TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-571
miRNA Sequence: UGAGUUGGCCAUCUGAGUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000090chr22599 41 1191 1222 --
NM_000098chr12419 222 ----1555
NM_000109chrX3927 901 100 ------
NM_000176chr553110 2615 1183 1055 837 --11392 --
NM_000208chr1953758 3422 1861 170 92 24650 4624 ----
NM_000248chr332606 2357 1916 11023 ----
NM_000267chr1752740 1387 1316 904 153 133 12941 --
NM_000304chr1751137 1096 1013 742 370 1728 --1312
NM_000332chr6117214 6530 6023 5945 5885 5512 4938 1269 1032 636 538 24597 2558 14684 --
NM_000337chr566376 5704 5458 4706 529 70 15233 21347 686 --
NM_000351chrX63917 3361 2933 1440 168 90 22847 364 12881 --
NM_000362chr2243320 2941 2866 642 --164 --
NM_000376chr1262948 2456 2159 1250 1214 471 --12632 --
NM_000408chr24947 596 533 162 13485 ----
NM_000428chr141145 11677 11850 --
NM_000430chr1723785 3261 2684 501 ----
NM_000461chr333230 1795 1641 1265 1288 --
NM_000462chr15--1709 --1486
NM_000489chrX42367 1023 280 86 11366 ----
NM_000525chr1111423 1100 21412 417 21278 216
NM_000533chrX41889 260 99 80 ----1640
NM_000555chrX167606 7176 7054 6930 6360 6208 5617 5328 5216 4902 2845 2612 2597 1277 493 204 27671 585 21494 550 11160
NM_000599chr254332 4304 4046 3094 170 14571 2405 52 --
NM_000609chr1063069 2753 2178 2157 2138 1153 --33028 2389 44 11221
NM_000615chr1152984 2606 1964 860 581 --1710 --
NM_000618chr1285752 5655 2462 2084 1525 1212 696 441 36461 1548 751 25073 570 15992
NM_000639chr11727 2332 165 ----
NM_000726chr241156 496 427 357 --1370 --
NM_000738chr11----1161 --
NM_000793chr1464140 3335 1897 835 534 147 14887 24335 3974 --
NM_000794chr51143 ----1962
NM_000807chr4------1168
NM_000813chr563656 2247 1909 1172 814 615 24486 2235 14562 --
NM_000814chr1554069 3637 3137 1233 789 --13585 --
NM_000828chrX11984 51861 1729 1638 862 317 12035 1423
NM_000844chr321076 1019 --1221 --
NM_000891chr1723294 395 12373 ----
NM_000933chr2021801 311 1256 11440 --
NM_001001323chr1263083 2395 2373 1169 153 54 33189 2558 519 12583 --
NM_001001419chr565191 5125 3639 1461 782 193 24560 465 --21061 445
NM_001001479chr223823 647 255 --1784 --
NM_001001484chr1021962 158 12380 --1533
NM_001001523chr121208 264 1370 31368 985 117 1544
NM_001001664chr22823 542 --13754 13428
NM_001001740chr11216 --1197 --
NM_001001890chr2143723 1668 1105 459 21656 1575 ----
NM_001002840chr72244 185 ------
NM_001002909chr1741895 1757 1735 581 1570 1902 11556
NM_001003652chr18138210 7973 7861 7820 7353 6922 6567 5963 5522 5416 2660 2512 45 15885 17159 --
NM_001003676chr112809 298 ------
NM_001003712chr1244050 3302 2762 1157 22714 528 ----
NM_001004317chr654073 3097 990 702 532 32891 2764 1743 --1920
NM_001004360chr241880 1669 1291 449 ------
NM_001005386chr24633 478 197 76 ------
NM_001005463chr1032429 766 204 12215 1302 --
NM_001005781chr2----187 --
NM_001006115chr312331 --12183 1599
NM_001006600chr552170 2142 1820 793 411 11838 ----
NM_001006636chr21775 ----1202
NM_001007098chr12162 103 ------
NM_001007102chr631086 551 79 ----11516
NM_001007271chr102880 860 ----21083 842
NM_001007277chr114891 828 175 52 --1846 --
NM_001007278chr13104499 4005 3864 3827 3623 3504 3346 1119 964 523 13450 ----
NM_001007559chr1862069 2025 1936 1778 1443 257 11688 ----
NM_001007794chr11149 --1683 --
NM_001008225chr7------1247
NM_001008239chr18103660 3107 2826 2641 2626 2558 2501 2419 682 256 --12413 --
NM_001008392chr32309 74 --22663 2277 2374 355
NM_001008408chr7105640 5269 4839 4726 4558 4316 2239 1959 629 455 --13961 --
NM_001008541chr1032329 1936 697 1629 --151
NM_001008567chr91127 --1319 --
NM_001008660chr1131242 269 261 1137 ----
NM_001008701chr1962996 2913 2707 2250 717 700 --32473 2145 222 --
NM_001008925chr432841 2617 1309 --11413 --
NM_001009566chr121480 342 --11485 --
NM_001009569chr1021264 627 1342 ----
NM_001010888chrX54154 1822 1200 766 572 13593 ----
NM_001010942chr12----176 155
NM_001011666chr7106585 6504 5625 4490 4462 4391 1661 1201 921 803 2435 84 15594 15645
NM_001012279chr61246 1151 ----
NM_001012393chr11104155 3918 3627 1581 1557 1074 868 396 167 81 33671 978 757 11753 --
NM_001012423chr1522839 2569 22446 80 12789 --
NM_001012755chrX84429 3785 3443 1994 1881 1147 396 141 25031 1253 --11107
NM_001013415chr4128 11372 ----
NM_001013690chr1231689 1631 1005 1830 22285 483 --
NM_001013693chr162846 2275 1984 932 646 402 --22375 780 --
NM_001014797chr10108174 6292 5883 2097 1941 1765 1663 1502 1023 862 25566 1487 28146 706 --
NM_001014812chr15------185
NM_001017926chr831699 227 33 142 ----
