TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5702
miRNA Sequence: UGAGUCAGCAACAUAUCCCAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842451 703 409 202 --11656 --
NM_000038chr551947 1929 1646 372 114 ------
NM_000067chr82555 274 ------
NM_000081chr13743 335 58 ------
NM_000084chrX86663 6181 6123 5878 2139 1205 657 602 46577 4664 2617 2075 56335 6301 4925 2112 1867 --
NM_000090chr21730 ------
NM_000092chr2104604 4370 4144 4119 3898 3205 2873 2847 844 256 24425 3571 ----
NM_000093chr952073 1946 843 708 624 --1124 --
NM_000094chr3--1211 1301 --
NM_000109chrX----2749 107 --
NM_000110chr12924 791 ------
NM_000125chr6114165 3349 3317 3045 2652 1356 796 693 449 433 397 ------
NM_000129chr641532 1470 1222 1161 193 1970 --
NM_000168chr722854 2826 --164 --
NM_000170chr9130 ------
NM_000175chr19133 --1232 --
NM_000176chr553694 3273 2527 1226 1042 1732 ----
NM_000179chr2130 ------
NM_000192chr122576 198 ------
NM_000196chr161440 ----1446
NM_000202chrX32794 1456 435 --12619 --
NM_000210chr231514 872 286 ----1455
NM_000214chr2051754 1150 469 366 133 ----196
NM_000216chrX83682 3425 3360 3072 2709 431 418 124 24062 3500 11448 --
NM_000217chr1273709 3392 1551 1128 796 711 261 34493 4199 81 ----
NM_000232chr432187 887 39 23198 867 22662 923 --
NM_000240chrX31672 1635 368 1735 1724 --
NM_000245chr722143 1656 ------
NM_000248chr352347 2254 2221 352 49 1477 12696 --
NM_000259chr1575840 5799 4993 4414 4147 4121 106 31433 1057 951 21902 974 --
NM_000266chrX3928 628 261 --1751 --
NM_000267chr1732298 1353 553 --22596 2371 --
NM_000269chr171171 ------
NM_000271chr182169 23 ------
NM_000304chr1721085 997 ------
NM_000314chr1023285 3135 1812 --13097
NM_000319chr12161 ------
NM_000321chr1361532 1224 715 473 338 160 ------
NM_000325chr41254 ------
NM_000329chr11593 ------
NM_000330chrX52108 1894 905 411 165 ------
NM_000332chr686004 5199 5073 2615 2300 905 677 30 27119 5175 36641 2103 322 --
NM_000334chr174706 659 619 519 1427 2711 113 --
NM_000337chr554600 4361 1589 525 63 11495 21083 886 --
NM_000338chr1521129 1020 ------
NM_000346chr17--1469 ----
NM_000367chr641974 1501 1445 473 --12278 --
NM_000368chr954625 1218 534 401 145 13775 21662 1129 --
NM_000378chr111883 1207 169 --
NM_000386chr171558 ------
NM_000390chrX73274 3159 943 768 256 195 44 22813 2535 ----
NM_000393chr252015 1697 1434 281 69 ------
NM_000399chr1041088 481 308 210 11026 ----
NM_000401chr1121059 874 1840 ----
NM_000408chr283434 3227 2710 2404 2298 2218 775 592 ------
NM_000426chr61206 ------
NM_000430chr1753187 2718 2513 1441 817 --21296 375 --
NM_000441chr731722 386 64 11648 ----
NM_000448chr1132273 802 177 13173 ----
NM_000459chr91740 --1178 --
NM_000461chr343109 1855 1184 659 1639 11162 --
NM_000462chr1531469 1452 1265 ------
NM_000474chr71227 ------
NM_000480chr1151433 1409 1099 414 205 ------
NM_000484chr211299 ------
NM_000489chrX53293 1351 1077 501 423 173 1989 --
NM_000492chr731439 1381 1231 --11483 --
NM_000495chrX3862 254 142 ----11113
NM_000523chr24942 396 346 194 --2181 153 --
NM_000533chrX21543 253 ------
NM_000544chr6_cox_hap131253 741 560 --13111 --
NM_000555chrX147816 7038 6627 6513 5517 5073 4975 4925 3104 2768 2162 2131 555 519 17518 23142 780 --
NM_000573chr121937 109 1469 1744 --
NM_000575chr22891 267 ------
NM_000594chr62692 669 1564 --192
NM_000598chr72122 83 1351 1342 --
NM_000610chr1142924 2388 712 93 12763 --1664
NM_000615chr1142997 2017 1021 747 --12368 --
NM_000618chr12106494 6436 6028 4851 4728 4655 4563 4464 1976 1820 --11736 --
NM_000618chr12106494 6436 6028 4851 4728 4655 4563 4464 1976 1820 --11736 --
NM_000627chr21624 ------
NM_000633chr1885049 1921 1397 902 792 456 448 335 24224 594 1844 --
NM_000651chr121937 109 1469 1744 --
NM_000683chr4----1388 --
NM_000724chr1041558 796 462 416 11873 ----
NM_000726chr231270 584 395 ------
NM_000739chr71109 --1297 --
NM_000780chr821093 1067 21270 108 ----
NM_000788chr421472 1411 ------
NM_000792chr131021 880 78 11027 ----
NM_000793chr1474418 4249 3709 3632 3255 1937 404 14521 13779 --
NM_000794chr52912 771 ------
NM_000807chr43269 243 73 ------
NM_000809chr498834 8457 8416 8197 6378 3721 2901 1881 616 --43415 3344 1425 1388 --
NM_000811chr51212 ------
NM_000813chr542201 1844 1736 1198 14981 ----
NM_000814chr1553925 3727 3599 2764 1248 ------
NM_000820chr13----1275 --
NM_000826chr42585 85 2476 466 ----
NM_000827chr532431 1675 966 31899 1628 134 ----
NM_000831chr156224 4368 1826 1451 997 --35809 5116 3883 25606 4161
NM_000838chr642577 2295 2027 941 ------
NM_000844chr31924 --1283 --
NM_000859chr551586 1571 1138 428 143 ------
NM_000860chr41607 21164 622 ----
NM_000866chr3----11880 --
NM_000868chrX32226 2101 741 ------
NM_000872chr101142 --11075 --
NM_000875chr15116830 6407 6276 6165 6120 6106 5464 4743 4665 1390 769 --1631 --
NM_000876chr641350 1253 393 177 21024 208 ----
NM_000891chr1732928 2851 540 ------
NM_000899chr1251667 1343 596 341 145 1160 ----
NM_000901chr41286 1101 12294 12230
NM_000910chr43353 151 85 21894 1694 ----
NM_000912chr843273 2477 2388 1137 23370 3248 23278 2721 --
NM_000921chr12139 ------
NM_000922chr1111121 --193 --
NM_000926chr11158798 8690 8462 7955 7554 6708 5822 3508 3467 3217 3098 1470 1367 1273 1224 18934 22233 826 --
NM_000933chr2041623 1372 1321 140 --1145 --
NM_000935chr311114 ------
NM_000944chr442345 2291 1775 1639 ------
NM_000945chr2--1396 ----
NM_000949chr5--1930 1164 --
NM_000950chrX43460 3138 1265 480 192 ----
NM_000962chr9102978 2930 1249 1027 467 440 419 391 383 168 41262 711 490 400 22217 2194 12201
NM_000965chr31350 --11209 1961
NM_000983chr141640 1171 229 162 1351 ----
NM_001001132chr213387 293 110 ------
NM_001001330chr1031303 1062 180 ------
NM_001001342chr1011422 11145 ----
NM_001001389chr1142924 2388 712 93 12763 --1664
NM_001001390chr1142924 2388 712 93 12763 --1664
NM_001001391chr1142924 2388 712 93 12763 --1664
NM_001001392chr1142970 2434 758 139 12809 --1710
NM_001001395chr1212525 ------
NM_001001396chr174156 3456 3222 3115 1597 1384 475 --21527 301 --
NM_001001419chr564254 1958 1281 1239 906 638 23795 1311 ----
NM_001001420chr564254 1958 1281 1239 906 638 23795 1311 ----
NM_001001433chr2063131 2925 2890 2060 1131 1066 12098 12443 --
NM_001001481chr833098 324 90 ------
NM_001001483chr112279 31 ------
NM_001001484chr101513 --12479 --
NM_001001549chr752786 2365 2296 2097 149 --11919 12105
NM_001001550chr752786 2365 2296 2097 149 --11919 12105
NM_001001555chr752786 2365 2296 2097 149 --11919 12105
NM_001001557chr831600 879 71 ------
NM_001001560chr222521 154 ------
NM_001001664chr251048 682 228 191 35 --13490 11461
NM_001001668chr1933598 3368 2734 23841 575 11287 --
NM_001001702chr541768 1640 1532 1193 ----2126 34
NM_001001852chr221750 --2621 73 --
NM_001001875chr92286 66 ------
NM_001001890chr2153464 3145 1675 623 339 1384 ----
NM_001001974chr1041645 961 747 382 1556 ----
NM_001001995chrX2518 348 ------
NM_001002032chr172480 72 ------
NM_001002033chr173580 172 73 ------
NM_001002233chr842164 1829 801 38 ------
NM_001002243chr23716 382 117 1662 ----
NM_001002255chr61102 --1274 --
NM_001002259chr122290 85 ------
NM_001002265chr102864 773 1565 ----
NM_001002266chr102864 773 1565 ----
NM_001002295chr101316 ----1222
NM_001002843chr152966 461 ------
NM_001002860chr1464427 3747 3725 3125 1857 1216 1841 14678 --
NM_001002909chr1722103 1901 ----11942
NM_001003406chr2293168 2738 2348 2093 2049 2039 622 587 317 --1961 --
NM_001003674chr1896258 5936 2735 2423 1881 1793 1785 1651 1113 --46180 2291 875 144 --
NM_001003675chr1896258 5936 2735 2423 1881 1793 1785 1651 1113 --46180 2291 875 144 --
NM_001003694chr33640 428 40 ----195
NM_001003712chr1233368 140 42 12842 ----
NM_001003760chr632627 1136 110 ------
NM_001003800chr932905 2556 535 13416 ----
NM_001003940chr1563338 2621 2464 1108 693 550 --1711 --
NM_001003942chr1563338 2621 2464 1108 693 550 --1711 --
NM_001003943chr1563342 2625 2468 1112 697 554 --1715 --
NM_001004019chr3----1121 --
NM_001004065chr953606 3378 3361 1400 548 22594 231 --12516
NM_001004304chr122871 307 12192 --12665
NM_001004317chr674211 4143 4093 3107 1381 686 666 34300 3959 1602 23792 1452 13529
NM_001004360chr221347 1307 ------
NM_001004419chr1221500 500 1332 14431 --
NM_001005266chr152713 624 --1240 --
NM_001005267chr152713 624 --1240 --
NM_001005268chr152713 624 --1240 --
NM_001005269chr152713 624 --1240 --
NM_001005366chr121390 ------
NM_001005375chrY21569 430 --1405 --
NM_001005386chr241864 1544 609 113 --12205 --
NM_001005404chr1773499 2999 1210 713 547 491 218 24454 912 1614 --
NM_001005463chr1032287 846 217 ------
NM_001005473chr576374 5155 4286 2445 1330 1187 335 --11336 --
NM_001005476chr2176 ------
NM_001005502chr1244566 3991 1015 97 53594 1296 1098 423 189 15235 --
NM_001005609chrX103601 2436 1272 1053 815 735 274 257 171 147 12662 --1263
NM_001005611chrX3505 199 165 ------
NM_001005732chr211596 ------
NM_001005733chr211553 ------
NM_001005739chr22315 78 ------
NM_001005743chr14189 ------
NM_001005744chr14189 ------
NM_001005745chr14189 ------
NM_001005746chr231270 584 395 ------
NM_001005747chr231270 584 395 ------
NM_001005782chr24905 379 324 176 ------
NM_001005845chr81691 11207 ----
NM_001005849chr17199 ------
NM_001006115chr352684 780 523 356 221 ----12521
NM_001006600chr53844 734 77 1757 ----
NM_001006626chr71109 --1297 --
NM_001006627chr71109 --1297 --
NM_001006628chr71109 --1297 --
NM_001006629chr71109 --1297 --
NM_001006630chr71109 --1297 --
NM_001006631chr71109 --1297 --
NM_001006632chr71109 --1297 --
NM_001006657chr233091 2846 2368 --12986 --
NM_001007023chr1474418 4249 3709 3632 3255 1937 404 14521 13779 --
NM_001007024chr1774383 3510 3307 2998 2666 602 83 24004 3011 23282 545 --
NM_001007025chr1774383 3510 3307 2998 2666 602 83 24004 3011 23282 545 --
NM_001007027chr111223 ------
NM_001007067chr831049 932 876 --21008 238 --
NM_001007068chr831049 932 876 --21008 238 --
NM_001007069chr831049 932 876 --21008 238 --
NM_001007070chr831049 932 876 --21008 238 --
NM_001007088chrX21169 82 ------
NM_001007097chr954712 4596 3861 3527 524 33490 3314 368 34290 4095 3395 --
NM_001007102chr62594 446 --11337 --
NM_001007189chr5161 ------
NM_001007226chr1731016 323 235 --1979 --
NM_001007227chr1731016 323 235 --1979 --
NM_001007228chr1731016 323 235 --1979 --
NM_001007229chr1731016 323 235 --1979 --
NM_001007230chr1731016 323 235 --1979 --
NM_001007245chr73610 260 170 ------
NM_001007257chr12147 35 --1268 1124
NM_001007277chr111407 ------
NM_001007466chr694664 4466 4453 3804 3443 3296 1211 812 591 3801 616 81 14092 --
NM_001007553chr131241 996 836 ------
NM_001008225chr7169 1741 ----
NM_001008239chr1843254 1408 589 274 --12801 12429
NM_001008388chr41231 --1188 --
NM_001008401chr1931445 1410 279 ------
NM_001008408chr7146125 6099 5852 5634 5603 5521 4893 4828 4271 4011 2329 2009 1883 1534 45996 4489 1855 334 45408 867 312 158 14617
NM_001008491chr241721 569 368 344 --1451 1334
NM_001008492chr241721 569 368 344 --1451 1334
NM_001008495chr832144 1963 115 ------
NM_001008529chr1721267 1216 ------
NM_001008539chr895080 4934 4557 4393 3550 2106 1886 1016 461 44920 4632 4187 968 14048 --
NM_001008541chr1021550 1458 ------
NM_001008541chr1021550 1458 ------
NM_001008564chr1352285 1517 253 241 218 21614 524 ----
NM_001008566chr222436 24 ------
NM_001008738chr532667 1905 181 22238 369 ----
NM_001008801chr1922180 774 21342 644 22125 1689 --
NM_001008895chr133588 132 88 ------
NM_001008925chr462449 2418 2286 2167 1216 571 1755 12742 --
NM_001009183chr141420 ------
NM_001009185chr52573 109 1686 ----
NM_001009555chr451424 1263 605 530 58 ------
NM_001009814chr13----125 --
NM_001009880chr2244758 4694 4270 4201 ------
NM_001009881chr11146 ------
NM_001009882chr11146 ------
NM_001009894chr1211225 11321 ----
NM_001009899chr365907 4576 2135 1488 1431 431 22044 415 11358 --
NM_001009960chr732349 2278 734 12306 ----
NM_001009992chr131358 1187 564 ------
NM_001009993chr274580 3773 3541 3238 1224 579 495 --1177 --
NM_001010000chr1893479 3135 2734 2272 1346 753 531 416 199 12670 21195 536 --
NM_001010861chr122073 741 --12592 --
NM_001010888chrX74297 3859 3736 3483 3423 3196 515 13084 11098 11714
NM_001010891chr576959 6434 6416 5788 5319 5294 4511 22739 930 36513 6247 5631 --
NM_001010908chr10--1545 --1143
NM_001010924chr1041195 494 193 22 ------
NM_001010986chrX41975 1006 222 123 ------
NM_001010989chr161382 --159 --
NM_001010990chr161382 --159 --
NM_001011513chr433925 2963 1574 33275 1153 539 ----
NM_001011537chr331779 253 34 1229 ----
NM_001011551chrX2443 323 ------
NM_001011666chr795117 2349 2151 1646 1489 1287 851 657 120 ------
NM_001011708chr252819 891 498 452 50 22669 2542 ----
NM_001011724chr131307 ------
NM_001011725chr131307 ------
NM_001012264chr141275 1711 --193
NM_001012267chr9--11419 ----
NM_001012329chr182378 2205 2119 678 544 397 327 58 --1291 11590
NM_001012393chr1164992 3954 1477 1391 851 783 24872 402 13929 11636
NM_001012398chr162982 113 ----1938
NM_001012420chr1552910 2586 2194 1871 854 ------
NM_001012423chr1552910 2586 2194 1871 854 ------
NM_001012512chr181110 ------
NM_001012513chr181121 ------
NM_001012643chr191216 --3534 236 149 --
NM_001012751chr103768 720 217 1310 ----
NM_001012754chr1321824 602 --22151 286 --
NM_001012755chrX53525 3465 1343 1286 416 11753 24627 1526 14161
NM_001012968chrX62749 2726 1954 1080 953 147 --1525 --
NM_001012979chrX124 ------
NM_001012980chrX2224 196 ------
NM_001012989chrX1580 ----1174
NM_001013031chr1033216 1376 340 --11244 --
NM_001013398chr72122 83 1351 1342 --
NM_001013399chr631123 916 164 ------
NM_001013406chr741589 1518 1485 1175 21155 103 ----
NM_001013415chr431466 438 244 11566 ----
NM_001013620chr12108156 7081 6379 6295 6227 2984 2047 2007 1842 492 27029 2894 27814 2107 --
NM_001013624chr17126 --1869 --
NM_001013674chr11234 --1318 1292
NM_001013699chr12166 ------
NM_001013843chr15164 --2348 88 --
NM_001014336chr12187 ------
NM_001014797chr1095260 2955 2903 2774 2660 1099 193 132 98 12503 15642 --
NM_001014809chr43984 923 322 --1314 --
NM_001014812chr152487 122 ------
NM_001015045chr44814 796 743 173 12140 12340 1199
NM_001015053chr1721209 385 --11224 --
NM_001015877chrX53127 2153 2037 1953 494 13121 ----
NM_001015881chrX3967 779 73 ------
NM_001017369chr41102 --21076 871 --
NM_001017395chr383461 3397 3209 3065 2877 1430 1054 526 --23023 2477 --
NM_001017396chr251956 1858 869 195 100 1799 11474 --
NM_001017405chr42914 826 ------
NM_001017415chr11598 1524 ----
NM_001017416chr11598 1524 ----
NM_001017424chr141599 1403 1280 1239 1758 ----
NM_001017425chr141599 1403 1280 1239 1758 ----
NM_001017440chr7127671 7606 7521 6558 5853 5313 5184 2984 2775 2764 2234 503 13102 36849 1345 460 21983 1195
NM_001017920chr21135 ------
NM_001017923chr1451658 1465 1424 1363 423 11606 ----
NM_001017926chr851425 1404 702 494 54 ------
NM_001017928chr3----1219 1273
NM_001017961chr11219 ------
NM_001017969chr9149 ------
NM_001017973chr5196 ------
NM_001017974chr5196 ------
NM_001017995chr584849 4808 2968 1853 1091 423 127 44 --11029 --
NM_001017999chr11903 ------
NM_001017999chr11903 ------
NM_001018000chr11903 ------
NM_001018000chr11903 ------
NM_001018001chr11903 ------
NM_001018009chr321157 1146 ------
NM_001018025chrX1249 --1745 --
NM_001018057chr1131394 360 127 ------
NM_001018064chr93836 325 189 ------
NM_001018067chr144606 3513 1520 711 24489 688 13996 25203 4961
NM_001018068chr144606 3513 1520 711 24489 688 13996 25203 4961
NM_001018069chr144606 3513 1520 711 24489 688 13996 25203 4961
NM_001018074chr553694 3273 2527 1226 1042 1732 ----
NM_001018075chr553694 3273 2527 1226 1042 1732 ----
NM_001018076chr553694 3273 2527 1226 1042 1732 ----
NM_001018077chr553694 3273 2527 1226 1042 1732 ----
NM_001018088chr152152 66 ------
NM_001018090chr1542442 840 588 162 12855 ----
NM_001018091chr1542552 950 698 272 22965 1825 ----
NM_001018102chr1542442 840 588 162 12855 ----
NM_001018108chr151293 ------
NM_001018115chr32614 581 1198 --1499
NM_001020658chr11219 ------
NM_001020658chr11219 ------
NM_001023567chr1522302 1892 --11902 --
NM_001024094chr553694 3273 2527 1226 1042 1732 ----
NM_001024218chr142207 49 ------
NM_001024372chr852207 1806 1628 592 266 11887 ----
NM_001024455chrX72136 2126 1633 1055 944 661 393 --1741 --
NM_001024460chr641234 290 198 144 ------
NM_001024649chr542425 2292 2064 1176 ------
NM_001024660chr32606 363 ------
NM_001024666chrX--2697 219 ----
NM_001024680chr22471 55 11570 --21402 369
NM_001024847chr321015 503 --12306 --
NM_001024934chr61678 ----1633
NM_001024935chr61678 ----1633
NM_001024936chr61678 ----1633
NM_001024937chr171508 ------
NM_001024948chr153133 2650 1176 911 358 ------
NM_001024956chr1165665 5400 2346 834 647 492 ------
NM_001025076chr1096252 6224 5538 4858 4092 2135 1563 1472 492 26234 574 13826 14951
NM_001025077chr10127610 7582 6896 6216 5450 4895 4792 2921 2830 1850 1284 1073 27592 1932 25184 1123 16309
NM_001025079chr332876 1475 911 189 ----
NM_001025105chr541279 1194 1178 1115 --1155 --
NM_001025107chr142662 2586 1741 1059 22695 966 11947 --
NM_001025107chr142662 2586 1741 1059 22695 966 11947 --
NM_001025108chr252787 895 454 384 281 24108 49 32748 1076 655 --
NM_001025233chr1262661 2486 1915 630 454 253 --1689 --
NM_001025252chr82638 405 ----13134
NM_001025253chr82638 405 ----13134
NM_001025266chr3104831 4633 4271 4106 3679 3167 1740 1649 876 148 --1738 1217
NM_001025356chr1231880 937 729 11000 12368 --
NM_001025366chr621619 484 --11501 --
NM_001025366chr621619 484 --11501 --
NM_001025367chr621619 484 --11501 --
NM_001025367chr621619 484 --11501 --
NM_001025368chr621619 484 --11501 --
NM_001025368chr621619 484 --11501 --
NM_001025369chr621635 500 --11517 --
NM_001025369chr621635 500 --11517 --
NM_001025370chr621619 484 --11501 --
NM_001025370chr621619 484 --11501 --
NM_001025389chr1151433 1409 1099 414 205 ------
NM_001025390chr1151433 1409 1099 414 205 ------
NM_001025580chrX63852 3626 3170 2804 2631 402 ------
NM_001025596chr111367 --143 --
NM_001025777chr241607 1069 141 127 --1147 --
NM_001025780chr941555 1073 1016 563 ------
NM_001029858chr643361 2479 716 678 12297 1195 --
NM_001029859chr1152372 2324 674 523 133 21885 1621 1765 --
NM_001029860chr8------150
NM_001029863chr632489 261 50 12618 ----
NM_001029875chr5198 ------
NM_001029891chrX3801 279 138 ------
NM_001030007chr1663416 3337 1445 1082 827 204 --13578 --
NM_001030047chr191363 ----11054
NM_001030272chr11----1112 --
NM_001030273chr11----1112 --
NM_001031679chr1232291 763 179 2689 311 ----
NM_001031684chr211395 ------
NM_001031690chr732705 800 454 --11916 --
NM_001031695chr2285380 4455 3848 3296 1749 1606 1471 54 --11975 11762
NM_001031711chr551859 1499 1454 146 98 --1572 --
NM_001031712chr61303 ------
NM_001031716chr221007 791 --1924 --
NM_001031732chr453666 3148 2618 457 22 12417 1266 13483
NM_001031746chr1021159 499 ------
