TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5700
miRNA Sequence: UAAUGCAUUAAAUUAUUGAAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511217 ------
NM_000021chr1411066 ------
NM_000038chr531745 1685 593 --1254 --
NM_000051chr1173322 2748 2300 1001 849 781 717 1662 --13535
NM_000052chrX103232 3141 3000 2832 2686 2676 2571 2372 1312 135 ------
NM_000055chr31335 ------
NM_000067chr81670 ------
NM_000081chr161809 1782 1450 1402 1251 1226 ------
NM_000084chrX46988 5160 4276 1031 161 25913 1042 --
NM_000092chr254065 3996 3592 1758 710 14559 14350 --
NM_000093chr92593 409 ------
NM_000096chr33678 286 60 --2863 773 --
NM_000098chr11563 ------
NM_000109chrX42596 2374 2270 2128 22644 2013 ----
NM_000110chr131172 994 415 11194 ----
NM_000112chr595343 5020 4826 3809 1913 1681 1386 1373 333 24594 1039 25430 260 --
NM_000125chr6114146 3956 3674 2609 999 950 508 493 325 105 44 ------
NM_000129chr6--11107 21448 1148 --
NM_000138chr1561768 1043 806 751 706 261 32120 2033 143 ----
NM_000141chr1051089 454 413 390 297 ------
NM_000161chr1461954 1944 1766 673 304 23 --11903 --
NM_000163chr521679 317 1766 ----
NM_000167chrX1721 ------
NM_000189chr24896 777 388 223 --1874 --
NM_000194chrX3507 164 113 ------
NM_000214chr2061453 1419 1219 689 495 420 ------
NM_000216chrX93940 3471 1322 1302 1264 1242 1232 1016 270 12973 --12790
NM_000217chr12114703 4515 4445 1534 1494 1156 1051 1042 983 464 153 --1145 1475
NM_000219chr2141932 1747 904 271 --22510 2486 --
NM_000240chrX31502 1477 662 --11533 --
NM_000242chr1032281 2031 1733 --22517 1030 --
NM_000248chr343029 1086 987 22 1969 2557 471 --
NM_000252chrX31343 1017 438 --1971 11536
NM_000253chr42372 109 ------
NM_000259chr1586366 5919 4832 4802 4779 4737 3955 985 35938 5356 2133 35812 5645 2169 1881
NM_000264chr92515 297 1152 11289 13189
NM_000267chr1723252 1190 43225 3124 1224 981 11100 --
NM_000280chr113992 861 140 2833 256 ----
NM_000297chr431710 1679 252 ------
NM_000304chr1741077 1023 1002 162 ----11116
NM_000314chr1042938 715 487 217 --22544 492 --
NM_000321chr1341726 1673 1303 401 11259 ----
NM_000328chrX245 36 --1382 --
NM_000329chr11824 ------
NM_000332chr6106892 6839 6464 6443 6042 4858 2389 2006 901 169 16029 ----
NM_000340chr331421 543 513 ------
NM_000346chr1722024 1332 1643 ----
NM_000362chr2233581 2466 270 --13507 --
NM_000373chr31697 ------
NM_000390chrX32925 2839 494 11033 2385 297 --
NM_000408chr283441 3013 2826 2682 1241 381 187 154 13403 23169 3145 --
NM_000428chr1452665 2640 2512 2327 2281 ------
NM_000430chr1753680 2810 1062 783 163 1907 ----
NM_000436chr541555 1424 284 89 --1263 11633
NM_000439chr522460 2036 1303 12577 --
NM_000441chr71819 12168 32133 466 60 --
NM_000448chr1173127 2544 2187 1091 657 413 57 12764 32915 2489 579 --
NM_000449chr121263 234 ------
NM_000452chr1361445 1382 765 565 222 205 --22061 135 --
NM_000454chr212227 67 ------
NM_000459chr92311 153 --1828 --
NM_000461chr353994 3822 2950 1418 186 --14207 13869
NM_000462chr151502 11337 11359 --
NM_000489chrX32705 2657 2438 ----11249
NM_000492chr741170 1004 969 462 11500 ----
NM_000523chr2----181 --
NM_000531chrX1302 ------
NM_000538chr1351143 674 167 135 127 ------
NM_000553chr81599 140 ----
NM_000555chrX127211 6903 6664 6644 6580 5881 2817 2517 1700 1680 1486 973 21206 304 16317 17470
NM_000574chr111326 --1855 --
NM_000586chr4182 ------
NM_000594chr6----1509 --
NM_000596chr7296 90 ------
NM_000598chr71625 --11462 --
NM_000599chr221434 760 11044 34640 1691 666 --
NM_000600chr72384 372 ------
NM_000609chr1053120 2974 2967 876 315 --12193 --
NM_000610chr1133001 1215 754 --22340 315 --
NM_000615chr1133004 1954 535 --12658 --
NM_000618chr1276562 6441 5608 5034 4555 1617 313 --36286 6272 624 --
NM_000618chr1276562 6441 5608 5034 4555 1617 313 --36286 6272 624 --
NM_000619chr12------1162
NM_000627chr2--1288 --167
NM_000633chr18105002 4863 4523 4121 2030 1850 1821 1224 604 494 21745 1725 166 --
NM_000685chr32807 801 1211 --1123
NM_000685chr32807 801 1211 --1123
NM_000719chr1296667 6052 5954 2546 1724 1544 1463 1377 1208 1892 ----
NM_000721chr142224 1018 504 24 ----1125
NM_000724chr101331 1127 ----
NM_000726chr211023 ------
NM_000767chr192521 392 ------
NM_000780chr8--11014 2475 86 --
NM_000783chr10195 ------
NM_000788chr411464 1971 21203 1009 --
NM_000791chr531042 1035 544 --22633 57 22622 2587
NM_000793chr14105132 5010 3550 3444 1690 1208 997 986 313 286 14670 ----
NM_000800chr521597 1519 11363 ----
NM_000806chr531959 766 517 ----1592
NM_000807chr42113 30 --1158 --
NM_000809chr4128641 8203 8067 7106 6883 6842 3621 2938 2913 1919 852 816 12970 29281 7293 --
NM_000811chr51612 ------
NM_000813chr584005 3423 1903 1831 1800 1342 1285 673 --23472 1529 --
NM_000814chr1563851 3563 1033 1023 292 187 1411 ----
NM_000817chr251207 864 820 767 255 ------
NM_000824chr44365 206 198 107 --1754 --
NM_000826chr482272 2238 1884 1854 1760 1630 775 108 ------
NM_000838chr662692 2432 2182 1062 686 348 12119 ----
NM_000839chr3--1470 ----
NM_000840chr7--1482 ----
NM_000844chr341099 963 793 743 --1757 --
NM_000857chr42419 413 ------
NM_000859chr521508 671 11385 187 --
NM_000861chr332651 1720 1682 --12390 12328
NM_000868chrX72468 1953 1944 1822 1693 1010 314 11980 22053 1903 12456
NM_000872chr1011033 --1373 --
NM_000875chr1536085 5662 2768 --26744 4859 --
NM_000880chr82835 148 1157 --1940
NM_000882chr31410 ------
NM_000891chr1732821 730 416 --13246 --
NM_000899chr1244218 2980 2759 1185 11759 13011 --
NM_000901chr451727 1691 938 916 722 12278 ----
NM_000912chr823476 2198 --43518 2701 2603 503 --
NM_000919chr5185 ------
NM_000943chr51118 ------
NM_000944chr471937 1912 1861 1530 932 845 327 11944 ----
NM_000950chrX43241 1174 589 301 --13530 --
NM_000959chr132962 2909 486 --21557 1296 --
NM_000963chr122459 372 21917 467 --1388
NM_000965chr31144 ------
NM_000990chr1193833 3662 3422 2847 2823 1339 885 601 94 --1260 --
NM_001001132chr2111020 --1488 --
NM_001001323chr1262756 2645 2528 2507 834 319 1577 ----
NM_001001331chr322120 1707 ------
NM_001001389chr1133001 1215 754 --22340 315 --
NM_001001390chr1133001 1215 754 --22340 315 --
NM_001001391chr1133001 1215 754 --22340 315 --
NM_001001392chr1123047 800 --22386 361 --
NM_001001395chr1262671 1777 1007 429 381 373 --21842 301 --
NM_001001396chr174278 3992 3656 3235 2824 1611 728 --24320 3769 --
NM_001001419chr585069 4914 4819 3225 764 324 173 145 24324 952 --25155 835
NM_001001420chr585069 4914 4819 3225 764 324 173 145 24324 952 --25155 835
NM_001001436chr161246 ------
NM_001001481chr872793 2623 2590 562 414 150 135 --32556 1392 306 --
NM_001001484chr1082398 2227 2161 2076 2054 1779 904 837 11704 11631 --
NM_001001549chr782310 2145 2039 1785 927 427 385 68 --12069 --
NM_001001550chr782310 2145 2039 1785 927 427 385 68 --12069 --
NM_001001555chr782310 2145 2039 1785 927 427 385 68 --12069 --
NM_001001556chr1511083 198 11451 1378
NM_001001664chr2114107 4080 3890 3635 3500 2975 1411 1356 1152 447 142 --22529 714 --
NM_001001668chr1944038 3057 2818 1474 --13872 12878
NM_001001669chr532424 2397 2202 --12322 --
NM_001001787chr12486 52 ------
NM_001001790chr91372 ------
NM_001001852chr221671 ------
NM_001001890chr2183813 3516 3509 892 772 742 531 522 ------
NM_001001933chr14408 236 142 56 ------
NM_001001971chr1031242 1117 368 ------
NM_001001974chr1042271 1742 1605 273 ----11706
NM_001001995chrX41749 1294 1249 143 --11367 --
NM_001002259chr121237 1267 ----
NM_001002860chr14114349 4131 3536 2983 1715 1614 1361 420 391 373 322 13464 1443 --
NM_001002909chr1712205 ------
NM_001003407chr10104664 4447 4015 3737 3341 3186 1503 1210 282 265 ------
NM_001003408chr10104664 4447 4015 3737 3341 3186 1503 1210 282 265 ------
NM_001003652chr18128607 8117 8036 7914 6538 2773 1966 1701 1238 956 807 318 35880 2557 1130 ----
NM_001003674chr1856784 5950 5162 5070 805 --2939 322 14633
NM_001003675chr1856784 5950 5162 5070 805 --2939 322 14633
NM_001003681chr2221938 1932 ------
NM_001003688chr411138 ------
NM_001003698chr62356 266 11880 ----
NM_001003699chr62356 266 11880 ----
NM_001003712chr1283650 3396 3136 2649 2499 1614 324 277 11032 ----
NM_001003760chr6103669 3625 3068 2865 2393 2249 801 510 312 115 ----12849
NM_001003800chr943550 3492 1382 610 23506 2388 ----
NM_001003810chr4----1648 --
NM_001004023chr12187 27 ----1208
NM_001004065chr923489 3320 31337 995 473 13677 --
NM_001004106chr52268 247 --1255 --
NM_001004317chr654041 3737 3575 1553 228 12750 44381 3384 3277 2858 --
NM_001004329chr1231138 361 118 11253 --21071 329
NM_001004342chr165987 5965 5671 5652 3946 1017 26047 5691 24629 4469 --
NM_001004346chr41840 --2418 162 --
NM_001004360chr241497 1285 670 273 1256 ----
NM_001004419chr1244483 3280 1646 911 --14443 --
NM_001004441chr5--21337 575 ----
NM_001004722chr241115 897 437 58 --1875 --
NM_001005335chr19195 ------
NM_001005360chr191817 ------
NM_001005361chr191817 ------
NM_001005362chr191817 ------
NM_001005375chrY6723 601 577 526 377 50 1214 ----
NM_001005404chr1784473 4438 4331 3366 3246 3040 1069 537 13858 ----
NM_001005473chr576630 4026 2577 2400 2361 734 569 2444 51 ----
NM_001005474chr32589 60 --11366 --
NM_001005502chr1274986 4529 4338 4250 1435 1252 1168 12020 ----
NM_001005609chrX33785 3113 95 ------
NM_001005743chr14121 1417 ----
NM_001005744chr14121 1417 ----
NM_001005745chr14121 1417 ----
NM_001005746chr211023 ------
NM_001005747chr211023 ------
NM_001005910chr31551 ------
NM_001005911chr31551 ------
NM_001006600chr541911 807 693 490 --1818 --
NM_001006610chr163908 310 221 1251 ----
NM_001006612chrX3398 157 123 ------
NM_001006613chrX3398 157 123 ------
NM_001006614chrX3398 157 123 ------
NM_001006634chr161504 ----1450
NM_001006635chr23241 136 127 --1246 --
NM_001006681chrX142 ------
NM_001006682chrX142 ------
NM_001006683chrX142 ------
NM_001006684chrX165 ------
NM_001006945chr11475 ----1515
NM_001006946chr211431 ------
NM_001007023chr14105132 5010 3550 3444 1690 1208 997 986 313 286 14670 ----
NM_001007027chr111104 ------
NM_001007067chr811093 166 ----
NM_001007068chr811093 166 ----
NM_001007069chr811093 166 ----
NM_001007070chr811093 166 ----
NM_001007098chr1178 ------
NM_001007099chr11788 2642 220 ----
NM_001007100chr11788 2642 220 ----
NM_001007231chr22580 217 ------
NM_001007237chr152788 2622 2394 2387 97 12742 ----
NM_001007245chr73637 428 204 --159 --
NM_001007246chr2141806 1306 566 125 2180 22 ----
NM_001007257chr111223 11162 11516 11450
NM_001007277chr11------11007
NM_001007466chr685092 4831 4710 4012 3555 1958 1690 473 25049 4682 24999 4659 34727 1088 464
NM_001007565chr32389 79 ------
NM_001008222chrX1571 ----11296
NM_001008225chr72626 94 ----1551
NM_001008239chr1853864 3354 992 488 358 --12952 --
NM_001008388chr451032 420 317 204 125 ------
NM_001008391chr11182 1142 1235 --
NM_001008392chr323148 703 --22945 215 22924 2578
NM_001008405chr72674 245 21844 1724 ----
NM_001008408chr786172 6069 5010 4570 4380 2070 1870 284 --55158 5143 5050 5003 1834 --
NM_001008495chr842081 354 276 224 195 1554 --
NM_001008539chr875394 5138 4157 1610 271 259 247 --14568 14168
NM_001008564chr1342144 1787 489 449 --11908 --
NM_001008660chr1151315 1273 545 381 337 --11395 1432
NM_001008661chr11364 ------
NM_001008662chr11364 ------
NM_001008707chr1421381 546 ----11355
NM_001008726chr1421659 339 ----1450
NM_001008738chr511068 12915 170 --
NM_001008801chr1932114 2037 292 ------
NM_001008925chr443291 3065 3031 1405 1475 --1275
NM_001008938chr113428 414 109 1477 ----
NM_001009552chr82434 240 --164 --
NM_001009554chr464739 4555 4481 4087 359 24 ------
NM_001009554chr464739 4555 4481 4087 359 24 ------
NM_001009571chr731291 1228 118 11155 ----
NM_001009881chr11612 1209 ----
NM_001009882chr11612 1209 ----
NM_001009899chr3166554 6546 6327 5808 5091 5076 4613 4532 4386 2499 1810 913 803 764 598 60 16409 26403 49 --
NM_001009923chr201235 ------
NM_001009955chr1----1238 --
NM_001009955chr1----1238 --
NM_001009958chr71188 ------
NM_001009960chr782803 2723 2711 2686 2377 2235 432 82 --32808 785 251 --
NM_001009993chr264392 3753 1511 1385 425 293 ----14552
NM_001010000chr1863527 3519 2223 1053 604 580 ----132
NM_001010853chr653185 3174 2521 680 368 ------
NM_001010861chr152784 2659 978 679 29 --1966 --
NM_001010867chr165429 5350 4389 2559 2152 494 --16701 --
NM_001010888chrX104617 4525 4321 4200 4143 3383 1566 976 862 584 ------
NM_001010891chr5186660 6649 6484 6462 6158 6119 5757 5253 5011 2410 1845 1694 1384 969 950 902 186 168 1774 ----
NM_001010922chr122703 657 12621 1870 12675
NM_001010942chr124872 863 344 299 11270 --11081
NM_001010984chr132292 953 432 22248 1790 ----
NM_001010986chrX42360 916 909 480 11688 ----
NM_001010989chr161482 ------
NM_001010990chr161482 ------
NM_001011513chr494148 3986 3456 3091 3042 2699 1641 423 215 13405 13965 --
NM_001011515chr4--2969 84 11002 --
NM_001011516chr4--2969 84 11002 --
NM_001011537chr362276 2255 2021 1748 1469 662 11975 --1486
NM_001011553chr75977 964 956 943 933 --1805 --
NM_001011666chr796556 6303 5633 4705 4241 4170 3983 2593 50 12499 ----
NM_001011708chr252081 1863 448 368 299 --12528 --
NM_001012267chr911501 ------
NM_001012393chr1145120 1573 1023 662 --14074 13962
NM_001012398chr1631023 296 132 ----1183
NM_001012415chr91211 ------
NM_001012418chr694251 4238 4178 4066 3457 3262 2821 1554 664 1332 1407 14259
NM_001012420chr1562304 2061 1902 588 378 258 12200 1993 11912
NM_001012423chr1562304 2061 1902 588 378 258 12200 1993 11912
NM_001012478chr191640 ------
NM_001012716chr181271 ----190
NM_001012732chr411230 ------
NM_001012751chr101461 1656 31519 476 176 --
NM_001012755chrX95054 4934 4334 4171 4058 3645 3166 1567 1354 --11626 --
NM_001012756chr1972961 2641 2507 1092 468 317 64 ----1296
NM_001012761chr542256 318 107 96 1682 12329 --
NM_001012968chrX82783 2412 2388 2296 1811 1033 981 861 ------
NM_001012977chrX51392 1377 556 114 105 ------
NM_001013031chr1083507 3482 3392 3258 2940 2862 1053 156 --23228 320 --
NM_001013398chr71625 --11462 --
NM_001013399chr61449 ------
NM_001013406chr751168 1138 1118 664 421 ------
NM_001013437chr18------1125
NM_001013620chr12117447 6732 5882 2696 2187 1464 1146 1005 671 553 298 1746 47137 6070 5511 5134 28347 3273
NM_001014380chr13105869 5796 5719 5611 5335 4697 1981 1963 1385 388 2722 232 15412 --
NM_001014434chr12725 221 ------
NM_001014797chr10138229 7836 7213 7094 5441 5084 5035 2137 1933 695 683 604 360 --58255 5231 2416 613 306 --
NM_001014812chr151299 ------
NM_001014972chr2159 ------
NM_001015508chr83587 523 486 ------
NM_001015877chrX43016 2417 2303 1948 --11168 12979
NM_001015881chrX11219 ------
NM_001015885chr201331 ------
NM_001017369chr411084 ------
NM_001017371chr251254 1150 1104 438 297 11367 ----
NM_001017415chr11760 --1584 1210
NM_001017416chr11760 --1584 1210
NM_001017440chr787822 6340 5729 5254 1583 1152 1050 48 --12572 --
NM_001017923chr143428 262 124 ------
NM_001017930chrX2236 138 --21301 1189 1959
NM_001017969chr93664 574 150 --1456 --
NM_001017999chr131622 745 428 ------
NM_001017999chr131622 745 428 ------
NM_001018000chr131622 745 428 ------
NM_001018000chr131622 745 428 ------
NM_001018001chr131622 745 428 ------
NM_001018037chr961368 1221 1150 579 245 111 ------
NM_001018038chr92218 113 ------
NM_001018053chr12724 709 --31963 1897 1650 --
NM_001018057chr1131327 1311 150 31452 974 514 11237 --
NM_001018067chr144797 4516 280 206 25163 2032 4527 300 259 218 15116
NM_001018068chr144797 4516 280 206 25163 2032 4527 300 259 218 15116
NM_001018069chr144797 4516 280 206 25163 2032 4527 300 259 218 15116
NM_001018090chr1551916 831 516 462 240 --12352 --
NM_001018091chr1552026 941 626 572 350 --12462 --
NM_001018100chr152799 664 --1301 --
NM_001018102chr1551916 831 516 462 240 --12352 --
NM_001020825chr51252 ------
NM_001023567chr1552234 1709 1565 591 258 --21581 1001 11933
NM_001023587chr311080 ------
NM_001024024chr1431008 998 820 --1957 --
NM_001024070chr1431004 994 816 --1953 --
NM_001024071chr143976 966 788 --1925 --
NM_001024647chr12157673 7360 7010 6238 4740 4670 2875 2510 2419 2079 1316 1278 993 809 656 --21257 631 1338
NM_001024649chr542927 2914 1864 600 22858 612 1926 1347
NM_001024808chr122453 304 ------
NM_001024847chr311591 --12447 12375
NM_001024855chr321748 171 --11816 --
NM_001024912chr1951888 1818 1594 1397 1340 --1169 --
NM_001024948chr142666 2353 2337 1411 22969 2799 ----
NM_001025068chr331802 1527 244 21725 1630 11786 --
NM_001025069chr331802 1527 244 21725 1630 11786 --
NM_001025076chr1065631 5063 4503 3974 3889 262 12407 11383 13771
NM_001025077chr1086989 6421 5861 5332 5247 5062 1620 242 11316 34805 4721 2741 15129
NM_001025079chr363270 3189 2776 2615 1304 1281 11550 24065 897 13856
NM_001025108chr244085 3704 3174 2988 13640 31122 872 675 1543
NM_001025266chr343886 1968 1753 1159 ------
NM_001025356chr1282984 2942 2849 2156 2131 2085 1032 521 ----1134
NM_001025366chr631608 1575 1343 11902 1479 --
NM_001025366chr631608 1575 1343 11902 1479 --
NM_001025367chr631608 1575 1343 11902 1479 --
NM_001025367chr631608 1575 1343 11902 1479 --
NM_001025368chr631608 1575 1343 11902 1479 --
NM_001025368chr631608 1575 1343 11902 1479 --
NM_001025369chr631624 1591 1359 11918 1495 --
NM_001025369chr631624 1591 1359 11918 1495 --
NM_001025370chr631608 1575 1343 11902 1479 --
NM_001025370chr631608 1575 1343 11902 1479 --
NM_001025595chr431666 1023 243 ----1446
NM_001025596chr112428 182 ------
NM_001025603chr121263 234 ------
NM_001025780chr921085 409 ------
NM_001029858chr642255 473 243 66 1302 ----
NM_001029863chr643235 2475 2204 941 ------
NM_001029875chr532567 678 250 ----1326
NM_001029884chr662681 2552 2484 2151 646 81 12159 ----
NM_001029955chr453361 3008 2616 2128 1375 13452 ----
NM_001030006chr172874 76 ------
NM_001030007chr1673329 3161 2900 1569 1477 622 592 --13233 13972
NM_001030055chr1474203 3370 3149 1569 1103 766 57 34495 3739 1397 14592 13316
NM_001031623chr631278 569 160 --2229 107 --
NM_001031679chr1233141 2920 1006 --23316 167 --
NM_001031684chr22483 383 11484 11278 1175
NM_001031695chr2244628 2098 376 232 25342 4686 3858 283 183 --
NM_001031700chr452519 2347 1969 868 169 --143 --
NM_001031712chr6175 ------
NM_001031732chr463701 3547 2968 1463 1155 49 21145 934 ----
NM_001031804chr1644180 1739 1519 1001 --12705 1890
NM_001031812chr572246 1946 1542 1502 824 784 504 --11603 --
NM_001032221chr931429 223 137 11330 1190 --
NM_001032279chr111402 ------
NM_001032280chr641598 1327 1283 1247 --21630 1068 --
NM_001032283chr124899 761 314 298 ------
NM_001032284chr124899 761 314 298 ------
NM_001032296chr1372869 2749 2714 2610 627 474 320 12384 ----
NM_001032363chr121853 173 1572 1143 --
NM_001032363chr121853 173 1572 1143 --
NM_001032380chr1091879 1771 1688 1634 611 367 238 220 143 1394 11546 --
NM_001032393chrX2722 476 1208 1744 --
NM_001032999chr2045290 4315 1534 82 --15340 15223
NM_001033002chr171101 ------
NM_001033045chr274252 3604 1731 1365 905 782 179 23881 1045 --11617
NM_001033057chr381936 1889 1828 1406 1385 1377 219 190 --1140 --
NM_001033059chr62628 252 --12041 1164
NM_001033081chr131869 1746 163 --1130 --
NM_001033082chr131869 1746 163 --1130 --
NM_001033117chr353993 1391 433 383 369 --11814 --
NM_001033557chr221400 1305 ----11342
NM_001033561chr172904 631 1561 ----
NM_001033578chr842038 1639 1589 88 --1140 --
NM_001033756chr631542 1509 1277 11836 1413 --
NM_001033756chr631542 1509 1277 11836 1413 --
NM_001033925chr1031356 735 505 --31780 1577 1533 --
NM_001034954chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_001034955chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_001034956chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_001034957chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_001035003chr421432 409 --1362 --
NM_001035004chr421432 409 --1362 --