NM_001017930chrX2296 22 1148 1565 --
NM_001017999chr131792 935 244 11734 11505 --
NM_001018064chr91344 --11994 --
NM_001020658chr111640 ------
NM_001023567chr1511897 180 12181 --
NM_001024226chr111114 1262 ----
NM_001024660chr31419 11484 11041 --
NM_001024948chr143227 2429 2264 1005 12245 1409 --
NM_001025077chr1032966 2874 387 15800 46519 5739 393 106 --
NM_001025596chr111496 --1373 --
NM_001029858chr683187 3103 2905 2140 2103 1352 234 22 21262 421 22827 335 134
NM_001029998chr4162 1470 ----
NM_001030007chr1643409 3144 1117 88 --1765 --
NM_001030055chr1464698 4340 3024 1513 1484 1170 24358 426 --1703
NM_001031695chr2244610 2010 1725 515 24672 4271 15155 --
NM_001032280chr631550 1472 74 --2625 206 --
NM_001032282chr8131 --1349 --
NM_001032288chr20--11391 142 1312
NM_001032999chr2084626 4169 3931 1777 1522 1465 1153 818 --65283 5096 4694 4510 3339 309 --
NM_001033044chr141449 1410 1384 1189 190 2444 56 --
NM_001033059chr61500 1306 ----
NM_001033087chr2042396 1118 278 141 --12242 12371
NM_001033576chr1711084 --22513 2491 --
NM_001035003chr4------1223
NM_001035511chr162067 1916 1462 708 432 340 --22030 245 --
NM_001037164chr721709 735 --1146 --
NM_001037290chr11------1674
NM_001038493chr231461 340 119 --169 1173
NM_001039199chr2094844 4385 4054 3631 3292 1423 1086 1030 532 11894 ----
NM_001039538chr263473 2991 2691 2484 1272 1209 32613 2244 992 22909 2790 --
NM_001039577chr183759 3397 3301 3290 1766 1680 1370 922 13314 33707 1314 133 --
NM_001039577chr183759 3397 3301 3290 1766 1680 1370 922 13314 33707 1314 133 --
NM_001039618chr1185941 5641 5066 5009 1391 698 583 43 --1172 --
NM_001039693chr263964 3824 2962 2748 1087 908 --1816 23332 220
NM_001039888chr12633 620 ----168
NM_001039937chr1343170 3039 821 661 11154 ----
NM_001040108chr1411081 22953 212 11230 12986
NM_001040152chr775061 3288 3203 1781 1413 693 151 23631 3421 --14819
NM_001040272chr921941 1863 12286 22158 758 --
NM_001040284chr1645036 4702 4110 3618 15949 1136 --
NM_001040402chr453165 3136 2963 2049 381 --2484 154 --
NM_001040712chr933346 615 549 --12671 --
NM_001042404chr131990 1430 1361 ------
NM_001042473chr101569 --11986 --
NM_001042486chr2061522 1469 1208 420 290 176 --1121 11330
NM_001042555chr1253828 1488 1284 1240 550 --44183 3195 1095 89 --
NM_001042599chr2167796 7537 7463 6699 6563 6270 6041 5752 5338 3133 2304 2030 1966 1423 159 45 16873 --1577
NM_001044387chr1933258 3173 388 31123 963 681 1913 11415
NM_001048183chr153817 3327 3279 3092 2407 12661 1431 13647
NM_001116chr1653012 1114 1081 583 134 ----22614 1159
NM_001153chr24893 728 621 105 ------
NM_001167chrX66177 4882 4184 2012 1792 1177 11256 12650 --
NM_001174chrX42006 1910 401 131 --1905 --
NM_001174chrX42006 1910 401 131 --1905 --
NM_001204chr2126537 6205 6086 5855 5341 4988 2789 2692 2247 2209 2176 1801 17022 27238 6018 --
NM_001206chr952319 2179 2172 1019 227 ------
NM_001232chr131188 931 82 --1103 1384
NM_001259chr795771 5135 5110 4678 4546 2440 1030 279 115 25727 4536 15983 --
NM_001300chr10----1340 --
NM_001304chr1773796 3503 3198 3186 1157 695 297 --12500 --
NM_001332chr511330 ----11310
NM_001343chr531219 536 109 ------
NM_001364chr1153981 3684 3141 1429 1159 14310 ----
NM_001401chr961531 1492 1478 365 295 67 21163 110 11564 --
NM_001408chr131589 1508 1321 --31119 1108 193 --
NM_001419chr1943650 3348 3017 92 24795 79 ----
NM_001430chr251628 1556 1513 596 50 ------
NM_001431chr62878 33 --1174 --
NM_001438chr183606 2877 2809 2715 2609 2298 1063 559 33630 2518 761 ----
NM_001497chr921879 612 --1178 --
NM_001530chr1411130 2721 204 --1762
NM_001635chr71951 1987 1282 --
NM_001681chr12------1132
NM_001701chr931139 442 88 ------
NM_001789chr351731 1709 1623 1479 443 --21287 479 --
NM_001829chr42252 63 ------
NM_001854chr121395 249 --1243 --
NM_001895chr201198 1215 ----
NM_001938chr111434 11784 --1758
NM_001939chrX63571 3407 3359 1015 545 112 1456 22614 1157 --
NM_001945chr521392 1266 --11125 --
NM_001981chr142294 1776 1563 621 --11874 --
NM_002006chr485284 5206 5086 1677 1424 1100 586 442 ------
NM_002015chr1342865 912 655 393 --191 12903
NM_002024chrX22080 2057 --11939 --
NM_002026chr23696 134 81 3765 147 142 ----
NM_002040chr2142929 2103 738 653 21168 645 12583 --
NM_002074chr121631 176 --148 --
NM_002077chr921698 297 --2444 261 11502
NM_002128chr1322438 843 165 12325 --
NM_002158chr263528 3407 1357 821 398 343 43809 3730 3160 2536 1661 --
NM_002199chr4--1174 1148 --
NM_002202chr5------1687
NM_002214chr785581 5565 4616 4389 4288 2227 2186 1322 24301 4273 35059 4865 4159 --
NM_002242chr2--1223 ----
