TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5704
miRNA Sequence: UUAGGCCAUCAUCCCAUUAUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51300 ------
NM_000038chr51175 ------
NM_000051chr1132619 1150 178 ----13358
NM_000053chr133775 610 212 --1182 --
NM_000084chrX55879 5293 4318 2135 1276 ----26931 5749
NM_000088chr1721143 335 ------
NM_000089chr71324 ------
NM_000092chr234529 3461 257 --13900 --
NM_000093chr921947 625 ------
NM_000104chr21398 --12409 --
NM_000109chrX2820 557 --1833 --
NM_000110chr1----11108 --
NM_000112chr535121 1983 1885 24285 2112 14136 --
NM_000125chr663703 3005 1364 694 353 121 --13319 --
NM_000129chr62354 38 --11286 11473
NM_000138chr1532517 2411 928 11816 11025 --
NM_000141chr1031116 1049 495 ------
NM_000143chr1--1163 ----
NM_000163chr521720 360 ------
NM_000165chr61127 1527 ----
NM_000167chrX------1154
NM_000168chr712426 12095 ----
NM_000189chr242237 1489 927 99 ----11568
NM_000214chr2031538 1364 291 --1135 --
NM_000216chrX33886 3805 242 13372 ----
NM_000217chr123797 779 735 --11121 1264
NM_000222chr431941 369 52 1486 --11918
NM_000232chr452586 2537 2501 2262 2188 --21293 137 --
NM_000237chr821832 1697 --1618 --
NM_000248chr31879 ------
NM_000252chrX1993 1321 11306 --
NM_000259chr1514606 --25479 1752 --
NM_000266chrX122 --1925 --
NM_000267chr171717 13303 ----
NM_000271chr181531 ------
NM_000276chrX4610 366 337 94 ------
NM_000291chrX1686 ------
NM_000304chr171958 ------
NM_000321chr1331596 1437 331 ----11132
NM_000330chrX42109 2053 1591 412 ------
NM_000332chr654609 2845 1881 1707 1161 1675 25328 2595 --
NM_000333chr32720 254 --1961 --
NM_000334chr1731834 1462 408 --2355 301 21570 826
NM_000337chr576308 5798 5651 4824 4131 1660 51 12024 35884 1591 599 2859 806
NM_000338chr1511102 --1275 --
NM_000345chr41240 --1859 --
NM_000362chr2233201 1334 140 --11298 --
NM_000378chr113959 858 180 ------
NM_000386chr172662 621 ------
NM_000390chrX52388 2361 2186 316 49 ------
NM_000391chr113450 415 26 ------
NM_000393chr22150 136 --11699 --
NM_000399chr101471 ------
NM_000406chr422518 537 1377 ----
NM_000408chr212711 --13238 --
NM_000429chr1051680 1576 1263 403 21 11381 21660 1396 --
NM_000430chr1743015 1121 702 383 1259 ----
NM_000439chr552534 1725 1608 1558 720 1474 ----
NM_000461chr354069 3938 3252 521 445 ------
NM_000484chr212751 215 ------
NM_000489chrX23014 1078 ------
NM_000499chr156740 600 375 273 42 23 --173 183
NM_000533chrX2703 472 ------
NM_000554chr1943299 1205 965 656 12296 ----
NM_000555chrX65483 5253 5149 5135 4785 1605 12129 14864 --
NM_000587chr52827 340 11241 ----
NM_000599chr283976 3740 3528 3502 3389 3375 3084 3064 --1425 --
NM_000600chr71317 ------
NM_000611chr1196473 6454 5402 4758 2709 2320 2301 1899 735 25718 4999 25416 1756 11532
NM_000612chr1142675 394 358 234 13233 1546 23404 2797
NM_000615chr1152410 2214 2026 1921 1143 ------
NM_000633chr1883415 3251 1357 1150 1075 1042 1009 449 13308 11863 1568
NM_000693chr1541780 1489 1388 720 ------
NM_000720chr32437 31 ------
NM_000721chr162344 1650 729 630 517 291 --1349 --
NM_000738chr113936 881 109 1349 ----
NM_000756chr81332 ------
NM_000767chr1921249 434 ------
NM_000793chr1421124 1068 14039 34171 3608 97 --
NM_000801chr202988 716 ------
NM_000806chr5--21692 585 ----
NM_000813chr5----2832 128 14044
NM_000814chr1523600 556 1883 ----
NM_000817chr2----1270 --
NM_000826chr432586 2021 586 ------
NM_000827chr552432 2235 1788 1676 907 --12152 --
NM_000831chr176070 5758 5013 4151 1153 1012 29 ------
NM_000839chr31489 ------
NM_000841chr62732 122 ------
NM_000844chr3--1192 ----
NM_000859chr511139 --1529 --
NM_000865chr61202 ------
NM_000875chr1586116 6107 5953 5124 4654 4470 4413 1914 --14424 --
NM_000876chr621351 1082 ------
NM_000895chr121106 ------
NM_000899chr1243690 3363 1632 418 ------
NM_000901chr432259 1696 671 --12172 --
NM_000919chr51156 ------
NM_000921chr12----1443 --
NM_000926chr1187881 7166 6675 6660 3400 2497 2373 2129 --28039 7957 1773
NM_000933chr2031563 1193 451 ------
NM_000944chr431776 968 816 ------
NM_000945chr23763 375 266 --11726 --
NM_001001132chr211272 ------
NM_001001323chr1223030 2570 ------
NM_001001331chr352475 1985 498 465 232 --12431 --
NM_001001342chr1041412 1401 1154 1037 ------
NM_001001344chrX22443 519 ------
NM_001001394chr2------1687
NM_001001396chr144166 3964 3900 795 --13206 --
NM_001001433chr2033027 2680 1290 --22432 63 --
NM_001001481chr832656 2521 425 11137 ----
NM_001001484chr1021664 622 ------
NM_001001523chr151237 1197 1191 168 148 --21084 37 --
NM_001001549chr732227 822 283 --12686 --
NM_001001550chr732227 822 283 --12686 --
NM_001001555chr732227 822 283 --12686 --
NM_001001664chr212839 --23452 589 --
NM_001001890chr2113925 ------
NM_001001924chr811374 ------
NM_001001925chr811374 ------
NM_001001931chr811374 ------
NM_001002257chr243521 3244 2466 970 ------
NM_001002265chr102276 127 ------
NM_001002266chr102276 127 ------
NM_001002295chr10------1871
NM_001002860chr1424715 3055 ------
NM_001002862chr2242246 1782 218 160 123 ----
NM_001002909chr172424 136 ------
NM_001002914chr1751040 1021 963 800 419 --2448 443 1454
NM_001003679chr11274 ----1629
NM_001003694chr31105 ------
NM_001003712chr1232747 1018 76 --149 --
NM_001003760chr61149 --11393 --
NM_001003792chr33196 185 71 --11168 --
NM_001003793chr33196 185 71 --11168 --
NM_001003794chr3122984 2638 2587 1908 1096 1090 1084 623 437 79 65 30 12175 ----
NM_001003800chr953737 3529 3208 2929 478 --1712 --
NM_001003927chr17135 ------
NM_001003937chr251676 1450 1283 471 326 --1413 --
NM_001003940chr1553801 2937 2720 1091 776 --33369 2949 2484 12531
NM_001003942chr1553801 2937 2720 1091 776 --33369 2949 2484 12531
NM_001003943chr1553805 2941 2724 1095 780 --33373 2953 2488 12535
NM_001004065chr953383 3198 2734 2713 1401 ------
NM_001004127chr131248 ------
NM_001004128chr14500 477 257 47 ------
NM_001004196chr31950 --21121 39 --
NM_001004304chr1242957 2724 600 67 ------
NM_001004308chrX21485 428 --1452 --
NM_001004317chr644144 3108 1560 820 ----14052
NM_001004342chr1136019 5381 5269 4889 4803 4520 3812 2433 2166 2041 1725 640 379 ------
NM_001005209chr24731 524 84 57 --1122 1164
NM_001005242chr123258 245 229 ------
NM_001005266chr152756 617 ------
NM_001005267chr152756 617 ------
NM_001005268chr152756 617 ------
NM_001005269chr152756 617 ------
NM_001005290chr12450 105 --1420 --
NM_001005375chrY31464 1391 1368 ------
NM_001005386chr221870 602 --1760 --
NM_001005404chr1761803 1096 804 636 339 219 11251 ----
NM_001005463chr1052309 2288 1743 1026 814 11625 ----
NM_001005473chr525041 1436 ----11758
NM_001005505chr351458 1359 698 524 143 11624 ----
NM_001005781chr2199 ------
NM_001005845chr821833 30 ------
NM_001005914chr31163 ------
NM_001006600chr51477 ------
NM_001006610chr1611007 ------
NM_001006617chr91217 ------
NM_001006619chr91217 ------
NM_001006620chr91217 ------
NM_001006621chr91217 ------
NM_001006634chr163509 212 140 ------
NM_001006657chr2----1976 22231 1169
NM_001006665chr12801 578 ------
NM_001006684chrX1174 ------
NM_001006946chr241619 709 353 83 1491 ----
NM_001007023chr1421124 1068 14039 34171 3608 97 --
NM_001007024chr1753729 3277 2761 736 50 ------
NM_001007025chr1753729 3277 2761 736 50 ------
NM_001007097chr944563 3636 1387 992 --21012 92 --
NM_001007099chr12585 246 ------
NM_001007100chr12585 246 ------
NM_001007156chr1521775 234 11214 ----
NM_001007257chr11160 ------
NM_001007271chr102762 396 ------
NM_001007466chr634517 3255 1638 13164 24493 974 --
NM_001007527chr51513 ------
NM_001007538chr1331746 631 115 --11476 --
NM_001007559chr1821832 535 ------
NM_001007565chr32330 45 ------
NM_001008222chrX4949 337 265 121 ------
NM_001008239chr1833733 927 869 --11295 --
NM_001008388chr42407 57 ------
NM_001008495chr851618 914 884 744 51 --1230 --
NM_001008529chr1731302 1088 1067 --11269 --
NM_001008564chr1331875 826 379 ------
NM_001008660chr1111385 ------
NM_001008701chr1952972 2825 2572 2151 2046 22171 172 22380 1045 --
NM_001008738chr542668 2503 2016 168 ------
NM_001008777chr171637 ------
NM_001008895chr1311458 ----11344
NM_001008938chr11284 73 ------
NM_001009185chr5------1676
NM_001009552chr8147 ------
NM_001009555chr421733 1418 1636 ----
NM_001009567chr102688 113 ------
NM_001009880chr22124732 4349 4275 3425 3315 3170 3136 1101 1039 1028 558 352 11592 ----
NM_001009881chr1----129 --
NM_001009882chr1----129 --
NM_001009909chr1133325 2594 253 --13951 --
NM_001009958chr71232 ------
NM_001009993chr274065 3774 3632 3255 3077 1559 190 13000 23889 3708 --
NM_001010861chr111071 ----1731
NM_001010867chr1145570 5467 5364 5012 2333 2194 1742 1477 1449 1113 919 804 58 45 11258 21629 500 --
NM_001010891chr576435 6015 5111 4983 2714 661 422 ------
NM_001010986chrX21976 223 --11953 --
NM_001011513chr443926 3179 1096 166 ------
NM_001011545chr211207 ------
NM_001011666chr752354 1554 1031 121 22 ------
NM_001011708chr21339 ----11094
NM_001011713chr1411065 ------
NM_001012329chr172335 2270 2108 1508 871 636 328 1724 --1202
NM_001012398chr16--1254 150 --
NM_001012420chr1532001 821 184 ------
NM_001012423chr1532001 821 184 ------
NM_001012426chr6113279 3220 3177 2904 2850 2535 1041 817 733 368 209 --1522 --
NM_001012427chr6113279 3220 3177 2904 2850 2535 1041 817 733 368 209 --1522 --
NM_001012756chr1952894 2714 2676 2549 285 12760 11134 --
NM_001012977chrX11360 ------
NM_001012989chrX1638 ------
NM_001013399chr6----11110 --
NM_001013415chr41127 ------
NM_001013438chr31627 ------
NM_001013620chr1258384 6003 5965 3039 2102 --21671 943 --
NM_001013690chr1262488 2358 1864 1556 677 542 --11874 --
NM_001014380chr1335708 5164 4310 13750 13729 --
NM_001014797chr1067316 6468 5354 2775 2254 2023 --18027 --
NM_001014809chr42688 650 ----1811
NM_001014839chr12878 131 --1790 --
NM_001014841chr12878 131 --1790 --
NM_001015053chr1741506 1152 575 160 11324 1613 --
NM_001015877chrX23040 1205 ------
NM_001015881chrX31119 275 217 ------
NM_001015887chr331550 1281 1272 1470 ----
NM_001017371chr211223 ------
NM_001017395chr343182 2543 527 318 --22888 1114 12736
NM_001017415chr11115 ------
NM_001017416chr11115 ------
NM_001017424chr11368 ------
NM_001017425chr11368 ------
NM_001017916chr1741944 1597 632 388 11478 11433 --
NM_001017917chr1741944 1597 632 388 11478 11433 --
NM_001017923chr141255 --1508 --
NM_001017926chr851596 1438 1426 1223 553 11750 ----
NM_001017989chr195963 851 804 784 21 --166 --
NM_001017992chr521452 25 ------
NM_001017995chr594393 1919 1332 1111 1021 620 463 378 45 23986 184 14013 13766
NM_001017999chr12726 521 11680 ----
NM_001017999chr12726 521 11680 ----
NM_001018000chr12726 521 11680 ----
NM_001018000chr12726 521 11680 ----
NM_001018001chr12726 521 11680 ----
NM_001018054chr11905 ----11337
NM_001018057chr112307 128 ------
NM_001018064chr92818 326 --12109 1580
NM_001018065chr945757 4765 4655 305 2997 667 11492 --
NM_001018066chr945757 4765 4655 305 2997 667 11492 --
NM_001018067chr1----14276 25037 3476
NM_001018068chr1----14276 25037 3476
NM_001018069chr1----14276 25037 3476
NM_001018090chr152841 245 ------
NM_001018091chr152951 355 ------
NM_001018102chr152841 245 ------
NM_001018111chr743843 3585 1614 1297 1739 11377 --
NM_001024024chr14--1815 1176 --
NM_001024070chr14--1811 1172 --
NM_001024226chr12350 307 --11062 --
NM_001024227chr12350 307 --11062 --
NM_001024228chr12350 307 --11062 --
NM_001024649chr53794 777 725 ----1335
NM_001024660chr321103 364 ------
NM_001024688chr841785 1444 703 578 ----1121
NM_001024847chr312227 ------
NM_001024858chr1472832 2824 2645 1848 733 264 66 --12226 --
NM_001024934chr6----1192 --
NM_001024935chr6----1192 --
NM_001024936chr6----1192 --
NM_001024959chr32211 25 ------
NM_001024960chr32211 25 ------
NM_001025076chr1056225 5093 2242 1253 976 ------
NM_001025077chr1077583 6451 4977 4865 2611 2334 830 --1501 --
NM_001025079chr342645 415 325 79 --1796 --
NM_001025108chr252970 2938 1487 1445 35 --13008 --
NM_001025201chr21707 ------
NM_001025266chr374272 3928 3699 3018 1795 877 542 --14040 11449
NM_001025579chr17134 ------
NM_001025580chrX34189 3348 3163 --174 --
NM_001025595chr411479 ------
NM_001025616chr421516 396 ------
NM_001025780chr921160 1127 ------
NM_001029863chr6------12290
NM_001029882chr1146 ------
NM_001029882chr1146 ------
NM_001029884chr652385 2377 2036 1712 661 --1731 --
NM_001029989chr151610 ------
NM_001030006chr171284 ------
NM_001030007chr1663584 2480 1597 1303 1083 323 ------
NM_001030055chr1433933 1148 789 ------
NM_001031623chr631303 703 33 ------
NM_001031679chr1242308 419 332 283 22779 546 --11197
NM_001031680chr141645 838 654 114 --11888 --
NM_001031684chr231443 1323 189 ------
NM_001031690chr74674 590 196 173 --33076 2440 1960 --
NM_001031695chr2235381 501 51 --11615 --
NM_001031716chr2--1358 ----
NM_001031732chr463227 2794 1295 1281 926 681 12270 --32813 2236 1403
NM_001031804chr1663818 3459 2690 1430 1039 827 12801 ----
NM_001032282chr8138 1106 1898 --
NM_001032283chr122870 32 --1999 --
NM_001032284chr122870 32 --1999 --
NM_001032293chr171220 ------
NM_001032296chr1352447 2379 2356 1151 891 ------
NM_001032363chr151892 1752 265 244 203 ----1445
NM_001032363chr151892 1752 265 244 203 ----1445
NM_001032380chr1031976 746 359 1261 ----
NM_001033047chr42850 91 11846 1154 22641 498
NM_001033059chr61394 1766 ----
NM_001033087chr2033127 968 300 --11024 --
NM_001033112chr52789 214 ------
NM_001033117chr35687 287 96 69 60 --24673 3385 --
NM_001033503chr5141 ------
NM_001033507chr151692 1566 1261 1248 70 --11346 --
NM_001033518chr72193 45 ------
NM_001033519chr72193 45 ------
NM_001033520chr72193 45 ------
NM_001033566chr171278 ------
NM_001033568chr171278 ------
NM_001033667chr14772 572 285 216 ------
NM_001033925chr1012081 11384 11592 --
NM_001034025chr122673 151 ------
NM_001034850chr51629 ------
NM_001034954chr1042210 900 864 790 ------
NM_001034955chr1042210 900 864 790 ------
NM_001034956chr1042210 900 864 790 ------
NM_001034957chr1042210 900 864 790 ------
NM_001035chr1--1956 ----
NM_001035254chr942304 2081 1043 428 --12232 --
NM_001035511chr151815 1384 253 150 72 ----1330
NM_001035512chr151922 1491 360 257 179 ----1437
NM_001035513chr151922 1491 360 257 179 ----1437
NM_001037164chr741426 289 194 46 --1602 --
NM_001037317chr111071 ----1731
NM_001037324chr32747 111 ------
NM_001037332chr542202 789 669 157 ------
NM_001037333chr542202 789 669 157 ------
NM_001037339chr131417 263 114 ------
NM_001037340chr131417 263 114 ------
NM_001037341chr131417 263 114 ------
NM_001037341chr131417 263 114 ------
NM_001037533chr11274 ----1305
NM_001037582chr431580 419 52 ------
NM_001037954chr1152174 2138 695 391 25 ------
NM_001038702chr542780 2714 959 620 --1924 --
NM_001039199chr2054905 3272 1576 1251 1126 --23071 798 --
NM_001039465chr14--1438 ----
NM_001039479chr1422284 787 ------
NM_001039538chr243289 2722 2685 213 ----13260
NM_001039550chr23700 690 121 ------
NM_001039569chr233261 2615 2578 --21146 925 --
NM_001039574chr12880 52 ------
NM_001039590chrX23571 661 ----1214
NM_001039591chrX23571 661 ----1214
NM_001039618chr1154237 4033 3888 1647 562 ----14366
NM_001039690chr1692339 2152 784 763 487 349 342 285 237 --31914 725 611 --
NM_001039711chr131008 846 365 ------
NM_001039712chr131008 846 365 ------
NM_001039840chrX179 --14802 15366