NM_001031804chr1683965 3625 3388 3332 2750 1734 1103 813 --14404 23133 269
NM_001032282chr81362 11282 ----
NM_001032283chr12179 ------
NM_001032284chr12179 ------
NM_001032288chr2031607 353 281 ------
NM_001032293chr172540 100 ------
NM_001032296chr1372699 2629 2355 2209 2002 1965 1041 --190 12526
NM_001032380chr1021969 440 --2331 210 --
NM_001032393chrX1124 1223 ----
NM_001032730chr11483 ------
NM_001033025chr121519 289 ------
NM_001033045chr263995 3516 3146 2710 1123 854 21206 361 --1204
NM_001033047chr43973 425 307 32267 1015 468 1513 --
NM_001033057chr31852 21974 1673 ----
NM_001033059chr651813 1711 1640 1479 577 ------
NM_001033081chr151895 1887 1833 1480 258 --21624 1429 1205
NM_001033082chr151895 1887 1833 1480 258 --21624 1429 1205
NM_001033085chr22297 70 ------
NM_001033087chr2022492 780 12993 2719 33 11070
NM_001033117chr374843 4648 4579 4237 1726 881 158 23407 41 --24143 1694
NM_001033503chr5------1169
NM_001033557chr23899 525 227 ------
NM_001033561chr172594 150 ------
NM_001033602chr1352593 2297 2243 1949 1889 1795 12081 --
NM_001033756chr621553 418 --11435 --
NM_001033756chr621553 418 --11435 --
NM_001033925chr1032146 306 261 ------
NM_001034025chr1231001 383 133 ------
NM_001034837chr52185 82 1175 ----
NM_001034838chr52185 82 1175 ----
NM_001034841chr1674858 4532 4475 1497 1018 1011 453 75399 5238 5225 4892 4442 2132 1208 --14717
NM_001034954chr1051013 964 863 747 628 1937 ----
NM_001034955chr1051013 964 863 747 628 1937 ----
NM_001034956chr1051013 964 863 747 628 1937 ----
NM_001034957chr1051013 964 863 747 628 1937 ----
NM_001035chr121325 91 ------
NM_001035254chr962449 2054 1042 530 427 337 ------
NM_001035511chr141927 656 327 211 12021 --12063
NM_001035512chr152034 1403 763 434 318 12128 --12170
NM_001035513chr152034 1403 763 434 318 12128 --12170
NM_001037164chr731641 1489 50 1815 ----
NM_001037165chr7128104 6844 6318 6222 3548 2478 2431 2124 1670 906 223 214 17807 55976 5656 3283 3081 1424 23464 2774
NM_001037317chr122073 741 --12592 --
NM_001037334chr1852337 2256 1953 1755 1520 21836 492 1567 --
NM_001037339chr141457 508 346 189 11707 11484 --
NM_001037340chr141457 508 346 189 11707 11484 --
NM_001037341chr141457 508 346 189 11707 11484 --
NM_001037341chr141457 508 346 189 11707 11484 --
NM_001037738chr51202 1213 ----
NM_001037954chr1143449 872 854 48 12675 12400 12451
NM_001038702chr542610 2459 1803 1028 12749 11808 11890
NM_001039091chrX41419 1022 377 255 --246 39 --
NM_001039199chr2023271 1213 25030 3478 1215 14532
NM_001039459chr7----1192 --
NM_001039479chr142786 26 --2967 857 --
NM_001039538chr263049 2721 689 441 212 185 ------
NM_001039547chr3117732 7464 6863 6336 5215 5030 3121 2906 2777 1289 775 47390 5923 5493 2071 ----
NM_001039577chr164305 4027 2753 1556 594 223 --33627 1187 93 --
NM_001039590chrX53789 2889 1108 262 75 13359 --11599
NM_001039591chrX53789 2889 1108 262 75 13359 --11599
NM_001039618chr1154988 4590 4555 4363 2147 --15084 --
NM_001039690chr1622141 1730 ------
NM_001039693chr273968 3942 3567 2934 981 928 398 3313 257 230 11556 1830
NM_001039715chr131021 880 78 11027 ----
NM_001039716chr131085 944 142 11091 ----
NM_001039762chr1032247 1602 1469 ----11566
NM_001039770chr321999 514 21807 150 1547 1138
NM_001039802chr12532 331 11031 ----
NM_001039840chrX85943 5716 4914 4690 4572 4205 2390 985 24083 2296 25479 3875 11139
NM_001039937chr1342968 1081 767 269 ----11204
NM_001040057chr73601 368 289 ------
NM_001040092chr82335 144 ------
NM_001040110chr721862 1325 --11407 --
NM_001040142chr232476 2117 105 ------
NM_001040143chr232476 2117 105 ------
NM_001040144chr1622141 1730 ------
NM_001040146chr1622141 1730 ------
NM_001040152chr784033 2010 1923 1601 1560 1401 421 367 1328 ----
NM_001040214chr632117 1935 931 12368 ----
NM_001040284chr1655279 4153 1552 1058 918 34862 708 113 12264 --
NM_001040402chr453130 2755 2504 2347 894 11970 ----
NM_001040409chr22995 937 ------
NM_001040429chr1343505 2499 2379 169 13418 --1394
NM_001040446chr562742 1786 1090 168 149 89 ------
NM_001040450chr152708 97 22040 1047 1375 --
NM_001040453chr152708 97 22040 1047 1375 --
NM_001040458chr531531 129 88 11351 41377 1345 615 502 --
NM_001040624chr862721 2076 1746 976 349 52 1608 ----
NM_001040625chr862721 2076 1746 976 349 52 1608 ----
NM_001040626chr862721 2076 1746 976 349 52 1608 ----
NM_001040627chr862721 2076 1746 976 349 52 1608 ----
NM_001040628chr862721 2076 1746 976 349 52 1608 ----
NM_001040629chr862721 2076 1746 976 349 52 1608 ----
NM_001040630chr862721 2076 1746 976 349 52 1608 ----
NM_001040665chr754571 4329 3317 1837 61 13771 --1134
NM_001040712chr933041 1131 222 ------
NM_001042353chr201544 --2403 175 --
NM_001042355chr1675323 4762 1705 1255 1202 1039 640 ------
NM_001042361chr1011434 --123 --
NM_001042364chr1011434 --123 --
NM_001042365chr1011434 --123 --
NM_001042368chr92789 23 --1241 --
NM_001042371chr1651543 1511 1334 409 400 22029 1559 11339 11741
NM_001042383chr363426 3282 2927 2846 1093 619 ----1288
NM_001042387chr1011434 --123 --
NM_001042388chr183662 278 208 ------
NM_001042393chr1011434 --123 --
NM_001042396chr1011434 --123 --
NM_001042397chr1011434 --123 --
NM_001042404chr111780 ------
NM_001042412chr1675323 4762 1705 1255 1202 1039 640 ------
NM_001042413chr983259 3186 1141 1030 911 859 352 289 --11631 --
NM_001042424chr442768 2503 949 845 --22464 415 --
NM_001042440chr53454 193 63 11271 21279 808 --
NM_001042441chr53454 193 63 11271 21279 808 --
NM_001042442chr53454 193 63 11271 21279 808 --
NM_001042443chr53454 193 63 11271 21279 808 --
NM_001042444chr53454 193 63 11271 21279 808 --
NM_001042445chr53454 193 63 11271 21279 808 --
NM_001042446chr53454 193 63 11271 21279 808 --
NM_001042459chr32286 90 ------
NM_001042473chr1031723 1375 314 ------
NM_001042475chr62262 90 ------
NM_001042490chr5------1110
NM_001042492chr1732298 1353 553 --22596 2371 --
NM_001042493chr631901 712 508 ------
NM_001042510chr82191 35 1533 1632 1476
NM_001042511chr82191 35 1533 1632 1476
NM_001042533chr352246 2212 900 351 306 22638 2152 ----
NM_001042537chrX31619 655 614 --12460 --
NM_001042543chr4----11318 --
NM_001042555chr1234747 4607 489 ------
NM_001042585chr11633 ----1599
NM_001042599chr297717 7398 6721 5643 5326 5205 2942 2673 2280 12495 15618 --
NM_001042601chr31500 --1786 --
NM_001042603chr1285017 4636 2126 2013 1175 1168 683 140 11719 11494 --
NM_001042683chr611394 1432 11612 --
NM_001042749chrX11850 ------
NM_001042750chrX11850 ------
NM_001042751chrX11850 ------
NM_001042762chr72323 144 ------
NM_001043351chr141453 826 542 394 --12129 --
NM_001044305chr651626 1578 1370 1299 132 ----1157
NM_001044385chr233138 1051 461 --13034 12504
NM_001046chr562744 2099 1961 680 215 104 ------
NM_001050chr174994 168 100 72 ------
NM_001071775chr1351741 1520 1334 1272 386 ------
NM_001077628chr11707 ------
NM_001079874chr13778 658 110 1530 ----
NM_001083620chr42584 85 2475 465 ----
NM_001087chr21118 --1139 --
NM_001096chr172744 240 ------
NM_001099678chr366264 4079 2493 1493 1412 1032 66370 4749 2090 1963 1914 1748 14649 --
NM_001100108chr198255 7801 6065 5500 5197 2966 2630 2004 1064 46475 5930 5426 1377 47889 6485 3327 1676 27818 6362
NM_001106chr3109385 8124 6943 6638 3418 3197 2696 2690 1178 128 29164 2050 23874 3868 1829
NM_001109977chr42872 57 ------
NM_001111chr142662 2586 1741 1059 22695 966 11947 --
NM_001113490chrX43109 1260 1082 932 --12310 --
NM_001116chr1642785 2189 412 329 ----1834
NM_001117chr1822422 648 --11011 169
NM_001119chr451395 1201 1092 430 274 --143 --
NM_001121chr101406 --11505 --
NM_001123chr101317 ------
NM_001126chr111069 ------
NM_001128chr1663416 3337 1445 1082 827 204 --13578 --
NM_001144chr163252 101 50 ------
NM_001146chr871730 1466 1452 797 690 237 214 ------
NM_001148chr422233 56 11715 ----
NM_001167chrX76569 5342 4808 1136 918 291 46 56027 5718 5578 4634 4167 169 --
NM_001177chr121119 1791 --1560
NM_001178chr11----1112 --
NM_001186chr2133064 673 403 ------
NM_001187chr21------1575
NM_001189chr42302 30 ------
NM_001191chr2051275 1005 588 522 303 --11376 --
NM_001198chr652338 2149 883 537 42 --11874 --
NM_001201chr433424 3320 2965 11107 ----
NM_001204chr2137464 7058 6451 5880 5391 5169 4911 1716 1434 1179 1163 669 393 46534 4838 2576 1065 1753 26591 5146
NM_001206chr962906 2836 1102 447 246 142 ------
NM_001227chr102526 291 1125 ----
NM_001248chr32955 143 --1805 --
NM_001256chr1782756 2388 2176 2008 1047 970 503 149 --1200 12908
NM_001257chr1641127 1068 253 26 ------
NM_001259chr756214 6068 4959 1680 385 22468 562 --22281 1743
NM_001261chr92271 55 ------
NM_001262chr11226 --164 --
NM_001270chr531130 1098 81 ------
NM_001271chr1593255 3131 2583 2371 1309 823 769 272 130 --32023 909 182 --
NM_001284chr51449 ----1556
NM_001290chr451024 439 405 244 140 ------
NM_001292chr152978 117 --1406 --
NM_001304chr1733346 3213 210 --1852 --
NM_001310chr1282728 2314 2268 1201 1030 452 445 85 --146 --
NM_001313chr43984 923 322 --1314 --
NM_001315chr652174 1540 1468 524 219 1283 ----
NM_001329chr101402 --21480 105 --
NM_001331chr1131059 919 63 12430 11845 1243
NM_001343chr5191 ------
NM_001346chr332750 2398 263 --22813 2303 --
NM_001351chr321365 302 ------
NM_001356chrX52459 2268 1844 615 117 1356 ----
NM_001358chr41151 --1427 --
NM_001362chr142919 21 --1950 1224
NM_001364chr1184342 3641 3214 2961 1875 1414 547 321 --24020 3082 13393
NM_001386chr822213 191 11896 31644 1614 579 --
NM_001387chr542193 1947 1033 217 --12501 12082
NM_001389chr211214 ------
NM_001396chr2141985 1032 695 134 11938 ----
NM_001399chrX103601 2436 1272 1053 815 735 274 257 171 147 12662 --1263
NM_001400chr111375 1962 11320 --
NM_001406chr1741653 1410 1181 1091 --11355 --
NM_001407chr311510 --1560 --
NM_001408chr161553 1465 1243 1064 347 311 --11379 --
NM_001412chrX103691 3648 3419 2785 2729 2535 716 520 354 122 ------
NM_001416chr171510 1476 ----
NM_001418chr111722 ------
NM_001418chr111722 ------
NM_001419chr1944088 2998 879 266 13412 23682 3029 --
NM_001421chrX31535 1349 348 --31284 335 244 --
NM_001423chr12----12077 --
NM_001427chr72440 184 ------
NM_001431chr6--21000 327 ----
NM_001432chr473750 3515 3330 2826 2538 2380 428 --13343 --
NM_001438chr183690 3598 3138 2493 1257 961 828 713 --12631 --
NM_001439chr121519 289 ------
NM_001440chr862386 2269 891 539 230 51 --52579 2468 2017 1897 1890 --
NM_001448chrX178 --1149 --
NM_001449chrX21066 259 ------
NM_001463chr22651 133 ------
NM_001497chr942603 2499 675 183 --12081 --
NM_001498chr64862 395 250 41 ------
NM_001527chr6104535 4348 4213 4156 3357 3192 1091 856 297 83 14123 --13445
NM_001550chr73610 260 170 ------
NM_001552chr1731041 952 423 --1414 --
NM_001570chr33971 914 295 --11171 --
NM_001609chr1074183 3702 3198 1174 554 487 369 11623 24284 3015 --
NM_001614chr171178 ------
NM_001614chr171178 ------
NM_001616chr253068 2780 2561 771 296 ------
NM_001619chr1121108 820 --1205 --
NM_001622chr32302 139 ------
NM_001634chr651813 1711 1640 1479 577 ------
NM_001635chr71809 ------
NM_001649chrX22474 1912 ------
NM_001650chr1833279 1490 1010 13768 23142 1616 11295
NM_001656chr531731 1543 1313 11770 ----
NM_001659chr1232405 924 659 --22545 2227 --
NM_001660chr32697 524 ------
NM_001663chr1432370 964 284 ------
NM_001665chr111514 ----1520
NM_001677chr11265 --1277 --
NM_001678chr1781460 1365 1303 1185 676 526 144 115 --21267 542 --
NM_001681chr122689 200 ------
NM_001684chr183873 3173 2939 2832 1614 1314 1101 192 --21646 1244 --
NM_001706chr3----1313 --
NM_001714chr121394 ------
NM_001717chr152487 123 ------
NM_001718chr611055 ------
NM_001726chr11115 ------
NM_001730chr13------11115
NM_001730chr13------11115
NM_001742chr71432 ------
NM_001744chr5198 ------
NM_001746chr542425 2292 2064 1176 ------
NM_001750chr53454 193 63 11271 21279 808 --
NM_001753chr731555 1425 32 11707 ----
NM_001754chr2153464 3145 1675 623 339 1384 ----
NM_001759chr1265265 4741 4533 4089 916 675 12032 12127 --
NM_001777chr332876 1475 911 189 ----
NM_001781chr122849 26 ------
NM_001783chr191313 ------
NM_001791chr12532 331 11031 ----
NM_001792chr181303 1854 ----
NM_001795chr162441 96 --21320 307 --
NM_001799chr51192 ------
NM_001802chr165916 869 809 243 231 --1814 --
NM_001806chr1932903 2347 1899 32043 638 104 21885 295 --
NM_001830chrX93613 2801 2756 2615 2500 1587 1077 604 37 --13818 1320
NM_001842chr9------1549
NM_001854chr131041 538 236 --2457 229 --
NM_001855chr91750 --1636 --
NM_001858chr645120 4843 3615 492 24314 316 11303 --
NM_001859chr994017 3915 2964 2834 2731 2574 1391 332 68 23587 2423 ----
NM_001874chr1244566 3991 1015 97 53594 1296 1098 423 189 15235 --
NM_001880chr22201 45 ------
NM_001891chr4144 ------
NM_001892chr541279 1194 1178 1115 --1155 --
NM_001895chr201172 --1973 --
NM_001901chr62939 871 ----152
NM_001918chr1109087 7665 7061 6635 6551 5717 3723 3650 1494 229 67567 6779 3059 2373 1628 309 1656 --
NM_001920chr121737 1123 ----
NM_001923chr112521 227 ------
NM_001931chr111857 ----143
NM_001933chr1441380 553 469 448 ----1916
NM_001945chr531255 1238 351 --1252 --
NM_001946chr122802 374 ------
NM_001949chr642812 2207 2173 251 12405 ----
NM_001951chr82537 183 --1114 --
NM_001955chr641097 189 115 77 ----1372
NM_001963chr42746 554 ------
NM_001964chr51212 ------
NM_001969chr1463582 3106 2943 1355 822 320 33068 2477 331 22610 349 --
NM_001977chr431113 680 575 ------
NM_001981chr152324 2072 1766 1696 417 --12079 12171
NM_001987chr1273726 3348 1496 1374 1166 352 250 23800 3156 ----
NM_001992chr531781 747 405 21707 92 1398 --
NM_001993chr1----1692 1913
NM_001995chr441238 1088 466 120 --1551 --
NM_001998chr3----1121 --
NM_002006chr434727 4719 787 23528 1931 34798 1841 725 --
NM_002009chr1511073 12663 12702 21860 1045
NM_002010chr133455 163 77 ------
NM_002015chr131985 --12497 --
NM_002017chr1121393 1326 ----11094
NM_002024chrX--12102 ----
NM_002025chrX158634 8026 7833 7804 7488 7087 6596 6548 6364 2321 2148 2121 2067 1695 1181 22079 1168 38735 6957 650 --
NM_002026chr22851 267 ------
NM_002031chr62534 170 ------
NM_002037chr61124 ----1371
NM_002040chr2152754 2686 635 588 364 12279 ----
NM_002045chr3--1270 ----
NM_002048chr91209 ------
NM_002051chr101316 ----1222
NM_002052chr831354 1296 109 --1511 --
NM_002063chrX31159 869 380 ------
NM_002069chr71299 ------
NM_002072chr931011 980 356 1257 ----
NM_002081chr2----21463 40 --
NM_002090chr42257 137 ------
NM_002091chr181110 ------
NM_002092chr474310 3835 3494 1641 1076 736 251 24594 1493 ----
NM_002094chr16145 ------
NM_002106chr42254 68 ------
NM_002114chr6----1536 --
NM_002119chr652653 2238 1659 247 24 1976 1110 --
NM_002126chr1742865 2791 1226 23 --1123 --
NM_002128chr1332471 1870 995 11862 --11954
NM_002130chr531511 1467 1091 --1609 --
NM_002134chr16294 72 ------
NM_002135chr123515 507 114 --1394 --
NM_002139chrX1191 ------
NM_002140chr91872 ------
NM_002158chr233763 2895 1214 12682 12644 13582
NM_002160chr91586 1238 ----
NM_002163chr162457 284 ------
NM_002167chr13435 378 127 ------
NM_002181chr21150 --1106 --
NM_002188chr52791 41 ------
NM_002193chr221468 691 1721 1547 --
NM_002202chr51748 ------
NM_002203chr543204 2829 873 261 13285 1998 --
NM_002205chr121748 ------
NM_002210chr282669 1355 1130 847 743 329 282 204 ----12344
NM_002214chr795570 5469 4679 4292 4042 4011 1945 505 298 23861 166 1181 --
NM_002222chr31264 11316 --176
NM_002232chr12877 509 1544 ----
NM_002241chr13929 567 374 ----12174
NM_002247chr102369 229 ------
NM_002254chr222387 1488 --1283 163
NM_002264chr374953 4944 4198 3147 1752 681 307 23911 1465 24470 2020 11302
NM_002265chr17----21058 216 --
NM_002267chr1322144 1749 22236 1799 ----
NM_002268chr3--41598 623 337 120 --1493
NM_002270chr535690 4807 3898 ----1887
NM_002285chr252787 895 454 384 281 24108 49 32748 1076 655 --
NM_002293chr152307 2232 1990 688 256 ------
NM_002296chr12644 330 --11116 --
NM_002298chr1351538 1479 1006 498 44 174 ----
NM_002310chr565430 4884 2622 1834 1636 957 46276 5141 897 191 --26286 4131
NM_002317chr52358 268 ------
NM_002334chr1131935 754 283 1673 ----
NM_002336chr1294878 4668 4389 3465 1941 1624 889 807 23 --44287 4215 4048 3096 --
NM_002345chr121632 ------
NM_002350chr8--11019 ----
NM_002353chr11255 --181 --
NM_002356chr622345 2002 11117 ----
NM_002359chr1733234 3159 1297 11114 --13192
NM_002372chr53620 121 94 ------
NM_002374chr263049 2721 689 441 212 185 ------
NM_002382chr1441240 1201 1113 975 ------
NM_002395chr611448 186 ----
NM_002398chr221139 359 ------
NM_002399chr151512 ------
NM_002401chr1732452 1929 542 ----22105 1935
NM_002408chr141164 ------
NM_002430chr2222446 2108 --11997 --
NM_002445chr831137 120 107 --2144 87 --
NM_002449chr531111 478 242 ------
NM_002465chr12177 ------
NM_002480chr1211480 ------
NM_002481chr1157428 7191 6882 6864 5998 5881 5387 5208 5131 4905 2990 2584 2136 672 446 12062 22834 572 --
NM_002495chr5129 ------
NM_002499chr1522061 477 --3687 152 23 --
NM_002500chr22886 471 ------
NM_002505chr62446 309 1143 11285 --
NM_002507chr1731527 1368 618 ------
NM_002508chr131980 439 90 11363 11625 --
NM_002519chr111340 ------
NM_002522chr1732722 2455 398 ----13367
NM_002524chr1--1751 169 --
NM_002537chr1541120 891 766 151 ------
NM_002538chr52498 73 ------
NM_002541chr73981 746 358 --1213 --
NM_002544chr17183 ------
NM_002545chr1164992 3954 1477 1391 851 783 24872 402 13929 11636
NM_002547chrX43582 2964 2958 1684 ------
NM_002556chr1172016 1819 1522 859 291 189 78 1384 11312 --
NM_002576chr1121178 346 1424 ----
NM_002577chr364032 3095 871 823 766 178 --1305 --
NM_002583chr122574 45 1435 ----
NM_002588chr52713 491 --11663 --
NM_002590chr132482 227 ------
NM_002594chr2032001 369 232 1554 ----
NM_002595chr12--1631 ----
NM_002600chr141457 508 346 189 11707 11484 --
NM_002613chr16145257 5100 4287 4082 3991 3896 3338 3287 2005 1874 1630 600 571 427 24433 1550 23645 912 21502 825
NM_002614chr1--1337 ----
NM_002628chr331185 1127 120 1374 ----
NM_002633chr12111 59 ------
NM_002634chr173629 55 34 ------
NM_002641chrX21997 1297 ------
NM_002645chr1163120 2981 2581 1214 669 657 ------
NM_002646chr152119 2075 1995 671 130 --11349 11896
NM_002648chr631150 1077 192 --1991 --
NM_002651chr1----2644 254 --
NM_002653chr51976 ------
NM_002655chr864030 3461 3290 1978 577 352 24575 972 --31215 373 217
NM_002657chr2033589 466 34 --43577 1451 823 774 --
NM_002660chr2011182 --2918 259 --
NM_002698chr1933023 2218 725 13006 ----
NM_002703chr441652 1224 606 432 11945 ----
NM_002706chr21182 ------
NM_002709chr293167 2400 2356 1418 1396 1389 1179 708 650 13549 ----
NM_002710chr1211064 ------
NM_002716chr1173457 3213 3056 2594 2562 1412 373 1149 23301 864 13024
NM_002718chr342683 2380 654 544 31939 719 459 ----
NM_002734chr1722229 2217 --21507 900 --
NM_002736chr752211 2179 1646 592 227 ------
NM_002745chr2254423 1318 1282 398 114 14307 13864 --
NM_002765chrX41419 1022 377 255 --246 39 --
NM_002773chr16----2478 88 --
NM_002775chr103513 452 102 ------
NM_002806chr14--2366 311 ----
