TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5706
miRNA Sequence: UUCUGGAUAACAUGCUGAAGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521872 359 2832 556 --11477
NM_000084chrX126910 6479 6388 5976 5685 2600 2474 2398 987 750 515 501 --15436 16414
NM_000112chr584141 4020 3951 3631 1994 1950 1725 1558 25486 1660 11812 --
NM_000217chr1274920 4696 4607 2115 2039 1109 274 54191 3793 3612 3409 803 1668 --
NM_000259chr15126152 5652 5614 4895 3993 2533 2486 2180 1955 1434 1375 872 26160 4916 11347 --
NM_000332chr6146645 6602 6468 6335 5525 5180 4956 4501 2410 1776 1488 1058 486 242 26292 1875 25615 52 15897
NM_000337chr532600 1912 1330 --34308 2182 385 26597 345
NM_000368chr994546 3863 3813 3274 1769 1443 1135 386 89 44487 655 567 460 13897 --
NM_000390chrX13422 33101 2788 371 23356 480 --
NM_000411chr2183252 2864 2827 2456 1295 1048 890 656 1764 1324 --
NM_000439chr512024 1189 22188 688 1589
NM_000448chr1173174 3142 3132 2671 2411 992 674 12477 --11066
NM_000489chrX42899 2365 1272 1151 13402 --12994
NM_000618chr12106187 4808 4102 2577 2195 1761 1120 1080 381 332 15242 22203 1356 --
NM_000618chr12106187 4808 4102 2577 2195 1761 1120 1080 381 332 15242 22203 1356 --
NM_000686chrX41346 1195 474 149 21432 1149 1295 1987
NM_000719chr12126465 6295 5958 5206 5025 4752 4339 4329 4242 2250 1585 502 2460 65 12443 16592
NM_000724chr1061822 1726 735 710 486 384 11532 ----
NM_000726chr261254 1167 978 590 494 175 ----1913
NM_000793chr1484702 4633 4451 4113 3526 2059 1253 267 24029 3834 ----
NM_000813chr51988 34660 4567 2118 11000 192
NM_000814chr1543916 3524 943 787 33807 2679 1171 13099 11128
NM_000831chr1146083 5361 5336 5062 4761 4459 4037 2504 2023 1772 1439 1326 1204 301 26317 5270 ----
NM_000899chr1223317 387 1346 33709 3049 1611 22895 163
NM_000912chr8133371 3259 3223 2827 2692 1344 1297 1029 925 690 463 389 58 --1412 --
NM_000962chr982876 2745 2626 2310 1228 1011 212 53 42325 475 375 185 1701 1431
NM_001001396chr1104247 4220 3750 3557 2854 2765 1371 1284 677 512 21406 984 --124
NM_001001419chr534487 2098 584 34859 408 243 13280 --
NM_001001420chr534487 2098 584 34859 408 243 13280 --
NM_001001664chr263893 3713 3424 1621 1580 49 156 ----
NM_001001669chr542433 2325 674 334 22569 419 21927 662 21994 994
NM_001001890chr2164280 4101 2935 1142 1135 785 33481 2920 2675 --1950
NM_001002814chr8103282 3261 2937 2887 870 817 719 607 129 57 13654 2684 299 --
NM_001002843chr151949 192 --11101
NM_001003652chr18107818 7725 5500 3322 2350 2335 1241 916 406 328 1196 15672 25806 1285
NM_001003792chr321153 464 21210 247 --1325
NM_001003793chr321153 464 21210 247 --1325
NM_001003800chr952922 1361 1116 855 550 22518 1369 42363 2354 963 666 --
NM_001004317chr664244 3804 1456 1330 563 515 1707 1196 --
NM_001005242chr1241595 1554 1211 1106 21615 171 --31166 488 136
NM_001005375chrY21649 106 ----2710 542
NM_001005474chr3--11152 1227 11295
NM_001005502chr1263939 1255 1052 957 190 59 14325 14231 14435
NM_001005609chrX93748 3368 3294 3198 2689 2612 1502 370 151 33637 1024 179 23160 335 --
NM_001005746chr261254 1167 978 590 494 175 ----1913
NM_001005747chr261254 1167 978 590 494 175 ----1913
NM_001007023chr1484702 4633 4451 4113 3526 2059 1253 267 24029 3834 ----
NM_001007094chr1063433 1744 1393 1126 786 720 23916 951 11038 13466
NM_001007097chr9104628 4568 4246 4218 4188 4146 4139 3491 3329 1377 34069 3560 827 24910 514 --
NM_001007466chr695195 4945 4873 3410 3280 1977 1205 921 21 35073 1968 408 ----
NM_001008239chr1862979 2743 2410 1456 1148 720 22582 94 1390 --
NM_001008392chr353533 3489 1396 457 111 1519 --13181
NM_001008408chr795800 5267 4344 1746 1672 1505 341 162 132 15033 --15297
NM_001008541chr101899 11786 12149 1215
NM_001008541chr101899 11786 12149 1215
NM_001009899chr325513 5193 14659 26315 4876 1448
NM_001009960chr762486 2448 726 450 47 36 ----12174
NM_001010000chr1811109 22604 244 2958 472 22649 261
NM_001010861chr172051 1890 1881 1873 790 480 415 12406 12310 --
NM_001010867chr1136295 6046 5641 5026 4717 1941 1856 1507 1365 502 414 254 66 35744 1221 658 --14859
NM_001010986chrX21798 86 ----11925
NM_001011513chr473808 3599 3276 3236 3167 3148 3037 --13425 12846
NM_001011666chr766098 5655 4487 2136 1802 472 ----25679 1073
NM_001012393chr1185153 5007 4840 3672 3383 1839 1534 115 13651 14177 --
NM_001012421chr91634 --150 1103
NM_001012755chrX33406 3076 373 14315 1889 14475
NM_001012761chr512469 32379 2318 610 --11964
NM_001013674chr12293 224 ----1782
NM_001014797chr1076881 6470 6110 5745 5201 2018 1652 36893 5811 2929 16613 1628
NM_001017424chr111470 --11656 11461
NM_001017425chr111470 --11656 11461
NM_001018065chr975927 5768 4574 3983 3921 3657 847 35919 4149 2211 16042 11222
NM_001018066chr975927 5768 4574 3983 3921 3657 847 35919 4149 2211 16042 11222
NM_001018091chr1531149 849 494 21834 264 --141
NM_001024647chr1256795 5673 1380 971 209 36656 1607 439 --47031 6601 1675 1297
NM_001024956chr1144326 4266 2086 1896 --1699 11355
NM_001025076chr1074933 4425 1767 505 426 220 185 21825 958 --14552
NM_001025077chr10106291 5783 5007 1863 1784 1578 1543 1215 1100 982 12316 --15910
NM_001025233chr1282710 2686 2183 2127 903 660 435 31 --22069 1740 --
NM_001025266chr354328 3488 1224 1149 674 11330 --11502
NM_001025580chrX53898 3300 3006 1194 520 33763 2847 1686 11343 --
NM_001029864chr2042246 764 311 270 41709 452 172 35 12137 21560 507
NM_001029884chr622235 943 ----22687 347
NM_001030055chr1464732 4372 3903 1698 1419 963 21525 1284 34567 4360 50 --
NM_001031679chr1263483 2936 2609 2475 2295 1393 22868 2430 12351 1314
