 174 --
NM_022828chr521449 1390 21489 717 11125 --
NM_022831chr131851 1660 582 --31520 1345 238 11516
NM_022841chr151160 --32265 917 387 22370 599
NM_022843chr132547 331 --21314 1043 --
NM_022845chr1611848 1728 32254 1542 248 22192 1822
NM_022893chr252849 2348 2092 959 730 --22937 2684 --
NM_022894chr23709 622 520 1278 11679 1472
NM_022898chr1484551 4525 3503 1603 963 403 271 75 --44514 3974 3872 517 11734
NM_022900chr721064 42 --1322 --
NM_022901chr921361 691 --11586 --
NM_022902chr51296 --1307 --
NM_022912chr242282 2015 494 414 1112 12131 --
NM_022918chr111560 11355 22117 1886 1332
NM_022977chrX22570 2426 32202 1863 533 41700 936 770 483 1168
NM_023000chr1421176 121 --1242 --
NM_023001chr1421176 121 --1242 --
NM_023037chr1331068 324 120 --1928 --
NM_023039chr5385 71 38 ------
NM_023929chr832582 2108 881 22408 334 22114 861 12352
NM_023934chrX52214 2019 463 451 101 --1426 --
NM_024007chr583180 2594 2535 2032 1224 1000 792 629 12102 --12255
NM_024016chr171792 ----1657
NM_024057chr12--1112 ----
NM_024060chr112229 133 ------
NM_024071chr142565 158 --1481 1451
NM_024089chr13--1166 ----
NM_024102chr111197 ------
NM_024295chr831648 1338 365 ------
NM_024337chr5----121 --
NM_024345chr994938 4752 4744 4508 4409 2000 1199 743 536 11947 11133 1704
NM_024348chr92282 83 ------
NM_024408chr163528 3307 3044 2701 2474 741 12385 33169 1275 625 --
NM_024411chr2011489 ----1590
NM_024416chr941583 1567 1492 1351 --31574 645 362 --
NM_024421chr18155 2881 840 1296 11041
NM_024422chr1851443 654 618 387 209 1254 1214 11535
NM_024423chr1824122 2725 --53654 3225 3135 1225 377 --
NM_024424chr111196 ------
NM_024425chr111196 ------
NM_024426chr111196 ------
NM_024494chr11683 ------
NM_024501chr22623 273 1143 ----
NM_024520chr2----1110 --
NM_024524chr383018 2613 2533 953 910 680 355 217 --1272 --
NM_024525chr1----2152 101 --
NM_024529chr11260 --31173 1113 897 --
NM_024539chrX--21017 361 1878 --
NM_024546chr1321037 497 --166 --
NM_024548chr341077 691 196 50 --31714 301 60 1348
NM_024561chr1331195 871 188 --1972 --
NM_024569chr152840 2740 2013 1932 339 ----2703 412
NM_024582chr431065 1048 309 --21025 918 --
NM_024607chr874378 4324 3309 3114 3055 2798 812 --43965 3716 3346 818 14123
NM_024610chr31230 --1320 --
NM_024612chr1741090 1001 802 60 ------
NM_024613chr851551 531 464 169 110 21523 493 21290 539 --
NM_024617chr93786 716 185 --1723 --
NM_024624chr241578 1329 624 523 11178 --1199
NM_024626chr151579 1533 1441 580 203 --11280 --
NM_024635chr91135 ------
NM_024639chr652162 2048 979 569 377 --41113 1011 1005 701 --
NM_024646chr183275 3263 3069 2681 2532 1019 430 261 23804 68 21171 221 --
NM_024665chr344070 3345 3203 3005 11207 --13620
NM_024670chr1031317 1288 511 ------
NM_024674chr142585 972 691 260 --21030 850 --
NM_024689chrX51847 1135 576 484 198 --21477 525 --
NM_024692chr221446 640 11628 21372 113 176
NM_024700chr11813 1123 1965 1378
NM_024702chr171207 ------
NM_024713chr1521619 1203 1553 ----
NM_024721chr83936 754 741 --12053 --
NM_024725chr113185 104 97 2747 326 1658 2209 141
NM_024731chr16----1117 --
NM_024740chr1173888 3564 3402 3324 2762 1328 1222 24126 1591 14014 11051
NM_024744chr272265 1967 698 653 619 299 226 --21869 168 11865
NM_024749chr1102250 2242 1884 1775 1588 853 675 451 300 286 ------
NM_024751chr442063 2035 1510 451 ----12095
NM_024755chr152359 60 ------
NM_024757chr931171 983 966 ------
NM_024761chr965183 4429 4140 1697 1247 384 14994 54823 4666 4562 4546 1287 --
NM_024770chr296764 6736 5083 5061 4767 4535 4483 1729 183 --36660 6130 1410 --
NM_024798chr1522553 2316 1925 12642 --
NM_024817chr1585448 5409 5043 5002 4750 2345 1019 40 14108 ----
NM_024818chr34248 151 129 114 --21389 1152 --
NM_024824chr1451635 601 575 413 132 ------
NM_024828chr941292 239 172 139 ------
NM_024835chr17------1105
NM_024837chr1541198 755 456 111 --132 --
NM_024887chr142049 656 427 161 --11329 --
NM_024899chr182258 64 ------
NM_024900chr421846 1447 --12294 11858
NM_024900chr421846 1447 --12294 11858
NM_024913chr751718 1097 693 535 253 ------
NM_024915chr83935 752 673 1229 12376 12632
NM_024920chr441359 1034 982 23 ----11618
NM_024921chrX3707 611 72 ----11342
NM_024926chr74266 240 232 36 ------
NM_024930chr562541 2286 2224 1105 752 67 --1904 --
NM_024941chr52303 102 --2169 61 --
NM_024947chr3149482 8843 8588 8509 7963 7547 7411 6240 3429 3326 2807 2280 932 520 27717 6596 69068 3456 3114 1729 1122 39 --
NM_024949chr443528 3295 3095 174 --11602 13469
NM_024953chr1242493 1972 1061 268 22796 939 11101 --
NM_024979chr131469 ------