NM_002822chr122551 251 ------
NM_002825chr71540 1229 ----
NM_002828chr181172 1940 ----
NM_002833chr1511271 ----11563
NM_002836chr201530 ------
NM_002837chr12104518 4500 4385 4272 3875 3203 1546 1228 720 277 --23537 1713 --
NM_002839chr933041 1131 222 ------
NM_002843chr1123011 1131 2974 347 ----
NM_002844chr631342 1197 504 ------
NM_002847chr721653 1154 1625 168 --
NM_002852chr3--1463 ----
NM_002855chr1123261 1028 --12345 --
NM_002858chr141270 1109 932 346 ----1297
NM_002862chr2011464 --3907 571 50 --
NM_002868chr1252451 891 855 840 717 --2358 113 11634
NM_002869chr1162087 2043 1950 741 727 67 11997 ----
NM_002874chr932304 1568 76 21583 357 --1966
NM_002886chr374534 4503 3553 1707 617 249 221 34783 3979 1014 13263 --
NM_002892chr1431497 579 186 11595 ----
NM_002893chrX--1258 1130 --
NM_002906chr113842 695 118 --11758 --
NM_002923chr11169 1133 ----
NM_002938chr431636 1379 526 11531 11514 --
NM_002941chr321295 270 ------
NM_002945chr172812 671 ------
NM_002959chr153989 983 755 203 67 --11133 --
NM_002968chr161266 ------
NM_002970chrX1326 ------
NM_002971chr331196 1179 1131 --1760 --
NM_002975chr19----1244 --
NM_002977chr293021 2997 2837 2771 2374 870 504 189 136 2661 249 ----
NM_002994chr42311 285 ------
NM_002996chr163625 413 254 133 11760 11697
NM_002999chr2071936 1840 1576 556 373 124 22 --1102 --
NM_003001chr152034 1403 763 434 318 12128 --12170
NM_003010chr1732020 284 184 ----11969
NM_003013chr42671 322 ------
NM_003016chr173461 342 98 11400 21342 1290 --
NM_003026chr92143 134 ------
NM_003030chr321509 215 1325 11528 --
NM_003034chr12107712 7016 5397 5304 1920 1391 432 393 376 60 46972 5355 2660 2594 27973 3247 16884
NM_003036chr1----11185 --
NM_003042chr371878 714 515 383 356 337 47 ------
NM_003043chr374200 3953 3882 3011 2994 1500 676 --23178 715 14019
NM_003045chr1344139 3457 949 811 13167 33640 3212 662 13666
NM_003046chr895080 4934 4557 4393 3550 2106 1886 1016 461 44920 4632 4187 968 14048 --
NM_003051chr11155 --11509 --
NM_003060chr521211 461 --1130 --
NM_003063chr11129 ------
NM_003074chr332151 1820 1459 1771 1748 --
NM_003081chr202325 227 --1958 --
NM_003087chr101249 ------
NM_003095chr12171 ------
NM_003099chr1545973 5609 1217 906 32088 1700 400 25534 1373 --
NM_003101chr141022 408 320 53 1128 ----
NM_003107chr632206 1801 136 ------
NM_003108chr266638 5689 5663 4869 2656 1752 --12578 1765
NM_003112chr722898 2175 12679 ----
NM_003128chr242653 2475 1764 437 --1431 --
NM_003136chr14------128
NM_003137chr62659 361 ------
NM_003142chr2--1206 ----
NM_003144chr622224 344 --1655 --
NM_003155chr842524 2493 1726 587 11071 12115 --
NM_003161chr1793572 3359 3332 2237 1432 688 339 282 234 1552 12367 --
NM_003173chrX21245 28 ------
NM_003178chr362246 2050 644 288 228 121 --11463 --
NM_003182chr72481 194 ------
NM_003182chr72481 194 ------
NM_003183chr23708 593 339 2813 103 --125
NM_003185chr2021101 443 ------
NM_003188chr63843 763 219 ------
NM_003189chr193340 2554 2479 2226 2062 1139 1045 411 167 ------
NM_003199chr1885139 4637 4429 3901 3582 1637 1310 736 11371 ----
NM_003200chr1962315 1903 1794 1725 1618 461 --11886 --
NM_003203chr242251 957 251 187 21969 1528 21845 823 --
NM_003204chr1741838 691 460 168 --11659 1174
NM_003206chr6----1356 --
NM_003211chr1231165 600 332 ------
NM_003216chr2263027 2723 2445 2029 666 95 1243 ----
NM_003217chr1271696 1629 1604 1438 1359 729 164 21977 1576 ----
NM_003221chr654191 3936 3794 3504 409 1783 ----
NM_003242chr321015 503 --12306 --
NM_003246chr154744 650 595 581 ------
NM_003253chr2121451 457 --21743 129 --
NM_003255chr1731872 1645 133 --1548 --
NM_003262chr374927 3538 1163 682 620 607 63 ------
NM_003269chr631281 1125 968 ------
NM_003270chrX4905 491 436 353 1140 1445 2217 185
NM_003274chr2122877 2450 --32412 333 81 --
NM_003275chr92448 145 ------
NM_003291chr131117 ------
NM_003292chr132186 364 174 ------
NM_003299chr121211 ------
NM_003314chr51446 --131 --
NM_003320chr1164462 4280 3494 1422 902 625 --22783 157 --
NM_003337chr541709 1345 647 561 ------
NM_003338chr1021521 625 1665 ----
NM_003339chr5181 1288 ----
NM_003340chr411020 21408 1312 ----
NM_003342chr1742152 1211 656 126 13286 22310 847 --
NM_003348chr1211303 --11446 1174
NM_003349chr2031607 353 281 ------
NM_003352chr24905 379 324 176 ------
NM_003368chr11598 1524 ----
NM_003370chr193188 181 78 --1583 --
NM_003374chr5--1138 ----
NM_003375chr101335 ------
NM_003376chr621619 484 --11501 --
NM_003376chr621619 484 --11501 --
NM_003379chr61264 --1212 --
NM_003385chr21316 1638 ----
NM_003387chr262035 1826 1157 506 281 238 ----22136 1091
NM_003390chr1151102 1025 1012 957 116 ------
NM_003392chr32799 65 --11045 11671
NM_003394chr122646 73 ------
NM_003406chr81519 --11565 --
NM_003410chrX42171 1226 565 139 22356 389 1254 --
NM_003411chrY21850 243 ------
NM_003412chr363034 2616 2591 2434 2291 2142 --22096 1170 --
NM_003413chrX11442 11272 1786 --
NM_003418chr3134 ------
NM_003432chr54490 155 67 52 ------
NM_003457chr172540 100 ------
NM_003466chr262529 1853 994 570 539 392 ------
NM_003468chr253826 3732 2979 1202 524 ------
NM_003469chr2177 ------
NM_003470chr1641891 1614 343 170 ----1306
NM_003472chr641178 945 50 24 ------
NM_003473chr1021032 679 --1166 --
NM_003474chr1021854 585 ------
NM_003483chr1222946 2770 12346 12086 --
NM_003485chr1461366 1266 1079 1035 181 23 ------
NM_003489chr2143123 2725 2397 1112 11106 --21306 463
NM_003498chr1662758 2535 1779 421 378 162 --11085 --
NM_003507chr211497 ------
NM_003528chr141598 596 354 51 11635 ----
NM_003557chr121380 372 --1448 --
NM_003563chr1731016 323 235 --1979 --
NM_003574chr18105371 5057 5013 4619 4480 3661 2034 1350 907 535 ------
NM_003576chr1372699 2629 2355 2209 2002 1965 1041 --190 12526
NM_003583chr1253320 3077 2686 1272 290 22971 1196 13225 --
NM_003589chr133588 132 88 ------
NM_003595chr222436 24 ------
NM_003598chr191585 ----123
NM_003603chr482032 2017 1988 1744 1666 1400 629 355 ------
NM_003607chr174025 3859 3443 3131 1707 1369 474 1432 --13989
NM_003615chr353639 2729 1405 875 803 13584 ----
NM_003616chr141389 ------
NM_003618chr221304 1187 11022 ----
NM_003620chr171118 ------
NM_003628chr2176 ------
NM_003629chr183210 2789 2697 2655 2502 2394 2251 399 ----13297
NM_003631chr103875 683 420 184 --1192
NM_003633chr541040 625 499 490 ------
NM_003637chr131417 1405 162 1509 2333 132 --
NM_003642chr22297 70 ------
NM_003644chr1796390 4203 2373 1992 1303 1047 589 540 131 21986 1586 34953 365 239 --
NM_003659chr21817 ------
NM_003663chr353515 3205 2627 1366 1350 23125 3070 13428 --
NM_003670chr311144 21293 502 ----
NM_003671chr933179 499 291 1193 1703 12351
NM_003672chr111723 11399 ----
NM_003677chr1242044 1871 1402 536 --1416 --
NM_003679chr1--42350 1313 360 88 ----
NM_003701chr131830 ------
NM_003705chr24873 779 642 96 ------
NM_003713chr12466 114 ------
NM_003716chr31181 1668 ----
NM_003718chr71418 ------
NM_003722chr362263 1708 1004 963 294 113 --1181 --
NM_003732chr52292 122 ------
NM_003735chr52713 491 --11663 --
NM_003736chr52713 491 --11663 --
NM_003743chr221789 753 ----11943
NM_003744chr14189 ------
NM_003749chr131430 ----12157
NM_003750chr101881 ------
NM_003758chr151266 ------
NM_003758chr151266 ------
NM_003759chr484240 3565 3430 3423 2929 2861 2755 532 ----23805 3193
NM_003762chr131309 581 302 ------
NM_003763chr2063131 2925 2890 2060 1131 1066 12098 12443 --
NM_003769chr121236 ------
NM_003774chr1283390 2976 2583 2078 1250 775 721 266 33039 1279 1131 13333 --
NM_003783chr1169 ------
NM_003787chr18------1366
NM_003794chr321049 768 --1222 --
NM_003798chr91150 ------
NM_003800chr632440 2335 1823 ------
NM_003816chr82437 305 ------
NM_003818chr2031076 1064 1011 179 ----
NM_003822chr153007 2601 2592 2393 1963 32202 2164 1069 ----
NM_003831chr1861690 1655 482 275 249 77 ------
NM_003846chr12730 168 ------
NM_003850chr132603 582 ------
NM_003861chr1462739 2611 1892 1828 864 237 --12112 --
NM_003864chr4----1129 --
NM_003872chr272976 2936 2598 2057 1869 531 388 ----1544
NM_003877chr1211020 1919 ----
NM_003883chr5175 --4449 389 366 114 --
NM_003884chr331271 1140 743 ------
NM_003885chr1731846 580 347 2705 25 1399 12688
NM_003887chr222323 2194 22081 1762 ----
NM_003893chr10----1335 --
NM_003899chr1362604 2561 749 653 280 203 ------
NM_003908chr2061283 1164 910 552 393 293 ------
NM_003909chr872474 2368 2258 2157 1047 525 426 11919 --1389
NM_003913chr634242 1651 1146 14332 ----
NM_003916chrX31053 272 23 ------
NM_003921chr131220 276 58 ------
NM_003922chr15155 ------
NM_003924chr451533 1238 1069 432 235 11341 ----
NM_003927chr183735 388 79 ------
NM_003930chr71124 1649 ----
NM_003931chr61678 ----1633
NM_003934chr911270 ------
NM_003939chr1064053 4044 3747 1043 1013 208 1338 ----
NM_003947chr351381 1174 1087 1050 975 ----11250
NM_003948chr472408 2331 1881 1827 1810 835 639 1754 12364 --
NM_003953chr152603 1033 740 407 225 ------
NM_003956chr102388 356 --1396 --
NM_003958chr653655 3452 3034 671 83 --22762 929 --
NM_003966chr587757 7257 6522 6288 2938 2899 2198 1101 15922 22468 744 --
NM_003980chr62975 322 ------
NM_003983chr161576 24450 791 1424 1462
NM_003994chr1251667 1343 596 341 145 1160 ----
NM_003998chr42501 225 ------
NM_004006chrX----2749 107 --
NM_004007chrX----2749 107 --
NM_004009chrX----2749 107 --
NM_004010chrX----2749 107 --
NM_004011chrX----2749 107 --
NM_004012chrX----2749 107 --
NM_004013chrX----2749 107 --
NM_004014chrX----2749 107 --
NM_004015chrX----2749 107 --
NM_004016chrX----2663 21 --
NM_004017chrX----2749 107 --
NM_004018chrX----2663 21 --
NM_004020chrX----2749 107 --
NM_004021chrX----2663 21 --
NM_004022chrX----2663 21 --
NM_004023chrX----2663 21 --
NM_004028chr1833279 1490 1010 13768 23142 1616 11295
NM_004035chr1795057 4999 4254 3359 917 451 353 284 246 24375 1721 --14147
NM_004050chr1422718 1965 --11728 --
NM_004052chr101217 --121 --
NM_004055chr1162038 1659 1460 1435 1413 462 --52032 1373 792 118 22 --
NM_004056chr821069 865 ------
NM_004061chr5----1521 --
NM_004063chr82655 237 ------
NM_004077chr1211002 1977 1310 --
NM_004080chr751289 516 473 373 361 ------
NM_004081chrY21569 430 --1405 --
NM_004083chr122209 67 ------
NM_004089chrX3967 779 73 ------
NM_004093chr1332476 747 96 ------
NM_004094chr1422563 53 ------
NM_004096chr1031730 380 57 --1293 --
NM_004099chr951967 1885 1306 353 270 --11747 1282
NM_004100chr62752 517 166 42394 533 403 79 --
NM_004112chr1741659 242 165 158 1585 --11107
NM_004114chrX--1487 ----
NM_004124chr1433380 2578 2560 ------
NM_004161chr23651 497 446 1176 1155 --
NM_004171chr11109557 8750 8696 7333 7180 6240 2101 1701 1540 1289 18629 18550 --
NM_004177chr1141866 1545 441 39 --1572 1159
NM_004187chrX41333 1219 469 146 --1161 --
NM_004199chr5196 ------
NM_004200chr1123292 2725 ----2864 251
NM_004206chr31399 --139 --
NM_004209chr1631199 945 920 ------
NM_004225chr851399 1321 1108 1015 566 --11532 --
NM_004229chrX31597 1484 714 ------
NM_004241chr101573 1181 180 --
NM_004242chr61404 ------
NM_004272chr51688 --21452 1426 --
NM_004273chr1044012 3806 3072 1466 35053 3914 3268 24689 1007 --
NM_004274chr1453095 2700 2121 138 54 12844 ----
NM_004277chr62174 123 --11048 --
NM_004279chr751675 1591 836 489 311 ------
NM_004281chr101488 --1433 --
NM_004293chr953809 3614 3373 3254 1434 ------
NM_004295chr1751172 912 474 393 59 ----21162 523
NM_004296chr1454046 2872 2715 1221 812 ------
NM_004301chr31323 --1152 --
NM_004323chr962373 2021 692 580 532 80 12161 ----
NM_004329chr101287 ------
NM_004331chr842000 1914 1862 1643 11856 --12413
NM_004337chr872204 2081 1563 835 312 164 75 ------
NM_004338chr1896258 5936 2735 2423 1881 1793 1785 1651 1113 --46180 2291 875 144 --
NM_004341chr2------1244
NM_004342chr742165 2122 1868 614 1571 12024 --
NM_004356chr11----1496 --
NM_004370chr611492 ----1552
NM_004381chr6------123
NM_004385chr51502 ------
NM_004393chr331652 1574 683 11515 2361 278 1706
NM_004395chr52219 128 --2501 166 --
NM_004397chr1132666 1342 218 12861 2407 380 --
NM_004404chr241721 569 368 344 --1451 1334
NM_004415chr63570 167 33 ------
NM_004416chr121979 --1811 --
NM_004417chr52628 564 1160 ----
NM_004423chr342316 835 463 178 32235 2050 1715 12150 --
NM_004428chr11725 ------
NM_004430chr811724 --11093 --
NM_004431chr1--2872 839 ----
NM_004432chr931716 720 416 22325 945 ----
NM_004438chr232525 2013 1003 22437 528 1349 --
NM_004439chr4136 ------
NM_004440chr621856 1257 ------
NM_004441chr341146 1014 479 96 1889 ----
NM_004443chr3----1606 --
NM_004451chr111677 ------
NM_004454chr372225 1884 803 748 692 398 234 --11573 --
NM_004458chrX42412 2249 2098 1014 12361 ----
NM_004459chr172508 386 ------
NM_004463chrX157 ------
NM_004464chr421300 1001 13381 1315 --
NM_004482chr22895 668 1841 --1869
NM_004494chr131267 1130 1035 --1188 --
NM_004497chr191703 --1678 --
NM_004499chr52479 158 ------
NM_004501chr1103064 2519 1605 1478 1368 1307 988 758 741 275 13360 12690 --
NM_004504chr232958 2645 733 12075 12242 --
NM_004505chr1731356 492 48 --11857 --
NM_004513chr1541285 1256 1150 313 1353 166 12501
NM_004514chr1751931 845 814 694 201 --11194 --
NM_004525chr261479 1426 1246 562 364 315 --11339 --
NM_004529chr911107 ------
NM_004535chr2031800 1274 93 ------
NM_004537chr1211511 ------
NM_004538chrX1530 1581 ----
NM_004540chr212264 233 1582 ----
NM_004560chr92857 276 ------
NM_004566chr1042456 1897 804 671 12450 22135 604 --
NM_004575chr4--1431 ----
NM_004576chr5193 ------
NM_004586chrX44511 4374 1247 554 23978 1496 ----
NM_004591chr2--1151 ----
NM_004593chr32256 112 ------
NM_004598chr562649 2211 903 837 551 166 12370 ----
NM_004612chr954717 3423 3011 2971 1938 1449 13407 --
NM_004622chr261888 1736 883 345 317 302 1973 ----
NM_004634chr33640 428 40 ----195
NM_004640chr61155 ------
NM_004654chrY31066 265 74 ------
NM_004655chr1751280 1130 463 299 198 1181 ----
NM_004660chrY42330 1774 313 116 22175 354 1612 --
NM_004661chr511250 ------
NM_004667chr151143 ------
NM_004673chr131139 566 232 ------
NM_004681chrY1121 ------
NM_004686chr831310 689 375 ------
NM_004687chr172827 261 31978 603 88 --1566
NM_004703chr1742173 1770 512 234 12294 ----
NM_004709chrX31301 712 368 1248 1504 --
NM_004711chr2243624 3232 3127 2830 13005 22646 763 --
NM_004713chr141639 ------
NM_004714chr192133 88 ------
NM_004717chr731573 1024 565 ------
NM_004718chr22692 241 ------
NM_004726chrX85649 5021 4344 3855 2141 771 195 95 14417 ----
NM_004730chr521458 1398 11482 11476 1662
NM_004736chr121872 392 ------
NM_004742chr311846 --11548 --
NM_004745chr8136759 6700 6680 6003 5635 5185 4942 4813 4517 2472 1239 273 245 --1942 25394 235
NM_004748chr1544130 2778 1489 174 11552 33789 3751 672 13283
NM_004757chr44655 610 559 122 192 ----
NM_004759chr11523 --31841 448 208 --
NM_004768chr12398 216 1362 ----
NM_004772chr511316 ----1188
NM_004774chr1742668 879 194 98 12504 12484 --
NM_004775chr181701 ------
NM_004776chr2062651 1187 1177 888 846 230 --42636 2518 1028 667 --
NM_004781chr111165 31445 1396 57 31694 506 464 11636
NM_004781chr111165 31445 1396 57 31694 506 464 11636
NM_004786chr18166 ------
NM_004788chr111200 --11028 12768
NM_004795chr1341873 1513 1238 110 ------
NM_004796chr1441921 821 422 300 ------
NM_004798chr2063641 3503 3337 2898 2405 1144 1650 13118 --
NM_004805chr21282 1537 177 --
NM_004808chr1032562 2241 1220 32919 2805 729 ----
NM_004817chr91533 ------
NM_004822chr1753203 1248 1118 988 566 --21569 1486 11163
NM_004824chr6----11165 --
NM_004830chr62700 286 1138 ----
NM_004834chr243193 2525 1073 340 ------
NM_004836chr23953 806 242 ------
NM_004842chr621782 368 --173 --
NM_004844chr321157 1146 ------
NM_004849chr631369 1184 334 --11597 1662
NM_004856chr152389 375 ------
NM_004857chr1424794 2993 54825 4320 3043 1549 648 ----
NM_004859chr1763030 2635 2020 737 566 306 ------
NM_004863chr1465312 5015 3683 1272 973 312 44673 1573 1529 225 1387 14238
NM_004866chr554788 4497 4185 1289 34 24111 1303 ----
NM_004867chrX2591 57 ----1541
NM_004869chr1811676 11341 ----
NM_004871chr1774383 3510 3307 2998 2666 602 83 24004 3011 23282 545 --
NM_004879chr111285 ------
NM_004884chr1551755 1254 444 269 124 --1706 --
NM_004887chr51932 ------
NM_004891chr2121 ----162
NM_004897chr101908 ------
NM_004898chr422597 2016 --12751 --
NM_004904chr795117 2349 2151 1646 1489 1287 851 657 120 ------
NM_004912chr741589 1518 1485 1175 21155 103 ----
NM_004915chr21--1590 ----
NM_004921chr1--1221 ----
NM_004922chr103915 879 276 ------
NM_004926chr1431618 701 218 ------
NM_004932chr511337 --11645 --
NM_004947chr332602 2210 582 11915 --1601
NM_004952chr13947 696 229 --1310 --
NM_004955chr61589 --1110 --
NM_004958chr1196 1310 ----
NM_004966chr1011011 ----1367
NM_004976chr11115182 3859 3620 3381 2074 1405 1283 687 539 407 32 ----1320
NM_004985chr1232883 1555 475 11522 ----
NM_004992chrX88001 6641 5528 5332 5256 2231 1207 1039 2887 564 38163 5909 2563 --
NM_004992chrX88001 6641 5528 5332 5256 2231 1207 1039 2887 564 38163 5909 2563 --
NM_004999chr631341 1225 1121 23844 1086 ----
NM_005006chr21731 ------
NM_005011chr721862 1325 --11407 --
NM_005026chr11155 1598 1244 11510
NM_005028chr105773 562 338 177 146 12229 1208 --
NM_005032chrX146 ------
NM_005045chr71766 1182 ----
NM_005056chr1265261 4880 1419 1412 927 384 11963 11738 --
NM_005057chr131188 409 82 21857 263 ----
NM_005063chr1033895 2366 1550 --33381 1543 685 --
NM_005065chr1435232 4706 4335 24322 4111 1730 --
NM_005068chr631210 448 254 11440 1528 --
NM_005076chr154194 3571 2673 2599 1436 14114 34108 2962 1575 23645 990
NM_005079chr82638 405 ----13134
NM_005095chr142080 1685 132 101 ------
NM_005096chrX31092 157 110 --1861 --
NM_005104chr62776 562 --1136 --
NM_005109chr332263 2145 679 ----12245
NM_005110chr5----143 --
NM_005116chr20134281 4225 4114 3923 3053 1483 1169 921 848 560 502 487 337 --24335 668 11704
NM_005119chr12503 414 11257 ----
NM_005121chr1742590 1178 181 142 12496 ----
NM_005124chr63959 272 257 --1214 --
NM_005126chr332297 2010 188 ------
NM_005134chr183662 278 208 ------
NM_005151chr1852337 2256 1953 1755 1520 21836 492 1567 --
NM_005153chr162176 84 --1270 --
NM_005156chr985325 4686 4446 3509 3425 3375 3289 1459 --13568 --
NM_005160chr22116260 5919 5500 5064 5049 2575 1886 1021 708 393 258 12485 1470 --
NM_005165chr17------1362
NM_005168chr21220 ------
NM_005180chr103648 523 41 --1635 --
NM_005184chr1951107 575 482 325 117 --21305 1224 --
NM_005188chr1197098 7088 6574 6542 2594 2469 2330 1043 94 --17024 16584
NM_005190chr631123 916 164 ------
NM_005197chr1424544 1602 22287 698 25732 1712 25603 5248
NM_005207chr2222926 484 33744 2374 936 2800 326 --
NM_005229chrX2382 109 ------
NM_005233chr322318 305 ------
NM_005235chr297717 7398 6721 5643 5326 5205 2942 2673 2280 12495 15618 --
NM_005238chr1193543 3284 2908 1363 1257 1069 1029 802 272 ------
NM_005240chr11556 ------
NM_005241chr331091 1083 50 1258 1223 --
NM_005243chr22130 ------
NM_005245chr4--1286 129 --
NM_005254chr1531115 993 911 ------