NM_001039937chr1312634 --11164 11200
NM_001040142chr2192 11836 ----
NM_001040143chr2192 11836 ----
NM_001040144chr1692339 2152 784 763 487 349 342 285 237 --31914 725 611 --
NM_001040146chr1692339 2152 784 763 487 349 342 285 237 --31914 725 611 --
NM_001040151chr1113312 1913 --131
NM_001040152chr734561 3886 1967 11838 ----
NM_001040181chr32929 227 ------
NM_001040182chr32929 227 ------
NM_001040183chr32929 227 ------
NM_001040199chr32929 227 ------
NM_001040200chr32929 227 ------
NM_001040214chr63834 366 61 ----1921
NM_001040284chr1694909 4671 4384 1620 1361 1240 1059 1008 312 --14715 --
NM_001040402chr42928 397 ------
NM_001040409chr22836 743 ------
NM_001040429chr1322920 1134 ------
NM_001040440chr5----1210 --
NM_001040441chr124097 227 ------
NM_001040455chr1151025 838 438 210 136 1451 1152 --
NM_001040624chr8----22561 2297 --
NM_001040625chr8----22561 2297 --
NM_001040626chr8----22561 2297 --
NM_001040627chr8----22561 2297 --
NM_001040628chr8----22561 2297 --
NM_001040629chr8----22561 2297 --
NM_001040630chr8----22561 2297 --
NM_001040709chr151001 839 555 177 113 12323 ----
NM_001040712chr933443 3333 389 ------
NM_001040715chr1641040 824 345 93 ----1480
NM_001042353chr204459 386 198 139 --1494 --
NM_001042361chr1041492 1319 585 201 ------
NM_001042364chr1041492 1319 585 201 ------
NM_001042365chr1041492 1319 585 201 ------
NM_001042387chr1041492 1319 585 201 ------
NM_001042393chr1041492 1319 585 201 ------
NM_001042396chr1041492 1319 585 201 ------
NM_001042397chr1041492 1319 585 201 ------
NM_001042404chr121892 1375 ------
NM_001042406chr61414 1353 ----
NM_001042413chr943086 2697 1262 493 ------
NM_001042424chr461202 1092 825 757 740 725 11051 11249 --
NM_001042486chr2031283 1121 157 ------
NM_001042492chr171717 13303 ----
NM_001042494chr1543015 2767 2729 45 ------
NM_001042495chr1543015 2767 2729 45 ------
NM_001042496chr1543015 2767 2729 45 ------
NM_001042497chr1543015 2767 2729 45 ------
NM_001042498chrX3777 119 93 ------
NM_001042537chrX22205 718 --1506 --
NM_001042550chr92666 612 --11622 --
NM_001042552chr131129 934 585 ------
NM_001042555chr1264242 3447 582 482 436 334 ------
NM_001042573chr1762096 1908 595 157 32 24 --171 --
NM_001042599chr246336 1369 703 76 16997 27346 2258 --
NM_001042601chr32834 658 ------
NM_001042603chr12114932 4783 4020 1473 1057 765 739 370 341 141 113 --14032 14146
NM_001042604chr334398 1159 325 ------
NM_001042632chr2041938 1897 548 298 ------
NM_001042633chr2041938 1897 548 298 ------
NM_001042669chr421516 396 ------
NM_001042683chr621148 500 --1151 --
NM_001042749chrX21297 258 ------
NM_001042750chrX21297 258 ------
NM_001042751chrX21297 258 ------
NM_001044305chr61146 ------
NM_001044385chr211378 11131 1463 --
NM_001046chr5--11049 ----
NM_001050chr172101 73 --11228 --
NM_001068chr31214 --187 --
NM_001071775chr13----21963 169 --
NM_001079874chr121910 193 ------
NM_001083620chr432584 2019 585 ------
NM_001092chr1731732 585 526 ------
NM_001095chr1271741 1656 1586 1487 1371 1212 29 11694 11782 11944
NM_001106chr3188959 7637 7536 6944 6783 6246 3787 3289 3055 2813 2790 2691 2182 2106 1546 1387 1101 869 --13623 19491
NM_001113490chrX23475 481 ------
NM_001121chr101195 21350 1245 ----
NM_001122679chr51300 ------
NM_001128chr1663584 2480 1597 1303 1083 323 ------
NM_001130chr192875 264 ------
NM_001146chr811913 ------
NM_001148chr421938 1690 --1839 1257
NM_001163chr9------1992
NM_001167chrX45818 4599 2293 928 1352 ----
NM_001173chr1433933 1148 789 ------
NM_001174chrX22040 456 ------
NM_001177chr1232153 1832 716 --12292 --
NM_001191chr2031276 423 211 11326 21143 1093 --
NM_001198chr642339 2036 975 73 ------
NM_001204chr227068 285 12245 ----
NM_001206chr942837 2282 1185 434 ------
NM_001219chr711739 --11953 --
NM_001222chr1061736 1721 1408 625 493 388 174 1478 --
NM_001241chr231862 951 456 ------
NM_001241chr231862 951 456 ------
NM_001256chr1722486 2177 --12096 --
NM_001257chr1611263 ------
NM_001259chr775495 5367 4622 2247 2165 1261 1047 1383 21577 53 --
NM_001263chr41476 ------
NM_001270chr51146 ------
NM_001271chr1572687 2584 2072 965 716 237 57 --12851 --
NM_001280chr193696 444 173 ------
NM_001282chr171284 ------
NM_001304chr172576 340 1713 ----
NM_001313chr42688 650 ----1811
NM_001326chr11----1339 --
NM_001329chr10192 ------
NM_001331chr1162669 1060 962 920 314 29 --21086 773 --
NM_001343chr52208 49 ------
NM_001351chr321438 356 1677 ----
NM_001356chrX------1971
NM_001357chr11278 ------
NM_001364chr1111038 ------
NM_001365chr173669 616 57 1607 121 --
NM_001386chr822128 906 --1700 --
NM_001389chr211474 ------
NM_001390chr1843087 2700 1011 991 11100 1649 12845
NM_001391chr1811114 ------
NM_001396chr214835 816 742 322 ------
NM_001402chr621996 1401 ------
NM_001406chr171481 11224 31416 1404 672 --
NM_001407chr321426 537 --11588 --
NM_001419chr1944578 3211 1840 1378 --14779 --
NM_001420chr1953120 2735 761 429 361 ------
NM_001421chrX2422 197 ------
NM_001427chr731723 623 464 --1434 --
NM_001430chr22638 155 ------
NM_001431chr62974 439 --1181 --
NM_001438chr122263 962 ------
NM_001440chr882771 2270 2183 1003 626 526 379 184 11709 1541 --
NM_001448chrX11692 11772 ----
NM_001451chr1611336 ------
NM_001460chr133320 604 166 13135 ----
NM_001482chr152225 29 ------
NM_001485chr22177 23 1154 ----
NM_001493chrX1140 ------
NM_001494chr103670 228 84 ------
NM_001497chr952576 2514 2338 955 137 --1657 --
NM_001498chr61251 --1851 --
NM_001518chr7--122 ----
NM_001552chr1711042 ------
NM_001555chrX1107 ------
NM_001584chr112975 38 ------
NM_001587chrX4610 366 337 94 ------
NM_001616chr21772 --12148 --
NM_001634chr61394 1766 ----
NM_001642chr111429 ------
NM_001658chr12350 307 --11062 --
NM_001660chr3----2533 47 --
NM_001663chr141219 --1438 --
NM_001668chr131482 1398 360 ------
NM_001678chr1751772 1366 1304 713 630 ------
NM_001682chr1222744 2284 ------
NM_001683chr352475 1985 498 465 232 --12431 --
NM_001684chr143883 3681 3617 512 --12923 --
NM_001695chr873858 3752 3088 3009 2939 936 143 --13171 --
NM_001709chr1142696 2644 2605 877 11119 1523 --
NM_001730chr131223 ------
NM_001730chr131223 ------
NM_001742chr71713 ------
NM_001743chr2----1221 --
NM_001746chr53794 777 725 ----1335
NM_001753chr711698 1698 ----
NM_001754chr2113925 ------
NM_001755chr162740 159 ------
NM_001773chr121225 583 ------
NM_001777chr342645 415 325 79 --1796 --
NM_001800chr19----1129 --
NM_001806chr1932904 731 35 ------
NM_001822chr21707 ------
NM_001834chr5142 ----1258
NM_001845chr1321033 443 11182 ----
NM_001858chr61368 --23295 895 --
NM_001859chr963900 3440 2470 1573 924 23 ------
NM_001873chr4162 1272 ----
NM_001893chr17290 65 ----1403
NM_001901chr62918 263 ------
NM_001915chr1741944 1597 632 388 11478 11433 --
NM_001918chr1178576 8175 8135 7115 6636 3673 3651 3138 2773 2068 1763 1268 1134 1100 877 405 265 --27198 6336 --
NM_001920chr12----1743 --
NM_001933chr1431270 1174 115 21199 236 ----
NM_001938chr111714 ------
NM_001949chr622958 330 --1379 --
NM_001955chr62215 190 --11025 1705
NM_001962chr51232 1174 ----
NM_001964chr52802 155 --11143 --
NM_001967chr31184 ------
NM_001969chr1443819 1586 953 146 --33205 2625 1461 1100
NM_001977chr41330 1530 --168
NM_001991chr1772228 1907 486 324 252 207 50 --21520 811 --
NM_002006chr454150 3888 2070 1072 695 13869 ----
NM_002009chr1522539 853 ------
NM_002013chr14153 ----1191
NM_002014chr121133 ------
NM_002015chr1343291 3056 2464 2437 ------
NM_002023chr131261 68 50 11331 ----
NM_002025chrX119103 8846 7515 7317 6963 6301 6179 2948 2149 1059 371 --28679 7886 --
NM_002035chr1822867 635 --179 --
NM_002040chr2121950 846 --1637 1367
NM_002048chr9186 ------
NM_002051chr10------1871
NM_002061chr1--11552 1322 --
NM_002062chr61374 ------
NM_002063chrX1375 ------
NM_002069chr71361 ------
NM_002073chr2231351 1185 129 1105 2517 452 11302
NM_002074chr121574 1513 ------
NM_002079chr101446 ------
NM_002086chr1731974 1586 610 ------
NM_002092chr494378 4364 3925 3312 1668 1077 833 737 265 --14583 --
NM_002111chr453431 2553 2403 1515 642 --2488 426 --
NM_002126chr1743655 2861 2574 24 1898 ----
NM_002131chr64438 420 404 223 ------
NM_002133chr222563 84 ----2571 208
NM_002137chr731788 785 292 ------
NM_002149chr23752 731 113 ------
NM_002167chr12349 341 ----1195
NM_002187chr511084 ------
NM_002193chr24702 595 534 522 1144 11667 --
NM_002196chr201379 --1362 --
NM_002196chr201379 --1362 --
NM_002198chr53662 285 168 ------
NM_002199chr4141 ------
NM_002202chr51989 ------
NM_002207chr3150 ------
NM_002214chr715470 ------
NM_002230chr173848 248 198 --1160 --
NM_002232chr1158 ------
NM_002241chr13930 455 33 --32812 272 137 --
NM_002242chr2------11506
NM_002264chr334973 771 515 14513 13762 --
NM_002267chr1322436 1743 ------
NM_002270chr545071 4965 4387 2188 ------
NM_002271chr1342467 2159 696 547 --1954 --
NM_002285chr252970 2938 1487 1445 35 --13008 --
NM_002296chr12496 367 ----1576
NM_002309chr22103033 2630 2264 2120 1960 1202 1192 683 651 66 ------
NM_002336chr1224041 873 ------
NM_002356chr612696 ------
NM_002359chr1794242 4171 4000 3530 2945 2767 1621 1533 1298 24150 593 13621 --
NM_002373chr151850 ------
NM_002374chr243289 2722 2685 213 ----13260
NM_002383chr162789 714 ------
NM_002387chr554115 3863 1878 1442 309 ------
NM_002399chr1511198 ------
NM_002406chr52794 81 ------
NM_002419chr111394 ------
NM_002438chr102688 113 ------
NM_002451chr933696 2667 2505 ----12920
NM_002465chr121223 ------
NM_002480chr1231338 1282 468 ------
NM_002481chr1117849 7547 6284 5669 5575 5209 5193 3159 1739 1601 673 --26192 2999 14981
NM_002485chr841785 1444 703 578 ----1121
NM_002499chr1542443 2410 2131 537 1684 ----
NM_002505chr621219 480 ------
NM_002509chr202638 602 ------
NM_002518chr23869 375 100 --11127 --
NM_002519chr11----11453 --
NM_002522chr1783491 2902 1259 1206 984 782 769 399 11224 ----
NM_002541chr721041 359 ------
NM_002544chr171353 ------
NM_002547chrX73704 3188 1365 1336 723 653 27 --13405 --
NM_002553chr71163 ------
NM_002568chr81163 ------
NM_002570chr152910 279 ------
NM_002572chr112398 346 ------
NM_002576chr1111157 ----1990
NM_002577chr353884 2783 2739 2701 99 --13688 --
NM_002581chr933857 1696 92 --25227 726 --
NM_002586chr621085 541 ------
NM_002588chr521760 479 ------
NM_002592chr20----1200 --
NM_002594chr2022269 391 ----11780
NM_002595chr121383 11954 ----
NM_002599chr1131053 961 56 ----1921
NM_002600chr131417 263 114 ------
NM_002603chr81211 ------
NM_002609chr52596 510 --2170 67 173
NM_002612chr721984 42 --11620 --
NM_002613chr16125258 5111 4980 3992 3687 2063 1875 1838 1661 1310 751 568 1935 11395 --
NM_002618chr21163 ------
NM_002641chrX----1654 --
NM_002643chr21202 ------
NM_002646chr152076 1641 1605 881 136 ------
NM_002651chr11227 --1617 --
NM_002655chr815332 11528 25259 5012 --
NM_002657chr2043787 3481 3413 1141 --12698 --
NM_002677chr8127 22076 134 ----
NM_002687chr14----11070 --
NM_002697chr1193 ------
NM_002698chr1962736 2029 1103 862 183 127 22435 913 22515 58 --
NM_002707chr21124 ------
NM_002709chr221153 832 ------
NM_002710chr121997 1886 1965 --
NM_002714chr63714 256 72 1806 ----
NM_002716chr1123057 520 --12564 --
NM_002717chr82476 452 ------
NM_002719chr1432347 2336 2107 ------
NM_002721chr9------1540
NM_002731chr121005 427 --12867 12923
NM_002734chr1721965 845 ------
NM_002736chr71511 --1518 --
NM_002737chr1776113 4892 4407 4142 2653 2014 1147 1120 ----
NM_002740chr342623 2420 2028 249 --1679 --
NM_002750chr102216 78 ------
NM_002751chr2241042 909 227 47 --2120 68 --
NM_002755chr151213 ------
NM_002756chr173854 685 284 ------
NM_002758chr171222 ------
NM_002760chrY95568 5475 5129 5088 4916 4425 1701 1127 936 1287 --14957
NM_002768chr164589 461 149 141 ------
NM_002806chr14----144 --
NM_002809chr171321 ------
NM_002811chr161546 ------
NM_002815chr171267 ------
NM_002819chr1951355 429 324 294 276 ------
NM_002826chr15804 781 648 351 269 --2716 103 --
NM_002839chr933443 3333 389 ------
NM_002843chr1121132 402 --12128 13425
NM_002844chr611282 --1506 --
NM_002849chr121709 ------
NM_002850chr192784 77 ------
NM_002851chr71619 ------
NM_002854chr22123 ------
NM_002855chr1192967 2812 2525 1326 1242 989 525 235 174 --1683 --
NM_002857chr142699 1904 1080 893 --1934 --
NM_002865chr82101 36 ------
NM_002868chr1292220 2205 2146 2059 1831 932 921 600 196 ------
NM_002869chr1142157 2144 341 86 ------
NM_002874chr91432 ------
NM_002886chr343703 3309 1179 136 13408 ----
NM_002888chr3140 ------
NM_002893chrX2359 114 --1108 --
NM_002897chr21764 --1694 --
NM_002902chr151147 ------
NM_002906chr111728 ------
NM_002907chr121420 ------
NM_002918chr193883 390 72 ------
NM_002923chr12637 236 ------
NM_002924chr11402 ------
NM_002938chr421380 1239 1694 ----
NM_002941chr31630 ------
NM_002942chr321336 355 ------
NM_002948chr31532 1268 ----
NM_002953chr12801 578 ------
NM_002968chr162236 60 ------
NM_002977chr222838 426 --13203 --
NM_002979chr12585 246 ------
NM_002997chr241619 709 353 83 1491 ----
NM_002998chr841931 1479 1473 370 ------
NM_002999chr2051712 1674 395 230 23 --11720 11579
NM_003001chr151922 1491 360 257 179 ----1437
NM_003011chr921190 582 ------
NM_003022chrX11215 196 --11108
NM_003028chr983764 3428 2934 2744 2493 2454 1211 179 ----13245
NM_003029chr151426 1388 1142 525 100 1456 ----
NM_003031chr1611007 ------
NM_003034chr1257576 7017 3202 433 164 22166 1113 --1396
NM_003039chr1130 --2211 55 --
NM_003045chr13145063 4851 4269 3893 3838 3486 1708 1552 1343 1041 771 703 606 543 ------
NM_003070chr91694 1298 ----
NM_003076chr123414 332 84 --2594 247 --
NM_003077chr172794 198 ----1696
NM_003081chr201185 ------
NM_003098chr202212 155 ----151
NM_003101chr121625 1023 --1410 --
NM_003106chr31710 ------
NM_003108chr287171 6919 6657 5908 5664 2657 2427 1947 --15439 --
NM_003111chr211223 ------
NM_003112chr732495 2176 117 ------
NM_003130chr711031 --11199 --
NM_003131chr662036 1796 1786 1606 552 169 ------
NM_003139chr112798 665 1186 ----
NM_003144chr631759 596 255 160 ----
NM_003155chr83976 915 528 1725 ----
NM_003157chr32635 206 ----159
NM_003161chr1753322 2892 1244 1186 881 --12519 11287
NM_003179chrX51261 1069 529 406 57 ----11047
NM_003185chr2031102 238 186 ------
NM_003189chr183253 2555 2541 2068 976 564 497 168 --42074 982 422 311 12270
NM_003193chr11169 ------
NM_003199chr1833902 3813 791 --14015 11830
NM_003200chr1972031 1904 1722 1582 1456 591 219 --2463 205 --
NM_003204chr1741225 1107 692 504 ------
NM_003211chr1221749 601 ------
NM_003215chr431438 1115 63 1431 ----
NM_003216chr2283253 2724 2457 1309 1293 1229 838 610 --21053 164 12823
NM_003217chr1251630 1478 1256 568 191 11710 ----
NM_003221chr653881 3441 2959 693 92 --12617 13797
NM_003236chr221360 744 --22238 117 --
NM_003242chr312227 ------
NM_003246chr153777 651 104 ------
NM_003247chr6182 ------
NM_003253chr2131900 1880 584 1270 1574 --
NM_003255chr1762192 2165 1005 717 420 362 --12026 --
NM_003262chr364327 4250 4171 3539 1436 320 ------
NM_003275chr931479 1336 319 ------
NM_003291chr13------1165
NM_003295chr13149 ------
NM_003298chr3105603 5304 5234 5037 4995 4960 4929 1171 1023 754 14582 --16215
NM_003304chr331301 1270 201 ------
NM_003320chr1173916 3745 3565 1528 1423 1291 626 11568 11455 --
NM_003334chrX177 ------
NM_003339chr521391 647 1541 ----