NM_024989chr2128078 7928 7550 6780 5763 2991 2943 1527 1500 1440 1101 425 16014 38124 2827 2484 11232
NM_025004chr114633 537 188 41 --1264 --
NM_025054chr8144130 3992 3965 3944 3818 3199 3119 2998 2956 1261 556 448 322 122 33425 1412 466 21611 836 --
NM_025057chr1451115 944 916 124 73 ------
NM_025073chr1104492 4470 4255 3720 3327 1029 890 555 230 89 11582 34208 973 561 --
NM_025074chr452728 2699 2471 582 558 1279 12733 --
NM_025076chr21539 --2266 192 --
NM_025106chr121660 1531 --1699 --
NM_025107chr632002 1983 359 --1437 --
NM_025134chr1631808 1695 588 1328 22537 2375 11884
NM_025138chr1321125 46 --11082 --
NM_025146chr362691 624 578 432 389 160 --32340 1788 476 --
NM_025147chr22940 325 ------
NM_025151chr872096 2077 669 602 459 398 226 --174 --
NM_025152chr1432012 665 27 --11278 --
NM_025154chr72963 574 ----11110
NM_025160chr133605 2695 625 ----13548
NM_025164chr1152139 1899 1518 1370 343 --21448 815 --
NM_025179chr144688 1890 1357 769 13627 11637 13632
NM_025191chr182804 2728 2366 1414 900 729 648 470 --12170 --
NM_025195chr821539 643 --21691 1557 --
NM_025214chr1862748 2685 2228 967 745 226 12775 --12294
NM_025222chr342168 925 877 542 --21891 171 --
NM_025234chr15--1174 166 --
NM_025235chr1062221 1959 1847 1782 698 633 ----12115
NM_025244chr21246 --186 --
NM_025248chr173866 831 464 --1224 --
NM_030579chr1683541 3449 3234 3141 2414 1220 991 338 13309 23641 2947 --
NM_030621chr14113888 3611 3578 3524 3290 3260 2922 1687 1316 1130 1065 --54208 3668 1481 983 228 1665
NM_030623chr231714 1665 1289 --1429 11671
NM_030625chr1042490 866 91 27 11836 12229 --
NM_030627chr552905 2832 2765 813 383 --31138 1120 458 11271
NM_030629chr1621931 1531 --1327 --
NM_030634chr162333 1563 794 516 219 179 ----1993
NM_030639chrX51206 1104 641 220 161 11309 21386 188 --
NM_030647chr7166230 6054 5559 5237 5128 4934 4868 4395 4069 2529 1987 1946 1832 1372 1256 1082 11073 25365 1225 26102 696
NM_030648chr4104637 4442 4184 3869 3755 3711 1130 757 495 64 1831 33899 791 474 --
NM_030650chr2123871 3341 3086 3032 2794 2714 1254 1234 983 890 255 130 --33370 292 80 13015
NM_030660chr142457 34 ------
NM_030664chr102616 92 --2860 144 1832
NM_030667chr1221016 136 --11222 --
NM_030668chr1221016 136 --11222 --
NM_030669chr1221016 136 --11222 --
NM_030674chr12125519 4850 4095 3875 2124 2081 1530 1364 1239 488 409 255 35661 4465 1118 25552 706 12144
NM_030751chr1031348 1240 561 --21629 1562 1367
NM_030751chr1031348 1240 561 --21629 1562 1367
NM_030752chr62136 52 1173 ----
NM_030762chr1241742 1542 1393 335 12007 11701 --
NM_030763chrX5916 896 600 178 41 ------
NM_030774chr1161391 1213 962 332 284 100 --128 --
NM_030777chr2042387 1675 1649 738 --12074 --
NM_030780chr81349 11561 21301 176 --
NM_030786chr161824 752 659 506 491 357 11905 1362 --
NM_030791chr1431628 1334 751 --21700 569 --
NM_030799chr551886 1470 1366 845 190 --1751 --
NM_030803chr221314 976 --2963 252 --
NM_030806chr1118531 8319 7694 3543 2996 2637 2505 1875 1128 1108 1075 45946 2849 2491 645 78746 6520 6084 3419 2538 1373 985 18286
NM_030809chr1251735 1668 548 195 56 11831 ----
NM_030810chr651602 613 532 392 131 11422 ----
NM_030816chr143496 3284 1281 711 --13235 --
NM_030885chr322166 287 1905 11552 --
NM_030915chr242363 2011 1936 302 --21902 171 --
NM_030918chr185300 2130 1280 1086 738 689 481 377 12178 31904 1811 1524 --
NM_030920chr132095 1890 1640 --1466 1145
NM_030922chr151757 --1149 --
NM_030926chr221145 95 ------
NM_030927chr1061646 1488 1421 1182 635 189 ------
NM_030934chr131671 1534 584 21789 601 ----
NM_030938chr174752 421 161 146 150 31174 720 280 --
NM_030939chr631108 362 166 1252 ----
NM_030962chr1151588 1512 1486 1282 215 --1986 11562
NM_030963chr62257 45 ----1251
NM_031216chr1831787 1536 328 12187 1495 --
NM_031217chr111130 1467 ----
NM_031226chr1531256 1149 1130 1467 ----
NM_031243chr752224 2003 1883 245 113 --21762 957 1212
NM_031244chr62946 923 ------
NM_031262chr931114 723 46 ------
NM_031263chr931171 780 103 ------
NM_031267chr73513 451 35 ------
NM_031271chr851671 1112 1077 590 59 ------
NM_031291chr41597 1650 1612 --
NM_031292chr1251535 649 602 537 105 ------
NM_031296chr452020 424 408 47 24 12424 ----
NM_031305chr451743 1669 1608 717 505 ------
NM_031314chr1441901 716 97 45 ------
NM_031371chr121269 1042 11224 ----
NM_031371chr121269 1042 11224 ----
NM_031411chr542200 2044 1961 1498 ------
NM_031418chr1162699 2593 2350 2264 2252 286 1820 1472 --
NM_031419chr311234 11058 31469 1196 261 183
NM_031422chr18------1510
NM_031427chr1485860 5651 5168 4944 2269 1450 1345 442 13879 15131 13777