NM_001031695chr2275238 5159 4272 3401 3348 1223 897 11881 11677 --
NM_001032394chr611861 22184 721 22436 75 1283
NM_001032999chr20104482 4294 4189 3935 3838 3471 1453 1095 545 519 34457 3580 1304 13405 --
NM_001033117chr374661 3988 3936 3798 1496 1234 173 41895 1349 694 677 14078 --
NM_001034954chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_001034955chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_001034956chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_001034957chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_001035chr111123 1889 --11240
NM_001035511chr111362 1571 32186 2023 672 1520
NM_001035512chr121469 126 1678 32293 2130 779 1627
NM_001035513chr121469 126 1678 32293 2130 779 1627
NM_001037317chr172051 1890 1881 1873 790 480 415 12406 12310 --
NM_001037553chr2194853 4563 3843 3802 3704 1174 980 632 46 2903 273 --1157
NM_001039618chr1174797 4520 4325 4299 3990 704 100 14414 1518 --
NM_001039709chr20104482 4294 4189 3935 3838 3471 1453 1095 545 519 34457 3580 1304 13405 --
NM_001039840chrX54360 3984 1336 1242 1010 25936 1021 25736 1031 --
NM_001040202chr462547 2318 830 759 525 28 1590 1922 --
NM_001040284chr1673851 2078 2058 424 341 103 84 ------
NM_001042355chr1684998 4948 4773 4588 2083 2021 970 465 3929 202 126 11932 --
NM_001042412chr1684998 4948 4773 4588 2083 2021 970 465 3929 202 126 11932 --
NM_001042494chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_001042495chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_001042496chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_001042497chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_001042555chr1254031 1669 1042 682 417 ----12910
NM_001042599chr2106411 6019 5181 3125 3060 3040 2496 2049 1602 528 --32538 2296 1260 --
NM_001042603chr1284824 4677 4044 2021 1853 912 349 118 --34807 798 669 15183
NM_001042604chr364456 4207 4051 3663 1535 1403 23878 3785 ----
NM_001042681chr152134 1752 993 391 332 --22071 764 31726 1677 260
NM_001042682chr152134 1752 993 391 332 --22071 764 31726 1677 260
NM_001042682chr152134 1752 993 391 332 --22071 764 31726 1677 260
NM_001042683chr621551 1169 ----11660
NM_001042749chrX11440 1639 21578 648 1412
NM_001042750chrX11440 1639 21578 648 1412
NM_001042751chrX11440 1639 21578 648 1412
NM_001044385chr243796 2937 2460 1595 2920 872 14035 11587
NM_001044387chr1944010 2662 970 226 1871 --2254 176
NM_001044388chr1944010 2662 970 226 1871 --2254 176
NM_001046chr522325 2204 130 --12074
NM_001099678chr396358 5735 5132 1609 699 671 510 175 160 11171 14506 12540
NM_001100108chr167043 5936 5879 3186 3174 3134 37385 7313 84 21126 856 17588
NM_001106chr3148531 8111 7538 7112 6962 6726 6716 6421 6210 3893 3779 3499 1199 25 48489 7125 6538 1905 27339 6499 19758
NM_001121chr1021563 161 1188 --11413
NM_001173chr1464732 4372 3903 1698 1419 963 21525 1284 34567 4360 50 --
NM_001186chr2122650 2119 1664 --1292
NM_001204chr286395 6157 5347 4741 3081 2005 1903 1671 57351 6276 6131 5953 1100 ----
NM_001259chr766119 5570 5353 5308 2038 2006 44782 4595 737 257 21840 338 --
NM_001304chr1753625 2674 906 748 500 33362 2736 2609 --2953 381
NM_001396chr2182732 2547 2541 2528 2437 2254 877 295 11874 1313 --
NM_001399chrX93748 3368 3294 3198 2689 2612 1502 370 151 33637 1024 179 23160 335 --
NM_001412chrX23345 2630 2840 606 --12964
NM_001419chr19134714 4614 4504 3549 3483 3236 1281 845 730 711 628 571 492 14362 ----
NM_001438chr143619 2497 855 154 32792 2680 2567 22524 807 13394
NM_001609chr1044102 3022 730 584 24222 3244 13479 34048 3962 1151
NM_001650chr181254 21362 1044 --23438 673
NM_001684chr193964 3937 3467 3274 2571 1088 1001 394 229 21123 701 ----
NM_001699chr1981826 1577 1343 1320 1272 1250 291 268 11132 ----
NM_001754chr2164280 4101 2935 1142 1135 785 33481 2920 2675 --1950
NM_001792chr182789 262 1756 --171
NM_001830chrX33500 3455 1121 43164 3134 1510 26 --12515
NM_001858chr634929 4658 395 43912 3428 1310 1099 11342 --
NM_001874chr1263939 1255 1052 957 190 59 14325 14231 14435
NM_001939chrX63285 3222 3037 2537 958 411 33144 1242 550 21292 300 11231
NM_001957chr451850 1548 1422 586 232 ----12138
NM_001977chr411508 11546 --21252 456
NM_001987chr1263776 3117 3036 2889 867 369 34146 2828 1034 21553 675 --
NM_002006chr475111 4968 3600 3529 2162 1913 131 1741 23942 1410 14983
NM_002092chr473772 1896 858 810 483 341 190 34871 3419 244 ----
NM_002158chr23802 699 451 --12801 11299
NM_002210chr232345 1378 177 22447 471 13205 --
NM_002214chr764625 4182 4111 3649 2271 188 ------
NM_002241chr172842 2133 912 871 792 409 165 32944 2513 467 12779 --
NM_002264chr353223 1846 1556 589 464 11598 11697 --
NM_002336chr1214797 11930 --23680 1848
NM_002387chr565052 4439 4038 3917 3680 1450 34121 1609 403 1194 --
NM_002545chr1185153 5007 4840 3672 3383 1839 1534 115 13651 14177 --
NM_002581chr955030 4228 3987 1698 699 34713 3750 1098 32181 1171 316 --
NM_002645chr1143103 2921 1018 452 22287 583 --11143
NM_002655chr874944 4500 4311 3542 803 543 498 --1918 --
NM_002709chr232959 626 83 ----12459
NM_002716chr1183687 3628 3481 3093 3071 3063 2602 328 13590 --1623
NM_002737chr1774095 2368 1976 1813 760 602 226 26344 6052 45909 5753 5082 825 25168 5118
NM_002745chr22104468 4382 4235 4124 4112 4025 3485 1680 1490 187 34394 1115 574 23471 3086 --
NM_002874chr932505 967 142 1372 --1319
NM_002886chr374805 4327 4236 3980 1578 1520 1015 21353 553 24265 3326 14527
NM_003001chr121469 126 1678 32293 2130 779 1627
NM_003149chr371669 1145 562 553 524 408 376 11109 1191 11531
NM_003161chr1743111 553 128 97 --11038 13402