NM_003342chr1763085 2872 2864 2652 2515 1141 ------
NM_003347chr2262077 2045 1552 1528 756 476 --3702 697 163 --
NM_003368chr11115 ------
NM_003387chr221957 397 ------
NM_003390chr11------11077
NM_003400chr21794 ------
NM_003404chr2021601 1318 --1646 --
NM_003406chr821707 289 ------
NM_003409chr1811065 ------
NM_003410chrX3627 566 37 1471 1815 --
NM_003411chrY21325 34 ------
NM_003412chr322453 456 ------
NM_003413chrX--11890 ----
NM_003420chr31257 ------
NM_003432chr52491 484 ------
NM_003442chr111786 ------
NM_003453chr131692 ------
NM_003455chr1131584 1210 496 ------
NM_003457chr171220 ------
NM_003458chr353321 2879 2641 391 76 23518 2453 ----
NM_003463chr61475 2753 49 182 --
NM_003468chr21382 ------
NM_003472chr621483 1150 ------
NM_003473chr101281 ------
NM_003474chr102586 516 ------
NM_003478chr11----13203 --
NM_003483chr1222152 95 ------
NM_003485chr1431267 1030 65 137 1274 --
NM_003488chr172962 822 --1227 --
NM_003489chr211842 ------
NM_003502chr16----1132 --
NM_003507chr242018 2008 652 87 --1385 1800
NM_003564chr13634 558 228 ------
NM_003566chr1232383 1067 188 ------
NM_003569chr62465 225 --1667 --
NM_003576chr1352447 2379 2356 1151 891 ------
NM_003583chr1263646 3479 3050 2861 2595 2577 ------
NM_003589chr1311458 ----11344
NM_003590chr223251 2783 13903 ----
NM_003615chr343933 3826 3658 938 ------
NM_003626chr1111122 ------
NM_003629chr1113452 3115 3084 3033 2796 2769 2520 2452 2252 1392 998 1175 11286 --
NM_003633chr522195 2026 11828 ----
NM_003634chr221782 ------
NM_003637chr131493 1333 458 11461 ----
NM_003644chr1755758 1555 1292 906 541 --25249 1902 --
NM_003663chr333146 2615 603 ------
NM_003670chr32405 366 1955 ----
NM_003671chr942812 885 344 296 --32884 2656 983 22902 483
NM_003677chr1232325 857 647 ----132
NM_003685chr191634 ------
NM_003690chr22469 179 ----1665
NM_003693chr172572 182 --1653 --
NM_003705chr2150 --1781 --
NM_003709chr21402 ------
NM_003716chr311028 ------
NM_003722chr332378 466 187 12361 12265 --
NM_003735chr521760 479 ------
NM_003736chr521760 479 ------
NM_003740chr661381 656 649 626 518 36 11763 1682 --
NM_003741chr31281 142 ----
NM_003743chr231480 541 303 ------
NM_003745chr162343 94 ------
NM_003749chr131302 --1432 --
NM_003750chr101928 ------
NM_003759chr41533 1847 ----
NM_003763chr2033027 2680 1290 --22432 63 --
NM_003768chr121570 565 ------
NM_003774chr1231179 540 246 ------
NM_003779chr11334 ------
NM_003787chr18187 132 ----
NM_003796chr191634 ------
NM_003800chr632084 554 99 ------
NM_003822chr132511 851 390 ----12951
NM_003825chr1521068 1023 11158 ----
NM_003829chr91359 ------
NM_003860chr111371 ------
NM_003872chr232557 2158 351 1765 ----
NM_003877chr121834 ------
NM_003884chr311233 ------
NM_003904chr111131 --1228 --
NM_003913chr63490 349 338 1887 ----
NM_003924chr43309 236 114 1131 ----
NM_003927chr18180 --1997 --
NM_003930chr732391 2362 696 ------
NM_003931chr6----1192 --
NM_003932chr221278 ----11833
NM_003934chr91372 ------
NM_003948chr431629 981 688 ------
NM_003953chr162382 2339 2136 1156 472 381 1399 ----
NM_003966chr594749 4743 2900 2573 2174 1344 1102 50 21 --1792 16114
NM_003980chr641335 1322 342 234 ------
NM_003981chr15131 2262 132 ----
NM_003982chr14----2116 45 --
NM_003983chr1651558 1427 997 339 27 1435 --11438
NM_003994chr1243690 3363 1632 418 ------
NM_004006chrX2820 557 --1833 --
NM_004007chrX2820 557 --1833 --
NM_004009chrX2820 557 --1833 --
NM_004010chrX2820 557 --1833 --
NM_004011chrX2820 557 --1833 --
NM_004012chrX2820 557 --1833 --
NM_004013chrX2820 557 --1833 --
NM_004014chrX2820 557 --1833 --
NM_004015chrX2820 557 --1833 --
NM_004016chrX2734 471 --1747 --
NM_004017chrX2820 557 --1833 --
NM_004018chrX2734 471 --1747 --
NM_004020chrX2820 557 --1833 --
NM_004021chrX2734 471 --1747 --
NM_004022chrX2734 471 --1747 --
NM_004023chrX2734 471 --1747 --
NM_004035chr1764520 3996 3314 1045 630 448 ----35060 1263 454
NM_004050chr1442192 840 737 641 --11110 --
NM_004081chrY31464 1391 1368 ------
NM_004086chr14----1674 --
NM_004089chrX31119 275 217 ------
NM_004093chr1312856 ------
NM_004094chr1421063 223 ------
NM_004098chr10--1954 ----
NM_004100chr621770 199 ------
NM_004112chr1751660 1474 647 463 200 ----1655
NM_004114chrX2836 461 ------
NM_004156chr8147 ------
NM_004171chr11129355 9212 9009 8259 7695 6784 3625 2609 2191 2155 1852 136 --17486 --
NM_004180chr21599 ------
NM_004183chr112726 607 ------
NM_004187chrX11129 ------
NM_004209chr162946 840 --1274 --
NM_004232chr1832826 2520 701 --12599 --
NM_004240chr19197 ------
NM_004241chr102763 729 ------
NM_004263chr251696 1535 1337 1143 79 --11542 --
NM_004273chr10125004 4626 4606 4551 4462 3884 3073 1344 1044 262 246 41 11421 25044 3814 --
NM_004274chr14296 72 11119 ----
NM_004290chr521139 1057 ------
NM_004296chr1493947 3773 3635 3097 2735 2726 2580 813 27 --22607 2602 12953
NM_004301chr31361 ------
NM_004319chr142514 431 214 68 ------
NM_004321chr2113423 3361 2648 2564 2508 2332 2237 1427 1378 1209 998 ------
NM_004326chr12969 352 ------
NM_004331chr81773 ----1203
NM_004337chr832082 1739 76 ------
NM_004349chr821005 953 ------
NM_004350chr141645 838 654 114 --11888 --
NM_004367chr641755 1749 1110 178 ------
NM_004373chr121141 ----1175
NM_004376chr1021272 164 11073 ----
NM_004379chr2147 ------
NM_004380chr1632480 2182 192 --11871 --
NM_004385chr51525 1704 ----
NM_004395chr51224 1163 ----
NM_004397chr1154164 3627 2984 2724 1164 ------
NM_004420chr1172172 2062 1847 1800 906 469 275 ------
NM_004423chr332104 805 650 1757 ----
NM_004427chr171092 1003 862 432 388 376 251 --1899 --
NM_004430chr842757 1719 693 107 --12812 --
NM_004432chr9----12041 --
NM_004437chr143184 3140 1224 732 22888 2262 ----
NM_004438chr263250 2045 844 588 468 175 1683 ----
NM_004440chr631499 1258 56 ------
NM_004441chr33881 859 97 ----11149
NM_004449chr2131270 1047 303 --11360 --
NM_004459chr17--11937 ----
NM_004474chr11993 ------
NM_004481chr131094 755 125 ------
NM_004491chr19133715 3171 2857 2683 1424 1286 900 871 436 362 212 189 62 23762 1559 --1864
NM_004500chr1421519 1393 ------
NM_004501chr143456 2707 2520 759 13744 ----
NM_004503chr121631 ------
NM_004504chr22960 675 --12647 --
NM_004505chr1711323 ----11555
NM_004514chr1722346 140 ------
NM_004516chr192863 116 ------
NM_004535chr201687 --1414 11446
NM_004537chr1231027 612 220 --142 --
NM_004560chr93904 846 386 ------
NM_004566chr1041965 1776 805 634 --1641 11936
NM_004575chr411660 --11500 --
NM_004578chr11838 ------
NM_004580chr1511727 ----1669
NM_004586chrX44051 3667 3644 1285 ------
NM_004588chr1164051 3571 3362 973 647 371 11490 2441 361 --
NM_004596chr191200 ------
NM_004598chr533088 1256 552 ----1250
NM_004612chr921518 290 --14666 --
NM_004621chr11------11260
NM_004622chr262478 1918 1889 1822 680 23 ------
NM_004630chr11147 ------
NM_004631chr11905 ----11337
NM_004634chr31105 ------
NM_004635chr361010 918 392 308 217 28 11018 ----
NM_004636chr31163 ------
NM_004637chr331301 425 417 ------
NM_004663chr152332 203 ------
NM_004666chr61212 ------
NM_004687chr1731950 1807 1425 --11350 --
NM_004690chr61682 144 ----
NM_004713chr141619 ------
NM_004718chr21168 ----199
NM_004726chrX34967 2168 2081 --15423 --
NM_004730chr521505 536 ------
NM_004736chr112183 ------
NM_004742chr3------1159
NM_004745chr875926 5905 5186 5012 4814 4621 1476 11491 22209 230 26289 2416
NM_004748chr1532578 865 818 ------
NM_004761chr6----121 --
NM_004763chr22926 851 6818 766 710 430 374 318 ----
NM_004765chr16145 ------
NM_004768chr11469 ------
NM_004774chr1752695 1249 928 691 126 ------
NM_004776chr2062407 1178 847 402 231 83 ------
NM_004788chr1122231 201 1753 ----
NM_004796chr1441896 914 602 319 --1374 --
NM_004801chr21548 ------
NM_004805chr241012 953 305 225 ------
NM_004808chr1042489 2333 2309 2295 --22460 1339 --
NM_004815chr184818 4025 3844 1691 1441 1290 750 707 --11347 --
NM_004822chr17103210 3103 2694 2563 1565 1281 1249 1115 601 311 11074 11310 --
NM_004824chr621065 480 ------
NM_004827chr4------2784 251
NM_004836chr21664 ------
NM_004840chrX52027 529 434 273 92 ------
NM_004849chr631622 1228 169 ----1291
NM_004850chr211263 --21663 1523 --
NM_004856chr151404 ------
NM_004857chr1453839 3086 2983 1824 1694 1518 13715 --
NM_004863chr1495299 5244 5016 3662 3516 3335 925 613 56 13499 ----
NM_004866chr534957 637 463 ------
NM_004869chr1821144 315 11634 1620 --
NM_004871chr1753729 3277 2761 736 50 ------
NM_004874chr81323 ------
NM_004897chr101773 ------
NM_004904chr752354 1554 1031 121 22 ------
NM_004905chr1----1130 --
NM_004922chr101916 ------
NM_004926chr141219 1312 ----
NM_004929chr821484 509 ------
NM_004947chr332049 1931 204 11670 11813 1619
NM_004953chr31156 ------
NM_004956chr722882 157 ----13653
NM_004962chr101303 ----1235
NM_004965chr211707 ------
NM_004973chr621584 472 --11633 --
NM_004975chr202375 331 ------
NM_004976chr11115025 4519 4282 4018 4007 3999 2075 1683 1406 1328 208 13278 ----
NM_004978chr131543 473 391 --2436 150 --
NM_004992chrX107109 6050 5692 5368 2786 2655 2232 1927 1040 151 26385 3040 56055 1642 1452 819 540 25906 701
NM_004992chrX107109 6050 5692 5368 2786 2655 2232 1927 1040 151 26385 3040 56055 1642 1452 819 540 25906 701
NM_004993chr142956 409 ------
NM_004998chr153639 348 114 ------
NM_004999chr634371 955 454 ----1810
NM_005006chr21836 --1291 --
NM_005023chr521274 145 --1553 --
NM_005030chr161276 ------
NM_005032chrX------185
NM_005044chrX94124 4030 3648 3607 3435 2944 1104 805 613 ----13476
NM_005056chr12115176 5027 4264 1717 1301 1009 983 614 585 385 357 --14276 14390
NM_005060chr151237 1197 1191 168 148 --21084 37 --
NM_005066chr12814 139 ------
NM_005067chr32851 148 --1193 --
NM_005078chr1541458 564 277 182 ------
NM_005095chr11524 ------
NM_005096chrX5990 337 222 201 158 --11185 --
NM_005109chr362351 2146 1921 969 889 756 127 11807 171
NM_005116chr2064484 3865 3192 729 594 338 23822 1527 21585 23 11326
NM_005119chr11831 ------
NM_005121chr1723248 372 1110 --1552
NM_005124chr62867 307 ------
NM_005126chr311407 ------
NM_005135chr1543015 2767 2729 45 ------
NM_005154chr151575 ------
NM_005155chr62157 55 --1566 --
NM_005156chr934940 4550 908 ------
NM_005160chr2265786 5501 4911 2642 1905 1877 ------
NM_005168chr221237 113 ------
NM_005187chr1631782 709 82 12010 61911 1879 1847 1815 438 97 --
NM_005190chr6----11110 --
NM_005194chr201476 ------
NM_005197chr1411435 ----15485
NM_005202chr13278 118 30 ----1189
NM_005207chr2253546 2754 1410 786 485 13197 2870 401 --
NM_005233chr322550 352 ------
NM_005234chr194335 310 104 35 ------
NM_005235chr246336 1369 703 76 16997 27346 2258 --
NM_005238chr1133079 2838 635 --12782 1275
NM_005239chr2141909 1609 703 133 ------
NM_005241chr31942 ------
NM_005254chr15----11339 --
NM_005259chr221124 97 ------
NM_005264chr101875 ------
NM_005273chr71294 ------
NM_005277chr421794 754 ------
NM_005279chr2133 ------
NM_005311chr732227 822 283 --12686 --
NM_005324chr1721988 855 ------
NM_005336chr272209 2073 1695 1622 1557 298 178 ------
NM_005339chr424122 982 ------
NM_005349chr4------1589
NM_005359chr1886468 5491 4835 4299 4238 2374 2330 2292 ------
NM_005381chr21121 ------
NM_005386chr201740 ------
NM_005387chr112541 524 ------
NM_005388chr941734 1439 533 85 ------
NM_005392chr911641 21856 427 ----
NM_005397chr743843 3585 1614 1297 1739 11377 --
NM_005398chr103916 198 24 ------
NM_005402chr72385 183 175 ----
NM_005406chr1811329 ------
NM_005410chr51137 ------
NM_005417chr2041933 1905 1308 392 ----2567 180
NM_005425chr16121 ------
NM_005430chr121991 ------
NM_005436chr1053008 2972 487 329 179 11027 ----
NM_005438chr112513 206 --178 --
NM_005440chr1742842 888 842 560 ------
NM_005443chr43579 492 146 ------
NM_005461chr2031328 1285 352 ------
NM_005474chr1741506 1152 575 160 11324 1613 --
NM_005475chr1252855 1014 726 200 159 --11041 --
NM_005477chr1552210 1817 810 646 501 --1731 12415
NM_005477chr1552210 1817 810 646 501 --1731 12415
NM_005479chr1041401 1241 1073 97 ------
NM_005493chr61606 ------
NM_005497chr1785778 4909 4828 3949 3765 2318 1833 461 11064 25482 2466 --
NM_005502chr931096 977 751 --13307 --
NM_005512chr1131930 1374 105 1410 ----
NM_005520chr51664 ------
NM_005523chr751446 1437 1378 293 149 --11550 --
NM_005530chr1541327 1290 1132 126 ------
NM_005537chr131198 ------
NM_005561chr133934 852 56 ------
NM_005563chr12337 213 ------
NM_005578chr323879 326 ------
NM_005594chr12194 ------
NM_005595chr11740 ------
NM_005596chr935552 2318 2132 ----25382 2301
NM_005602chr321224 116 ------
NM_005604chr622048 798 --22346 845 --
NM_005618chr61535 ------
NM_005627chr62875 622 ------
NM_005637chr1821832 535 ------
NM_005638chrX----11726 --
NM_005639chr1221892 719 ------
NM_005643chr62555 21 ------
NM_005644chr11299 ------
NM_005647chrX53255 2607 2520 1340 1140 11125 22796 2404 --
NM_005652chr161300 ------
NM_005655chr8138 1106 1898 --
NM_005659chr22158 ----1426
NM_005662chr82364 69 ------
NM_005664chr151231 --124 --
NM_005668chr544251 3061 908 872 ------
NM_005688chr32274 136 ------
NM_005711chr51945 1162 ----
NM_005715chr632679 500 25 ------
NM_005718chr32211 25 ------
NM_005722chr221870 602 --1760 --
NM_005724chr154608 135 77 30 ------
NM_005730chr12103383 2625 2264 1454 1094 925 850 816 440 418 ------
NM_005735chr23284 92 72 ------
NM_005737chr252735 2093 1984 1868 214 --1683 --
NM_005738chr741426 289 194 46 --1602 --
NM_005748chr122996 204 13167 13065 --
NM_005759chr234382 3756 525 --24561 3339 --
NM_005779chr5--23047 127 33280 2966 886 12566
NM_005786chr18163 1460 --169
NM_005795chr231896 572 418 ------
NM_005814chr151323 1066 946 246 62 --2503 162 --
NM_005822chr622053 438 ------
NM_005826chr1------2570 81
NM_005840chrX97293 7156 6408 5676 5008 2707 1622 1431 1220 15923 --25975 2805
NM_005868chr72168 44 --1687 --
NM_005871chr101126 ------
NM_005880chr16----1117 --
NM_005896chr2149 --2745 659 1665
NM_005897chr141205 1100 1010 155 ------
NM_005898chr111323 ------
NM_005905chr132342 56 ------
NM_005907chr61515 11580 ----
NM_005909chr544056 1309 1216 1150 ------
NM_005920chr172927 2864 2712 1100 1082 1041 970 ------
NM_005933chr1112278 1334 ----
NM_005935chr444416 3527 1739 580 --34903 988 286 --
NM_005941chr833652 2569 1504 ------
NM_005944chr31950 --21121 39 --
NM_005955chr153969 2195 2056 878 637 --44556 3772 2139 855 11450
NM_005966chr21266 ----1363
NM_005977chr131367 ------
NM_005999chr12477 95 ------
NM_006007chr923861 3690 --21754 686 --
NM_006011chr1534010 1457 346 --1694 --
NM_006015chr11351 ----11268
NM_006016chr611680 ------
NM_006030chr351458 1359 698 524 143 11624 ----
NM_006033chr1852213 768 582 463 140 ------
NM_006037chr254144 3446 1834 1291 635 ----1824
NM_006038chr205646 558 451 444 100 ------
NM_006047chr2033451 2943 947 ------
NM_006070chr32330 45 ------
NM_006079chr61261 ------
NM_006080chr7--12318 ----
NM_006089chrX21815 1445 ------
NM_006091chr1521768 1133 ------
NM_006095chr434451 3802 712 ------
NM_006099chr14846 764 669 139 ------
NM_006106chr1132666 1234 452 ------
NM_006113chr121910 193 ------
NM_006116chr2271589 1389 1321 593 293 231 33 21341 1029 11356 1649
NM_006141chr1672800 2446 1817 1723 1093 605 149 ----1906
NM_006148chr1742855 2439 1150 879 --32909 1823 287 --
NM_006158chr851632 1499 731 215 207 ------
NM_006161chr51181 1444 ----
NM_006178chr1711414 --2422 59 --