NM_005257chr181110 ------
NM_005259chr211329 ------
NM_005263chr12863 228 --1103 --
NM_005277chr421395 486 1123 ----
NM_005279chr22181 53 ------
NM_005302chr71140 ------
NM_005311chr752786 2365 2296 2097 149 --11919 12105
NM_005316chr111969 1336 ----
NM_005324chr1771969 1830 1742 638 343 269 66 ------
NM_005327chr41701 ------
NM_005328chr81665 ------
NM_005333chrX31257 832 165 ------
NM_005336chr23608 375 151 ----11432
NM_005339chr464264 3534 3110 1514 972 462 --1600 --
NM_005342chrX1530 ----1889
NM_005349chr42633 157 --133 --
NM_005358chr1341777 1330 524 311 ------
NM_005359chr18115934 5905 5149 4392 2239 1813 1548 1242 1200 1053 376 25861 209 34558 4379 2182 --
NM_005370chr1931029 919 42 ------
NM_005374chr1752407 2254 1748 149 109 22192 25 --11816
NM_005375chr63957 750 48 ------
NM_005386chr201786 ------
NM_005388chr941517 1453 1438 84 1188 ----
NM_005391chrX136 ------
NM_005398chr1031181 130 29 11024 ----
NM_005399chr153450 1518 645 402 92 --13497 --
NM_005400chr252897 2520 2495 2480 1922 ------
NM_005402chr731727 329 81 11401 ----
NM_005406chr1831585 1467 1124 21263 462 ----
NM_005407chr1421485 86 --11490 --
NM_005410chr51553 1175 ----
NM_005433chr1811988 1707 ----
NM_005436chr10103993 3557 2934 2895 2589 1582 700 486 328 248 23697 99 12503 --
NM_005442chr31542 --1536 --
NM_005458chr972261 2141 1527 927 438 374 88 ----1618
NM_005465chr121866 56 --1387 --
NM_005474chr1721209 385 --11224 --
NM_005475chr1272562 2463 2337 1167 1013 725 199 12657 11297 12766
NM_005476chr931111 486 115 1412 11043 --
NM_005493chr62643 72 ------
NM_005497chr1765467 4854 828 460 90 68 44790 4238 696 119 11460 --
NM_005499chr193419 116 105 ------
NM_005502chr972776 2254 1076 976 912 638 215 ------
NM_005504chr12136265 6197 5760 5684 5184 4489 4410 4148 1973 1804 1446 825 638 15988 ----
NM_005506chr452284 1984 997 859 519 ------
NM_005509chr5--1530 --11224
NM_005512chr111568 --11511 21714 67
NM_005513chr341095 529 410 149 ------
NM_005520chr5----1143 --
NM_005537chr132262 150 1240 ----
NM_005542chr74201 126 113 55 1180 ----
NM_005544chr22951 189 196 ----
NM_005562chr131522 1347 399 ------
NM_005565chr51383 ------
NM_005570chr1831216 1206 926 ------
NM_005577chr61174 ------
NM_005587chr151795 ------
NM_005591chr11--1155 ----
NM_005596chr935017 4504 587 36335 5345 2572 1417 --
NM_005604chr63998 824 95 11930 12179 --
NM_005607chr81833 ------
NM_005610chr1--1181 ----
NM_005611chr161260 ------
NM_005614chr721078 700 ------
NM_005625chr831049 932 876 --21008 238 --
NM_005627chr62984 633 ------
NM_005639chr121397 ------
NM_005643chr63554 191 175 ------
NM_005644chr11404 ------
NM_005647chrX63254 3051 2606 1181 1139 96 21085 976 ----
NM_005650chr2221155 409 ------
NM_005655chr81362 11282 ----
NM_005665chr173654 3469 3398 1598 655 470 195 13822 --13582
NM_005668chr554337 3288 1371 817 193 13457 ----
NM_005711chr51682 ------
NM_005715chr642595 1058 231 199 1340 ----
NM_005717chr1------11211
NM_005721chr2157 --2908 103 --
NM_005722chr241864 1544 609 113 --12205 --
NM_005725chr121614 496 1152 21895 277 --
NM_005734chr111757 2820 231 ----
NM_005737chr262185 1983 1829 1078 686 204 1184 ----
NM_005738chr731641 1489 50 1815 ----
NM_005746chr732211 2191 773 1941 12222 --
NM_005749chr172258 187 ------
NM_005756chrX41478 355 261 200 --11452 --
NM_005765chrX1878 ------
NM_005776chr142318 128 ------
NM_005779chr533358 3278 822 12491 --22311 1290
NM_005785chr1231911 1643 408 ------
NM_005789chr17193 1510 --21316 40
NM_005822chr662407 1868 1690 1474 764 408 --11840 --
NM_005828chr17135104 4971 4858 4086 3918 3664 3304 3290 1828 1814 1436 1373 325 --2868 733 24536 710
NM_005832chr311417 ------
NM_005840chrX77681 6309 5327 5007 4672 1621 1506 36761 6257 1112 47489 6821 1709 1300 --
NM_005842chr131529 ------
NM_005853chr161428 ------
NM_005859chr531305 467 191 ------
NM_005862chr331068 862 104 ------
NM_005868chr752441 1995 680 501 234 31787 1654 193 22524 381 --
NM_005875chr3178 ------
NM_005876chr22728 127 ------
NM_005880chr163498 199 51 ------
NM_005882chr42914 826 ------
NM_005885chr541629 1537 618 118 ------
NM_005898chr1142193 800 557 342 11187 ----
NM_005902chr1574420 4198 3952 3589 3086 1037 617 24169 1836 ----
NM_005903chr564254 1958 1281 1239 906 638 23795 1311 ----
NM_005906chr641466 1042 480 456 ----11227
NM_005907chr631246 1051 334 ------
NM_005909chr563839 3064 1602 1089 954 175 --22798 290 --
NM_005910chr1794162 4118 3880 3560 3325 3158 2545 303 162 --23728 1407 13296
NM_005911chr231281 1196 338 --11338 --
NM_005920chr163327 2863 2485 1225 668 255 11412 23404 629 --
NM_005922chr62457 393 ------
NM_005923chr61546 ------
NM_005941chr833880 1429 559 23817 3411 33319 3013 114 --
NM_005955chr194537 3938 2150 2003 1889 1845 1321 1099 694 25015 1916 1666 25160 642
NM_005962chr1021550 1458 ------
NM_005962chr1021550 1458 ------
NM_005964chr1731412 1206 1028 ------
NM_005968chr192234 162 ------
NM_005997chr1141 ------
NM_006007chr933787 3613 1296 ----13740
NM_006011chr1574216 3113 1688 692 592 345 321 2618 30 22949 2934 --
NM_006015chr1163 ------
NM_006016chr632163 1679 337 135 --12309
NM_006017chr41231 1129 --11138
NM_006032chr142185 62 --1204 --
NM_006033chr1812212 --22146 360 1444
NM_006036chr242268 1840 974 490 ------
NM_006037chr274216 4164 3695 3152 1333 1188 634 ------
NM_006040chr1611439 11259 21152 563 --
NM_006047chr2032756 2694 147 1594 ----
NM_006055chr232710 2089 881 23204 1270 3936 886 453 --
NM_006089chrX------11236
NM_006094chr85711 584 480 199 131 --1824 --
NM_006095chr473514 3493 3002 868 795 776 329 13427 1632 1467
NM_006106chr1132969 499 203 ------
NM_006107chr171540 --1467 --
NM_006113chr13778 658 110 1530 ----
NM_006134chr2131557 635 326 1341 ----
NM_006135chr13501 350 168 ------
NM_006136chr721150 258 ------
NM_006139chr232574 1950 260 1840 ----
NM_006141chr1662799 2722 1763 1034 1010 234 ------
NM_006145chr193884 386 355 ------
NM_006148chr1752931 2918 2626 380 116 12965 ----
NM_006154chr1562962 2837 2420 2400 2119 261 32429 301 62 ----
NM_006155chr241721 569 368 344 --1451 1334
NM_006166chr1252443 1739 261 140 53 11701 1163 --
NM_006180chr93836 325 189 ------
NM_006183chr121396 137 ----
NM_006186chr231237 1017 224 ------
NM_006190chr24900 882 363 170 ------
NM_006191chr122849 830 --1179 --
NM_006194chr143516 205 122 ------
NM_006195chr921331 1300 --1424 --
NM_006197chr822238 1928 ------
NM_006203chr574587 4407 1892 1835 816 778 135 44604 2172 790 300 11929 --
NM_006206chr432530 2153 2047 ------
NM_006209chr82335 144 ------
NM_006212chr1115315 4501 4456 4417 4360 4296 4260 1773 1521 956 477 14106 22148 805 21780 1715
NM_006224chr1722162 1922 --21698 550 12414
NM_006226chr21435 --11385 --
NM_006228chr82404 359 ------
NM_006241chr352399 1942 1829 1699 156 22161 90 ----
NM_006243chr13920 866 303 ------
NM_006246chr141484 ------
NM_006251chr543123 2712 1162 596 32439 2052 1113 ----
NM_006252chr1117565 6386 6301 5732 5680 5205 4822 4800 2886 1928 1102 14875 --17611
NM_006255chr1411119 ------
NM_006256chr142770 1850 439 176 ----132
NM_006258chr1041592 1524 1430 295 ------
NM_006265chr81185 21304 34 ----
NM_006266chr92789 23 --1241 --
NM_006281chr8------1857
NM_006281chr8------1857
NM_006282chr2064552 3573 1589 1360 1341 625 24212 1884 34565 4231 2989 --
NM_006283chr864824 4208 3915 3616 1878 377 13726 23674 3661 1640
NM_006298chr672883 2615 1133 1027 829 339 192 13272 2836 655 --
NM_006306chrX95460 4337 4279 3875 3658 1891 1120 432 70 14496 14571 --
NM_006310chr171967 1819 --175
NM_006315chr444074 4028 3819 607 --14450 --
NM_006323chr41665 ------
NM_006325chr121229 ------
NM_006345chr431068 892 436 ------
NM_006350chr5256 30 ------
NM_006353chr671099 1053 878 373 256 247 38 ------
NM_006354chr3125 ------
NM_006357chr2----1109 --
NM_006359chrX31619 655 614 --12460 --
NM_006366chr61231 1326 ----
NM_006371chr3135026 4991 4859 4652 4634 4120 4068 4005 3381 2091 1909 650 437 13283 1849 --
NM_006372chr61179 ------
NM_006379chr7--22140 1577 ----
NM_006380chr1723600 1436 23510 2985 32919 2750 650 --
NM_006382chr171245 --1250 --
NM_006386chr223560 265 23 11568 ----
NM_006391chr11----1263 --
NM_006393chr1064125 3610 1487 1377 589 525 --11539 --
NM_006403chr621420 436 1518 11736 --
NM_006405chr142225 80 ------
NM_006419chr41747 --1693 --
NM_006420chr2032782 256 60 ------
NM_006432chr142115 90 ------
NM_006434chr1051013 964 863 747 628 1937 ----
NM_006451chr51668 ------
NM_006457chr433925 2963 1574 33275 1153 539 ----
NM_006459chr103805 431 147 ------
NM_006464chr294228 4081 3684 3279 3041 1788 693 421 109 24300 3012 ----
NM_006469chr141097 1024 463 328 ------
NM_006475chr132264 82 ------
NM_006482chr1253320 3077 2686 1272 290 22971 1196 13225 --
NM_006483chr192133 88 ------
NM_006484chr192133 88 ------
NM_006496chr131716 1618 222 21833 1396 ----
NM_006504chr1032945 2855 1821 ------
NM_006517chrX32044 1568 872 --1608 --
NM_006524chr7--1698 ----
NM_006526chr201758 11702 ----
NM_006534chr2032336 1131 497 23382 3275 12402 --
NM_006537chr151430 1141 ----
NM_006538chr294082 4009 3887 3743 3408 3016 2581 995 605 --13214 --
NM_006540chr831458 1197 409 11322 ----
NM_006544chr1466029 5074 3734 2266 2164 1448 24987 2324 ----
NM_006546chr1766059 5391 5234 4806 2528 1433 1552 35977 2015 872 16568
NM_006549chr1262489 2127 1071 453 211 184 ------
NM_006559chr12172 50 ------
NM_006560chr111367 --143 --
NM_006561chr1096252 6224 5538 4858 4092 2135 1563 1472 492 26234 574 13826 14951
NM_006565chr1631086 1024 863 --1444 --
NM_006572chr1723102 880 1184 ----
NM_006574chr3----1283 --
NM_006575chr1411275 --11447 --
NM_006579chrX1255 ------
NM_006587chr42382 59 ------
NM_006595chr1161881 1851 1436 790 428 279 ------
NM_006599chr16137769 7474 6801 6618 6334 5861 5437 3271 2878 1795 1019 916 138 27125 1269 47789 5561 2891 34 --
NM_006602chr20--1115 2288 98 --
NM_006603chrX11850 ------
NM_006609chr242976 2393 137 64 --1983 --
NM_006614chr372694 2545 2323 832 407 398 311 23356 2347 ----
NM_006620chr634609 3753 1459 21576 366 ----
NM_006622chr51180 ------
NM_006624chr1012105 ------
NM_006625chr121097 91 1248 ----
NM_006625chr121097 91 1248 ----
NM_006625chr121097 91 1248 ----
NM_006626chr932223 1079 273 ------
NM_006628chr1534169 1820 592 33504 3361 1192 14320 11491
NM_006629chr1832703 1805 167 22640 83 12042 --
NM_006633chr52306 246 ------
NM_006636chr22995 937 ------
NM_006644chr133638 480 61 --1435 --
NM_006654chr1234747 4607 489 ------
NM_006662chr161269 --163 --
NM_006675chr1263383 3217 2929 2548 619 579 ------
NM_006698chr202986 249 --1411 --
NM_006708chr62951 872 31149 1096 53 ----
NM_006713chr5--1760 1777 --
NM_006717chr963426 3041 2679 2143 2107 1156 12313 ----
NM_006721chr101317 ------
NM_006722chr352347 2254 2221 352 49 1477 12696 --
NM_006724chr62457 393 ------
NM_006729chrX85624 4105 1939 1835 1550 1493 881 268 23631 1575 13900 --
NM_006732chr1991843 1762 1355 1315 835 666 285 277 234 --31876 698 121 11715
NM_006734chr611324 --1468 --
NM_006736chr22590 37 --11211 152
NM_006738chr1554582 4103 3001 1059 922 ------
NM_006744chr10139 ----1211
NM_006745chr41102 --21076 871 --
NM_006750chr1696987 5344 5177 2063 1939 1459 1315 1137 30 25748 295 14945 --
NM_006751chr231034 681 168 ----1296
NM_006755chr112124 55 ------
NM_006756chr8----11015 --
NM_006761chr171811 --1100 --
NM_006764chr31405 ------
NM_006766chr842543 2299 1752 1007 ------
NM_006771chr174795 743 81 27 3919 843 232 1726 --
NM_006772chr621211 135 ------
NM_006777chrX72883 2805 2797 2424 1847 780 624 ------
NM_006788chr1841995 1318 846 516 --21960 146 --
NM_006790chr51154 ------
NM_006801chr195647 523 260 251 90 ------
NM_006802chr12950 875 ------
NM_006805chr51423 11680 1352 --
NM_006813chr64824 742 727 653 ------
NM_006815chr1221336 1273 --1500 --
NM_006818chr13336 329 283 --1910 --
NM_006820chr123942 897 --12637 1760
NM_006823chr82538 308 ----1405
NM_006826chr21936 ------
NM_006827chr1472857 2644 2354 2247 1314 415 213 ------
NM_006832chr143875 282 274 ------
NM_006838chr1221451 1304 2721 269 ----
NM_006846chr51242 ------
NM_006852chr1732687 1909 496 ------
NM_006856chr122855 740 --1864 --
NM_006861chr1231544 1415 335 --1274 --
NM_006868chr1852627 2515 2293 2276 118 --11235 13202
NM_006884chr321509 215 1325 11528 --
NM_006885chr1633841 1625 1025 --1818 --
NM_006888chr1472921 2807 2229 2155 1389 1238 749 ------
NM_006908chr71985 11503 ----
NM_006913chr62359 290 --2404 333 --
NM_006918chr1165665 5400 2346 834 647 492 ------
NM_006920chr22176 104 --11793 --
NM_006922chr21102 12158 ----
NM_006930chr51576 11824 --1565
NM_006937chr17199 ------
NM_006939chr142812 411 ------
NM_006940chr1241567 1157 144 99 ------
NM_006948chr21------12365
NM_006950chrX----1165 --
NM_006951chr101182 ------
NM_006962chrX21169 82 ------
NM_006979chr62534 475 ------
NM_006981chr932785 933 816 --1152 --
NM_006990chr152232 2137 1617 909 802 --1964 --
NM_006996chr13229 130 111 --11259 1242
NM_006997chr101406 ------
NM_006999chr531953 1818 762 --11391 11612
NM_007005chr921183 325 ------
NM_007008chr22758 173 ------
NM_007010chr1721448 328 ------
NM_007011chr1556826 2427 1885 1576 720 36896 5396 2457 26565 938 1663
NM_007017chr51808 ------
NM_007023chr2177 ------
NM_007026chr171493 --193 --
NM_007033chr142187 1495 817 746 1559 21922 433 --
NM_007034chr11707 ----1227
NM_007036chr52900 358 ------
NM_007038chr2186065 5390 5241 4268 3838 2362 723 589 35482 2229 1102 11847 --
NM_007039chr1411653 ------
NM_007040chr191286 1998 ----
NM_007043chr1232032 1303 21 ------
NM_007050chr2047978 6036 3227 3034 14929 45595 1397 290 113 --
NM_007052chrX2423 119 ------
NM_007054chr543804 2569 1257 465 11181 22980 2869 --
NM_007064chr32606 363 ------
NM_007067chr171994 11016 21339 143 --
NM_007078chr1022941 1946 22859 2540 --1663
NM_007106chr1372793 2045 1989 1941 1910 1035 190 ------
NM_007107chr331841 940 25 1729 --12372
NM_007111chr134762 593 583 557 ------
NM_007124chr651305 456 157 125 98 21394 1323 ----
NM_007125chrY31298 263 92 11276 ----
NM_007129chr131111 ------
NM_007137chrX75204 4968 4526 1437 1105 812 791 25226 5079 ----
NM_007146chr1742366 1917 710 402 --12115 12578
NM_007158chr131241 996 836 ------
NM_007159chr341493 650 373 191 ------
NM_007170chr12776 80 ------
NM_007173chr1141890 587 259 166 ------
NM_007174chr121752 12372 --1115
NM_007175chr863408 1408 648 287 216 96 22976 2810 13101 11016
NM_007178chr122339 36 ------
NM_007184chr32539 112 ------
NM_007195chr1853206 2627 2333 490 459 12481 ----
NM_007197chr122859 795 1275 ----
NM_007200chr1554582 4103 3001 1059 922 ------
NM_007203chr953606 3378 3361 1400 548 22594 231 --12516
NM_007207chr13836 830 665 ------
NM_007212chr1----1407 --
NM_007214chr631231 935 836 ------
NM_007217chr3177 ------
NM_007222chr851425 1404 702 494 54 ------
NM_007225chr171998 --21006 790 --
NM_007229chr222339 285 ------
NM_007236chr1552100 1895 1855 854 831 22225 1544 2808 554 12110
NM_007246chr41213 ------
NM_007249chr1368756 6336 3354 3171 3110 1381 38447 7312 6769 16683 19417
NM_007266chr22623 203 1153 ----
NM_007281chr4137 ------
NM_007292chr1795057 4999 4254 3359 917 451 353 284 246 24375 1721 --14147
NM_007294chr172155 112 2855 478 --1292
NM_007295chr172155 112 2855 478 --1292
NM_007296chr172155 112 2855 478 --1292
NM_007297chr172155 112 2855 478 --1292
NM_007298chr172155 112 2855 478 --1292
NM_007299chr172155 112 2855 478 --1292
NM_007300chr172155 112 2855 478 --1292
NM_007302chr172155 112 2855 478 --1292
NM_007303chr172155 112 2855 478 --1292
NM_007304chr172155 112 2855 478 --1292
NM_007305chr172155 112 2855 478 --1292
NM_007322chr191564 ------
NM_007345chr1831992 1703 889 11633 ----
NM_007346chr201347 ------
NM_007358chr141968 1460 76 37 ------
NM_007359chr1761770 1736 531 408 123 82 ------
NM_007361chr14--1546 ----
NM_007372chr173852 842 229 ------
NM_007375chr122147 249 ------
NM_012064chr1251170 992 731 418 247 --1935 --
NM_012072chr2054384 3304 828 388 235 ------
NM_012081chr512900 21335 1205 1582 --
NM_012089chr121247 370 ------
NM_012090chr121210 381 ------
NM_012092chr211706 --11693 1100
NM_012110chr41250 ------
NM_012120chr622670 2109 --32740 958 68 --
NM_012129chr772193 1810 1803 1660 997 666 545 2975 960 ----
NM_012137chr162895 2247 598 547 132 55 12500 --1970
NM_012141chr1342968 1081 767 269 ----11204
NM_012156chr2052655 2541 1374 1027 800 11110 --13003
NM_012158chr1321630 1395 ------
NM_012164chr9107563 6469 5927 5496 4953 2309 2190 1480 224 24 35882 2276 1578 31803 1034 29 1916
NM_012175chr112814 35 1379 ----
NM_012180chr41468 --1509 --
NM_012193chr1155147 4029 3568 1605 1370 64607 3996 3443 869 816 748 34951 3688 1083 --
NM_012197chr931226 83 75 ------
NM_012199chr194148 3739 3319 3105 2947 1806 1384 1367 934 21555 313 --14136
NM_012207chr101865 1195 ----
NM_012214chr2126240 5834 5279 4773 4516 4051 2284 1708 1674 1347 942 244 21273 207 ----
NM_012215chr1041481 1289 691 471 ------
NM_012219chr373245 2919 2599 1264 1159 864 161 21097 265 ----
NM_012223chr22454 138 ------
NM_012224chr4------2747 286
NM_012234chr333294 2399 670 --12953 --
NM_012238chr1021781 486 ------
NM_012242chr101329 ------
NM_012247chr101392 1254 ----
NM_012249chr243591 3397 2995 2213 ------
NM_012250chr1131289 1235 136 --1221 --
NM_012252chr765128 4942 4693 1514 834 218 14284 ----
NM_012255chr201329 ------
NM_012259chr621466 334 ------
NM_012262chr1134960 4867 4445 4208 3924 3471 3424 2020 1659 830 817 208 161 14329 --24933 4556
NM_012281chr752065 1869 458 226 40 ------
NM_012282chrX2694 639 1782 ----
NM_012287chr353699 3378 1546 762 307 11118 11186 --
NM_012288chr684831 1192 1012 694 568 547 391 268 ------
NM_012290chr231667 1073 212 ------
NM_012293chr232026 744 714 ------
NM_012294chr743227 2600 1093 675 1748 ----
NM_012297chr442403 789 716 423 ------
NM_012300chr542510 2439 1706 51 --32175 512 178 12541
NM_012304chr532294 2281 2105 --22483 804 --
NM_012307chr18----197 1196
NM_012308chr1121786 828 21892 1029 22123 47 --
NM_012309chr1154943 4630 3452 3178 629 11010 --1183
NM_012316chr154565 4200 3843 1395 373 24940 4162 24435 711 24581 1972
NM_012319chr181910 ------
NM_012322chr71345 ------
NM_012323chr22--31368 1234 408 --11553
NM_012328chr74422 318 204 37 ------
NM_012329chr1721555 1444 --1109 11160
NM_012330chr1021394 1384 ------
NM_012333chr12277 47 11612 ----
NM_012334chr563201 1880 1636 1054 806 435 23946 1358 2915 64 14089
NM_012343chr531111 803 377 ------
NM_012347chr632950 2224 232 ----21117 913
NM_012382chr564292 3992 3768 2911 611 593 22821 490 14354 --
NM_012388chr1563137 2852 2184 2068 401 375 32679 997 56 ----
NM_012394chr1----136 --
NM_012399chr2221492 420 ------
NM_012417chr171160 1136 --1506
NM_012420chr102558 459 12112 ----
NM_012421chr11377 --132 --
NM_012432chr1164 ------
NM_012446chr5--1181 ----
NM_012448chr1732471 1644 1600 --1848 11987
NM_012461chr141242 ------
NM_012464chr432957 2620 1986 --1435 --
NM_012465chr1053113 2401 1088 787 759 --12655 12310