NM_003199chr1855243 4827 1055 851 704 --15150 1247
NM_003215chr461536 457 300 166 154 138 --11327 11052
NM_003234chr321689 51 32311 512 241 --11814
NM_003298chr3124924 4855 4512 4319 3985 3822 2484 2329 2264 1591 1390 1006 3783 698 44 --14559
NM_003338chr10145 --1386 11243
NM_003369chr1152605 1914 1753 1091 510 --11111 1427
NM_003374chr54568 162 139 124 2635 58 --1263
NM_003392chr373527 3159 1556 1529 965 774 427 ----24017 330
NM_003421chr1063433 1744 1393 1126 786 720 23916 951 11038 13466
NM_003439chr743465 2571 554 55 43324 2228 1368 1342 1946 --
NM_003574chr1841309 1287 415 317 --24944 4243 --
NM_003607chr143875 3103 1623 136 12847 33701 3050 2918 1405
NM_003644chr17126071 4859 4065 2390 2352 2067 2018 1803 1213 840 460 378 24238 136 25450 4594 --
NM_003663chr333295 960 492 33447 2551 1039 --13318
NM_003679chr162864 2203 1314 1089 500 488 ------
NM_003692chr93914 141 83 ----1400
NM_003722chr342184 1072 1035 732 11822 1517 11094
NM_003759chr484028 3890 3693 3278 2866 1207 568 366 24010 602 ----
NM_003774chr1243280 3014 2667 2255 ----1821
NM_003831chr1841706 1603 684 467 31555 1235 538 11488 --
NM_003884chr351609 1515 643 358 161 1577 1537 11452
NM_003909chr842711 2592 694 201 21877 871 --1909
NM_003941chr762460 2192 1962 1663 976 395 1950 ----
NM_003966chr5106217 5715 5126 3079 2952 2387 1922 1814 1168 85 36307 1677 767 15516 --
NM_003994chr1223317 387 1346 33709 3049 1611 22895 163
NM_004028chr181254 21362 1044 --23438 673
NM_004035chr1743148 1603 1476 150 31240 929 34 14883 1220
NM_004081chrY21649 106 ----2710 542
NM_004124chr1483407 3176 2260 2202 1270 719 704 236 1553 ----
NM_004171chr1198762 8335 8089 6405 6036 6010 3753 1251 366 39305 7015 466 48360 6542 3363 2873 --
NM_004172chr531581 524 398 2745 388 11689 --
NM_004227chr762587 2320 2285 812 215 122 32397 450 290 --1506
NM_004232chr1843889 2601 2543 2361 23224 1439 23700 3595 --
NM_004293chr973851 3347 2962 1222 1106 596 472 12819 --1908
NM_004342chr72485 175 32002 1986 1640 --1359
NM_004380chr1642021 1718 1711 69 --22450 62 1421
NM_004397chr1133484 2651 1259 44138 3203 1491 1151 --1482
NM_004437chr183534 2563 2522 2401 1081 694 173 96 ----12216
NM_004438chr252649 2551 2169 2155 1051 22929 2142 ----
NM_004464chr454258 3981 2897 1171 64 13116 --11409
NM_004514chr172949 610 33014 1169 499 --12064
NM_004586chrX65376 4590 3878 3442 2183 2088 24167 3798 ----
NM_004612chr953937 1407 1347 979 38 --1451 1606
NM_004685chr1332850 297 202 12143 --22910 2891
NM_004703chr1772135 2007 1712 429 407 226 137 22263 1835 1967 --
NM_004726chrX35095 1439 593 --11131 12188
NM_004734chr1353177 2472 2338 1093 204 22162 559 12678 31990 1193 673
NM_004745chr8116441 5584 5436 5201 4565 4390 4365 2101 1651 1409 1356 55021 4911 4874 1106 644 15064 15774
NM_004815chr194349 3946 3671 3454 3435 1087 846 689 546 54937 4121 3442 1982 832 --13393
NM_004845chrX103962 3918 3746 3256 1565 1152 810 614 513 240 12690 11473 --
NM_004857chr1464292 3854 3299 3090 1293 377 23641 108 11796 11134
NM_004866chr554846 3394 1753 665 259 24749 1958 11585 25029 3914
NM_004898chr462827 2155 572 484 438 312 1513 --1866
NM_004904chr766098 5655 4487 2136 1802 472 ----25679 1073
NM_004956chr743912 3412 3057 3029 24374 2816 24221 3659 33330 3203 1662
NM_004992chrX147755 7230 7214 6849 6483 5744 5340 3022 2896 2803 2016 1707 1575 1312 68363 6155 6137 5843 2612 2145 --16300
NM_004992chrX147755 7230 7214 6849 6483 5744 5340 3022 2896 2803 2016 1707 1575 1312 68363 6155 6137 5843 2612 2145 --16300
NM_004999chr634412 640 486 43154 1374 586 578 23007 728 11005
NM_005056chr1285068 4921 4288 2097 1156 593 362 179 1109 35051 1042 913 15427
NM_005093chr20104482 4294 4189 3935 3838 3471 1453 1095 545 519 34457 3580 1304 13405 --
NM_005135chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_005147chr1621001 916 2441 96 --1957
NM_005156chr984376 4351 3961 1702 1285 903 330 56 1871 --14607
NM_005235chr2106411 6019 5181 3125 3060 3040 2496 2049 1602 528 --32538 2296 1260 --
NM_005339chr464071 3386 2713 1114 1080 123 --1558 1535
NM_005359chr1855113 2587 1619 1105 365 21956 191 46370 5952 2035 595 14062
NM_005436chr1032833 455 119 23800 2846 23716 469 --
NM_005465chr111656 1413 12024 1459
NM_005497chr1755770 5427 2294 525 245 12069 --1934
NM_005509chr5--1564 11870 21227 177
NM_005578chr355104 4569 4523 1646 956 23914 858 --1619
NM_005596chr996360 6178 4645 4428 4313 2346 1629 1334 423 25247 4324 ----
NM_005607chr81930 2775 411 --2228 218
NM_005639chr1231808 1765 118 11314 2643 354 11615
NM_005665chr184826 4492 4372 4270 3796 1692 523 355 33421 3321 1430 ----
NM_005742chr22658 22 ----1782
NM_005748chr1231046 718 188 13068 1906 12520
NM_005759chr284722 3424 3216 3045 1437 1304 916 519 11574 24659 1628 31378 951 309
NM_005808chr353533 3489 1396 457 111 1519 --13181
NM_005840chrX137641 7525 6530 5960 5861 2316 1951 1922 1180 891 607 445 255 12162 36810 1866 23 16120
NM_005843chr261762 1702 505 258 186 48 11611 21420 278 --
NM_005880chr1621397 68 --191 11098
NM_005901chr18107818 7725 5500 3322 2350 2335 1241 916 406 328 1196 15672 25806 1285
NM_005903chr534487 2098 584 34859 408 243 13280 --
NM_005909chr554175 3997 3674 2916 92 146 --1767
NM_005962chr101899 11786 12149 1215
NM_005962chr101899 11786 12149 1215
NM_005966chr22612 98 1840 1341 1943
NM_005977chr131299 --2654 382 2749 200
NM_005999chr141335 1193 283 115 11579 21506 1274 --
NM_006047chr2073420 3108 3067 1224 990 296 81 1565 159 --
NM_006055chr253119 2794 2291 609 149 4648 513 281 133 11133 --
NM_006080chr742926 2441 2066 127 22201 825 --1569