NM_031431chr1351803 1461 724 711 544 ------
NM_031435chr1283327 3037 2840 2135 1025 960 853 102 32274 651 195 --11003
NM_031439chr821906 53 ----21761 1666
NM_031442chrX52144 1052 876 336 320 1996 1138 --
NM_031445chr283384 3310 2895 2686 1278 1037 209 93 --21124 173 --
NM_031453chr1082038 1884 1877 1631 514 421 161 57 ------
NM_031469chr6114102 3094 2846 1503 1032 793 586 274 233 223 71 --33985 3390 1022 --
NM_031479chr122895 326 1445 11070 11089
NM_031483chr2073540 3447 3178 2565 665 148 110 12512 43469 3369 3276 249 22883 2726
NM_031844chr174143 4092 3948 3910 3503 2804 261 23228 938 ----
NM_031845chr252924 2587 2557 1402 1151 --22592 297 --
NM_031847chr252924 2587 2557 1402 1151 --22592 297 --
NM_031849chr542200 2044 1961 1498 ------
NM_031850chr32762 97 ----1866
NM_031850chr32762 97 ----1866
NM_031857chr542200 2044 1961 1498 ------
NM_031860chr542200 2044 1961 1498 ------
NM_031866chr101864 ------
NM_031889chr461464 1435 1420 1364 1315 1291 11478 2779 513 --
NM_031891chr181153 ----2418 413
NM_031911chr452653 2310 2277 2250 1905 --12658 1319
NM_031935chr14985 243 185 137 ----1960
NM_031940chr832479 1615 320 --32497 2335 179 --
NM_031942chr241105 951 324 26 ------
NM_031966chr53518 222 146 --3481 113 85 --
NM_031992chr7------1379
NM_032021chr1111095 ----11216
NM_032025chr331667 795 186 ------
NM_032028chr51619 ------
NM_032042chr542762 2182 2151 1856 12193 1848 --
NM_032047chr362372 2203 2110 610 184 172 1679 32304 1837 1695 --
NM_032049chr32762 97 ----1866
NM_032049chr32762 97 ----1866
NM_032102chr1152922 1242 1093 470 131 --31014 947 412 --
NM_032116chr1395836 4620 4609 4377 4208 3655 1035 588 543 22176 1540 65821 5371 4891 1972 1911 1886 15074
NM_032121chrX32388 296 102 42701 478 329 162 32722 2322 2192 1362
NM_032128chr431038 818 348 1664 ----
NM_032144chr261551 1513 668 438 283 227 11127 ----
NM_032145chr651636 1491 1275 779 596 ----1179
NM_032147chr126385 331 234 218 181 46 --1791 --
NM_032154chr105931 804 737 270 118 ------
NM_032160chr1844281 3408 2836 651 12658 43358 1020 468 210 --
NM_032174chr121477 469 ------
NM_032182chr1051491 1212 526 385 367 1105 3618 397 170 --
NM_032186chr1181 --1971 --
NM_032189chr1345029 4588 1496 1325 --11887 14636
NM_032193chr1121915 831 1275 ----
NM_032195chr214510 499 473 205 1346 1529 --
NM_032199chr1043870 3604 3568 3293 --13456 11001
NM_032208chr273424 3025 2567 1372 486 383 324 --13412 --
NM_032217chr41491 21093 458 --1203
NM_032221chr2042006 1813 1616 65 --11422 --
NM_032228chr1163466 3047 2945 2803 2678 938 1347 ----
NM_032239chr461407 925 561 176 153 64 --1942 --
NM_032246chr1511138 11156 ----
NM_032265chr171115 ------
NM_032281chr1933168 2187 2087 ------
NM_032288chr342305 1897 678 88 --32055 1991 455 --
NM_032291chr131564 544 190 --1493 --
NM_032311chr2252038 1875 1773 404 296 ------
NM_032312chr23689 353 182 --1742 --
NM_032320chr113584 534 323 2665 569 1524 --
NM_032321chr2103004 2787 2765 2717 2447 2423 2138 2080 1073 730 12907 22750 1253 12797
NM_032328chr11106 ----177
NM_032329chr254312 1669 1320 1137 87 --12975 --
NM_032345chr121111 ------
NM_032352chr1441238 362 336 210 1525 1311 132
NM_032373chr10145919 5862 4896 4724 3778 3625 2066 1653 1639 1522 1340 741 437 304 34343 1729 791 22098 1035 11279
NM_032410chr861270 1125 940 836 266 159 2995 794 1868 --
NM_032434chr231316 1261 1086 --1234 --
NM_032435chr152052 1927 1575 313 67 --1275 --
NM_032436chr132959 189 1693 ----
NM_032437chr1--1151 ----
NM_032438chr651330 1193 547 472 388 --2653 243 --
NM_032440chr1062201 799 726 689 287 250 --2714 359 --
NM_032445chr1562605 2553 2290 1823 420 310 --31761 1718 614 1394
NM_032446chr533756 2602 419 --23120 1229 --
NM_032452chr1451468 1438 185 103 62 ----1579
NM_032457chr453858 2670 1272 205 122 --23650 2812 --
NM_032458chrX32943 1349 1322 12524 32996 2341 1257 12881
NM_032466chr831465 461 298 ------
NM_032468chr831465 461 298 ------
NM_032482chr1922502 1989 --1744 --
NM_032491chr1251278 1026 975 284 89 ------
NM_032494chr2--144 ----
NM_032499chr1541685 1579 1340 1132 --161 1714
NM_032503chr61701 2879 46 1821 --
NM_032505chr352783 1990 1765 1063 785 1821 11780 --
NM_032509chr852380 2191 467 387 320 21697 854 21701 700 166
NM_032511chr6--1446 ----
NM_032517chr101136 ------
NM_032521chr2073108 3041 2388 2176 2035 1211 651 12991 22688 1977 --
NM_032557chr461000 767 730 659 315 85 ------
NM_032558chr931441 567 441 1971 11506 --
NM_032582chr1721221 682 11618 --11512
NM_032622chr4----31078 491 72 --
NM_032632chr1441486 1329 354 242 --1758 --
NM_032663chr1272041 1423 681 655 576 458 343 --1695 --