NM_001035260chr1041655 1622 1191 268 ------
NM_001037132chr772068 870 738 729 497 308 194 ------
NM_001037133chr772068 870 738 729 497 308 194 ------
NM_001037174chr231425 619 465 11840 ----
NM_001037317chr152784 2659 978 679 29 --1966 --
NM_001037339chr141813 1766 1748 1737 --11852 --
NM_001037340chr141813 1766 1748 1737 --11852 --
NM_001037341chr141813 1766 1748 1737 --11852 --
NM_001037341chr141813 1766 1748 1737 --11852 --
NM_001037494chr121203 ------
NM_001037495chr121203 ------
NM_001037553chr2165089 4592 4169 4153 3374 1368 14114 --14432
NM_001037954chr1133392 2431 355 ----21240 1010
NM_001038702chr562387 763 665 357 131 112 ------
NM_001038707chr112252 --11966 --
NM_001038707chr112252 --11966 --
NM_001039199chr2075024 4978 4170 3339 1862 1697 1063 --11799 --
NM_001039465chr14--1192 ----
NM_001039577chr153571 1731 1722 605 425 14326 ----
NM_001039580chr484615 4559 3965 3856 3435 3138 1649 488 24103 1899 21417 1131 21034 745
NM_001039585chr143219 3166 743 155 --11553 --
NM_001039590chrX73794 3771 2771 2749 1572 1300 969 1738 ----
NM_001039591chrX73794 3771 2771 2749 1572 1300 969 1738 ----
NM_001039618chr1164322 3867 3668 1663 1035 898 34274 2250 1007 23785 467 --
NM_001039649chr131234 ------
NM_001039693chr264113 3788 2684 1310 888 448 12780 --14138
NM_001039709chr2045290 4315 1534 82 --15340 15223
NM_001039762chr101562 --11552 --
NM_001039802chr11211 --11391 21407 1344
NM_001039840chrX115887 5879 2070 1818 1784 1380 942 819 631 235 227 14863 ----
NM_001039937chr1363984 3974 3431 3023 688 79 --31470 468 97 --
NM_001040001chr631982 1934 27 11886 11972 --
NM_001040057chr72436 92 1559 ----
NM_001040092chr8164 ------
NM_001040100chr321074 444 --21256 827 --
NM_001040110chr761574 1494 387 314 209 160 --1519 --
NM_001040142chr292389 2226 2140 825 797 789 781 530 121 ------
NM_001040143chr292389 2226 2140 825 797 789 781 530 121 ------
NM_001040152chr765115 5074 4735 4576 3365 666 --1453 14710
NM_001040153chr133383 294 127 --1865 --
NM_001040157chr43856 278 142 1388 ----
NM_001040159chr451506 1221 1013 442 428 --11484 --
NM_001040202chr412263 11875 --12573
NM_001040214chr672385 2323 2010 1852 1841 1779 69 --22342 1876 --
NM_001040272chr952369 2363 2035 1565 771 ------
NM_001040284chr16105889 5531 4599 4488 3769 1964 1418 1264 452 124 --15582 --
NM_001040402chr442945 1232 799 205 33099 2669 2248 1330 --
NM_001040409chr25923 782 652 329 121 ------
NM_001040429chr1362987 2782 2405 1259 1089 1047 1216 ----
NM_001040450chr1542421 2341 1993 638 22596 2153 ----
NM_001040453chr1542421 2341 1993 638 22596 2153 ----
NM_001040633chr72847 98 1192 ----
NM_001040653chr352669 2528 2510 2358 826 ------
NM_001040665chr744603 1625 1255 1243 1960 24130 1722 21168 434
NM_001040708chr83980 907 780 ----1195
NM_001040712chr9113404 2848 2693 2601 2190 1401 1359 1295 1276 930 577 ------
NM_001042355chr1665193 3576 1594 1241 1156 274 13877 13957 14699
NM_001042388chr182712 344 1948 ----
NM_001042403chr122328 157 --1850 --
NM_001042404chr121472 723 --11982 --
NM_001042406chr631093 946 794 ------
NM_001042412chr1665193 3576 1594 1241 1156 274 13877 13957 14699
NM_001042413chr953985 3662 2874 620 326 12831 ----
NM_001042414chr131100 ------
NM_001042424chr4--13267 ----
NM_001042425chr641598 1327 1283 1247 --21630 1068 --
NM_001042453chrX41685 1185 425 227 --11474 --
NM_001042473chr1031545 1386 711 --1762 --
NM_001042481chr1462450 2387 2350 2060 1900 611 12626 1742 --
NM_001042492chr1723252 1190 43225 3124 1224 981 11100 --
NM_001042494chr1543605 3562 2677 1508 13682 13738 --
NM_001042495chr1543605 3562 2677 1508 13682 13738 --
NM_001042496chr1543605 3562 2677 1508 13682 13738 --
NM_001042497chr1543605 3562 2677 1508 13682 13738 --
NM_001042506chrX51333 1045 556 114 105 ------
NM_001042510chr872057 1840 1767 1663 1512 729 490 --11338 --
NM_001042511chr872057 1840 1767 1663 1512 729 490 --11338 --
NM_001042550chr942075 1670 471 220 --11866 21724 1436
NM_001042555chr1264058 4005 1824 1806 970 134 23786 3682 13321 --
NM_001042599chr297247 7142 6929 6316 3007 2855 2685 1627 433 --35437 2788 2089 --
NM_001042601chr353103 3069 2955 485 447 12809 21170 350 --
NM_001042603chr1235361 2044 875 24327 258 14004 --
NM_001042604chr344724 3952 3530 3273 31434 840 265 24745 4048 --
NM_001042646chr331972 1730 715 --31836 1769 698 --
NM_001042681chr122543 148 ------
NM_001042682chr122543 148 ------
NM_001042682chr122543 148 ------
NM_001042683chr611293 21817 37 --1689
NM_001042749chrX31856 775 144 11658 22049 432 --
NM_001042750chrX31856 775 144 11658 22049 432 --
NM_001042751chrX31856 775 144 11658 22049 432 --
NM_001043318chr1453297 3029 2779 1638 672 13010 13038 --
NM_001044385chr253751 545 279 89 78 11580 164 --
NM_001044722chr572246 1946 1542 1502 824 784 504 --11603 --
NM_001044723chr572246 1946 1542 1502 824 784 504 --11603 --
NM_001046chr532797 2371 1840 --12831 12483
NM_001048183chr153756 3725 3698 3602 1026 ------
NM_001049chr1432025 1679 624 22102 918 --12491
NM_001079874chr121899 103 12129 21840 1650 --
NM_001083620chr482270 2236 1882 1852 1758 1629 774 108 ------
NM_001099678chr3126281 6122 6103 5818 5053 4885 4659 4457 4433 2315 2274 1256 25754 1007 45301 2582 2003 719 11558
NM_001101662chr1138 ------
NM_001113490chrX83563 3283 3254 2921 2819 2713 1230 877 --1703 --
NM_001115chr8133 ------
NM_001116chr1683021 2913 2411 2364 874 691 514 60 --13083 11907
NM_001117chr1832193 2144 1906 --1106 --
NM_001121chr1041872 1758 1680 1518 11672 ----
NM_001122679chr511217 ------
NM_001123chr101304 ------
NM_001128chr1673329 3161 2900 1569 1477 622 592 --13233 13972
NM_001146chr832238 1847 741 22198 1555 21517 885 1430
NM_001148chr421431 553 ----12171
NM_001149chr1021374 1176 ------
NM_001151chr41186 ------
NM_001152chrX1200 146 ----
NM_001153chr21199 1149 1252 --
NM_001156chr101493 ------
NM_001160chr1282764 2677 2095 1973 743 506 356 116 12688 22034 290 --
NM_001167chrX126538 5776 5651 5486 5421 5397 4963 1413 718 703 677 276 36588 5216 194 --1879
NM_001173chr1474203 3370 3149 1569 1103 766 57 34495 3739 1397 14592 13316
NM_001198chr642071 1542 1505 273 1900 1455 --
NM_001200chr203433 358 309 --1242 --
NM_001201chr473911 3698 3555 2705 668 563 182 --1101 22512 2431
NM_001204chr277695 7274 6812 6191 5896 2883 2296 27772 7587 36300 2140 325 --
NM_001211chr15150 --1335 --
NM_001219chr731643 828 267 1236 --1243
NM_001227chr1021081 536 --1119 --
NM_001231chr1----1464 --
NM_001237chr421161 179 ------
NM_001237chr421161 179 ------
NM_001241chr241625 933 505 490 --12397 --
NM_001241chr241625 933 505 490 --12397 --
NM_001257chr1651482 1133 1112 378 362 ------
NM_001259chr765604 3938 3909 1751 715 411 --1720 11856
NM_001267chr171546 ----1556
NM_001271chr1542189 1101 405 382 ----13217
NM_001280chr192654 101 ------
NM_001282chr172874 76 ------
NM_001284chr5----1429 --
NM_001286chr112810 ------
NM_001290chr441056 1048 943 327 --1732 --
NM_001304chr17103461 2568 1489 1471 1356 1302 992 570 312 136 174 22636 2334 --
NM_001310chr1252149 1115 868 836 300 ----1572
NM_001326chr112441 111 ------
NM_001332chr551014 620 441 40 34 --1489 --
NM_001349chr22475 242 1588 ----
NM_001356chrX62450 2251 1922 702 690 267 32418 599 509 ----
NM_001363chrX----1723 --
NM_001364chr11124690 4678 4652 4093 4075 3556 3356 1914 1648 806 731 96 --11020 --
NM_001365chr171171 ------
NM_001380chr103989 408 324 ------
NM_001390chr1843515 3255 3122 247 13073 13109 --
NM_001391chr1841186 913 897 58 ----11172
NM_001399chrX33785 3113 95 ------
NM_001400chr131204 1092 987 --11028 --
NM_001401chr941007 992 561 552 ------
NM_001412chrX93448 3388 3381 3369 2812 2452 2434 1162 777 --23033 276 --
NM_001419chr1971607 1176 917 885 461 428 262 --11637 --
NM_001423chr1211980 11952 11898 --
NM_001427chr751978 1561 1304 392 144 1117 ----
NM_001429chr22------1750
NM_001431chr611155 21200 922 1198 --
NM_001432chr4113936 3721 2985 2977 2939 2724 2661 2462 1134 177 114 --43922 3621 2951 1076 11554
NM_001438chr143283 3201 3182 1134 13403 13551 --
NM_001451chr1631318 1284 1181 ------
NM_001453chr631244 1151 1130 1635 --11283
NM_001493chrX1752 ------
NM_001495chr81998 ----11102
NM_001497chr962759 2705 2674 2018 1907 533 --1864 --
NM_001498chr631148 1087 335 --21285 216 127
NM_001514chr13502 226 153 ------
NM_001527chr654775 4740 781 707 115 --21571 1540 14849
NM_001533chr19195 ------
NM_001541chr111124 ------
NM_001542chr152788 2622 2394 2387 97 12742 ----
NM_001546chr62896 539 ------
NM_001550chr73637 428 204 --159 --
NM_001557chr211212 ------
NM_001564chr4--1127 ----
NM_001584chr111932 1775 ----
NM_001604chr113992 861 140 2833 256 ----
NM_001614chr172549 191 --1567 --
NM_001614chr172549 191 --1567 --
NM_001616chr2103503 3359 3190 2972 2571 2277 2244 1041 438 170 --12740 --
NM_001621chr783000 2725 2677 2348 2305 1859 585 115 12885 --21957 1919
NM_001621chr783000 2725 2677 2348 2305 1859 585 115 12885 --21957 1919
NM_001634chr62628 252 --12041 1164
NM_001635chr71133 ------
NM_001642chr1121187 301 ------
NM_001650chr1862844 2578 1208 1146 795 498 12530 23835 3195 --
NM_001655chr1131418 525 247 ------
NM_001656chr541740 1582 1505 104 21932 1822 ----
NM_001661chr17--1539 ----
NM_001663chr1472609 2086 1803 985 739 447 387 1226 ----
NM_001664chr33785 686 661 ------
NM_001668chr121840 582 ------
NM_001677chr151124 957 353 324 140 ------
NM_001681chr12388 58 51 2570 162 1640 --
NM_001682chr1272470 2359 2242 2221 1034 548 33 1291 ----
NM_001683chr322120 1707 ------
NM_001684chr173995 3709 3373 2952 2541 1328 445 --24037 3486 --
NM_001690chr342400 2241 791 534 --22455 2338 --
NM_001695chr853441 2625 853 540 387 11565 11238 1305
NM_001701chr921585 1462 21146 110 ----
NM_001706chr34692 686 386 342 21022 733 ----
NM_001709chr1132758 2631 116 1220 ----
NM_001722chr81249 ------
NM_001730chr1331529 216 125 1164 ----
NM_001730chr1331529 216 125 1164 ----
NM_001731chr122862 324 ------
NM_001742chr751824 1786 599 583 415 --2729 64 --
NM_001746chr542927 2914 1864 600 22858 612 1926 1347
NM_001753chr731843 1725 1564 ------
NM_001754chr2183813 3516 3509 892 772 742 531 522 ------
NM_001755chr1641707 1667 1542 231 1575 11453 --
NM_001759chr1265168 4674 3721 1391 855 314 ------
NM_001777chr363270 3189 2776 2615 1304 1281 11550 24065 897 13856
NM_001788chr75977 964 956 943 933 --1805 --
NM_001791chr11211 --11391 21407 1344
NM_001792chr1821118 395 ----1771
NM_001797chr161650 ------
NM_001806chr1921950 1037 ----21934 453
NM_001830chrX43376 1436 1220 1132 --31026 845 94 11295
NM_001839chr15753 725 713 678 535 --2652 303 --
NM_001844chr121392 ------
NM_001845chr1311260 2923 364 ----
NM_001858chr6105139 4946 4937 4866 4799 1652 1580 1090 1047 467 ------
NM_001859chr973872 3713 2558 1199 973 962 944 ------
NM_001874chr1274986 4529 4338 4250 1435 1252 1168 12020 ----
NM_001880chr2--1266 ----
NM_001894chr22147 ------
NM_001903chr51211 ------
NM_001904chr33942 339 324 ------
NM_001918chr179195 8860 8493 2215 2201 1321 1301 17756 23146 2684 --
NM_001921chr411230 ------
NM_001924chr11428 ------
NM_001935chr2------1969
NM_001938chr151919 1626 355 349 94 --11392 11860
NM_001944chr1862298 2291 2154 2082 2032 85 ----22379 2356
NM_001946chr121448 --21072 767 --
NM_001949chr662912 2641 2577 2372 2310 439 22449 2384 ----
NM_001955chr6----21046 1031 --
NM_001957chr482170 1609 1530 1480 1462 907 743 229 --12124 --
NM_001964chr5--1478 ----
NM_001968chr43840 653 98 1856 1712 --
NM_001969chr1463779 2691 2462 934 711 77 --12782 --
NM_001980chr1272052 1662 1469 1410 319 201 129 --12132 --
NM_001981chr152010 1987 1907 1892 491 ------
NM_001992chr532064 517 303 12243 1157 --
NM_001995chr411522 --11382 11302
NM_002006chr485717 4945 4454 4317 1776 608 297 190 ----15734
NM_002015chr1383139 2765 1155 1113 1078 1058 906 359 12627 33014 2664 1118 12713
NM_002024chrX42041 1557 676 313 --11387 --
NM_002025chrX129247 9109 8563 8073 6479 6080 3375 2959 2613 1940 981 820 37624 7148 7121 29288 234 11515
NM_002031chr62573 160 ----1139
NM_002035chr1824004 532 12942 22959 95 13653
NM_002039chr41276 ----1778
NM_002040chr2143181 2242 1081 119 --13102 --
NM_002044chr1511083 198 11451 1378
NM_002054chr22449 93 1346 ----
NM_002068chr191670 ------
NM_002069chr741333 514 278 111 1524 3664 291 27 --
NM_002072chr92264 70 ------
NM_002077chr922089 1373 ------
NM_002082chr52231 210 --1218 --
NM_002090chr42421 190 --1170 --
NM_002092chr474995 4322 4078 3918 3287 965 532 14749 34906 1862 1538 --
NM_002114chr61424 ------
NM_002126chr1723937 139 --32658 1488 841 --
NM_002128chr1342527 2389 2368 907 ------
NM_002135chr121482 ------
NM_002136chr121175 ------
NM_002137chr752349 2147 1631 1498 124 11614 ----
NM_002138chr4----1648 --
NM_002146chr17--11104 11127 --
NM_002155chr11268 ------
NM_002158chr243517 3247 3058 2496 1901 1418 --
NM_002165chr201325 ------
NM_002167chr11455 ------
NM_002182chr352742 2644 2593 2190 1052 ------
NM_002188chr51700 ------
NM_002190chr61405 --1271 --
NM_002193chr2------11560
NM_002194chr2----1140 --
NM_002203chr553976 3816 3279 1447 290 11079 13462 --
NM_002211chr101129 --1868 1366
NM_002214chr7105687 5358 4178 4003 3845 2238 2094 1334 694 588 --15596 15305
NM_002222chr351241 865 316 138 25 --31201 309 173 --
NM_002228chr111175 --11274 --
NM_002232chr11194 --21105 454 --
NM_002233chr112102 56 1159 ----
NM_002234chr121495 --1263 --
NM_002239chr231151 439 253 ----2368 216
NM_002247chr1072075 1984 1506 869 732 145 133 --12112 --
NM_002264chr315041 2942 536 --13388
NM_002265chr1711063 ------
NM_002267chr1382346 1619 1600 1510 789 392 197 191 --12225 --
NM_002270chr5155638 4798 4783 4510 4232 3868 3801 3699 2087 1937 1677 1482 1147 1017 773 24524 184 21623 879 14181
NM_002285chr244085 3704 3174 2988 13640 31122 872 675 1543
NM_002290chr61235 ------
NM_002293chr132542 475 322 --12272 --
NM_002296chr141416 1189 1091 234 1183 ----
NM_002313chr10104664 4447 4015 3737 3341 3186 1503 1210 282 265 ------
NM_002332chr121107 ------
NM_002336chr1244426 4032 3244 1571 13338 24909 1723 13506
NM_002342chr121590 ------
NM_002345chr121549 ------
NM_002349chr231217 1035 301 ----11048
NM_002351chrX--1679 199 11471
NM_002356chr642792 2780 2020 450 12706 22272 536 22545 783
NM_002358chr42498 258 ------
NM_002376chr14166 ------
NM_002382chr142951 537 --1211 --
NM_002384chr182804 230 ----1816
NM_002387chr585035 4935 4173 2004 1836 933 670 322 15094 24899 4288 --
NM_002397chr541721 1366 421 287 --11984 188
NM_002398chr241308 1174 213 168 11258 1339 --
NM_002402chr72228 57 127 ----
NM_002412chr10--183 ----
NM_002449chr52409 259 ------
NM_002451chr953814 3497 810 513 429 1157 11412 13777
NM_002478chr111513 ------
NM_002480chr1221497 492 11486 --1594
NM_002481chr167011 6688 6340 4869 3037 533 --37827 6136 1458 --
NM_002492chr3170 1357 ----
NM_002499chr1552204 1833 631 496 299 ------
NM_002500chr23992 936 279 --1135 1197
NM_002507chr1711734 ------
NM_002520chr51217 ------
NM_002524chr151070 1003 943 809 719 ------
NM_002525chr1138 ------
NM_002537chr151420 ------
NM_002538chr5--1233 ----
NM_002544chr171316 --1308 --
NM_002545chr1145120 1573 1023 662 --14074 13962
NM_002577chr364026 3265 2659 700 462 290 ------
NM_002581chr954953 4539 4169 3585 347 --15041 --
NM_002595chr1231908 436 401 1298 --11602
NM_002600chr141813 1766 1748 1737 --11852 --
NM_002607chr72939 855 11186 11061 1826
NM_002608chr22156 ------
NM_002610chr2--144 1540 12153
NM_002620chr4--164 ----
NM_002623chr201757 --2795 198 --
NM_002632chr14144 ------
NM_002645chr1183071 2991 2777 2548 780 327 154 49 13144 ----
NM_002648chr6----1904 --
NM_002655chr8105060 5020 4971 4939 4847 4344 3354 3300 1349 34 --35041 4614 2044 11274
NM_002667chr6----1166 11240
NM_002670chr311565 11147 1396 --
NM_002687chr14--11106 ----
NM_002706chr23683 588 63 --168 1625
NM_002709chr242573 899 259 180 --22592 1052 12915
NM_002715chr51863 ------
NM_002718chr32511 35 --21058 780 --
NM_002721chr91466 163 ----
NM_002731chr133005 1954 1220 ------
NM_002734chr1742206 1897 1875 415 ------
NM_002736chr761989 1982 1739 1531 852 757 --1704 --
NM_002737chr1756593 6119 4352 2412 1233 --11556 --
NM_002738chr1611072 --1890 --
NM_002740chr352842 2675 2467 1797 48 2324 304 123 12485
NM_002742chr145729 522 504 178 140 1203 --1267
NM_002752chr51550 1483 ----
NM_002753chr43593 333 313 ------
NM_002763chr1128 ------
NM_002767chr171462 ------
NM_002786chr11------127
NM_002788chr14125 ------
NM_002806chr14176 --181 --
NM_002814chrX3736 677 626 --3724 588 68 --
NM_002819chr1911266 ------
NM_002823chr22628 270 ------
NM_002825chr73168 86 62 ------
NM_002827chr2011629 ----1467
NM_002833chr1531617 1536 489 ------
NM_002835chr71739 ------
NM_002837chr1284548 4377 1160 830 449 330 185 110 --2874 212 --
NM_002839chr9113404 2848 2693 2601 2190 1401 1359 1295 1276 930 577 ------
NM_002841chr31474 1702 ----
NM_002843chr1133348 927 213 1905 --13480
NM_002845chr181542 ------
NM_002849chr124952 736 308 119 --2678 186 --
NM_002851chr72647 264 ------
NM_002858chr1------21118 471
NM_002865chr82210 194 1287 ----
NM_002869chr1122081 658 --32099 1480 720 --
NM_002874chr952399 2319 1872 817 171 21844 41 ----
NM_002890chr54979 761 750 675 ------
NM_002892chr1411263 --21329 408 --
NM_002895chr201701 --1180 --
NM_002902chr154598 574 270 86 --1193 --
NM_002922chr12662 514 2605 255 ----
NM_002924chr1------1573
NM_002941chr331132 1091 322 ------
NM_002942chr341410 1230 890 296 ------
NM_002955chr62356 266 11880 ----
NM_002956chr1231207 451 383 --11266 --
NM_002968chr161244 ----1404
NM_002971chr311079 --1781 --
NM_002977chr233221 3104 1245 22110 1361 --1489
NM_002979chr11788 2642 220 ----
NM_002990chr161111 --11771 1541
NM_002995chr14733 708 146 121 ------
NM_002996chr1611983 ------
NM_002997chr211431 ------
NM_002998chr82800 139 --2874 157 --
NM_003010chr1752360 2250 2142 650 167 12087 ----
NM_003011chr941570 1467 458 359 ----11042
NM_003013chr41567 ------
NM_003014chr73334 279 255 --11180 11469
NM_003016chr1731892 382 271 11988 11586 --
NM_003027chr151404 --1141 --
NM_003031chr163908 310 221 1251 ----
NM_003034chr1288051 6906 6795 5637 5191 1120 985 782 1764 16892 --
NM_003042chr321822 1645 11995 12185 --
NM_003043chr384252 4208 4124 3959 3805 2634 989 311 --1279 --
NM_003045chr1393949 3793 3362 3091 1178 733 717 564 396 --34149 3055 1013 --
NM_003046chr875394 5138 4157 1610 271 259 247 --14568 14168
NM_003051chr1----31444 1254 751 --
NM_003054chr10----1230 --
NM_003068chr82809 112 --136 --
NM_003069chrX2229 40 ----1745
NM_003070chr91685 ------
NM_003093chr61183 ------
NM_003095chr12188 ------
NM_003099chr1586544 5695 4595 4467 2317 1892 291 87 16516 11953 16565
NM_003106chr321015 962 1985 ----
NM_003107chr642376 2201 2186 1739 12347 ----
NM_003108chr2117010 6781 6608 6283 6163 5943 5022 4990 4707 1312 681 --17130 --
NM_003111chr251254 1150 1104 438 297 11367 ----
NM_003112chr773101 3060 2450 2169 578 462 403 --12815 --
NM_003114chr85792 705 304 156 32 1685 ----
NM_003115chr11459 ------
NM_003142chr2------1262
NM_003144chr62240 169 1486 ----
NM_003150chr1742285 2087 575 53 ------
NM_003155chr832696 2350 408 12579 12585 --
NM_003157chr32959 846 ------
NM_003161chr1743563 3043 2978 885 13578 ----
NM_003174chr103741 690 164 ------
NM_003182chr71412 --1160 --
NM_003182chr71412 --1160 --
NM_003184chr8145 ------
NM_003193chr1----1138 --
NM_003199chr1885448 5348 5086 4801 4618 4422 3889 1029 163 24884 326 11748
NM_003202chr521858 1848 --11710 --
NM_003206chr61309 ------
NM_003211chr121208 ------
NM_003213chr121189 ------
NM_003214chr621311 1289 ------
NM_003220chr641598 1327 1283 1247 --21630 1068 --
NM_003221chr643779 3420 1324 582 --21613 1548 --
NM_003242chr311591 --12447 12375
NM_003253chr2161664 1531 1518 762 705 497 ------
NM_003257chr1561284 1186 1056 958 420 332 --1917 --
NM_003262chr365054 4817 4740 4580 726 389 11031 34115 918 121 --