NM_002249chr12506 55 ----1135
NM_002264chr374104 3584 3320 1932 1086 897 88 --33604 3375 3293 11740
NM_002267chr1321811 240 ------
NM_002270chr565458 4331 1822 1709 393 253 15360 15498 24504 1002
NM_002271chr1352413 2078 2051 910 578 32317 939 805 134 --
NM_002356chr642745 2455 1110 860 --12855 --
NM_002389chr12779 517 --1494 --
NM_002399chr151522 --1943 --
NM_002429chr1271547 1292 1213 1117 628 301 248 --3599 267 183 1236
NM_002444chrX41737 1253 478 98 --1750 276 67
NM_002501chr1971352 1209 1137 624 611 513 421 --23146 1491 --
NM_002505chr62450 65 ------
NM_002544chr17----1131 --
NM_002605chr155860 830 752 409 352 ------
NM_002628chr31874 --1775 11178
NM_002634chr171255 --2768 269 --
NM_002655chr844673 4466 3317 226 24699 427 ----
NM_002699chr111025 --1603 1240
NM_002745chr2254540 4384 1035 656 393 --11206 --
NM_002747chr1831498 371 361 --11704 --
NM_002760chrY55054 3663 1861 1098 1008 45004 1714 1320 620 1106 --
NM_002815chr17----1191 --
NM_002820chr121957 1143 --1617
NM_002844chr61999 ----11380
NM_002847chr71542 11223 11580 --
NM_002868chr1271924 1897 725 710 682 229 137 ----12319
NM_002886chr334429 1929 592 --31644 1391 56 --
NM_002938chr441938 1782 1599 341 --1434 --
NM_002942chr331342 1185 203 --1947 --
NM_002959chr163777 3474 2941 1176 662 397 --53162 544 385 109 73 13634
NM_002970chrX----155 --
NM_002973chr122507 61 ------
NM_003010chr1732015 1955 914 1972 1811 --
NM_003027chr15------1105
NM_003028chr993580 2971 2798 2569 1539 1045 845 829 368 11157 1308 --
NM_003030chr321778 1447 11640 21935 1693 1586
NM_003081chr2011002 --1233 --
NM_003093chr61211 ------
NM_003106chr3--11061 1832 --
NM_003108chr267197 6476 5411 4648 2811 607 15543 31959 1831 833 --
NM_003110chr171766 --1986 --
NM_003144chr652199 2168 2049 104 22 --12027 --
NM_003161chr1752808 2304 736 624 479 2557 81 ----
NM_003178chr332190 2087 152 --2444 401 --
NM_003185chr2041344 962 358 135 2310 221 ----
NM_003234chr31584 --21542 393 --
NM_003253chr21----2158 52 --
NM_003255chr1772361 1779 1071 764 680 344 29 12393 167 --
NM_003298chr3135746 5464 4823 4798 4755 4515 4506 3824 2078 2011 1750 1474 1099 35681 2153 244 11893 --
NM_003300chr142434 38 ------
NM_003319chr21288 --1745 --
NM_003337chr5----2658 587 --
NM_003338chr1011916 1471 ----
NM_003339chr511013 --1613 --
NM_003342chr1732532 2064 47 22341 812 --1192
NM_003380chr10----1290 --
NM_003400chr24788 708 89 36 1769 ----
NM_003413chrX11966 21694 1467 --1295
NM_003418chr33562 158 98 ------
NM_003463chr632781 2692 1221 1738 --1949
NM_003470chr1631626 1402 550 --21564 1159 --
NM_003482chr1222000 622 12322 1239 1402
NM_003483chr1242801 2198 2107 272 --1697 12410
NM_003489chr2132418 560 418 11195 --1482
NM_003629chr153311 3137 3014 2668 568 --23496 373 --
NM_003645chr15--122 172 --
NM_003686chr1154 --159 --
NM_003718chr7----1357 --
NM_003743chr262172 2017 1805 1646 1515 526 ------
NM_003758chr15165 11227 1579 --
NM_003760chr11719 --196 --
NM_003800chr642405 1784 950 549 22217 869 ----
NM_003872chr242592 1189 685 514 22420 363 ----
NM_003899chr1362146 1870 1819 1688 646 419 21860 1699 ----
NM_004050chr1452533 2375 1872 1693 956 ------
NM_004090chr1762641 2429 2261 1096 974 922 --1375 --
NM_004117chr611922 ----3304 269 67
NM_004124chr1473492 3101 2397 2292 2198 957 935 23018 3003 ----
NM_004183chr11--2515 233 1715 --
NM_004205chr11----2554 491 --
NM_004227chr743042 2729 1939 621 --32563 2066 930 --
NM_004229chrX31473 1418 709 11920 11572 --
NM_004311chr1052690 1178 1072 320 105 --1878 21992 855
NM_004331chr841041 933 583 136 --1127 --
NM_004337chr822330 2223 2608 476 1220 --
NM_004349chr831011 887 148 --155 1963
NM_004389chr22880 316 --190 1886
NM_004393chr362112 2094 2050 912 654 387 --1889 --
NM_004397chr1141509 526 395 238 13277 --12912
NM_004423chr332493 792 133 12418 52661 2344 2165 985 21 --
NM_004437chr193416 3281 2741 2621 2278 1174 746 412 230 --126 12291
NM_004438chr22734 652 --32573 2108 1102 22633 2207
NM_004441chr3--21229 1103 2513 298 --
NM_004446chr12183 28 ------
NM_004458chrX22188 1923 --21899 1695 --
NM_004459chr1752031 818 319 161 145 --11472 11449
NM_004514chr1742999 1878 135 34 --22670 1900 --
NM_004516chr19245 32 --156 --
NM_004529chr91578 11448 1559 --
NM_004555chr16----2201 161 --
NM_004586chrX54949 4080 3925 829 108 24323 3983 ----
NM_004598chr533275 2767 957 ----12798
NM_004654chrY--1395 1402 --
NM_004734chr1353241 2220 1241 345 42 12450 297 27 --
NM_004748chr1523511 435 --14137 --
NM_004768chr12106 25 --1195 --
NM_004776chr2011173 ----1674
NM_004808chr1043072 2302 1032 879 22144 97 ----