NM_012479chr732039 1747 557 ------
NM_013231chr1454258 3868 741 669 532 33690 2948 1008 21389 1078 --
NM_013233chr241157 965 959 536 ------
NM_013247chr2256 36 --1132 --
NM_013253chr1131394 360 127 ------
NM_013261chr423566 3516 ------
NM_013269chr1221427 427 1259 14358 --
NM_013277chr1251029 689 369 280 34 ------
NM_013279chr1131612 628 341 --32255 1816 684 --
NM_013281chr203448 325 318 ------
NM_013302chr1694304 3990 2867 1556 1322 974 776 392 145 24067 3113 ----
NM_013309chr1532422 1701 242 22098 1893 ----
NM_013328chr1--127 ----
NM_013341chr252819 891 498 452 50 22669 2542 ----
NM_013352chr61869 ------
NM_013354chr81344 --1450 --
NM_013357chr81742 --1148 --
NM_013363chr31132 ------
NM_013365chr222521 154 ------
NM_013372chr1522818 1288 22262 2193 1324 --
NM_013374chr32673 511 22827 2173 --21982 29
NM_013377chr122106 29 ------
NM_013382chr1452394 1896 1850 1625 878 --1624 --
NM_013390chr921458 425 11664 11222 --
NM_013397chr61690 1900 ----
NM_013434chr241859 1686 1417 213 --11669 11729
NM_013434chr241859 1686 1417 213 --11669 11729
NM_013437chr821372 250 ------
NM_013438chr92410 86 --21402 695 --
NM_013442chr9----155 --
NM_013444chrX41122 908 102 51 ------
NM_013446chr711345 11125 ----
NM_013449chr1252861 2765 2489 1886 119 ------
NM_013450chr21104 ------
NM_013951chr262529 1853 994 570 539 392 ------
NM_013958chr82165 93 1419 ----
NM_013959chr82165 93 1419 ----
NM_013961chr82165 93 1419 ----
NM_013962chr82165 93 1419 ----
NM_013986chr22130 ------
NM_013989chr1474418 4249 3709 3632 3255 1937 404 14521 13779 --
NM_013995chrX22227 1991 11974 22327 174 12281
NM_013996chr72481 194 ------
NM_013996chr72481 194 ------
NM_013997chr72481 194 ------
NM_013997chr72481 194 ------
NM_013998chr72481 194 ------
NM_013998chr72481 194 ------
NM_014001chr1721474 216 --1260 --
NM_014011chr212185 11602 ----
NM_014018chr8125 ------
NM_014023chr1042766 959 780 702 ------
NM_014028chr632634 631 541 --12989 --
NM_014034chr621459 234 ------
NM_014043chr321552 247 ------
NM_014057chr911002 21076 464 --11530
NM_014071chr20272 43 ------
NM_014089chr1352285 1517 253 241 218 21614 524 ----
NM_014106chr1542870 2824 2174 729 2806 471 ----
NM_014112chr855323 5055 4157 3436 1981 --21607 1338 --
NM_014154chr311062 --1596 --
NM_014155chr11107377 7100 7006 6770 5992 5389 2737 1974 1047 432 34836 1707 526 16584 --
NM_014159chr3----1265 --
NM_014166chr134947 758 155 112 ------
NM_014181chr262578 2094 1803 1172 446 50 12265 ----
NM_014189chr451395 1201 1092 430 274 --143 --
NM_014190chr451747 1553 1444 626 348 --1395 --
NM_014191chr122873 364 ------
NM_014216chr14----41170 455 135 107 11441
NM_014217chr141599 1403 1280 1239 1758 ----
NM_014230chr17----137 --
NM_014232chr1731394 1258 297 ------
NM_014232chr1731394 1258 297 ------
NM_014240chr354181 3422 3412 1265 829 34117 3688 3660 11375 --
NM_014243chr421818 1531 1189 1316 1146
NM_014253chrX1924 2860 736 ----
NM_014263chr1021493 1260 1502 ----
NM_014264chr4151 1547 1215 --
NM_014268chr1821110 530 11398 ----
NM_014271chrX1216 ------
NM_014283chr111409 11294 ----
NM_014290chr92176 95 ------
NM_014292chr2251885 1472 1464 338 120 --2607 491 --
NM_014305chr132287 121 ------
NM_014309chr2285370 4445 3838 3286 1739 1596 1461 44 --11965 11752
NM_014319chr121569 --1259 --
NM_014325chr1231645 332 258 22081 1878 1606 --
NM_014331chr466361 6329 5427 5408 3002 2342 26707 6631 --15679
NM_014332chrX1421 ------
NM_014333chr1121820 990 1683 ----
NM_014338chr221143 1834 ----
NM_014345chr61347 ----1310
NM_014350chr52481 59 ------
NM_014365chr12----156 --
NM_014368chr931641 847 304 ------
NM_014372chr112085 11370 2573 22 --
NM_014382chr351730 1616 1505 452 112 ------
NM_014386chr5----149 --
NM_014393chr82903 607 21962 461 ----
NM_014405chr1752325 1638 757 696 146 --1208 --
NM_014408chr1190 --1506 --
NM_014409chr13735 318 87 ------
NM_014410chr181383 ------
NM_014415chr321595 531 1539 21497 1185 --
NM_014421chr462087 1625 1363 784 358 307 ------
NM_014423chr544500 2111 669 28 21608 1250 22121 1307 --
NM_014437chr12271 159 ------
NM_014445chr321768 116 12436 --1707
NM_014452chr62377 77 ------
NM_014454chr62123 26 1367 ----
NM_014456chr1041389 658 531 309 11446 ----
NM_014487chr41259 1529 ----
NM_014491chr72308 243 ------
NM_014494chr1682293 2216 2123 1973 1901 1638 1505 661 ----1565
NM_014517chr321985 1383 --11624 --
NM_014567chr161441 --159 --
NM_014570chr221136 ------
NM_014571chr142941 1061 678 422 --22233 1141 1102
NM_014573chr17----21697 719 11398
NM_014574chr1421252 1143 ------
NM_014575chr31478 ------
NM_014577chr222700 87 ------
NM_014591chr1031301 877 420 11102 ----
NM_014592chr52185 82 1175 ----
NM_014608chr152479 218 1151 ----
NM_014612chr941486 953 599 241 ------
NM_014616chr31381 12606 ----
NM_014620chr12163 ------
NM_014629chr84949 927 284 48 11261 11347 1441
NM_014636chr942812 1290 796 25 13216 ----
NM_014646chr1832009 993 461 1933 166 --
NM_014647chr1661911 1473 845 575 563 116 --147 --
NM_014660chr731134 1057 902 ------
NM_014663chr14911 815 301 292 ------
NM_014666chr511162 ------
NM_014670chr231494 1110 1068 11099 ----
NM_014676chr11219 ------
NM_014677chr811233 11131 ----
NM_014678chr221569 ------
NM_014682chr822043 554 ------
NM_014685chr161382 --159 --
NM_014686chr1942013 548 288 179 ----1918
NM_014690chr732705 800 454 --11916 --
NM_014701chr1582933 2848 2810 2804 2755 2450 1298 543 ------
NM_014702chr633501 2233 379 --13237 --
NM_014703chr32986 276 11086 11212 --
NM_014705chr731943 1621 591 ------
NM_014707chr711794 ------
NM_014709chr24635 625 588 458 ------
NM_014711chr1611312 2487 397 ----
NM_014713chr21465 ----1381
NM_014720chr102236 33 1486 --11448
NM_014721chr696809 6731 6716 6341 5131 1873 1371 209 179 26428 135 2690 307 --
NM_014723chr2053193 2654 333 295 44 ------
NM_014729chr832165 864 567 ----1489
NM_014730chr1285185 4977 4936 4757 3374 2100 1827 1759 13554 2703 225 1796
NM_014730chr1285185 4977 4936 4757 3374 2100 1827 1759 13554 2703 225 1796
NM_014733chr532274 640 104 ------
NM_014735chrX51902 836 648 402 338 --1727 --
NM_014739chr673932 3798 3616 1685 920 479 61 13043 1325 --
NM_014741chr1121937 120 11358 32027 1695 1590 --
NM_014743chr442349 2325 1083 646 1498 11104 1117
NM_014746chr264412 3488 1506 1259 410 48 1794 12882 12989
NM_014747chr184927 4799 4239 3866 1697 958 695 480 24360 324 21348 1163 11437
NM_014751chr831482 775 757 ------
NM_014752chr112483 221 --1375 --
NM_014755chr253811 1398 1355 901 458 ------
NM_014757chr542019 1943 1819 637 ------
NM_014764chr1241198 1186 1038 385 ------
NM_014765chr152386 1916 1902 1810 430 --12550 2892 784
NM_014766chr763558 3306 2504 1035 957 839 11073 21251 589 --
NM_014772chr1843100 2356 935 347 --12208 --
NM_014779chr32840 302 ----1397
NM_014781chr82154 44 ------
NM_014791chr91250 ------
NM_014800chr7----1192 --
NM_014802chr123729 708 408 1788 ----
NM_014810chr123704 1388 ----1296
NM_014812chr111780 ------
NM_014819chr521956 267 12229 ----
NM_014820chr331656 349 296 --21839 549 --
NM_014822chr41216 ------
NM_014824chr1131236 430 94 --1497 --
NM_014826chr174025 3859 3443 3131 1707 1369 474 1432 --13989
NM_014827chr141450 1384 1261 314 ------
NM_014829chr53833 443 113 11790 22314 685 --
NM_014832chr1321594 1335 --21969 1697 --
NM_014836chr1021969 440 --2331 210 --
NM_014839chr151862 613 567 461 52 12102 ----
NM_014840chr12133392 3280 3174 3134 3097 3014 2536 1120 1107 639 564 443 89 12161 12519 --
NM_014848chr1562695 2285 1875 971 183 120 --11895 --
NM_014850chr374843 4648 4579 4237 1726 881 158 23407 41 --24143 1694
NM_014859chr172244 213 --1102 --
NM_014862chr15104223 3867 3196 3049 2993 2984 2935 2648 1349 1323 13003 21532 1304 --
NM_014872chr931744 546 105 --11636 --
NM_014877chr1787550 7144 7093 6385 6006 5946 5300 897 26706 2536 27119 5400 --
NM_014883chr44814 796 743 173 12140 12340 1199
NM_014890chr32286 90 ------
NM_014892chr6169 --2449 159 --
NM_014893chrY2528 424 --21824 112 --
NM_014897chr1763150 3105 2565 2088 711 249 12532 ----
NM_014899chr562949 2809 2550 2008 633 361 11167 ----
NM_014901chr542276 2177 1900 1679 --21423 530 --
NM_014903chr1211570 --12000 --
NM_014905chr241883 1562 567 515 ------
NM_014912chr1082840 2173 861 572 373 342 276 221 23063 235 ----
NM_014917chr1----1200 --
NM_014920chr643640 2635 965 62 21333 491 ----
NM_014932chr31655 ------
NM_014934chr1333227 2565 79 12623 12905 1129
NM_014935chr193797 3436 3274 1273 664 643 343 327 22 --21470 93 --
NM_014937chr1021112 444 1847 11241 --
NM_014938chr1252505 2040 1814 823 683 --12421 12028
NM_014946chr222195 1916 22586 2440 22833 267 --
NM_014947chr152660 2419 1072 764 303 ------
NM_014949chr15994 807 800 713 36 ------
NM_014950chr1431609 1565 219 1210 ----
NM_014951chr1052659 1908 1687 980 966 ------
NM_014952chr1561526 813 708 579 545 530 ------
NM_014953chr1373316 1603 1407 1110 861 603 152 ------
NM_014961chr42610 120 --192 --
NM_014962chr2042556 2292 648 506 ------
NM_014964chr1762413 2161 2131 732 583 481 ------
NM_014974chr1041827 1807 1667 1304 ------
NM_014977chr14------1576
NM_014978chr1031615 327 173 11737 137 --
NM_014982chr1475156 5089 4987 4932 4683 3772 3281 34790 1225 457 1170 --
NM_014988chr412490 ------
NM_014989chr621976 1410 ------
NM_014991chr433073 2953 775 --22969 398 --
NM_014996chr32757 133 ------
NM_014999chr1231191 1182 290 11232 ----
NM_015000chr1263072 2773 2609 2592 2067 115 22342 2241 1187 --
NM_015001chr12894 371 ----1708
NM_015008chr383461 3397 3209 3065 2877 1430 1054 526 --23023 2477 --
NM_015020chr1673568 3403 2929 2569 1323 890 687 --1482 --
NM_015026chr1254547 4268 946 833 775 --11284 --
NM_015032chr1332785 288 194 ------
NM_015039chr1197 23170 3061 21648 428 1119
NM_015040chr252820 2187 1044 492 357 21084 554 --13054
NM_015042chr1584107 3929 3810 3798 3723 1615 929 51 --13437 --
NM_015044chr1623018 2707 12324 23158 2915 1141
NM_015045chr102499 144 --21752 1485 12040
NM_015047chr12361 336 --1411 --
NM_015049chr213255 --22549 82 --
NM_015060chr72240 214 ------
NM_015068chr762885 862 775 453 412 253 --11473 --
NM_015069chr161626 1618 ----
NM_015071chr596546 6301 6294 5778 4660 4554 1505 1061 909 22433 1312 44839 4127 110 58 --
NM_015072chr141603 ------
NM_015074chr174631 3535 1858 1767 755 87 74 44230 3855 3769 1088 14895 --
NM_015076chr664554 2896 2839 1524 428 236 22806 176 14471 --
NM_015082chr51519 --12564 --
NM_015090chr176233 6169 5344 4478 1795 803 651 --25676 5090 --
NM_015092chr1631601 1405 862 11527 14066 --
NM_015093chr6----11229 --
NM_015097chr312184 11988 ----
NM_015100chr132075 1905 258 1146 ----
NM_015101chr162442 2143 2134 2069 1999 816 1324 21116 296 --
NM_015107chrX61938 1765 1623 743 653 248 ------
NM_015115chr453130 2755 2504 2347 894 11970 ----
NM_015125chr191500 ------
NM_015129chrX31729 1157 692 ------
NM_015137chr842146 1747 989 795 --12151 --
NM_015138chr1542522 1019 771 749 --12820 --
NM_015143chr421358 108 ------
NM_015144chr1643424 3350 3144 1384 ------
NM_015149chr131722 1448 526 2883 222 1211 --
NM_015153chr63763 718 624 ------
NM_015155chr1031315 318 248 11042 ----
NM_015156chr1432831 1614 268 ------
NM_015158chr91566 ------
NM_015161chr1631498 1250 239 --31023 555 438 --
NM_015170chr822326 785 ----1268
NM_015172chr1--11200 ----
NM_015173chr451783 1438 1203 464 229 ----1540
NM_015176chr141388 572 545 170 --11685 --
NM_015180chr142695 40 186 ----
NM_015185chrX52942 2884 2304 276 261 1394 12947 --
NM_015191chr1132445 854 148 --12649 12667
NM_015192chr2022838 752 22208 605 ----
NM_015199chr342308 2112 729 207 ------
NM_015200chr431931 1642 642 ------
NM_015208chr1853891 3816 3507 3332 2491 1861 ----
NM_015209chr11903 ------
NM_015215chr122939 1953 --22244 490 --
NM_015231chr11--1242 ----
NM_015233chr1352593 2297 2243 1949 1889 1795 12081 --
NM_015236chr431522 1132 50 ------
NM_015239chr9----1374 1101
NM_015245chr642615 2571 958 253 1321 ----
NM_015247chr1675323 4762 1705 1255 1202 1039 640 ------
NM_015256chr52573 109 1686 ----
NM_015263chr152377 346 ----1261
NM_015264chr2244758 4694 4270 4201 ------
NM_015265chr232198 834 640 1822 ----
NM_015268chr32735 544 ------
NM_015269chr11146 ------
NM_015270chr1221688 213 ------
NM_015271chr444146 1625 1005 563 2671 163 ----
NM_015272chr1611479 --22015 1771 --
NM_015275chr12--1583 11729 --
NM_015277chr1851716 1459 1390 1178 751 ------
NM_015278chr662660 1359 1240 953 499 281 23378 1326 ----
NM_015286chr1552460 2035 1928 1882 942 ------
NM_015288chr543756 2790 2428 286 ----12956
NM_015291chr143468 2718 2691 780 --12162 --
NM_015292chr123731 235 24 ------
NM_015294chr171991 11116 124 --
NM_015299chr1443544 1231 379 302 --53938 3694 3312 1583 1282 --
NM_015310chr856250 5297 2975 2574 1171 27743 5928 36479 5843 660 15670
NM_015313chr1184709 3968 1454 1144 1106 859 640 350 24539 257 21267 73 --
NM_015317chr21126 --12751 1378
NM_015321chr1974395 3134 1844 1681 1508 955 101 --44757 4386 1466 276 --
NM_015323chr621665 221 ------
NM_015326chr142703 2186 411 48 --12839 --
NM_015327chr121004 464 --134 --
NM_015335chr1271675 712 639 549 229 182 131 ----129
NM_015336chr1221896 453 --12707 --
NM_015339chr201816 1240 ----
NM_015340chr361275 1139 1026 929 378 113 ------
NM_015344chr832087 1708 210 ------
NM_015355chr1731761 1560 1364 ------
NM_015365chrX63852 3626 3170 2804 2631 402 ------
NM_015375chr174819 3623 3561 1677 395 273 154 23495 706 24870 1622 --
NM_015382chr141268 ------
NM_015385chr1051013 964 863 747 628 1937 ----
NM_015387chr231836 1781 1618 12036 ----
NM_015393chr462790 1460 1339 536 215 153 13591 11287 --
NM_015396chr331454 1349 76 ------
NM_015397chr951926 1353 1329 303 236 --11806 --
NM_015426chr33578 542 457 --1627 --
NM_015432chr162526 131 ------
NM_015443chr1741482 599 469 450 ------
NM_015446chr11440 1449 11321 --
NM_015455chr52480 126 131 13210 --
NM_015457chr1111107 ------
NM_015458chr874891 3993 2096 1916 1425 1030 727 23270 1612 14569 --
NM_015460chr362064 1686 1582 1477 318 251 21630 349 --2791 665
NM_015472chr32431 113 ------
NM_015472chr32431 113 ------
NM_015477chr151371 ------
NM_015508chr331485 1015 571 --11020 --
NM_015520chr321873 1839 22672 2371 ----
NM_015532chr1542442 840 588 162 12855 ----
NM_015535chr274126 4085 3814 2639 1652 1589 508 --13335 --
NM_015541chr311272 --1944 --
NM_015542chr101290 ------
NM_015550chr763463 3111 2235 953 925 188 ------
NM_015553chr665078 4929 4137 3490 668 411 25045 1146 12000 --
NM_015554chr1532621 2203 671 ------
NM_015564chr543593 3242 2783 641 1749 21362 1116 13507
NM_015565chr2132269 2040 417 ------
NM_015567chr1331089 954 445 ------
NM_015568chr2063836 3602 956 857 149 73 34244 3362 3124 13953 --
NM_015569chr112996 34358 1294 186 14677 --
NM_015571chr622500 46 ------
NM_015575chr293714 3644 3478 1186 798 730 690 493 263 12863 ----
NM_015576chr31190 ------
NM_015601chr101937 ------
NM_015602chr141785 1612 340 267 ------
NM_015605chr1011434 --123 --
NM_015607chr1186 ------
NM_015608chr101557 ------
NM_015609chr142048 1979 1819 511 ----1116
NM_015626chr171296 --171 1411
NM_015630chr231050 1008 809 ------
NM_015634chr101416 ----1551
NM_015635chr921606 819 22108 1574 ----
NM_015640chr144606 3513 1520 711 24489 688 13996 25203 4961
NM_015651chr922263 1920 --12118 11408
NM_015666chr2031486 1120 254 11412 --1311
NM_015668chr81147 ------
NM_015676chr141266 1317 ----
NM_015686chrX22190 1739 12402 11916 12121
NM_015691chrX52556 2247 940 784 597 1289 1385 --
NM_015693chr41273 ------
NM_015695chr632020 1447 1335 ------
NM_015716chr171508 ------
NM_015719chr192529 120 --1237 --
NM_015840chr142662 2586 1741 1059 22695 966 11947 --
NM_015841chr142662 2586 1741 1059 22695 966 11947 --
NM_015866chr12147 35 --1268 1124
NM_015872chr11647 ------
NM_015874chr42633 157 --133 --
NM_015878chr852179 1856 1421 689 424 1276 ----
NM_015881chr1131394 360 127 ------
NM_015886chr855211 4963 4097 3892 1032 23847 432 --14105
NM_015888chr152356 743 609 590 163 1478 ----
NM_015891chr642013 1997 761 215 1631 ----
NM_015904chr22564 336 ------
NM_015906chr154576 1863 1398 283 276 23581 1795 23038 868 --
NM_015912chr841023 674 393 320 1610 ----
NM_015948chr62396 176 --1181 --
NM_015976chr12309 238 ------
NM_015980chr531458 557 210 --1364 --
NM_015981chr532881 2307 2258 --12369 11116
NM_015986chr172508 469 ------
NM_015995chr15124910 4872 4166 4037 4017 2072 1957 1077 744 610 543 401 25592 3739 44289 3605 1841 565 --
NM_016009chr123737 36 23370 1646 ----
NM_016018chr852185 2019 727 691 117 ----12702
NM_016019chr71990 --1392 --
NM_016021chr633046 2664 512 131 12062 --
NM_016022chr111099 ------
NM_016025chr161507 --1805 --
NM_016038chr71488 ------
NM_016040chr122679 1087 12095 22020 893 11093
NM_016045chr2051483 573 219 144 52 --1339 --
NM_016061chr231603 1493 1428 ------
NM_016072chr1211746 11592 ----
NM_016073chr152784 204 ------
NM_016075chr1333163 977 394 --11023 --
NM_016076chr132857 2572 106 --1703 --
NM_016083chr653634 3534 3399 2958 830 --21246 854 --
NM_016090chr11151 1426 ----
NM_016096chr82191 35 1533 1632 1476
NM_016098chr6----1352 --
NM_016100chr202435 70 ------
NM_016103chr5------1169
NM_016107chr5--11326 ----
NM_016123chr12265 26 11077 1338 --
NM_016131chr211832 32044 1710 1622 1168 --
NM_016152chr31350 --11209 1961
NM_016169chr1073022 2679 2374 312 299 211 55 13229 12284 12689
NM_016178chr1--172 ----
NM_016185chr173580 172 73 ------
NM_016200chr73726 102 50 1115 ----
NM_016205chr4----2387 54 --
NM_016206chr388187 5808 3108 3098 2386 1232 809 135 1973 27264 2977 --
NM_016210chr331387 279 72 --2210 160 --
NM_016224chr611933 --21913 46 --
NM_016227chr111409 11294 ----
NM_016240chr821549 525 --1104 11647
NM_016248chr1343167 2820 1494 453 13913 13114 --
NM_016252chr22774 220 ------
NM_016257chr122947 71 --23464 1091 12549
NM_016258chr11624 --1104 --
NM_016260chr277273 5962 5538 2471 1681 333 231 32590 1612 306 ----
NM_016263chr1961381 1349 793 528 419 165 ------
NM_016271chr1831475 773 695 ------
NM_016275chr352809 2575 1787 1761 978 ------
NM_016279chr5----1332 --
NM_016281chr12--1267 ----
NM_016284chr162196 67 --195 --
NM_016287chr12597 430 ------
NM_016289chr242328 1834 1526 934 179 ----
NM_016297chr233046 681 658 23490 2435 1604 1428
NM_016298chr333258 584 211 22188 782 ----
NM_016322chr922363 962 --21966 847 --
NM_016340chr531094 1006 68 ------
NM_016356chr672575 2140 2103 1882 1146 666 501 --12660 --
NM_016374chr121105 1089 --1135 --
NM_016374chr121105 1089 --1135 --
NM_016377chr621782 368 --173 --
NM_016395chr1551821 1727 1709 1269 490 2782 431 148 --
NM_016396chr1552655 2145 2126 1841 417 1987 12772 --
NM_016401chr11--1255 161 --
NM_016410chr94576 547 255 198 1402 ----
NM_016418chr2252580 961 726 650 156 --23244 339 --
NM_016424chr1722045 619 --11972 --
NM_016436chr2062540 1957 1764 624 578 375 12162 1113 --
NM_016441chr252401 2054 1635 351 110 ------
NM_016467chr21549 11101 11293 --
NM_016470chr202453 437 ------
NM_016505chr11686 1590 ----