NM_003269chr611312 ------
NM_003272chr11674 --1259 --
NM_003274chr2122433 1091 22968 2504 --11181
NM_003292chr111881 11552 --11809
NM_003298chr376154 6122 4868 4135 4123 4114 253 25839 5592 16172 --
NM_003304chr331566 1372 509 --11137 --
NM_003330chr1241756 1434 1372 242 11195 11795 --
NM_003337chr52664 233 ----1696
NM_003338chr103462 422 382 --1211 --
NM_003339chr551577 1173 993 530 454 ------
NM_003340chr41560 2280 31 1552 --
NM_003342chr1753231 3195 1151 1046 695 --11269 --
NM_003350chr83999 830 773 ------
NM_003358chr91104 ------
NM_003360chr4----1190 --
NM_003368chr11760 --1584 1210
NM_003372chrX1944 ----1891
NM_003374chr51721 ------
NM_003376chr631608 1575 1343 11902 1479 --
NM_003376chr631608 1575 1343 11902 1479 --
NM_003387chr24691 599 140 100 --22573 2474 12530
NM_003390chr113710 290 153 2851 751 ----
NM_003392chr354186 2790 1682 1367 546 --23829 2896 13207
NM_003403chr142632 586 --1797 --
NM_003406chr841863 744 660 485 --1779 --
NM_003407chr191569 ----1137
NM_003410chrX72098 1965 999 896 840 784 710 ----12475
NM_003411chrY31528 1415 696 ------
NM_003412chr353112 2806 2605 855 463 ------
NM_003413chrX----31878 1563 480 --
NM_003418chr32214 167 147 1712 --
NM_003423chr1912302 12535 --12484
NM_003435chr192240 52 ------
NM_003453chr133744 734 294 ------
NM_003463chr643295 2125 609 166 21134 628 11274 --
NM_003468chr283938 3763 3754 3711 1332 283 209 197 --1256 24360 4231
NM_003471chr371902 1849 1769 1744 1666 856 237 --12270 --
NM_003472chr63584 247 182 --181 --
NM_003474chr1031761 1630 939 11927 12199 --
NM_003477chr11--1536 ----
NM_003478chr1142815 2180 2111 234 12919 ----
NM_003482chr1212429 ------
NM_003483chr123917 617 85 22886 2322 11984 --
NM_003489chr21123011 3003 2987 2936 2902 2863 2806 2708 2487 717 234 156 1955 23478 331 --
NM_003490chr2211053 ------
NM_003505chr731676 1515 303 11550 ----
NM_003506chr81112 2936 861 1423 --
NM_003557chr111593 --11463 --
NM_003559chr1763941 3369 1455 955 544 76 1636 ----
NM_003566chr1253269 3228 3060 709 532 --31309 1017 298 --
NM_003576chr1372869 2749 2714 2610 627 474 320 12384 ----
NM_003582chr12187 27 ----1208
NM_003583chr1273751 3203 3127 1393 836 758 249 11547 12852 13850
NM_003590chr293974 3834 3222 3085 2621 1507 1408 547 252 --13056 --
NM_003591chr101326 ------
NM_003593chr171542 ------
NM_003603chr452150 1389 677 466 437 ------
NM_003607chr194381 3821 3255 2714 955 611 592 567 510 --13260 --
NM_003610chr201331 ------
NM_003615chr312930 11276 22935 165 --
NM_003617chr1104992 4933 4041 3222 1588 1474 1365 1264 1080 60 22001 1152 1760 --
NM_003618chr221152 463 ------
NM_003620chr171164 ------
NM_003622chr1262416 2127 1970 971 512 264 ------
NM_003624chr19----11442 --
NM_003629chr12719 331 ------
NM_003630chr61733 ------
NM_003631chr101984 ------
NM_003633chr542009 1723 1665 726 ------
NM_003645chr151214 ------
NM_003648chr212557 ------
NM_003659chr221126 305 ----11120
NM_003663chr393385 3354 3313 2457 1061 613 328 289 81 13328 12780 --
NM_003666chr1--152 ----
NM_003668chr12155 ------
NM_003672chr151836 1778 1768 1512 448 --41900 1297 337 281 --
NM_003677chr12122080 605 368 239 219 197 171 163 143 121 103 21 --11532 11814
NM_003679chr132452 175 28 13318 1663 --
NM_003688chrX2246 234 ----1252
NM_003690chr22479 204 ------
NM_003701chr13175 --127 --
NM_003704chr4--1607 ----
NM_003711chr54340 283 273 75 ------
NM_003722chr341857 1778 500 345 --2843 652 --
NM_003725chr12--1410 ----
NM_003743chr232078 2035 1781 1803 ----
NM_003744chr14121 1417 ----
NM_003746chr121203 ------
NM_003749chr13102403 2386 2127 2094 1895 1777 1715 1631 752 230 ----11514
NM_003750chr101785 2227 140 ----
NM_003759chr454306 4085 3290 1704 990 23469 1228 13419 --
NM_003760chr1------1231
NM_003762chr13972 946 424 2355 347 ----
NM_003764chr62778 718 ------
NM_003772chr111123 --1237 --
NM_003774chr1263348 2875 2286 694 446 82 --12201 --
NM_003778chr31135 ------
NM_003783chr161198 965 835 301 257 55 1235 ----
NM_003797chr11163 ------
NM_003800chr652016 1609 671 628 502 --21489 173 --
NM_003816chr81321 ------
NM_003822chr152576 2357 462 203 188 --11063 --
NM_003850chr133465 194 151 ------
NM_003858chr141600 1512 ----
NM_003861chr1412658 ----11964
NM_003877chr12------11002
NM_003884chr3----2169 93 --
NM_003885chr1732570 2475 2190 --2206 40 --
NM_003887chr252170 1705 699 595 343 2862 321 21656 208 --
NM_003895chr21----1210 11989
NM_003899chr1342133 1790 769 365 ----1879
NM_003902chr13856 547 306 1653 1255 --
NM_003913chr6104316 4304 4105 3760 3738 3202 1258 851 249 74 ------
NM_003916chrX2519 344 ------
NM_003932chr2271761 1675 1410 1315 1175 609 355 --1456 --
NM_003934chr941231 1101 506 221 --11057 --
NM_003941chr742506 2423 2346 2289 --11018 --
NM_003947chr321145 842 ------
NM_003951chrX----174 --
NM_003953chr122864 159 ------
NM_003958chr643361 3066 2673 502 23625 2609 23954 1207 --
NM_003966chr577597 7420 7023 6797 5534 421 114 37779 6874 5407 27358 5349 --
NM_003971chr172472 427 ------
NM_003972chr1061145 1135 1072 935 923 862 1185 ----
NM_003994chr1244218 2980 2759 1185 11759 13011 --
NM_004006chrX42596 2374 2270 2128 22644 2013 ----
NM_004007chrX42596 2374 2270 2128 22644 2013 ----
NM_004009chrX42596 2374 2270 2128 22644 2013 ----
NM_004010chrX42596 2374 2270 2128 22644 2013 ----
NM_004011chrX42596 2374 2270 2128 22644 2013 ----
NM_004012chrX42596 2374 2270 2128 22644 2013 ----
NM_004013chrX42596 2374 2270 2128 22644 2013 ----
NM_004014chrX42596 2374 2270 2128 22644 2013 ----
NM_004015chrX42596 2374 2270 2128 22644 2013 ----
NM_004016chrX42510 2288 2184 2042 22558 1927 ----
NM_004017chrX42596 2374 2270 2128 22644 2013 ----
NM_004018chrX42510 2288 2184 2042 22558 1927 ----
NM_004020chrX42596 2374 2270 2128 22644 2013 ----
NM_004021chrX42510 2288 2184 2042 22558 1927 ----
NM_004022chrX42510 2288 2184 2042 22558 1927 ----
NM_004023chrX42510 2288 2184 2042 22558 1927 ----
NM_004028chr1862844 2578 1208 1146 795 498 12530 23835 3195 --
NM_004034chr101493 ------
NM_004035chr1764477 3871 3681 1040 832 572 --15029 --
NM_004050chr1442680 495 473 349 21925 770 ----
NM_004060chr511075 ------
NM_004065chrX195 ------
NM_004067chr73959 484 238 --1426 11576
NM_004071chr21237 ------
NM_004081chrY6723 601 577 526 377 50 1214 ----
NM_004086chr142656 60 ------
NM_004087chr311686 2445 177 ----
NM_004089chrX11219 ------
NM_004093chr1362495 2387 2264 896 426 410 --12948 --
NM_004094chr1432158 1115 804 --32962 638 385 --
NM_004100chr632720 1853 979 ------
NM_004113chr362011 1856 1540 1441 455 288 --11615 --
NM_004124chr1453291 3149 1388 1305 970 1490 --136
NM_004133chr852592 641 282 254 201 ------
NM_004136chr1572828 2283 2269 2167 1133 1034 689 13305 1963 1672
NM_004152chr191146 ------
NM_004156chr82434 240 --164 --
NM_004162chr34907 847 480 175 1928 ----
NM_004170chr94676 615 452 333 ------
NM_004171chr11129328 8906 8714 8557 8138 7899 3749 3001 2932 2740 2114 98 21588 227 48123 7909 6939 1930 --
NM_004180chr21250 ------
NM_004225chr821311 444 ------
NM_004229chrX31870 1757 431 --31934 1887 1773 --
NM_004232chr1833878 729 353 --23105 2846 1332
NM_004236chr155458 436 405 232 166 ------
NM_004239chr14159 --1102 --
NM_004241chr10168 1236 2711 283 --
NM_004253chr91617 1823 ----
NM_004272chr521574 238 --31839 1258 696 11700
NM_004274chr1452201 883 859 754 434 --12234 --
NM_004275chr641622 1446 1436 395 ------
NM_004279chr752297 1902 753 321 76 1159 136 --
NM_004291chr51291 ------
NM_004293chr953769 3431 1076 770 591 --23774 2971 --
NM_004296chr1463960 3339 3016 1235 1179 254 11352 13451 --
NM_004301chr3--1286 ----
NM_004316chr1211139 ----1979
NM_004330chr156755 447 328 301 282 63 2217 144 174 --
NM_004331chr852667 2211 2016 50 28 --12610 --
NM_004338chr1856784 5950 5162 5070 805 --2939 322 14633
NM_004342chr762266 2012 702 692 143 78 11685 ----
NM_004349chr8----11160 11253
NM_004365chr51138 ------
NM_004379chr231342 585 422 1162 ----
NM_004384chr572246 1946 1542 1502 824 784 504 --11603 --
NM_004389chr24872 578 339 78 ------
NM_004392chr1322638 846 1120 ----
NM_004397chr1153962 3889 1676 1485 388 --22827 731 --
NM_004429chrX1105 ------
NM_004432chr962134 2096 2067 1865 1679 243 ------
NM_004434chr1421381 546 ----11355
NM_004438chr2103307 3061 2997 2830 2812 2507 2187 1183 380 311 12855 32487 1289 1149 --
NM_004449chr2161395 1338 1131 440 315 34 --11200 --
NM_004457chr251599 656 420 360 67 11613 21127 530 --
NM_004458chrX42584 2294 1852 1039 --12556 2973 424
NM_004459chr1731368 828 391 1808 11321 --
NM_004464chr4104336 3433 3072 2699 2626 1705 1494 447 273 115 ------
NM_004491chr1954209 4093 3910 2899 1546 --14286 --
NM_004496chr141186 ------
NM_004500chr1472021 1810 1319 798 700 526 278 --1494 --
NM_004501chr142995 2988 1205 734 2675 453 13769 --
NM_004503chr124638 623 550 79 ------
NM_004504chr25913 906 318 224 129 23067 137 11006 11024
NM_004505chr171168 --1783 --
NM_004506chr6128 ------
NM_004520chr51577 ------
NM_004521chr102349 132 ------
NM_004529chr941262 371 335 21 ----11193
NM_004538chrX3809 742 517 ------
NM_004565chr11708 ------
NM_004571chr2162614 2297 1255 1040 872 110 ------
NM_004575chr431451 1140 526 ----11549
NM_004580chr1551732 1533 1424 1212 305 ------
NM_004583chr172737 730 ------
NM_004586chrX55415 5381 5039 4245 508 14971 13517 --
NM_004592chr12------1213
NM_004593chr32636 171 --1233 --
NM_004595chrX1160 ------
NM_004598chr563320 3138 876 654 644 63 1808 12850 --
NM_004600chr11115 11192 --11165
NM_004602chr201580 ------
NM_004606chrX------1366
NM_004612chr984230 4054 4002 3228 1774 1243 929 571 --11404 --
NM_004615chrX3806 794 665 --1934 1965
NM_004626chr111585 ------
NM_004627chr214682 657 609 101 --1629 --
NM_004630chr1111089 ------
NM_004650chrX21765 1536 2498 102 11876 --
NM_004651chrX1333 ------
NM_004654chrY1928 ------
NM_004655chr1731233 492 269 ----11324
NM_004660chrY2688 265 22288 512 ----
NM_004663chr1531538 1530 1341 11485 21133 1083 --
NM_004665chr61310 ------
NM_004667chr152678 507 1241 --1592
NM_004673chr121295 76 --1408 --
NM_004684chr43330 273 114 1394 1324 --
NM_004685chr1371059 941 935 829 685 615 180 --1234 --
NM_004687chr1732064 1523 353 1526 1589 --
NM_004703chr1732160 950 517 ------
NM_004709chrX21682 1205 ----11217
NM_004712chr17----1493 --
NM_004715chr181112 ------
NM_004719chr1282875 2414 2133 1946 513 320 291 248 22825 2346 1373 22404 451
NM_004725chr1031048 343 183 1210 21198 1102 --
NM_004726chrX135782 5607 5449 4734 4610 3636 2001 1606 1345 1098 1021 851 417 --13722 --
NM_004730chr562117 1982 1415 643 444 302 12024 --12063
NM_004733chr3----2601 195 --
NM_004736chr1--12107 1603 11753
NM_004738chr2052638 707 660 205 96 --1728 --
NM_004744chr473957 3705 3545 3470 3147 1311 29 12964 12747 --
NM_004745chr877012 2668 1878 1097 902 816 407 14988 12054 --
NM_004748chr1553555 3459 1395 1226 1123 23894 1584 22741 317 --
NM_004760chr762343 2334 2088 1954 733 302 1365 --12520
NM_004768chr14904 280 99 75 ------
NM_004772chr51477 21395 23 11568 --
NM_004775chr182890 734 22402 2010 ----
NM_004779chr551219 1114 842 331 120 ------
NM_004781chr141286 1094 589 516 21702 551 ----
NM_004781chr141286 1094 589 516 21702 551 ----
NM_004788chr1192746 2679 2226 1868 1858 1686 993 928 461 ------
NM_004789chr92289 70 ------
NM_004795chr1341770 1499 629 584 ------
NM_004798chr2052892 2665 2281 962 225 11268 ----
NM_004801chr251293 1145 1030 1022 529 ------
NM_004815chr1103406 1559 851 606 596 482 453 308 224 138 23959 3215 13753 --
NM_004817chr92311 286 --1782 --
NM_004821chr5----1680 --
NM_004824chr611224 --1899 --
NM_004834chr233076 799 485 33382 3294 3051 1984 --
NM_004835chr32807 801 1211 --1123
NM_004835chr32807 801 1211 --1123
NM_004836chr21380 ------
NM_004849chr621602 327 11156 ----
NM_004856chr151557 ------
NM_004857chr1464099 1832 1652 574 538 298 --13678 --
NM_004859chr1732321 1071 619 22438 1058 1407 --
NM_004863chr1435074 2120 930 ------
NM_004866chr584962 4084 3483 3276 3266 506 128 60 11196 ----
NM_004869chr1861776 1681 1554 1542 1447 1205 11691 134 --
NM_004879chr111388 ----1885
NM_004884chr1511412 ------
NM_004890chr17--1236 ----
NM_004896chr1041570 1537 1106 183 ------
NM_004902chr203621 548 24 ------
NM_004904chr796556 6303 5633 4705 4241 4170 3983 2593 50 12499 ----
NM_004912chr751168 1138 1118 664 421 ------
NM_004926chr1431574 1528 260 ------
NM_004938chr971269 1165 1144 953 489 414 394 ------
NM_004945chr191817 ------
NM_004947chr342394 2287 2259 461 ------
NM_004948chr1861286 571 432 323 244 198 11213 --11145
NM_004956chr731516 561 98 24533 146 11044 1945
NM_004964chr1190 ------
NM_004966chr10----1690 --
NM_004972chr931050 391 364 ------
NM_004973chr62650 265 1256 ----
NM_004985chr1244197 3895 3666 275 --24264 1085 --
NM_004992chrX37185 6195 2212 ----12761
NM_004992chrX37185 6195 2212 ----12761
NM_004995chr1411523 ------
NM_004998chr152798 264 ----1246
NM_004999chr633688 1195 1016 11506 2611 602 --
NM_005010chr772068 870 738 729 497 308 194 ------
NM_005011chr761574 1494 387 314 209 160 --1519 --
NM_005014chr92719 675 ----2109 78
NM_005045chr72619 394 ------
NM_005054chr251488 1474 1177 268 144 11563 1179 11251
NM_005056chr1225605 1119 24571 502 14248 --
NM_005063chr1033271 2766 564 --13173 --
NM_005065chr1493910 3671 1699 1381 1324 940 381 343 65 --24369 3903 13394
NM_005066chr14819 760 517 74 ----1629
NM_005077chr91440 ------
NM_005080chr221839 ------
NM_005086chr1231117 704 176 ------
NM_005093chr2045290 4315 1534 82 --15340 15223
NM_005095chr152264 1493 257 81 58 ------
NM_005116chr2074573 3710 3323 1824 1674 1111 42 ------
NM_005121chr1773415 2944 1229 1223 1209 648 466 23114 2982 23489 3420 --
NM_005123chr122341 58 ------
NM_005126chr372173 2051 1941 1527 822 473 59 ------
NM_005130chr41142 --1219 --
NM_005133chr111402 ------
NM_005134chr182712 344 1948 ----
NM_005135chr1543605 3562 2677 1508 13682 13738 --
NM_005154chr151586 ------
NM_005155chr61699 ------
NM_005156chr985259 5252 4725 3772 1972 1032 534 163 14459 ----
NM_005168chr241679 1620 325 101 ------
NM_005171chr1251304 1171 500 359 35 ------
NM_005180chr1031067 1055 453 --1466 --
NM_005188chr1187223 6698 2811 2247 2084 1296 570 212 28228 529 ----
NM_005190chr61449 ------
NM_005194chr20--1488 ----
NM_005197chr14116091 6084 5916 5679 5572 5461 5347 2434 2300 1252 1070 --26188 1352 --
NM_005219chr521196 1188 1245 11690 --
NM_005227chr11504 ------
NM_005233chr342462 2314 1830 1611 1504 12062 --
NM_005235chr297247 7142 6929 6316 3007 2855 2685 1627 433 --35437 2788 2089 --
NM_005238chr1183555 3301 3143 3056 2726 2232 1132 1089 12617 1947 --
NM_005239chr2131533 553 506 --11777 1669
NM_005254chr1531151 943 567 11042 1189 --
NM_005259chr231420 1068 961 --1947 --
NM_005269chr121132 ------
NM_005277chr441820 1486 1432 717 1350 21559 37 --
NM_005308chr101380 ------
NM_005311chr782310 2145 2039 1785 927 427 385 68 --12069 --
NM_005324chr1751974 1333 511 248 100 ------
NM_005329chr1612270 ------
NM_005339chr424339 702 33350 3042 1192 ----
NM_005349chr41225 ------
NM_005358chr1351623 1583 1259 707 410 --31721 731 433 --
NM_005359chr1894513 4130 1264 1081 854 776 766 343 263 --36223 1238 534 --
NM_005375chr65983 845 409 300 143 --1892 --
NM_005384chr9--169 ----
NM_005385chr332565 2100 273 21829 601 11763 12590
NM_005387chr111462 ------
NM_005388chr951500 1364 1334 395 120 --21554 1312 --
NM_005393chrX1243 ------
NM_005400chr243071 3049 2941 140 --22913 2826 --
NM_005406chr1821630 1391 --1994 --
NM_005407chr1411270 ------
NM_005412chr121567 ------
NM_005433chr1842445 2424 757 464 --11006 --
NM_005436chr1073723 3653 3638 3086 1526 1319 999 --13791 --
NM_005443chr41199 ------
NM_005445chr10135 ------
NM_005450chr171199 ------
NM_005455chr141675 1543 216 147 ----1112
NM_005461chr2031652 1447 665 21713 634 21698 1464 --
NM_005465chr141845 1615 1276 490 --11781 --
NM_005475chr12----13222 --
NM_005476chr921236 901 1381 --1322
NM_005487chr2221938 1932 ------
NM_005493chr6--1677 ----
NM_005497chr1785765 5131 4866 4669 1581 1044 754 349 15826 ----
NM_005499chr196663 576 491 257 225 177 --1455 --
NM_005502chr973248 2695 2096 1016 876 616 334 1967 ----
NM_005503chr1511100 ------
NM_005504chr1286549 5044 4130 1653 1053 598 105 70 2938 581 25954 1752 --
NM_005509chr521507 580 --11860 --
NM_005513chr351470 1314 516 422 237 ------
NM_005522chr721157 917 --1874 --
NM_005524chr3--1235 ----
NM_005526chr81276 ------
NM_005537chr1341028 443 94 48 1946 ----
NM_005540chr151568 1345 1085 625 439 --11608 --
NM_005544chr22781 142 --2926 356 --
NM_005546chr542370 2326 2125 1895 --12350 --
NM_005575chr52649 150 ------
NM_005578chr344995 4551 1848 272 --1468 14889
NM_005587chr152808 135 ------
NM_005593chr123522 491 158 1463 ----
NM_005596chr9106079 5561 5439 5275 4287 1934 1889 1575 1385 1365 25432 1188 --26154 4159
NM_005603chr1831999 1726 92 ------
NM_005604chr662357 2229 2013 1957 1627 839 ------
NM_005610chr13770 702 587 ------
NM_005613chr172061 1751 1685 1658 542 526 344 21769 79 1373 --
NM_005618chr6----1567 --
NM_005625chr811093 166 ----
NM_005626chr11385 ------
NM_005639chr1251631 1337 452 315 25 --1103 --
NM_005644chr1----136 --
NM_005646chr12201 102 ------
NM_005665chr174562 3936 3349 1699 978 668 405 ------
NM_005667chr21389 ------
NM_005668chr5104068 4010 3908 3717 1742 1659 1542 830 589 244 11301 24310 3537 --
NM_005717chr1--1341 ----
NM_005730chr1223567 2987 13629 ----
NM_005737chr252925 2666 2070 1048 531 --2903 462 --
NM_005739chr1512338 12261 ----
NM_005746chr73885 704 366 --21913 177 1621
NM_005748chr1252813 1195 1158 414 270 23050 2872 --1381
NM_005749chr171142 1737 1564 --
NM_005751chr7180 --1190 --
NM_005756chrX51497 1242 456 384 80 --1480 --
NM_005759chr284762 3991 3444 1812 1219 728 556 247 23597 1079 11761 --
NM_005772chr92758 592 1516 ----
NM_005776chr14136 --1682 1308
NM_005801chr17----1783 --
NM_005802chr92572 179 ------
NM_005808chr323148 703 --22945 215 22924 2578
NM_005813chr242197 810 451 253 --12456 --
NM_005826chr14613 486 455 121 ------
NM_005828chr1745095 4558 1860 41 ------
NM_005832chr31501 ------
NM_005839chr11838 1180 ----
NM_005840chrX117007 6150 4869 2945 2885 2508 1959 1691 1444 630 522 --35808 5388 2935 --
NM_005841chr41971 ----1429
NM_005842chr133738 549 492 --1233 --
NM_005843chr231979 1405 1247 143 ----
NM_005853chr16--1226 ----
NM_005870chr1331135 1091 118 ------
NM_005871chr1051005 943 852 754 156 21057 864 ----
NM_005875chr3--1305 ----
NM_005877chr221808 22403 835 2813 624 1562
NM_005880chr162456 122 --11129 11371
NM_005898chr11103002 2546 2452 2285 2205 1986 877 528 514 468 ----12151
NM_005900chr411138 ------
NM_005901chr18128607 8117 8036 7914 6538 2773 1966 1701 1238 956 807 318 35880 2557 1130 ----
NM_005902chr1594483 3988 3352 3160 1339 955 922 763 752 --24488 3732 --
NM_005903chr585069 4914 4819 3225 764 324 173 145 24324 952 --25155 835
NM_005904chr18----21328 1257 --
NM_005924chr731133 778 375 1408 11108 --
NM_005930chr141321 ------
NM_005935chr423596 3589 --25044 4585 11305
NM_005941chr812923 33711 1460 871 ----
NM_005955chr175403 4603 2014 1611 1581 926 306 --13839 --
NM_005964chr1721455 141 --11195 --
NM_005966chr231876 1761 807 1732 1313 12147
NM_005968chr193171 86 47 ------
NM_005977chr132912 859 --11014 --
NM_005986chr1331874 838 598 1635 1652 --
NM_005999chr1------11323
NM_006002chr13--134 ----
NM_006007chr9103819 3428 3168 1192 1072 868 822 386 200 76 43349 1463 1087 707 11421 --
NM_006011chr1544296 3986 3231 1146 14188 23236 3216 --
NM_006015chr111210 ------
NM_006016chr632242 1542 127 ----11763
NM_006024chr71658 ----1331
NM_006033chr1832292 1510 746 ------
NM_006036chr272480 2444 2309 2263 2104 1951 401 11980 11639 --
NM_006037chr234241 3986 1143 14917 21222 1163 --
NM_006041chr172440 60 ------
NM_006048chr1--11075 ----
NM_006055chr262950 2411 2248 2233 1156 843 --13177 1926