NM_004834chr233366 3253 2589 --1314 --
NM_004852chr181913942 12602 12595 11233 10885 10798 10681 10530 10487 9776 9568 3608 2651 1430 1393 1376 943 677 126 39003 4675 1934 310835 3225 3177 --
NM_004929chr82449 239 ------
NM_004958chr11856 3605 591 315 1163 --
NM_004969chr10----1589 --
NM_004984chr12----1100 --
NM_004985chr1254216 4124 3552 900 308 11239 24158 2760 --
NM_004992chrX87655 5452 3254 3177 2973 2550 2092 426 --46492 950 647 435 --
NM_005032chrX1180 --11051 --
NM_005063chr1073831 2669 1193 506 377 317 165 32927 2842 909 ----
NM_005065chr1494915 4878 4852 4535 2024 1764 303 232 180 14552 11963 14584
NM_005121chr1733682 2929 1518 11422 11128 --
NM_005206chr1751350 1113 955 943 188 ------
NM_005229chrX41008 197 156 89 ------
NM_005238chr1112494 --23296 1220 --
NM_005316chr11159 11096 1131 --
NM_005338chr743945 3925 3609 725 --31510 1136 678 --
NM_005339chr443490 3382 1321 803 ----1875
NM_005381chr21432 ------
NM_005392chr921337 328 11865 11350 11824
NM_005400chr252901 1171 945 555 317 22050 1239 1584 --
NM_005436chr1033989 3683 3666 1467 11431 --
NM_005438chr114561 164 109 72 1496 1100 1422
NM_005465chr161802 1549 1270 427 328 265 ------
NM_005493chr62615 168 --164 --
NM_005507chr11----1346 --
NM_005544chr2--1961 --163
NM_005596chr985929 5077 4765 4676 4043 3883 2198 1804 25268 2177 ----
NM_005604chr631573 817 88 --1663 --
NM_005605chr8194 185 ----
NM_005639chr122590 470 2516 117 --11612
NM_005643chr6----1810 --
NM_005647chrX42829 1393 508 68 12465 2274 125 --
NM_005668chr533641 1028 149 3727 459 373 ----
NM_005708chr13------155
NM_005725chr131935 748 622 ----21879 71
NM_005736chr102222 39 ----11528
NM_005746chr722384 988 --1431 --
NM_005813chr2----12418 --
NM_005819chr173304 3054 3046 785 769 674 366 1872 13110 --
NM_005843chr22779 533 199 11363 --
NM_005862chr31820 1200 ----
NM_005868chr73448 439 272 ----137
NM_005904chr1811140 11062 11038 --
NM_005906chr651562 1438 1231 1187 318 ----11207
NM_005933chr1172889 2772 1903 1169 667 597 240 12181 ----
NM_005935chr485074 4949 4506 4384 4227 1154 359 239 11006 21453 684 11024
NM_005937chr1783707 3585 3055 1631 1454 1311 1284 1209 13662 53501 3033 934 904 469 13866
NM_005966chr221725 1629 1102 11981 --
NM_005969chr11----1183 --
NM_006038chr2041553 1467 787 537 2631 169 41924 1777 383 23 11619
NM_006079chr62312 255 --141 --
NM_006080chr72794 143 12359 ----
NM_006141chr1622668 908 --12151 --
NM_006191chr124956 843 753 22 --1169 --
NM_006206chr442859 2172 2135 367 22211 632 22095 2082 11808
NM_006210chr1931237 1191 307 --11226 1866
NM_006237chr132538 515 --12172 --
NM_006242chr2041745 1462 1392 771 ------
NM_006282chr2084439 4283 3927 3767 3439 3137 1526 765 23555 239 24456 29 --
NM_006283chr853285 1132 1049 462 344 23952 3435 11523 1653
NM_006301chr12--1480 --1153
NM_006307chrX126 --1312 --
NM_006352chr122082 542 ----11320
NM_006372chr61161 ----1399
NM_006380chr1763646 1360 1219 513 386 23 11325 14297 12681
NM_006387chr1911045 192 31109 429 416 --
NM_006393chr1084566 4446 3999 3992 3653 3030 392 86 --21135 383 1884
NM_006517chrX41915 1785 347 322 11440 21776 35 --
NM_006520chrX2516 284 11347 ----
NM_006534chr2033162 2412 111 22266 1039 ----
NM_006540chr831232 1087 95 1258 11515 --
NM_006544chr14136009 5817 5784 5395 5348 4866 4242 4095 4022 3949 1422 1392 1247 11301 21516 726 --
NM_006562chr101245 --1103 --
NM_006599chr1687892 7491 7214 6209 5276 5110 2959 252 --25926 5647 --
NM_006614chr383670 3315 2853 2750 2556 721 560 268 ----12911
NM_006646chr1332296 1948 321 22216 706 ----
NM_006668chr141455 --1218 --
NM_006717chr933420 3374 2134 --1319 --
NM_006751chr21915 ----1219
NM_006775chr672898 2481 2332 2144 1987 1979 1206 --13093 2267 182
NM_006802chr121181 883 --1297 1253
NM_006806chr211267 ------
NM_006814chr204801 689 237 177 12328 2999 258 --
NM_006815chr1211400 1114 --128
NM_006832chr142911 667 ------
NM_006850chr12265 238 1805 ----
NM_006888chr1423180 2587 12858 13473 --
NM_006908chr71950 21363 566 1124 --
NM_006981chr972856 2175 2037 824 651 363 116 12687 ----
NM_007017chr53769 718 188 ------
NM_007017chr53769 718 188 ------
NM_007040chr19----1700 --
NM_007050chr20137915 7863 7695 6133 5695 5646 5530 2814 1727 1588 1122 661 341 27474 7303 11679 13121
NM_007067chr1731479 1433 1254 --11285 --
NM_007124chr631741 1726 523 --166 --
NM_007137chrX145495 4866 4812 4678 4400 4185 4166 2006 1636 1628 1101 1059 1015 60 14220 ----
NM_007146chr1751133 1042 775 618 145 32327 2169 53 1581 --
NM_007174chr1251655 1561 738 705 334 --31709 1498 23 --
NM_007212chr142059 1616 1434 508 ------