NM_016507chr1753071 2605 2462 2055 529 1360 23091 2728 --
NM_016513chr643640 2635 965 62 21333 491 ----
NM_016516chr22315 78 ------
NM_016519chr41445 ------
NM_016522chr1111296 --11645 1644
NM_016530chr152941 888 23282 758 ----
NM_016531chr433108 1410 30 21208 108 146 --
NM_016548chr941107 1029 530 466 11018 31188 494 312 --
NM_016559chr341215 993 543 407 ------
NM_016577chr364109 3943 3547 2738 1490 1130 11293 1586 --
NM_016578chr111111 ------
NM_016588chr6198 --1146 --
NM_016603chr511965 11367 ----
NM_016604chr541289 1089 939 303 ------
NM_016605chr542368 2039 1758 686 --21871 39 --
NM_016607chrX11641 ------
NM_016620chr131345 1199 446 ------
NM_016622chr222131 494 --11811 --
NM_016623chr81526 ------
NM_016628chr101602 ------
NM_016631chr211847 --1947 --
NM_016654chr1531115 993 911 ------
NM_016818chr21--1590 ----
NM_016824chr101406 --11505 --
NM_016834chr1794162 4118 3880 3560 3325 3158 2545 303 162 --23728 1407 13296
NM_016835chr1794162 4118 3880 3560 3325 3158 2545 303 162 --23728 1407 13296
NM_016841chr1794162 4118 3880 3560 3325 3158 2545 303 162 --23728 1407 13296
NM_016929chr694598 4263 3776 3659 2855 1227 849 669 497 21819 1579 23870 3353 34604 1299 1138
NM_016931chr111335 ------
NM_016940chr211450 ------
NM_016953chr265345 2164 1708 1190 1181 846 12090 35935 5005 4079 --
NM_017413chrX62425 2265 1988 504 192 176 --1250 --
NM_017415chr533386 588 54 24101 1115 1134 --
NM_017420chr1443512 2896 2867 282 ----1952
NM_017423chr411942 ------
NM_017447chr2164111 3762 2799 1759 1423 752 22765 196 ----
NM_017488chr231600 1365 523 --21223 584 1339
NM_017489chr821153 466 ------
NM_017510chr51638 --164 --
NM_017514chrX1938 --1667 172
NM_017519chr631290 347 58 ------
NM_017545chr201167 ----1444
NM_017548chr32836 332 ------
NM_017563chr3106305 5040 4806 4470 4449 4300 3951 1072 994 622 35707 5237 2269 153 --
NM_017582chr121746 1263 1473 --1210
NM_017583chr1131614 711 77 ----11778
NM_017594chr953208 2767 2390 2288 2228 12560 ----
NM_017599chr1222054 373 ------
NM_017610chr1532091 2069 706 180 1121 1754
NM_017617chr921601 361 11345 --1559
NM_017629chr1193 --21540 494 --
NM_017632chr4----156 --
NM_017633chr643809 3714 1487 1096 --12571 --
NM_017634chr831284 637 189 --1171 --
NM_017635chr1131627 1229 168 --1353 1152
NM_017637chr9128731 7825 6801 6405 6162 6039 3497 2703 1749 1102 776 648 28039 3322 28215 7783 --
NM_017641chr1221006 138 ------
NM_017643chr1732090 1181 52 ------
NM_017644chr3105201 4219 3737 3336 3276 1522 1459 746 587 397 11687 ----
NM_017650chr721383 949 24948 4254 25238 4618 --
NM_017651chr641365 1155 477 142 ------
NM_017657chr23716 382 117 1662 ----
NM_017660chr1963303 3032 2646 2144 670 468 --190 --
NM_017661chr152966 461 ------
NM_017666chrX71937 852 640 614 547 270 229 11371 ----
NM_017667chr72168 124 ------
NM_017672chr153521 282 162 --1124 --
NM_017680chr91679 1363 --1136
NM_017686chr12383 139 ------
NM_017693chr134630 571 358 346 11303 ----
NM_017694chr252032 1785 1737 1408 384 11615 ----
NM_017700chr42166 21 ------
NM_017709chr153336 2774 1333 1089 843 1512 1117 --
NM_017714chr202930 650 ------
NM_017744chr152457 2168 2032 619 307 ------
NM_017748chr176871 727 643 214 178 87 ------
NM_017762chr1532427 2249 657 --2828 225 --
NM_017768chr11842 ------
NM_017769chr1433120 2657 553 12058 ----
NM_017778chr811259 ------
NM_017779chr152761 2251 2094 1061 890 ----12569
NM_017787chr1092890 2673 2125 1850 1139 814 660 360 79 1237 21114 391 --
NM_017798chr202468 37 ------
NM_017799chr1421681 1398 --21814 253 --
NM_017810chr164648 185 172 108 2567 210 189 --
NM_017811chr993075 2849 2693 2681 2413 2048 1937 1240 249 12258 22993 136 --
NM_017813chr864787 4631 2255 1903 1330 896 ------
NM_017816chr4----140 --
NM_017824chr1032726 2189 63 32645 891 687 ----
NM_017831chr1884739 3522 3459 3207 3077 1485 1260 915 13537 24120 3100 14402
NM_017845chr4197 ------
NM_017847chr122144 142 1368 ----
NM_017848chrX54319 4145 3770 1635 58 ------
NM_017849chr252793 2211 1015 965 851 --22716 1228 --
NM_017851chr153916 846 439 ------
NM_017866chr83767 265 89 ----1437
NM_017873chr942813 2717 1240 662 12772 1886 --
NM_017895chr202190 69 ------
NM_017902chr1095219 4648 4426 4074 3975 2183 2177 1211 1143 --11667 --
NM_017910chr22348 234 1111 126 --
NM_017913chr91333 ------
NM_017915chr121994 1761 ----
NM_017921chr174444 414 125 21 --22233 1923 --
NM_017938chrX42031 1673 491 92 11833 ----
NM_017944chr1152004 687 479 175 121 --11945 --
NM_017945chr331160 969 877 ------
NM_017953chr14878 250 177 78 ------
NM_017964chr23272 78 35 ------
NM_017982chr151345 1222 1154 341 24 ------
NM_017988chr124805 797 761 57 ------
NM_017994chr782776 2760 2030 1111 936 861 667 149 ------
NM_017998chr92430 33 --1456 --
NM_018015chrX21005 267 --1951 --
NM_018017chr1032714 2275 640 1355 ----
NM_018018chr1221804 616 11868 ----
NM_018027chr1043131 2162 2074 263 11229 --1943
NM_018045chr132837 993 487 2661 180 11923 1745
NM_018046chr53750 692 410 1325 --1123
NM_018060chr12357 45 ------
NM_018061chr111119 ------
NM_018063chr10178 ------
NM_018067chr11557 ------
NM_018080chr152152 66 ------
NM_018084chr232790 2431 875 12502 11261 --
NM_018086chr231335 314 189 ------
NM_018092chr1621094 340 ------
NM_018097chr15160 3759 624 320 1160 --
NM_018098chr331169 1115 462 ----167
NM_018099chr12166 ------
NM_018105chr81916 ------
NM_018110chr1661335 1118 1015 480 473 56 ----11341
NM_018120chr8------11535
NM_018126chr4------11002
NM_018133chr31249 ------
NM_018139chr143228 147 63 ------
NM_018145chr152121 26 ------
NM_018155chr373352 3204 3060 2664 2512 737 709 33246 1067 779 13439 --
NM_018157chr1233046 2965 568 11268 12479 --
NM_018159chrX--1370 1167 --
NM_018184chr311776 1484 1419 --
NM_018191chr132550 85 ------
NM_018197chr203860 548 256 1166 ----
NM_018200chr1532482 2078 585 1946 12053 --
NM_018201chr951883 1727 1707 1619 697 --31946 875 58 1813
NM_018202chr11161 ------
NM_018222chr1141517 1342 1205 487 ------
NM_018227chr482361 2285 2240 2225 1162 809 754 412 ------
NM_018230chr12385 188 ----1487
NM_018243chr422932 1624 33385 2586 423 1896 --
NM_018247chr652826 2734 416 299 164 1951 ----
NM_018254chr131727 1548 64 31977 729 381 ----
NM_018257chr2062560 2215 1795 972 851 155 ----11013
NM_018287chr102375 98 ------
NM_018293chr332637 1096 175 1920 --1985
NM_018299chr833098 324 90 ------
NM_018302chr451930 1667 396 143 85 1945 1807 --
NM_018312chr1141951 1819 1497 25 --22203 1727 --
NM_018313chr342558 2411 1747 192 12220 ----
NM_018314chr112517 155 ------
NM_018315chr431466 438 244 11566 ----
NM_018330chr1021537 472 21352 1294 ----
NM_018339chr931865 1637 1393 1416 ----
NM_018351chr1254340 3988 3464 2929 29 22985 1287 ----
NM_018361chr844006 2594 699 580 --14052 1706
NM_018362chr1164039 3917 3406 2558 639 372 31150 573 62 --13552
NM_018364chr154139 3100 2575 547 71 32876 1181 695 ----
NM_018370chr1231559 546 92 11574 --1802
NM_018387chr9----1416 --
NM_018394chr341596 1518 1194 385 11008 11565 --
NM_018403chr393900 3891 3816 3709 3465 3148 2714 2688 1016 11330 ----
NM_018424chr971827 1540 1513 1334 1164 243 189 ------
NM_018429chr552668 1922 923 271 192 ----22589 198
NM_018434chr5125 ------
NM_018439chr1832091 364 95 12021 12476 --
NM_018440chr888168 7580 3422 2743 2189 2067 1929 1799 26151 2680 26650 428 11301
NM_018448chr1221144 901 ------
NM_018451chr131230 1866 2584 38 --
NM_018456chr3--1129 ----
NM_018462chr32797 631 1744 ----
NM_018465chr9144 ------
NM_018469chr1721318 1210 11280 ----
NM_018471chr2155 --2169 110 --
NM_018475chr42159 113 --1195 --
NM_018477chr141156 ------
NM_018482chr83935 358 308 ------
NM_018490chr1121208 243 ------
NM_018553chr1721220 575 --11813 --
NM_018557chr211732 --11373 11738
NM_018566chr185141 5111 4890 4138 3866 3123 720 599 34152 4102 564 11906 --
NM_018571chr2--1536 ----
NM_018593chr6----1550 --
NM_018638chr1264948 4913 3996 2221 1032 500 11518 ----
NM_018640chr1212525 ------
NM_018649chr10--1514 ----
NM_018652chr152924 398 ------
NM_018657chr3--2747 335 ----
NM_018660chr873131 2880 2841 2755 2569 939 471 22768 484 12931 --
NM_018672chr171739 --1732 --
NM_018683chr2041702 1671 1262 73 ------
NM_018684chrX31206 1169 300 ------
NM_018685chr73437 173 79 ------
NM_018695chr53844 734 77 1757 ----
NM_018697chr721528 197 ------
NM_018704chr12666 419 1188 1791 --
NM_018710chr821267 1225 ------
NM_018713chr12354 224 161 ----
NM_018834chr51248 ------
NM_018841chr143115 2748 1401 187 12823 12928 --
NM_018847chr931425 654 321 11657 ----
NM_018890chr71985 11503 ----
NM_018912chr52713 491 --11663 --
NM_018913chr52713 491 --11663 --
NM_018914chr52713 491 --11663 --
NM_018915chr52713 491 --11663 --
NM_018916chr52713 491 --11663 --
NM_018917chr52713 491 --11663 --
NM_018918chr52713 491 --11663 --
NM_018919chr52713 491 --11663 --
NM_018920chr52713 491 --11663 --
NM_018921chr52713 491 --11663 --
NM_018922chr52713 491 --11663 --
NM_018923chr52713 491 --11663 --
NM_018924chr52713 491 --11663 --
NM_018925chr52713 491 --11663 --
NM_018926chr52713 491 --11663 --
NM_018927chr52713 491 --11663 --
NM_018928chr52713 491 --11663 --
NM_018929chr52713 491 --11663 --
NM_018945chr653399 3146 1271 625 382 12789 1817 --
NM_018948chr121379 493 --1179 --
NM_018951chr71282 --1167 --
NM_018953chr121811 ------
NM_018958chr1563461 2563 1380 822 615 502 12672 --12851
NM_018970chr773146 3078 2909 2747 2488 2466 190 --12377 --
NM_018975chr162768 511 ------
NM_018979chr1231840 1766 598 ------
NM_018999chr1034653 3144 876 11330 ----
NM_019002chr2----1103 --
NM_019004chr732291 2201 631 182 ----
NM_019005chr71244 199 ----
NM_019006chr152152 51 ------
NM_019009chr1162542 2391 1816 1005 856 686 ----1575
NM_019012chr121314 --123 --
NM_019027chr432042 2003 57 ------
NM_019028chr112279 31 ------
NM_019042chr72810 470 --154 --
NM_019046chr102615 279 ------
NM_019050chr442297 1429 770 577 22062 632 --12014
NM_019053chr10--143 21053 427 --
NM_019064chr171798 ------
NM_019072chr573770 2946 1595 1428 1281 956 212 1820 ----
NM_019083chr11270 1435 11147 --
NM_019084chr1041605 561 495 245 1881 ----
NM_019094chr1253456 2657 1395 1211 80 13377 12857 --
NM_019106chr2253241 3145 2865 888 258 ------
NM_019114chr92386 146 1695 ----
NM_019116chr1652672 2480 2300 1274 767 1525 --12791
NM_019555chr321673 1129 ------
NM_019557chr12768 676 1819 1325 --
NM_019592chr94600 167 83 30 ------
NM_019597chrX1124 1223 ----
NM_019610chr142065 1888 833 195 ------
NM_019859chr101173 --11106 --
NM_019860chr101221 141 11154 --
NM_019891chr11150 21153 1126 192 --
NM_019903chr101406 --11505 --
NM_020116chr421154 149 11738 ----
NM_020120chr241607 1069 141 127 --1147 --
NM_020122chr276041 5148 5104 4681 4613 4364 859 14715 ----
NM_020123chr102526 183 ------
NM_020127chr191715 1435 1391 681 584 318 107 96 88 11653 11190 --
NM_020139chr451916 1746 1605 604 541 --21984 156 --
NM_020141chr132228 2157 1527 1941 ----
NM_020148chr1832392 526 320 11191 22306 73 --
NM_020150chr1042158 859 571 333 1319 11622 --
NM_020177chr532654 2449 551 12347 ----
NM_020182chr2032885 1154 1117 --23394 3374 --
NM_020184chr272268 2242 2026 1940 1837 1524 112 --11668 2823 445
NM_020198chr17----1419 --
NM_020199chr5145 11080 --1350
NM_020205chr162586 1321 1006 714 226 120 22451 60 ----
NM_020228chr112581 182 --12375 --
NM_020240chr542610 2459 1803 1028 12749 11808 11890
NM_020243chr221637 ------
NM_020245chr694570 4372 4359 3710 3349 3202 1117 718 497 2707 522 13998 --
NM_020248chr182378 2205 2119 678 544 397 327 58 --1291 11590
NM_020307chr3194 ------
NM_020310chr1762373 1852 873 653 624 205 12367 1331 --
NM_020337chr452311 966 944 921 681 ------
NM_020338chr1023681 1418 13412 12457 --
NM_020341chr2031615 615 587 ------
NM_020342chr242483 2213 2005 993 ----11677
NM_020346chr111237 1227 ----
NM_020348chr1052579 2393 2343 720 287 1441 ----
NM_020357chr31463 --1397 --
NM_020362chr11301 ------
NM_020374chr122353 335 --11440 --
NM_020381chr63691 634 90 1601 ----
NM_020384chrX61497 540 504 411 400 367 --1128 --
NM_020390chr333726 1424 429 34827 1606 1437 11684 --
NM_020416chr41885 1779 22410 851 1713
NM_020420chrY21569 430 --1405 --
NM_020423chr14530 241 175 162 ------
NM_020425chr631901 712 508 ------
NM_020429chr752961 963 751 376 176 ------
NM_020432chr72501 52 --180 --
NM_020440chr121125 708 --33207 1130 307 12811
NM_020443chr1216454 6099 5374 4990 4519 4393 4271 2737 2691 2669 2613 2539 2348 1426 1309 1116 501 370 287 269 252 25973 1079 21333 95 14387
NM_020452chr131933 1559 547 ------
NM_020457chr162464 219 ------
NM_020466chr685047 4432 4162 4025 3574 1526 966 910 1311 ----
NM_020467chr12154 --2161 35 --
NM_020473chrX21997 1297 ------
NM_020474chr1831341 410 40 11247 1627 --
NM_020475chr842388 640 346 139 --11593 --
NM_020476chr842388 640 346 139 --11593 --
NM_020477chr842388 640 346 139 --11593 --
NM_020478chr842451 703 409 202 --11656 --
NM_020480chr842388 640 346 139 --11593 --
NM_020532chr22758 173 ------
NM_020546chr552946 2391 895 420 63 ------
NM_020640chr342288 2250 1781 79 ------
NM_020644chr114970 329 236 60 ------
NM_020645chr112623 93 1471 ----
NM_020647chr822210 1788 ------
NM_020651chr211414 ------
NM_020661chr1221890 303 1393 --11993
NM_020666chr52950 341 ------
NM_020673chr20105933 5694 2833 2634 2433 2321 2279 1898 1861 1177 35872 5444 2022 35801 5426 2924 --
NM_020689chr2031681 296 248 --21145 328 --
NM_020699chr155226 4576 4040 2042 1876 --11569 --
NM_020708chr2012167 --2417 165 --
NM_020715chr1431696 1414 246 --1263 --
NM_020718chr1686453 4910 1973 1839 1415 750 470 319 32652 2336 1833 25162 397 15260
NM_020732chr631290 347 58 ------
NM_020734chr1233076 2936 1203 --1903 23215 2129
NM_020738chr221421 65 1180 ----
NM_020739chr1544130 2778 1489 174 11552 33789 3751 672 13283
NM_020742chrX32053 1011 442 --11890 1131
NM_020748chr171181 ------
NM_020752chr1072762 2242 2205 779 768 704 677 --11993 --
NM_020760chr231773 1555 242 ------
NM_020766chrX84350 4094 3967 3471 3440 3357 3174 39 1468 13202 11087
NM_020768chr572713 2207 1980 901 733 513 477 --1665 --
NM_020769chrX1158 --135 --
NM_020770chr151227 1061 1026 906 479 11157 --11033
NM_020772chr1787723 7628 7384 7046 2927 1901 1561 1106 27288 470 ----
NM_020773chr462556 2414 995 926 441 116 1272 --11734
NM_020774chr18124960 4879 4451 2289 1925 1785 1604 1546 1463 1032 605 518 15314 --24690 1931
NM_020778chr1594451 4407 3891 3829 1808 1624 929 741 491 --11780 14249
NM_020779chr233091 2846 2368 --12986 --
NM_020782chr1244486 4166 3642 3623 34773 4352 900 ----
NM_020783chr1822241 1620 ------
NM_020791chr1721245 1230 --1551 --
NM_020792chr342670 2306 179 81 ------
NM_020795chr1731733 1526 82 11917 ----
NM_020796chr543047 2553 1918 1218 --11121 12943
NM_020800chr331380 989 50 ------
NM_020801chr562435 2156 1949 1788 816 569 ------
NM_020804chr6----12535 --
NM_020805chr183626 462 411 ------
NM_020806chr142207 49 ------
NM_020807chr1631760 1517 1180 --21572 234 --
NM_020819chr621023 292 ------
NM_020826chr1173349 2389 1414 1061 981 943 129 11044 ----
NM_020830chr243137 2358 985 502 --1783 --
NM_020834chr143604 402 389 --1495 --
NM_020839chr321238 112 ------
NM_020841chr1233368 140 42 12842 ----
NM_020854chr1821291 468 ------
NM_020856chr1921550 1391 --177 --
NM_020858chr1511649 ------
NM_020859chr463464 1587 1060 535 267 175 12942 ----
NM_020860chr42986 788 ------
NM_020865chr31153 ------
NM_020866chr132803 439 ------
NM_020868chr221347 1307 ------
NM_020870chr43649 234 128 ------
NM_020871chrX52455 1842 1745 602 504 ------
NM_020872chr321222 428 21177 495 11161 --
NM_020873chr32820 97 ------
NM_020886chr1141257 972 915 37 1362 1468 --
NM_020888chr121914 1327 --11727 --
NM_020899chr17----1355 --
NM_020909chr2104123 3830 2992 2781 1664 1552 611 417 300 125 ----1450
NM_020917chr1942948 2875 623 605 23704 436 1304 --
NM_020920chr141153 ------
NM_020921chr1422550 629 23467 3226 11166 11095
NM_020925chr121176 1011 11255 ----
NM_020933chr1941965 1522 433 328 132 1774 --
NM_020935chr254523 4516 3045 1130 206 --34529 3299 614 --
NM_020937chr142610 193 ------
NM_020940chr1062025 1906 1003 950 914 317 ------
NM_020948chr153532 3510 3377 3358 708 ------
NM_020962chr1551521 1005 657 465 315 12482 1558 --
NM_020977chr422233 56 11715 ----
NM_020983chr1221688 213 ------
NM_020988chr1631323 1077 31 ------
NM_021003chr141169 ------
NM_021005chr15--11016 ----
NM_021007chr232476 2117 105 ------
NM_021013chr17----176 --
NM_021033chr1332355 1218 670 12946 ----
NM_021038chr353357 2945 2442 1138 371 ------
NM_021061chr844061 3194 3067 798 34160 3523 704 ----
NM_021069chr482032 2017 1988 1744 1666 1400 629 355 ------
NM_021072chr531642 839 372 22400 1675 12556 --
NM_021083chrX53588 2229 1047 974 702 1600 --13407
NM_021088chr251956 1858 869 195 100 1799 11474 --
NM_021096chr2293168 2738 2348 2093 2049 2039 622 587 317 --1961 --
NM_021097chr232998 2834 1909 11985 ----
NM_021116chr7119118 8547 8403 2892 2314 2295 1875 1094 657 197 73 16252 12537 --
NM_021120chrX33137 2449 1942 12108 ----
NM_021136chr141610 ------
NM_021140chrX2915 100 --1279 --
NM_021159chr451548 1491 642 309 188 --1627 --
NM_021174chr83717 648 622 --1303 --
NM_021183chrX42161 1742 1700 687 ------
NM_021190chr131207 467 60 11152 11134 --
NM_021194chr1127 ------
NM_021202chr2043050 2943 2573 2313 12080 12279 1369
NM_021222chr121341 519 1557 --143
NM_021227chr41361 ------
NM_021229chr12----1235 --
NM_021238chr1251779 1283 778 643 180 2761 147 ----
NM_021240chr91126 ------
NM_021252chr101458 ------
NM_021253chr621403 197 --1337 --
NM_021255chr1451434 1395 1328 863 557 1458 22644 571 --
NM_021269chr1911283 11755 21561 109 --
NM_021622chr1041645 961 747 382 1556 ----
NM_021629chr324560 1186 35051 3824 3203 ----
NM_021633chr111020 ------
NM_021637chrX2457 169 --11056 --
NM_021643chr251696 1469 1247 155 88 ------
NM_021644chr101865 1195 ----
NM_021705chr62446 309 1143 11285 --
NM_021724chr171251 ------
NM_021728chr141244 ------
NM_021813chr664156 3845 1956 1758 1387 1247 23600 255 24846 3637 --
NM_021814chr62558 40 2307 117 ----
NM_021905chr652309 2196 1498 588 32 --1119 --
NM_021911chr542201 1844 1736 1198 14981 ----
NM_021912chr1553925 3727 3599 2764 1248 ------
NM_021914chr1411567 11615 12066 --
NM_021940chr651626 1578 1370 1299 132 ----1157
NM_021942chr41865 ------
NM_021943chr61187 --1609 11979
NM_021954chr1333461 2468 2404 23444 2642 ----
NM_021956chr61277 ------
NM_021960chr162592 2507 1098 945 578 26 11079 ----
NM_021961chr1176530 5926 5558 4813 2064 830 89 26846 1391 21999 1838 --
NM_021964chr375943 5028 4219 2230 1968 1629 1491 12418 14010 --
NM_021965chr941251 1092 885 96 ------
NM_021976chr61689 ------
NM_021977chr683716 3493 3226 2475 1034 819 753 698 --1334 --
NM_021988chr2031607 353 281 ------
NM_021998chrX2308 111 ------
NM_022041chr1642531 2350 2294 356 32702 2579 716 ----
NM_022048chr1555811 5528 1780 1225 265 35633 2417 1888 1742 144
NM_022049chr131604 1163 219 21878 1272 ----
NM_022051chr12173 163 ------