NM_006095chr453821 3018 1571 1440 1429 --43735 1626 414 140 --
NM_006106chr1163134 2889 2452 1279 428 121 11131 --13078
NM_006203chr565099 4442 3843 2211 911 146 2646 370 35211 4884 3549 --
NM_006283chr884554 4513 4062 3925 3108 1472 1310 1099 23177 202 14629 178
NM_006306chrX45839 4505 3846 1502 --13622 15212
NM_006313chr1241096 661 412 109 --1618 11171
NM_006375chrX1693 2647 512 1667 1724
NM_006380chr1773455 1173 1045 192 182 113 43 ----13880
NM_006420chr2052535 2323 2249 2140 987 22498 806 ----
NM_006434chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_006457chr473808 3599 3276 3236 3167 3148 3037 --13425 12846
NM_006544chr1465207 1524 1477 1414 255 24 ----14640
NM_006546chr1795464 5223 4811 4086 2020 1169 813 280 95 36229 5396 31 14605 11285
NM_006561chr1074933 4425 1767 505 426 220 185 21825 958 --14552
NM_006599chr16148119 7736 7154 6999 6559 6445 6328 6060 5569 2705 2646 2371 953 655 37580 1861 1325 25014 2522 --
NM_006603chrX11440 1639 21578 648 1412
NM_006621chr14821 532 526 418 --11289 11407
NM_006654chr1254031 1669 1042 682 417 ----12910
NM_006682chr752553 2318 1985 631 23 ----1926
NM_006729chrX65056 4533 4153 3866 2020 404 1962 34968 3854 1472 13642
NM_006738chr1544623 4172 1686 115 12866 23185 2848 23387 782
NM_006851chr1232547 1164 1079 1104 12681 1416
NM_006918chr1144326 4266 2086 1896 --1699 11355
NM_006924chr1764072 1743 960 603 240 57 199 --11263
NM_006981chr952888 2594 2552 2338 822 ----1950
NM_007007chr1263738 3723 3588 3283 775 69 31696 1526 1352 ----
NM_007011chr15146526 5949 5681 5161 2660 2230 1734 1090 841 628 440 297 259 176 11582 15763 34199 2224 2026
NM_007036chr52861 79 ----1138
NM_007038chr2175968 4475 4459 916 771 679 44 45807 3904 1344 517 12421 --
NM_007039chr1421610 294 12037 --21977 619
NM_007050chr20117700 7553 7403 7034 5177 2610 2531 1652 1255 641 32 46096 5782 2604 2218 47210 5719 5275 2897 --
NM_007106chr1342481 929 902 260 292 81 --1423
NM_007125chrY2585 184 1197 --11241
NM_007137chrX34440 1955 1942 12220 --21560 160
NM_007175chr8103193 2977 2817 2734 1241 1110 1102 659 379 260 11339 11065 --
NM_007200chr1544623 4172 1686 115 12866 23185 2848 23387 782
NM_007220chrX54927 4903 4525 1899 341 21531 1209 24828 1806 --
NM_007249chr13108470 7819 7141 7102 7011 6396 6149 3601 3568 59 37643 7000 1598 11892 37994 5917 2226
NM_007292chr1743148 1603 1476 150 31240 929 34 14883 1220
NM_007350chr1254398 3794 3478 2825 943 2606 497 14148 11628
NM_007373chr1031417 1186 539 --1550 1661
NM_012081chr563112 2882 2736 2435 340 73 23500 2306 13255 21476 591
NM_012095chr1053396 2799 2652 501 346 11114 --12806
NM_012102chr152134 1752 993 391 332 --22071 764 31726 1677 260
NM_012193chr11115254 4988 4816 4424 3637 3554 3292 1766 659 431 315 55224 2052 1350 473 308 1841 --
NM_012214chr2106302 5540 5204 4939 4335 4302 4251 2216 1736 1661 24751 2402 --16083
NM_012234chr362829 2324 1236 1157 957 755 1849 --21045 987
NM_012262chr144717 4321 3898 3761 1310 --11729
NM_012287chr373441 3077 1738 657 607 255 168 23372 465 --13156
NM_012297chr442554 2243 2147 294 1652 1208 --
NM_012309chr1174242 3810 3160 843 541 370 172 43671 1641 1554 852 13791 1888
NM_012316chr195562 5516 4163 4040 3762 3755 3747 809 465 --23817 1701 --
NM_012334chr554615 4146 3274 3260 2906 24385 1081 24429 3177 --
NM_012338chr711266 21041 80 --2891 829
NM_012382chr564305 3997 3733 1507 924 120 14298 11582 --
NM_013231chr1444403 3540 1588 476 31613 855 483 12971 13487
NM_013255chr7198747 8406 7986 6626 5950 5894 5877 5782 5501 3160 1701 1655 1341 1119 1058 966 828 377 323 46948 5775 883 783 12820 18059
NM_013322chr741170 1076 1069 47 --11541 1683
NM_013374chr333140 2975 2174 22681 807 131 11931
NM_013381chr1242075 1847 750 400 ----1340
NM_013989chr1484702 4633 4451 4113 3526 2059 1253 267 24029 3834 ----
NM_014021chr163373 3192 3154 2902 2738 2303 32786 2128 1094 1901 --
NM_014028chr65714 502 304 204 123 21169 67 ----
NM_014048chr1694838 4110 3759 3442 1914 1711 880 703 259 23473 1774 24213 2036 1566
NM_014155chr11106934 6653 6383 5524 5108 4810 1835 1377 1004 791 16363 ----
NM_014181chr252266 2062 1885 1852 1143 12601 2507 223 --
NM_014217chr111470 --11656 11461
NM_014253chrX52439 1665 861 458 80 1265 --22033 314
NM_014309chr2275228 5149 4262 3391 3338 1213 887 11871 11667 --
NM_014331chr487183 5368 1990 1424 1200 1094 1081 82 36220 1308 1179 --1641
NM_014333chr111505 2824 551 --1686
NM_014423chr5105309 4966 4224 4187 4096 2181 1774 1682 1251 994 44774 4352 1582 784 ----
NM_014458chr12980 387 ----1562
NM_014504chr721388 782 21456 691 11817 179
NM_014586chr2184506 3727 3453 2999 1767 1294 1126 207 21780 33 54387 3530 986 434 231 24277 1504
NM_014615chr1653354 2547 1350 202 139 1147 13008 --
NM_014636chr983931 3786 3553 3043 1461 1226 758 29 23500 1520 --11320
NM_014637chr831149 250 106 ----11387
NM_014721chr676748 5412 4564 4514 2734 1907 624 46411 4769 2840 861 ----
NM_014730chr1273683 3352 1777 655 580 448 436 44038 3851 3494 1642 24787 4548 --
NM_014730chr1273683 3352 1777 655 580 448 436 44038 3851 3494 1642 24787 4548 --
NM_014739chr654065 3600 3583 3329 2817 11645 --13316
NM_014758chr1162148 1706 856 519 481 387 2664 538 --12252
NM_014781chr8--21187 247 --1456
NM_014810chr143558 2735 1203 1178 12384 22772 830 21431 1054
NM_014826chr143875 3103 1623 136 12847 33701 3050 2918 1405
NM_014829chr552197 1859 273 261 210 22048 770 ----
NM_014832chr1351955 1891 1327 829 260 21686 1523 ----
NM_014850chr374661 3988 3936 3798 1496 1234 173 41895 1349 694 677 14078 --
NM_014873chr154130 3934 3220 3014 41 54815 3060 1542 547 405 ----