NM_006064chrX3323 104 57 ----1384
NM_006067chr16--1749 ----
NM_006070chr32389 79 ------
NM_006080chr772921 2606 2553 2467 2389 1035 366 --32998 2213 632 12634
NM_006094chr861708 951 554 340 246 185 ------
NM_006095chr4104466 3744 3572 3136 2941 1664 1274 997 810 149 24244 3222 ----
NM_006106chr1142723 1301 978 699 --21039 179 --
NM_006113chr121899 103 12129 21840 1650 --
NM_006133chr1112385 --1412 --
NM_006139chr232462 2207 2032 ------
NM_006154chr1552885 1799 1070 942 192 22711 1081 42721 2588 2263 429 --
NM_006157chr11----1329 --
NM_006158chr851627 1354 1319 232 119 --1437 --
NM_006161chr5----1605 1477
NM_006166chr1272609 2567 2506 1879 1653 507 96 --22439 272 --
NM_006178chr1731582 1434 167 ------
NM_006186chr21335 ------
NM_006195chr931278 170 46 --11204 11341
NM_006197chr852224 1871 1849 1602 48 ------
NM_006202chr1911927 11717 ----
NM_006203chr563729 3505 1766 1168 892 61 11856 1612 --
NM_006206chr452640 2382 2271 1044 496 1395 22649 1154 12889
NM_006209chr8164 ------
NM_006212chr1105380 5371 4865 4689 3629 3550 1746 1462 1322 528 --34904 4098 1751 --
NM_006216chr23671 663 560 --1565 --
NM_006223chrX1131 ------
NM_006237chr1362264 2096 1974 1754 1527 114 --11861 --
NM_006238chr612006 1364 ----
NM_006239chr44673 175 137 119 ------
NM_006243chr111085 ------
NM_006246chr1451338 1282 1175 1157 81 --31142 994 410 --
NM_006247chr191130 ------
NM_006251chr5133307 2757 2286 2191 1354 1330 1320 1300 1233 1119 1097 214 43 ------
NM_006252chr1137171 7051 6040 6007 5905 5266 3043 2557 1601 1497 1370 824 566 25601 3013 36359 5461 4614 --
NM_006256chr132559 1086 969 --32248 990 782 --
NM_006258chr101976 ------
NM_006267chr241834 1407 457 206 ------
NM_006279chr1--1321 ----
NM_006282chr2043486 3207 562 372 --13519 --
NM_006283chr874820 4496 3666 1920 1197 527 34 11595 33755 1676 1089 --
NM_006298chr692305 2260 2116 957 640 581 538 416 235 ----13008
NM_006300chr1941959 1867 1689 238 185 32334 2105 212 --
NM_006306chrX115166 5150 4120 3606 1868 1693 1451 541 360 342 330 --34892 2087 557 --
NM_006313chr1231703 1414 218 1425 21498 1248 --
NM_006315chr454148 3954 1560 1131 566 --23424 2834 14040
NM_006317chr52761 684 --2874 168 --
NM_006325chr121343 ------
NM_006330chr851402 1371 1331 448 387 11167 1193 --
NM_006334chr91289 --2219 96 --
NM_006350chr51251 ------
NM_006357chr21503 1377 ----
NM_006363chr202468 153 --1611 --
NM_006364chr141471 2847 115 --1926
NM_006372chr62496 114 ------
NM_006379chr742160 2086 442 208 --1156 --
NM_006380chr1784380 2856 2799 1685 1527 825 356 98 ------
NM_006386chr2232171 1616 576 12353 --12213
NM_006390chr1241397 479 403 39 21733 592 11690 --
NM_006393chr1043615 977 110 38 --1288 --
NM_006403chr641716 1490 369 207 21798 31 31304 308 275 --
NM_006420chr2083433 3357 3309 3233 2975 2814 2116 1007 12741 ----
NM_006421chr821142 376 --11043 --
NM_006425chr531600 624 430 11387 ----
NM_006434chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_006449chr262082 1962 1557 1541 771 85 ------
NM_006452chr41357 ----1117
NM_006457chr494148 3986 3456 3091 3042 2699 1641 423 215 13405 13965 --
NM_006460chr1741779 1654 1378 447 --1276 --
NM_006465chr15----12201 --
NM_006467chr552225 1474 814 302 69 1485 ----
NM_006472chr11406 11301 ----
NM_006480chr51487 ------
NM_006482chr1273751 3203 3127 1393 836 758 249 11547 12852 13850
NM_006486chr22----1169 1134
NM_006496chr121900 294 21757 153 11530 --
NM_006504chr1022787 2605 ----1191
NM_006526chr2041912 1807 523 455 21856 560 12073 --
NM_006534chr2043063 2554 1009 924 1995 ----
NM_006538chr284067 3578 3351 2632 1170 791 772 638 1384 ----
NM_006540chr83546 331 241 --3993 336 322 --
NM_006544chr1465833 4316 3819 2260 863 762 --45700 4759 2251 1221 24794 4674
NM_006547chr752081 1912 549 193 170 ------
NM_006554chr23241 136 127 --1246 --
NM_006560chr112428 182 ------
NM_006561chr1065631 5063 4503 3974 3889 262 12407 11383 13771
NM_006571chr8----1319 --
NM_006572chr1763194 2952 2808 2673 2346 1129 --33216 2529 875 --
NM_006574chr3----1143 --
NM_006575chr142561 506 --21208 936 --
NM_006577chr221312 38 --1818 --
NM_006585chr212109 37 ------
NM_006595chr1141312 774 713 196 --11412 --
NM_006597chr111190 ------
NM_006599chr1697255 7082 6839 6519 6124 2440 1972 707 398 ----17044
NM_006601chr123712 224 109 --1928 --
NM_006603chrX31856 775 144 11658 22049 432 --
NM_006609chr24955 877 524 403 ------
NM_006614chr373633 3597 3086 2883 1417 1097 252 13616 ----
NM_006626chr921880 528 136 ----
NM_006628chr1564666 4069 1144 681 393 378 34421 763 689 ----
NM_006629chr1821790 490 1708 --1795
NM_006633chr5----1772 --
NM_006636chr25923 782 652 329 121 ------
NM_006646chr1312892 11986 ----
NM_006654chr1264058 4005 1824 1806 970 134 23786 3682 13321 --
NM_006667chrX31122 171 33 ------
NM_006691chr1111161 ------
NM_006695chr171333 ------
NM_006696chr51241 ------
NM_006699chr152686 2567 2528 766 284 12189 1389 --
NM_006703chr61139 ------
NM_006710chr22920 74 ----1708
NM_006716chr74880 522 345 68 ------
NM_006717chr9103310 2951 2561 2514 2414 2112 1221 1107 887 385 --12405 147
NM_006720chr10104664 4447 4015 3737 3341 3186 1503 1210 282 265 ------
NM_006721chr101304 ------
NM_006722chr343029 1086 987 22 1969 2557 471 --
NM_006726chr441034 864 424 332 ------
NM_006729chrX124257 4118 4089 2004 1828 1601 1566 1414 1098 462 144 103 14660 35155 1319 53 13958
NM_006732chr1922069 1578 ------
NM_006735chr71336 1313 1327 --
NM_006738chr1564509 3788 3656 3483 3310 1620 --22997 625 --
NM_006745chr411084 ------
NM_006750chr16137985 7964 7838 6660 6626 6452 6180 5758 5693 5094 2607 2570 2119 --12850 --
NM_006751chr2134 ------
NM_006754chr741260 1069 1031 311 --1185 --
NM_006761chr171837 ------
NM_006763chr121734 86 ------
NM_006766chr81363 --12236 --
NM_006775chr683014 2806 2703 2396 1232 902 464 457 --32783 2752 2664 1762
NM_006777chrX52759 2745 2220 901 891 ------
NM_006785chr1831389 336 257 1579 22224 832 --
NM_006790chr5--188 ----
NM_006805chr541599 1431 1410 1312 ------
NM_006811chr201759 --1402 1648
NM_006813chr6--1149 1244 1186
NM_006818chr11831 --2750 147 --
NM_006823chr831215 499 114 --167 --
NM_006826chr231203 1151 281 1333 1466 --
NM_006827chr1472656 2432 2079 1359 1029 952 662 --13133 --
NM_006832chr143963 387 373 2810 676 21072 709 --
NM_006838chr1241831 1810 1263 589 ------
NM_006852chr1732189 2181 2153 ----12824
NM_006854chr751759 508 470 432 180 21427 248 11252 --
NM_006857chr24721 82 71 64 ------
NM_006868chr1842931 2095 792 258 1585 13126 --
NM_006873chr243109 2968 610 168 --13203 --
NM_006874chr431086 403 112 --1393 --
NM_006888chr1453519 2913 1100 632 318 1356 21208 174 --
NM_006898chr2----1500 --
NM_006908chr731497 456 339 11008 --11032
NM_006910chr16--147 ----
NM_006915chrX22218 1882 32479 505 82 --12364
NM_006920chr231988 593 361 1809 161 --
NM_006922chr282552 2428 2152 2012 1918 1041 942 382 --12586 12411
NM_006924chr1774104 4089 2890 1675 1300 184 123 --24289 944 --
NM_006925chr14--1192 ----
NM_006939chr141746 ------
NM_006948chr2162415 2159 1621 878 774 593 31713 402 376 ----
NM_006963chr10--11237 ----
NM_006965chr1821227 343 1261 21024 481 --
NM_006981chr932381 1198 379 12258 --12772
NM_006997chr104432 398 358 118 ------
NM_007005chr941497 485 367 350 --11517 1272
NM_007006chr1673466 3268 2658 2276 2158 1363 1085 23190 422 13361 1788
NM_007007chr12104824 4280 4072 3433 3080 3071 1657 1163 1097 589 13893 34267 3396 2959 23628 3008
NM_007011chr1544699 4678 378 215 11901 15946 --
NM_007023chr241068 748 143 82 ------
NM_007029chr8189 ------
NM_007034chr141024 1014 987 205 --1410 --
NM_007035chr123644 171 134 1185 1682 --
NM_007038chr21135946 5613 5107 4619 4395 4369 4351 4160 2373 1092 943 762 732 15448 11035 14427
NM_007040chr191778 ------
NM_007042chr372689 2644 2578 1799 1776 437 319 ------
NM_007054chr593961 3928 3918 3910 3708 2812 1140 525 294 ------
NM_007067chr1721263 567 1227 ----
NM_007073chr683696 3319 3102 2898 1502 1270 740 103 11035 ----
NM_007084chr1341347 310 125 51 --11391 --
NM_007106chr1342669 1789 993 206 21019 364 1845 --
NM_007111chr131326 --1855 --
NM_007124chr662005 1815 1630 1274 756 298 --21287 547 --
NM_007125chrY41410 1127 930 325 --1898 --
NM_007145chr1941244 996 988 170 --1450 --
NM_007146chr1722762 1816 22865 2700 42393 520 504 486 --
NM_007147chr1961023 1008 810 800 772 458 ------
NM_007166chr1151315 1273 545 381 337 --11395 1432
NM_007175chr823293 3030 ------
NM_007184chr31553 ------
NM_007187chr133338 266 198 1214 2689 121 1350
NM_007191chr123694 618 604 ------
NM_007192chr144941 931 343 77 ------
NM_007200chr1564509 3788 3656 3483 3310 1620 --22997 625 --
NM_007203chr923489 3320 31337 995 473 13677 --
NM_007207chr11871 ------
NM_007212chr141940 1826 1659 319 31736 813 784 22288 400 --
NM_007214chr62894 136 ----1290
NM_007217chr3----1353 --
NM_007220chrX114659 4649 4013 3383 3043 3027 1400 770 614 114 91 23907 1590 23157 589 --
NM_007231chrX42445 1790 571 378 --22080 285 --
NM_007235chr12----1472 --
NM_007246chr42884 811 ------
NM_007249chr13149280 9266 9067 9060 8989 8167 6819 6712 3050 2934 2383 2356 2249 1446 --39342 9079 7017 18277
NM_007259chr11500 ------
NM_007269chr13582 420 414 ------
NM_007279chr191640 ------
NM_007282chr32947 326 1892 1878 --
NM_007292chr1764477 3871 3681 1040 832 572 --15029 --
NM_007315chr271389 1324 1171 1048 581 340 195 11395 ----
NM_007327chr91234 ------
NM_007345chr1882321 2290 1980 1790 1593 1489 902 501 1335 1915 12118
NM_007358chr162040 1986 1562 763 587 282 ------
NM_007373chr1031412 1309 1128 1118 21326 475 --
NM_007374chr141363 ------
NM_007375chr142451 1723 979 871 --22785 2116 --
NM_009585chr32807 801 1211 --1123
NM_009585chr32807 801 1211 --1123
NM_012062chr123920 146 92 --1925 --
NM_012073chr52201 68 1211 11242 --
NM_012081chr573293 2962 1357 1344 795 568 166 --13096 --
NM_012082chr82964 662 1173 ----
NM_012089chr131505 994 243 ------
NM_012090chr121202 362 21171 277 11283 --
NM_012092chr251595 1264 749 727 302 ------
NM_012093chr131235 190 182 11042 1879 --
NM_012095chr1031041 612 56 23468 1273 ----
NM_012096chr393744 3269 3090 2762 1067 851 842 314 172 22816 1491 12494 1211
NM_012097chr231425 619 465 11840 ----
NM_012102chr122543 148 ------
NM_012109chr191495 ------
NM_012110chr4--1274 1244 --
NM_012115chr63600 488 455 --1442 --
NM_012120chr6102962 2860 2572 2556 2349 2298 1064 775 635 437 1313 11984 --
NM_012124chr111297 1350 ----
NM_012129chr722380 362 1680 22536 1681 --
NM_012137chr162928 2821 2785 2602 2216 296 ------
NM_012141chr1363984 3974 3431 3023 688 79 --31470 468 97 --
NM_012154chr8----1698 --
NM_012158chr1331809 1735 733 --21235 356 144
NM_012164chr977230 7137 6812 5988 5350 5069 2090 21909 1674 31699 896 267 --
NM_012177chr63565 471 78 ------
NM_012180chr41296 ------
NM_012183chr11473 ------
NM_012193chr1184256 4097 3729 1923 1479 1112 997 898 25438 4385 ----
NM_012207chr102816 81 --1294 --
NM_012214chr296391 5546 5352 5294 5083 4551 1141 167 64 46108 5784 2543 928 26198 818 --
NM_012223chr251265 1223 1153 448 347 ------
NM_012233chr23948 813 354 --2907 780 --
NM_012234chr332624 1029 766 --22700 203 13421
NM_012247chr1031004 768 371 ------
NM_012249chr2103561 3368 3134 2766 2364 1424 1408 752 650 525 2695 150 ----
NM_012250chr111562 ------
NM_012252chr784854 4673 4529 4392 3260 1391 677 514 ------
NM_012255chr203302 178 113 ------
NM_012257chr73783 746 413 ------
NM_012259chr631109 1084 297 11401 --11279
NM_012262chr195149 5087 4202 3540 3442 3436 1070 936 112 --23197 981 --
NM_012266chr911122 ------
NM_012281chr772462 2295 2288 965 932 480 454 22412 951 ----
NM_012286chrX3623 532 102 ----1574
NM_012287chr3104379 4098 3198 3179 3125 1810 784 620 350 49 --13350 --
NM_012290chr221493 1362 ------
NM_012294chr794048 3955 3937 3704 3632 3005 899 609 371 13743 1919 13555
NM_012297chr452104 1782 1010 861 55 --11787 --
NM_012300chr521719 762 1521 ----
NM_012301chr7------22106 1892
NM_012307chr1841059 851 754 219 ------
NM_012316chr163529 1736 1163 1122 937 650 1591 25609 1050 --
NM_012326chr21333 ------
NM_012327chr1831382 613 604 1479 ----
NM_012329chr1731670 1131 528 ----11182
NM_012333chr131134 605 301 ------
NM_012334chr5104573 4488 4478 4318 1648 1622 1075 888 786 601 33686 854 183 ----
NM_012340chr201222 ------
NM_012382chr521672 1401 11271 33075 755 302 12954
NM_012388chr1553010 2888 2639 2515 699 12290 ----
NM_012395chr722856 842 13373 1272 --
NM_012399chr2241608 770 201 193 --1619 --
NM_012406chr1221302 959 --31285 1268 283 --
NM_012412chr7----1557 1307
NM_012416chr91807 11019 11199 --
NM_012420chr1022291 1510 ----1159
NM_012428chr1541000 957 880 303 ------
NM_012431chr722275 1240 188 1209 --
NM_012432chr1--1337 ----
NM_012434chr621173 74 1115 137 --
NM_012446chr51250 ------
NM_012449chr7168 ------
NM_012474chr11101 ------
NM_012482chr11253 1173 ----
NM_012484chr53606 252 96 ------
NM_013229chr1282764 2677 2095 1973 743 506 356 116 12688 22034 290 --
NM_013231chr1433193 2775 118 --22832 111 13147
NM_013232chr51414 ------
NM_013233chr221465 468 ----1568
NM_013242chr161374 ------
NM_013243chr1511011 11097 ----
NM_013249chr112338 201 ------
NM_013253chr1131327 1311 150 31452 974 514 11237 --
NM_013255chr7128353 7171 6367 6214 3467 3028 2792 2735 2728 1449 568 542 12585 38865 7710 2395 --
NM_013257chr842038 1639 1589 88 --1140 --
NM_013261chr442352 1116 323 303 12500 13696 --
NM_013263chr16--1152 ----
NM_013269chr1244410 3207 1573 838 --14370 --
NM_013272chr15--129 ----
NM_013278chr16171 1379 ----
NM_013281chr2041287 946 370 257 1523 21515 1340 --
NM_013283chr52807 642 --2936 606 --
NM_013320chr12----1142 --
NM_013322chr71585 11280 11580 --
NM_013341chr252081 1863 448 368 299 --12528 --
NM_013372chr1533032 424 155 13204 --13211
NM_013374chr373150 3096 1174 987 841 592 560 1237 11103 --
NM_013381chr1262106 707 680 674 351 302 ------
NM_013396chr2121493 216 1474 ----
NM_013423chrX51115 1067 830 360 342 11195 1844 --
NM_013427chrX51115 1067 830 360 342 11195 1844 --
NM_013436chr22327 129 ------
NM_013437chr861391 1339 1259 1040 469 204 ------
NM_013438chr951200 508 225 213 171 11526 2421 130 --
NM_013443chr91138 ------
NM_013444chrX41099 439 356 31 11081 21024 141 11162
NM_013446chr731410 973 299 ------
NM_013448chr142735 574 1720 1216 --
NM_013450chr2170 --1416 --
NM_013943chr173246 2588 1180 824 415 408 93 23305 3022 33251 2962 438 11057
NM_013956chr81144 ------
NM_013957chr81144 ------
NM_013958chr8--1138 ----
NM_013959chr8--1138 ----
NM_013960chr81820 ------
NM_013961chr8--1138 ----
NM_013962chr8--1138 ----
NM_013964chr81144 ------
NM_013989chr14105132 5010 3550 3444 1690 1208 997 986 313 286 14670 ----
NM_013995chrX42572 2346 2217 608 22435 2025 1908 --
NM_013996chr71412 --1160 --
NM_013996chr71412 --1160 --
NM_013997chr71412 --1160 --
NM_013997chr71412 --1160 --
NM_013998chr71412 --1160 --
NM_013998chr71412 --1160 --
NM_014021chr152808 970 485 386 239 13365 1196 32549 628 611
NM_014023chr1032700 369 206 1343 12705 --
NM_014038chr72384 307 ------
NM_014043chr3--11118 188 --
NM_014048chr16105297 5202 5194 5111 4010 3977 908 790 769 91 --1900 --
NM_014051chr63436 371 71 --1507 --
NM_014057chr911511 --11249 1301
NM_014059chr131250 ------
NM_014065chr31150 --129 --
NM_014071chr20----1434 --
NM_014089chr1342144 1787 489 449 --11908 --
NM_014106chr1542494 741 480 263 32453 93 59 172 --
NM_014109chr841212 1110 1017 870 1334 ----
NM_014112chr895446 5410 3774 3353 2203 1993 1322 1117 997 21704 1353 13946 34844 1591 1508
NM_014117chr1632192 795 298 --11806 11762
NM_014141chr751375 975 960 856 635 14005 22031 1637 14903
NM_014145chr201235 ------
NM_014154chr341549 1213 647 487 ------
NM_014155chr11107288 7059 6686 6331 5962 5246 2861 2501 2053 1541 12356 27353 6083 --
NM_014160chr341412 443 430 203 ----11121
NM_014181chr22606 550 --1362 1556
NM_014184chr11140 ------
NM_014190chr4--11783 ----
NM_014223chr12578 544 ----1706
NM_014240chr333434 3121 188 1537 11360 --
NM_014243chr4101975 1782 1634 1502 1422 1406 423 304 183 67 ------
NM_014248chr221143 ------
NM_014250chr2221938 1932 ------
NM_014253chrX72367 2286 2177 1836 766 296 69 22432 2011 22198 1889 --
NM_014264chr42439 408 --2500 142 --
NM_014267chr11--291 26 1351 --
NM_014283chr121102 1012 ------
NM_014296chr341516 1002 268 239 1525 ----
NM_014309chr2244618 2088 366 222 25332 4676 3848 273 173 --
NM_014319chr1291765 1657 1647 1360 722 692 583 552 291 1634 11397 --
NM_014325chr1251894 1820 1511 883 452 ------
NM_014326chr1511227 ------
NM_014331chr4127738 7717 7662 7449 7353 7293 5914 5739 5570 2828 1036 495 25690 2492 36911 5446 867 27749 7098
NM_014333chr1152762 2751 2608 1780 322 --32504 2467 573 --
NM_014335chr1541067 559 412 289 ------
NM_014342chr1131440 947 266 ------
NM_014345chr64928 807 411 335 1831 1242 11082
NM_014350chr531060 952 395 --1366 --
NM_014372chr141719 319 300 240 21548 554 ----
NM_014390chr71493 ------
NM_014393chr8102396 1978 1808 1726 1544 1516 939 577 441 291 12371 ----
NM_014395chr421958 1813 11400 21435 1383 --
NM_014415chr361678 1457 1439 491 366 336 ----11445
NM_014421chr422109 47 --12026 2801 57
NM_014423chr595498 5356 4379 3685 3533 1350 1195 746 647 25662 1171 45487 5441 4040 3746 34033 756 681
NM_014432chr61173 ----11506
NM_014445chr341880 1827 1816 366 --12418 --
NM_014447chr431665 1022 243 ----1446
NM_014449chr12------1193
NM_014452chr6----1318 --
NM_014454chr621029 856 1790 --11016
NM_014455chr12446 375 ------
NM_014458chr151406 1250 1188 1064 38 ----1454
NM_014497chr2159 ------
NM_014548chr1541504 1105 1056 400 ----11118
NM_014552chr221471 184 --11530 --
NM_014554chr1232063 1976 496 --1142 --
NM_014570chr22122 ------
NM_014572chr1331523 1324 353 1224 ----
NM_014574chr1451500 1489 1326 639 189 11196 ----
NM_014575chr32551 441 ------
NM_014577chr223919 838 582 --2682 633 --
NM_014584chr142594 181 ------
NM_014586chr2164699 4444 4333 4029 3257 3083 ------
NM_014612chr931064 1002 393 1417 --11081
NM_014618chr91280 ------
NM_014623chr61202 ------
NM_014635chr221460 232 --1143 11448
NM_014636chr984298 3995 3749 3486 2777 1586 1223 416 --1538 --
NM_014669chr16--1117 1123 --
NM_014670chr231238 585 264 1233 11565 --
NM_014671chr711321 ------
NM_014674chr353746 2912 1571 842 597 --23912 3053 --
NM_014675chr11451 ------
NM_014682chr862226 2105 1908 562 352 106 --22231 1597 11686
NM_014683chr1761573 1450 851 747 621 469 --1410 11502
NM_014685chr161482 ------
NM_014686chr1962436 2131 1905 1752 899 459 --21893 518 --
NM_014701chr1523065 1069 13370 13131 --
NM_014702chr673470 3367 1173 398 314 292 167 1802 21384 346 --
NM_014705chr732054 1885 673 --21711 29 --
NM_014707chr742191 1918 430 111 11815 ----
NM_014711chr1632063 1602 617 --11610 1733
NM_014717chr191105 ------
NM_014718chr121677 ------
NM_014721chr6147095 7087 6904 5310 5251 4737 2620 2496 2265 1416 1303 1190 1063 657 26853 1772 46938 6649 5097 465 --
NM_014729chr832328 897 780 12115 11810 --
NM_014730chr1224187 75 --15105 --
NM_014730chr1224187 75 --15105 --
NM_014733chr53827 605 436 --11613 2788 611
NM_014735chrX31622 1523 327 --12007 1313
NM_014738chr171252 1732 ----
NM_014739chr643607 3111 1379 702 23203 1612 21606 267 --
NM_014743chr473134 2910 2316 2253 1162 718 261 13037 12094 --
NM_014746chr2134237 4135 4114 4090 3566 3284 1514 1339 1282 855 711 566 532 13899 24336 4147 --
NM_014750chr141143 --186 --
NM_014751chr851761 1527 815 698 313 --21755 417 --
NM_014755chr2104195 4077 3868 3137 1634 1518 1042 510 339 78 23178 940 23151 2593 --
NM_014756chr113428 414 109 1477 ----
NM_014765chr161714 855 833 745 620 188 ----12288
NM_014766chr763818 3299 2432 501 275 214 ------
NM_014774chr173175 3083 2432 2238 2075 472 327 ------
NM_014781chr851238 974 847 443 294 ------
NM_014782chrX1138 ------
NM_014786chr11------11253
NM_014790chr53207 192 115 ------
NM_014795chr251322 1252 945 454 318 1192 ----