NM_007236chr1531996 1577 814 --171 --
NM_007249chr13149411 9285 8499 8254 7568 7159 6963 6278 3646 2196 1646 1266 1063 597 --18218 158
NM_007271chr641605 1364 697 253 11198 ----
NM_007315chr22981 357 ----1162
NM_007345chr18----1584 --
NM_012081chr543744 3525 3017 2877 13253 12295 --
NM_012121chr1761706 1608 1201 572 386 198 --21733 520 --
NM_012137chr121164 1091 --1112 --
NM_012161chr421132 134 ------
NM_012189chr18184 ----1215
NM_012197chr931556 632 622 ------
NM_012199chr164654 4059 1853 910 608 355 --13205 --
NM_012244chr1441513 1500 415 244 --31653 1179 589 --
NM_012249chr243349 3338 2882 227 11054 ----
NM_012262chr194918 4902 4417 3832 3601 3207 1030 353 67 24574 4232 14354 13897
NM_012300chr542321 2297 2019 602 --1147 --
NM_012316chr195375 5271 4862 4777 3789 1832 1359 641 429 --33665 2196 878 --
NM_012328chr721091 29 ------
NM_012333chr111549 ----1242
NM_012429chr22----1254 --
NM_013261chr433276 2758 661 --13686 --
NM_013279chr1142206 1976 1542 172 --22249 103 --
NM_013354chr821253 297 --1512 --
NM_013381chr122856 843 233 28 --1616
NM_013390chr951157 1132 366 162 48 1522 --1533
NM_013438chr921363 1156 --11325 --
NM_013446chr721307 104 ------
NM_014011chr232579 2296 284 --11619 --
NM_014016chr31480 ------
NM_014043chr311581 ----1359
NM_014057chr921029 353 ------
NM_014109chr8----1258 --
NM_014112chr875034 4728 4058 3756 3673 3546 3476 21864 911 13509 --
NM_014154chr31235 --21583 473 --
NM_014155chr11106924 6894 5814 4851 2406 2223 1553 972 447 79 --16178 --
NM_014190chr431819 1607 1264 11227 159 --
NM_014212chr12----178 --
NM_014232chr1721219 149 --31654 1250 1157 --
NM_014253chrX52512 1947 1581 529 125 12274 ----
NM_014268chr1821367 299 11195 1239 --
NM_014322chr11988 ------
NM_014335chr1531158 937 418 --149 --
NM_014445chr362462 2306 2195 1847 1503 960 189 1327 12173
NM_014494chr1611510 --12141 --
NM_014554chr1221872 1614 --145 --
NM_014612chr9--11535 --11445
NM_014613chr542506 940 403 323 --33002 743 608 --
NM_014614chr2----1188 --
NM_014615chr1633411 3381 2514 --13344 1628
NM_014635chr241529 1435 356 75 --1490 21337 215
NM_014665chr863637 3323 3003 2896 2697 2402 12765 13097 --
NM_014666chr52272 82 1939 ----
NM_014682chr842168 1423 848 146 ------
NM_014701chr1553013 1378 1058 504 31 13169 11362 --
NM_014723chr2053247 2967 2359 815 234 --32418 1016 809 --
NM_014747chr175679 4882 4434 4310 1473 585 139 --45754 5504 4331 1193 --
NM_014755chr243506 3467 2658 467 13572 21541 1180 --
NM_014757chr532330 2162 710 12060 ----
NM_014830chr1232908 425 82 21472 1119 23748 3003 12666
NM_014835chr2012235 --195 --
NM_014839chr12527 203 1443 1330 --
NM_014872chr922373 93 --1765 --
NM_014876chr22----12066 --
NM_014877chr1787678 7626 7312 6063 2879 1698 1596 1150 11022 --16854
NM_014897chr1753032 2800 2755 458 227 1767 ----
NM_014901chr521507 895 --11857 --
NM_014909chr1463651 2964 2648 720 226 182 --43968 2936 2554 745 1137
NM_014920chr622414 299 13613 12356 --
NM_014932chr321588 177 --11680 --
NM_014936chr642570 2152 975 262 ----22040 928
NM_014961chr43807 772 592 144 21518 1381 --
NM_014989chr641972 1516 146 104 ----12052
NM_014991chr493035 2703 2314 2302 2015 922 546 302 64 ----1503
NM_015001chr1----1933 --
NM_015042chr1554113 3668 3648 2797 967 --21114 837 11622
NM_015049chr243269 3046 2558 2028 --1990 --
NM_015051chr932974 1330 384 13364 11268 1151
NM_015052chr741384 882 478 86 --1456 --
NM_015074chr184940 4192 4007 3637 3445 3390 1402 1237 24574 3473 13341 --
NM_015077chr1773301 1177 912 811 678 511 66 --34532 4357 975 --
NM_015090chr135990 5881 5682 --56066 5728 4196 1379 1162 --
NM_015092chr1674580 4318 3939 3626 3563 1680 772 160 ----
NM_015097chr342007 1861 558 406 ------
NM_015125chr19----1473 --
NM_015147chr242984 2286 2065 932 ----12954
NM_015176chr131673 1179 612 2692 122 ----
NM_015184chr3248 37 ----1253
NM_015185chrX32805 2525 2083 12638 12200 --
NM_015215chr131960 613 217 1709 12394 --
NM_015226chr1652927 2348 2120 1365 1081 --31256 853 663 --
NM_015272chr1621674 326 21374 814 11653 1626
NM_015277chr1851291 1257 1235 209 174 1357 ----
NM_015288chr563207 3153 3139 2748 1419 749 12782 23162 849 --
NM_015317chr232599 749 494 180 ----
NM_015335chr121156 1908 11928 2688 474
NM_015347chr121307 1645 --2859 61
NM_015355chr172544 439 ------
NM_015359chr821854 453 22884 1953 32509 1992 1833 --
NM_015447chr91806 --1588 --
NM_015455chr583578 2925 1584 1475 1366 905 896 577 23885 733 13497 --
NM_015475chr21151 1711 ----
NM_015554chr1542607 1108 480 334 ------
NM_015567chr133918 441 267 --1474 --
NM_015570chr731172 602 293 ----1646