NM_014877chr1765431 5344 2893 1749 1695 1359 35369 2837 1668 27041 5270 --
NM_014897chr1752874 2811 989 810 781 21181 29 21255 401 --
NM_014904chr1023797 2793 33317 1030 309 13568 13840
NM_014906chr1784088 3803 3691 3297 2945 1316 1166 931 --13861 --
NM_014912chr1041353 734 495 183 31365 831 406 --12249
NM_014920chr653271 2864 1224 958 348 22361 1374 --13713
NM_014982chr1475244 4926 4791 4086 3851 3672 1272 1971 14106 11818
NM_015000chr1232456 438 349 1983 22574 1163 23110 700
NM_015026chr1254100 3689 1847 1009 361 11489 13548 14052
NM_015035chr20116554 5870 4759 4719 2677 2231 2209 1938 989 964 276 35966 1715 133 1863 --
NM_015039chr194147 3994 3500 3407 3211 1709 1638 373 295 11240 13063 13009
NM_015071chr586454 5975 5702 1992 1574 1509 1313 614 22362 330 45734 5244 5233 420 --
NM_015074chr194431 3635 3480 3439 1951 1634 1462 604 132 11826 13093 --
NM_015077chr17124639 4392 3649 3522 3361 3175 2859 1877 1657 1509 1471 1380 14230 43587 1280 839 622 --
NM_015090chr165099 4915 1869 1012 925 392 22191 1424 24756 3859 25599 4789
NM_015092chr1631339 1037 692 34686 883 556 23673 463 1383
NM_015100chr122046 637 11649 --1715
NM_015156chr1453443 2540 419 339 47 21305 448 11401 23568 3396
NM_015172chr121190 114 21548 1175 11337 11203
NM_015192chr2052177 1864 1127 730 141 123 1963 --
NM_015208chr1842835 1591 1391 1356 ----12459
NM_015247chr1684998 4948 4773 4588 2083 2021 970 465 3929 202 126 11932 --
NM_015271chr463601 3459 3142 1733 1244 789 33785 3072 585 --12989
NM_015278chr642722 2487 986 813 43114 1043 253 173 --1105
NM_015285chr1872497 1813 972 770 753 665 118 1824 1192 --
NM_015299chr14103037 2723 2460 1574 1558 1346 1180 930 731 284 33535 1455 757 23108 97 --
NM_015310chr887523 6073 5713 5389 2649 2310 844 518 47999 1881 1483 254 27241 5672 36240 3328 888
NM_015313chr1143554 3406 1723 589 21420 1251 13805 1260
NM_015326chr162812 1074 434 379 219 25 --12459 11090
NM_015328chr7113001 2631 2178 1245 974 931 818 721 343 325 79 --31933 1907 1086 --
NM_015344chr831807 1532 1352 11371 --1363
NM_015355chr1721952 1435 11340 --1297
NM_015365chrX53898 3300 3006 1194 520 33763 2847 1686 11343 --
NM_015385chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_015446chr131442 173 71 --2666 451 11111
NM_015455chr583757 3451 3302 3131 1372 894 719 412 12962 1375 --
NM_015458chr884574 3835 3755 3743 3665 3522 3271 342 --11894 1821
NM_015460chr351758 1470 1334 810 350 11936 --1162
NM_015550chr733411 2986 1312 11417 23475 1447 12589
NM_015554chr1542613 2568 1838 812 1793 --11947
NM_015560chr362591 2430 2017 675 515 69 1370 ----
NM_015564chr51555 12725 12508 23002 607
NM_015569chr144094 3436 721 355 31156 756 563 24018 1145 --
NM_015577chr551728 593 397 236 229 21617 1171 157 --
NM_015879chr1897754 7596 7110 5438 5404 2780 1879 1432 720 57796 6127 2415 1741 70 67729 7512 7441 5310 1776 1560 11172
NM_015886chr8115333 4873 3977 1661 1607 1559 1533 1366 810 697 433 24701 1147 --24108 2049
NM_015906chr153951 3253 1796 1631 828 44170 1569 1171 735 11529 --
NM_016018chr852498 2080 2051 860 479 1909 ----
NM_016021chr612829 43013 2291 883 769 32405 160 152 --
NM_016075chr132558 352 1158 23013 2571 1192
NM_016206chr3148731 8241 8038 7225 7189 7100 6077 5948 5585 2670 2222 1798 1522 82 27973 6127 12214 17335
NM_016248chr1353655 3182 2983 2458 1426 53926 3606 2715 2604 1186 ----
NM_016260chr276129 6110 5900 1575 584 480 378 32894 1383 789 --1351
NM_016272chr2252780 2131 1711 328 136 22514 125 --12676
NM_016289chr272055 1766 1509 915 150 56 35 31664 622 227 --11941
NM_016442chr53893 530 105 21616 1499 --11721
NM_016513chr653271 2864 1224 958 348 22361 1374 --13713
NM_016530chr1594097 3679 3074 2766 2519 1284 627 590 371 12872 11406 --
NM_016824chr1021563 161 1188 --11413
NM_016953chr2115254 4882 4783 4138 4087 3972 3862 1953 674 648 60 --11382 1798
NM_017447chr2154041 3812 3442 2766 680 12931 11659 14052
NM_017563chr3136235 6029 5896 5763 5421 4818 4563 4514 4480 4415 2463 1839 1267 35445 2473 2441 36073 5572 341 12309
NM_017628chr465237 4790 4717 3943 1689 163 33324 1798 1389 11725 --
NM_017633chr663130 3056 1447 455 88 39 13176 --11107
NM_017637chr988905 8362 8134 2274 2186 1412 1220 613 43004 2987 2211 1014 ----
NM_017644chr385041 4299 3957 3280 1698 1383 1344 557 --34724 1689 494 11844
NM_017650chr765948 5901 4622 4332 732 74 34781 3946 1426 --11650
NM_017654chr731584 595 114 ----21478 1148
NM_017658chr1464463 4149 3923 3028 1645 914 --159 --
NM_017661chr151949 192 --11101
NM_017712chr1966190 5133 4828 2166 1753 271 35622 5008 375 45874 5848 5385 2406 14924
NM_017754chr6125010 4507 4282 4250 3567 3186 3117 1766 1534 631 506 81 ----11786
NM_017813chr865730 5428 4571 3620 1077 956 14599 12246 --
NM_017847chr132100 1814 846 1207 31857 226 33 --
NM_017848chrX64105 3514 3211 1882 1489 174 54581 1287 1272 581 110 ----
NM_017919chr985541 4712 4591 1958 1933 1754 1620 1183 33894 3755 426 ----
NM_017938chrX21520 293 1683 21555 814 12116
NM_017943chr142672 239 2370 100 --2322 313
NM_017944chr1142285 1024 973 734 11009 12833 1457
NM_017952chr274143 3437 3401 3380 3238 3180 248 11735 11379 24544 3945
NM_017994chr762968 2195 1909 865 303 284 22035 1037 --1178
NM_018027chr10102947 2413 2078 2031 2023 1209 570 507 497 63 --12985 22259 48
NM_018036chr1463379 3277 3038 2743 1193 72 11299 --13777
NM_018167chr141906 --1342 2830 283
NM_018200chr1542570 2400 2097 2057 12035 32219 1882 956 --
NM_018211chr131860 1790 1536 11634 1823 11470
NM_018247chr673108 3066 2766 2584 779 546 537 1969 1437 1889
NM_018293chr322833 583 52772 2313 1913 223 151 ----