NM_032664chr84593 545 302 272 --1234 165
NM_032682chr353484 2855 700 473 199 13497 22418 2276 --
NM_032784chr64927 796 663 197 ------
NM_032786chr121596 ------
NM_032796chrX3262 180 145 1156 ----
NM_032801chr1142472 2003 624 472 ------
NM_032804chr1082598 2408 1994 1842 1595 967 403 300 1840 22526 727 --
NM_032813chr131821 --21081 284 11130
NM_032833chr13684 265 44 1677 11993 --
NM_032837chr1721892 158 1344 122 --
NM_032842chr741542 1360 1058 183 --1203 --
NM_032846chr1451516 1457 1294 620 373 11395 31409 444 121 --
NM_032857chr15----1211 --
NM_032859chr1373961 2913 1557 1326 1291 532 234 23614 936 13109 --
NM_032860chr61274 1188 ----
NM_032861chr651477 1151 511 505 447 ------
NM_032870chr62426 402 ------
NM_032873chr1163407 3240 3145 1228 431 213 24121 3164 13466 --
NM_032883chr20------1602
NM_032900chr1043354 990 517 190 --23772 826 1560
NM_032932chr17116377 5919 5515 5409 5105 4546 3912 1917 1903 1254 575 --12216 11236
NM_032947chr5----21247 377 --
NM_032949chr132478 401 1103 2455 417 --
NM_032961chr43273 233 21 --31378 1371 84 --
NM_032967chrX2376 340 ------
NM_032968chrX113988 3289 3192 3088 2712 2685 2635 1487 857 845 410 33048 594 383 43598 3205 1410 400 1774
NM_032969chrX113988 3289 3192 3088 2712 2685 2635 1487 857 845 410 33048 594 383 43598 3205 1410 400 1774
NM_032971chrY2403 367 ------
NM_032972chrY2403 367 ------
NM_032973chrY113980 3284 3187 3083 2707 2680 2634 1487 857 845 410 33043 594 383 43594 3200 1410 400 1774
NM_032975chr181974 --23331 2691 11152
NM_032980chr181974 --23331 2691 11152
NM_032983chr783331 3148 3098 2930 1225 1016 968 241 --22660 1306 --
NM_032999chr751151 1107 147 127 102 ------
NM_033000chr751151 1107 147 127 102 ------
NM_033001chr751151 1107 147 127 102 ------
NM_033012chr134943 807 772 432 --11048 11023
NM_033014chr941583 1567 1492 1351 --31574 645 362 --
NM_033020chr194092 4042 3990 3904 3773 3699 3194 3031 1503 33048 1133 496 11604 11854
NM_033023chr731230 1220 1156 ------
NM_033044chr131302 1096 193 1132 1340 11231
NM_033055chr1--197 1995 --
NM_033058chr83808 269 78 ------
NM_033081chr2031377 332 238 --1273 --
NM_033089chr205488 373 338 292 135 --11509 --
NM_033103chr191334 11315 21179 1144 --
NM_033119chr163948 920 378 1689 ----
NM_033121chr1211200 --21624 498 1664
NM_033132chr1341748 892 756 466 ------
NM_033136chr541810 1795 1553 444 11254 ----
NM_033137chr541810 1795 1553 444 11254 ----
NM_033138chr762219 1942 1698 1623 335 201 --32140 552 111 1444
NM_033139chr762219 1942 1698 1623 335 201 --32140 552 111 1444
NM_033140chr762219 1942 1698 1623 335 201 --32140 552 111 1444
NM_033143chr444083 3896 2988 1231 --33347 1214 797 11731
NM_033150chr12157 ------
NM_033157chr762219 1942 1698 1623 335 201 --32140 552 111 1444
NM_033167chr351692 638 546 476 40 1394 11870 --
NM_033168chr351692 638 546 476 40 1394 11870 --
NM_033169chr351692 638 546 476 40 1394 11870 --
NM_033181chr683950 3763 3739 3520 1411 944 672 329 12786 33666 2790 770 --
NM_033211chr542054 575 372 325 11562 11969 --
NM_033222chr951385 1355 1017 477 353 ------
NM_033224chr777656 7197 6678 5604 2182 1731 1061 16019 22533 1158 57397 6231 5689 5021 1764
NM_033281chr54930 827 193 168 1211 1348 --
NM_033285chr8124168 3899 3748 3520 3260 3065 3045 1422 1192 365 182 143 12812 73460 3221 2883 1547 1069 200 187 23585 3450
NM_033290chrX31452 405 281 23141 850 1634 --
NM_033300chr111295 1326 ----
NM_033326chr1132043 771 268 --2900 312 1936
NM_033331chr973319 3243 3231 1361 1248 1067 457 1637 11028 --
NM_033360chr12114375 4312 4194 3477 3128 1572 492 410 214 137 21 12932 23394 1346 23957 256
NM_033364chr341957 550 411 366 ------
NM_033389chr1754535 4195 3652 939 414 --34633 4541 3177 --
NM_033393chr422731 2076 --32789 1062 908 --
NM_033394chr241618 1484 1130 332 --1302 --
NM_033407chr11600 --1208 --
NM_033425chr1163196 3158 3080 2144 847 333 13034 ----
NM_033426chr1462961 1882 1789 438 58 26 ------
NM_033427chr73833 809 76 --1684 --
NM_033429chr1562805 2665 2436 2398 2037 371 1719 --22212 891
NM_033430chr484079 3882 3481 3034 3018 1610 1556 106 12670 14007 --
NM_033437chr484079 3882 3481 3034 3018 1610 1556 106 12670 14007 --
NM_033484chr52562 37 --1706 --
NM_033495chrX2277 37 --21066 907 --
NM_033505chr2146563 6483 6014 5700 5433 4461 4284 2513 2462 2012 1966 1735 1236 834 54647 2530 2081 1296 1057 15338 --
NM_033512chr872560 1207 1125 270 261 155 71 1240 22277 2203 --
NM_033535chr44987 925 791 191 ----1767
NM_033540chr331030 931 806 ----2904 85
NM_033551chr533089 2297 1200 --13289 1920
NM_033624chr1251803 814 515 136 42 --31963 1424 620 --