NM_006180chr92818 326 --12109 1580
NM_006191chr122850 185 ------
NM_006194chr1411213 --11126 --
NM_006203chr535299 4231 3838 15009 14791 --
NM_006206chr432871 2565 2434 12511 ----
NM_006216chr21643 ------
NM_006224chr1752319 2118 2071 1886 701 ------
NM_006243chr11867 ------
NM_006244chr113177 114 100 --2583 402 --
NM_006251chr53708 556 254 ------
NM_006256chr152771 2063 1851 1006 639 12498 ----
NM_006267chr211731 --11466 11816
NM_006275chr2042174 1893 440 79 ------
NM_006282chr2043995 723 626 61 11473 --14555
NM_006283chr834306 3920 1775 13845 24297 447 14363
NM_006287chr212448 ------
NM_006292chr111159 ------
NM_006296chr21110 ------
NM_006306chrX64451 4196 4026 2205 1150 207 22008 1171 15103 --
NM_006310chr173968 912 507 11023 --11237
NM_006313chr1221533 542 ------
NM_006321chr341373 786 658 212 --22033 576 --
NM_006352chr121760 1522 177 --1295
NM_006353chr62402 97 1560 ----
NM_006359chrX22205 718 --1506 --
NM_006366chr631273 969 111 ------
NM_006367chr121051 849 ------
NM_006369chr11370 ------
NM_006371chr3114992 3800 3423 1669 1495 915 844 833 651 462 424 24661 3965 1743 11798
NM_006375chrX31575 1218 562 ------
NM_006380chr1723799 2734 ------
NM_006386chr2242330 2288 2128 552 ----12050
NM_006393chr1034539 4390 533 ------
NM_006407chr3----11382 --
NM_006415chr921143 23 ----181
NM_006430chr22414 116 ------
NM_006434chr1042210 900 864 790 ------
NM_006454chr472994 2745 1929 1134 935 756 168 1347 126 --
NM_006457chr443926 3179 1096 166 ------
NM_006458chr11124 ------
NM_006460chr171130 ----11802
NM_006482chr1263646 3479 3050 2861 2595 2577 ------
NM_006517chrX41848 1717 515 255 ------
NM_006520chrX21576 1189 ------
NM_006534chr2022988 638 --22192 1142 --
NM_006538chr253829 1162 1129 996 407 --14084 --
NM_006544chr1425355 2204 14394 --11114
NM_006546chr17116379 5210 5145 5053 4421 4295 4162 4035 2138 2075 1894 21346 77 25895 5259 --
NM_006547chr721804 1463 ----1351
NM_006555chr761839 1693 672 617 543 263 11229 ----
NM_006559chr11173 ------
NM_006561chr1056225 5093 2242 1253 976 ------
NM_006565chr162355 91 ------
NM_006566chr185910 370 364 323 89 1284 ----
NM_006570chr91392 ------
NM_006572chr172637 233 ------
NM_006587chr431718 338 51 1260 ----
NM_006599chr1668100 2879 2432 1488 917 419 --17322 15162
NM_006601chr12----1910 --
NM_006602chr201697 ------
NM_006603chrX21297 258 ------
NM_006609chr222404 1911 ------
NM_006624chr1011826 --11925 --
NM_006625chr13732 340 98 ------
NM_006625chr13732 340 98 ------
NM_006625chr13732 340 98 ------
NM_006626chr91122 11861 ----
NM_006628chr15104393 3943 3735 3648 3416 2915 967 881 517 314 --11679 --
NM_006634chr2153 ------
NM_006636chr22836 743 ------
NM_006654chr1264242 3447 582 482 436 334 ------
NM_006675chr1263384 3240 3200 2866 2292 789 --12425 --
NM_006690chr2041977 1545 1525 32 --1148 --
NM_006693chr71817 1596 ----
NM_006698chr202982 210 --1132 --
NM_006699chr12967 370 ------
NM_006705chr9123 ------
NM_006706chr51339 ------
NM_006713chr53681 261 67 ------
NM_006717chr922162 1157 ------
NM_006722chr31879 ------
NM_006729chrX74199 4080 3781 3694 1876 1494 1072 ----14708
NM_006734chr631410 1100 1056 ------
NM_006736chr221710 1700 --1369 --
NM_006738chr1594583 4315 4304 2972 1663 1534 1430 848 275 14219 ----
NM_006742chr1691852 1825 1769 1544 1290 381 306 174 92 11421 21927 242 --
NM_006743chrX1728 ------
NM_006749chr82882 40 ------
NM_006751chr221002 675 ------
NM_006754chr72217 99 ------
NM_006761chr171113 ------
NM_006764chr32456 77 ------
NM_006769chr11490 ------
NM_006777chrX42798 821 689 625 ----12914
NM_006788chr182616 297 --32096 1992 772 --
NM_006791chr151525 ------
NM_006807chr1721096 93 1502 ----
NM_006809chr203783 316 136 ------
NM_006823chr821280 219 ------
NM_006826chr221032 183 ------
NM_006827chr1433229 2698 234 ----171
NM_006832chr14--1339 --1790
NM_006851chr1222825 52 ------
NM_006852chr1742588 1845 1810 703 --12581 --
NM_006854chr731638 1579 1418 ------
NM_006861chr1271887 1785 1601 733 620 553 336 ------
NM_006873chr212494 --11352 --
NM_006874chr421137 819 ------
NM_006885chr1631336 463 275 ------
NM_006892chr202314 290 ------
NM_006892chr202314 290 ------
NM_006898chr21592 ------
NM_006914chr921528 396 ----1541
NM_006915chrX22278 1924 ------
NM_006922chr222026 590 ------
NM_006925chr14--1438 ----
NM_006939chr1421148 820 ------
NM_006940chr1221729 385 ------
NM_006946chr111547 ------
NM_006950chrX2770 720 ------
NM_006959chr191327 --1351 --
NM_006990chr162132 2103 1618 892 532 424 12126 12229 --
NM_006999chr531787 1445 1418 --11950 --
NM_007010chr172647 234 --1730 --
NM_007011chr1566318 4523 4246 2291 1831 508 ------
NM_007052chrX2557 65 ------
NM_007054chr542947 2935 2859 2428 12509 --12634
NM_007064chr321103 364 ------
NM_007067chr1721290 1166 ------
NM_007074chr161100 ------
NM_007078chr1042942 2009 845 743 --1972 --
NM_007084chr1331408 354 201 --11249 --
NM_007097chr5142 ----1258
NM_007112chr1148 179 ----
NM_007118chr51862 ------
NM_007124chr6--11472 ----
NM_007137chrX95042 4489 4262 4179 4063 3617 1986 1659 1258 158 --13982
NM_007144chr1721302 877 ------
NM_007159chr321344 1316 ----1279
NM_007166chr1111385 ------
NM_007173chr111167 1834 ----
NM_007191chr121623 ----1109
NM_007197chr123853 752 341 ------
NM_007200chr1594583 4315 4304 2972 1663 1534 1430 848 275 14219 ----
NM_007203chr953383 3198 2734 2713 1401 ------
NM_007207chr11666 ------
NM_007216chr111357 ------
NM_007218chr81185 ------
NM_007219chr203921 861 630 ------
NM_007220chrX94908 4863 3502 3458 3425 1957 1480 1442 630 13871 ----
NM_007222chr851596 1438 1426 1223 553 11750 ----
NM_007235chr12188 ------
NM_007236chr1561896 1688 957 801 739 28 ------
NM_007246chr41910 ------
NM_007247chr172941 828 ------
NM_007249chr1353209 2021 732 209 159 --26896 2739 --
NM_007271chr6----1566 --
NM_007275chr351135 802 347 319 72 ------
NM_007278chr171136 ------
NM_007280chr152337 91 1357 ----
NM_007283chr3122984 2638 2587 1908 1096 1090 1084 623 437 79 65 30 12175 ----
NM_007292chr1764520 3996 3314 1045 630 448 ----35060 1263 454
NM_007294chr172360 60 --1337 --
NM_007295chr172360 60 --1337 --
NM_007296chr172360 60 --1337 --
NM_007297chr172360 60 --1337 --
NM_007298chr172360 60 --1337 --
NM_007299chr172360 60 --1337 --
NM_007300chr172360 60 --1337 --
NM_007302chr172360 60 --1337 --
NM_007303chr172360 60 --1337 --
NM_007304chr172360 60 --1337 --
NM_007305chr172360 60 --1337 --
NM_007308chr41240 ------
NM_007331chr422457 487 --21957 1705 --
NM_007347chr1542442 989 879 429 12800 ----
NM_007358chr1177 ------
NM_007359chr172602 409 21188 1181 --11423
NM_007365chr122073 550 ------
NM_007373chr1031795 1174 185 ----11372
NM_007375chr122650 920 11975 11751 --
NM_012081chr5--13008 1730 --
NM_012095chr1033347 2667 339 ----12234
NM_012098chr921293 550 ------
NM_012099chr192902 227 1823 21257 124 --
NM_012104chr1143356 2669 2488 781 --13613 12580
NM_012104chr1143356 2669 2488 781 --13613 12580
NM_012141chr1312634 --11164 11200
NM_012156chr2052684 2656 2567 2248 1303 --11376 23247 2294
NM_012157chr31232 1819 ----
NM_012158chr1321560 1460 ------
NM_012193chr1155189 4139 3287 1964 1550 13519 34220 1316 1183 --
NM_012199chr1134681 4008 3920 3644 3513 3316 3094 2995 2948 1770 1760 1143 1051 23558 1226 ----
NM_012207chr1011023 --146 --
NM_012218chr1993049 2907 2308 2271 2220 933 796 778 552 12988 --12143
NM_012224chr4----154 --
NM_012232chr1721485 714 22140 1741 1765 12130
NM_012233chr241060 362 236 28 11089 ----
NM_012238chr101686 ------
NM_012247chr10------1927
NM_012249chr233592 1374 328 ------
NM_012250chr1111052 ------
NM_012252chr733641 1966 1362 --191 --
NM_012257chr71940 ------
NM_012262chr155065 4640 4006 3731 1994 1284 ----
NM_012281chr711870 ------
NM_012285chr175442 429 329 77 23 --1111 --
NM_012286chrX1113 ------
NM_012287chr334103 1447 117 ------
NM_012288chr685350 5145 3831 3778 636 448 269 169 15197 14733 --
NM_012296chr1143473 2926 1197 573 1177 22891 1450 --
NM_012297chr442478 2464 711 78 11935 ----
NM_012300chr542511 2098 1774 352 ------
NM_012306chr1263500 3239 2544 2310 725 398 1868 12826 --
NM_012307chr183817 700 325 ------
NM_012308chr1141841 1716 1009 177 11597 ----
NM_012309chr1144027 509 458 289 1560 11749 --
NM_012316chr165363 1750 1436 1427 1206 1080 11298 34520 4407 2245 11393
NM_012324chr222746 80 ------
NM_012325chr2031614 1555 562 ----1575
NM_012329chr1721634 1403 ------
NM_012347chr642414 1939 802 559 ----12620
NM_012382chr543502 3338 771 229 ------
NM_012392chr12472 48 1212 ----
NM_012396chr14498 471 277 83 2661 536 ----
NM_012402chr115978 509 491 173 105 1132 ----
NM_012419chr61136 ------
NM_012420chr1012016 22251 1937 ----
NM_012425chr102280 25 ------
NM_012437chr12475 357 ------
NM_012448chr1762038 1954 1627 953 941 643 ------
NM_012479chr7--12631 ----
NM_013230chrY1294 ------
NM_013233chr21348 ------
NM_013240chr2153930 3666 1354 1302 149 11198 34102 2522 1030 --
NM_013245chr16------1709
NM_013246chr112289 180 ------
NM_013253chr112307 128 ------
NM_013261chr412428 ------
NM_013267chr121418 ------
NM_013281chr2011397 ------
NM_013282chr19--187 ----
NM_013304chr16149 --155 --
NM_013309chr1512175 ------
NM_013316chr71692 ------
NM_013323chr172463 415 ----11217
NM_013336chr371758 1616 1595 1359 1299 677 596 --1504 --
NM_013341chr21339 ----11094
NM_013357chr81803 ------
NM_013368chr192589 112 --150 --
NM_013372chr1533321 2523 313 ----187
NM_013381chr1212157 --21951 894 --
NM_013390chr911414 11776 ----
NM_013446chr73540 140 28 ------
NM_013449chr12------12768
NM_013943chr112740 ------
NM_013989chr1421124 1068 14039 34171 3608 97 --
NM_014011chr21669 --12488 --
NM_014016chr32178 29 ------
NM_014021chr123019 107 ------
NM_014038chr72421 86 ------
NM_014042chr11121 1203 --1260
NM_014089chr1331875 826 379 ------
NM_014106chr155783 575 390 88 29 ------
NM_014112chr814007 ------
NM_014117chr1632142 444 187 1716 ----
NM_014154chr3----1366 11479
NM_014155chr11137437 6959 6670 6647 6197 2461 2442 1807 1501 1464 1028 324 288 ----1672
NM_014159chr31239 ------
NM_014181chr242336 1919 854 58 12346 ----
NM_014182chr121629 ------
NM_014191chr1211046 ------
NM_014210chr17135 ------
NM_014213chr23561 224 164 ------
NM_014216chr1461653 1436 1050 501 439 353 ------
NM_014217chr11368 ------
NM_014225chr193431 111 27 ------
NM_014232chr1741407 1177 395 187 ------
NM_014232chr1741407 1177 395 187 ------
NM_014233chr1741696 727 428 104 --12126 --
NM_014238chr1731423 455 323 --1197 --
NM_014240chr333475 1266 1217 ------
NM_014255chr12126 ------
NM_014267chr111839 1768 ----
NM_014271chrX--1671 ----
NM_014284chr12878 131 --1790 --
NM_014286chr992967 2589 2582 2555 2412 2357 1280 1132 423 12499 1801 --
NM_014290chr9--167 ----
NM_014298chr16--1211 ----
NM_014309chr2235371 491 41 --11605 --
NM_014319chr1241277 570 522 59 ------
NM_014323chr221170 ------
NM_014331chr446567 5673 5182 2386 --47151 6810 2590 1360 --
NM_014333chr11----22313 1137 --
NM_014345chr661029 793 731 700 342 41 ------
NM_014368chr951909 1775 617 383 154 1596 ----
NM_014372chr111433 --11297 --
NM_014376chr542202 789 669 157 ------
NM_014382chr31214 --11089 --
NM_014393chr822305 278 --196 --
NM_014399chr72265 203 ------
NM_014405chr1761672 1560 606 298 147 124 --32245 656 564 --
NM_014415chr321406 389 ------
NM_014423chr544291 3828 1854 1508 ------
NM_014426chr201616 ------
NM_014447chr411478 ------
NM_014456chr101536 ------
NM_014458chr12943 927 ------
NM_014469chr112848 289 ------
NM_014491chr71285 ------
NM_014494chr1622042 1546 ------
NM_014496chrX155 ------
NM_014498chr31331 ------
NM_014505chr121360 ------
NM_014515chr12----1137 --
NM_014517chr331297 693 390 ------
NM_014548chr1521642 383 ------
NM_014554chr1221456 877 ------
NM_014572chr131571 ------
NM_014577chr221666 --1707 --
NM_014608chr151403 ------
NM_014630chr1532931 1178 227 ------
NM_014634chr2273298 3070 3035 2707 2347 1322 1239 1710 ----
NM_014636chr983541 3533 1628 797 750 142 136 56 1862 1825 --
NM_014646chr1852817 999 392 231 217 ------
NM_014647chr163762 630 564 12024 ----
NM_014663chr11447 --1318 --
NM_014671chr721406 321 --1619 --
NM_014680chr171141 ------
NM_014682chr811697 11507 ----
NM_014686chr1942586 2334 237 180 1373 ----
NM_014690chr74674 590 196 173 --33076 2440 1960 --
NM_014693chr32747 111 ------
NM_014702chr623271 756 11126 ----
NM_014709chr21253 1139 1487 --
NM_014717chr192250 23 ------
NM_014723chr2063043 2791 2192 2075 1305 794 22186 35 --22244 498
NM_014729chr82643 385 ------
NM_014730chr1275186 4974 4937 4302 3457 1087 1068 --24319 3760 14929
NM_014730chr1275186 4974 4937 4302 3457 1087 1068 --24319 3760 14929
NM_014737chr2053509 2597 1663 1637 929 --1937 --
NM_014739chr643776 1129 885 754 --22578 666 --
NM_014743chr432161 508 458 --12593 --
NM_014748chr22367 313 ------
NM_014755chr223262 1664 ------
NM_014756chr11284 73 ------
NM_014757chr541975 928 328 140 --199 --
NM_014762chr162193 1800 1624 805 685 151 --12597 --
NM_014764chr122390 301 ------
NM_014765chr111917 1591 22403 301 --
NM_014766chr753489 1118 752 488 110 11455 12408 --
NM_014774chr122994 1211 --12944 12348
NM_014781chr81155 --1303 --
NM_014784chr12282 167 ----156
NM_014787chr142805 2534 1063 445 1834 1901 12216
NM_014803chr1032559 2188 916 ------
NM_014806chr9282 23 ------
NM_014807chr112827 729 ------
NM_014810chr133048 2826 2478 --32998 863 398 --
NM_014812chr121892 1375 ------
NM_014819chr52735 312 12425 --12013
NM_014824chr112416 282 --1142 --
NM_014828chr1431993 1711 689 --12286 --
NM_014836chr1031976 746 359 1261 ----
NM_014841chr621332 1108 ----11115
NM_014850chr35687 287 96 69 60 --24673 3385 --
NM_014857chr1178 ------
NM_014871chr122122 69 ------
NM_014872chr912011 ------
NM_014873chr134417 3236 1415 --11044 --
NM_014876chr2252217 1957 821 783 62 12145 ----
NM_014877chr1767687 6118 5307 1738 1291 898 ------
NM_014897chr1753120 2676 2052 939 358 ------
NM_014900chr221003 136 ------
NM_014902chr2031283 1121 157 ------
NM_014903chr122682 126 ------
NM_014905chr21275 ------
NM_014906chr1722751 388 ------
NM_014912chr1022877 76 ------
NM_014921chr1952972 2825 2572 2151 2046 22171 172 22380 1045 --
NM_014923chr1342267 1620 787 528 --11870 1659
NM_014926chr32852 448 ------
NM_014932chr32483 69 ------
NM_014935chr143678 3160 3061 1237 1260 12794 23795 2454
NM_014937chr102834 30 ----1498
NM_014938chr1282297 1991 1930 554 460 371 328 175 --1319 --
NM_014939chr1821378 1270 ------
NM_014946chr243048 2535 1238 273 ------
NM_014947chr112933 12653 ----
NM_014949chr13995 756 84 ------
NM_014950chr14------11600
NM_014952chr1571551 1408 1283 1276 709 580 531 1102 1115 --
NM_014953chr1343794 2884 1305 749 24270 1405 1957 --
NM_014961chr412170 ------
NM_014962chr20------12665
NM_014969chr12860 327 ------
NM_014978chr1051472 1355 1219 668 295 --2630 528 --
NM_014982chr1425230 4286 ------
NM_014989chr621283 165 ------
NM_014990chr142905 92 ------
NM_014991chr432580 594 32 ------
NM_014996chr32699 80 ------
NM_014999chr124560 529 448 291 ------
NM_015000chr122436 321 12843 ----
NM_015002chr1221480 244 ------
NM_015008chr343182 2543 527 318 --22888 1114 12736
NM_015009chr31159 ------
NM_015015chr1931886 689 439 ------
NM_015017chr111249 ------
NM_015032chr132700 511 ------
NM_015035chr20126167 6106 5761 5634 5128 4962 4580 4516 2262 1886 1091 174 ------