NM_018351chr1254157 3943 3239 1661 1445 24647 3741 23086 1758 --
NM_018373chr14106140 5851 5043 4826 3987 3924 2364 1260 957 265 1795 16331 --
NM_018374chr755199 4133 4002 3653 3499 ----1845
NM_018440chr856017 5483 1522 832 457 47953 6978 2791 1497 27621 3063 28565 379
NM_018444chr82503 442 12106 --1770
NM_018566chr154734 4663 4068 1524 1373 ----147
NM_018638chr1265087 4713 3675 3442 1302 838 25095 3865 1965 --
NM_018657chr32748 336 ----1586
NM_018844chr751984 1856 1667 681 171 41877 800 81 66 ----
NM_018847chr931245 739 549 ----1455
NM_018947chr754734 3125 1586 1529 209 34950 3649 3065 23036 96 33617 3313 731
NM_018970chr772925 2660 2259 2077 1954 1177 835 ------
NM_018976chr1252739 2714 1051 925 262 --22650 804 21813 514
NM_018999chr1073341 1570 961 593 477 455 248 --13687 143
NM_019001chr364456 4207 4051 3663 1535 1403 23878 3785 ----
NM_019044chr2124643 3753 3697 3509 3229 3120 2989 2909 2902 1368 1112 600 13470 2934 396 --
NM_019050chr462164 2129 2072 1996 1970 746 22235 739 ----
NM_019903chr1021563 161 1188 --11413
NM_020132chr2194853 4563 3843 3802 3704 1174 980 632 46 2903 273 --1157
NM_020245chr685101 4851 4779 3316 3186 1883 1111 827 34979 1874 314 ----
NM_020336chr2093789 3405 3183 2978 2814 2800 784 512 177 23826 1476 1986 --
NM_020340chr632286 1588 441 --21601 193 1570
NM_020341chr2041260 258 101 53 ----11760
NM_020420chrY21649 106 ----2710 542
NM_020455chr611861 22184 721 22436 75 1283
NM_020456chr1352045 1836 872 642 139 ----1692
NM_020463chr221506 580 ----2930 356
NM_020673chr2057350 6831 5445 1936 1552 26999 2898 35616 1918 1655 --
NM_020718chr1684782 4105 2488 2305 1911 1117 909 304 ----35979 5594 5027
NM_020766chrX93709 1650 1599 1088 1069 988 469 259 109 --13316 --
NM_020768chr5103043 2936 2629 2394 2200 1298 1284 959 647 196 ------
NM_020772chr1798105 7651 5339 3063 2548 1864 1833 1580 918 11841 13211 --
NM_020774chr1896050 5856 5672 4926 2054 627 489 69 39 ----15693
NM_020782chr1294637 4099 3519 3223 3215 1567 1136 517 493 ------
NM_020805chr1861852 1581 1530 1282 737 231 11699 11340 --
NM_020861chr621108 494 1509 --3441 271 71
NM_020918chr1073468 3062 2858 2256 1374 1060 1016 --13239 23246 2501
NM_020927chr1672397 2062 2042 1954 1852 380 99 32086 1669 277 --21929 795
NM_020940chr1012114 ----2510 241
NM_020948chr132588 1288 662 23639 2423 2884 277 --
NM_021038chr343160 1349 1286 721 1178 22882 2184 --
NM_021061chr8124368 3555 3349 3200 3168 2984 2920 2768 1377 1339 177 116 53402 3284 3074 2800 137 11250 24106 1408
NM_021090chr2284975 4866 4769 4310 4137 1716 1613 1230 24062 955 1940 --
NM_021227chr42483 126 1368 --1387
NM_021255chr14166 43946 2792 2673 440 12752 12522
NM_021629chr374551 4367 4319 3789 3629 1451 1174 23770 847 1915 --
NM_021633chr151090 882 510 384 40 3455 208 78 123 --
NM_021813chr675829 5350 4947 1150 1130 702 668 15302 144 14206
NM_021911chr51988 34660 4567 2118 11000 192
NM_021912chr1543916 3524 943 787 33807 2679 1171 13099 11128
NM_021913chr1981826 1577 1343 1320 1272 1250 291 268 11132 ----
NM_021977chr673890 3660 3026 3014 2701 1141 635 13081 23237 144 138
NM_022048chr15106273 5634 5222 4743 4498 4483 3933 1532 886 694 45969 4386 1591 1082 1870 --
NM_022166chr1686331 5613 4290 2244 1136 796 769 320 21122 497 23991 2201 --
NM_022170chr771711 1663 1590 1108 523 399 197 11548 ----
NM_022456chr1256795 5673 1380 971 209 36656 1607 439 --47031 6601 1675 1297
NM_022458chr762568 2485 1066 849 744 48 22209 108 --2445 392
NM_022459chr1385075 2245 1319 1239 1088 962 640 477 14703 22121 1211 11770
NM_022462chr19163309 3113 3023 2995 2711 2558 2528 2453 2421 1470 1458 1392 1089 792 760 369 62744 2619 2499 2438 2356 1367 23638 3054 --
NM_022735chr12570 212 31437 1180 526 --21537 1496
NM_022831chr161480 1335 1267 642 340 167 --1161 --
NM_022918chr1122025 1584 ----21717 158
NM_023018chr131640 562 153 11475 1331 11548
NM_024052chr1762794 2263 2144 2048 2005 689 12832 --1853
NM_024341chr1944010 2662 970 226 1871 --2254 176
NM_024345chr975983 5199 5095 4839 3995 1417 163 45543 4370 2353 669 15405 14413
NM_024524chr353173 2810 554 224 42 1253 ----
NM_024548chr32153 146 11719 --21658 673
NM_024607chr883350 3289 3083 2850 1744 1508 177 166 33673 2996 1337 --11375
NM_024639chr652888 2864 2110 2003 103 11912 11931 11026
NM_024665chr354418 4200 4165 2853 642 14724 11575 11272
NM_024770chr2116617 6377 5874 5759 5466 5437 5271 4947 2643 2346 442 24262 2626 36698 1811 529 --
NM_024941chr5------21388 307
NM_024947chr399374 7858 7190 6479 3742 2460 2405 1928 455 37773 2102 82 1979 --
NM_024953chr1232086 1891 1037 ----199
NM_024989chr266962 5931 5820 5618 2950 1284 36929 3285 1160 --17807
NM_024991chr1062506 2386 1106 1017 643 602 22380 310 --13276
NM_025054chr862758 2585 1427 646 623 131 23260 943 11529 12614
NM_025134chr1642218 861 521 144 2997 869 1722 11753
NM_025160chr141240 1118 1045 264 23616 1617 33806 857 559 --
NM_030627chr512940 --22716 1017 1755
NM_030647chr754848 3849 2474 1803 537 35950 5543 4980 1684 --
NM_030650chr263897 3839 2728 1491 1065 870 13103 2991 124 --
NM_030674chr12175815 5735 5652 5646 4578 4380 4007 3665 2037 2013 1901 1693 1162 1087 1012 742 615 --31650 650 360 --
NM_030755chr1483062 2781 2680 2419 2097 2060 837 114 ----1146
NM_030806chr1218482 8163 8063 7725 7061 6996 6871 6582 6486 6362 5805 5714 3364 3081 2922 2782 2337 795 458 267 89 29188 7844 15935 12357
NM_030817chr1232934 1190 631 63169 757 516 469 445 60 1475 --
NM_030918chr1145390 5267 5089 4991 4826 4765 3748 3456 1179 882 781 720 631 106 1770 1681 --
NM_031271chr821681 1605 1614 --11214