NM_033637chr1083803 3300 3201 2821 1489 1230 631 244 --12693 13338
NM_033642chrX3908 276 42 ------
NM_033644chr552527 2325 910 741 641 ------
NM_033645chr552527 2325 910 741 641 ------
NM_033656chr21125125 4370 4277 4180 3650 2395 1854 1614 1533 1423 1113 1010 1879 55951 4570 4122 1861 319 --
NM_048368chr181315 ------
NM_052818chr1341677 1431 774 455 1705 ----
NM_052832chr862887 2607 1154 923 578 345 22778 2104 22974 1005 22341 499
NM_052834chr181479 11918 --11846
NM_052849chr152659 199 ------
NM_052851chr1362366 2146 1950 886 279 246 --22299 1704 11784
NM_052862chr11269 ------
NM_052864chr431853 1475 671 21983 533 1537 --
NM_052867chr1331258 1052 543 --11477 --
NM_052879chr12----43338 2602 1217 430 --
NM_052882chr195779 670 309 200 43 --1811 --
NM_052885chr12134563 4284 4076 3443 1984 1494 1478 1309 935 752 640 474 252 ----11165
NM_052886chr831714 1561 1430 149 41446 809 792 766 --
NM_052898chr831681 1596 313 11580 11817 --
NM_052905chr251759 1526 442 302 244 11607 21871 1181 11612
NM_052910chr132608 173 ------
NM_052911chr182945 235 --1203 --
NM_052913chr61167 --41048 1036 982 292 --
NM_052917chr283241 3004 2875 2853 2831 2512 989 477 23384 360 --12972
NM_052918chr1093525 3177 2420 1374 1299 1280 1255 1002 879 --13744 13183
NM_052926chrX1903 --1140 --
NM_052932chr1152285 2173 2144 394 261 21881 445 22128 2048 1854
NM_052936chrX1633 ------
NM_052937chr892451 2268 2197 2098 1894 1871 977 594 416 --31842 990 458 1454
NM_052953chr3171 ------
NM_052954chr212102 44 11864 11530 --
NM_052958chr82304 224 ----1260
NM_052965chr14442 398 218 77 --2827 464 11165
NM_053016chr9248038 7903 7884 7800 7396 6343 5771 5702 5435 5208 2801 2540 2463 2178 1719 1338 1307 1187 1131 930 507 446 415 110 1545 42589 2217 1753 115 25497 1469
NM_053023chr1163246 3192 3140 2462 2413 967 --22684 457 --
NM_053024chr33541 499 422 11370 ----
NM_053025chr351685 1448 1373 1282 303 --11431 --
NM_053026chr351685 1448 1373 1282 303 --11431 --
NM_053027chr351685 1448 1373 1282 303 --11431 --
NM_053028chr351685 1448 1373 1282 303 --11431 --
NM_053031chr351685 1448 1373 1282 303 --11431 --
NM_053032chr351685 1448 1373 1282 303 --11431 --
NM_053042chr462480 2411 2262 1089 735 622 1484 22745 32 --
NM_053043chr776243 6225 4697 4677 4640 2198 1271 24373 1162 32559 1454 415 11966
NM_053053chr12903 417 11027 ----
NM_053064chr1452756 2712 2387 900 469 ----12454
NM_053274chr1143 ------
NM_053275chr12162 ------
NM_054016chr121617 62 --11582 --
NM_054016chr121617 62 --11582 --
NM_054016chr121617 62 --11582 --
NM_057159chr911016 1578 1533 --
NM_057169chr1283071 3026 2748 2575 2555 2511 2046 622 --22267 2135 1189
NM_057170chr1283071 3026 2748 2575 2555 2511 2046 622 --22267 2135 1189
NM_057175chr432351 2312 2224 22452 248 1120 1349
NM_057178chr1762771 2735 2199 1915 494 468 129 22303 583 --
NM_057180chr121387 --1374 --
NM_057749chr82519 398 1370 1317 --
NM_058172chr441855 1146 1122 147 1556 --1503
NM_058179chr94951 921 300 275 --1263 --
NM_058191chr212902 719 --1595 --
NM_058237chr142836 696 --11033 --
NM_058241chr251863 1628 1612 934 179 --3734 574 32 --
NM_058241chr251863 1628 1612 934 179 --3734 574 32 --
NM_078473chr832479 1615 320 --32497 2335 179 --
NM_078483chr543642 916 681 57 13548 33264 1445 701 --
NM_078485chr6--1613 2122 97 --
NM_078625chr631179 953 389 ------
NM_078626chr1128 136 1247 --
NM_078629chrX1596 --2567 214 --
NM_078630chrX1596 --2567 214 --
NM_079837chr161588 ------
NM_080422chr182313 116 --1276 --
NM_080423chr182313 116 --1276 --
NM_080617chr2021045 991 1790 --1965
NM_080629chr151081 573 410 145 43 --11100 11242
NM_080630chr151081 573 410 145 43 --11100 11242
NM_080645chr651820 1625 1585 867 745 12164 41825 1723 1557 576 11949
NM_080654chr1181042 948 459 415 397 141 101 80 --21124 926 --
NM_080664chr1421788 1348 ------
NM_080672chr202481 160 ------
NM_080676chr2063079 2231 1321 1015 735 161 --13262 13009
NM_080678chr2----1254 1241
NM_080683chr43565 529 501 2186 126 ----
NM_080684chr43565 529 501 2186 126 ----
NM_080685chr43565 529 501 2186 126 ----
NM_080743chr682588 2020 1963 1898 910 819 334 259 --22217 113 --
NM_080759chr1332466 1632 581 ------
NM_080760chr1332466 1632 581 ------
NM_080764chr2242899 2443 2167 994 12021 --1308
NM_080832chrX61726 1555 1413 1234 577 201 --21359 1281 11436
NM_080867chr1464557 4109 3648 1557 1318 1122 14499 64412 4372 3878 1818 1659 939 11894
NM_080872chr873564 3535 3319 2932 2566 1081 953 --1652 --
NM_080874chr421821 26 31829 1744 276 ----
NM_080927chr362853 2811 2584 2211 1259 987 12637 12228 23233 740