NM_014802chr1231132 953 894 ------
NM_014803chr1051125 982 379 161 133 ------
NM_014806chr9----1462 --
NM_014810chr123636 367 23310 644 ----
NM_014812chr121472 723 --11982 --
NM_014824chr1152015 2005 1816 1736 797 21374 582 ----
NM_014826chr194381 3821 3255 2714 955 611 592 567 510 --13260 --
NM_014827chr121416 359 11630 1370 --
NM_014828chr1431822 647 396 11958 1893 --
NM_014829chr541631 1618 608 44 --177 --
NM_014830chr1263606 3483 2757 2599 1051 886 ------
NM_014832chr1332053 1420 278 --1440 21488 648
NM_014835chr2031938 899 552 ----1646
NM_014836chr1091879 1771 1688 1634 611 367 238 220 143 1394 11546 --
NM_014838chr2252331 1809 748 642 390 ------
NM_014839chr132168 649 301 --12493 --
NM_014841chr671364 1342 1237 1128 1064 234 217 ------
NM_014844chr1433441 1032 934 11077 --14183
NM_014847chr11200 ----1187
NM_014848chr1562673 2446 2158 475 338 57 22273 1923 12623 --
NM_014850chr353993 1391 433 383 369 --11814 --
NM_014860chr262476 2375 2129 807 790 162 22437 63 ----
NM_014862chr1574124 3217 1669 550 423 239 230 ------
NM_014864chr163832 3709 3356 762 703 490 11608 13849 13444
NM_014868chr121175 1879 --1331
NM_014872chr93620 528 165 1771 ----
NM_014873chr144599 4380 1914 1373 164 34779 4492 950 11937
NM_014874chr121456 678 --21876 1862 --
NM_014877chr17227225 7070 6489 6075 5807 5747 5707 5327 4969 2818 2807 2797 1744 1692 1092 874 839 581 551 443 249 186 --47784 7760 5458 341 --
NM_014882chr22580 217 ------
NM_014885chr4151 ------
NM_014887chr133620 602 183 ------
NM_014893chrY42133 1743 903 616 11692 ----
NM_014897chr1753047 2634 793 723 237 1952 1626 13191
NM_014899chr533106 2063 1111 ------
NM_014900chr22289 79 ------
NM_014901chr552311 2304 2033 176 118 12157 12038 --
NM_014903chr1231830 1693 1553 11531 12372 --
NM_014904chr1094018 3846 3435 3078 2948 2635 1469 493 21 --12529 11168
NM_014905chr23224 93 73 --1337 --
NM_014906chr1763319 3238 3125 3055 2662 2548 ------
NM_014910chr191284 1249 ----
NM_014912chr1033322 2681 99 ----23462 2454
NM_014917chr12790 701 1753 ----
NM_014918chr15--11632 11052 --
NM_014920chr653068 2933 2879 1327 872 13538 ----
NM_014923chr1362335 2215 1697 817 558 67 --11540 --
NM_014946chr211994 12630 23120 784 --
NM_014947chr133125 2693 1085 1713 32928 2770 802 --
NM_014949chr12367 54 --159 --
NM_014952chr1522092 1994 ------
NM_014969chr121008 133 21089 475 1318 --
NM_014978chr1061731 1510 619 501 228 205 --21851 679 --
NM_014982chr1454550 3640 1982 1756 1266 11598 34248 1953 296 --
NM_014988chr41206 --22123 469 --
NM_014989chr662057 1494 1342 1261 787 355 ------
NM_014991chr442989 2805 2585 418 --12676 --
NM_014992chr143234 171 147 --1262 --
NM_014994chr1532388 656 162 ------
NM_014996chr32250 116 --2159 102 1957
NM_015000chr1241159 894 695 286 32633 1057 757 22700 2665 --
NM_015001chr11800 ------
NM_015002chr1231988 356 329 --1400 11860
NM_015015chr1922025 1775 ------
NM_015017chr12877 394 ------
NM_015020chr1663823 3681 2995 2534 860 534 12623 12451 --
NM_015024chr841047 1004 575 473 ------
NM_015025chr241914 648 513 259 --22193 2090 --
NM_015026chr1284721 4344 3847 3181 1440 1303 1141 537 21583 1120 11875 1703
NM_015029chr8------1135
NM_015032chr1342028 1068 422 416 ------
NM_015033chr973302 2635 2591 2281 2115 1330 1128 ------
NM_015042chr1534347 3700 2864 ------
NM_015045chr1042017 1983 1814 1586 --1159 --
NM_015046chr952007 660 643 308 130 ----12771
NM_015049chr263108 2214 1011 703 667 523 22289 2171 11037 --
NM_015055chr1122463 1879 11996 12791 --
NM_015068chr753967 3926 3587 3428 1078 ----13562
NM_015074chr164878 4705 4603 3710 3625 595 --13022 --
NM_015075chrX12264 ------
NM_015076chr674516 4035 3470 2908 1325 937 63 11093 11549 24041 1161
NM_015087chr1382583 2420 2299 2224 1714 703 666 655 1709 1109 --
NM_015090chr146084 5431 799 379 16058 21571 563 --
NM_015092chr1694638 4603 4554 4488 3351 1846 1393 962 897 14648 1459 --
NM_015093chr641623 1398 1250 708 --21432 592 --
NM_015097chr361814 1648 1596 1569 820 144 --11848 --
NM_015115chr442945 1232 799 205 33099 2669 2248 1330 --
NM_015129chrX11423 ------
NM_015130chr41378 1289 ----
NM_015137chr852440 2251 1960 1720 1690 22599 87 11965 1748
NM_015138chr1522223 1777 --12658 --
NM_015144chr1663644 3035 2936 2452 1108 157 11097 ----
NM_015149chr141960 1579 784 288 --1278 --
NM_015156chr1463742 3596 2717 2503 1365 404 13286 11193 12729
NM_015158chr94758 724 620 81 1668 1807 --
NM_015170chr842290 1882 622 341 11908 ----
NM_015172chr141379 289 267 238 11598 ----
NM_015176chr141584 1357 673 61 --1678 --
NM_015184chr31155 ------
NM_015185chrX32908 814 430 12005 ----
NM_015187chr4------1290
NM_015192chr2082935 2278 2063 1039 1009 485 395 220 22770 2553 22478 566 --
NM_015199chr311119 22843 629 21863 654 --
NM_015200chr462398 1967 1843 1638 535 328 --11673 --
NM_015208chr1862901 2713 2603 2550 1246 770 23140 241 ----
NM_015209chr131622 745 428 ------
NM_015215chr173062 2362 1206 956 686 350 197 ------
NM_015216chr511467 --21176 70 --
NM_015234chr611365 11030 11140 --
NM_015247chr1665193 3576 1594 1241 1156 274 13877 13957 14699
NM_015250chr921852 1794 21808 690 ----
NM_015251chr1642317 2059 1612 1475 21755 183 1275 --
NM_015252chr21828 ------
NM_015263chr152764 88 --1979 --
NM_015265chr242656 2406 417 411 --2883 704 1528
NM_015268chr31536 ------
NM_015269chr11612 1209 ----
NM_015271chr4114179 4065 3974 3917 3763 2623 2613 1688 1205 1123 178 --11483 11152
NM_015272chr1642090 719 578 290 21945 683 1565 --
NM_015275chr1241535 761 385 333 ------
NM_015278chr663420 3343 2739 1072 881 51 13105 12160 --
NM_015282chr232946 758 196 ------
NM_015285chr1892582 2351 2299 2203 1912 1668 1656 148 28 ------
NM_015286chr1522429 2345 ------
NM_015288chr523712 2884 13602 23634 2896 --
NM_015291chr183479 2670 2588 2197 1159 1040 798 559 --12773 --
NM_015305chr1491597 1584 570 455 446 431 277 171 76 ------
NM_015308chr112841 137 2261 30 1718 1653
NM_015310chr8118383 8325 8208 6633 6209 3303 2931 2528 2154 1922 266 1116 46866 5236 2174 320 16491
NM_015313chr1154851 4509 3980 3280 276 11478 23750 341 --
NM_015315chr533483 2549 144 13357 ----
NM_015317chr252803 1797 828 536 429 --11017 --
NM_015326chr122907 844 ------
NM_015328chr752669 2345 1977 1240 265 23091 2871 12862 --
NM_015330chr22------12612
NM_015335chr1212371 ----12172
NM_015336chr1242010 1977 1662 762 ------
NM_015338chr2031590 339 44 ------
NM_015339chr2041048 1017 986 897 1701 ----
NM_015342chr51124 ------
NM_015347chr1272948 2604 2343 2287 2163 2093 341 1257 12717 --
NM_015349chr641966 957 925 873 --12455 --
NM_015358chr2151249 1134 1018 366 125 11057 1134 --
NM_015360chr51196 ------
NM_015361chr22746 366 --2783 172 --
NM_015375chr194914 4624 4512 4337 3081 1660 1020 1000 841 --13782 13715
NM_015382chr142779 712 ----1649
NM_015385chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_015387chr242000 1487 511 82 1806 11376 --
NM_015423chr1141490 1293 1181 207 ------
NM_015429chr341111 911 457 97 --1880 --
NM_015435chr831426 1083 1017 1206 11247 --
NM_015436chr443110 2884 2850 1224 1294 --194
NM_015446chr141653 1363 1175 256 --1472 --
NM_015455chr544039 997 978 521 --33953 3727 1340 --
NM_015461chr182112 91 1132 --1212
NM_015462chr171272 ------
NM_015464chr731059 1028 224 ------
NM_015483chr731132 774 342 1753 ----
NM_015496chr81267 ------
NM_015509chr1241645 1626 1560 1031 --11586 --
NM_015520chr382634 2587 2526 2104 2083 2075 917 888 --1838 --
NM_015532chr1551916 831 516 462 240 --12352 --
NM_015535chr243827 2693 1228 496 12752 ----
NM_015548chr64812 769 644 137 --1987 --
NM_015550chr783305 2285 2191 582 542 424 159 33 1388 13200 --
NM_015554chr1562263 2180 1065 802 544 164 ------
NM_015555chr631278 569 160 --2229 107 --
NM_015560chr342596 2578 2381 140 12816 ----
NM_015565chr2112064 ------
NM_015567chr1351293 1135 929 820 32 --1969 --
NM_015568chr2043750 3082 1399 326 --14050 --
NM_015569chr184842 3290 3270 3264 3157 3100 1808 1590 --1134 --
NM_015570chr731420 1166 135 ------
NM_015571chr642220 2070 1877 987 11758 2685 247 1157
NM_015575chr283551 3525 3514 3319 3258 2685 906 540 13690 ----
NM_015576chr372528 2115 2095 1170 932 775 564 --1100 22865 497
NM_015578chr1932004 342 255 --11763 --
NM_015626chr1741192 344 314 133 11016 --11198
NM_015630chr22730 151 1863 1857 --
NM_015640chr144797 4516 280 206 25163 2032 4527 300 259 218 15116
NM_015641chr741270 1015 804 52 ------
NM_015646chr124872 863 344 299 11270 --11081
NM_015670chr171145 ------
NM_015711chr191775 ------
NM_015844chr182804 230 ----1816
NM_015846chr182804 230 ----1816
NM_015847chr182804 230 ----1816
NM_015866chr111223 11162 11516 11450
NM_015872chr11245 --1302 --
NM_015874chr41225 ------
NM_015878chr861985 1792 878 696 447 202 --12033 --
NM_015879chr1898003 7652 7120 7103 2757 2143 774 590 230 --48618 8218 1519 185 --
NM_015881chr1131327 1311 150 31452 974 514 11237 --
NM_015886chr8105745 5490 4886 4491 4014 1578 363 347 258 53 ----14851
NM_015888chr143119 3070 879 140 22444 323 12811 --
NM_015891chr63733 363 73 --1368 --
NM_015895chr6----1159 --
NM_015905chr7--1616 ----
NM_015906chr194312 4003 3799 3756 1814 1694 1047 959 517 14787 ----
NM_015933chr3149 ------
NM_015934chr21221 ------
NM_015956chr191222 ------
NM_015971chr171432 ------
NM_015975chrX41832 1535 1172 740 --2507 26 --
NM_015995chr1565551 5168 5155 4352 2113 1015 --25459 5094 --
NM_015999chr11682 ------
NM_016009chr154742 1973 1261 759 42 14313 ----
NM_016018chr862375 2316 2004 1937 1816 262 --22543 625 --
NM_016021chr682967 2356 1997 891 821 413 99 56 --12891 1839
NM_016032chrX1571 ----11296
NM_016037chr11955 ------
NM_016063chr63690 627 59 ------
NM_016072chr1262285 1870 1600 1585 507 444 ------
NM_016073chr15----11062 --
NM_016075chr1352943 2564 2287 1996 1172 --23066 1988 --
NM_016076chr152899 2061 2052 2042 1143 --2824 785 --
NM_016081chr452143 1730 1709 1552 637 1521 11976 --
NM_016083chr653689 3413 2414 913 747 --22826 1378 23860 433
NM_016087chr731428 1381 1132 --11492 --
NM_016096chr872057 1840 1767 1663 1512 729 490 --11338 --
NM_016100chr204420 405 364 278 ------
NM_016106chr14----1162 --
NM_016107chr551383 1247 370 334 309 ----11335
NM_016121chr131151 1055 351 --1928 --
NM_016124chr141406 1232 495 69 ------
NM_016125chr173501 473 203 1566 ----
NM_016128chr31101 --1342 --
NM_016131chr231509 257 200 1269 11964 --
NM_016132chr1543273 2655 2226 1029 --12420 --
NM_016152chr31144 ------
NM_016162chr123836 328 289 --1885 --
NM_016195chr103211 81 65 ----194
NM_016203chr72847 98 1192 ----
NM_016205chr43964 317 138 1255 21435 925 175
NM_016206chr3138674 7869 7559 7530 6815 6702 6432 6402 6056 5785 5657 720 392 28778 1550 31765 941 456 --
NM_016217chr673666 2263 1305 1296 1073 934 220 1459 --13672
NM_016221chr542272 2066 453 307 155 11821 --
NM_016227chr121102 1012 ------
NM_016248chr1363490 3353 3319 3084 2781 1379 --33439 974 254 --
NM_016252chr22838 711 ----1844
NM_016255chr622937 47 13348 1644 12832
NM_016257chr122942 2572 --13410 --
NM_016260chr2117413 7369 6878 6870 5985 5089 2870 2698 2524 2389 1785 35125 4879 4755 1915 --
NM_016262chr6--1569 1562 --
NM_016270chr19--1392 ----
NM_016271chr1852243 2135 890 822 528 --22340 327 --
NM_016279chr53507 490 69 ------
NM_016281chr1241045 845 793 340 21022 466 ----
NM_016284chr162975 923 --2906 187 --
NM_016287chr151728 1294 661 250 65 ------
NM_016289chr252253 2117 739 597 285 ------
NM_016303chrX3398 157 123 ------
NM_016307chr9--1268 ----
NM_016315chr251858 1829 1620 480 320 --1596 --
NM_016319chr121772 1749 ----
NM_016322chr952459 2393 1192 1044 656 33154 2118 1033 ----
NM_016356chr642407 1894 1180 732 1893 ----
NM_016357chr1241167 913 303 238 ------
NM_016374chr131134 1085 361 --21334 351 --
NM_016374chr131134 1085 361 --21334 351 --
NM_016376chr1774066 3875 3831 1647 1548 813 540 11456 24071 3808 --
NM_016395chr1551945 1887 1795 1747 224 ------
NM_016396chr1552949 2588 2153 1093 95 1501 42120 1927 691 523 --
NM_016404chr11140 ------
NM_016410chr91614 ------
NM_016422chr1142860 2696 1964 448 1245 12080 --
NM_016436chr2022713 1662 21750 1011 ----
NM_016472chr1441392 995 613 89 --11247 --
NM_016485chr642085 2079 910 317 --127 1716
NM_016499chr11----1562 --
NM_016505chr12661 601 ------
NM_016507chr1752979 2392 2236 135 107 ------
NM_016513chr653068 2933 2879 1327 872 13538 ----
NM_016530chr1563724 3704 3140 2797 732 691 ------
NM_016531chr484076 3010 3004 2571 1573 1159 1073 833 14131 1334 33556 3311 364
NM_016542chrX41685 1185 425 227 --11474 --
NM_016545chr11892 ------
NM_016584chr121258 ------
NM_016603chr541725 1687 1372 42 ------
NM_016604chr521266 1147 ------
NM_016623chr83613 544 520 --1244 --
NM_016626chr1841609 1472 1462 1223 --21455 524 --
NM_016644chr51112 ----2350 179
NM_016654chr1531151 943 567 11042 1189 --
NM_016656chrX3323 104 57 ----1384
NM_016824chr1041872 1758 1680 1518 11672 ----
NM_016830chr12----1557 --
NM_016929chr654068 4052 4008 3853 2837 --12808 --
NM_016946chr153278 2624 1119 837 32 13641 ----
NM_016950chr451506 1221 1013 442 428 --11484 --
NM_016952chr1194011 3768 3345 3226 1580 1573 611 426 146 1729 ----
NM_016953chr285759 5752 5318 4496 4264 3977 2070 474 11055 34777 4746 3853 15704
NM_017412chr82920 908 ----11315
NM_017415chr553715 3314 1754 1459 1345 ----14534
NM_017420chr14103753 3639 3061 3006 2675 696 475 337 254 118 1183 ----
NM_017423chr442242 1880 1848 1663 --12077 --
NM_017426chr44456 242 223 37 --1541 --
NM_017447chr2164368 3487 3355 1376 539 468 11005 11674 31237 1143 837
NM_017452chr201580 ------
NM_017453chr201580 ------
NM_017454chr201580 ------
NM_017455chr1541000 957 880 303 ------
NM_017489chr83535 180 54 ------
NM_017519chr641220 1025 321 263 --1440 --
NM_017534chr17184 ------
NM_017544chrX1962 1166 ----
NM_017545chr202569 370 129 --149
NM_017546chr2199 --2591 309 --
NM_017548chr351908 1896 1546 670 171 1816 ----
NM_017551chr1022591 179 --11797 --
NM_017563chr376279 5486 5131 3965 2259 1391 474 36391 4269 860 14722 --
NM_017582chr12421 66 --21817 1805 --
NM_017590chr2232504 2168 1855 12556 ----
NM_017594chr9113255 2916 2887 2822 1215 1075 999 354 127 113 87 --11101 13023
NM_017599chr123588 437 387 11980 ----
NM_017610chr1571397 1312 711 438 257 237 163 21477 473 1183 --
NM_017615chr10156 ------
NM_017628chr443622 1559 184 140 21843 1527 ----
NM_017632chr4196 ----1335
NM_017633chr673347 2827 1562 1426 1076 657 158 --11555 13414
NM_017634chr851877 1797 1596 1494 153 11806 1353 --
NM_017637chr9159375 9329 9173 8453 8103 7410 6703 6124 3603 2717 1939 1804 568 126 118 --23486 1926 --
NM_017640chr63914 718 247 ------
NM_017641chr1221027 51 --1401 --
NM_017643chr1741241 1111 272 219 22674 907 12883 --
NM_017644chr3105071 4099 3951 3836 3644 3411 2053 763 355 339 25215 1928 1440 --
NM_017650chr7155557 5139 4927 4758 4721 4299 2246 2183 2111 1734 1604 1379 1359 1187 151 15383 ----
NM_017658chr14104595 3542 3378 1507 1482 1019 993 847 413 92 14369 24503 3647 21247 1218
NM_017660chr1913292 12426 ----
NM_017664chr133841 191 169 1888 1779 --
NM_017666chrX32222 2129 1481 ------
NM_017669chrX123 ------
NM_017672chr1521212 451 11312 ----
NM_017680chr9----11009 --
NM_017704chr11----3311 164 60 --
NM_017719chr372350 2293 2106 1954 1883 168 155 22012 1787 ----
NM_017730chr3----1699 --
NM_017736chr1653128 3070 2775 960 757 1111 12370 --
NM_017747chr51308 1387 ----
NM_017752chrX31795 1747 141 ----12116
NM_017754chr634955 3626 3610 13592 21504 1059 15068
NM_017761chr131437 961 470 ------
NM_017769chr1473058 2936 2782 2477 2317 1084 498 --12734 --
NM_017772chr621788 1263 ------
NM_017779chr132739 1890 524 ------
NM_017784chr32857 816 1103 ----
NM_017789chr21301 ------
NM_017798chr2021169 155 ----1179
NM_017801chr33627 546 44 --22528 1996 --
NM_017810chr16146 ------
NM_017811chr973150 2652 2593 1209 1053 527 221 ------
NM_017813chr8125518 5102 4101 2114 1488 1345 1264 1073 749 627 509 90 12233 35266 4475 3794 --
NM_017824chr1042166 885 735 509 ------
NM_017831chr1884635 2927 1833 1476 1360 1313 1285 146 --14762 --
NM_017848chrX53678 1801 1213 945 722 14389 14444 --
NM_017849chr263144 2930 2627 2449 2263 834 ------
NM_017864chr81187 ------
NM_017890chr85677 659 197 174 75 --1376 11680
NM_017902chr1095138 1998 1745 1732 1716 726 356 342 255 ------
NM_017907chr111450 ------
NM_017922chr142598 94 1241 1270 --
NM_017933chr241462 1261 632 160 21638 1113 11609 --
NM_017938chrX72036 2024 2012 1938 290 100 45 2762 268 21845 674 --
NM_017953chr131106 1094 59 --1152 11100
NM_017954chr731291 1228 118 11155 ----
NM_017964chr22623 74 --1166 --
NM_017987chr1042062 1916 1716 26 1510 1191 --
NM_017988chr123933 867 699 --1689 1616
NM_017998chr941385 1330 1176 224 --1229 --
NM_018009chr121109 ------
NM_018011chr133465 425 211 ------
NM_018025chr19191 ------
NM_018036chr1474322 4174 4122 4015 3483 1599 1306 --1771 --
NM_018043chr11--11407 ----
NM_018046chr541862 1458 1383 418 21720 1624 ----
NM_018051chr74362 337 109 96 ------
NM_018054chr161504 ----1450
NM_018056chr11123 ------
NM_018060chr11364 --1294 --
NM_018061chr151309 1113 227 171 118 ------
NM_018064chr6--1214 ----
NM_018070chr1----1238 --
NM_018078chr44852 795 696 404 --1272 --
NM_018084chr282975 2797 2778 2655 2436 935 853 843 12076 32868 1180 1052 --
NM_018085chr177539 7167 5380 2632 1416 1320 1279 17099 27715 874 --
NM_018086chr231765 733 170 --21879 1796 --
NM_018092chr1631481 1343 571 ------
NM_018098chr331140 885 34 11198 11035 --
NM_018112chr92172 78 ------
NM_018119chr16----1257 --
NM_018121chr1073050 2774 2657 2408 2129 2072 743 --32571 748 560 --
NM_018126chr451461 1085 559 468 126 ----11130
NM_018133chr352034 1791 1617 866 316 12190 ----
NM_018145chr151503 ------
NM_018151chr24706 689 318 223 1615 1207 --
NM_018155chr383420 3408 3380 2345 2311 2220 2157 343 12193 1761 --
NM_018157chr12103226 3185 3173 3160 3027 2369 2234 2097 1164 750 --12049 --
NM_018158chr22212 65 ------
NM_018159chrX----11403 --
NM_018176chr431554 1353 171 ------
NM_018181chr1851777 1747 1732 1278 1264 ------
NM_018182chr1731815 1412 670 --1899 --
NM_018184chr362063 2038 2024 1410 542 531 11900 11976 --
NM_018195chr1141873 1521 418 266 --11665 --
NM_018200chr1542105 1777 543 187 ------
NM_018201chr9----11734 --
NM_018202chr1198 --1289 --
NM_018206chr163740 708 544 ------
NM_018211chr162242 1857 1447 424 392 214 ------
NM_018214chr61401 --1496 --
NM_018227chr422552 310 2275 263 11188 --
NM_018237chr102225 84 --1111 --
NM_018243chr474047 3939 2817 1447 1297 712 409 ------
NM_018247chr683035 2652 2167 1180 533 402 278 36 --21005 374 12211
NM_018254chr152107 1850 1617 520 311 ----12057
NM_018263chr222463 1609 ----1306
NM_018270chr202722 623 ------
NM_018272chr12121 ------
NM_018286chr1731022 844 387 ------
NM_018287chr103461 325 241 --21295 72 --
NM_018293chr342888 2278 448 67 --22795 2374 --
NM_018296chr16----1108 --
NM_018298chr131016 880 732 --1272 --
NM_018299chr872793 2623 2590 562 414 150 135 --32556 1392 306 --
NM_018312chr1142176 592 356 232 ------
NM_018313chr352631 2112 955 669 111 --21874 1687 --
NM_018314chr112655 114 ----1755
NM_018321chr5151 ------
NM_018323chr451788 1422 234 215 128 ------
NM_018328chr2155 ------
NM_018330chr1031423 528 318 21676 462 ----
NM_018334chr7--1363 ----
NM_018335chr141125 ------
NM_018339chr921482 340 1617 --31798 541 396
NM_018340chr1674504 3755 3707 1443 873 313 186 1417 14340 --
NM_018351chr1243057 2905 782 468 2918 304 24744 4640 --
NM_018360chrX2115 22 ------
NM_018361chr894107 3704 2486 1292 1175 564 480 320 298 1570 ----
NM_018362chr1173913 3742 3726 3342 520 174 33 ------
NM_018364chr1104090 3916 3891 3692 3527 3390 3366 1625 1619 1515 11601 11630 --
NM_018367chr111725 2959 482 ----
NM_018370chr1242239 1584 156 104 ------
NM_018372chr11475 ----1515
NM_018374chr734227 1789 745 1668 ----
NM_018387chr9----1436 --