NM_022058chr231715 349 96 1516 --160
NM_022073chr1431092 654 351 ------
NM_022079chr101937 ------
NM_022114chr144397 2987 525 459 13995 13282 --
NM_022116chr72323 144 ------
NM_022123chr141435 ----1160
NM_022130chr52282 64 ------
NM_022133chr821754 560 ----1645
NM_022143chr721554 1098 ----11115
NM_022166chr1665472 5407 4884 4012 1837 1483 1209 14749 14563
NM_022169chr1151393 1358 558 142 127 --1563 --
NM_022170chr711669 --1623 --
NM_022337chr11------1641
NM_022346chr441195 540 455 272 1363 ----
NM_022351chr823326 2809 ------
NM_022368chrX2127 30 ------
NM_022442chr2031607 353 281 ------
NM_022444chr731975 72 58 ------
NM_022458chr753158 2598 2388 591 568 --22148 407 --
NM_022459chr1385763 5671 2528 2398 2005 1516 927 66 ----11162
NM_022462chr1963327 2644 2554 986 621 578 --83757 3043 3013 2707 2598 2524 1330 675 22507 2464
NM_022463chr1721496 980 --1359 --
NM_022465chr1223066 45 --12910 --
NM_022469chr163264 3188 2761 2517 887 474 22957 2357 ----
NM_022474chr1462416 2035 1125 763 594 412 1861 ----
NM_022476chr162982 113 ----1938
NM_022484chr741405 1321 1082 278 1568 ----
NM_022488chr3141 ------
NM_022495chr142480 72 ------
NM_022552chr21203 ------
NM_022652chr122802 374 ------
NM_022716chr153024 2222 2162 658 418 23069 2582 ----
NM_022719chr2273195 2955 2892 2722 1383 1155 666 ------
NM_022726chr651759 1193 667 411 256 ------
NM_022728chr71218 ------
NM_022730chr22842 750 --11052 --
NM_022735chr121168 435 11493 ----
NM_022739chr1721165 46 --1269 --
NM_022758chr653054 2875 1296 1168 552 --32174 110 49 --
NM_022763chr312070 --12715 --
NM_022771chr1221049 880 ------
NM_022776chr331553 353 98 ------
NM_022781chr941323 1121 1086 632 1141 ----
NM_022802chr101402 --21480 105 --
NM_022824chr551867 1581 1570 613 190 ------
NM_022826chr221229 105 21209 943 ----
NM_022831chr11736 21479 414 ----
NM_022832chr441856 291 227 128 ----21916 25
NM_022836chr1----1534 --
NM_022841chr151257 12261 22518 982 --
NM_022843chr1321082 1069 --143 --
NM_022893chr233070 2198 937 ------
NM_022894chr21192 11217 ----
NM_022898chr1431038 500 373 13303 171 --
NM_022912chr242925 2717 2363 613 11238 --12565
NM_022913chr52264 235 ------
NM_022977chrX42412 2249 2098 1014 12361 ----
NM_023000chr1431497 579 186 11595 ----
NM_023001chr1431497 579 186 11595 ----
NM_023010chrX2696 30 ------
NM_023016chr231089 1039 374 ------
NM_023074chr1931305 896 74 ------
NM_023112chr1452794 2470 1907 1185 925 1429 1689 --
NM_023925chr122290 85 ------
NM_023927chr541169 926 475 202 ------
NM_023929chr812542 --1656 12674
NM_023940chr44863 814 746 91 ------
NM_024019chr41202 --1143 --
NM_024029chr192271 103 1165 ----
NM_024034chr20254 28 1188 ----
NM_024052chr1732087 1137 572 1898 ----
NM_024076chr1932344 1798 899 --22152 58 --
NM_024087chrX2584 255 ------
NM_024095chr1231447 1408 225 1421 ----
NM_024294chr653054 2875 1296 1168 552 --32174 110 49 --
NM_024295chr851965 832 476 244 80 11272 ----
NM_024345chr965550 4905 2348 1996 1189 400 42112 1556 882 44 --11416
NM_024415chr51152 ------
NM_024416chr911002 21076 464 --11530
NM_024424chr111883 1207 169 --
NM_024425chr111883 1207 169 --
NM_024426chr111883 1207 169 --
NM_024492chr651487 1370 476 182 134 --1340 --
NM_024511chr473383 2194 923 893 705 418 188 33310 906 385 ----
NM_024524chr352346 2251 1256 713 495 ------
NM_024529chr11346 ------
NM_024539chrX21241 1204 ------
NM_024541chr103377 314 29 1521 11708 11427
NM_024551chr1271579 944 295 263 242 140 70 ------
NM_024551chr1271579 944 295 263 242 140 70 ------
NM_024569chr152680 1110 817 484 302 ------
NM_024574chr4172 ------
NM_024583chr22145 112 ------
NM_024586chr11204 ------
NM_024613chr811858 11490 ----
NM_024615chr5127 ------
NM_024624chr231304 628 376 ------
NM_024626chr121633 499 1552 ----
NM_024631chr11--1476 ----
NM_024646chr163692 3423 3143 1113 875 378 22748 1561 ----
NM_024663chr202439 55 --1421 --
NM_024665chr374007 3949 3104 3092 1742 695 625 11269 24302 1325 --
NM_024674chr132190 1021 934 12445 13199 --
NM_024676chr12472 37 --11203 --
NM_024680chr11169 ------
NM_024686chr1----1583 --
NM_024700chr131109 735 175 161 ----
NM_024740chr1163743 3622 3300 2838 2573 49 14042 163 --
NM_024744chr232337 1682 39 ------
NM_024755chr15164 --2348 88 --
NM_024757chr931117 728 303 --1800 --
NM_024761chr985256 5163 4936 4678 1458 254 134 81 --24554 1008 11297
NM_024770chr275019 4601 4511 2320 1202 656 413 15459 26477 5313 --
NM_024779chr1231429 362 266 ----1382
NM_024780chr163737 199 135 ------
NM_024812chr862101 1700 1522 822 486 160 11781 ----
NM_024834chr102288 185 1492 ----
NM_024835chr171119 187 ----
NM_024841chr1132391 1838 883 --1246 1267
NM_024874chr131326 1213 889 1526 ----
NM_024881chr1973396 3235 3094 3037 872 459 34 11065 23410 2641 --
NM_024884chr1411082 1992 34181 1233 917 1822
NM_024887chr13587 532 421 --21799 855 --
NM_024899chr182140 105 ------
NM_024906chr41986 1145 ----
NM_024920chr431535 301 239 --1155 --
NM_024939chr1651580 394 297 264 102 --11030 --
NM_024945chr921054 804 ------
NM_024947chr3119648 7460 7180 7095 6565 3757 2942 2756 2077 1117 616 28120 372 37654 3554 2835 --
NM_024948chr101102 ------
NM_024949chr484642 4101 3827 3506 1968 1700 1202 830 --14163 13335
NM_024953chr1272052 1998 1943 916 509 168 30 ------
NM_024969chr22826 675 --1770 --
NM_024989chr2147682 7157 6904 6676 5742 3280 3136 2745 2610 2337 1562 1367 1334 1110 1640 ----
NM_024991chr1051013 964 863 747 628 1937 ----
NM_024993chr251293 1218 1079 350 165 ------
NM_024997chr1621046 389 ------
NM_025054chr884096 2817 1281 740 720 714 592 234 21389 645 32978 2828 192 --
NM_025065chr11102 ------
NM_025074chr473085 3031 3023 2790 2683 1993 1195 1981 ----
NM_025076chr21557 ------
NM_025077chr1----1198 --
NM_025083chr1562052 1910 1706 1677 1340 600 ------
NM_025126chr122740 119 ------
NM_025134chr1672599 2100 767 698 577 343 34 12410 ----
NM_025146chr3164 12141 ----
NM_025147chr21271 --136 --
NM_025151chr842164 1829 801 38 ------
NM_025152chr1431315 577 141 ------
NM_025154chr741385 1200 995 241 --1367 --
NM_025160chr154317 4116 3629 1489 711 23888 767 ----
NM_025179chr183870 3697 1976 1936 1414 1100 747 446 14547 ----
NM_025180chr363425 3281 2927 2846 1093 619 ----1288
NM_025182chr91779 --1161 --
NM_025184chrX1324 1299 ----
NM_025187chr1651214 1077 496 396 258 ------
NM_025191chr163528 3015 2558 585 460 132 ------
NM_025195chr831601 535 163 --11899 --
NM_025222chr332045 1897 96 12267 ----
NM_025235chr1041419 749 559 299 --1152 --
NM_025248chr1761981 1249 1061 879 784 582 --22732 2039 --
NM_025250chr732949 2276 2101 ------
NM_030579chr1673583 2902 1425 1229 1085 578 438 1460 ----
NM_030594chr1541094 1064 231 96 ------
NM_030621chr1434021 3663 1614 ------
NM_030623chr21436 --11085 --
NM_030625chr1072598 2511 2455 2062 1812 1697 905 ------
NM_030627chr533141 1655 1110 12714 ----
NM_030629chr163513 105 56 11959 ----
NM_030634chr122353 700 131 ----
NM_030637chr14136 ------
NM_030647chr796159 5815 5773 5461 4900 4854 2480 1973 1100 13905 25820 1978 16029
NM_030648chr475172 4815 2164 1642 1443 1066 159 25105 3740 34893 4644 4254 1702
NM_030650chr233835 902 411 24022 3488 --11064
NM_030664chr101513 --12479 --
NM_030674chr1263904 3821 3655 2358 699 582 13675 --11721
NM_030751chr1041233 732 334 100 21175 298 11848 --
NM_030751chr1041233 732 334 100 21175 298 11848 --
NM_030755chr1462184 1165 921 633 597 86 22856 2509 ----
NM_030756chr102330 221 ------
NM_030786chr131796 1714 149 31775 1620 1393 ----
NM_030789chr201292 ------
NM_030791chr1421548 1450 ------
NM_030795chr81545 ------
NM_030799chr51115 11597 11410 --
NM_030806chr1139336 9224 6420 6268 5760 2836 2477 2059 1699 1478 1195 953 592 47141 6538 3202 2579 22283 2215 --
NM_030816chr133432 2515 906 ------
NM_030820chr63925 374 165 ------
NM_030881chr223560 265 23 11568 ----
NM_030885chr332290 1793 929 1334 ----
NM_030893chr11633 ----1599
NM_030918chr195005 4083 1983 1667 1624 627 497 243 147 13558 --11742
NM_030920chr141846 1608 490 210 ------
NM_030927chr1031619 1166 265 1311 ----
NM_030934chr111538 ----1366
NM_030937chr121269 991 --1591 --
NM_030949chr621107 234 1406 21312 577 --
NM_030953chr52368 148 31103 218 201 ----
NM_030959chr6238 22 ------
NM_030964chr583732 3185 2927 2758 2663 2291 1016 410 --22344 1164 --
NM_031203chr192234 162 ------
NM_031216chr1862238 2148 1866 1815 617 485 --12072 --
NM_031244chr631187 933 812 ------
NM_031262chr91815 ------
NM_031263chr91872 ------
NM_031266chr52479 158 ------
NM_031267chr71418 ------
NM_031268chr16145257 5100 4287 4082 3991 3896 3338 3287 2005 1874 1630 600 571 427 24433 1550 23645 912 21502 825
NM_031291chr41552 ------
NM_031296chr451676 947 886 679 34 ------
NM_031371chr121105 1089 --1135 --
NM_031371chr121105 1089 --1135 --
NM_031372chr421412 675 1205 ----
NM_031407chrX--1455 ----
NM_031424chr201544 --2403 175 --
NM_031426chr952601 2572 2029 1777 477 22707 973 2920 385 --
NM_031427chr1495901 4715 4537 4131 3661 2330 2230 1313 729 34546 4146 1537 ----
NM_031431chr1331598 1298 137 ------
NM_031438chr51383 ------
NM_031442chrX42831 2340 1096 207 ------
NM_031445chr262856 2602 1238 841 716 152 11372 ----
NM_031453chr1052453 2334 1804 1793 114 ----22222 1871
NM_031461chr852273 1682 1548 848 607 ------
NM_031468chr7127671 7606 7521 6558 5853 5313 5184 2984 2775 2764 2234 503 13102 36849 1345 460 21983 1195
NM_031483chr2073057 1378 1143 707 652 635 95 33217 3112 753 1501 --
NM_031492chr111168 ------
NM_031844chr1103064 2519 1605 1478 1368 1307 988 758 741 275 13360 12690 --
NM_031845chr263049 2721 689 441 212 185 ------
NM_031847chr263049 2721 689 441 212 185 ------
NM_031866chr103822 720 327 1168 --1425
NM_031890chr2232395 2332 2104 --32939 2161 879 --
NM_031892chrX1845 2697 219 ----
NM_031904chr1131797 1618 149 12144 11931 --
NM_031911chr441759 1107 950 35 ------
NM_031914chr143999 725 161 ------
NM_031936chr12204 89 ----1699
NM_031954chr1252611 2416 2150 1088 827 ------
NM_031992chr711669 --1623 --
NM_032012chr963658 1908 1177 931 816 282 11434 14818 13313
NM_032015chr11----1630 --
NM_032041chr862721 2076 1746 976 349 52 1608 ----
NM_032042chr52841 734 --1277 --
NM_032047chr332093 795 146 ------
NM_032088chr52713 491 --11663 --
NM_032092chr52713 491 --11663 --
NM_032102chr1163023 2796 2786 2029 1076 673 --1346 --
NM_032105chr1157561 7324 7015 6997 6131 6014 5520 5341 5264 5038 3123 2717 2269 805 579 12195 22967 705 --
NM_032109chr521487 201 ------
NM_032121chrX62815 2661 2614 2461 712 349 11094 ----
NM_032132chr13543 221 139 --1403 --
NM_032139chr1931141 1135 106 1807 ----
NM_032144chr221806 579 11853 ----
NM_032153chr352721 2632 2520 1069 853 --1962 --
NM_032156chr122290 85 ------
NM_032172chr7--141 ----
NM_032182chr102544 505 ------
NM_032186chr131345 1199 446 ------
NM_032189chr1374993 4582 4309 2038 1715 1613 551 ----14681
NM_032192chr17----2715 122 --
NM_032195chr211391 ------
NM_032199chr1073613 710 529 211 193 161 71 13067 21181 808 13098
NM_032205chr8156 ------
NM_032208chr232277 2227 782 ------
NM_032211chr1031135 1086 187 ------
NM_032217chr421018 106 ------
NM_032221chr203658 123 32 ------
NM_032228chr1132428 575 438 22491 233 23227 3214 --
NM_032229chr13139 ------
NM_032236chr12815 679 ------
NM_032268chr1633129 592 548 --2133 23 --
NM_032288chr331779 253 34 1229 ----
NM_032294chr1711358 --1558 1417
NM_032295chr73925 547 89 1442 31501 121 96 --
NM_032300chr1231348 1106 378 1118 ----
NM_032312chr23723 645 220 ------
NM_032325chr1161765 1555 1419 702 193 172 1141 31893 686 48 --
NM_032328chr1124 1320 ----
NM_032333chr103872 664 255 1278 ----
NM_032373chr1025047 1541 55658 3905 1770 350 280 --12359
NM_032403chr52713 491 --11663 --
NM_032412chr52236 79 ------
NM_032420chr52682 288 ------
NM_032424chr1121403 1348 --11560 --
NM_032430chr19----1455 --
NM_032434chr241626 423 171 114 ------
NM_032438chr62594 446 --11337 --
NM_032440chr1052758 2012 538 197 127 ------
NM_032445chr1542423 2202 772 72 1929 296 49 --
NM_032457chr4103722 3329 3245 2987 2901 2553 1381 767 427 345 --2230 172 --
NM_032458chrX63457 2483 2367 2283 824 181 13451 ----
NM_032468chr821231 615 --1415 --
NM_032471chr6--11117 1806 --
NM_032482chr1942401 2369 769 419 12476 --1241
NM_032491chr124906 343 304 242 ------
NM_032505chr352820 2598 652 584 367 ------
NM_032510chr1812524 1502 32232 1870 423 --
NM_032521chr2062649 2476 2362 2221 2039 1032 22297 942 1402 --
NM_032525chr18--1412 ----
NM_032536chr9----1465 --
NM_032538chr641958 1024 724 659 ----22479 1127
NM_032539chrX1720 ------
NM_032547chr421325 909 ------
NM_032558chr921377 72 ------
NM_032560chr1431111 310 132 ------
NM_032582chr1731375 503 48 --11869 --
NM_032595chr1751380 1311 1026 628 439 ------
NM_032622chr42310 169 11217 ----
NM_032632chr1421879 1588 ------
NM_032682chr313491 --12951 1310
NM_032711chr1733234 3159 1297 11114 --13192
NM_032727chr102664 53 1270 ----
NM_032777chr831428 425 232 ------
NM_032778chr352246 2212 900 351 306 22638 2152 ----
NM_032802chr15168 ------
NM_032804chr1042136 2104 816 433 --12445 --
NM_032810chr10--2547 301 ----
NM_032813chr131113 ------
NM_032818chr942471 2433 985 892 21861 192 ----
NM_032832chr631726 1174 232 ------
NM_032840chr1221039 954 --170 1135
NM_032842chr71239 21130 274 2357 81 --
NM_032867chr112523 27 ------
NM_032870chr6245 28 ------
NM_032873chr1174470 3070 1574 1458 1323 796 566 24368 178 ----
NM_032884chr1158 ------
NM_032885chr19------1253
NM_032900chr10103852 2996 2811 2683 2402 1526 1256 1008 985 846 1898 11380 --
NM_032924chr71753 --1917 --
NM_032932chr17116245 5596 4922 4853 4682 4196 4034 2251 2161 1076 344 24499 1278 26226 942 --
NM_032949chr132482 227 ------
NM_032960chr1--1266 11214 1458
NM_032961chr43947 891 390 11130 1933 --
NM_032968chrX64168 3564 2743 338 322 81 12912 --13697
NM_032969chrX64168 3564 2743 338 322 81 12912 --13697
NM_032973chrY64160 3560 2738 338 322 81 12907 --13689
NM_033012chr131830 ------
NM_033014chr911002 21076 464 --11530
NM_033020chr154576 1863 1398 283 276 23581 1795 23038 868 --
NM_033030chr2135 ------
NM_033031chrX1175 ------
NM_033044chr121210 381 ------
NM_033055chr1------1356
NM_033056chr10----1608 --
NM_033058chr81149 1266 157 --
NM_033067chr12667 589 --1124 --
NM_033089chr202462 182 --11271 --
NM_033103chr1931167 995 307 --149 --
NM_033121chr1221752 723 21699 1686 1550 --
NM_033133chr1782913 1323 1194 1027 838 804 492 461 1576 23260 860 12474
NM_033136chr551735 589 567 407 179 ----11179
NM_033137chr551735 589 567 407 179 ----11179
NM_033138chr742165 2122 1868 614 1571 12024 --
NM_033139chr742165 2122 1868 614 1571 12024 --
NM_033140chr742165 2122 1868 614 1571 12024 --
NM_033143chr421631 1332 13712 1646 --
NM_033157chr742165 2122 1868 614 1571 12024 --
NM_033161chr951885 1707 1572 1358 27 1173 11832 11289
NM_033181chr653634 3534 3399 2958 830 --21246 854 --
NM_033211chr53299 232 83 1355 1344 --
NM_033224chr757501 6944 5985 1422 1373 37033 5102 1304 15525 --
NM_033225chr843061 231 98 60 --12264 128
NM_033227chr5173 ------
NM_033274chr543072 1367 1135 553 1156 42995 2304 946 734 32946 2689 639
NM_033284chrY1117 ------
NM_033285chr864324 1737 1484 1228 1106 877 11038 ----
NM_033290chrX93753 3675 3540 2901 2889 2615 2430 1478 800 ------
NM_033300chr11280 ------
NM_033326chr1152278 2145 1700 160 91 --11705 --
NM_033331chr933179 499 291 1193 1703 12351
NM_033338chr102526 291 1125 ----
NM_033339chr102526 291 1125 ----
NM_033360chr1233004 1676 596 11643 ----
NM_033364chr311901 2400 110 --1706
NM_033375chr17----41198 551 473 386 --
NM_033380chrX3862 254 142 ----11113
NM_033381chrX3862 254 142 ----11113
NM_033389chr1784625 4346 3725 1801 1611 1461 803 23 --24231 3803 --
NM_033402chr8189 ------
NM_033425chr1143449 872 854 48 12675 12400 12451
NM_033426chr1432926 2694 151 1742 22778 616 --
NM_033429chr152763 310 33094 2181 409 1289 --
NM_033480chr632950 2224 232 ----21117 913
NM_033481chr632950 2224 232 ----21117 913
NM_033503chr1563338 2621 2464 1108 693 550 --1711 --
NM_033505chr286400 4168 2421 2087 1592 1243 1092 766 3905 809 289 12234 --
NM_033515chr621359 126 ------
NM_033516chr951481 1468 1261 1096 435 ------
NM_033540chr33996 950 302 ------
NM_033542chr2031609 628 342 --11443 --
NM_033632chr431466 438 244 11566 ----
NM_033637chr1064053 4044 3747 1043 1013 208 1338 ----
NM_033642chrX--1487 ----
NM_033644chr542510 2439 1706 51 --32175 512 178 12541
NM_033645chr542510 2439 1706 51 --32175 512 178 12541
NM_033655chr941069 682 165 72 ------
NM_033656chr2172123 2094 1826 1125 528 248 62 21808 1305 15132 --
NM_044472chr12701 287 1644 ----
NM_052818chr1352110 2079 1902 1724 507 11864 21841 1832 --
NM_052832chr81885 22577 132 ----
NM_052851chr131479 --22151 2126 1441
NM_052875chr1132154 1891 330 1140 1337 --
NM_052879chr1273714 3088 2700 893 822 690 475 --11126 --
NM_052880chr2221082 928 11468 ----
NM_052885chr1273183 1678 1573 291 167 118 67 --23652 627 --
NM_052897chr122336 33 ------
NM_052900chr841713 1478 1416 531 21648 1257 1412 --
NM_052904chr62209 43 ------
NM_052907chr1254255 4200 3454 1188 450 --11611 --
NM_052910chr1341571 524 492 423 ------
NM_052911chr181842 --163 --
NM_052913chr61809 --1733 --
NM_052918chr1023415 539 --11443 --
NM_052925chr191695 ------
NM_052937chr822147 851 --1291 --
NM_052950chr1331978 1780 249 11543 ----
NM_053002chr32889 426 ------
NM_053016chr977907 7102 6124 5135 1702 469 322 --1661 17668
NM_053023chr1162184 2104 872 740 669 501 --21303 432 --
NM_053024chr341507 1449 1028 442 ------
NM_053025chr33647 257 138 --2568 432 --
NM_053026chr33647 257 138 --2568 432 --
NM_053027chr33647 257 138 --2568 432 --
NM_053028chr33647 257 138 --2568 432 --
NM_053031chr33647 257 138 --2568 432 --
NM_053032chr33647 257 138 --2568 432 --
NM_053043chr7146125 6099 5852 5634 5603 5521 4893 4828 4271 4011 2329 2009 1883 1534 45996 4489 1855 334 45408 867 312 158 14617
NM_053046chr193435 69 42 --1103 --
NM_053056chr1122891 1976 12171 --1174
NM_053064chr141698 --1204 1191
NM_053067chr9186 ------
NM_053281chrX143 ------
NM_054016chr151678 1466 1387 1285 425 1502 ----
NM_054016chr151678 1466 1387 1285 425 1502 ----
NM_054016chr151678 1466 1387 1285 425 1502 ----
NM_054027chr521958 831 12022 1239 --
NM_057175chr472599 2259 1703 893 477 455 30 ------
NM_057749chr82440 138 --11029 --
NM_058172chr431804 572 57 11158 ----
NM_058229chr82169 44 ------
NM_058243chr19148 --124 --
NM_078469chr102494 113 ------
NM_078625chr641297 353 261 207 ------
NM_078626chr11226 --164 --
NM_080392chr1----175 --
NM_080415chr174947 829 205 98 --1674 --
NM_080546chr941688 786 751 307 ------
NM_080552chr202480 136 ------
NM_080591chr9102978 2930 1249 1027 467 440 419 391 383 168 41262 711 490 400 22217 2194 12201
NM_080599chr101290 ------
NM_080604chr62621 179 ----1515
NM_080617chr20----1380 --
NM_080629chr131041 538 236 --2457 229 --
NM_080630chr131041 538 236 --2457 229 --
NM_080632chrX2696 30 ------
NM_080645chr611492 ----1552