NM_130387chr321156 135 --1328 --
NM_130391chr9103525 3463 3064 3015 2828 2757 2461 2362 679 669 ------
NM_130392chr9103525 3463 3064 3015 2828 2757 2461 2362 679 669 ------
NM_130393chr9103525 3463 3064 3015 2828 2757 2461 2362 679 669 ------
NM_130434chr151362 1181 11160 --
NM_130435chr1052730 2565 2040 652 91 2247 126 22941 522 --
NM_130439chr1031864 1780 1505 11479 ----
NM_130439chr1031864 1780 1505 11479 ----
NM_130469chr142977 695 ------
NM_130808chr31397 184 1332 --
NM_130809chr55928 913 623 437 71 --32745 984 954 32919 943 884
NM_130811chr203450 161 75 ------
NM_130838chr1531759 1429 465 --11223 --
NM_130839chr1531759 1429 465 --11223 --
NM_130846chr121894 ----1762
NM_130847chr1184754 4396 3600 1626 1586 1242 557 387 15839 --15158
NM_133264chr1783825 3428 2881 2518 2409 1284 307 286 12694 11162 --
NM_133265chrX93655 3270 3237 3127 2924 2849 2232 1206 1023 ------
NM_133329chr231702 667 158 1488 ----
NM_133370chr453562 2837 945 793 502 23705 1112 1784 --
NM_133372chr552849 2106 1796 681 628 22462 774 22406 1103 --
NM_133433chr53615 602 250 ------
NM_133445chr942919 898 823 420 23473 3377 11439 12422
NM_133468chr772341 1960 1945 1873 1748 455 375 ------
NM_133478chr241727 788 672 601 --11570 12441
NM_133486chrX------1425
NM_133493chr673914 3127 3113 3034 3003 1430 1140 34625 4251 3866 44352 3477 1649 1219 1295
NM_133496chr183494 3420 3318 2877 1817 1319 604 561 --64355 3807 2834 1195 1128 461 --
NM_133631chr311264 21138 244 11170 --
NM_133636chr4--174 ----
NM_133646chr285404 5205 5142 5109 436 318 160 63 14806 23584 1776 14263
NM_134265chr172347 80 1930 11155 11170
NM_134447chr192419 231 1182 2242 114 --
NM_138270chrX63009 2242 1321 1014 443 196 23265 2448 42405 775 568 139 1640
NM_138286chr1964102 2884 2659 1413 1110 354 13585 ----
NM_138288chr1452203 1731 1674 521 245 --1338 --
NM_138292chr1183549 3500 3270 3238 2330 1352 1268 1066 182 62956 2320 2295 751 725 690 13540
NM_138335chr42696 166 1651 1898 --
NM_138340chr182201 143 1229 ----
NM_138357chr1051840 1454 1188 636 625 --2110 48 11156
NM_138395chr221049 431 --148 --
NM_138423chr1552231 2053 1994 1812 58 22239 2000 11445 --
NM_138444chr1374640 4607 3419 1661 1358 1194 1182 23909 1911 --11655
NM_138459chr652977 1370 1125 565 147 ------
NM_138468chr2115741 5560 4790 4272 4098 1998 1895 1014 976 731 184 --26318 361 --
NM_138473chr12185087 5062 4660 4526 4501 4069 3948 3797 3629 3528 3466 2037 1939 1924 1647 506 388 358 11953 24877 4506 24155 530
NM_138494chr722580 377 1294 1812 --
NM_138558chr111041 --1750 --
NM_138559chr221322 302 1931 ----
NM_138565chr111163 ------
NM_138576chr1484551 4525 3503 1603 963 403 271 75 --44514 3974 3872 517 11734
NM_138609chr5----1475 --
NM_138610chr5----1475 --
NM_138621chr284133 4087 3892 2672 845 675 546 163 1471 33227 2718 1667 --
NM_138633chr631241 133 125 1374 11310 --
NM_138638chr14102445 2131 2047 1528 648 618 609 452 344 222 --2866 198 --
NM_138711chr3----1171 --
NM_138712chr3----1171 --
NM_138713chr16188049 7921 7591 6765 6461 6147 5996 5710 5635 5615 5515 5293 5038 2449 2188 1581 1221 723 26774 2531 47841 5118 867 370 2891 79
NM_138714chr16188049 7921 7591 6765 6461 6147 5996 5710 5635 5615 5515 5293 5038 2449 2188 1581 1221 723 26774 2531 47841 5118 867 370 2891 79
NM_138730chr61458 ------
NM_138731chr14103282 2827 1361 1250 1240 1074 969 737 343 277 --44255 3571 1650 843 --
NM_138735chr2150 11149 2971 77 --
NM_138766chr51136 ------
NM_138771chr741458 1196 1122 959 197 ----
NM_138782chr562309 2005 1560 763 666 58 ------
NM_138798chr2--135 ----
NM_138799chr211725 --41473 1467 1276 666 21481 385
NM_138821chr51136 ------
NM_138822chr51136 ------
NM_138927chr211883 --1809 1349
NM_138959chr1116628 6375 4795 4745 4457 2698 2054 1878 1419 503 323 14629 45951 5639 2352 1435 45547 5505 2546 526
NM_138967chr1582107 1903 1746 928 705 461 356 117 ------
NM_138970chr1432013 551 377 11937 ----
NM_138971chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138971chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138972chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138972chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138973chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138973chr1173337 3124 1517 1333 784 529 138 13532 21218 381 --
NM_138980chr41481 ------
NM_138981chr42612 530 ------
NM_138982chr41481 ------
NM_139012chr61460 1611 --11397
NM_139035chrX--1504 ----
NM_139046chr101197 ------
NM_139048chr3----21265 229 --
NM_139076chr451168 499 467 173 160 1945 ----
NM_139126chr62870 191 --1765 --
NM_139136chr122705 440 --1860 --