NM_015576chr342574 2136 2124 75 --12167 --
NM_015630chr221128 57 --1396 --
NM_015886chr864164 3791 2139 1829 1126 442 --21981 1394 1647
NM_015902chr82748 682 --1215 --
NM_016009chr153521 1385 1278 1124 58 31550 365 273 34923 3999 3225 --
NM_016018chr832740 481 166 --11768 --
NM_016040chr11265 12363 1483 --
NM_016131chr232035 911 85 1249 ----
NM_016132chr1532548 2366 127 1322 1664 --
NM_016206chr357082 2741 2649 239 230 28880 2492 15502 --
NM_016231chr1741565 1398 1139 67 11581 11228 --
NM_016315chr231760 1743 1241 ------
NM_016333chr161513 --1457 --
NM_016374chr111376 --1211 --
NM_016396chr1542913 2723 2484 233 12623 12241 --
NM_016436chr2021889 108 --32400 2053 405 --
NM_016525chr91942 --1767 --
NM_016530chr1533173 2928 881 --1235 14042
NM_016531chr464241 3916 2935 1669 751 316 33943 1653 602 ----
NM_016605chr521970 1909 12568 31098 634 312 1121
NM_016946chr153266 3209 853 427 340 --13656 1891
NM_017420chr1423580 945 --1889 --
NM_017544chrX1740 --1901 --
NM_017548chr322035 380 --1434 --
NM_017596chr163954 1787 1402 1305 1124 665 11411 24488 2971 --
NM_017633chr663132 2940 2763 755 649 226 --32947 2521 432 --
NM_017637chr988143 7516 6484 6378 3262 2769 1056 615 --36031 997 30 --
NM_017643chr1772937 2570 2392 1249 458 298 68 12407 32331 2178 971 --
NM_017694chr2--11387 --1769
NM_017753chr91947 3746 657 348 147 --
NM_017778chr821418 1151 --11228 --
NM_017824chr1032667 2200 1900 1393 ----
NM_017851chr15134 ------
NM_017893chr1041444 1219 1072 590 --1121 --
NM_017902chr1085647 5593 4659 1467 1139 663 317 275 11246 21311 775 --
NM_017919chr995187 4926 4838 3735 1351 1282 578 525 292 --35544 5028 4888 22114 1370
NM_017964chr2150 --168 --
NM_017988chr12--1587 1215 --
NM_018011chr132537 151 ------
NM_018013chr653061 2655 2570 1115 80 190 ----
NM_018084chr252366 2341 1137 584 219 1814 11306 13222
NM_018121chr1042497 1112 394 298 --23095 1178 --
NM_018178chr162091 1955 1870 1839 333 141 ----11688
NM_018184chr311733 ------
NM_018197chr20----2620 607 --
NM_018202chr1----1274 --
NM_018247chr653129 2252 2183 1074 826 ----1711
NM_018325chr931547 466 435 ------
NM_018362chr1143761 3271 1136 220 11284 1394 --
NM_018364chr153736 2952 2766 1150 723 2972 258 12658 --
NM_018440chr858373 8320 6306 5727 277 27025 2303 27681 566 35738 5366 1891
NM_018469chr171343 1531 --11011
NM_018534chr21530 --1230 --
NM_018557chr21450 ------
NM_018691chr51255 --11126 --
NM_018711chr1231623 1610 65 ------
NM_018847chr921558 1263 1430 11241 --
NM_018945chr6113433 3351 2939 2755 2643 1247 1064 1031 563 346 218 ----11005
NM_018970chr733194 2492 585 32564 2166 1978 22731 2215 1715
NM_018979chr1231762 544 89 1944 12556 --
NM_019004chr722156 603 12211 --197
NM_019084chr1022150 1958 22306 717 12022 --
NM_019555chr331124 597 518 --2686 375 1487
NM_019610chr162206 1742 741 459 361 331 --1815 11657
NM_020066chr11719 2734 323 ----
NM_020117chr53997 912 724 --1128 --
NM_020123chr101196 --2632 295 --
NM_020134chr2155 --1178 --
NM_020137chrX----1291 --
NM_020144chr741596 807 270 96 --21633 193 --
NM_020159chr461332 1140 1078 157 144 42 ----11085
NM_020177chr553323 2622 2604 2257 592 1600 --1805
NM_020180chr181307 --1969 --
NM_020225chr4----1326 --
NM_020231chr33628 203 152 --1256 --
NM_020246chr7----1374 --
NM_020318chr12346 312 --1365 --
NM_020340chr652202 2031 1978 620 390 --1264 --
NM_020342chr23908 483 472 --11826 --
NM_020346chr11--21481 1288 --11476
NM_020390chr393794 3209 3199 3166 1878 1078 1021 861 43 13929 34238 3133 909 14105
NM_020416chr452687 2653 1692 520 169 12608 22002 927 --
NM_020443chr1116904 5894 5011 4294 2763 2584 2357 2255 1891 1742 482 15589 2764 461 12236
NM_020649chr171254 ------
NM_020689chr2061647 1620 1195 1103 303 29 --1257 --
NM_020693chr11192 --161 1427
NM_020699chr185185 4977 4524 4393 1285 1251 1239 528 25218 1271 168 --
NM_020724chr461702 644 595 448 326 110 ------
NM_020734chr1232409 1148 458 --171 --
NM_020748chr17172 1124 ----
NM_020772chr17127000 6902 6567 6173 5295 5274 2874 2834 1361 904 700 364 23024 2356 26912 1756 --
NM_020774chr1844584 3944 1626 1499 35893 5671 227 36148 2300 1973 --
NM_020782chr1234379 1703 1593 11140 2189 81 --
NM_020783chr181836 42328 2298 1519 575 22390 1846 --
NM_020796chr572907 1874 1139 766 697 414 76 161 --1531
NM_020834chr1421783 1261 1726 1600 21596 50
NM_020845chr1262528 1864 853 446 433 401 ------
NM_020850chr1631325 1227 1096 23003 2485 --1561
NM_020872chr341765 1309 565 94 ------
NM_020918chr103914 312 61 1235 1173 --
NM_020935chr264357 4241 3183 1839 1303 929 1119 1550 --
NM_020981chr23603 265 153 ------