NM_031419chr3--11152 1227 11295
NM_031427chr1465597 5375 5257 4889 2302 160 45817 5801 1418 503 --2431 394
NM_031469chr6113793 3593 2969 2909 2838 2673 1363 1138 1085 867 558 43614 2993 1573 616 ----
NM_031935chr12742 68 2770 201 --1366
NM_031992chr771711 1663 1590 1108 523 399 197 11548 ----
NM_032012chr974827 4666 3942 3437 2080 775 209 34478 1635 1121 13486 14016
NM_032042chr542326 449 442 161 31872 957 740 --1557
NM_032102chr1163128 2905 2701 803 721 475 12897 --12635
NM_032105chr1117186 6461 3140 2034 1890 1867 1837 1680 1506 146 47 46777 6168 5209 571 --17502
NM_032199chr1063473 2492 1314 1091 1006 244 11134 1505 1294
NM_032208chr242804 2361 916 254 1245 11247 23538 2293
NM_032457chr453654 3220 2446 465 140 23268 794 21423 1217 --
NM_032509chr862369 2342 2026 1603 938 928 42431 2109 1730 574 ----
NM_032837chr1741369 632 466 414 --2568 307 11785
NM_032900chr1063948 3247 3020 2945 2936 2657 13441 --1688
NM_032918chr122897 502 ----11003
NM_033020chr153951 3253 1796 1631 828 44170 1569 1171 735 11529 --
NM_033138chr72485 175 32002 1986 1640 --1359
NM_033139chr72485 175 32002 1986 1640 --1359
NM_033140chr72485 175 32002 1986 1640 --1359
NM_033143chr454589 4312 3228 1502 395 13447 --11740
NM_033157chr72485 175 32002 1986 1640 --1359
NM_033224chr7107916 7807 7186 6629 6418 6171 4927 1974 1439 487 46937 6045 1208 717 47363 7138 733 340 17769
NM_033389chr1773830 3517 3182 573 500 438 257 24610 30 ----
NM_033505chr265451 4868 4563 4110 2330 906 22518 345 14315 --
NM_033656chr2164902 4215 1508 1393 190 93 25339 1751 15357 --
NM_052834chr1872497 1813 972 770 753 665 118 1824 1192 --
NM_052885chr1244715 3979 618 358 54152 4018 1507 764 131 1600 13392
NM_052932chr111430 1551 12309 1924
NM_053016chr997924 7486 6247 5614 5313 2690 1571 559 523 47954 7699 2345 1285 --11311
NM_053043chr795800 5267 4344 1746 1672 1505 341 162 132 15033 --15297
NM_053064chr1453104 2364 1206 1118 904 1974 12212 21000 803
NM_080546chr941841 935 485 394 42064 2033 1822 1696 --11952
NM_080591chr982876 2745 2626 2310 1228 1011 212 53 42325 475 375 185 1701 1431
NM_130436chr2182732 2547 2541 2528 2437 2254 877 295 11874 1313 --
NM_130438chr2183309 3124 3118 3105 3014 2831 2235 872 12451 1890 12147
NM_130439chr101899 11786 12149 1215
NM_130439chr101899 11786 12149 1215
NM_130831chr362591 2430 2017 675 515 69 1370 ----
NM_130832chr362591 2430 2017 675 515 69 1370 ----
NM_130833chr362591 2430 2017 675 515 69 1370 ----
NM_130834chr362591 2430 2017 675 515 69 1370 ----
NM_130835chr362591 2430 2017 675 515 69 1370 ----
NM_130836chr362591 2430 2017 675 515 69 1370 ----
NM_130837chr362591 2430 2017 675 515 69 1370 ----
NM_133170chr20117700 7553 7403 7034 5177 2610 2531 1652 1255 641 32 46096 5782 2604 2218 47210 5719 5275 2897 --
NM_133329chr221761 1448 11536 --1353
NM_133445chr9113811 3434 3036 2870 1369 1340 1296 1038 962 422 193 43668 3444 1446 732 1456 13534
NM_133493chr632827 1678 1551 53947 3705 1477 534 279 13097 13168
NM_133638chr541206 531 233 77 ----1356
NM_133646chr245012 4732 3374 1005 1766 --55519 5060 4690 4139 1091
NM_133647chr1583618 3107 2819 2498 2349 1062 1040 356 11347 ----
NM_138270chrX42899 2365 1272 1151 13402 --12994
NM_138333chr971765 947 493 206 188 147 51 1966 ----
NM_138426chr772348 946 384 289 216 167 56 12137 1408 --
NM_138459chr643010 569 545 495 11338 13493 --
NM_138468chr255326 4223 1531 1320 791 22010 1848 --14457
NM_138494chr762486 2448 726 450 47 36 ----12174
NM_138694chr633194 2849 2495 13554 12663 11097
NM_138713chr16148119 7736 7154 6999 6559 6445 6328 6060 5569 2705 2646 2371 953 655 37580 1861 1325 25014 2522 --
NM_138714chr16148119 7736 7154 6999 6559 6445 6328 6060 5569 2705 2646 2371 953 655 37580 1861 1325 25014 2522 --
NM_138731chr1423204 1273 33834 3734 990 --13263
NM_138782chr52422 218 2857 341 31965 939 236 --
NM_138959chr1106352 6331 5096 4199 4117 1075 537 454 379 331 45235 2401 2071 1247 11398 12210
NM_139169chr1021530 536 ----1266
NM_139207chr1241703 1592 1478 877 22200 642 ----
NM_139319chr1221211 616 11442 --1260
NM_144578chr1484979 4182 4082 2202 1753 1664 1112 1009 --34206 3966 687 13511
NM_144599chr1534408 3555 1278 55150 4909 4686 4261 3388 14479 11329
NM_144664chr1162574 2257 2087 1729 526 385 1328 --1226
NM_144710chr231429 1182 1059 --1950 1232
NM_144767chr1544623 4172 1686 115 12866 23185 2848 23387 782
NM_144778chr1352734 899 829 672 355 12208 --22419 380
NM_145011chr1021967 519 22056 265 --1407
NM_145055chr1862979 2743 2410 1456 1148 720 22582 94 1390 --
NM_145165chr1422726 171 1343 --22441 2325
NM_145307chr1064552 4207 3948 3222 1404 231 1875 157 14156
NM_145320chr733411 2986 1312 11417 23475 1447 12589
NM_145321chr733411 2986 1312 11417 23475 1447 12589
NM_145322chr733411 2986 1312 11417 23475 1447 12589
NM_147223chr222109 48 42034 1957 1568 802 --11852
NM_152352chr1862964 2239 767 562 427 352 2974 281 ----
NM_152388chr243796 2937 2460 1595 2920 872 14035 11587
NM_152407chr532450 2366 613 11295 --23266 2424
NM_152433chr1121596 328 1485 --1219
NM_152455chr1552790 1918 756 346 92 --1156 11826
NM_152622chr531161 1016 706 13505 --12164
NM_152624chr557393 7058 5518 5107 1756 26360 1695 16311 11595
NM_152641chr1262115 1936 719 503 305 264 ----11813
NM_152704chr133890 397 131 ----1952
NM_152733chr6125989 5958 5922 5834 4410 2588 2523 2235 783 514 281 110 46330 4334 4007 1378 16195 --
NM_152734chr6125035 4869 4676 4665 4566 3688 3659 2151 841 535 212 33 14439 25092 978 1516
NM_152756chr563654 3446 1731 1711 1334 553 --23144 3020 --
NM_152838chr2073420 3108 3067 1224 990 296 81 1565 159 --