NM_139168chr541582 1450 1295 507 --21545 402 11524
NM_139207chr125898 720 409 315 67 --1419 --
NM_139242chr1561528 1434 507 455 390 73 --1569 --
NM_139244chr63951 359 143 ------
NM_139276chr1752242 1920 1769 208 145 12388 ----
NM_139312chr1031508 338 70 --11365 --
NM_139319chr1231478 1437 1340 --31770 149 65 135
NM_139321chr2043679 524 505 458 --43334 1702 625 202 --
NM_139323chr2041915 1630 822 765 ------
NM_144498chr2012189 --2586 479 --
NM_144563chr23809 780 714 ----183
NM_144563chr23809 780 714 ----183
NM_144571chr4186832 6188 6135 6071 6014 5660 5603 5473 4801 2046 1912 1235 1207 779 595 514 428 335 --36406 2105 1662 --
NM_144574chr14------2463 179
NM_144581chr14----1276 --
NM_144582chr242527 2415 2157 1015 22058 865 12315 1494
NM_144590chr1062989 2889 2381 2267 2167 56 22699 2280 2768 449 22875 2110
NM_144595chr133274 181 59 1808 ----
NM_144599chr1585463 2209 1962 1736 1269 664 372 210 --35250 3940 382 --
NM_144600chr1651686 1511 1265 1068 601 --1578 --
NM_144609chr1721337 529 --11281 --
NM_144610chr172457 393 ------
NM_144628chr20103059 3042 2230 2207 2149 1202 1005 731 669 407 --32216 863 148 --
NM_144632chr262382 1855 1693 618 195 54 --1588 --
NM_144642chr32252 232 ------
NM_144643chr41407 ------
NM_144664chr1132566 682 671 11826 31959 1881 471 --
NM_144665chr111232 ------
NM_144722chr53303 167 134 ------
NM_144723chr53760 314 158 ------
NM_144732chr193986 446 272 ------
NM_144766chr12558 503 ------
NM_144767chr1554233 4059 3739 1744 365 13341 44600 3744 3224 1556 --
NM_144775chr17104808 4140 3916 3803 3112 1933 1876 1844 655 81 13480 33881 3509 3484 --
NM_144777chr13------166
NM_144778chr1341909 905 640 325 --21832 277 22678 1708
NM_144949chr252105 948 478 231 150 12060 ----
NM_144963chr882517 2091 1003 970 921 388 381 37 1267 21093 224 --
NM_144973chr12145136 4972 4559 4383 4075 3742 2132 1977 1380 862 791 530 501 234 13877 14099 14633
NM_144982chr122803 776 ------
NM_145011chr1042179 1997 1608 275 ------
NM_145012chr101765 ----11009
NM_145037chr35605 542 529 385 313 --11353 --
NM_145055chr1893384 3127 2392 1383 1190 1015 563 297 266 --23082 2369 --
NM_145062chr6144 ------
NM_145112chr1421005 449 ------
NM_145117chr1182843 2825 2774 2214 1334 860 657 219 1232 52858 2642 1151 877 248 12570
NM_145165chr1442612 837 382 125 11179 11183 12467
NM_145203chr132883 857 --1618 --
NM_145243chr11202 --165 --
NM_145251chr1411558 ----2635 349
NM_145259chr2187008 6513 6427 6068 5418 5184 4825 4762 4461 2360 1911 1792 1604 1268 812 776 423 324 25907 5635 35911 1337 1257 --
NM_145274chr175934 355 317 252 65 ------
NM_145301chr172536 481 --1598 --
NM_145307chr1054493 4434 3091 2858 1876 44387 4262 3053 1077 34138 3675 3057 --
NM_145313chr101300 21568 417 ----
NM_145320chr773484 3105 2931 2219 1146 468 461 21059 342 150 1662
NM_145321chr773484 3105 2931 2219 1146 468 461 21059 342 150 1662
NM_145322chr773484 3105 2931 2219 1146 468 461 21059 342 150 1662
NM_145341chr1051880 1274 1246 277 253 ------
NM_145686chr252718 2156 1150 962 717 ------
NM_145687chr252718 2156 1150 962 717 ------
NM_145690chr8101819 1722 1675 1521 1430 737 615 273 199 116 1417 11480 --
NM_145698chr1021631 310 1471 21658 319 --
NM_145714chr16----1379 --
NM_145733chr221480 ------
NM_145735chr1372672 2378 2017 1991 1955 408 140 --11997 12105
NM_145753chr321426 1271 ----1503
NM_145793chr104771 751 376 54 ------
NM_145808chr773049 2969 2738 2581 2529 1926 990 2466 108 11999 1873
NM_145810chr241105 951 324 26 ------
NM_145891chr1621225 1131 ----1152
NM_145892chr1621225 1131 ----1152
NM_145893chr1621347 1253 ----1274
NM_145899chr631321 1058 823 ------
NM_145901chr631321 1058 823 ------
NM_145902chr631321 1058 823 ------
NM_145903chr631321 1058 823 ------
NM_145904chr631321 1058 823 ------
NM_145905chr631321 1058 823 ------
NM_147150chr973469 3446 3213 3012 2951 2929 944 11578 --12599
NM_147156chr1051487 1084 1049 380 135 11477 31336 113 99 --
NM_147175chrX2662 620 --2148 136 --
NM_147188chr154518 465 107 45 --21329 937 --
NM_148174chr811775 1889 12221 --
NM_148414chr16----1462 --
NM_148415chr16----1402 --
NM_148416chr16----1379 --
NM_148571chr171385 --2705 570 --
NM_148894chr42445 62 --1223 1480
NM_148921chr1751664 1528 650 599 326 1845 1966 --
NM_148923chr182244 196 1213 ----
NM_148955chr15106155 5930 5028 2615 2497 2075 1827 1629 192 41 16041 26520 2144 22002 1872
NM_148957chr1362676 2521 1696 895 565 403 22494 908 11757 1457
NM_148976chr11180 ------
NM_152221chr2231200 1084 902 --11141 --
NM_152233chr1431383 1217 36 --2399 336 1589
