TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-572
miRNA Sequence: GUCCGCUCGGCGGUGGCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000314chr1022779 309 ------
NM_000575chr2------1154
NM_000615chr1112182 ------
NM_000681chr1041416 1358 148 48 ----11049
NM_000814chr1513922 --1782 --
NM_000933chr2031720 1670 1397 ------
NM_001001394chr21216 ------
NM_001003686chr7----191 --
NM_001005404chr1743609 3102 1368 655 13381 13691 --
NM_001008239chr181978 --22589 2335 --
NM_001012393chr1143808 1469 190 178 --14485 --
NM_001012755chrX------1388
NM_001013415chr4------1487
NM_001024460chr611104 ----1529
NM_001039590chrX33865 2695 2662 1183 1120 --
NM_001040429chr131859 --12235 --
NM_001106chr389574 8939 8479 8155 8115 6090 234 35 --26819 790 --
NM_001379chr19------1256
NM_001386chr8----12290 --
NM_001390chr18------13632
NM_001968chr4----191 --
NM_002077chr91466 ----11959
NM_002107chr1------1141
NM_002140chr9----1280 --
NM_002147chr17----1844 --
NM_002149chr21531 --173 --
NM_002181chr2----1704 --
NM_002199chr41267 --1310 --
NM_002247chr10------11932
NM_002265chr17------1356
NM_002398chr2----1294 --
NM_002430chr22----1117 --
NM_002841chr3----1487 --
NM_002902chr15------1623
NM_003246chr151350 21566 1339 11294 --
NM_003295chr13----1146 --
NM_003374chr5--1279 ----
NM_003442chr11----1135 --
NM_003592chr7----1363 --
NM_003908chr2021237 124 --169 --
NM_004050chr142364 84 ----12521
NM_004100chr61543 ----1933
NM_004205chr11----1141 --
NM_004326chr1------11081
NM_004426chr12----1315 --
NM_004505chr1731550 738 627 21782 1664 ----
NM_004687chr1721804 575 11646 ----
NM_004983chr111563 --1263 --
NM_005206chr17133 ----11042
NM_005530chr15----1259 --
NM_005596chr926409 2357 --14982 --
NM_005604chr6----1252 --
NM_005748chr1233310 2928 675 ------
NM_005759chr211308 11581 14730 --
NM_005765chrX--1803 1836 --
NM_005841chr4----1183 --
NM_005898chr111920 12943 1442 --
NM_005909chr511632 ----13102
NM_005941chr81954 ----1165
NM_006136chr711117 ----11164
NM_006196chr2------1280
NM_006298chr61730 1572 1778 --
NM_006382chr17----151 --
NM_006469chr11609 ------
NM_006593chr2--1516 ----
NM_006857chr2----155 --
NM_007219chr202842 707 --1221 --
NM_012081chr5----11176 --
NM_012105chr21----1245 --
NM_012164chr923010 1881 27188 1587 1291 --
NM_012259chr6------1150
NM_012343chr5------1789
NM_013261chr412955 --1987 12804
NM_013323chr172789 386 --11202 --
NM_014329chr16------1264
NM_014423chr514282 --11277 --
NM_014584chr14--11404 --154
NM_014670chr2------11363
NM_014711chr16------12040
NM_014910chr191215 ------
NM_014929chr2------1146
NM_014946chr2--1988 ----
NM_015000chr12----11112 --
NM_015017chr1------1903
NM_015071chr515211 15279 16520 --
NM_015315chr511088 ----21349 933
NM_015317chr2----1215 1819
NM_015548chr6----1679 --
NM_015553chr6----1447 --
NM_016271chr1811658 ------
NM_016604chr5--1359 11081 --
NM_016605chr5--12636 22405 108 --
NM_017546chr2----181 --
NM_017668chr161205 ------
NM_017709chr133713 1683 561 1775 1566 --
NM_017848chrX14429 ----11160
NM_018287chr10--11134 ----
NM_019080chr13----1330 --
NM_019600chr15----198 --
NM_019610chr1------158
NM_020144chr7----12051 --
NM_020795chr1711596 ----1758
NM_020834chr14------11476
NM_020873chr3----1120 --
NM_020940chr10----22527 152 12268
NM_021639chr1----1814 --
NM_021977chr633218 2921 765 --11479 --
NM_022143chr721135 71 ----11068
NM_022737chr19----1239 --
NM_022780chr2------1681
NM_022781chr91306 ----1400
NM_022898chr142769 637 138 11895 13050
NM_024007chr5------182
NM_024329chr131443 1226 494 ------
NM_025160chr112919 --12721 --
NM_030621chr14------1100
NM_030759chr10----1749 --
NM_030912chr10------1626
NM_031911chr411987 ------
NM_032560chr14--1297 ----
NM_032689chr19------1606
NM_033224chr776384 5286 5142 4969 1859 727 91 11945 1882 --
NM_052898chr82636 157 11853 --11478
NM_052910chr13----11603 --
NM_058172chr4------11411
NM_080669chr1773455 3439 1910 1785 1456 1383 1373 ----11694
NM_080738chr121465 113 ------
NM_145175chr2--11060 11231 --
NM_152520chr2----11173 --
NM_152545chr4----1450 --
NM_152753chr61673 ----11316
NM_153020chr6------1634
NM_153619chr15--1153 1853 --
NM_170750chrX1668 ----123
NM_173172chr2------186
NM_173552chr3----1266 --
NM_176795chr111102 --127 --
NM_181705chr513586 ------
NM_181715chr11363 --1381 --
NM_198243chr15----1320 --
NM_198270chrX1639 --1504 --
NM_206855chr625794 4062 --1927 --
NM_207422chrX41117 488 459 438 --1240 --
NM_212467chr1522117 212 12595 --1790