NM_015039chr144164 4043 1663 1360 ------
NM_015042chr15124310 3930 3884 3842 3799 1713 1464 902 685 354 311 267 --23812 53 --
NM_015044chr1633230 3143 2692 11064 12960 11283
NM_015049chr222330 72 --1486 --
NM_015054chr121460 1213 ----
NM_015060chr71190 ------
NM_015061chr92625 337 ------
NM_015063chr193366 146 77 ------
NM_015064chr1252891 2814 2583 972 560 ------
NM_015068chr733413 2738 819 1690 ----
NM_015069chr161600 ------
NM_015071chr556473 5528 5269 4661 1881 11854 65948 4203 1449 1215 863 592 --
NM_015074chr184714 4490 3620 3173 1768 734 521 353 --1494 2225 110
NM_015076chr634403 3520 2950 1578 ----
NM_015082chr542183 2041 963 131 12231 12387 --
NM_015087chr1332603 609 192 ------
NM_015091chr141806 ------
NM_015092chr1654500 4020 3573 3535 114 --1203 --
NM_015097chr311727 ------
NM_015100chr141527 680 551 65 --12001 --
NM_015101chr172784 2603 2388 2259 1154 741 503 --2621 418 --
NM_015107chrX2566 519 --1612 --
NM_015110chr932114 1969 1782 ------
NM_015115chr42928 397 ------
NM_015138chr1532523 675 228 2769 574 ----
NM_015144chr1653314 2578 992 838 352 ------
NM_015149chr121685 628 --31904 711 368 --
NM_015150chr31113 ------
NM_015153chr61283 ------
NM_015155chr1082730 2281 2217 2211 470 449 397 113 ------
NM_015156chr1473132 2836 1338 1239 1078 441 251 11510 21199 385 1620
NM_015161chr1631098 378 212 --11106 --
NM_015170chr832327 257 40 ------
NM_015171chr162178 106 ------
NM_015172chr111398 --21545 95 --
NM_015191chr1142607 2295 981 855 12338 ----
NM_015192chr201525 ----1794
NM_015199chr322584 2220 --12991 --
NM_015200chr411021 ------
NM_015206chr1563880 3822 2773 2512 1001 430 ------
NM_015209chr12726 521 11680 ----
NM_015215chr121258 505 ------
NM_015234chr611005 ----11199
NM_015236chr421448 294 ------
NM_015238chr52731 645 ------
NM_015250chr932039 1831 1510 --1417 --
NM_015251chr1612070 --1744 12105
NM_015256chr5------1676
NM_015264chr22124732 4349 4275 3425 3315 3170 3136 1101 1039 1028 558 352 11592 ----
NM_015265chr262378 1040 663 580 561 114 --11631 --
NM_015267chr1231992 1954 683 ------
NM_015268chr31545 ------
NM_015269chr1----129 --
NM_015271chr453746 2755 1370 1352 33 --11554 1255
NM_015272chr1631814 1618 1467 ------
NM_015275chr121491 --11394 --
NM_015277chr18--21782 484 ----
NM_015278chr652937 2625 2594 419 115 --22100 743 --
NM_015285chr1822389 98 ------
NM_015288chr553309 2635 2456 614 395 --23575 187 --
NM_015293chr61157 ------
NM_015299chr1453720 2711 1543 535 528 ----13127
NM_015310chr888022 5494 5127 3275 2976 2121 1754 842 17549 ----
NM_015316chr143395 99 27 ------
NM_015317chr242856 2534 2336 394 ------
NM_015326chr162704 2675 2464 2140 1939 1177 ------
NM_015327chr131242 1005 127 --11227 --
NM_015332chr763247 2780 2568 1362 1178 540 ------
NM_015335chr121297 --1421 --
NM_015346chr1421559 554 11297 --134
NM_015347chr1232297 2186 187 --1768 --
NM_015349chr621100 100 ------
NM_015354chr9186 --1385 --
NM_015355chr1721374 426 ------
NM_015358chr211995 ------
NM_015361chr2162 ------
NM_015365chrX34189 3348 3163 --174 --
NM_015375chr184683 4497 3906 3364 3273 1794 1574 274 --23913 1276 --
NM_015382chr141237 ----1670
NM_015385chr1042210 900 864 790 ------
NM_015387chr211525 --21872 785 --
NM_015396chr32922 142 ------
NM_015397chr92304 237 --21219 1192 --
NM_015404chr9168 ------
NM_015443chr174955 623 445 377 --1257 --
NM_015446chr11334 --1230 --
NM_015455chr521507 1073 ------
NM_015460chr351608 1521 733 252 110 ------
NM_015461chr181236 ----1311
NM_015465chr51201 ------
NM_015477chr152886 56 ----1332
NM_015481chr1211007 --1998 --
NM_015497chr15------1934
NM_015508chr32341 334 ------
NM_015530chr21247 ------
NM_015532chr152841 245 ------
NM_015535chr273399 2596 2558 1383 1128 1090 183 ------
NM_015542chr101107 ------
NM_015550chr713176 ------
NM_015554chr1511833 ------
NM_015555chr631303 703 33 ------
NM_015565chr2111649 ----12087
NM_015567chr131446 1439 ----
NM_015568chr2094300 3949 3910 3783 3603 3551 429 233 224 ------
NM_015570chr711446 ------
NM_015575chr293479 3355 3286 2991 2489 2449 1464 1362 1200 12833 32710 1183 754 1419
NM_015577chr551514 1435 1397 426 319 --1109 --
NM_015578chr19--1789 ----
NM_015602chr121652 1480 ------
NM_015605chr1041492 1319 585 201 ------
NM_015609chr152561 2368 1100 962 908 ------
NM_015610chr72193 45 ------
NM_015630chr21810 ------
NM_015640chr1----14276 25037 3476
NM_015641chr74965 884 846 47 ------
NM_015657chr2141 ------
NM_015678chr131553 ------
NM_015686chrX61856 1674 1622 1577 968 267 ------
NM_015691chrX32782 2713 2542 ----12488
NM_015695chr641959 1651 595 188 ------
NM_015850chr831783 1694 365 --2502 145 --
NM_015866chr11160 ------
NM_015872chr131699 1266 560 ----21400 645
NM_015874chr4------1589
NM_015878chr822226 1852 ------
NM_015881chr112307 128 ------
NM_015888chr123026 289 ------
NM_015902chr8--2225 168 ----
NM_015906chr144503 3356 3306 1864 11272 23285 671 14286
NM_015912chr822472 2232 --1322 --
NM_015932chr131559 ------
NM_015976chr11239 ------
NM_015995chr15115434 5428 5003 4761 3965 1801 1719 1515 885 524 52 ----1487
NM_016003chr72193 45 ------
NM_016009chr144723 4217 3259 133 ------
NM_016021chr632743 2246 807 ------
NM_016023chr81882 ----12012
NM_016025chr1621973 564 ------
NM_016032chrX4949 337 265 121 ------
NM_016037chr13999 466 442 ------
NM_016038chr7175 1201 ----
NM_016040chr132471 952 82 1320 ----
NM_016059chr62124 97 --1381 --
NM_016061chr231604 1073 491 ------
NM_016072chr12--12242 1924 --
NM_016073chr1511146 ------
NM_016076chr122785 469 ----1534
NM_016083chr623546 3339 --13456 --
NM_016103chr5141 ------
NM_016132chr1512634 ------
NM_016133chr211639 ------
NM_016141chr31741 ------
NM_016144chr5----1124 --
NM_016205chr41339 2429 203 ----
NM_016206chr369048 7636 7600 6427 6199 1233 17053 ----
NM_016230chr61166 ------
NM_016231chr1711144 --11315 --
NM_016258chr11256 ------
NM_016260chr225968 232 ----21195 804
NM_016269chr42761 111 ------
NM_016271chr182851 743 ------
NM_016277chr611386 ------
NM_016284chr161287 1697 ----
NM_016287chr131973 1648 1336 ------
NM_016306chr3--1113 ----
NM_016315chr211596 ------
NM_016322chr912219 ------
NM_016351chr7----1183 --
NM_016374chr131026 628 473 ------
NM_016374chr131026 628 473 ------
NM_016376chr1763706 2886 2797 1198 618 435 1246 14277 12650
NM_016395chr1521368 21 ----1581
NM_016396chr1532971 2371 927 ------
NM_016418chr2253361 3160 3042 1302 43 11194 ----
NM_016424chr1731818 1491 1382 ------
NM_016431chr222746 80 ------
NM_016436chr2021710 636 ------
NM_016451chr11151 ------
NM_016453chr31183 ------
NM_016463chr5155 ------
NM_016480chr52789 214 ------
NM_016488chr1221692 358 ------
NM_016490chr2136 ------
NM_016507chr1731998 1961 499 --1526 --
NM_016512chr8--1215 1231 --
NM_016530chr1563823 3811 3216 2899 2545 449 --1167 13980
NM_016531chr41116 ------
NM_016559chr321440 994 ------
NM_016575chr12105075 4621 4500 4025 3754 3376 3338 1502 1464 986 --23780 1547 --
NM_016577chr353548 3261 3013 1668 21 --11310 --
NM_016603chr511961 1901 ----
NM_016604chr52813 247 ------
NM_016605chr532394 2097 791 11794 ----
NM_016619chr4----1238 --
NM_016621chr1163992 3970 3205 3066 1707 1637 ------
NM_016622chr212116 ----1236
NM_016626chr181183 ------
NM_016631chr211880 ------
NM_016644chr51554 ------
NM_016654chr15----11339 --
NM_016824chr101195 21350 1245 ----
NM_016836chr21764 --1694 --
NM_016839chr21764 --1694 --
NM_016929chr673562 3515 1182 840 783 670 183 ------
NM_016936chr1622137 1486 ------
NM_016946chr132342 2306 1018 13592 42835 1446 932 214 --
NM_016952chr1152850 1259 1098 412 61 --1724 --
NM_017412chr81967 ------
NM_017413chrX42255 1848 449 65 1746 ----
NM_017415chr563446 1134 1035 923 778 754 --1206 --
NM_017420chr1423521 1002 ------
NM_017423chr42694 489 11856 ----
NM_017437chr1432204 331 194 ------
NM_017440chr121161 --1596 --
NM_017447chr2131424 753 42 ----11528
NM_017450chr172512 58 1350 11206 --
NM_017482chr251571 1537 1439 1060 973 ------
NM_017510chr52618 208 1565 ----
NM_017519chr6------11293
NM_017522chr11905 ----11337
NM_017553chr15275 64 ------
NM_017559chr171264 ------
NM_017582chr131718 624 466 --1695 --
NM_017590chr2242603 850 725 270 164 12266 --
NM_017596chr1124210 4025 3979 3724 3173 1703 1505 1461 1417 973 722 260 --23800 147 --
NM_017602chrX3691 661 77 ------
NM_017610chr151341 ------
NM_017622chr172684 104 ------
NM_017628chr424315 4110 35223 3871 1680 14797 --
NM_017633chr613615 12882 12993 --
NM_017635chr112534 450 --11180 --
NM_017637chr9108732 7275 3154 2921 2704 1948 1417 937 709 366 --23359 45 --
NM_017640chr61228 ------
NM_017641chr12--11173 ----
NM_017658chr1423211 1030 --11103 --
NM_017664chr132676 181 ------
NM_017666chrX41908 1523 703 573 ------
NM_017681chrX1848 ------
NM_017694chr2--11694 ----
NM_017709chr141426 1232 164 92 ------
NM_017712chr19106203 5972 5892 5143 4465 2464 1978 503 400 294 --34591 1679 1302 --
NM_017737chr11371 --12241 --
NM_017742chr1831449 210 189 ------
NM_017749chr111182 1242 ----
NM_017752chrX12141 ------
NM_017753chr91882 ------
NM_017754chr634074 1043 362 ------
NM_017755chr52252 50 --199 --
NM_017758chr1721064 941 1585 ----
NM_017770chr622288 47 ----12008
NM_017780chr81664 ------
NM_017786chr81554 ------
NM_017790chr92530 117 ------
NM_017811chr942240 2106 964 327 ------
NM_017824chr1021980 1707 ------
NM_017848chrX64627 3219 1852 653 438 185 13232 23812 1687 1554
NM_017849chr262845 2529 2491 2025 1279 1069 --11012 --
NM_017851chr153986 970 268 --2963 924 1139
NM_017857chr112676 636 ------
NM_017895chr20174 ------
NM_017896chr2071138 813 738 568 554 307 156 --11380 --
NM_017907chr114482 342 192 84 ------
NM_017922chr14----1250 --
NM_017926chr141889 ------
NM_017929chr2231202 954 395 ------
NM_017933chr211064 ------
NM_017938chrX21740 38 --1119 --
NM_017945chr341217 878 281 159 ------
NM_017955chr141823 ------
NM_017964chr22667 44 ------
NM_017972chr141889 ------
NM_017987chr1031655 632 552 --12004 --
NM_017988chr123669 320 79 ------
NM_017994chr772468 2454 2446 2320 2025 746 74 ----1489
NM_017998chr911022 ------
NM_018011chr131260 ------
NM_018024chr82583 95 --1569 --
NM_018027chr1042775 2037 2002 362 1120 ----
NM_018043chr1111028 ------
NM_018045chr152358 1232 1072 994 384 1369 ----
NM_018046chr521795 693 11329 ----
NM_018047chr52869 809 ------
NM_018054chr163509 212 140 ------
NM_018061chr111181 11730 ----
NM_018064chr62256 227 ------
NM_018071chr14--1136 ----
NM_018072chr11160 ------
NM_018085chr198099 7567 7354 6646 6530 3219 2298 125 69 12339 --16634
NM_018092chr1611244 ------
NM_018101chr131134 972 75 ------
NM_018116chr12548 502 ------
NM_018121chr1022757 1205 ------
NM_018133chr311564 ------
NM_018155chr341387 920 394 171 ------
NM_018157chr1232760 1111 846 1762 --12476
NM_018167chr141368 1348 ----
NM_018179chr123614 551 50 ------
NM_018181chr1821898 772 ------
NM_018184chr342112 1495 571 328 ------
NM_018211chr1----22054 719 11680
NM_018214chr61192 ------
NM_018241chr41956 ----1180
NM_018243chr473128 3112 3055 2641 1610 872 282 ----1582
NM_018244chr203933 364 36 --2851 374 195
NM_018247chr6------11995
NM_018254chr11429 --12199 --
NM_018265chr131994 1891 1795 --1242 --
NM_018268chr52619 349 ------
NM_018287chr1011272 ------
NM_018293chr341102 326 112 95 --1177 --
NM_018299chr832656 2521 425 11137 ----
NM_018302chr422455 2260 ----1499
NM_018307chr171278 ------
NM_018312chr1171905 1882 1863 1840 1776 804 770 ------
NM_018315chr41127 ------
NM_018327chr202754 654 ------
NM_018334chr71201 ------
NM_018351chr1223976 3461 13398 14631 --
NM_018362chr1124049 2763 --13615 --
NM_018364chr133925 3851 3652 ----174
NM_018368chr61223 ------
NM_018371chr831132 1125 467 ------
NM_018374chr721691 750 ------
NM_018388chrX2937 53 --1342 --
NM_018400chr1113312 1913 --131
NM_018403chr343092 2782 1529 1500 --23150 2681 --
NM_018416chr1242597 1807 887 755 --12337 --
NM_018424chr921597 69 --1413 --
NM_018429chr531802 1028 38 ------
NM_018440chr852023 1925 970 503 288 1362 15571 15986
NM_018444chr811945 ------
NM_018448chr121145 ------
NM_018449chr93604 508 35 ------
NM_018451chr13----1794 --
NM_018452chr6_random32770 713 533 ------
NM_018462chr32142 110 --1760 --
NM_018469chr1731374 281 86 ------
NM_018482chr83936 327 309 --11940 --
NM_018490chr1111445 ------
NM_018492chr8126 ------
NM_018566chr153704 3439 1491 845 815 11467 ----
NM_018569chr411557 ------
NM_018590chr101645 ------
NM_018602chr153307 149 87 ------
NM_018638chr1214081 --11433 --
NM_018639chr122398 87 ------
NM_018644chr1132190 1833 45 1660 ----
NM_018650chr132237 1508 86 11477 ----
NM_018657chr31176 ------
NM_018683chr2021703 1079 ------
NM_018695chr51477 ------
NM_018711chr1241451 1027 487 26 11111 ----
NM_018715chr152192 2158 1905 1880 544 --22013 1559 --
NM_018718chr731958 1743 752 ------
NM_018719chr721231 361 ------
NM_018841chr122589 232 --13335 1340
NM_018898chr51220 ------
NM_018899chr51220 ------
NM_018900chr51220 ------
NM_018901chr51220 ------
NM_018902chr51220 ------
NM_018903chr51220 ------
NM_018904chr51220 ------
NM_018905chr51220 ------
NM_018906chr51220 ------
NM_018907chr51220 ------
NM_018908chr51220 ------
NM_018909chr51220 ------
NM_018910chr51220 ------
NM_018911chr51220 ------
NM_018912chr521760 479 ------
NM_018913chr521760 479 ------
NM_018914chr521760 479 ------
NM_018915chr521760 479 ------
NM_018916chr521760 479 ------
NM_018917chr521760 479 ------
NM_018918chr521760 479 ------
NM_018919chr521760 479 ------
NM_018920chr521760 479 ------
NM_018921chr521760 479 ------
NM_018922chr521760 479 ------
NM_018923chr521760 479 ------
NM_018924chr521760 479 ------
NM_018925chr521760 479 ------
NM_018926chr521760 479 ------
NM_018927chr521760 479 ------
NM_018928chr521760 479 ------
NM_018929chr521760 479 ------
NM_018945chr622420 437 13269 --13674
NM_018948chr12984 494 ------
NM_018963chr211486 --31022 1007 247 --
NM_018976chr1212839 11150 11115 --
NM_018993chr2041392 1362 1139 397 --1287 --
NM_018994chr12392 33 ------
NM_018999chr1094543 4331 4054 3492 3296 3048 1223 967 683 ----13747
NM_019000chr51629 ------
NM_019001chr334398 1159 325 ------
NM_019004chr72378 356 ------
NM_019022chr1812806 ------
NM_019036chr61414 1353 ----
NM_019042chr711093 1947 ----
NM_019045chrX2958 370 ------
NM_019053chr1021033 375 1131 ----
NM_019058chr101233 ------
NM_019074chr155868 683 362 310 280 1715 ----
NM_019084chr101354 1345 ----
NM_019094chr1253707 2906 2824 1448 960 23724 552 13791 --
NM_019096chr63778 753 352 --1273 --
NM_019106chr2262593 2112 1198 697 507 102 ------
NM_019114chr932361 2000 147 1975 ----
NM_019116chr1621275 64 --1859 --
NM_019555chr321805 32 1558 11750 --
NM_019557chr11352 ------
NM_019590chr10--1112 21386 1359 --
NM_019592chr91601 ------
NM_019605chr11621 ----1484
NM_019610chr121513 827 --11408 --
NM_019613chr172930 120 ------
NM_019850chr25803 594 494 116 34 ------
NM_019854chr121708 ------
NM_019860chr101609 ------
NM_019895chr32929 227 ------
NM_019903chr101195 21350 1245 ----
NM_020039chr1271741 1656 1586 1487 1371 1212 29 11694 11782 11944
NM_020066chr11787 ------
NM_020140chr12------184
NM_020144chr721429 134 ------
NM_020148chr1843117 2397 2301 258 32770 2481 748 --12556
NM_020159chr4--21737 1431 ----
NM_020177chr532197 1222 256 1543 ----
NM_020178chr172834 828 ------