NM_018388chrX2475 320 ----1121
NM_018394chr33634 501 35 --1140 --
NM_018403chr323724 3527 23871 3298 11035 --
NM_018409chr472818 2624 2351 2114 1273 1009 56 --12407 --
NM_018416chr1242567 2376 935 610 ------
NM_018427chr1621057 502 ------
NM_018429chr542811 779 587 470 22466 1928 12549 --
NM_018437chr94555 514 221 58 ------
NM_018444chr822311 2199 1734 12186 1460
NM_018448chr1221116 190 ------
NM_018452chr6_random63343 2807 2362 1541 1236 979 ----13860
NM_018464chr10----1346 --
NM_018471chr21399 ------
NM_018475chr4199 --1653 --
NM_018490chr1141695 1536 1386 216 1328 ----
NM_018553chr1721528 1248 ------
NM_018555chr1932236 1457 618 11485 12037 --
NM_018557chr241597 1500 670 34 ----11393
NM_018566chr132028 1739 763 35133 4809 3755 35085 4260 840 11442
NM_018569chr451513 1197 1045 1006 63 ------
NM_018571chr2166 ------
NM_018638chr1285718 5643 4958 4615 4545 4446 2068 1238 25131 736 35262 1506 455 44676 4165 4127 3897
NM_018640chr1262671 1777 1007 429 381 373 --21842 301 --
NM_018650chr141405 440 325 235 ------
NM_018667chr1622666 2654 ------
NM_018682chr73544 501 133 ------
NM_018683chr2011655 11638 ----
NM_018686chr121237 ------
NM_018695chr541911 807 693 490 --1818 --
NM_018700chr52626 457 --21284 545 --
NM_018703chr16--147 ----
NM_018704chr11147 ------
NM_018710chr821341 110 --1439 --
NM_018713chr14927 875 431 111 --1245 --
NM_018718chr762190 2113 1983 1749 687 116 ----12293
NM_018834chr52913 824 --1646 --
NM_018844chr73487 191 134 22086 1966 ----
NM_018847chr951818 1685 628 606 450 --2177 164 --
NM_018890chr731497 456 339 11008 --11032
NM_018896chr171289 ------
NM_018898chr522251 2183 ------
NM_018899chr522251 2183 ------
NM_018900chr522251 2183 ------
NM_018901chr522251 2183 ------
NM_018902chr522251 2183 ------
NM_018903chr522251 2183 ------
NM_018904chr522251 2183 ------
NM_018905chr522251 2183 ------
NM_018906chr522251 2183 ------
NM_018907chr522251 2183 ------
NM_018908chr522251 2183 ------
NM_018909chr522251 2183 ------
NM_018910chr522251 2183 ------
NM_018911chr522251 2183 ------
NM_018945chr633548 2315 1439 --32242 1127 910 --
NM_018948chr11268 31433 1388 959 11188 --
NM_018951chr721233 1050 --21159 810 --
NM_018970chr741183 1057 921 909 2675 607 ----
NM_018975chr163818 538 90 --1201 --
NM_018976chr1252880 2600 2479 1109 950 22774 2272 12400 --
NM_018977chrX1113 ------
NM_018979chr1242115 807 149 103 1819 ----
NM_018981chr2----2892 264 --
NM_018992chr1621697 638 ------
NM_018993chr2051340 1129 570 298 29 ------
NM_018999chr1073912 3717 1463 1421 1079 665 22 --23183 1526 --
NM_019001chr344724 3952 3530 3273 31434 840 265 24745 4048 --
NM_019003chrX142 ------
NM_019004chr752162 933 871 764 277 21875 1708 ----
NM_019015chr71100 ------
NM_019024chr2124 ------
NM_019027chr462596 2127 1973 1648 588 551 ------
NM_019030chr51162 --1205 --
NM_019035chr44189 146 102 34 11655 21940 1559 --
NM_019036chr631093 946 794 ------
NM_019041chr662628 2133 2033 1839 251 122 12562 --1168
NM_019044chr2104563 4553 4488 4257 3462 1737 1704 1067 792 307 --23542 3292 14743
NM_019045chrX2306 48 ----2944 329
NM_019049chr13301 221 112 --2237 160 --
NM_019050chr451902 1738 842 442 227 ----11873
NM_019053chr101992 ------
NM_019063chr241798 1453 728 309 --12275 --
NM_019069chr362630 2063 2055 625 583 563 ------
NM_019071chr71168 1784 195 --
NM_019073chr1177 ------
NM_019080chr1341525 588 488 216 ------
NM_019083chr121345 573 1330 ----
NM_019084chr1022518 2453 ------
NM_019114chr952517 2377 1749 1616 494 ----11846
NM_019555chr351519 1408 448 217 58 --21373 579 1630
NM_019556chrX31209 331 129 --11112 --
NM_019590chr102983 322 --11086 --
NM_019593chr2092496 2263 1092 1086 1049 754 678 435 393 --31097 706 440 --
NM_019597chrX2722 476 1208 1744 --
NM_019600chr15--1597 ----
NM_019610chr122189 1527 ------
NM_019842chr63409 316 159 ------
NM_019852chr141110 ------
NM_019858chr12------1193
NM_019860chr1011112 --1452 --
NM_019903chr1041872 1758 1680 1518 11672 ----
NM_020066chr12950 770 ------
NM_020119chr764021 4002 2576 561 425 244 23865 3830 12899 --
NM_020122chr285615 5345 5126 4313 1228 393 319 40 1933 1943 22238 1964
NM_020132chr2165089 4592 4169 4153 3374 1368 14114 --14432
NM_020135chr61347 ------
NM_020144chr721845 432 11687 1546 --
NM_020154chr151285 ------
NM_020159chr4--11610 11617 --
NM_020177chr533311 3289 1177 ------
NM_020184chr212354 ------
NM_020189chr82136 126 ------
NM_020193chr113980 387 67 ------
NM_020194chr25694 649 588 192 84 --1121 --
NM_020204chr12725 221 ------
NM_020205chr143445 977 802 753 12276 ----
NM_020228chr1132171 1613 974 1439 ----
NM_020239chr112252 --11966 --
NM_020240chr562387 763 665 357 131 112 ------
NM_020242chr31455 ------
NM_020243chr221618 ------
NM_020245chr684998 4737 4616 3918 3461 1864 1596 379 24955 4588 24905 4565 34633 994 370
NM_020297chr1263211 2254 1392 1075 703 487 1243 33562 1300 28 --
NM_020307chr32297 60 ------
NM_020319chr71932 --170 1683
NM_020336chr2063804 3672 1484 398 326 307 --13121 --
NM_020337chr483086 3077 3009 2078 440 379 335 221 ------
NM_020338chr1043660 3306 3082 2856 --23615 3060 --
NM_020341chr2032044 1414 95 11798 1428 --
NM_020342chr242606 2353 2162 1921 2703 535 ----
NM_020345chr31734 ------
NM_020346chr1141499 1333 392 218 ------
NM_020354chr10----1936 --
NM_020357chr381451 1186 1178 1157 1104 1037 546 434 ------
NM_020381chr61702 31918 1805 1595 21589 106 183
NM_020390chr384327 4197 3382 1552 1524 1093 1062 183 24918 399 33272 1414 1259 --
NM_020420chrY6723 601 577 526 377 50 1214 ----
NM_020422chr162857 636 ------
NM_020432chr762303 1637 744 702 660 401 ------
NM_020440chr143311 3274 2439 656 12054 12845 --
NM_020443chr197011 6604 5906 5425 4555 4547 2745 2066 795 ------
NM_020449chrX2675 188 1181 ----
NM_020456chr1332261 1802 26 --22273 136 12267
NM_020466chr664417 3983 3453 447 177 52 24510 1217 23326 3107 --
NM_020529chr141476 --1443 --
NM_020548chr21213 ------
NM_020640chr3----1645 --
NM_020647chr862293 2116 2048 1963 379 368 ------
NM_020648chr1852839 2806 2781 2501 1928 --12174 --
NM_020651chr241750 1642 1601 396 21619 107 ----
NM_020654chr321150 471 ------
NM_020673chr2087560 6725 6138 5208 4932 4816 2155 1546 --12385 --
NM_020680chr11----152 --
NM_020696chr31302 ------
NM_020699chr145235 4017 3504 929 ------
NM_020708chr201542 ------
NM_020718chr1686436 6129 4523 1996 1594 1262 961 143 --35040 4873 4174 --
NM_020727chr2184055 3984 3861 3176 2880 2765 1302 273 --12826 23362 1398
NM_020732chr641220 1025 321 263 --1440 --
NM_020734chr1282780 2702 2189 2063 1115 1066 741 730 22288 450 12464 --
NM_020739chr1553555 3459 1395 1226 1123 23894 1584 22741 317 --
NM_020742chrX62726 2202 1999 1072 966 630 11758 ----
NM_020747chr51907 --1336 --
NM_020752chr1052698 2516 515 463 293 11079 --12002
NM_020755chr651641 1431 1267 359 169 ------
NM_020760chr261932 1742 1403 1390 697 610 ------
NM_020762chr121178 ------
NM_020766chrX33601 735 590 --24603 127 1281
NM_020768chr573227 3196 3040 1105 754 560 523 1815 ----
NM_020772chr17138067 7065 6456 5638 5315 3226 3133 2567 1951 1924 1451 779 568 27102 3475 17119 --
NM_020774chr1896192 6073 5331 2154 1212 611 420 296 35 ------
NM_020782chr1234176 753 363 14724 21416 893 --
NM_020783chr1831781 1775 470 22213 170 11505 22162 1563
NM_020794chr131563 225 120 ----21390 196
NM_020800chr371491 1207 1189 921 448 350 127 --1177 --
NM_020801chr552409 2292 2179 1646 575 --12337 --
NM_020802chr1143332 2145 1132 57 --13337 11094
NM_020803chr43966 586 129 --11981 --
NM_020805chr1851847 1783 1575 1514 349 1442 184 --
NM_020809chr1152276 2204 1755 1511 661 ------
NM_020810chr1432875 922 563 161 ----
NM_020819chr611180 ----163
NM_020825chr1653839 3668 3653 2551 456 --13072 --
NM_020839chr311145 ------
NM_020841chr1283650 3396 3136 2649 2499 1614 324 277 11032 ----
NM_020843chr15122 ------
NM_020844chr8137472 7225 6985 6940 6708 5962 5319 2758 2177 1898 811 305 81 17369 27443 7123 17721
NM_020856chr1941133 588 452 170 1414 --1289
NM_020858chr1542361 855 396 97 --1401 --
NM_020859chr453887 3675 2577 578 342 --33919 2555 2535 --
NM_020868chr241497 1285 670 273 1256 ----
NM_020870chr442094 1924 1750 209 --2785 467 --
NM_020871chrX32561 2496 891 --22533 2149 32409 865 644
NM_020872chr331590 1171 81 ----11800
NM_020873chr33845 659 90 ------
NM_020886chr1121208 984 1226 ----
NM_020895chr19------1284
NM_020897chr11849 ------
NM_020898chr123626 608 62 --1673 --
NM_020899chr17----12258 --
NM_020909chr241415 1085 1048 153 14129 ----
NM_020917chr1963839 2803 2775 1577 581 23 22790 1147 32672 956 561 1337
NM_020918chr1073632 3431 3086 3044 2535 2392 1069 --13049 --
NM_020920chr14141 ------
NM_020932chrX2488 94 --165 --
NM_020940chr1082840 2585 2577 2496 1981 1078 777 396 12719 ----
NM_020948chr1113691 3518 2846 2679 2449 2288 2250 1119 1014 654 317 11144 32962 2622 2558 1342
NM_020951chr1961802 830 749 734 685 345 1285 1423 --
NM_020960chr944763 4331 3524 1057 --33757 3563 763 --
NM_020962chr1552487 2387 2346 579 252 ------
NM_020973chr42244 183 --1501 --
NM_020977chr421431 553 ----12171
NM_020987chr1021374 1176 ------
NM_020988chr161163 ------
NM_020993chr122453 304 ------
NM_021003chr141659 ------
NM_021005chr151321 1922 --1200
NM_021007chr292389 2226 2140 825 797 789 781 530 121 ------
NM_021032chr362011 1856 1540 1441 455 288 --11615 --
NM_021033chr1343508 3087 220 91 12281 1474 --
NM_021038chr361345 1175 951 499 468 306 --43300 931 382 295 --
NM_021047chr191717 ------
NM_021061chr843755 1802 1403 810 ------
NM_021069chr452150 1389 677 466 437 ------
NM_021072chr562477 2368 2360 2242 513 321 1947 --12510
NM_021097chr262893 2762 2332 1979 1089 60 22704 925 ----
NM_021115chr221156 ------
NM_021116chr778689 8235 7603 5523 5512 1142 774 25644 3430 ----
NM_021129chr101280 ----158
NM_021132chr1041367 1206 892 465 ------
NM_021136chr143741 619 258 2666 219 ----
NM_021140chrX31108 981 942 ------
NM_021141chr2--1241 ----
NM_021148chr711835 ------
NM_021158chr201832 ------
NM_021167chr722275 1084 --22291 2262 --
NM_021180chr11729 --1773 1820
NM_021190chr161297 1116 1075 945 841 337 --1950 --
NM_021222chr141448 1082 1032 55 --2902 395 --
NM_021227chr42521 490 ------
NM_021237chr31354 ------
NM_021238chr1221920 1613 22019 1326 ----
NM_021239chr142541 514 ------
NM_021255chr1423236 2828 13934 23977 2695 --
NM_021269chr1951979 1922 1798 1568 23 12014 ----
NM_021569chr91234 ------
NM_021622chr1042271 1742 1605 273 ----11706
NM_021629chr3104783 4497 1675 1571 1554 1424 568 443 328 272 1213 14634 --
NM_021633chr131378 1350 319 ------
NM_021637chrX1243 --1322 --
NM_021638chr454715 3966 1909 1655 166 --14855 --
NM_021643chr241880 1842 1577 1170 ----21220 740
NM_021644chr102816 81 --1294 --
NM_021647chr464739 4555 4481 4087 359 24 ------
NM_021738chr103741 690 164 ------
NM_021803chr4169 ------
NM_021813chr635573 4703 2118 --45871 5196 5105 4812 --
NM_021814chr631567 1383 360 1482 ----
NM_021818chr1441159 1027 957 501 --1134 --
NM_021911chr584005 3423 1903 1831 1800 1342 1285 673 --23472 1529 --
NM_021912chr1563851 3563 1033 1023 292 187 1411 ----
NM_021914chr142286 94 ----1502
NM_021942chr42829 300 ------
NM_021946chrX2526 466 ------
NM_021954chr1332892 1041 915 13156 13613 11006
NM_021959chr6148 ------
NM_021961chr1187471 7116 6315 6264 6207 4872 1166 783 --27280 398 --
NM_021963chrX2554 78 ------
NM_021964chr3156054 5924 5722 4968 4602 4477 2311 1402 1293 888 860 720 655 155 105 21999 561 46546 6384 5852 1451 1222
NM_021970chr41721 ------
NM_021977chr663732 2612 1470 1457 1430 86 --12490 --
NM_021978chr111505 ------
NM_021998chrX41194 1086 510 257 1127 1981 --
NM_022037chr22677 355 --1115 1878
NM_022045chr8----1187 --
NM_022048chr15105950 5856 5766 5413 4955 4820 4156 4088 3927 797 ----15655
NM_022080chr2082628 2145 1126 935 638 557 374 126 ------
NM_022098chr222421 138 194 2306 105 --
NM_022104chr201179 ------
NM_022114chr194628 4392 4043 3849 1720 1689 1672 624 556 ------
NM_022118chr133580 186 164 --1521 2495 454
NM_022130chr531443 474 355 1569 ----
NM_022133chr861771 1365 331 275 194 122 --11867 --
NM_022143chr721583 1575 --1587 --
NM_022154chr42470 262 --21314 296 --
NM_022164chr12645 514 ------
NM_022166chr1646195 5885 4703 2489 16117 14151 16264
NM_022169chr1111501 ------
NM_022170chr741642 456 213 141 ----11560
NM_022173chr22677 355 --1115 1878
NM_022351chr873733 3631 2715 2634 1476 1124 295 1521 12997 13783
NM_022373chr72875 140 1864 ----
NM_022444chr72527 443 --21949 1863 --
NM_022456chr12157673 7360 7010 6238 4740 4670 2875 2510 2419 2079 1316 1278 993 809 656 --21257 631 1338
NM_022458chr762961 2003 1185 882 820 731 12585 1453 --
NM_022459chr13146384 5729 5475 5334 5180 4790 4690 4265 1883 1787 1626 1016 843 137 --46106 4912 4742 1809 --
NM_022465chr1212187 ------
NM_022469chr153218 2366 1172 748 420 --12551 1870
NM_022474chr1472820 2523 944 935 855 812 177 ------
NM_022476chr1631023 296 132 ----1183
NM_022477chr2061687 486 423 352 287 107 --11266 --
NM_022484chr72222 79 --1998 --
NM_022490chr9177 ------
NM_022491chr1243308 2964 2932 405 --12856 --
NM_022497chr353267 3166 3111 2693 2636 3827 678 124 ----
NM_022550chr51164 ------
NM_022648chr234472 3912 689 --24632 4577 --
NM_022650chr54979 761 750 675 ------
NM_022652chr121448 --21072 767 --
NM_022658chr1221345 1181 ------
NM_022726chr621507 313 11567 ----
NM_022728chr71729 1690 1562 --
NM_022735chr121637 1372 ------
NM_022763chr373126 3066 2583 2206 2058 1271 607 13100 ----
NM_022776chr311137 --11241 --
NM_022777chr721397 350 ------
NM_022781chr953337 3164 645 555 49 ----13170
NM_022782chr12148 ------
NM_022810chrX----174 --
NM_022824chr521902 126 --1723 1310
NM_022845chr1641661 1621 1496 185 1529 11407 --
NM_022893chr293082 2306 2235 2017 845 634 371 291 263 13152 ----
NM_022894chr241381 1165 446 259 11507 21245 1134 --
NM_022897chr5----199 --
NM_022898chr1454481 3536 1400 870 231 --13707 --
NM_022900chr71420 1955 1226 --
NM_022902chr5----1341 --
NM_022915chr22625 586 ------
NM_022918chr1142191 1979 1871 748 ------
NM_022970chr1051089 454 413 390 297 ------
NM_022977chrX42584 2294 1852 1039 --12556 2973 424
NM_023000chr1411263 --21329 408 --
NM_023001chr1411263 --21329 408 --
NM_023012chr121104 ----1757
NM_023033chr121581 ------
NM_023039chr5--1332 ----
NM_023112chr1431858 777 48 --1551 --
NM_023923chr153756 3725 3698 3602 1026 ------
NM_023925chr121237 1267 ----
NM_023927chr51861 --21079 1053 --
NM_023929chr852660 2180 1080 526 33 --11829 --
NM_023931chr1621598 1071 ------
NM_024007chr552317 1952 639 576 248 21990 26 ----
NM_024016chr17----1722 --
NM_024019chr41162 --21074 1037 1870
NM_024050chr19----1155 --
NM_024052chr1731997 933 927 ------
NM_024055chr53687 514 269 1625 ----
NM_024061chr71188 ------
NM_024090chr4----1350 --
NM_024092chr11----11270 --
NM_024122chrX1110 ------
NM_024334chr311848 ------
NM_024345chr9115721 5347 4850 4671 4520 4265 4101 1443 1313 895 735 22139 1967 --14825
NM_024408chr153264 2975 2623 689 332 ------
NM_024416chr911511 --11249 1301
NM_024420chr12432 366 ------
NM_024429chr72847 98 1192 ----
NM_024430chr1821820 1471 ------
NM_024491chr3253 37 --198 --
NM_024496chr142621 149 ------
NM_024501chr21668 ------
NM_024511chr493199 2913 2622 2261 1023 978 828 737 489 --22783 2427 --
NM_024519chr161275 ------
NM_024524chr333114 2849 980 ----22975 2328
NM_024529chr121002 775 ------
NM_024539chrX21236 1190 --21158 971 --
NM_024546chr1351186 1134 966 896 313 ------
NM_024548chr331758 636 126 --21199 1163 --
NM_024556chr11--1497 ----
NM_024565chr511070 ------
NM_024569chr122941 236 ------
NM_024582chr42392 357 1372 1217 --
NM_024583chr21208 1249 --1855
NM_024586chr1------1521
NM_024595chr12385 366 1947 ----
NM_024612chr1751023 1006 783 363 337 ------
NM_024613chr821180 1170 --11344 --
NM_024617chr91235 --1240 --
NM_024636chr782946 2865 2784 2566 2062 1048 753 316 ------
NM_024639chr632885 812 45 --22898 2382 --
NM_024665chr374674 4250 3504 3150 1331 651 505 --1587 --
NM_024670chr101467 ----1146
NM_024674chr1102861 2744 2580 2398 2256 2005 739 697 109 83 ------
NM_024680chr112430 419 --1553 --
NM_024700chr151146 1069 959 882 795 --11175 --
NM_024704chr2051028 998 977 789 740 --11091 --
NM_024715chr51146 --1289 1680
NM_024721chr851642 1036 983 667 655 --11681 --
NM_024744chr282692 2608 2591 1842 1706 588 400 380 ------
NM_024761chr973354 2063 1988 1976 1924 1421 362 15245 21228 761 11414
NM_024770chr274934 4488 4464 2434 1596 146 109 1477 11897 --
NM_024817chr1554090 3795 1517 1471 464 21362 1232 15101 --
NM_024852chr13684 496 463 ------
NM_024854chr1241478 1402 404 81 ------
NM_024881chr1941003 920 352 111 --1170 1987
NM_024896chr921635 186 1402 --12255
NM_024900chr472072 1893 1794 1569 1464 588 567 ------
NM_024900chr472072 1893 1794 1569 1464 588 567 ------
NM_024911chr14845 831 825 325 1703 2754 204 --
NM_024930chr552834 1840 461 111 78 12808 ----
NM_024941chr521333 1271 11301 ----
NM_024944chr2131002 374 366 ------
NM_024947chr3109371 9292 9246 9217 8223 7472 3710 3463 2826 1824 29126 2277 59104 8601 8575 3790 176 --
NM_024948chr103735 583 258 --1595 --
NM_024949chr434965 4302 925 1805 23724 3419 --
NM_024953chr1242693 1900 241 117 12617 ----
NM_024960chr201126 2451 436 --1386
NM_024969chr23245 132 51 ------
NM_024989chr2157978 7939 7913 7819 7370 6459 6437 6008 5461 5361 2686 2349 1392 973 271 16651 36497 5922 2086 --
NM_024991chr1072829 2729 2460 2189 2140 827 227 1176 1599 --
NM_025054chr893610 3489 3093 2907 2608 1340 1035 903 136 ------
NM_025073chr144716 4560 4464 3801 ------
NM_025074chr443050 2489 135 21 13122 ----
NM_025106chr12731 607 ------
NM_025107chr621456 241 --22263 234 1299
NM_025133chr241054 1015 875 430 2948 108 1460 --
NM_025134chr1652380 1677 1666 333 85 --11632 --
NM_025138chr133481 434 158 --11119 --
NM_025154chr731245 286 280 --11460 --
NM_025160chr154167 3669 3522 2966 2672 1419 12794 --
NM_025164chr1152126 2090 1984 1420 485 ------
NM_025181chr21639 1610 1709 --
NM_025184chrX3834 660 242 ------
NM_025191chr133485 3429 437 --23510 516 --
NM_025208chr112792 214 --1705 --
NM_025212chr41122 ------
NM_025221chr421432 409 --1362 --
NM_025235chr101707 --31616 503 294 --
NM_025246chr3144 ------
NM_030579chr1673618 3047 2909 1214 1014 105 29 1563 ----
NM_030621chr1484075 3826 3812 2848 1644 1148 835 173 13575 11388 21420 750
NM_030625chr1062252 2071 1859 771 690 44 --1759 --
NM_030627chr584116 3819 3670 2793 2573 1363 905 591 ------
NM_030647chr7166313 6261 6199 6174 5517 5176 4845 2519 1712 1703 1383 1219 874 671 591 146 16227 1300 1569
NM_030648chr445498 5054 1962 975 43538 2032 801 165 25111 3648 1124
NM_030650chr274157 3282 2694 2583 815 686 310 23258 1169 13415 --
NM_030664chr1082398 2227 2161 2076 2054 1779 904 837 11704 11631 --
NM_030665chr1731419 1267 953 11232 ----
NM_030674chr1245424 1839 1548 1482 --1881 --
NM_030751chr1061925 1828 1821 1518 639 348 11439 --11597
NM_030751chr1061925 1828 1821 1518 639 348 11439 --11597
NM_030755chr1483075 2242 1225 995 660 512 458 255 1322 11039 --
NM_030784chr61109 ------
NM_030789chr201281 ------
NM_030790chr162276 108 ------
NM_030791chr1451710 1379 520 416 146 2375 259 11860 --
NM_030799chr532116 1524 756 ------
NM_030806chr169407 8443 7808 6077 1326 847 ------
NM_030809chr1222496 1633 ------
NM_030820chr61955 ------
NM_030881chr2232171 1616 576 12353 --12213
NM_030885chr332279 2067 828 ------
NM_030915chr232243 2227 1576 ------
NM_030918chr155305 5284 4478 1458 1192 ------
NM_030938chr171410 ------
NM_030939chr631178 753 303 --1123 --
NM_030978chr91121 --1136 --
NM_030981chr1121087 330 ------
NM_031157chr121175 ------
NM_031203chr193171 86 47 ------
NM_031216chr1841527 1375 852 753 ----11930
NM_031231chr201194 ------
NM_031232chr201194 ------
NM_031243chr752349 2147 1631 1498 124 11614 ----
NM_031282chr131490 1197 129 --2270 136 --