NM_021005chr151238 ------
NM_021038chr333174 2898 819 23267 3098 ----
NM_021072chr511897 1388 ----
NM_021116chr7169046 8905 7320 7283 7200 6631 6409 6112 5950 5899 3402 3324 2639 1756 1485 219 28840 8779 38105 6066 805 12547
NM_021155chr1942673 2094 344 141 --12973 12166
NM_021191chr1231689 1621 304 --2778 688 --
NM_021252chr102784 537 ------
NM_021255chr1452931 2838 2770 2625 785 12519 162 --
NM_021637chrX1217 1561 ----
NM_021638chr484628 4461 3586 3407 1844 1138 1049 108 --23111 222 --
NM_021809chr2051841 841 664 150 38 --21934 465 --
NM_021813chr674840 4606 3787 1823 848 643 503 1917 14772 --
NM_021914chr1441858 908 549 376 1577 --153
NM_021947chr173890 263 75 ------
NM_022080chr2012424 --21028 33 --
NM_022130chr511408 1413 ----
NM_022351chr873291 2839 2786 1536 1495 1317 793 33709 243 164 --1493
NM_022465chr1242265 863 357 337 --22496 2460 --
NM_022474chr1421965 759 --12388 --
NM_022658chr1251289 1190 152 125 35 ------
NM_022726chr61134 ------
NM_022728chr72131 91 ------
NM_022735chr1----11414 11510
NM_022763chr363164 3032 2970 2857 2269 1214 2950 707 ----
NM_022781chr933303 2560 148 32700 1305 1162 21220 850 22961 2538
NM_023009chr13690 610 537 ------
NM_023016chr232241 1840 828 ----11032
NM_023072chr19168 ------
NM_023079chr1721624 354 --1320 --
NM_023927chr521265 955 ----21298 146
NM_024076chr1962244 1683 1589 762 261 173 2553 230 12049 12031
NM_024315chr71431 --1375 --
NM_024523chr721200 1143 11077 1450 --
NM_024524chr322656 2545 1596 1538 --
NM_024583chr22987 97 ------
NM_024595chr131141 146 90 --196 --
NM_024631chr11----1617 --
NM_024665chr343120 874 852 29 11490 ----
NM_024721chr811000 11748 1735 --
NM_024757chr921034 841 ------
NM_024811chr1161711 1673 1209 748 655 517 11226 1118 --
NM_024900chr4----11689 --
NM_024949chr474915 4890 4457 1577 1278 348 117 --24523 4173 --
NM_025010chr342780 815 389 321 11926 22621 293 --
NM_025054chr853222 3147 2690 1470 675 13025 ----
NM_025074chr452757 2018 763 405 243 22029 142 ----
NM_025106chr141742 1406 1391 403 ----147
NM_025133chr23938 387 323 1799 1277 --
NM_025134chr1632220 1975 568 ----1520
NM_025179chr1104700 4299 3621 3193 3075 3006 1906 1869 1857 185 14197 41812 1656 1475 430 13530
NM_030576chr1732655 2609 830 12389 21767 295 11009
NM_030627chr524170 3675 23031 2978 11348 --
NM_030628chr11----1162 --
NM_030640chr12------1704
NM_030648chr464947 4724 4264 4248 1513 149 --14884 --
NM_030786chr151459 1405 1344 424 199 21554 123 11324 --
NM_030806chr1118015 7821 7684 7417 7406 7259 6436 2784 1599 1024 247 26189 3207 29214 7179 1799
NM_030915chr252234 2156 1910 710 646 --11756 --
NM_030918chr194881 4492 4224 4146 3930 3644 3546 1035 749 15070 24696 1072 --
NM_030964chr593309 3173 2884 2557 1407 982 712 703 135 --23554 717 --
NM_031445chr223236 2847 13077 13362 --
NM_031469chr622917 821 12503 1870 --
NM_032104chr1------124
NM_032182chr101109 --1573 --
NM_032199chr10103757 3618 3395 3189 2998 2976 2494 1229 176 126 22901 883 ----
NM_032211chr101458 ----186
NM_032228chr1153246 3020 2160 1290 316 12316 --1202
NM_032287chr2283914 3821 3618 2821 1698 1684 975 876 --13457 --
NM_032420chr51690 --148 1355
NM_032439chr101395 11121 1468 --
NM_032446chr573246 3143 2449 496 473 383 103 12969 21114 737 --
NM_032449chr1112853 2822 2644 2435 1782 1047 780 676 446 357 53 167 22178 794 11024
NM_032457chr453842 2398 818 695 688 --12743 --
NM_032482chr1932560 1034 234 1274 150 --
NM_032505chr33896 731 450 ------
NM_032560chr141220 ----1155
NM_032578chr1011408 1532 --21136 402
NM_032632chr141580 11803 --140
NM_032682chr353308 2945 2888 149 133 ------
NM_032747chr10------175
NM_032858chr1----146 --
NM_032961chr43147 74 66 --1440 --
NM_032968chrX33773 3691 64 21108 995 --11453
NM_032973chrY33765 3683 64 21108 995 11452 --
NM_033030chr24488 246 86 72 ----128
NM_033056chr10------1173
NM_033121chr1251213 1135 743 570 293 ------
NM_033129chr2081901 1808 1670 1499 1424 1266 766 353 22047 174 1739 21991 276
NM_033224chr7177957 6753 6323 6253 5854 5702 5619 5240 4919 3200 3130 2372 2293 1441 569 282 178 27736 6663 12388 15828
NM_033272chr21285 2421 399 ----
NM_033296chr42903 40 ----1690
NM_033315chr1721486 714 --21942 459 --
NM_033389chr1724069 843 --11377 13987
NM_033427chr71752 1843 1232 --
NM_033495chrX11051 ------
NM_033516chr951142 1121 996 638 218 ------
NM_033631chr133749 482 47 11270 1694 13535
NM_052832chr863016 1841 451 76 39 24 1425 1167 12999
NM_052879chr1253875 3754 3422 1020 924 13796 ----
NM_052906chr2265049 3828 1486 973 626 169 --54498 1960 1499 937 590 --
NM_052934chr151474 530 514 505 341 11740 --11776