NM_020179chr112136 74 ------
NM_020182chr2062954 2682 2538 2519 470 162 13561 ----
NM_020193chr1121068 256 ------
NM_020205chr1--13235 33126 2775 2521 --
NM_020228chr1142196 2057 1682 276 12418 ----
NM_020240chr542780 2714 959 620 --1924 --
NM_020245chr634423 3161 1544 --24399 880 --
NM_020248chr172335 2270 2108 1508 871 636 328 1724 --1202
NM_020309chr19--3904 734 110 --161
NM_020342chr231688 817 101 ----12455
NM_020346chr1111101 ------
NM_020348chr1042584 2118 1882 245 12767 12367 12373
NM_020362chr11807 --1151 --
NM_020363chrY31464 1391 1368 ------
NM_020381chr631662 1260 508 --1341 11725
NM_020405chr1734455 788 83 --11610 --
NM_020420chrY31464 1391 1368 ------
NM_020429chr732156 964 264 ------
NM_020443chr152386 1279 1055 967 239 25497 1966 ----
NM_020456chr1332284 1844 1441 --176 --
NM_020463chr2133 ------
NM_020466chr623988 3075 --14254 --
NM_020473chrX----1654 --
NM_020526chr131800 1723 1296 ------
NM_020630chr103681 666 63 ------
NM_020640chr321497 1442 --12024 --
NM_020644chr112971 739 1950 ----
NM_020647chr81211 ------
NM_020651chr211181 ------
NM_020673chr20107408 6627 6180 5958 5250 4988 4714 2892 1237 236 15710 17435 11452
NM_020697chr81230 --11265 --
NM_020699chr135136 1877 1814 ------
NM_020708chr2042478 2339 773 712 11906 ----
NM_020715chr1442153 643 569 531 191 ----
NM_020717chrX63522 1937 1921 1591 858 643 --21306 1095 --
NM_020727chr2133459 3141 2489 ------
NM_020728chr743029 2244 647 311 ------
NM_020732chr6------11293
NM_020734chr1223168 2937 ------
NM_020738chr21200 1329 ----
NM_020739chr1532578 865 818 ------
NM_020748chr1731431 1407 294 ------
NM_020749chr811374 ------
NM_020752chr1022101 705 ------
NM_020755chr62603 252 ------
NM_020760chr21598 ------
NM_020761chr1731921 1261 222 --11347 --
NM_020762chr1231045 404 120 ------
NM_020764chr1611064 ------
NM_020765chr12228 41 ------
NM_020766chrX94223 3777 3684 1672 1580 1175 992 829 212 ------
NM_020769chrX1710 --1837 --
NM_020771chr611501 ------
NM_020772chr1748144 7633 5923 738 --1818 26021 1407
NM_020773chr472183 1868 1845 1833 1784 182 135 1764 ----
NM_020779chr2----1976 22231 1169
NM_020791chr171366 --11144 --
NM_020794chr111576 --11097 --
NM_020795chr1721705 83 11583 11802 --
NM_020796chr552739 2385 2130 909 108 --1986 --
NM_020801chr531858 1789 929 ------
NM_020804chr642579 2473 2048 1845 11744 2864 388 11055
NM_020808chr12304 297 --1954 --
NM_020810chr1423423 1345 --1471 1479
NM_020819chr61307 ------
NM_020820chr2051456 1356 1111 286 75 11010 ----
NM_020824chr101689 ------
NM_020841chr1232747 1018 76 --149 --
NM_020850chr1653089 2718 2576 217 127 ------
NM_020854chr181218 ------
NM_020856chr1911352 ------
NM_020858chr152365 29 ------
NM_020859chr463465 3401 1556 1305 947 354 13195 ----
NM_020870chr431676 1453 606 1305 ----
NM_020873chr31628 ------
NM_020896chr115985 861 348 227 196 --1714 --
NM_020899chr1781979 1727 1566 647 518 470 230 74 --1840 --
NM_020904chr19144 ------
NM_020917chr1953589 2456 1264 865 574 ----11325
NM_020927chr1622328 1484 ------
NM_020935chr284272 3565 3075 3026 1821 1131 463 189 13092 34368 4252 1172 --
NM_020939chr641109 368 168 33 1499 2441 87 --
NM_020948chr1--1637 ----
NM_020949chr3--1183 ----
NM_020967chr202475 44 ------
NM_020971chr191887 ------
NM_020977chr421938 1690 --1839 1257
NM_021007chr2192 11836 ----
NM_021020chr873327 3193 847 526 288 227 151 12149 ----
NM_021025chr51352 ------
NM_021033chr1332191 773 671 11112 ----
NM_021044chr12148 --1142 --
NM_021047chr192487 449 ------
NM_021064chr621369 316 ----11798
NM_021065chr6123 ------
NM_021072chr552521 2247 1757 1064 871 --1131 --
NM_021077chr15----135 --
NM_021079chr1783261 3129 2687 2532 2300 573 394 209 13089 43057 1060 761 503 --
NM_021097chr22999 336 ------
NM_021116chr7108891 8240 7751 1905 1876 1797 1681 798 658 547 11396 23087 151 26583 2895
NM_021120chrX42408 2295 1145 1094 12447 13186 --
NM_021132chr1041340 979 531 433 --11250 --
NM_021137chr1752000 1733 909 868 732 12287 11784 --
NM_021141chr22669 256 ------
NM_021145chr71412 193 1425 --
NM_021148chr721988 1638 --12276 --
NM_021155chr1942544 1150 784 524 11833 1868 --
NM_021174chr81758 ------
NM_021183chrX21959 172 ------
NM_021190chr11468 --1923 --
NM_021202chr2042811 1137 886 624 --1327 --
NM_021215chr2022046 458 ------
NM_021224chr92311 65 ------
NM_021238chr1221388 290 ------
NM_021240chr91207 ------
NM_021249chr1421576 1262 ----11333
NM_021253chr631073 908 486 --11089 --
NM_021627chr311241 --1796 1903
NM_021629chr335074 4072 3671 --24021 1729 --
NM_021637chrX1142 ------
NM_021639chr12320 150 ------
NM_021643chr221860 1339 ------
NM_021644chr1011023 --146 --
NM_021648chr652375 1874 1690 310 239 --1165 --
NM_021649chr51726 1689 ----
NM_021705chr621219 480 ------
NM_021723chr7----1183 --
NM_021813chr641840 1727 1407 1388 13896 --11426
NM_021814chr61606 --1102 --
NM_021825chr11133 ------
NM_021905chr64422 260 128 33 ------
NM_021911chr5----2832 128 14044
NM_021912chr1523600 556 1883 ----
NM_021940chr61146 ------
NM_021943chr64851 767 541 399 --11946 --
NM_021946chrX71241 1230 1203 1170 954 350 308 --1357 --
NM_021949chrX22738 814 ------
NM_021960chr122423 564 11051 --12498
NM_021961chr1137178 5677 2906 --12011 --
NM_021962chr1731732 585 526 ------
NM_021964chr326481 4046 ----1467
NM_021977chr643151 2835 2438 286 13060 12799 12926
NM_021998chrX11289 ------
NM_022037chr2132 ------
NM_022048chr1575529 5271 4569 4083 1467 564 170 --11407 11766
NM_022085chr621011 418 11208 ----
NM_022107chr6138 ------
NM_022118chr131609 ------
NM_022130chr52134 108 --1274 --
NM_022131chr311324 ------
NM_022133chr811755 11633 ----
NM_022138chr641172 1140 336 182 1273 ----
NM_022140chr541952 1840 1584 357 --11485 --
NM_022153chr1093516 3015 1376 1109 1031 679 515 89 80 ----13156
NM_022166chr1665128 4890 4616 3864 2457 1838 170 --15410
NM_022171chr3148 --11597 --
NM_022173chr2132 ------
NM_022334chr22926 851 6818 766 710 430 374 318 ----
NM_022336chr242025 841 821 157 --1806 --
NM_022340chr343570 3385 2659 665 --13192 --
NM_022343chr921070 974 ----11247
NM_022351chr812805 ------
NM_022362chr10192 ------
NM_022368chrX126 ------
NM_022373chr71236 ------
NM_022450chr16177 --1111 --
NM_022459chr1356265 5219 4127 1119 676 ----12531
NM_022462chr1983543 2869 2616 1097 815 313 197 142 --13632 --
NM_022465chr122839 825 ------
NM_022469chr143236 2693 1089 894 ------
NM_022474chr1432102 2062 205 ----12645
NM_022476chr16--1254 150 --
NM_022477chr2021308 85 ------
NM_022497chr362906 2839 564 365 355 272 1297 ----
NM_022553chr61183 --1128 --
NM_022574chr731599 648 555 ------
NM_022644chr172399 180 ------
NM_022648chr284641 4034 3140 2935 1844 1838 1338 1298 11472 ----
NM_022720chr2231591 1349 695 1223 11295 1569
NM_022731chr12238 104 ------
NM_022735chr13506 436 117 ------
NM_022744chr1641270 951 521 300 1865 21018 278 --
NM_022749chr841069 494 419 201 ------
NM_022750chr72521 494 --1678 --
NM_022755chr932323 1798 937 ------
NM_022756chr1--11334 --11313
NM_022758chr652443 2255 1994 898 681 146 --12944
NM_022763chr322699 2143 ------
NM_022768chr1----1117 --
NM_022771chr122948 727 ------
NM_022776chr321340 1221 ------
NM_022780chr221598 207 ------
NM_022781chr932685 2652 85 ------
NM_022802chr10192 ------
NM_022821chr13450 334 101 ------
NM_022826chr211190 ------
NM_022832chr442540 1893 359 124 ------
NM_022841chr15--1566 ----
NM_022842chr352989 2906 2865 2573 2385 1279 ----
NM_022845chr162694 113 ------
NM_022893chr243094 3071 2887 2223 ------
NM_022898chr1464016 3684 3485 3410 1415 1039 --34686 2939 985 --
NM_022912chr252749 2718 528 521 187 --1695 --
NM_022917chr92303 113 --31234 1096 855 --
NM_022970chr1031116 1049 495 ------
NM_023034chr82573 225 ------
NM_023074chr19----1868 --
NM_023076chr1642546 2191 1829 287 --11087 1169
NM_023079chr1731677 1659 167 ------
NM_023105chr831783 1694 365 --2502 145 --
NM_023106chr831783 1694 365 --2502 145 --
NM_023110chr831783 1694 365 --2502 145 --
NM_023111chr831783 1694 365 --2502 145 --
NM_023927chr511170 --11138 --
NM_023929chr832723 2309 2089 ------
NM_023940chr43860 134 31 150 --1983
NM_023943chr31201 ------
NM_024007chr542967 2869 2654 821 ----12562
NM_024019chr41171 ------
NM_024046chr31241 ------
NM_024061chr71232 ------
NM_024076chr1952233 960 794 247 121 11784 21553 745 --
NM_024077chr92789 243 ------
NM_024086chr1753288 2439 1359 953 470 --155 --
NM_024094chr82884 277 ------
NM_024107chr17131 ------
NM_024117chr91217 ------
NM_024294chr652443 2255 1994 898 681 146 --12944
NM_024295chr831305 833 826 ------
NM_024306chr162755 92 ------
NM_024408chr151291 1092 876 572 191 --13295 --
NM_024411chr202369 220 ------
NM_024424chr113959 858 180 ------
NM_024425chr113959 858 180 ------
NM_024426chr113959 858 180 ------
NM_024503chr1130 ------
NM_024524chr3--11009 1552 11254
NM_024529chr1----1167 --
NM_024539chrX21096 60 ----1153
NM_024551chr1232430 296 43 1758 1244 --
NM_024551chr1232430 296 43 1758 1244 --
NM_024554chr131091 104 93 ------
NM_024556chr111420 ------
NM_024563chr531350 1213 726 ------
NM_024569chr152459 2416 2213 549 458 1476 ----
NM_024586chr11550 ------
NM_024595chr13893 859 829 ----1472
NM_024612chr171282 --2826 118 --
NM_024635chr91215 ------
NM_024657chrX--1588 ----
NM_024664chr1177 ------
NM_024665chr3--24357 3490 --1813
NM_024674chr142336 2298 1210 935 --1302 --
NM_024704chr201245 --1370 --
NM_024721chr821979 978 ------
NM_024740chr1133824 3638 3143 --1391 --
NM_024751chr4----12032 --
NM_024787chr81228 --1130 --
NM_024808chr132792 146 ------
NM_024811chr112709 280 ------
NM_024859chrX31078 944 663 ------
NM_024881chr1963392 3322 3246 3187 3163 3149 --1998 --
NM_024920chr411402 ------
NM_024939chr161103 ----1248
NM_024944chr2121278 82 ------
NM_024946chr1621737 314 ------
NM_024947chr399552 8701 8167 7552 6399 2544 2415 2287 1736 170 179 26902 6078
NM_024949chr444814 3649 3451 831 --13829 --
NM_024953chr1241999 1952 408 316 --11736 --
NM_024989chr277449 7190 6309 6107 2391 1572 1269 16380 17024 --
NM_024991chr1042210 900 864 790 ------
NM_025027chr19----1251 --
NM_025054chr844089 2991 968 721 12793 ----
NM_025076chr22535 61 ------
NM_025079chr11502 ------
NM_025106chr131872 1750 126 ------
NM_025141chr152511 34 ------
NM_025146chr31783 ----1631
NM_025160chr131735 269 60 12623 ----
NM_025176chr201152 ------
NM_025179chr184555 4496 4075 4012 1977 1308 1032 895 --13833 --
NM_025222chr342505 2046 1011 125 1686 ----
NM_025230chr145689 430 374 262 179 ------
NM_025234chr15121 ------
NM_025235chr1041395 774 108 59 --11923 --
NM_025248chr17133080 2406 2005 1978 1250 962 941 777 727 629 536 523 282 22977 1176 11201 --
NM_030594chr15197 --2233 26 --
NM_030621chr1424022 2972 ------
NM_030627chr51421 --21657 1116 --
NM_030637chr141738 ----128
NM_030645chr141284 1076 335 24 1403 1358 --
NM_030648chr445344 2026 1467 510 14402 ----
NM_030650chr243884 2847 2808 2676 11532 13045 --
NM_030660chr142956 409 ------
NM_030661chr711391 ------
NM_030664chr1021664 622 ------
NM_030674chr1264934 4519 4511 1565 795 298 --1622 --
NM_030753chr171288 ------
NM_030758chr2221470 84 ------
NM_030762chr1221977 1931 ------
NM_030774chr1131315 600 37 ------
NM_030796chr73757 635 51 1661 ----
NM_030806chr168600 8462 8202 7568 6317 674 29378 968 58971 7325 3052 2838 2685 1928
NM_030809chr1242337 1880 842 635 11967 ----
NM_030810chr621011 418 11208 ----
NM_030877chr20178 ------
NM_030881chr2242330 2288 2128 552 ----12050
NM_030915chr242191 1963 928 696 --1588 --
NM_030918chr184501 4270 4259 2056 2042 1668 498 54 14456 13869 --
NM_030938chr171265 --1881 --
NM_030939chr61338 ------
NM_030964chr522664 902 --12786 --
NM_030978chr9----1465 --
NM_030979chr131171 ------
NM_031243chr731788 785 292 ------
NM_031268chr16125258 5111 4980 3992 3687 2063 1875 1838 1661 1310 751 568 1935 11395 --
NM_031272chr171260 ----134
NM_031296chr441958 997 555 474 ------
NM_031305chr421516 396 ------
NM_031314chr1421519 1393 ------
NM_031371chr131026 628 473 ------
NM_031371chr131026 628 473 ------
NM_031372chr431449 1258 73 ------
NM_031409chr641755 1749 1110 178 ------
NM_031411chr51220 ------
NM_031412chr121234 ------
NM_031417chr1932742 2520 228 --22781 106 --
NM_031424chr204459 386 198 139 --1494 --
NM_031426chr952692 2317 2071 1798 744 11059 ----
NM_031427chr1435811 4499 883 --12155 23664 1841
NM_031442chrX2951 274 ------
NM_031445chr273336 2915 2902 2857 2554 2538 1005 ------
NM_031459chr131635 502 337 21492 1241 ----
NM_031844chr143456 2707 2520 759 13744 ----
NM_031845chr243289 2722 2685 213 ----13260
NM_031847chr243289 2722 2685 213 ----13260
NM_031849chr51220 ------
NM_031857chr51220 ------
NM_031860chr51220 ------
NM_031890chr2252202 1165 1019 937 90 ------
NM_031914chr141157 ------
NM_031953chr4--181 ----
NM_031990chr1951355 429 324 294 276 ------
NM_031991chr1951355 429 324 294 276 ------
NM_032012chr973974 3291 1369 1164 283 248 132 --24923 571 --
NM_032013chr2021308 85 ------
NM_032017chr141858 1738 1566 796 11777 ----
NM_032041chr8----22561 2297 --
NM_032050chr221170 ------
NM_032088chr521760 479 ------
NM_032092chr521760 479 ------
NM_032102chr1122797 338 2554 480 22655 630 --
NM_032105chr1107982 7680 6417 5802 5708 5342 5326 1872 1734 806 14899 26325 3132 15114
NM_032116chr1335708 5164 4310 13750 13729 --
NM_032121chrX2855 524 ------
NM_032139chr191107 --1925 --
NM_032144chr21191 ------
NM_032153chr332676 2307 1070 2983 514 12106 --
NM_032160chr1843824 3668 3490 2993 12883 1173 --
NM_032175chr511303 --11758 11177
NM_032182chr1011446 11264 ----
NM_032193chr1161855 1465 472 420 394 388 ----11668
NM_032199chr1022881 1194 --23375 73 --
NM_032208chr231136 872 783 --1430 --
NM_032211chr1031121 209 195 --1216 1865
NM_032217chr411031 ------
NM_032221chr2011266 --11743 --
NM_032233chr142850 342 ------
NM_032281chr1953120 2735 761 429 361 ------
NM_032283chr12457 140 --132 11502
NM_032294chr1731680 412 371 --1320 1251
NM_032316chr382350 2312 2109 1851 1550 628 157 29 1659 ----
NM_032320chr111531 ------
NM_032345chr12----1108 --
NM_032352chr1421124 988 ------
NM_032364chr122368 330 ------
NM_032373chr1024191 900 15346 ----
NM_032389chr1151174 1159 445 136 24 --2908 323 --
NM_032403chr521760 479 ------
NM_032408chr72979 81 ------
NM_032412chr51253 ------
NM_032430chr19----1296 --
NM_032439chr1011048 --1337 --
NM_032440chr102770 213 ------
NM_032445chr152896 773 ------
NM_032446chr523512 1082 --23682 1350 --
NM_032449chr151836 1145 452 367 133 --22218 927 --
NM_032452chr1451434 1364 522 504 27 ------
NM_032458chrX13370 ------
NM_032505chr322175 768 12409 --11106
NM_032509chr842299 2268 2185 1751 ------
NM_032539chrX--1745 ----
NM_032547chr42960 94 ------
NM_032560chr14191 ------
NM_032569chr164711 682 349 74 11225 ----
NM_032575chr1671672 1396 1387 657 471 452 162 --1190 --
NM_032580chr17129 --1146 --
NM_032582chr1711342 ----11578
NM_032590chr121193 ------
NM_032638chr331457 490 380 --21287 1103 --
NM_032682chr331156 836 672 1685 ----
NM_032689chr1921076 98 ----11534
NM_032711chr1794242 4171 4000 3530 2945 2767 1621 1533 1298 24150 593 13621 --
NM_032737chr1952458 2393 1844 1785 70 --12149 --
NM_032788chr2----21242 1095 --
NM_032802chr151218 ------
NM_032808chr155879 861 725 624 53 ------
NM_032812chr10----1306 --
NM_032826chr775188 4847 4273 4048 3787 330 317 --14396 --