NM_031283chr21836 ------
NM_031296chr431968 955 140 ----12672
NM_031309chr81932 ------
NM_031314chr1472021 1810 1319 798 700 526 278 --1494 --
NM_031365chr252787 962 865 788 46 12546 ----
NM_031366chr252787 962 865 788 46 12546 ----
NM_031369chr4----1648 --
NM_031370chr4----1648 --
NM_031371chr131134 1085 361 --21334 351 --
NM_031371chr131134 1085 361 --21334 351 --
NM_031411chr522251 2183 ------
NM_031418chr1172581 1989 1963 1095 681 132 110 12510 ----
NM_031419chr32589 60 --11366 --
NM_031435chr1263411 1226 973 863 740 358 1427 13498 --
NM_031442chrX12884 ------
NM_031445chr232180 703 405 13371 ----
NM_031461chr842134 1594 379 128 ----1828
NM_031468chr787822 6340 5729 5254 1583 1152 1050 48 --12572 --
NM_031469chr654110 3894 3109 1268 78 --132 --
NM_031476chr1632223 2162 710 --12693 --
NM_031844chr142995 2988 1205 734 2675 453 13769 --
NM_031849chr522251 2183 ------
NM_031850chr32807 801 1211 --1123
NM_031850chr32807 801 1211 --1123
NM_031857chr522251 2183 ------
NM_031860chr522251 2183 ------
NM_031922chr61145 ------
NM_031990chr1911266 ------
NM_031991chr1911266 ------
NM_031992chr741642 456 213 141 ----11560
NM_032012chr975121 5047 3633 1614 884 828 184 11204 1410 1521
NM_032013chr2061687 486 423 352 287 107 --11266 --
NM_032021chr1121189 1090 ------
NM_032047chr31209 12369 11832 --
NM_032049chr32807 801 1211 --1123
NM_032049chr32807 801 1211 --1123
NM_032116chr13105869 5796 5719 5611 5335 4697 1981 1963 1385 388 2722 232 15412 --
NM_032121chrX12556 199 12757 --
NM_032124chr1811067 2417 135 1831 1405
NM_032128chr43982 780 705 11035 1856 --
NM_032138chr13----147 --
NM_032141chr172714 229 --1655 --
NM_032147chr122328 157 --1850 --
NM_032156chr121237 1267 ----
NM_032182chr1011648 ----1598
NM_032189chr1344664 3183 3107 1761 14841 24760 1862 --
NM_032195chr211482 ------
NM_032199chr1053492 3224 3204 2735 456 23819 3723 ----
NM_032208chr232909 2442 591 ------
NM_032217chr431445 1351 1199 ------
NM_032221chr2031613 1413 470 11490 11959 --
NM_032228chr1173307 2740 2333 1243 1180 590 68 21374 963 33427 2387 980 22942 1210
NM_032229chr131459 ------
NM_032239chr451472 345 207 162 54 --11083 --
NM_032246chr1531120 982 265 ------
NM_032268chr161888 ------
NM_032272chr81308 ------
NM_032288chr362276 2255 2021 1748 1469 662 11975 --1486
NM_032291chr141232 385 235 52 ------
NM_032311chr22--1420 --12035
NM_032320chr11----1217 --
NM_032321chr253131 2185 937 918 680 23011 813 1157 --
NM_032325chr1152022 2012 2003 1986 1432 ------
NM_032352chr1441445 1408 482 120 11210 177 --
NM_032364chr123983 909 288 ------
NM_032373chr1085321 1991 1506 1209 1058 844 675 154 23717 879 25798 5680 12200
NM_032379chr112852 696 1915 1613 --
NM_032387chr17122 ------
NM_032410chr8------1428
NM_032424chr1131468 409 246 ----11069
NM_032433chr1951567 282 274 234 85 --21523 1394 --
NM_032435chr161983 1957 1661 604 153 60 32354 2125 1622 ----
NM_032439chr1031587 1177 569 --1360 --
NM_032440chr1062560 2405 1149 898 153 123 12877 ----
NM_032446chr573545 2929 2903 2692 1130 1090 1017 11215 11249 --
NM_032457chr463683 1475 1264 935 746 37 33169 1308 563 21167 460 23827 3114
NM_032458chrX43346 2747 2633 2278 ----13309
NM_032468chr81170 ------
NM_032491chr12--11115 11019 --
NM_032505chr3102776 2538 2458 2446 2341 1972 1863 1834 480 23 ----11987
NM_032507chr6----1254 --
NM_032521chr2041986 1163 658 374 --12314 --
NM_032532chr63600 592 549 ------
NM_032536chr91626 1239 ----
NM_032547chr421058 513 21017 174 21301 204 --
NM_032558chr921483 1309 --21162 990 --
NM_032574chr22204 98 ------
NM_032626chr161312 --174 --
NM_032632chr1451990 1934 1461 691 274 1219 32024 380 313 11561
NM_032663chr12--22059 731 12026 11912
NM_032682chr333108 548 231 12261 23235 594 --
NM_032689chr191138 --1226 --
NM_032772chr103581 538 135 1367 ----
NM_032777chr8--11408 ----
NM_032793chr11339 ------
NM_032800chr142142 1837 1826 1820 --193 --
NM_032804chr1072422 2054 1787 949 865 600 439 1802 ----
NM_032810chr1031293 404 387 --1366 --
NM_032825chr192806 399 --1750 --
NM_032842chr731462 1281 552 ----11383
NM_032859chr1373643 1268 768 522 448 419 25 --23302 226 --
NM_032869chr842008 1776 1739 1701 --1419 --
NM_032873chr11194424 4376 4349 4317 3758 3699 3373 3306 2977 2930 1750 1519 1480 1380 1236 1070 1050 921 834 --11785 --
NM_032892chr151310 ------
NM_032900chr1043858 2745 572 106 --13889 --
NM_032918chr1251215 1203 1187 1065 84 --21257 1192 --
NM_032943chr112852 696 1915 1613 --
NM_032961chr421001 498 1359 ----
NM_032968chrX124243 4071 3933 3181 3062 2803 2796 1601 907 652 197 39 24218 3119 24059 3030 --
NM_032969chrX124243 4071 3933 3181 3062 2803 2796 1601 907 652 197 39 24218 3119 24059 3030 --
NM_032973chrY124235 4063 3925 3176 3057 2798 2791 1600 907 652 197 39 24210 3114 24051 3025 --
NM_032975chr1843515 3255 3122 247 13073 13109 --
NM_032978chr1841186 913 897 58 ----11172
NM_032979chr1841186 913 897 58 ----11172
NM_032980chr1843515 3255 3122 247 13073 13109 --
NM_032981chr1841186 913 897 58 ----11172
NM_033012chr13175 --127 --
NM_033014chr911511 --11249 1301
NM_033016chr22156 ------
NM_033020chr194312 4003 3799 3756 1814 1694 1047 959 517 14787 ----
NM_033023chr72915 831 11162 11037 1802
NM_033030chr211415 --11266 11660
NM_033044chr121202 362 21171 277 11283 --
NM_033055chr11118 ------
NM_033081chr2041402 1200 986 500 --152 --
NM_033088chr12700 663 ------
NM_033114chr121760 1619 1749 --
NM_033119chr161917 ------
NM_033132chr1372224 2106 2071 1859 1803 557 441 --22213 2204 --
NM_033133chr1723772 2781 23023 1314 ----
NM_033135chr112792 214 --1705 --
NM_033136chr521778 1700 11544 ----
NM_033137chr521778 1700 11544 ----
NM_033138chr762266 2012 702 692 143 78 11685 ----
NM_033139chr762266 2012 702 692 143 78 11685 ----
NM_033140chr762266 2012 702 692 143 78 11685 ----
NM_033143chr4104667 3764 3403 3030 2957 2828 1825 778 604 446 ------
NM_033150chr121392 ------
NM_033157chr762266 2012 702 692 143 78 11685 ----
NM_033161chr931956 524 91 ------
NM_033181chr653689 3413 2414 913 747 --22826 1378 23860 433
NM_033211chr531649 420 404 11796 22024 2005 --
NM_033224chr787474 6766 5224 2787 2177 2133 1801 387 --37456 5746 1842 --
NM_033254chr31140 ------
NM_033260chr62777 689 ------
NM_033276chr121248 ------
NM_033281chr52165 150 ------
NM_033285chr884446 4257 4008 3659 1074 632 130 50 1362 22898 552 --
NM_033290chrX73106 2675 2415 2381 2293 454 214 1176 11332 --
NM_033305chr961368 1221 1150 579 245 111 ------
NM_033338chr1021081 536 --1119 --
NM_033339chr1021081 536 --1119 --
NM_033360chr1254318 4016 3787 2838 396 --24385 1206 --
NM_033389chr1743681 2962 913 127 ----24042 1395
NM_033393chr412758 12785 32885 2022 731 --
NM_033394chr2----1409 11183
NM_033425chr1133392 2431 355 ----21240 1010
NM_033427chr73611 338 330 1637 1157 --
NM_033429chr1563265 2903 2638 1196 441 202 ------
NM_033430chr4103950 3872 3661 3584 1679 1103 573 503 120 93 --11180 --
NM_033437chr4103950 3872 3661 3584 1679 1103 573 503 120 93 --11180 --
NM_033495chrX4920 823 293 209 --1968 --
NM_033505chr296077 5996 2499 2404 2343 2270 1583 1414 778 26560 1872 16543 14334
NM_033546chr181204 ------
NM_033550chr2041870 683 484 241 12057 ----
NM_033551chr533483 2549 144 13357 ----
NM_033624chr1231988 356 329 --1400 11860
NM_033631chr143859 3827 3591 741 13645 23560 1034 --
NM_033644chr521719 762 1521 ----
NM_033645chr521719 762 1521 ----
NM_033656chr2175308 5142 1663 1110 961 700 447 12109 --1547
NM_033666chr104951 806 175 109 --1768 133
NM_044472chr11573 1141 ----
NM_048368chr181231 ------
NM_052832chr812797 --22964 1996 --
NM_052834chr1892582 2351 2299 2203 1912 1668 1656 148 28 ------
NM_052851chr13102356 2329 2253 2206 2118 2014 1791 334 274 71 11524 11532 --
NM_052854chr111442 ------
NM_052857chr172393 312 ------
NM_052879chr1274069 4063 4033 3466 1340 781 490 23818 1213 12509 --
NM_052885chr1244690 4610 1598 375 --24659 1561 13786
NM_052886chr841479 1420 822 680 11754 ----
NM_052905chr251743 1431 708 436 366 ------
NM_052907chr1273884 3582 3288 1221 950 915 22 11476 12937 1274
NM_052910chr1311983 --2794 472 12167
NM_052918chr1083706 3681 3591 3457 3139 3061 1252 355 --23427 519 --
NM_052927chr542133 1578 787 225 1632 ----
NM_052937chr822095 391 --22117 155 --
NM_052940chr11179 ------
NM_052948chr19179 ------
NM_052953chr31106 ------
NM_052958chr82619 62 --1733 --
NM_052965chr111337 --1267 --
NM_053001chr81391 ------
NM_053002chr341068 1054 976 476 --1351 170
NM_053016chr996931 6485 5558 5428 5250 2468 1783 575 180 15572 16051 11021
NM_053024chr3--11234 21518 1278 --
NM_053043chr786172 6069 5010 4570 4380 2070 1870 284 --55158 5143 5050 5003 1834 --
NM_053053chr141012 982 937 202 --1748 --
NM_053064chr1443078 2930 455 136 ----12936
NM_053281chrX1350 ------
NM_054016chr131896 1808 33 ------
NM_054016chr131896 1808 33 ------
NM_054016chr131896 1808 33 ------
NM_054026chr8----1874 --
NM_054027chr551898 1714 1485 911 716 ------
NM_057157chr10195 ------
NM_057159chr941007 992 561 552 ------
NM_057168chr731428 1381 1132 --11492 --
NM_057175chr432161 1749 77 12517 ----
NM_057749chr8------11322
NM_058170chr1----21363 574 --
NM_058172chr421239 86 ----11245
NM_058237chr1441020 1014 985 318 ------
NM_058241chr241525 833 405 390 --12297 --
NM_058241chr241525 833 405 390 --12297 --
NM_078488chr61310 ------
NM_080422chr182303 281 ------
NM_080423chr182303 281 ------
NM_080546chr9102275 1736 1596 1498 838 447 122 116 100 94 --165 --
NM_080616chr201505 ------
NM_080617chr201940 ------
NM_080654chr112887 165 ------
NM_080666chr1421659 339 ----1450
NM_080669chr1724337 1514 ------
NM_080671chr222218 2170 ------
NM_080672chr20--1475 ----
NM_080742chr61198 ------
NM_080759chr1322638 846 1120 ----
NM_080760chr1322638 846 1120 ----
NM_080792chr2022156 2106 ------
NM_080832chrX31796 524 244 11277 21546 504 --
NM_080867chr1433733 596 358 1882 --1961
NM_080872chr863959 3358 2608 1176 989 342 --24061 3691 --
NM_080874chr421435 767 21605 156 11878 --
NM_080927chr353332 2922 2729 2128 1149 --13166 189
NM_130387chr31209 ------
NM_130391chr9113404 2848 2693 2601 2190 1401 1359 1295 1276 930 577 ------
NM_130392chr9113404 2848 2693 2601 2190 1401 1359 1295 1276 930 577 ------
NM_130393chr9113404 2848 2693 2601 2190 1401 1359 1295 1276 930 577 ------
NM_130395chr61347 ------
NM_130435chr1022787 2605 ----1191
NM_130446chr314217 14118 ----
NM_130809chr532504 1045 535 --13106 --
NM_130831chr342596 2578 2381 140 12816 ----
NM_130832chr342596 2578 2381 140 12816 ----
NM_130833chr342596 2578 2381 140 12816 ----
NM_130834chr342596 2578 2381 140 12816 ----
NM_130835chr342596 2578 2381 140 12816 ----
NM_130836chr342596 2578 2381 140 12816 ----
NM_130837chr342596 2578 2381 140 12816 ----
NM_130838chr151502 11337 11359 --
NM_130839chr151502 11337 11359 --
NM_130846chr124952 736 308 119 --2678 186 --
NM_130847chr1175691 5164 5106 4601 3690 1148 293 1962 ----
NM_133265chrX83563 3283 3254 2921 2819 2713 1230 877 --1703 --
NM_133330chr4--13267 ----
NM_133331chr4--13267 ----
NM_133334chr455891 5658 5402 4684 4046 24353 1106 26307 5680 11525
NM_133335chr4--13267 ----
NM_133370chr463701 3547 2968 1463 1155 49 21145 934 ----
NM_133372chr511068 12915 170 --
NM_133433chr5--1223 ----
NM_133446chr10--1254 2311 260 --
NM_133468chr74921 537 490 195 1385 1219 1570
NM_133477chr4113253 3241 3023 2926 2907 2862 1996 1213 705 268 169 12319 11135 --
NM_133486chrX1349 ----1150
NM_133493chr664294 3756 3636 1427 1117 156 --24634 3625 --
NM_133496chr174577 4205 3289 2814 1056 847 658 12915 23466 622 --
NM_133631chr331132 1091 322 ------
NM_133633chr2211169 ------
NM_133638chr521338 361 ----1516
NM_133646chr245514 1032 330 110 --24207 848 --
NM_133647chr1543605 3562 2677 1508 13682 13738 --
NM_134265chr1741192 344 314 133 11016 --11198
NM_134266chr8----1397 --
NM_134428chr9----1155 --
NM_134442chr231342 585 422 1162 ----
NM_138270chrX32705 2657 2438 ----11249
NM_138286chr1994025 3269 3253 2814 1507 1279 1030 847 53 1920 14249 --
NM_138292chr1173322 2748 2300 1001 849 781 717 1662 --13535
NM_138316chr1041244 1221 1013 226 ----1276
NM_138333chr942556 2548 2391 744 11833 ----
NM_138376chr141346 1137 ----
NM_138423chr1542040 681 581 265 32203 2138 186 22263 1439 --
NM_138426chr782485 2337 1814 1736 1697 791 676 548 11746 2631 240 --
NM_138459chr6113653 3641 3242 2875 2766 2634 2590 2564 2259 724 205 --13574 --
NM_138468chr245807 4262 2551 1331 --36239 5764 4368 --
NM_138473chr1265012 3455 3388 1563 300 112 --1456 --
NM_138494chr782803 2723 2711 2686 2377 2235 432 82 --32808 785 251 --
NM_138555chr151557 ------
NM_138576chr1454481 3536 1400 870 231 --13707 --
NM_138612chr16161 ------
NM_138621chr284067 3578 3351 2632 1170 791 772 638 1384 ----
NM_138635chr762998 2991 2211 1980 702 239 23076 22 22287 2004 --
NM_138638chr142286 94 ----1502
NM_138643chr18162 ------
NM_138644chr18162 ------
NM_138713chr1697255 7082 6839 6519 6124 2440 1972 707 398 ----17044
NM_138714chr1697255 7082 6839 6519 6124 2440 1972 707 398 ----17044
NM_138717chr61699 ------
NM_138731chr1464114 4078 4056 1585 569 510 --34214 3120 437 --
NM_138735chr251275 1145 1030 1022 529 ------
NM_138766chr5185 ------
NM_138771chr711329 1971 1551 11050
NM_138798chr2179 124 ----
NM_138799chr221455 289 --11813 --
NM_138821chr5185 ------
NM_138822chr5185 ------
NM_138923chrX------1366
NM_138927chr213818 694 308 1979 2359 205 --
NM_138931chr34692 686 386 342 21022 733 ----
NM_138959chr175104 4790 4276 4165 2510 2264 2108 --22432 435 --
NM_138980chr43462 202 182 ------
NM_138981chr43593 333 313 ------
NM_138982chr43462 202 182 ------
NM_139015chr1211116 ------
NM_139035chrX2229 40 ----1745
NM_139045chr91685 ------
NM_139048chr3--11182 ----
NM_139057chr1522771 2311 12798 ----
NM_139068chr53681 456 450 1614 ----
NM_139069chr53681 456 450 1614 ----
NM_139070chr51550 1483 ----
NM_139072chr21840 ------
NM_139078chr12155 ------
NM_139131chr111462 ------
NM_139135chr111210 ------
NM_139160chr11131 ------
NM_139168chr551883 1431 640 392 231 11465 ----
NM_139169chr1062127 1948 1683 704 236 76 ----21465 171
NM_139175chr7--127 ----
NM_139207chr1231497 665 88 ------
NM_139239chr19193 ------
NM_139242chr1551034 974 607 540 258 ------
NM_139244chr62957 643 1321 ----
NM_139266chr22202 80 ------
NM_139276chr1742285 2087 575 53 ------
NM_139279chr213404 2259 249 13451 --
NM_139283chr1232106 1960 1640 ------
NM_139316chr71133 ------
NM_139321chr2064180 4125 4006 2671 1547 857 ------
NM_144498chr2031938 899 552 ----1646
NM_144563chr22307 89 ------
NM_144563chr22307 89 ------
NM_144568chr141567 ------
NM_144570chr1672916 2705 2524 2284 2251 2228 2179 12258 ----
NM_144571chr486945 5598 5117 4776 2522 767 312 155 1256 25417 1656 --
NM_144578chr14145057 4769 4645 3996 3559 1460 1198 1100 766 698 178 162 65 49 24876 4715 34906 4662 1483 --
NM_144583chr231460 272 144 ------
NM_144595chr133383 294 127 --1865 --
NM_144600chr1631694 1427 391 2574 39 --11646
NM_144610chr171571 --1412 --
NM_144632chr262290 2080 1806 1746 701 642 ------
NM_144633chr31615 --1434 --
NM_144642chr371402 1293 1266 531 423 326 272 --21174 363 --
NM_144643chr4163 ------
NM_144645chr4----1233 --
NM_144664chr1152512 2348 862 779 271 12617 12479 12425
NM_144689chr19--1687 ----
NM_144710chr221179 382 --11387 --
NM_144721chr432377 829 448 --32706 416 187 1129
NM_144726chr51199 --1216 --
NM_144728chr11871 ------
NM_144729chr11871 ------
NM_144732chr191778 ------
NM_144767chr1564509 3788 3656 3483 3310 1620 --22997 625 --
NM_144775chr1724866 372 ------
NM_144778chr1352277 2181 1787 1100 37 11828 11760 11855
NM_144963chr852586 2018 536 239 215 ------
NM_144967chrX21086 978 ------
NM_144973chr1265201 5186 5116 1614 479 158 --1436 --
NM_144979chr41649 --1603 --
NM_145025chr621134 65 --11163 --
NM_145049chr521012 331 ------
NM_145055chr1853864 3354 992 488 358 --12952 --
NM_145056chr192778 294 ------
NM_145112chr142951 537 --1211 --
NM_145113chr1431223 1076 982 --1483 --
NM_145115chr742282 1807 524 514 11662 12350 --
NM_145117chr1123081 2894 --1915 --
NM_145176chr663489 2903 888 711 346 68 12854 ----
NM_145185chr191675 ------
NM_145243chr1----1180 --
NM_145245chr1911264 ------
NM_145259chr2117033 6836 6629 6491 6045 5504 5466 5148 4958 4448 1724 14905 47053 7038 6820 1494 --
NM_145263chr451798 1605 795 760 187 --11689 --
NM_145266chr53251 144 118 ------
NM_145268chr7----2386 309 1357
NM_145284chrX52565 1777 1557 969 333 ------
NM_145285chr101695 ------
NM_145303chr63561 530 178 ------
NM_145305chrX----11287 11300
NM_145307chr1033339 2848 1611 --13085 --
NM_145320chr783305 2285 2191 582 542 424 159 33 1388 13200 --
NM_145321chr783305 2285 2191 582 542 424 159 33 1388 13200 --
NM_145322chr783305 2285 2191 582 542 424 159 33 1388 13200 --
NM_145686chr233076 799 485 33382 3294 3051 1984 --
NM_145687chr233076 799 485 33382 3294 3051 1984 --
NM_145690chr841863 744 660 485 --1779 --
NM_145693chr272506 2495 2375 2280 1944 1604 221 --11004 --
NM_145698chr1031545 1386 711 --1762 --
NM_145716chr1----1238 --
NM_145728chr1522429 2345 ------
NM_145735chr1382855 2767 2749 2733 2251 1810 1727 641 11911 ----
NM_145756chr1831405 1268 446 ------
NM_145799chrX42754 2150 1023 247 12123 11013 --
NM_145805chr151611 ------
NM_145808chr743007 2771 2039 734 12479 22296 1191 22393 1162
NM_145859chr3----1353 --
NM_145860chr3----1353 --
NM_145909chr63452 403 180 ----11244
NM_146387chr191222 ------
NM_146388chr1911297 ------
NM_147147chr683696 3319 3102 2898 1502 1270 740 103 11035 ----
NM_147150chr923489 3320 31337 995 473 13677 --
NM_147156chr1041378 1358 1314 178 ------
NM_147171chr7180 --1190 --
NM_147181chr421432 409 --1362 --
NM_147182chr421432 409 --1362 --
NM_147183chr421432 409 --1362 --
NM_147185chr7180 --1190 --
NM_147223chr232261 2218 1964 1986 ----
NM_147233chr232078 2035 1781 1803 ----
NM_148174chr861985 1792 878 696 447 202 --12033 --
NM_148571chr173687 646 234 --143 --
NM_148894chr43397 384 104 --1886 --
NM_148904chr1------1521
NM_148905chr1------1521
NM_148906chr1------1521
NM_148907chr1------1521
NM_148908chr1------1521
NM_148909chr1------1521
NM_148955chr1586544 5695 4595 4467 2317 1892 291 87 16516 11953 16565
NM_148976chr11------127
NM_148977chr1041244 1221 1013 226 ----1276
NM_148978chr1041244 1221 1013 226 ----1276
NM_152132chr14125 ------
NM_152221chr22147 ------
NM_152261chr1232267 1954 342 12539 22484 575 --
NM_152263chr186045 4694 4542 1205 852 834 598 209 12308 44757 4460 1367 146 --
NM_152265chr151526 1276 302 292 169 ------
NM_152280chr131057 707 398 --12538 --
NM_152291chr4----2896 848 --
NM_152330chr1462450 2387 2350 2060 1900 611 12626 1742 --
NM_152347chr173470 148 57 ------
NM_152350chr171161 ------
NM_152352chr1822828 2525 22347 700 13001 --
NM_152373chr12635 579 1643 ----
NM_152388chr253751 545 279 89 78 11580 164 --
NM_152407chr52358 78 ------
NM_152409chr573308 2917 2238 1426 774 661 198 33159 2556 1286 13340 --
NM_152412chr821490 1346 1559 21321 472 --
NM_152415chr81340 ------
NM_152417chr831329 1320 854 ----1324
NM_152422chr911879 21625 263 ----
NM_152424chrX74456 4338 3486 3417 531 446 197 ------
NM_152446chr141266 ------
NM_152451chr152799 664 --1301 --
NM_152455chr1552737 1849 1797 888 353 --143 11872
NM_152519chr21523 ----1110
NM_152520chr231227 896 443 --2925 293 --
NM_152523chr21695 ----1761
NM_152529chr274252 3604 1731 1365 905 782 179 23881 1045 --11617
NM_152542chr441859 1524 1450 528 ------
NM_152556chr742543 2281 2065 642 --12073 --
NM_152564chr85677 659 197 174 75 --1376 11680
NM_152581chrX2460 444 ------
NM_152588chr1231891 1624 1537 11874 --11478
NM_152594chr1552233 1650 1576 491 184 12278 --1319
NM_152603chr192617 550 ------
NM_152608chr162590 2285 2175 1722 1592 213 --22551 1976 --
NM_152622chr573470 3418 2561 2399 2381 1166 127 --11256 --
NM_152624chr5157132 5941 5866 5687 4732 2894 2887 2633 2456 1902 1061 852 832 581 282 --21109 304 26391 1656