NM_052950chr1341898 1726 837 575 31663 1548 753 1193 --
NM_053056chr1121946 314 ----22704 944
NM_057175chr462331 2177 1889 1726 809 86 ------
NM_057749chr8------1115
NM_058172chr4--1226 ----
NM_080546chr92267 245 --1628 --
NM_080654chr1121250 403 --11131 --
NM_080743chr621614 863 --1467 --
NM_080927chr323059 807 --33088 3072 853 --
NM_133264chr1773950 3819 3704 3677 2995 2957 2497 23480 326 13411 1149
NM_133326chr1--1357 ----
NM_133473chr1941591 1534 1327 388 11501 11831 --
NM_133507chr122271 162 ------
NM_138333chr922506 1938 ------
NM_138468chr284984 3885 2495 2456 2351 2150 1523 505 --25540 133 --
NM_138473chr1275185 4929 4371 4037 3156 602 314 ----1713
NM_138479chr171929 1499 1294 625 366 263 45 --21805 136 --
NM_138703chrX----1142 --
NM_138782chr552269 1903 1878 955 207 1470 11850 --
NM_138927chr21127 ----1880
NM_139207chr1241867 188 150 57 ----1876
NM_139280chr17----2961 162 --
NM_144571chr496654 6444 6110 6092 5839 5452 5329 1196 290 16852 15691 22725 840
NM_144578chr1475368 4219 3465 895 668 350 117 14446 14956 --
NM_144600chr1621676 1171 --1161 --
NM_144643chr4------1415
NM_144778chr1371905 1879 1821 920 831 241 148 --12534 --
NM_145113chr1451243 440 270 132 121 --3614 539 214 --
NM_145117chr1142661 2494 1212 176 11281 12944 --
NM_145176chr652960 2344 1263 1024 79 --23102 910 --
NM_145274chr174779 751 664 219 1693 ----
NM_145891chr1641677 1625 1587 98 ------
NM_148894chr411003 --11027 --
NM_152265chr1----11432 --
NM_152376chr151759 1512 715 459 202 ------
NM_152380chr11521 2418 207 ----
NM_152470chr1873840 3515 3029 2777 925 911 666 13211 22881 1026 --
NM_152556chr752178 1670 473 322 58 --1891 12226
NM_152594chr1542215 277 168 55 1633 1781 --
NM_152622chr573318 3094 2640 2250 2194 597 334 ----1365
NM_152744chr793553 3498 3216 1157 1015 790 336 74 42 11278 32600 1037 534 --
NM_152748chr72404 218 ------
NM_152749chr73287 256 31 1321 --1756
NM_152758chr862312 1923 965 953 390 317 ------
NM_152996chr111630 11749 1816 --
NM_153332chr842377 2173 2072 30 1557 ----
NM_153343chr432362 2049 2010 ----1528
NM_153607chr511079 --1721 --
NM_153619chr1553330 2993 2293 1373 821 ------
NM_153620chr741793 1670 1443 1226 31274 188 107 2330 90 --
NM_153810chr1044548 1125 861 584 11620 2808 546 11422
NM_170672chr22596 178 --21550 689 --
NM_171998chrX42388 1993 662 513 ------
NM_172037chr851156 1091 536 156 124 --11473 --
NM_172071chr186766 6065 2354 1459 951 712 691 442 45043 2569 870 236 36892 5735 559 --
NM_172373chr1331168 1006 162 --21132 892 --
NM_173078chrX3444 368 70 ------
NM_173473chr1072224 1923 1055 998 680 520 321 1456 --12397
NM_173478chr172811 125 2931 926 ----
NM_173495chrX102549 2386 2355 2187 2106 1780 966 833 750 396 --12482 --
NM_173510chr2252136 1825 978 921 524 1544 11949 --
NM_173515chr62957 916 --1410 --
NM_173557chr18------138
NM_173576chr1012105 1787 --12226
NM_173595chr1224242 2110 14929 34491 330 321 13277
NM_174890chr103778 209 88 --1731 --
NM_175061chr721947 1420 1408 ----
NM_175733chr1152175 1494 1442 750 137 1458 ----
NM_175736chr12136248 6082 5014 2766 2571 2482 2393 2264 2067 1919 1642 493 392 31692 1617 253 36437 661 124 27449 1677
NM_175767chr511710 --1553 --
NM_175839chr20----135 --
NM_177968chr242062 669 533 455 --11686 --
NM_178864chr111457 --1688 --
NM_180989chr1331647 905 579 ----1332
NM_181077chr1511895 180 12174 --
NM_181291chr141663 ------
NM_181354chr81277 ------
NM_181716chr172174 51 --1235 --
NM_182485chr443701 3675 2579 116 ------
NM_182757chr652980 2897 1160 298 216 --2745 99 --
NM_182765chr10----1112 --
NM_182830chr1411752 21789 855 ----
NM_182970chr2053328 3242 3221 2766 400 --43733 3355 493 320 --
NM_194247chr2104068 3811 3734 3300 2859 2819 1476 1383 1233 1144 12977 ----
NM_194286chr1285513 5083 4533 2036 1506 1404 1320 727 24080 1120 55868 5063 4862 4344 424 36027 885 214
NM_194314chr154960 4885 4038 3493 240 24412 883 ----
NM_197941chr532481 2221 414 12186 1751 1914
NM_198465chrX42784 2264 1119 580 ------
NM_198513chr831352 263 134 11888 11793 --
NM_198567chr5153 --1142 --
NM_198576chr1----11084 --
NM_199000chr711848 ----21694 234
NM_199355chr1681417 1360 1337 1179 636 434 175 65 21386 727 --11405
NM_203446chr2122424 370 --31141 232 226 --
NM_203459chr131640 613 500 1949 --1778
NM_206853chr674004 3425 2870 1612 1545 1425 722 13622 ----
NM_207303chr1063031 1016 682 624 582 316 1611 1691 --
NM_207337chr1241107 986 953 132 ------
NM_207497chr61929 --31325 1069 936 11278
NM_212464chr15--11550 11384 22049 2012
NM_213589chr264434 3728 3404 1515 855 121 45250 1471 708 54 15116 13441