NM_032828chr19114293 4212 4133 4061 3973 3647 3329 3196 1488 428 347 --23277 1462 11005
NM_032833chr122592 1811 1352 1490 11927
NM_032837chr171112 11813 ----
NM_032838chr19----1505 --
NM_032857chr151155 ------
NM_032869chr821876 208 1480 ----
NM_032871chr1141938 447 344 139 21952 756 ----
NM_032875chr171220 ------
NM_032876chr144773 389 213 100 --1434 11732
NM_032880chr11115 ------
NM_032968chrX22669 248 ------
NM_032969chrX22669 248 ------
NM_032973chrY22664 248 ------
NM_032975chr1843087 2700 1011 991 11100 1649 12845
NM_032978chr1811114 ------
NM_032979chr1811114 ------
NM_032980chr1843087 2700 1011 991 11100 1649 12845
NM_032981chr1811114 ------
NM_032998chr131008 846 365 ------
NM_032999chr7--122 ----
NM_033000chr7--122 ----
NM_033001chr7--122 ----
NM_033020chr144503 3356 3306 1864 11272 23285 671 14286
NM_033030chr211385 ------
NM_033036chr1131387 688 654 1267 11233 --
NM_033071chr61157 ------
NM_033089chr202541 469 --11459 --
NM_033116chr142232 89 ------
NM_033117chr9139 ------
NM_033121chr122268 89 ------
NM_033132chr13--1118 ----
NM_033133chr1763298 2345 1445 1414 1324 1195 --1856 --
NM_033181chr623546 3339 --13456 --
NM_033222chr9------11206
NM_033224chr797923 7246 6945 6808 6651 3077 2929 2625 1423 ------
NM_033225chr822597 99 --13107 --
NM_033226chr161101 ------
NM_033227chr5--1469 ----
NM_033228chr5--1509 ----
NM_033255chr132151 25 ------
NM_033266chr16268 28 ------
NM_033278chr11124 ------
NM_033285chr844068 1684 1609 1154 14291 ----
NM_033290chrX43656 2852 2671 355 --13136 --
NM_033300chr11905 ----11337
NM_033310chr11164 ------
NM_033326chr1162339 2091 1862 853 398 116 12073 ----
NM_033331chr942812 885 344 296 --32884 2656 983 22902 483
NM_033340chr1041221 1027 977 81 --1583 --
NM_033360chr1212869 ------
NM_033389chr1754740 4281 4099 3628 692 --11832 --
NM_033394chr21280 --11547 --
NM_033425chr1152174 2138 695 391 25 ------
NM_033429chr1541228 1019 860 768 134 1272 --
NM_033449chr561873 1406 566 525 494 442 ----11687
NM_033480chr642414 1939 802 559 ----12620
NM_033481chr642414 1939 802 559 ----12620
NM_033503chr1553801 2937 2720 1091 776 --33369 2949 2484 12531
NM_033505chr286470 5961 5798 4552 4529 2633 2399 533 ------
NM_033515chr6--1235 ----
NM_033624chr1221480 244 ------
NM_033626chrX61625 1589 1374 1250 1134 544 --1575 --
NM_033631chr123710 1382 1862 23002 614 --
NM_033632chr41127 ------
NM_033642chrX2836 461 ------
NM_033644chr542511 2098 1774 352 ------
NM_033645chr542511 2098 1774 352 ------
NM_044472chr11283 ------
NM_052828chr641426 1364 616 386 ----1405
NM_052834chr1822389 98 ------
NM_052840chr1531489 1420 621 ------
NM_052846chr2031104 497 346 1307 1447 1936
NM_052851chr1311898 12003 --12052
NM_052875chr1142174 2146 850 650 11682 ----
NM_052877chr1148 ------
NM_052879chr1253295 2916 2585 484 455 23180 1175 --13318
NM_052885chr1233904 1679 911 11364 44266 1275 471 437 --
NM_052896chr132478 1860 1623 1316 ----
NM_052898chr821273 164 ----1226
NM_052905chr221879 1823 --11177 --
NM_052907chr1223784 1419 --24145 4129 1406
NM_052911chr182980 312 1414 ----
NM_052927chr5--1352 11726 --
NM_052932chr11----1548 --
NM_052937chr822008 1822 12483 ----
NM_052971chr51152 ------
NM_052978chr1431386 463 170 1240 1481 --
NM_053002chr32890 247 1792 1463 --
NM_053016chr986903 6320 6222 6211 5371 2695 1703 584 --16596 --
NM_053023chr1121031 112 ------
NM_053025chr31653 ------
NM_053026chr31653 ------
NM_053027chr31653 ------
NM_053028chr31653 ------
NM_053031chr31653 ------
NM_053032chr31653 ------
NM_053042chr422317 849 11979 ----
NM_053064chr1422342 2277 --1552 --
NM_053275chr12159 ------
NM_053281chrX1289 ------
NM_054025chr1132190 1833 45 1660 ----
NM_057175chr41867 ------
NM_058163chrX2173 23 1717 ----
NM_058170chr11209 ----1327
NM_058240chr1421455 34 ------
NM_058241chr231762 851 356 ------
NM_058241chr231762 851 356 ------
NM_078470chr1062445 1895 1090 1018 818 454 12246 ----
NM_078471chr1741062 878 253 40 --1290 --
NM_078474chr152511 34 ------
NM_079421chr19----1129 --
NM_080415chr171830 ------
NM_080491chr1143473 2926 1197 573 1177 22891 1450 --
NM_080546chr91231 11522 ----
NM_080550chr172941 828 ------
NM_080599chr101107 ------
NM_080654chr1131294 125 35 2310 176 ----
NM_080664chr1422006 511 ------
NM_080669chr1794787 4577 3476 3139 1947 1861 1252 1180 953 --21259 566 --
NM_080670chr52785 376 1288 --1683
NM_080671chr242047 1747 1733 262 ------
NM_080676chr2033127 968 300 --11024 --
NM_080679chr61666 ------
NM_080680chr61666 ------
NM_080681chr61666 ------
NM_080764chr2252788 2780 2691 746 512 ----1221
NM_080792chr2042286 1935 1662 581 11567 ----
NM_080827chr20168 ------
NM_080867chr1454715 4288 3775 3280 1151 --14193 --
NM_080872chr843246 3021 2911 460 --13904 --
NM_080874chr431349 1215 346 --1438 --
NM_080881chr51224 1163 ----
NM_080927chr342946 2684 402 46 --1640 --
NM_101395chr213990 415 274 ------
NM_130387chr32850 51 --162 --
NM_130391chr933443 3333 389 ------
NM_130392chr933443 3333 389 ------
NM_130393chr933443 3333 389 ------
NM_130436chr214835 816 742 322 ------
NM_130437chr2141369 949 374 233 ------
NM_130438chr2141319 899 324 183 ------
NM_130798chr1521068 1023 11158 ----
NM_130811chr201185 ------
NM_130846chr121709 ------
NM_133264chr1793760 3403 2924 2627 2621 2605 1224 1061 914 ------
NM_133265chrX23475 481 ------
NM_133266chr113338 181 102 ------
NM_133330chr461202 1092 825 757 740 725 11051 11249 --
NM_133331chr461202 1092 825 757 740 725 11051 11249 --
NM_133334chr476218 5987 4898 4536 4088 1921 792 --11260 --
NM_133335chr461202 1092 825 757 740 725 11051 11249 --
NM_133370chr463227 2794 1295 1281 926 681 12270 --32813 2236 1403
NM_133372chr542668 2503 2016 168 ------
NM_133433chr51359 ------
NM_133445chr942591 1367 867 110 ----11429
NM_133452chr195998 337 252 202 32 ------
NM_133486chrX182 --1371 --
NM_133496chr174179 4108 3624 3115 1406 889 210 13249 ----
NM_133499chrX2840 790 ------
NM_133503chr12----1743 --
NM_133504chr12----1743 --
NM_133505chr12----1743 --
NM_133506chr12----1743 --
NM_133507chr12----1921 --
NM_133509chr143954 304 58 11152 ----
NM_133631chr31630 ------
NM_133638chr51195 ------
NM_133647chr1543015 2767 2729 45 ------
NM_133650chr61157 ------
NM_134325chr1127 ------
NM_134421chr23752 731 113 ------
NM_134428chr9--156 ----
NM_134442chr2147 ------
NM_134447chr191634 ------
NM_138270chrX23014 1078 ------
NM_138285chr21410 ------
NM_138288chr1432033 1792 1440 --12134 --
NM_138292chr1132619 1150 178 ----13358
NM_138319chr152910 279 ------
NM_138357chr1021328 204 ------
NM_138415chr2241655 551 292 157 ------
NM_138423chr1531828 686 648 1939 ----
NM_138426chr732473 2451 820 --1499 --
NM_138453chr5----168 --
NM_138457chr6113279 3220 3177 2904 2850 2535 1041 817 733 368 209 --1522 --
NM_138473chr1245132 4752 4197 592 ------
NM_138479chr121733 1465 11302 ----
NM_138492chr51372 --11254 --
NM_138555chr151404 ------
NM_138576chr1464016 3684 3485 3410 1415 1039 --34686 2939 985 --
NM_138578chr2031276 423 211 11326 21143 1093 --
NM_138621chr253829 1162 1129 996 407 --14084 --
NM_138713chr1668100 2879 2432 1488 917 419 --17322 15162
NM_138714chr1668100 2879 2432 1488 917 419 --17322 15162
NM_138717chr62157 55 --1566 --
NM_138735chr21548 ------
NM_138766chr51156 ------
NM_138771chr7----179 --
NM_138779chr13----1221 --
NM_138795chr12597 294 ------
NM_138799chr221375 806 --11597 --
NM_138821chr51156 ------
NM_138822chr51156 ------
NM_138961chr111402 176 ----
NM_138966chr181621 ------
NM_138970chr1441896 914 602 319 --1374 --
NM_138971chr1143356 2669 2488 781 --13613 12580
NM_138971chr1143356 2669 2488 781 --13613 12580
NM_138972chr1143356 2669 2488 781 --13613 12580
NM_138972chr1143356 2669 2488 781 --13613 12580
NM_138973chr1143356 2669 2488 781 --13613 12580
NM_138973chr1143356 2669 2488 781 --13613 12580
NM_138980chr41233 ------
NM_138982chr41233 ------
NM_139015chr1221618 1368 --182 --
NM_139045chr91694 1298 ----
NM_139046chr102216 78 ------
NM_139047chr10182 ------
NM_139049chr10182 ------
NM_139057chr1572353 1977 1801 1025 953 471 193 11047 1901 --
NM_139062chr174172 147 60 50 ----1485
NM_139071chr123414 332 84 --2594 247 --
NM_139076chr41244 ------
NM_139125chr33331 120 24 ----1484
NM_139131chr112541 524 ------
NM_139135chr11351 ----11268
NM_139166chr8140 ------
NM_139168chr51265 ------
NM_139169chr102424 181 ------
NM_139177chr1741431 1233 618 58 --1388 --
NM_139207chr1231701 894 716 ------
NM_139244chr61157 ------
NM_139245chr351364 1263 142 134 54 --11255 --
NM_139246chr962213 935 921 854 484 395 11781 1825 11614
NM_139278chr831150 378 22 ----11071
NM_139283chr1252349 935 534 496 234 2892 726 12362 --
NM_139323chr2021601 1318 --1646 --
NM_144571chr425923 5516 ------
NM_144579chr2102831 2765 2387 2213 2189 2027 1850 836 539 436 22469 2037 12773 --
NM_144582chr262612 2302 2259 2053 389 110 ----12201
NM_144599chr1525236 127 --14997 14664
NM_144600chr162433 362 --1624 --
NM_144609chr1721182 468 --11213 --
NM_144610chr17----1389 --
NM_144625chr1--1283 ----
NM_144632chr211708 21596 293 --1343
NM_144633chr33405 330 231 ------
NM_144644chr4121 ------
NM_144664chr1131575 1013 919 ----12470
NM_144667chr125952 773 429 312 195 ------
NM_144721chr422528 351 --12430 --
NM_144723chr51620 1608 131 --
NM_144728chr11666 ------
NM_144729chr11666 ------
NM_144767chr1594583 4315 4304 2972 1663 1534 1430 848 275 14219 ----
NM_144778chr13--1576 ----
NM_144949chr21669 --12488 --
NM_144967chrX2277 187 1667 ----
NM_144973chr1224109 1015 1937 1894 --
NM_145010chr1022193 1945 --11558 --
NM_145021chr102276 127 ------
NM_145049chr51123 ------
NM_145055chr1833733 927 869 --11295 --
NM_145109chr173854 685 284 ------
NM_145119chrX126 ------
NM_145175chr251328 1189 1022 449 331 ------
NM_145203chr13----1732 --
NM_145206chr1022702 1075 11227 --12158
NM_145259chr235813 5680 570 --25819 5792 --
NM_145284chrX22518 1764 ------
NM_145296chr195827 742 34 28 22 ------
NM_145307chr1044401 3754 3390 3179 1535 ----
NM_145313chr1021279 438 11451 ----
NM_145320chr713176 ------
NM_145321chr713176 ------
NM_145322chr713176 ------
NM_145341chr101536 ------
NM_145349chr1721966 1576 --12047 --
NM_145350chr1731318 558 487 --11399 --
NM_145638chr115985 861 348 227 196 --1714 --
NM_145644chr21358 ------
NM_145647chr82173 162 ------
NM_145690chr821707 289 ------
NM_145735chr132905 403 1152 --12527
NM_145793chr101875 ------
NM_145804chr112842 34 1551 ----
NM_145808chr732590 2065 47 ------
NM_145891chr161453 158 ----
NM_145892chr161453 158 ----
NM_145893chr161575 1180 ----
NM_145899chr64438 420 404 223 ------
NM_145901chr64438 420 404 223 ------
NM_145902chr64438 420 404 223 ------
NM_145903chr64438 420 404 223 ------
NM_145904chr64438 420 404 223 ------
NM_145905chr64438 420 404 223 ------
NM_145909chr62543 262 --1151 --
NM_146388chr192497 43 2884 844 ----
NM_147150chr953383 3198 2734 2713 1401 ------
NM_147156chr101327 ------
NM_147175chrX1597 ------
NM_147189chr831789 359 160 ------
NM_147223chr241663 1527 724 486 ------
NM_147233chr231480 541 303 ------
NM_148174chr822226 1852 ------
NM_148571chr1721759 1409 --1240 --
NM_148894chr42968 26 ------
NM_148898chr71285 ------
NM_148899chr71285 ------
NM_148904chr11550 ------
NM_148905chr11550 ------
NM_148906chr11550 ------
NM_148907chr11550 ------
NM_148908chr11550 ------
NM_148909chr11550 ------
NM_152222chr1141938 447 344 139 21952 756 ----
NM_152227chr201616 ------
NM_152233chr1421576 1262 ----11333
NM_152237chr2241549 1318 281 130 --159 --
NM_152238chr11239 ------
NM_152244chr172463 415 ----11217
NM_152247chr221239 ------
NM_152261chr121138 ------
NM_152263chr135980 4791 2349 15220 --12195
NM_152265chr121129 577 ------
NM_152267chr222662 75 ----1730
NM_152271chr82975 364 ------
NM_152280chr173017 2832 2711 1311 876 730 439 12964 ----
NM_152289chr1931309 1062 99 --21706 1284 --
NM_152300chr172647 234 --1730 --
NM_152332chr1442718 2635 2589 1879 ------
NM_152335chr152621 109 ------
NM_152342chr163535 488 197 ------
NM_152344chr1731179 546 58 ------
NM_152365chr1192 --149 --
NM_152375chr152471 2252 2142 2108 1785 --12319 --
NM_152380chr131176 656 271 ------
NM_152388chr211378 11131 1463 --
NM_152407chr551307 611 228 172 128 --12391 --
NM_152408chr5142 ------
NM_152410chr6----1127 --
NM_152414chr8--11221 ----
NM_152423chrX--11472 11189 --
NM_152424chrX74358 4271 3784 3151 2963 1815 558 136 1620 14281
NM_152437chr12--12051 12021 --
NM_152440chr122416 71 1846 ----
NM_152450chr1511486 1142 ----
NM_152470chr1864112 1334 1143 817 770 724 ----12526
NM_152493chr131460 479 452 ------
NM_152520chr2------1354
NM_152538chr331550 1281 1272 1470 ----
NM_152549chr5----1210 --
NM_152570chr91125 ------
NM_152574chr9----1159 --
NM_152594chr1511491 ------
NM_152624chr567402 6532 5488 5470 1994 1489 24746 2812 14926 --
NM_152629chr943086 2697 1262 493 ------
NM_152641chr1222467 2110 ------
NM_152652chr163281 221 75 ------
NM_152660chr1----1651 --
NM_152688chr6153 ------
NM_152695chrX21957 1667 ------
NM_152713chr111215 ------
NM_152724chr102280 25 ------
NM_152733chr686302 6242 6148 4573 4270 2532 1104 321 25936 5733 22200 914 25124 1976
NM_152734chr685386 4718 4529 3862 3345 1313 733 418 --21511 868 --
NM_152758chr842457 2360 2244 1010 ------
NM_152787chrX43640 3098 684 130 12748 ----
NM_152788chr12------184
NM_152829chr74965 884 846 47 ------
NM_152835chr112705 1659 ----
NM_152836chr811755 11633 ----
NM_152837chr811755 11633 ----
NM_152838chr2033451 2943 947 ------
NM_152860chr123620 498 205 ------
NM_152896chr9135 ------
NM_152902chr111493 ------
NM_152924chr1566318 4523 4246 2291 1831 508 ------
NM_152989chr1221729 385 ------
NM_152995chr43738 729 239 ------
NM_153028chr162265 205 ------
NM_153029chr1673901 3163 3043 2944 2514 1545 1398 --1831 --
NM_153181chr181621 ------
NM_153183chrX21180 221 ------
NM_153188chr545071 4965 4387 2188 ------
NM_153207chr1233901 3572 944 ------
NM_153228chr17192 ------
NM_153235chr6--11855 ----
NM_153260chr151275 --1588 --
NM_153280chrX177 ------
NM_153321chr171958 ------
NM_153322chr171958 ------
NM_153333chrX1174 ------
NM_153343chr421567 488 --1818 --
NM_153367chr1073740 3493 3429 2945 1445 241 116 ------
NM_153450chr113616 336 62 ------
NM_153487chr693735 3693 3102 1792 1713 1096 733 429 127 13344 --11579
NM_153499chr1252735 2651 2500 1885 595 --42740 2488 2034 2029 1939
NM_153500chr1252735 2651 2500 1885 595 --42740 2488 2034 2029 1939
NM_153607chr512474 ------
NM_153616chr152365 29 ------
NM_153617chr152365 29 ------
NM_153618chr152365 29 ------
NM_153619chr1521267 175 ----12387
NM_153631chr711391 ------
NM_153632chr711391 ------
NM_153693chr121631 ------
NM_153705chr1132373 809 117 12195 ----
NM_153756chr141756 1376 768 489 11327 2405 146 --
NM_153757chr41265 ------
NM_153810chr1053709 3543 3276 1802 503 --14542 --
NM_170662chr31187 ------
NM_170665chr1273689 2956 2791 1815 1521 598 542 --21070 886 --
NM_170674chr1511198 ------
NM_170675chr151874 ------
NM_170676chr151874 ------
NM_170677chr1511198 ------
NM_170679chr511118 ------
NM_170706chr144164 4043 1663 1360 ------
NM_170711chr193882 665 28 --1591 --
NM_170731chr1142696 2644 2605 877 11119 1523 --
NM_170732chr1142696 2644 2605 877 11119 1523 --
NM_170733chr1142696 2644 2605 877 11119 1523 --