NM_080669chr1774013 3026 1730 1464 1276 1046 581 --53174 1581 1315 892 780 11052
NM_080671chr22441 27 11589 2253 133 --
NM_080672chr201532 ------
NM_080676chr2022492 780 12993 2719 33 11070
NM_080679chr61953 ------
NM_080680chr61953 ------
NM_080681chr61953 ------
NM_080717chr122576 198 ------
NM_080732chr193435 69 42 --1103 --
NM_080737chrX31329 384 176 --11085 --
NM_080738chr131346 1338 555 ------
NM_080743chr642466 2338 2026 354 11799 ----
NM_080764chr2231209 218 128 11185 22191 1152 --
NM_080840chr201530 ------
NM_080841chr201530 ------
NM_080862chr311296 --1110 --
NM_080867chr1444617 3298 1423 537 34394 1487 1187 14873 --
NM_080872chr823855 500 --1390 --
NM_080881chr52219 128 --2501 166 --
NM_080927chr32360 347 --32916 2573 566 22630 2254
NM_100264chr101602 ------
NM_100486chr101602 ------
NM_130386chr181208 ------
NM_130391chr933041 1131 222 ------
NM_130392chr933041 1131 222 ------
NM_130393chr933041 1131 222 ------
NM_130434chr153992 424 37 11131 ----
NM_130435chr1032945 2855 1821 ------
NM_130436chr2141985 1032 695 134 11938 ----
NM_130438chr2152562 2184 2170 1272 711 12515 ----
NM_130439chr1021550 1458 ------
NM_130439chr1021550 1458 ------
NM_130442chr7----1192 --
NM_130446chr354176 3503 3410 2643 1269 1130 32884 513 315 1846
NM_130463chr61338 --3581 288 21 --
NM_130468chr151706 1173 3789 280 88 --
NM_130809chr533163 2733 432 1733 12110 --
NM_130811chr202325 227 --1958 --
NM_130838chr1531469 1452 1265 ------
NM_130839chr1531469 1452 1265 ------
NM_133170chr2047978 6036 3227 3034 14929 45595 1397 290 113 --
NM_133264chr1773565 2835 1393 1121 1060 980 957 ----1864
NM_133265chrX43109 1260 1082 932 --12310 --
NM_133330chr442768 2503 949 845 --22464 415 --
NM_133331chr442768 2503 949 845 --22464 415 --
NM_133334chr495529 4322 4031 2144 1383 1219 1100 911 521 25168 2091 24367 2444 14203
NM_133335chr442768 2503 949 845 --22464 415 --
NM_133370chr453666 3148 2618 457 22 12417 1266 13483
NM_133372chr532667 1905 181 22238 369 ----
NM_133433chr5----1761 --
NM_133452chr1921134 201 --2479 419 --
NM_133486chrX--1462 ----
NM_133499chrX----1235 --
NM_133503chr121737 1123 ----
NM_133504chr121737 1123 ----
NM_133505chr121737 1123 ----
NM_133506chr121737 1123 ----
NM_133507chr122915 33 1301 ----
NM_133631chr321295 270 ------
NM_133638chr511424 11073 21417 1358 1370
NM_133646chr285469 1719 1432 1293 869 335 297 239 13800 14371 --
NM_134265chr171296 --171 1411
NM_138270chrX53293 1351 1077 501 423 173 1989 --
NM_138282chr61338 --3581 288 21 --
NM_138286chr1924254 1023 21178 870 12668 --
NM_138290chr72305 61 --1346 --
NM_138316chr10--2411 184 ----
NM_138333chr952640 2402 1988 1891 1857 1355 11736 --
NM_138335chr43762 333 208 --1196 --
NM_138353chr19----127 --
NM_138357chr1011323 11346 ----
NM_138376chr14--182 ----
NM_138409chr641397 1146 459 163 ------
NM_138410chr31578 ------
NM_138423chr1522132 1498 1479 172 --
NM_138426chr712045 --11822 --
NM_138444chr1384948 4652 3854 1416 1317 780 381 93 1439 --13200
NM_138459chr652806 685 614 361 58 1458 11294 --
NM_138473chr1274919 4196 3990 3435 3320 1515 1104 24146 1021 14227 --
NM_138492chr51980 ----1471
NM_138494chr732349 2278 734 12306 ----
NM_138555chr152389 375 ------
NM_138563chr194635 622 179 150 --1587 --
NM_138576chr1431038 500 373 13303 171 --
NM_138578chr2051275 1005 588 522 303 --11376 --
NM_138619chr1721474 216 --1260 --
NM_138620chr91117 ------
NM_138621chr294082 4009 3887 3743 3408 3016 2581 995 605 --13214 --
NM_138633chr621782 368 --173 --
NM_138638chr1411567 11615 12066 --
NM_138694chr693655 3337 2794 2415 1086 1073 753 537 278 ----1311
NM_138713chr16137769 7474 6801 6618 6334 5861 5437 3271 2878 1795 1019 916 138 27125 1269 47789 5561 2891 34 --
NM_138714chr16137769 7474 6801 6618 6334 5861 5437 3271 2878 1795 1019 916 138 27125 1269 47789 5561 2891 34 --
NM_138727chr152457 2168 2032 619 307 ------
NM_138728chr152457 2168 2032 619 307 ------
NM_138730chr61429 ------
NM_138731chr1444197 3469 1549 1495 --1181 --
NM_138736chr1644152 3251 1225 666 33050 675 329 23951 632 --
NM_138769chr161498 1560 1186 --
NM_138771chr721117 77 ------
NM_138782chr541776 554 185 125 ----1971
NM_138799chr221595 643 11843 11433 --
NM_138819chrX1416 1133 ----
NM_138927chr212918 746 ------
NM_138931chr3----1313 --
NM_138959chr1126436 6321 4776 4478 4433 2257 1327 1285 945 727 655 107 15095 2741 212 16177
NM_138966chr181557 ------
NM_138970chr1441921 821 422 300 ------
NM_138992chr211358 ------
NM_139012chr652174 1540 1468 524 219 1283 ----
NM_139015chr1231760 570 317 1544 ----
NM_139057chr1541110 1049 326 188 ------
NM_139072chr21659 --1866 --
NM_139135chr1163 ------
NM_139136chr12165 ------
NM_139168chr521684 139 ------
NM_139199chr5----122 --
NM_139207chr1222185 1419 1441 --1593
NM_139279chr262871 2858 2513 1342 1034 932 22365 497 13500 --
NM_139283chr121540 --12586 --
NM_139286chr92220 201 ------
NM_139312chr1021493 1260 1502 ----
NM_139316chr71809 ------
NM_139318chr141213 ------
NM_139320chr152311 122 --1641 1910
NM_139321chr2023713 921 --13933 23393 134
NM_144563chr22572 321 ------
NM_144563chr22572 321 ------
NM_144571chr426811 5185 11265 21107 466 --
NM_144578chr1444561 4154 3548 977 --14538 13472
NM_144582chr282611 2444 2362 2216 1687 994 852 109 1169 12381 --
NM_144586chr21190 ------
NM_144599chr1584818 3968 2107 854 694 634 536 108 23510 152 --13768
NM_144600chr1631404 322 188 ------
NM_144604chr16194 ------
NM_144617chr19----2875 69 --
NM_144628chr2033051 2693 2430 --11029 --
NM_144632chr232234 1812 1753 --1475 --
NM_144633chr32369 314 ------
NM_144641chr31393 ------
NM_144657chrX1499 1530 ----
NM_144664chr1112548 12409 ----
NM_144710chr2----1266 --
NM_144726chr521181 74 11135 ----
NM_144728chr13836 830 665 ------
NM_144729chr13836 830 665 ------
NM_144732chr191286 1998 ----
NM_144736chr23755 593 175 1301 ----
NM_144767chr1554582 4103 3001 1059 922 ------
NM_144775chr1784046 3954 3694 1986 1671 367 223 134 138 31971 893 179 --
NM_144778chr1342427 1029 1022 668 ------
NM_144949chr212185 11602 ----
NM_144967chrX----1404 --
NM_144973chr1295336 5005 4846 4806 4533 3508 1720 1579 854 33435 1646 296 13521 --
NM_144981chr11121 ------
NM_145011chr1021668 25 ------
NM_145012chr102683 380 ------
NM_145021chr102864 773 1565 ----
NM_145037chr311084 31122 207 141 ----
NM_145049chr52407 356 ----1821
NM_145055chr1843254 1408 589 274 --12801 12429
NM_145058chr123416 177 29 --135 --
NM_145074chr2256 36 --1132 --
NM_145112chr1441240 1201 1113 975 ------
NM_145113chr1441512 1473 1385 1247 ------
NM_145117chr1162598 2460 2446 2273 700 80 23317 2488 ----
NM_145119chrX2127 30 ------
NM_145165chr141659 11849 1338 --
NM_145166chr331071 824 231 --11076 22799 1932
NM_145203chr13138 --1154 1892
NM_145204chr152468 181 --1640 --
NM_145206chr1033192 933 678 1574 ----
NM_145207chr453948 3486 1673 1564 1288 1766 11572 11832
NM_145239chr1611178 ------
NM_145251chr1421417 1152 ------
NM_145259chr276446 6399 5817 5747 4428 2563 180 --26294 6063 --
NM_145279chr121839 1804 --1769 --
NM_145284chrX3709 424 244 22455 2161 ----
NM_145307chr1033959 755 181 --22995 499 24313 3905
NM_145313chr1021596 61 --11045 --
NM_145320chr763463 3111 2235 953 925 188 ------
NM_145321chr763463 3111 2235 953 925 188 ------
NM_145322chr763463 3111 2235 953 925 188 ------
NM_145331chr63843 763 219 ------
NM_145332chr64991 911 367 151 ------
NM_145333chr64991 911 367 151 ------
NM_145341chr1041389 658 531 309 11446 ----
NM_145644chr21373 --153 --
NM_145686chr243193 2525 1073 340 ------
NM_145687chr243193 2525 1073 340 ------
NM_145690chr81519 --11565 --
NM_145698chr1031723 1375 314 ------
NM_145727chr63476 182 134 --1340 --
NM_145728chr1552460 2035 1928 1882 942 ------
NM_145733chr2221030 934 ------
NM_145802chrX------1196
NM_145808chr752101 986 673 549 36 --22938 354 --
NM_145859chr3177 ------
NM_145860chr3177 ------
NM_145861chr131346 1338 555 ------
NM_147150chr953606 3378 3361 1400 548 22594 231 --12516
NM_147156chr101471 1119 ----
NM_147164chr9------1549
NM_147166chr71582 ------
NM_147175chrX62165 2049 1693 1518 1451 484 ------
NM_147188chr154510 356 236 195 ------
NM_147189chr882227 2169 1629 1602 724 358 189 159 11898 ----
NM_147223chr241972 1501 936 177 --11555 12126
NM_147233chr221789 753 ----11943
NM_148174chr852179 1856 1421 689 424 1276 ----
NM_148177chr82169 44 ------
NM_148894chr421190 967 ------
NM_148898chr72308 243 ------
NM_148899chr72308 243 ------
NM_148904chr11204 ------
NM_148905chr11204 ------
NM_148906chr11204 ------
NM_148907chr11204 ------
NM_148908chr11204 ------
NM_148909chr11204 ------
NM_148911chr152311 122 --1641 1910
NM_148921chr1762413 2161 2131 732 583 481 ------
NM_148955chr1545973 5609 1217 906 32088 1700 400 25534 1373 --
NM_148977chr10--2411 184 ----
NM_148978chr10--2411 184 ----
NM_152238chr12309 238 ------
NM_152261chr122291 137 ------
NM_152280chr163208 3170 2982 1098 715 328 --13011 12426
NM_152300chr1721448 328 ------
NM_152313chr11--1639 1788 --
NM_152332chr1452085 1878 1063 914 445 ------
NM_152344chr1761389 1263 441 434 210 109 --1319 --
NM_152345chr17----41147 900 725 244 --
NM_152347chr172542 65 ----1381
NM_152388chr233138 1051 461 --13034 12504
NM_152407chr542991 2271 2070 787 13020 23084 976 12856
NM_152409chr513478 1918 12784 --
NM_152410chr62400 87 ------
NM_152414chr821432 512 1545 ----
NM_152415chr81146 ------
NM_152417chr82937 354 --1875 --
NM_152422chr931423 1158 243 ------
NM_152424chrX84583 4256 3783 3531 1878 1769 1058 513 13743 14291 --
NM_152437chr1242019 1812 217 179 1600 ----
NM_152470chr1844151 3235 1340 220 --21353 1267 --
NM_152510chr22--2882 768 1616 --
NM_152529chr263995 3516 3146 2710 1123 854 21206 361 --1204
NM_152556chr742042 2024 1725 336 2398 204 ----
NM_152557chr711318 --1424 --
NM_152581chrX21455 510 11179 --1422
NM_152589chr12155 ------
NM_152609chr121204 1124 ------
NM_152622chr553448 3313 2437 2366 2226 ------
NM_152624chr547401 6488 4756 1638 57168 6811 6287 4641 2230 16112 --
NM_152625chr5--1320 ----
NM_152629chr983259 3186 1141 1030 911 859 352 289 --11631 --
NM_152638chr1241169 219 78 39 ------
NM_152640chr12124 ------
NM_152641chr1232619 1801 920 ------
NM_152653chr31683 ------
NM_152660chr13954 765 68 ------
NM_152680chr441763 1655 446 218 --12305 --
NM_152692chrX2443 323 ------
NM_152721chr18123 1168 ----
NM_152733chr696526 6325 6317 4572 4186 2495 1114 85 26 --34886 4613 1773 --
NM_152737chr61137 ------
NM_152739chr721158 953 --1178 1325
NM_152745chr72301 127 ----1331
NM_152749chr72971 377 ------
NM_152754chr793297 3085 2933 2666 2590 2347 1509 871 642 13613 ----
NM_152756chr544136 1606 1345 85 23688 221 1161 --
NM_152758chr842456 2032 862 136 ------
NM_152763chr11103 --1185 --
NM_152780chrX11132 --1322 --
NM_152787chrX42925 2750 2649 2466 33672 1347 699 ----
NM_152789chr73601 368 289 ------
NM_152793chr763819 3648 1845 1743 1459 278 --2320 112 --
NM_152826chr1545973 5609 1217 906 32088 1700 400 25534 1373 --
NM_152835chr122929 1097 1787 ----
NM_152836chr821754 560 ----1645
NM_152837chr821754 560 ----1645
NM_152838chr2032756 2694 147 1594 ----
NM_152874chr104668 528 435 43 1324 --11046
NM_152878chr22--31368 1234 408 --11553
NM_152890chr12358 299 ------
NM_152896chr91580 ------
NM_152902chr12378 37 11793 1417 --
NM_152913chr74982 326 309 39 --147 --
NM_152914chr1794334 3670 3068 2725 1404 1385 1114 989 889 --11373 11132
NM_152924chr1556826 2427 1885 1576 720 36896 5396 2457 26565 938 1663
NM_152989chr1241567 1157 144 99 ------
NM_152999chr754571 4329 3317 1837 61 13771 --1134
NM_153020chr641659 1382 1258 464 190 ----
NM_153029chr1664042 4023 3804 3617 3003 39 --22865 835 12790
NM_153038chr23732 647 111 ------
NM_153042chr621468 1220 ------
NM_153047chr61124 ----1371
NM_153048chr61124 ----1371
NM_153181chr181557 ------
NM_153182chr352246 2212 900 351 306 22638 2152 ----
NM_153183chrX21108 436 ------
NM_153186chr91566 ------
NM_153188chr535690 4807 3898 ----1887
NM_153235chr632190 668 187 11932 ----
NM_153251chr13--2212 193 ----
NM_153262chr142493 2066 850 412 12863 ----
NM_153267chr92777 116 ----1160
NM_153273chr352684 780 523 356 221 ----12521
NM_153321chr1721085 997 ------
NM_153322chr1721085 997 ------
NM_153331chr32584 58 ------
NM_153347chr11----1351 22519 902
NM_153354chr54933 813 333 282 ------
NM_153362chr631017 962 319 ------
NM_153365chr441802 812 205 163 ------
NM_153367chr1033393 1387 373 11572 ----
NM_153371chr1332074 1735 818 --11815 --
NM_153374chr152354 173 ------
NM_153426chr41254 ------
NM_153427chr41254 ------
NM_153456chr13115344 5330 5245 4943 4278 2138 1891 1736 1343 102 52 1537 14844 --
NM_153498chr101211 1583 1197 --
NM_153499chr1272587 2225 1884 1169 551 309 282 ------
NM_153500chr1272587 2225 1884 1169 551 309 282 ------
NM_153607chr543195 2686 1248 833 ------
NM_153616chr1511649 ------
NM_153617chr1511649 ------
NM_153618chr1511649 ------
NM_153619chr1542887 885 640 217 ------
NM_153633chr12163 ------
NM_153634chr1211397 11046 ----
NM_153646chr1452564 2246 2188 1997 1587 --1486 --
NM_153647chr1452564 2246 2188 1997 1587 --1486 --
NM_153648chr1452564 2246 2188 1997 1587 --1486 --
NM_153649chr141453 826 542 394 --12129 --
NM_153686chr462366 2218 2099 1924 931 756 --12397 --
NM_153689chr231789 1552 336 1505 ----
NM_153712chr253651 3502 2713 2551 2349 32893 1373 760 12443 --
NM_153715chr71282 --1167 --
NM_153748chr12165 ------
NM_153757chr41187 ------
NM_153759chr21203 ------
NM_153810chr1075041 4622 4570 4170 3708 3396 3135 --15035 --
NM_153816chr61362 ------
NM_153827chr171508 ------
NM_153828chr22758 173 ------
NM_153831chr81833 ------
NM_170606chr74603 544 139 111 ------
NM_170607chr1731240 1041 195 ------
NM_170662chr31544 ------
NM_170663chr171508 ------
NM_170665chr1284524 4035 3800 3458 3150 1508 1488 104 --1152 --
NM_170674chr151512 ------
NM_170675chr151188 ------
NM_170676chr151188 ------
NM_170677chr151512 ------
NM_170706chr1197 23170 3061 21648 428 1119
NM_170721chr172843 433 11047 ----
NM_170750chrX1282 ------
NM_170751chr6----11165 --
NM_170752chr6----11165 --
NM_171825chr532881 2307 2258 --12369 11116
NM_172016chr621403 197 --1337 --
NM_172037chr821506 477 ------
NM_172069chr241939 1850 674 150 ------
NM_172070chr231577 825 293 ------
NM_172071chr1117102 6840 6383 6241 5678 2635 2470 2034 1687 1323 1041 47418 5075 2721 2449 --37331 6019 778
NM_172103chr62752 517 166 42394 533 403 79 --
NM_172105chr62752 517 166 42394 533 403 79 --
NM_172127chr432101 1316 552 11449 ----
NM_172128chr442057 1272 832 508 11405 ----
NM_172206chr1711358 --1558 1417
NM_172216chr1262489 2127 1071 453 211 184 ------
NM_172217chr1541285 1256 1150 313 1353 166 12501
NM_172226chr1272587 2225 1884 1169 551 309 282 ------
NM_172232chr171739 --1732 --
NM_172240chr121455 ------
NM_172315chr151512 ------
NM_172316chr151512 ------
NM_172337chr141244 ------
NM_172373chr1361027 481 471 409 134 67 --2321 72 --
NM_172375chr1411147 ------
NM_173054chr71766 1182 ----
NM_173060chr53454 193 63 11271 21279 808 --
NM_173061chr53454 193 63 11271 21279 808 --
NM_173063chr53454 193 63 11271 21279 808 --
NM_173075chr431728 734 43 ------
NM_173078chrX163 ------
NM_173082chr611131 1169 11349 --
NM_173156chr12808 428 --22052 1940 --
NM_173157chr123515 507 114 --1394 --
NM_173171chr231237 1017 224 ------
NM_173172chr261545 1325 1000 532 132 41 ------
NM_173173chr231237 1017 224 ------
NM_173191chr1031301 877 420 11102 ----
NM_173192chr1031301 877 420 11102 ----
NM_173193chr1031301 877 420 11102 ----
NM_173194chr1031301 877 420 11102 ----
NM_173195chr1031301 877 420 11102 ----
NM_173198chr932785 933 816 --1152 --
NM_173200chr932785 933 816 --1152 --
NM_173214chr16137769 7474 6801 6618 6334 5861 5437 3271 2878 1795 1019 916 138 27125 1269 47789 5561 2891 34 --
NM_173354chr2152090 1586 869 683 457 --31803 838 34 --
NM_173359chr361804 1783 1217 484 275 37 11717 11232 --
NM_173468chr4105429 5278 5063 4999 4769 4251 1975 1686 1356 148 11887 11249 14871
NM_173469chr1521342 1265 ----1994
NM_173470chrX52594 2312 2004 542 500 ----1850
NM_173491chr541065 490 237 98 ----11390
NM_173495chrX42592 2439 775 384 21717 623 ----
NM_173510chr224719 597 585 167 21898 292 ----
NM_173513chr2191 1213 145 --
NM_173517chr71129 ------
NM_173519chr821847 646 11934 ----
NM_173532chr1----1150 --
NM_173552chr3146 1835 11857 --
NM_173554chr101298 ------
NM_173560chr61517 ------
NM_173561chr621338 88 --1929 --
NM_173576chr1032115 628 91 11927 ----
NM_173582chr1186137 5508 5067 4619 1939 1170 842 151 55988 5109 1602 1251 204 24569 1153 --
NM_173595chr1264613 4415 3805 3552 3263 287 --64172 4026 2084 825 667 272 --
NM_173602chr1253751 2481 526 493 63 13258 33821 2803 1323 --
NM_173609chr152713 624 --1240 --
NM_173624chr17127 ------
NM_173642chr1159050 8975 8643 8592 6332 6309 5955 5600 5573 3583 2794 2662 2397 604 333 16029 2300 282 --
NM_173648chr2172 1106 ----
NM_173653chr32489 230 21453 1026 ----
NM_173681chr741858 1316 526 426 ------
NM_173683chr831640 640 409 ------
NM_173698chrX32037 1849 542 ----11274
NM_173797chr511287 1544 ----
NM_173807chr11471 --141 --
NM_173808chr144497 3881 569 368 13726 13913 --
NM_173809chr1011422 11145 ----
NM_173814chr152602 409 122 ----
NM_173822chr21488 11530 ----
NM_173825chr343018 2144 2077 1195 22472 583 11169 22625 2394
NM_173827chr422829 2230 2674 161 ----
NM_173829chr575916 5522 4195 3894 1885 875 560 12064 11482 14201
NM_173851chr853935 3839 3241 1575 453 ------
NM_173852chr1126 ------
NM_173854chr132289 2229 792 --1610 --
NM_174902chr1121656 644 --145 --
NM_174909chr5158 ------
NM_174911chr823241 2600 13703 21364 705 13661
NM_174916chr1552080 1869 1650 796 702 11881 21736 1691 22298 56
NM_174934chr1153408 3380 3220 2400 975 1110 13542 --
NM_174936chr121236 327 --1859 11019
NM_175061chr7149 ----1657
NM_175607chr321142 1099 ------
NM_175611chr211114 ------
NM_175612chr321142 1099 ------
NM_175629chr21203 ------
NM_175736chr12117390 6095 5685 5507 5271 5154 2964 1827 1787 1325 220 --76397 6046 5234 4941 4741 2517 892 12587
NM_175748chr1432008 1975 711 1195 1170 --
NM_175767chr53676 189 35 --11890 --
NM_175863chr631290 347 58 ------
NM_175902chr171297 ------
NM_175907chr1822770 577 --11012 --
NM_175921chr583791 3678 2676 1473 1100 1040 908 196 ------
NM_176801chr451747 1553 1444 626 348 --1395 --
NM_176812chr201488 --1299 --
NM_176814chr741288 979 926 154 ------
NM_176863chr17193 1510 --21316 40
NM_176871chr873269 3101 2906 2298 2067 502 106 1152 12653 --
NM_177414chr12466 114 ------
NM_177424chr12251 190 11623 ----
NM_177438chr1434021 3663 1614 ------
NM_177531chr81188 ------
NM_177559chr201172 --1973 --
NM_177560chr201172 --1973 --
NM_177937chr941107 1029 530 466 11018 31188 494 312 --
NM_177947chrX11641 ------
NM_177948chrX11641 ------
NM_177952chr141169 ------
NM_177968chr221426 31 21912 1745 ----
NM_177969chr21182 ------
NM_177972chr1164462 4280 3494 1422 902 625 --22783 157 --
NM_177974chr1522132 1498 1479 172 --
NM_177989chr31323 --1152 -