NM_152261chr1262303 1884 940 863 405 212 1601 1102 --
NM_152263chr175912 5409 5250 1872 1561 1410 759 24469 1345 25917 710 35480 5451 4578
NM_152265chr161453 1245 634 605 556 454 --21321 408 1621
NM_152275chr23886 732 61 --21976 817 --
NM_152280chr133069 844 719 --13483 1229
NM_152289chr1981563 1427 1410 1069 546 536 163 68 11660 ----
NM_152291chr41348 --21042 313 --
NM_152305chr362061 1703 795 676 262 91 --11485 --
NM_152330chr1452500 1967 977 92 80 11868 22694 2686 11777
NM_152332chr1472524 2385 2209 694 596 457 342 --11153 --
NM_152344chr1741506 1306 312 206 --1374 --
NM_152349chr17------1710
NM_152371chr121231 702 ------
NM_152387chr261065 1038 999 982 740 338 ------
NM_152388chr243872 3354 2513 584 23161 1511 --1295
NM_152392chr2----128 --
NM_152406chr511450 --21478 292 --
NM_152409chr593294 2978 2744 2469 2223 2200 673 435 287 33193 3183 2986 53445 3163 2794 856 638 --
NM_152424chrX84679 4241 3466 3309 3115 2940 535 160 13658 11341 --
NM_152437chr1231990 497 338 --12433 --
NM_152441chr122272 153 ------
NM_152450chr15--11324 3512 268 153 --
NM_152470chr1833950 3253 1051 13811 32949 719 81 --
NM_152487chr131326 498 84 11360 --1510
NM_152493chr1------11431
NM_152519chr252174 2023 755 732 233 12220 11617 1410
NM_152520chr241243 941 483 222 1498 ----
NM_152522chr22251 227 --3858 349 265 1879
NM_152529chr253692 1623 1386 868 382 33403 2952 1781 12841 14402
NM_152538chr381860 1758 1694 1506 1426 673 616 145 --41833 1725 1253 1156 21685 1372
NM_152549chr51448 ------
NM_152556chr731847 739 262 21887 1015 31689 758 457 1232
NM_152605chr1971302 1268 1111 914 896 237 64 1501 ----
NM_152608chr142198 2182 708 565 12039 12116 22044 983
NM_152609chr141163 1104 973 327 ----1435
NM_152622chr552912 2753 2615 2338 140 23482 720 12269 --
NM_152624chr586828 6320 6256 2439 1907 1797 1468 755 16247 76428 5391 4892 2333 2035 205 78 26857 6797
NM_152629chr942532 927 794 282 --23199 2602 --
NM_152630chrX21202 1085 --21390 994 --
NM_152638chr1241228 1146 1002 876 1900 ----
NM_152641chr1261154 642 553 386 249 116 11164 12675 12899
NM_152653chr32642 200 ------
NM_152665chr121279 198 1983 21242 29 --
NM_152666chr12642 203 1161 ----
NM_152678chr372677 2620 2461 2146 1914 468 405 --22085 175 --
NM_152682chr451744 1503 593 524 478 1235 --21662 199
NM_152688chr61742 ------
NM_152695chrX51824 1623 803 524 179 12004 ----
NM_152699chr373785 3572 3551 3034 885 127 56 ----1489
NM_152704chr131321 --2326 265 --
NM_152707chr103831 178 83 1201 ----
NM_152713chr11----1221 --
NM_152716chr1171556 1517 1508 1462 609 558 251 --31578 1278 222 --
NM_152723chr1151134 1112 297 256 98 2228 134 1993 --
NM_152725chr10----149 1102
NM_152727chr161258 ------
NM_152734chr694045 2132 765 720 454 436 326 113 105 14223 35494 4147 824 13823
NM_152736chr61686 ------
NM_152739chr731088 766 349 ------
NM_152744chr753245 2754 1260 942 137 --22608 888 --
NM_152754chr772956 2748 2732 1489 1163 436 36 1745 152 12610
NM_152756chr593841 3289 3153 3017 2810 1526 897 406 109 13514 33786 1296 1130 --
NM_152758chr842845 2104 1170 997 12483 11117 --
NM_152765chr872390 2286 1575 871 716 437 263 --22372 724 --
NM_152774chr772552 2340 2144 1868 457 146 99 12465 ----
NM_152787chrX113537 3511 3113 2567 2523 1512 1081 678 642 410 349 --23704 3459 --
NM_152789chr771484 1400 536 470 461 284 176 ------
NM_152793chr794689 4623 3841 1433 1198 647 604 432 141 --35006 944 794 --
NM_152826chr15106155 5930 5028 2615 2497 2075 1827 1629 192 41 16041 26520 2144 22002 1872
NM_152835chr172637 2399 2076 2061 1149 1021 667 --1559 --
NM_152836chr861714 1358 1161 747 722 297 21671 664 21856 1846 --
NM_152837chr861714 1358 1161 747 722 297 21671 664 21856 1846 --
NM_152838chr2043492 2211 754 518 --22440 1019 11293
NM_152878chr22------11175
NM_152890chr121259 504 21075 288 ----
NM_152902chr151827 1449 686 371 327 --31877 554 91 --
NM_152903chr1342690 2642 2108 399 177 22208 494 --
NM_152919chr1973091 2878 2367 1492 801 539 247 ------
NM_152924chr1586909 6040 5784 4370 2605 2059 1807 1532 11542 66820 6760 2672 1994 1253 1144 --
NM_152989chr122685 549 1578 1766 1108
NM_152991chr113596 538 175 ------
NM_152996chr131877 626 579 1490 1309 --
NM_152999chr784808 3845 3437 3409 3367 1855 1822 1310 34956 1510 951 34853 3954 1914 1267
NM_153013chr572450 2262 1959 1647 855 268 49 --1933 --
NM_153020chr621388 343 11086 --11615
NM_153035chr141190 1153 1102 536 ------
NM_153042chr641712 620 487 438 11630 11728 --
NM_153050chr2254632 3760 3492 215 193 23534 2006 34861 3479 755 --
NM_153051chr2254632 3760 3492 215 193 23534 2006 34861 3479 755 --