NM_170734chr1142696 2644 2605 877 11119 1523 --
NM_170735chr1142696 2644 2605 877 11119 1523 --
NM_170751chr621065 480 ------
NM_170752chr621065 480 ------
NM_170774chr2053509 2597 1663 1637 929 --1937 --
NM_171998chrX2959 286 11673 11908 --
NM_171999chr182762 139 ------
NM_172016chr631073 908 486 --11089 --
NM_172069chr242132 928 914 297 ------
NM_172070chr211419 ----1519
NM_172071chr156398 2620 2172 2017 1718 17186 --16113
NM_172103chr621770 199 ------
NM_172105chr621770 199 ------
NM_172169chr1061736 1721 1408 625 493 388 174 1478 --
NM_172170chr1061736 1721 1408 625 493 388 174 1478 --
NM_172171chr1061736 1721 1408 625 493 388 174 1478 --
NM_172173chr1061736 1721 1408 625 493 388 174 1478 --
NM_172206chr1731680 412 371 --1320 1251
NM_172226chr1252735 2651 2500 1885 595 --42740 2488 2034 2029 1939
NM_172315chr1511198 ------
NM_172316chr1511198 ------
NM_172373chr13--11275 ----
NM_173065chr153452 3125 2737 2323 1260 ------
NM_173074chr22346 83 ------
NM_173075chr4------11615
NM_173076chr2141 ------
NM_173084chr37859 821 602 401 338 246 32 ----1485
NM_173214chr1668100 2879 2432 1488 917 419 --17322 15162
NM_173353chr12297 44 ------
NM_173354chr212129 74 --11536 --
NM_173359chr33777 760 245 ------
NM_173468chr445000 3681 2255 732 ------
NM_173470chrX42782 2771 2005 418 --12812 --
NM_173476chr1652026 1752 1586 1507 256 --21870 276 --
NM_173478chr1711094 ------
NM_173489chr5126 ------
NM_173495chrX32579 479 168 12347 ----
NM_173500chr1531354 1035 497 ----11179
NM_173510chr2232837 1031 224 --12536 --
NM_173511chr233443 3217 494 ------
NM_173515chr62643 202 ------
NM_173525chr11160 ------
NM_173531chr1933224 2662 1563 --12531 --
NM_173552chr32411 317 ------
NM_173564chr72730 176 --1688 --
NM_173595chr1255297 4416 3880 559 33 --1172 --
NM_173602chr1252942 1342 1316 1220 605 12818 11482 --
NM_173609chr152756 617 ------
NM_173642chr1149130 8901 8569 7895 6541 6333 5956 3217 2460 2300 2045 1809 975 735 18949 38314 5623 159 --
NM_173664chr551309 1089 514 141 78 ------
NM_173672chr612560 ------
NM_173694chrX22042 289 --12019 --
NM_173809chr1041412 1401 1154 1037 ------
NM_173822chr221848 378 ------
NM_173825chr312726 ------
NM_173854chr132051 1719 326 --22286 646 1202
NM_174909chr51818 ------
NM_174934chr1193579 3409 2890 2671 2430 2223 1054 657 431 ----13131
NM_175061chr711674 ------
NM_175624chr1266745 5188 4909 2851 2279 540 ------
NM_175625chr1266745 5188 4909 2851 2279 540 ------
NM_175630chr22215 45 --2357 85 1598
NM_175634chr821005 953 ------
NM_175635chr821005 953 ------
NM_175636chr821005 953 ------
NM_175733chr1152090 2039 1675 1606 142 --12015 --
NM_175747chr61376 ------
NM_175847chr1951355 429 324 294 276 ------
NM_175848chr202314 290 ------
NM_175848chr202314 290 ------
NM_175849chr202314 290 ------
NM_175849chr202314 290 ------
NM_175850chr202314 290 ------
NM_175850chr202314 290 ------
NM_175854chr1311013 1823 ----
NM_175856chr52630 127 ------
NM_175863chr6------11293
NM_175873chr52300 147 1245 141 11186
NM_175884chr72353 230 ----1934
NM_175907chr1852532 1996 620 401 258 12684 ----
NM_175931chr1631782 709 82 12010 61911 1879 1847 1815 438 97 --
NM_176795chr111422 ------
NM_176823chr153817 2475 575 499 207 13052 12860 --
NM_177398chr151692 1566 1261 1248 70 --11346 --
NM_177399chr151692 1566 1261 1248 70 --11346 --
NM_177438chr1424022 2972 ------
NM_177441chr17131 ------
NM_177454chr21292 --1184 --
NM_177925chr1232639 2605 2534 12403 1326 --
NM_177968chr21463 ----11436
NM_177972chr1173916 3745 3565 1528 1423 1291 626 11568 11455 --
NM_177974chr1531828 686 648 1939 ----
NM_177983chr21124 ------
NM_177989chr31361 ------
NM_177996chr2052684 2656 2567 2248 1303 --11376 23247 2294
NM_177999chr963628 3585 3271 2971 1458 191 --33391 3148 471 --
NM_178006chr1311898 12003 --12052
NM_178007chr1311898 12003 --12052
NM_178010chr1221729 385 ------
NM_178037chr1252891 2814 2583 972 560 ------
NM_178038chr1252891 2814 2583 972 560 ------
NM_178042chr31361 ------
NM_178126chr173689 651 501 --1126 --
NM_178135chr411111 ------
NM_178151chrX65483 5253 5149 5135 4785 1605 12129 14864 --
NM_178152chrX65483 5253 5149 5135 4785 1605 12129 14864 --
NM_178153chrX65483 5253 5149 5135 4785 1605 12129 14864 --
NM_178313chr221860 63 ------
NM_178426chr131582 1498 460 ------
NM_178427chr131482 1398 360 ------
NM_178450chr51505 1111 ----
NM_178454chr1----1636 1559
NM_178470chrX2240 100 ------
NM_178496chr331566 1402 1334 ------
NM_178526chr1951907 1901 1290 1258 144 1136 ----
NM_178539chr1241774 1731 445 145 --11571 --
NM_178565chr821341 1075 ------
NM_178566chr91577 --11829 --
NM_178585chr432580 594 32 ------
NM_178586chr1432347 2336 2107 ------
NM_178812chr821490 1323 --1625 --
NM_181050chr16----1132 --
NM_181349chr732156 964 264 ------
NM_181351chr1152410 2214 2026 1921 1143 ------
NM_181354chr8------11382
NM_181357chr145689 430 374 262 179 ------
NM_181358chr143188 3078 2855 523 --13269 --
NM_181443chr20------12665
NM_181457chr211249 ------
NM_181458chr221382 44 ------
NM_181460chr211195 ------
NM_181504chr554026 3287 3246 3013 988 ----1421
NM_181507chr111357 ------
NM_181508chr111357 ------
NM_181521chr1666408 4956 4512 2082 1819 836 36546 5465 5320 27028 6363 --
NM_181523chr554026 3287 3246 3013 988 ----1421
NM_181524chr554026 3287 3246 3013 988 ----1421
NM_181571chr102913 82 ----1890
NM_181655chr172610 67 ------
NM_181656chr172819 276 ------
NM_181659chr2022988 638 --22192 1142 --
NM_181659chr2022988 638 --22192 1142 --
NM_181672chrX1271 11343 ----
NM_181673chrX1271 11343 ----
NM_181689chr201740 ------
NM_181825chr221307 ------
NM_181828chr2253361 3160 3042 1302 43 11194 ----
NM_181829chr2253361 3160 3042 1302 43 11194 ----
NM_181830chr2253361 3160 3042 1302 43 11194 ----
NM_181832chr2253376 3175 3057 1317 58 11209 ----
NM_181838chr521391 647 1541 ----
NM_181839chr821280 219 ------
NM_182314chrX31575 1218 562 ------
NM_182485chr421371 195 --153 1704
NM_182493chr1655306 4985 1918 676 90 --14840 --
NM_182501chr282965 2895 2279 1303 1126 672 595 121 --22493 755 --
NM_182503chr644704 4593 4165 1533 15291 35526 5478 5340 --
NM_182520chr22------1911
NM_182526chr1471972 902 599 530 469 269 23 1372 12724 22395 859
NM_182527chr2272100 1839 1599 1559 666 539 123 1860 2246 179 --
NM_182528chr22199 154 ------
NM_182537chr31303 ------
NM_182551chr243521 3244 2466 970 ------
NM_182620chr1741689 547 396 120 --1349 --
NM_182641chr17--11937 ----
NM_182646chr421371 195 --153 1704
NM_182649chr20----1200 --
NM_182687chr161188 ------
NM_182691chr71102 ------
NM_182692chr71102 ------
NM_182700chr751771 1715 1550 479 218 ------
NM_182715chr72217 99 ------
NM_182717chr1021318 487 ----11295
NM_182718chr102913 82 ----1890
NM_182719chr102913 82 ----1890
NM_182720chr1021318 487 ----11295
NM_182721chr1021318 487 ----11295
NM_182722chr1021318 487 ----11295
NM_182723chr1021318 487 ----11295
NM_182724chr102913 82 ----1890
NM_182725chr102913 82 ----1890
NM_182756chr2----1418 --
NM_182758chr1533820 3642 2453 ------
NM_182765chr1021841 505 ------
NM_182769chr102913 82 ----1890
NM_182770chr102913 82 ----1890
NM_182771chr102913 82 ----1890
NM_182772chr102913 82 ----1890
NM_182797chr2031583 1213 471 ------
NM_182830chr142718 701 --1415 --
NM_182848chr131193 ------
NM_182850chr102913 82 ----1890
NM_182853chr1021318 487 ----11295
NM_182896chr321629 440 ------
NM_182898chr752354 1554 1031 121 22 ------
NM_182899chr752354 1554 1031 121 22 ------
NM_182907chr642339 2036 975 73 ------
NM_182917chr31156 ------
NM_182918chr2131270 1047 303 --11360 --
NM_182920chr311228 ------
NM_182936chr1421455 34 ------
NM_182948chr121005 427 --12867 12923
NM_182961chr61157 ------
NM_182970chr20114320 3447 3269 3185 3119 1651 1468 1365 1189 1151 678 --43702 3544 1462 35 --
NM_182972chr162561 2254 2243 1937 1849 651 ------
NM_183002chr1421455 34 ------
NM_183004chr1443819 1586 953 146 --33205 2625 1461 1100
NM_183006chr2031283 1121 157 ------
NM_183011chr1021318 487 ----11295
NM_183012chr1021318 487 ----11295
NM_183013chr1021318 487 ----11295
NM_183043chr131367 ------
NM_183044chr131367 ------
NM_183060chr102913 82 ----1890
NM_183079chr2031426 1250 1066 ------
NM_183227chr611386 ------
NM_183234chr1511727 ----1669
NM_183235chr1511727 ----1669
NM_183236chr1511727 ----1669
NM_183376chr1522382 1687 1516 ----
NM_183393chr311028 ------
NM_183394chr311028 ------
NM_183398chr521139 1057 ------
NM_183399chr521139 1057 ------
NM_183400chr521139 1057 ------
NM_183401chr521139 1057 ------
NM_184231chr31183 ------
NM_194247chr233439 3428 1701 23650 3542 ----
NM_194285chr1132177 1319 722 ------
NM_194286chr12136156 5607 5428 4406 3763 2495 2426 2320 1413 1199 962 834 220 13927 25211 4763 13920
NM_194317chr232159 1748 1725 12042 --22626 79
NM_194328chr932685 2652 85 ------
NM_194329chr932685 2652 85 ------
NM_194330chr932685 2652 85 ------
NM_194332chr932685 2652 85 ------
NM_194442chr12496 367 ----1576
NM_194449chr182613 326 ------
NM_194463chrX21096 60 ----1153
NM_197939chr171195 --1461 --
NM_197956chr94831 306 84 78 ------
NM_197968chr131692 ------
NM_197970chr211385 ------
NM_198040chr171092 1003 862 432 388 376 251 --1899 --
NM_198047chr21528 ------
NM_198057chrX31119 275 217 ------
NM_198066chr1432577 2333 285 12957 ----
NM_198086chr144773 389 213 100 --1434 11732
NM_198128chr182851 743 ------
NM_198147chr172950 209 ------
NM_198158chr31879 ------
NM_198159chr31879 ------
NM_198177chr31879 ------
NM_198178chr31879 ------
NM_198217chr131198 ------
NM_198218chr131198 ------
NM_198219chr131198 ------
NM_198225chr1031976 746 359 1261 ----
NM_198236chr12282 167 ----156
NM_198241chr31156 ------
NM_198242chr31156 ------
NM_198244chr31156 ------
NM_198268chr143188 3078 2855 523 --13269 --
NM_198269chr143188 3078 2855 523 --13269 --
NM_198270chrX32812 2494 2402 ------
NM_198279chrX2512 418 --1472 --
NM_198291chr2041933 1905 1308 392 ----2567 180
NM_198391chr2011397 ------
NM_198393chr171260 ----134
NM_198401chr831553 1415 46 --1528 --
NM_198513chr831780 1718 230 1640 ----
NM_198530chr1731242 1028 1007 --11209 --
NM_198549chr142885 2733 2480 204 ------
NM_198560chr383660 3427 3007 1510 1443 804 703 565 23374 208 4869 745 293 169 133
NM_198567chr5------1199
NM_198597chr101916 ------
NM_198793chr342641 411 321 75 --1792 --
NM_198844chr171904 ------
NM_198859chr354978 4289 3638 3475 640 --199 --
NM_198889chr411031 ------
NM_198896chr1142157 2144 341 86 ------
NM_198901chr711031 --11199 --
NM_198902chr154608 135 77 30 ------
NM_198956chr751771 1715 1550 479 218 ------
NM_198969chr192875 264 ------
NM_198970chr192875 264 ------
NM_198993chr1731280 555 421 --1139 --
NM_199040chr1253707 2906 2824 1448 960 23724 552 13791 --
NM_199160chr951850 1716 558 324 95 1537 ----
NM_199168chr101391 1154 --1450
NM_199169chr2062954 2682 2538 2519 470 162 13561 ----
NM_199170chr2062954 2682 2538 2519 470 162 13561 ----
NM_199171chr2062954 2682 2538 2519 470 162 13561 ----
NM_199188chr1253295 2916 2585 484 455 23180 1175 --13318
NM_199190chr1253295 2916 2585 484 455 23180 1175 --13318
NM_199192chr2135 ------
NM_199193chr2135 ------
NM_199205chr81758 ------
NM_199229chr221735 1099 ------
NM_199245chr1222275 250 1896 ----
NM_199262chr17182 --21854 838 --
NM_199286chr121374 ------
NM_199320chr41858 1298 ----
NM_199320chr41858 1298 ----
NM_199321chr171904 ------
NM_199324chr41320 ------
NM_199334chr171485 --1417 --
NM_199355chr1621531 39 --11537 --
NM_199413chr15131 2262 132 ----
NM_199421chr1454715 4288 3775 3280 1151 --14193 --
NM_199436chr243048 2535 1238 273 ------
NM_199437chr1142196 2057 1682 276 12418 ----
NM_199438chr1142196 2057 1682 276 12418 ----
NM_199439chr1142196 2057 1682 276 12418 ----
NM_199461chr1032911 624 393 --13489 --
NM_199462chr184683 4497 3906 3364 3273 1794 1574 274 --23913 1276 --
NM_199464chr13147 ------
NM_199478chrX2703 472 ------
NM_199482chr211525 --21872 785 --
NM_199487chr203933 364 36 --2851 374 195
NM_201266chr232557 2158 351 1765 ----
NM_201279chr232557 2158 351 1765 ----
NM_201280chr61661 --11604 1383
NM_201413chr212751 215 ------
NM_201414chr212751 215 ------
NM_201432chr1755758 1555 1292 906 541 --25249 1902 --
NM_201433chr1755758 1555 1292 906 541 --25249 1902 --
NM_201591chr421794 754 ------
NM_201592chr421794 754 ------
NM_201599chrX5990 337 222 201 158 --11185 --
NM_201624chr111249 ------
NM_201628chr152623 1110 1096 833 715 12279 1822 --
NM_201999chr421137 819 ------
NM_203283chr4------1589
NM_203284chr4------1589
NM_203301chr1411255 ------
NM_203305chr942304 2081 1043 428 --12232 --
NM_203307chr1921379 589 ------
NM_203318chr1741062 878 253 40 --1290 --
NM_203327chr2064484 3865 3192 729 594 338 23822 1527 21585 23 11326
NM_203329chr1196473 6454 5402 4758 2709 2320 2301 1899 735 25718 4999 25416 1756 11532
NM_203330chr1196473 6454 5402 4758 2709 2320 2301 1899 735 25718 4999 25416 1756 11532
NM_203331chr1196473 6454 5402 4758 2709 2320 2301 1899 735 25718 4999 25416 1756 11532
NM_203342chr143184 3140 1224 732 22888 2262 ----
NM_203343chr143184 3140 1224 732 22888 2262 ----
NM_203344chr192589 112 --150 --
NM_203346chr272209 2073 1695 1622 1557 298 178 ------
NM_203349chr1521931 1727 --1672 --
NM_203382chr511061 --11576 --
NM_203391chrX------1154
NM_203394chr1212142 ------
NM_203399chr12337 213 ------
NM_203401chr12337 213 ------
NM_203446chr2142545 772 470 287 ------
NM_203459chr1--12044 ----
NM_203463chr244810 4394 4246 1745 24485 3360 14838 13402
NM_203504chr442478 2464 711 78 11935 ----
NM_203505chr442478 2464 711 78 11935 ----
NM_203506chr1731974 1586 610 ------
NM_205768chr121760 1522 177 --1295
NM_205846chr51372 --11254 --
NM_205848chr122554 746 ------
NM_205860chr132511 851 390 ----12951
NM_206594chr122263 962 ------
NM_206595chr122263 962 ------
NM_206819chr121233 ------
NM_206820chr121233 ------
NM_206821chr121233 ------
NM_206839chr151525 ------
NM_206853chr644033 3741 2901 364 12589 ----
NM_206854chr655294 5002 4162 1625 1244 13850 13624 --
NM_206855chr646259 5967 5127 2209 14815 14589 --
NM_206876chr221153 832 ------
NM_206907chr53708 556 254 ------
NM_206909chr888022 5494 5127 3275 2976 2121 1754 842 17549 ----
NM_206914chr122486 227 ------
NM_207012chr1033347 2667 339 ----12234
NM_207043chr112182 ------
NM_207044chr112182 ------
NM_207047chr112182 ------
NM_207121chr204459 386 198 139 --1494 --
NM_207171chr141527 680 551 65 --12001 --
NM_207299chr91882 ------
NM_207303chr1043642 446 230 71 ------
NM_207304chr13--1463 ----
NM_207332chr8171 ------
NM_207351chr31188 --156 --
NM_207356chr11586 1613 ----
NM_207371chr1011491 ------
NM_207372chr1072372 2322 1767 1756 680 174 88 ------
NM_207380chr15133569 3377 3180 3127 3004 2325 988 755 530 390 287 167 98 --22345 568 --
NM_207391chr193976 851 449 1518 177 --
NM_207406chr465988 5927 4014 2300 2117 1949 ------
NM_207412chr81312 --1126 21367 332
NM_207422chrX21058 146 ------
NM_207429chr112600 389 1372 ----
NM_207577chr1172874 2640 2529 954 565 526 152 --12741 --
NM_207645chr1121302 967 ------
NM_212460chr741426 289 194 46 --1602 --
NM_212467chr1542154 1855 535 319 --1676 --
NM_212471chr1721965 845 ------
NM_212472chr1721965 845 ------
NM_212551chr11302 --2158 90 --
NM_213589chr234279 4107 861 --25519 3573 --
NM_213654chr3----1366 11479
NM_213662chr1762188 2167 2089 1917 1669 1623 ------