NM_152890chr15948 841 447 370 26 ----21229 1114
NM_152924chr15146526 5949 5681 5161 2660 2230 1734 1090 841 628 440 297 259 176 11582 15763 34199 2224 2026
NM_153050chr2284975 4866 4769 4310 4137 1716 1613 1230 24062 955 1940 --
NM_153051chr2284975 4866 4769 4310 4137 1716 1613 1230 24062 955 1940 --
NM_153235chr642179 1880 954 48 12390 21934 155 32326 1959 1651
NM_153262chr152501 2231 1067 731 188 23107 251 ----
NM_153367chr1083833 3536 2448 2440 1594 1556 1020 938 22787 288 1568 12976
NM_153371chr1332393 2365 946 31638 1572 234 1240 --
NM_153456chr13106153 5743 5649 4929 3854 2447 2090 1648 916 155 45051 4104 1749 1573 12492 1695
NM_153607chr532371 730 184 33119 2881 838 --12002
NM_153619chr1553430 1097 1055 610 316 1645 2989 720 12941
NM_153620chr72680 327 21111 219 21470 595 11201
NM_153689chr232223 2045 2032 --32200 1577 69 --
NM_153810chr1074361 3914 3680 3576 3278 1423 1337 14031 168 --
NM_153831chr81930 2775 411 --2228 218
NM_170706chr194147 3994 3500 3407 3211 1709 1638 373 295 11240 13063 13009
NM_172070chr2----11817 21469 286
NM_172071chr196097 5710 5461 4545 2826 2352 779 600 489 --2302 238 22464 115
NM_172344chr221761 1448 11536 --1353
NM_173198chr952888 2594 2552 2338 822 ----1950
NM_173200chr952888 2594 2552 2338 822 ----1950
NM_173214chr16148119 7736 7154 6999 6559 6445 6328 6060 5569 2705 2646 2371 953 655 37580 1861 1325 25014 2522 --
NM_173468chr493992 1989 1555 1466 1320 1231 1162 799 772 44062 1444 1392 963 11856 11890
NM_173470chrX1109 22223 510 --12614
NM_173536chr474589 3509 3174 1594 609 209 46 21139 149 --14768
NM_173552chr32534 490 --1105 1838
NM_173582chr1135690 1129 191 25448 4376 15415 14178
NM_173602chr1273574 3039 2487 2311 1010 966 832 ----13357
NM_173607chr142161 75 31475 1458 1431 21967 185 --
NM_173642chr167181 6991 6188 5821 2241 2169 37405 6762 2328 46547 5833 3112 1043 22377 853
NM_173694chrX21864 152 ----11991
NM_173808chr173860 3268 1710 536 481 394 304 --24166 512 23472 3228
NM_173829chr565983 5693 5440 4644 4340 889 15313 ----
NM_174911chr863662 3276 2672 2611 2479 1297 23037 2815 --1506
NM_174916chr1531566 1559 118 22085 235 11883 11487
NM_175623chr1256795 5673 1380 971 209 36656 1607 439 --47031 6601 1675 1297
NM_175733chr114524 180 152 82 31475 495 392 41718 1369 430 93 --
NM_175736chr12187738 7445 6950 6767 6621 6448 5632 5536 5388 2884 2326 2248 1968 1640 1437 1107 410 401 12644 37495 3122 2129 --
NM_175767chr551565 1488 1401 1201 119 31851 742 570 21760 1296 --
NM_177990chr2041260 258 101 53 ----11760
NM_178584chr231429 1182 1059 --1950 1232
NM_181521chr1666534 4876 4792 1997 458 93 66377 5373 4515 2218 1047 667 14893 --
NM_182314chrX1693 2647 512 1667 1724
NM_182503chr6115342 5036 3406 2191 1751 1675 1636 1306 1101 453 303 3413 399 207 34997 4841 3996 --
NM_182757chr633201 214 120 --13406 23154 944
NM_182898chr766098 5655 4487 2136 1802 472 ----25679 1073
NM_182899chr766098 5655 4487 2136 1802 472 ----25679 1073
NM_183043chr131299 --2654 382 2749 200
NM_183044chr131299 --2654 382 2749 200
NM_194247chr223466 1105 23207 1726 14394 14373
NM_194285chr1172955 2612 703 179 168 63 30 12572 13237 --
NM_194314chr114463 24600 821 34991 1080 654 --
NM_194434chr1841309 1287 415 317 --24944 4243 --
NM_198320chr1263939 1255 1052 957 190 59 14325 14231 14435
NM_198439chr1121596 328 1485 --1219
NM_198465chrX51052 1009 87 69 62 21827 388 1300 --
NM_198484chr366252 6212 5691 4856 4206 170 35757 5035 2029 55350 4768 4602 1416 1281 14982
NM_198900chr12187738 7445 6950 6767 6621 6448 5632 5536 5388 2884 2326 2248 1968 1640 1437 1107 410 401 12644 37495 3122 2129 --
NM_198990chr762711 2417 1251 464 174 116 --11041 1867
NM_199003chr811102 2401 205 --11299
NM_199138chr133890 397 131 ----1952
NM_199324chr463240 2997 2374 1076 939 353 ----1211
NM_201432chr17126071 4859 4065 2390 2352 2067 2018 1803 1213 840 460 378 24238 136 25450 4594 --
NM_201433chr17126071 4859 4065 2390 2352 2067 2018 1803 1213 840 460 378 24238 136 25450 4594 --
NM_201570chr1061822 1726 735 710 486 384 11532 ----
NM_201571chr1061822 1726 735 710 486 384 11532 ----
NM_201572chr1061822 1726 735 710 486 384 11532 ----
NM_201590chr1061822 1726 735 710 486 384 11532 ----
NM_201593chr1061822 1726 735 710 486 384 11532 ----
NM_201596chr1061822 1726 735 710 486 384 11532 ----
NM_201597chr1061822 1726 735 710 486 384 11532 ----
NM_203342chr183534 2563 2522 2401 1081 694 173 96 ----12216
NM_203343chr183534 2563 2522 2401 1081 694 173 96 ----12216
NM_203504chr442554 2243 2147 294 1652 1208 --
NM_203505chr442554 2243 2147 294 1652 1208 --
NM_206594chr143619 2497 855 154 32792 2680 2567 22524 807 13394
NM_206595chr143619 2497 855 154 32792 2680 2567 22524 807 13394
NM_206855chr625472 5023 --1171 1817
NM_206866chr2122650 2119 1664 --1292
NM_206876chr232959 626 83 ----12459
NM_206909chr887523 6073 5713 5389 2649 2310 844 518 47999 1881 1483 254 27241 5672 36240 3328 888
NM_207012chr1053396 2799 2652 501 346 11114 --12806
NM_207171chr122046 637 11649 --1715
NM_207292chr343160 1349 1286 721 1178 22882 2184 --
NM_207293chr343160 1349 1286 721 1178 22882 2184 --
NM_207294chr343160 1349 1286 721 1178 22882 2184 --
NM_207295chr343160 1349 1286 721 1178 22882 2184 --
NM_207296chr343160 1349 1286 721 1178 22882 2184 --
NM_207297chr343185 1374 1311 746 1203 22907 2209 --
NM_207304chr1352621 786 716 559 242 12095 --22306 267
NM_207306chr183910 3339 3166 1688 1675 1622 1536 194 14140 13627 13577
NM_207517chr1522021 1375 --1742 11998
NM_213589chr285416 4465 2099 1333 119 108 84 75 34898 1812 1695 ----