NM_152629chr953985 3662 2874 620 326 12831 ----
NM_152636chr1153005 2873 2446 1220 1156 --12779 --
NM_152641chr1232915 1061 1005 1891 12441 11123
NM_152666chr15861 792 626 195 34 ------
NM_152678chr362412 2329 1974 1663 144 38 1171 11884 --
NM_152688chr61950 ----1870
NM_152695chrX62215 2063 2032 1984 1821 746 ------
NM_152699chr353633 3264 2854 1336 261 23469 1219 1921 --
NM_152723chr112876 452 ------
NM_152734chr675457 4279 4244 1952 1137 552 128 12172 ----
NM_152737chr631983 1626 1353 ------
NM_152742chr7----1621 --
NM_152745chr721126 908 --1462 --
NM_152753chr61818 ------
NM_152754chr763833 3320 2815 1527 803 796 23848 552 23495 2466 --
NM_152756chr533963 3762 781 13490 ----
NM_152758chr852776 2697 715 699 269 11217 ----
NM_152772chr121480 ------
NM_152774chr782654 2208 1055 755 597 285 94 88 ------
NM_152787chrX63913 3312 2728 2440 1358 881 23596 1148 33244 2978 756 --
NM_152789chr72436 92 1559 ----
NM_152793chr744634 3470 1938 1047 186 21975 739 1346
NM_152826chr1586544 5695 4595 4467 2317 1892 291 87 16516 11953 16565
NM_152829chr741270 1015 804 52 ------
NM_152835chr162158 1960 842 454 422 410 1195 ----
NM_152836chr861771 1365 331 275 194 122 --11867 --
NM_152837chr861771 1365 331 275 194 122 --11867 --
NM_152879chr212557 ------
NM_152889chr3----1699 --
NM_152902chr162008 1971 1540 1389 401 308 --1531 --
NM_152903chr1342736 1984 1097 995 1860 ----
NM_152905chr121170 ------
NM_152924chr1544699 4678 378 215 11901 15946 --
NM_152991chr111593 ------
NM_152995chr42116 76 ------
NM_152999chr744603 1625 1255 1243 1960 24130 1722 21168 434
NM_153000chr181528 ------
NM_153013chr532508 1828 407 22366 136 --1695
NM_153020chr611529 --11180 --
NM_153042chr62567 208 ----11501
NM_153184chr321485 328 --21353 434 11769
NM_153186chr94758 724 620 81 1668 1807 --
NM_153188chr5155638 4798 4783 4510 4232 3868 3801 3699 2087 1937 1677 1482 1147 1017 773 24524 184 21623 879 14181
NM_153201chr111190 ------
NM_153207chr1273867 3293 3106 2932 1171 894 589 11050 34034 3176 2534 13747
NM_153226chr1031220 106 88 --1324 11112
NM_153235chr642159 547 497 481 --1595 1561
NM_153240chr331182 942 142 1918 11233 --
NM_153261chr1621239 264 11601 21047 320 --
NM_153262chr1103212 3185 3056 2462 2456 2411 2071 1239 791 783 --12557 --
NM_153267chr92731 340 1618 1353 --
NM_153321chr1741077 1023 1002 162 ----11116
NM_153322chr1741077 1023 1002 162 ----11116
NM_153333chrX165 ------
NM_153341chr11288 --196 --
NM_153354chr53918 239 149 1132 2947 826 --
NM_153362chr63849 770 163 2646 384 ----
NM_153365chr442242 2053 1971 528 ----2982 654
NM_153367chr1073182 3166 2566 2511 679 349 96 13999 ----
NM_153377chr12----1280 --
NM_153456chr1386240 6214 6082 2540 1360 1282 1042 230 26065 5868 ----
NM_153605chr311456 1362 ----
NM_153607chr592675 2634 2480 992 791 744 609 178 38 --13032 --
NM_153616chr1542361 855 396 97 --1401 --
NM_153617chr1542361 855 396 97 --1401 --
NM_153618chr1542361 855 396 97 --1401 --
NM_153634chr1221550 1263 11614 1292 11507
NM_153640chr201126 2451 436 --1386
NM_153686chr41562 ------
NM_153688chr1621677 1669 --21326 501 1130
NM_153689chr242358 1882 916 96 12368 ----
NM_153693chr124638 623 550 79 ------
NM_153697chr2--1329 --1336
NM_153702chr4--1297 ----
NM_153715chr721233 1050 --21159 810 --
NM_153769chr18162 ------
NM_153810chr1064693 4617 4518 3191 399 64 45081 3626 3204 2025 13196 --
NM_153819chr111188 ------
NM_153825chr431560 1527 635 --11744 --
NM_153836chr282155 1856 1309 740 621 452 369 240 --11767 1541
NM_170606chr71660 --11631 --
NM_170665chr1264214 3923 3893 3886 3786 1007 24405 3997 34475 757 399 --
NM_170679chr51509 1122 ----
NM_170707chr12655 138 ------
NM_170708chr12655 138 ------
NM_170709chr842038 1639 1589 88 --1140 --
NM_170710chr493184 2911 2794 2774 2509 2238 2203 759 490 22895 721 11986 --
NM_170719chr133481 434 158 --11119 --
NM_170731chr1132758 2631 116 1220 ----
NM_170732chr1132758 2631 116 1220 ----
NM_170733chr1132758 2631 116 1220 ----
NM_170734chr1132758 2631 116 1220 ----
NM_170735chr1132758 2631 116 1220 ----
NM_170750chrX3882 823 772 --3870 734 214 --
NM_170751chr611224 --1899 --
NM_170752chr611224 --1899 --
NM_172037chr831366 1199 432 11320 ----
NM_172069chr241562 1548 876 739 11736 ----
NM_172070chr262003 1863 1664 832 409 307 21426 879 21813 1464 --
NM_172071chr1107266 6740 6514 5691 5613 1994 1347 863 750 381 27255 2478 32890 2749 188 --
NM_172103chr632720 1853 979 ------
NM_172105chr632720 1853 979 ------
NM_172127chr471671 1495 184 173 143 129 69 --11868 --
NM_172128chr471627 1451 140 129 99 85 25 --11824 --
NM_172159chr371902 1849 1769 1744 1666 856 237 --12270 --
NM_172160chr371902 1849 1769 1744 1666 856 237 --12270 --
NM_172193chr1441251 930 370 272 --11277 --
NM_172196chr21182 ------
NM_172218chr85792 705 304 156 32 1685 ----
NM_173039chr11------1224
NM_173054chr72619 394 ------
NM_173082chr621030 509 11554 --1426
NM_173083chr131290 1143 321 --11001 --
NM_173091chr201122 ------
NM_173157chr121482 ------
NM_173171chr21335 ------
NM_173173chr21335 ------
NM_173198chr932381 1198 379 12258 --12772
NM_173200chr932381 1198 379 12258 --12772
NM_173214chr1697255 7082 6839 6519 6124 2440 1972 707 398 ----17044
NM_173354chr2142183 2161 497 412 --1806 --
NM_173359chr331914 1824 408 ------
NM_173463chr463572 3175 3139 2881 2852 1030 --21672 252 --
NM_173468chr4135993 5757 5486 5469 5379 2203 1970 1852 930 896 577 481 54 ----1721
NM_173469chr153594 221 172 11179 ----
NM_173475chr1661441 1376 1332 1309 1142 710 1567 ----
NM_173491chr551297 1270 1157 231 41 1196 ----
NM_173495chrX22516 984 --21825 999 12041
NM_173500chr1541055 517 488 56 ------
NM_173505chr1831012 476 64 ------
NM_173510chr2252933 2628 2602 1870 990 1864 ----
NM_173511chr243566 2915 1572 1030 13051 23916 637 --
NM_173517chr7--1405 ----
NM_173531chr1973187 3161 2699 2502 1428 1190 972 42737 1279 1253 617 12488 --
NM_173552chr351795 1769 893 383 352 12397 ----
NM_173567chr11201 ------
NM_173570chr322113 1823 21428 47 ----
NM_173576chr1041904 539 347 224 2844 239 ----
NM_173582chr1176036 5996 4907 4169 2036 1794 750 16232 26268 625 --
NM_173591chr1231032 728 110 --1249 --
NM_173602chr1263690 757 391 294 266 258 12320 11357 --
NM_173607chr143616 551 313 --22152 431 --
NM_173618chr16--1333 ----
NM_173642chr1129140 8503 7770 7203 6928 3677 3129 3108 2624 2138 1938 1777 16320 25699 3624 --
NM_173644chr2081883 1877 1803 1654 1640 654 554 71 --31750 1697 604 --
NM_173694chrX42426 982 975 546 11754 ----
NM_173797chr5----1195 --
NM_173803chr1621222 243 ------
NM_173808chr122973 1182 13811 33719 3588 439 --
NM_173812chr1221129 273 11525 --11571
NM_173822chr252040 2022 1522 1357 140 ------
NM_173825chr312537 --1907 --
NM_173829chr586210 5437 5070 4640 4178 4105 1605 886 15201 ----
NM_173851chr863720 3436 2974 1050 538 317 ------
NM_174858chr131235 190 182 11042 1879 --
NM_174911chr843187 3145 2547 859 --13745 --
NM_174934chr1193611 3598 3391 3203 3085 3035 2650 2610 2498 ------
NM_174941chr121183 ------
NM_174963chr1--1321 ----
NM_174964chr1--1321 ----
NM_174965chr1--1340 ----
NM_174966chr1--1321 ----
NM_174967chr1--1340 ----
NM_174968chr1--1321 ----
NM_174969chr1--1321 ----
NM_174970chr1--1340 ----
NM_174971chr1--1321 ----
NM_175061chr751907 1747 316 153 117 --12030 --
NM_175610chr1561284 1186 1056 958 420 332 --1917 --
NM_175623chr12157673 7360 7010 6238 4740 4670 2875 2510 2419 2079 1316 1278 993 809 656 --21257 631 1338
NM_175624chr12157768 7455 7105 6333 4835 4765 2970 2605 2514 2174 1411 1373 1088 904 751 --21352 726 1433
NM_175625chr12157768 7455 7105 6333 4835 4765 2970 2605 2514 2174 1411 1373 1088 904 751 --21352 726 1433
NM_175634chr8----11160 11253
NM_175635chr8----11160 11253
NM_175636chr8----11160 11253
NM_175736chr1267834 7789 6917 6184 5427 406 27148 5646 --17165
NM_175748chr1462093 2029 1980 1425 1390 1351 ------
NM_175847chr1911266 ------
NM_175852chr13835 425 227 --23056 196 --
NM_175854chr1362648 2610 2295 1908 1879 699 1840 11827 --
NM_175856chr5--176 ----
NM_175861chr1295936 5506 5195 4184 1861 1800 1767 962 768 ------
NM_175863chr641220 1025 321 263 --1440 --
NM_175876chr142661 2026 1800 487 177 ----
NM_175884chr7----21015 997 1962
NM_175920chr52649 150 ------
NM_176787chr1831382 613 604 1479 ----
NM_176801chr4--11783 ----
NM_176824chr421270 546 1886 1376 1321
NM_176895chr54340 283 273 75 ------
NM_177422chr13684 496 463 ------
NM_177424chr141940 1385 345 245 ------
NM_177438chr1484075 3826 3812 2848 1644 1148 835 173 13575 11388 21420 750
NM_177452chr1462369 1680 1593 1572 727 683 --31559 280 119 --
NM_177524chr72228 57 127 ----
NM_177525chr72228 57 127 ----
NM_177949chrX1138 ------
NM_177951chr141138 1894 1800 --
NM_177952chr141659 ------
NM_177967chr1311037 --1202 1281
NM_177968chr262256 1905 647 609 311 245 1545 1500 --
NM_177969chr23683 588 63 --168 1625
NM_177974chr1542040 681 581 265 32203 2138 186 22263 1439 --
NM_177985chr231425 619 465 11840 ----
NM_177989chr3--1286 ----
NM_177990chr2032044 1414 95 11798 1428 --
NM_177995chr911879 21625 263 ----
NM_178006chr13102356 2329 2253 2206 2118 2014 1791 334 274 71 11524 11532 --
NM_178007chr13102356 2329 2253 2206 2118 2014 1791 334 274 71 11524 11532 --
NM_178011chr1032722 1157 986 --1309 12052
NM_178042chr3--1286 ----
NM_178043chr4175 ------
NM_178135chr421069 27 ----11271
NM_178136chr22--1420 --12035
NM_178140chr531895 1022 642 1767 ----
NM_178150chr101205 --1264 --
NM_178151chrX127211 6903 6664 6644 6580 5881 2817 2517 1700 1680 1486 973 21206 304 16317 17470
NM_178152chrX127211 6903 6664 6644 6580 5881 2817 2517 1700 1680 1486 973 21206 304 16317 17470
NM_178153chrX127211 6903 6664 6644 6580 5881 2817 2517 1700 1680 1486 973 21206 304 16317 17470
NM_178313chr251993 1634 1494 1350 133 --1502 --
NM_178424chr5------1254
NM_178426chr121940 682 ------
NM_178427chr121840 582 ------
NM_178439chr24484 207 201 192 ------
NM_178498chr1133285 403 95 ------
NM_178539chr1262025 1755 1678 1489 1320 649 12003 ----
NM_178548chr11625 ------
NM_178581chr201281 ------
NM_178584chr221179 382 --11387 --
NM_178585chr442989 2805 2585 418 --12676 --
NM_178815chr1052106 1966 785 297 217 --12621 --
NM_178818chr1642427 2273 1572 145 12484 ----
NM_178864chr111231 ------
NM_178868chr3293 74 ----1221
NM_180989chr1331950 1829 139 --22280 468 12433
NM_181054chr1431281 820 385 --11048 --
NM_181077chr1552227 1563 1461 591 258 11425 11579 11931
NM_181265chr493184 2911 2794 2774 2509 2238 2203 759 490 22895 721 11986 --
NM_181291chr141678 1671 ----
NM_181332chrX62726 2202 1999 1072 966 630 11758 ----
NM_181351chr1133004 1954 535 --12658 --
NM_181358chr194264 4214 3172 3043 1456 1421 1162 183 53 --13929 --
NM_181361chr31501 ------
NM_181442chr2041048 1017 986 897 1701 ----
NM_181453chr221460 232 --1143 11448
NM_181481chr1856784 5950 5162 5070 805 --2939 322 14633
NM_181482chr1856784 5950 5162 5070 805 --2939 322 14633
NM_181483chr1856784 5950 5162 5070 805 --2939 322 14633
NM_181504chr5103955 3886 3872 3483 3042 3034 3026 2836 1294 582 14183 24177 3911 --
NM_181521chr16127208 7054 6353 6157 5838 4926 4618 2691 2546 2382 2298 303 27265 1874 16007 --
NM_181523chr5103955 3886 3872 3483 3042 3034 3026 2836 1294 582 14183 24177 3911 --
NM_181524chr5103955 3886 3872 3483 3042 3034 3026 2836 1294 582 14183 24177 3911 --
NM_181527chr204420 405 364 278 ------
NM_181528chr204475 460 419 333 ------
NM_181571chr103356 212 34 ------
NM_181656chr172950 898 --2940 206 --
NM_181659chr2043063 2554 1009 924 1995 ----
NM_181659chr2043063 2554 1009 924 1995 ----
NM_181670chr1231466 1278 1209 ------
NM_181701chr962342 1816 708 392 276 212 --11468 --
NM_181704chr2121263 70 ------
NM_181705chr544169 3964 1051 716 --25709 5649 --
NM_181706chr1142427 1465 795 182 --21580 1568 --
NM_181713chr21273 --1312 --
NM_181714chr621561 1380 --1329 --
NM_181723chr842104 899 688 181 ------
NM_181726chr4----1157 --
NM_181782chr651789 1762 736 579 358 --12334 --
NM_181783chr1281990 1827 1517 694 650 505 183 174 21568 161 1582 --
NM_181787chr873391 3079 2514 1278 655 641 444 13716 23155 1431 --
NM_181838chr551577 1173 993 530 454 ------
NM_181839chr831215 499 114 --167 --
NM_181844chr1731386 387 320 ----11412
NM_181861chr1282764 2677 2095 1973 743 506 356 116 12688 22034 290 --
NM_181868chr1282764 2677 2095 1973 743 506 356 116 12688 22034 290 --
NM_181869chr1282849 2762 2180 2058 828 591 441 201 12773 22119 375 --
NM_181886chr41560 2280 31 1552 --
NM_181887chr41560 2280 31 1552 --
NM_181888chr41560 2280 31 1552 --
NM_181889chr41560 2280 31 1552 --
NM_181890chr41560 2280 31 1552 --
NM_181891chr41560 2280 31 1552 --
NM_181893chr41560 2280 31 1552 --
NM_181897chr32511 35 --21058 780 --
NM_182481chr2111168 ------
NM_182482chr2111168 ------
NM_182484chr2121263 70 ------
NM_182485chr4133276 3179 2676 2668 2594 2446 767 738 670 243 130 94 45 1592 --22303 886
NM_182498chr192317 247 --1337 --
NM_182503chr6105585 4837 3683 1567 1403 1377 1174 1133 568 274 --13607 --
NM_182508chr1362716 2590 461 368 71 42 21052 810 ----
NM_182511chr1841348 919 506 336 --11186 --
NM_182515chr1976504 5201 4890 4353 2319 2146 2088 12178 26091 4339 --
NM_182524chr4--2239 84 ----
NM_182527chr2222237 2187 ------
NM_182641chr1731368 828 391 1808 11321 --
NM_182643chr861708 951 554 340 246 185 ------
NM_182646chr4133276 3179 2676 2668 2594 2446 767 738 670 243 130 94 45 1592 --22303 886
NM_182648chr142735 574 1720 1216 --
NM_182678chr21503 1377 ----
NM_182689chr11320 ------
NM_182690chr11382 ------
NM_182715chr741260 1069 1031 311 --1185 --
NM_182717chr102617 439 ------
NM_182718chr103356 212 34 ------
NM_182719chr103356 212 34 ------
NM_182720chr102617 439 ------
NM_182721chr102617 439 ------
NM_182722chr102617 439 ------
NM_182723chr102617 439 ------
NM_182724chr103356 212 34 ------
NM_182725chr103356 212 34 ------
NM_182729chr1241756 1434 1372 242 11195 11795 --
NM_182734chr2083182 2525 2310 1286 1256 732 642 467 23017 2800 22725 813 --
NM_182742chr1241756 1434 1372 242 11195 11795 --
NM_182743chr1241756 1434 1372 242 11195 11795 --
NM_182756chr21138 ------
NM_182758chr1563188 2981 1462 1218 1040 959 13941 23309 2591 1147
NM_182762chr795788 5380 4477 4417 2333 1466 1287 838 712 15448 65865 5741 4889 4336 1232 268 --
NM_182765chr1032326 1988 1757 12332 ----
NM_182767chr1262099 1855 1540 725 473 268 --22000 818 --
NM_182769chr103356 212 34 ------
NM_182770chr103356 212 34 ------
NM_182771chr103356 212 34 ------
NM_182772chr103356 212 34 ------
NM_182796chr52807 642 --2936 606 --
NM_182835chr14----1162 --
NM_182850chr103356 212 34 ------
NM_182853chr102617 439 ------
NM_182898chr796556 6303 5633 4705 4241 4170 3983 2593 50 12499 ----
NM_182899chr796556 6303 5633 4705 4241 4170 3983 2593 50 12499 ----
NM_182907chr642071 1542 1505 273 1900 1455 --
NM_182918chr2161395 1338 1131 440 315 34 --11200 --
NM_182931chr73544 501 133 ------
NM_182948chr133005 1954 1220 ------
NM_182964chr1123081 2894 --1915 --
NM_182972chr122195 333 ------
NM_182976chr12608 290 --1108 --
NM_183004chr1463779 2691 2462 934 711 77 --12782 --
NM_183011chr102617 439 ------
NM_183012chr102617 439 ------
NM_183013chr102617 439 ------
NM_183043chr132912 859 --11014 --
NM_183044chr132912 859 --11014 --
NM_183060chr103356 212 34 ------
NM_183061chr3------2360 29
NM_183078chr643267 2972 2579 408 23531 2515 23860 1113 --
NM_183079chr2031496 1288 997 ----21364 1224
NM_183234chr1551732 1533 1424 1212 305 ------
NM_183235chr1551732 1533 1424 1212 305 ------
NM_183236chr1551732 1533 1424 1212 305 ------
NM_183244chr20--1475 ----
NM_183246chr20--1475 ----
NM_183376chr1572429 1875 1722 1666 1609 1052 435 ------
NM_183380chr64812 769 644 137 --1987 --
NM_183381chr32947 326 1892 1878 --
NM_183383chr32947 326 1892 1878 --
NM_183384chr32947 326 1892 1878 --
NM_183416chr161840 755 739 674 662 621 --11715 --
NM_183419chr831426 1083 1017 1206 11247 --
NM_184234chr203621 548 24 ------
NM_194247chr253457 3364 1676 1170 757 11662 --198
NM_194278chr1453297 3029 2779 1638 672 13010 13038 --
NM_194279chr141346 ------
NM_194282chr492398 2150 2001 1943 1115 1086 468 327 91 --1726 --
NM_194285chr1163423 3069 2581 2078 580 124 --23184 2318 --
NM_194286chr1275966 5851 5542 4722 4139 3782 2251 ------
NM_194291chr862510 2495 2480 1885 342 298 --11919 22456 126
NM_194294chr82687 229 ------
NM_194314chr155092 4444 3897 2097 2048 25277 5187 25119 4493 --
NM_194317chr242271 372 314 273 11035 ----
NM_194328chr953337 3164 645 555 49 ----13170
NM_194329chr953337 3164 645 555 49 ----13170
NM_194330chr953337 3164 645 555 49 ----13170
NM_194332chr953337 3164 645 555 49 ----13170
NM_194356chr1282175 1785 1592 1533 442 324 252 25 --12255 --
NM_194442chr141416 1189 1091 234 1183 ----
NM_194449chr181397 ------
NM_194454chr751168 1138 1118 664 421 ------
NM_194455chr751168 1138 1118 664 421 ------
NM_194456chr751168 1138 1118 664 421 ------
NM_194463chrX21236 1190 --21158 971 --
NM_197941chr53694 374 50 22849 572 --1104
NM_197968chr133744 734 294 ------
NM_197970chr211415 --11266 11660
NM_197978chr94555 514 221 58 ------
NM_198057chrX11219 ------
NM_198077chr13568 179 106 --2237 184 --
NM_198128chr1852243 2135 890 822 528 --22340 327 --
NM_198150chr531149 619 445 11330 21239 67 --
NM_198158chr343029 1086 987 22 1969 2557 471 --
NM_198159chr343029 1086 987 22 1969 2557 471 --
NM_198173chr11729 --1773 1820
NM_198174chr11729 --1773 1820
NM_198177chr343029 1086 987 22 1969 2557 471 --
NM_198178chr343029 1086 987 22 1969 2557 471 --
NM_198181chr1552634 2575 2065 602 344 --11010 --
NM_198182chr221471 184 --11530 --
NM_198189chr22920 74 ----1708
NM_198196chr352531 2493 1018 974 420 ------
NM_198215chr1031242 1117 368 ------
NM_198217chr1341028 443 94 48 1946 ----
NM_198218chr1341028 443 94 48 1946 ----
NM_198219chr1341028 443 94 48 1946 ----
NM_198225chr1091879 1771 1688 1634 611 367 238 220 143 1394 11546 --
NM_198240chr1231207 451 383 --11266 --
NM_198261chr121104 ----1757
NM_198262chr121104 ----1757
NM_198268chr194264 4214 3172 3043 1456 1421 1162 183 53 --13929 --
NM_198269chr194264 4214 3172 3043 1456 1421 1162 183 53 --13929 --
NM_198270chrX53466 3409 3276 3130 575 ----11256
NM_198271chr321730 376 ------
NM_198273chr5113027 2977 2891 2460 2105 2011 798 714 285 266 40 12930 13059 1608
NM_198279chrX--1206 2870 271 --
NM_198320chr1274986 4529 4338 4250 1435 1252 1168 12020 ----
NM_198336chr721845 1182 --1703 --
NM_198376chr171289 ------
NM_198377chr171289 ------
NM_198378chr171289 ------
NM_198379chr171289 ------
NM_198380chr171289 ------
NM_198382chr171289 ------
NM_198383chr171289 ------
NM_198384chr171289 ------
NM_198385chr171289 ------
NM_198386chr171289 ------
NM_198387chr171289 ------
NM_198388chr171289 ------
NM_198391chr2041287 946 370 257 1523 21515 1340 --
NM_198396chr171289 ------
NM_198399chr331802 1527 244 21725 1630 11786 --
NM_198400chr1552885 1799 1070 942 192 22711 1081 42721 2588 2263 429 --
NM_198401chr851737 1723 1383 1155 121 --11769 --
NM_198402chr31303 ------
NM_198441chr134871 864 667 308 1850 ----
NM_198451chrX--1639 ----
NM_198465chrX52921 2733 296 172 42 --12849 12774
NM_198507chr51181 ------
NM_198513chr831879 615 458 31872 1828 756 1821 --
NM_198552chr11167 1518 --1419
NM_198570chr7----1279 --
NM_198581chr2106796 6356 5308 5012 1450 1144 1130 1109 927 755 46222 4553 1284 818 ----
NM_198595chr454715 3966 1909 1655 166 --14855 --
NM_198700chr112428 182 ------
NM_198715chr1126277 5652 5540 5294 5170 4717 4548 4362 2472 2430 1194 489 13867 34022 497 100 13905
NM_198793chr363266 3185 2772 2611 1300 1277 11546 24061 893 13852
NM_198794chr142561 506 --21208 936 --
NM_198829chr731497 456 339 11008 --11032
NM_198844chr17--1399 2926 124 --
NM_198859chr354956 4015 3756 3539 455 1993 --11832
NM_198880chr3</